Use of MBV for treating autoimmune diseases

Abstract

Methods for treating an autoimmune disorder in a subject in need thereof are disclosed. These methods include administering to the subject a pharmaceutical preparation comprising isolated matrix-bound vesicles (MBVs) derived from extracellular matrix. The administration can be systemic. In some embodiments, the subject has rheumatoid arthritis or psoriasis. The present invention provides, for example, a method for treating an autoimmune disorder in a subject in need thereof, comprising administering to the subject a pharmaceutical preparation comprising a therapeutically effective amount of isolated matrix-bound vesicles (MBVs) derived from extracellular matrix by systemic administration, thereby treating the autoimmune disorder.

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit of U.S. Application No. 62 / 925,129, filed Oct. 23, 2019, which is incorporated herein by reference.

[0002] Field The present invention relates to the administration of matrix - bound vesicles (MBVs) for treating autoimmune disorders.

Background Art

[0003] Background A major challenge in the treatment of autoimmune conditions, such as, inter alia, rheumatoid arthritis, psoriasis, lupus, multiple sclerosis, etc., is to selectively modulate the autoimmune - causing immune response while maintaining the host - defense immune response against infectious pathogens. To date, the most frequent side effects of currently used immunosuppressive therapies are an increased risk of infections and malignancies. Thus, other therapeutic agents for treating these conditions are still needed.

Summary of the Invention

Means for Solving the Problems

[0004] Summary A method for treating an autoimmune disorder in a subject in need thereof, comprising administering to the subject a pharmaceutical preparation comprising a therapeutically effective amount of isolated matrix - bound nanovesicles (MBVs) derived from the extracellular matrix, whereby the autoimmune disorder is treated, is disclosed. In some non - limiting examples, the administration is systemic. In other non - limiting examples, the disorder is rheumatoid arthritis. In further non - limiting examples, the disorder is psoriasis, lupus, pemphigus, pemphigoid, or multiple sclerosis. The method may include the step of selecting these subjects for treatment.

[0005] The above and other objects, features, and advantages of the present invention will become more apparent from the following detailed description proceeding with reference to the accompanying drawings.

Brief Description of the Drawings

[0006]

Figure 1-1

Figure 1-2

Figure 1-3

Figure 2-1

Figure 2-2

Figure 2-3

Figure 2-4

Figure 3-1

Figure 3-2

Figure 3-3

Figure 3-4

Figure 4-1

Figure 4-2

Figure 4-3

Figure 4-4

Figure 5-1

Figure 5-2

Figure 6-1

Figure 6-2

Figure 7

Figure 8-1

Figure 8-2

Figure 9-1

Figure 9-2

Figure 10

Figure 11

Figure 12-1

Figure 12-2

Figure 13-1

Figure 13-2

Figure 14-1

Figure 14-2

Figure 15-1

Figure 15-2

Figure 16

Figure 17

Figure 18

Figure 19

BEST MODE FOR CARRYING OUT THE INVENTION

[0007] Sequence Listing The nucleic acid and amino acid sequences set forth in the accompanying sequence listing are shown using the standard letter abbreviations for nucleotide bases and the three-letter codes for amino acids defined in 37 CFR § 1.822 of the United States Patent Rules, Code of Federal Regulations. Only one strand of each nucleic acid sequence is shown, but it should be understood that any reference to the shown strand includes the complementary strand. The sequence listing has been filed as an ASCII text file [Sequence_Listing, October 22, 2020, 1,097 bytes] and is incorporated herein by reference.

[0008] Detailed Description Biological scaffolds composed of the extracellular matrix (ECM) have been developed as surgical mesh materials and are used in clinical applications including, among others, repair of abdominal wall hernias (Alicuban et al., Hernia. 2014;18(5):705-712), skeletal muscle remodeling (Mase et al., Orthopedics. 2010;33(7):511), esophageal reconstruction (Badylak et al., Tissue Eng Part A. 2011; 17(11-12):1643-50), dura mater replacement (Bejjani et al., J Neurosurg. 2007;106(6):1028-1033), tendon repair (Longo et al., Stem Cells Int. 2012;2012:517165), and breast reconstruction (Salzber, Ann Plast Surg. 2006;57(1):1-5) (Badylak et al., Acta Biomater. 2009;5(1):1-13).

[0009] Matrix-bound nanovesicles (MBV) are embedded within the fibrous network of the ECM. These nanoparticles shield their cargo from degradation and denaturation during the ECM scaffold manufacturing process.

[0010] Exosomes are vesicles that have previously been identified almost exclusively in body fluids and cell culture supernatants. It has been demonstrated that MBV and exosomes are distinct. MBV, for example, are resistant to digestion by detergents and / or enzymes, have a unique lipid profile, and contain different clusters of microRNAs, and thus differ from other vesicles. MBV do not have the same characteristic surface proteins found in other vesicles such as exosomes.

[0011] As disclosed herein, MBV modulates a systemic healing response (e.g., by systemic administration) to, for example, preserve or restore a biological function. For example, administration of MBV can be for preserving or restoring an immune response, such as for treating an autoimmune disorder (e.g., rheumatoid arthritis, scleroderma, ulcerative colitis, pemphigus, pemphigoid, Crohn's disease, psoriasis, psoriatic arthritis, sclerosis, or systemic lupus erythematosus, etc.).

[0012] The term The following explanations of terms and methods are presented to better describe the present disclosure and to guide those of ordinary skill in the art regarding the practice of the present disclosure. The singular forms "a," "an," and "the" refer to one or more than one unless the context clearly dictates otherwise. For example, the term "comprising a cell" includes a single entity or plural entities and is considered equivalent to the phrase "comprising at least one cell." The term "or" refers to a single element of the listed alternatives or a combination of two or more of the listed alternatives unless the context clearly indicates otherwise. As used herein, "comprises" means "includes." Thus, "comprising A or B" means "including A, B, or A and B" without excluding additional elements. The date of a GENBANK® accession number referred to herein is an available sequence as early as September 16, 2015. All references, patent applications, and publications, as well as GENBANK® accession numbers cited herein are incorporated by reference. Unless otherwise indicated, "about" indicates within five percent. To facilitate review of the various embodiments of the present disclosure, the following explanations of specific terms are presented.

[0013] Administration: Introduction of a selected composition (e.g., MBV, or a pharmaceutical preparation containing MBV, etc.) to a subject by a selected route. The route may be local or systemic. For example, if the selected route is intravenous, the composition is administered by introducing the composition into a vein of the subject. If the selected route is local, the composition may be administered by directly introducing the composition into the tissue of the subject.

[0014] Animal: A living multicellular vertebrate organism, e.g., a category including mammals and birds. The term mammal includes both humans and non-human mammals. Similarly, the term "subject" includes both human and animal subjects.

[0015] Arthritis: Arthritis is a disease that affects the synovium of one or more joints in the body. Arthritis is the most common type of joint disease and is characterized by inflammation of the joints. This disease is usually oligoarticular (affecting a few joints), but can also be systemic. Commonly affected joints include the hip, knee, lower lumbar and cervical spine, proximal and distal interphalangeal joints of the fingers, the first carpometacarpal joint, and the first tarsometatarsal joint. Symptoms include joint pain and stiffness, redness, warmth, swelling, and decreased range of motion of the affected joints. In some embodiments, the compositions and methods disclosed herein can be used to treat arthritis.

[0016] One type of arthritis is rheumatoid arthritis. Rheumatoid arthritis is a chronic systemic autoimmune disease that affects the synovium of multiple joints in the body. Since this disease is systemic, it has many extra-articular symptoms. For example, neuropathy, episcleritis, lymphadenopathy, pericarditis, splenomegaly, arthritis, and rheumatoid nodules are frequent elements of this disease. In most cases of rheumatoid arthritis, the subject has periods of remission and exacerbation (also referred to as "flares or relapses") of symptoms. Rheumatoid arthritis is considered an acquired autoimmune disease, and genetic factors appear to be involved in this autoimmune disease. In some embodiments, the compositions and methods disclosed herein can be used to treat rheumatoid arthritis.

[0017] Another type of arthritis is psoriatic arthritis, which is a seronegative spondyloarthropathy and a long-term autoimmune arthritis that occurs in people with psoriasis. Psoriatic arthritis presents as swelling of the entire fingers and toes with a sausage-like appearance, and may be accompanied by changes to the nails (e.g., small depressions in the nails, nail thickening, and separation of the nails from the nail bed), and skin changes consistent with psoriasis (e.g., red, scaly, itchy patches that occur frequently prior to the onset of psoriatic arthritis). Psoriatic arthritis affects up to 30% of people with psoriasis and occurs in both children and adults. Various types of psoriatic arthritis are included, such as oligoarticular, polyarticular, erosive arthritis, spondyloarthritis, and distal interphalangeal arthritis. Treatments can include NSAIDs (e.g., ibuprofen, naproxen, diclofenac, indomethacin, and etodolac), disease-modifying antirheumatic drugs (DMARDs, e.g., methotrexate, leflunomide, cyclosporine, azathioprine, and sulfasalazine), biologic response modifiers (e.g., TNF-α inhibitors including infliximab, etanercept, golimumab, certolizumab pegol, and adalimumab; the IL-12 / IL-23 inhibitor ustekinumab; and the Jak inhibitor tofacitinib, or XELJANZ®), phosphodiesterase-4 inhibitors (e.g., apremilast), low-level laser therapy, the retinoid etretinate, photochemotherapy with methoxsalen and long-wave ultraviolet light (PUVA), intra-articular corticosteroid injections, and orthopedic surgery (e.g., joint replacement). In some embodiments, the compositions and methods disclosed herein can be used to treat psoriatic arthritis.

[0018] Autoimmune disorders: Autoimmune disorders include a wide range of related diseases in which a person's immune system causes an inappropriate response to endogenous antigens (e.g., B-cell or T-cell responses), resulting in damage to its own cells, tissues, and / or organs, leading to inflammation and injury. There are over 80 different autoimmune diseases. The damage can be limited to certain organs or tissues, such as in Sjogren's disease, or systemic, such as in psoriasis. Symptoms can vary depending on the type of autoimmune disease, but common symptoms include fatigue, muscle pain, swelling and redness, low-grade fever, difficulty concentrating, numbness and tingling in the hands and feet, hair loss, and rashes. Tests for autoimmune disorders also vary by type, but typical tests include antinuclear antibody tests (ANA), tests for specific autoantibodies produced in certain types of disorders, and tests for inflammation in the body.

[0019] In some examples, autoimmune diseases include Addison's disease, alopecia areata, ankylosing spondylitis, antiphospholipid antibody syndrome, autoimmune hepatitis, autoimmune encephalitis, celiac disease, Crohn's disease, Goodpasture syndrome, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, immune thrombocytopenia, IgA nephropathy, inflammatory bowel disease (IBD), multiple sclerosis, myasthenia gravis, pemphigoid, pemphigus, type 2 polyglandular autoimmune syndrome, psoriasis, psoriatic arthritis, rheumatoid arthritis, scleroderma, Sjogren syndrome, systemic lupus erythematosus, Takayasu's arteriosis, type 1 diabetes, ulcerative colitis, or undifferentiated connective tissue disease (UCTD).

[0020] Various treatments for autoimmune diseases can be administered. In some examples, anti-inflammatory drugs and / or immunosuppressive drugs can be administered.

[0021] Biocompatibility: Any material that does not cause a harmful response in a mammalian subject when implanted. A biocompatible material can perform its intended function when introduced into an individual, is not toxic or injurious to that individual, and does not induce an immunological rejection of the material in the subject.

[0022] Autoimmune encephalitis: Inflammation of the brain of varying severity caused by autoimmune diseases. Symptoms can include headache, fever, confusion, shoulder pain, and vomiting, and complications can include seizure, hallucination, speech difficulty, memory impairment, and hearing impairment. Various types of autoimmune encephalitis are included, such as antibody-mediated anti-N-methyl-D-aspartic acid receptor encephalitis (anti-NMDA receptor encephalitis, which may be associated with ovarian teratoma and mainly affects women aged 18-45) and Rasmussen encephalitis. Other autoimmune diseases, such as systemic lupus erythematosus, Hashimoto encephalopathy, autoimmune limbic encephalitis, and Sydenham chorea, may also cause autoimmune encephalitis. In some embodiments, the compositions and methods disclosed herein can be used to treat autoimmune encephalitis.

[0023] Enrichment: A process in which the ratio of the amount of a target component, such as nanovesicles present in a mixture, to the amount of other unwanted components in that mixture becomes higher after an enrichment process compared to before the enrichment process.

[0024] Extracellular matrix (ECM): A complex mixture of structural and functional biomolecules and / or biopolymers, including but not limited to structural proteins, special proteins, proteoglycans, glycosaminoglycans, and growth factors, that surround and support cells within a tissue and is acellular unless otherwise specified. An ECM preparation can be considered "decellularized" or "acellular," meaning that the cells have been removed from the source tissue by a process described herein and known in the art. "ECM-derived materials," such as "ECM-derived nanovesicles," "matrix-bound nanovesicles," "MBV," or "nanovesicles derived from ECM," are nanovesicles prepared from natural ECM or from an in vitro source where the ECM is produced by cultured cells. ECM-derived nanovesicles are defined below.

[0025] Relapse or flare: The worsening of a disease or disorder, such as an autoimmune disorder. A relapse occurs when the symptoms of a disease or disorder that have been present for some time suddenly worsen. For example, in the case of a relapse, the severity of the disease or disease symptoms temporarily worsens but ultimately weakens or subsides. For example, in the case of an autoimmune disorder, the inflammation or other signs or symptoms of the autoimmune disorder may worsen during a relapse.

[0026] Inflammatory bowel disease (IBD): An autoimmune disease characterized by chronic, recurrent inflammation of the intestine of unknown cause. In patients with IBD, ulcers and inflammation of the inner wall of the intestine cause symptoms of abdominal pain, diarrhea, and rectal bleeding. There are two main types of IBD, Crohn's disease (CD) and ulcerative colitis (UC), and both of these diseases appear to be due to the unrestricted activation of an intestinal inflammatory response mediated by autoantibodies against intestinal epithelial cells.

[0027] The main differences between CD and UC are the location and nature of the inflammatory changes. CD can affect any part of the digestive tract from the mouth to the anus (skip lesions), but the majority of cases begin at the terminal ileum. In contrast, ulcerative colitis is limited to the colon and rectum. The most common symptoms of IBD include fever, vomiting, diarrhea, bloody stool (hematochezia), abdominal pain, and weight loss, but many other problems may also be included. The severity of the symptoms can impair the quality of life of patients suffering from IBD. For most patients, IBD is a chronic condition with symptoms lasting for months to years. It is most commonly seen in young adults but can occur at any age. IBD is particularly common in people of Jewish descent, and there are also ethnic differences in the incidence.

[0028] The diagnosis of IBD can be based on clinical symptoms or the use of a barium enema, but direct visualization (sigmoidoscopy or colonoscopy) is the most accurate test. Prolonged IBD is a risk factor for colon cancer, and the treatment of IBD can include medications and surgery.

[0029] Some patients with UC have only a rectal disease (proctitis). Others with UC have a disease limited to the rectum and adjacent left colon (proctosigmoiditis). Still others have UC throughout the colon (pancolonic IBD). The symptoms of UC generally increase in severity as the disease becomes more extensive (as the portion of the colon affected by the disease becomes larger). The prognosis for patients with a disease limited to the rectum (proctitis) or UC limited to the distal left colon (proctosigmoiditis) is better than that for pancolonic UC. In patients with a more extensive disease, blood loss from the inflamed intestine can cause anemia and may require treatment with iron supplements or even blood transfusions.

[0030] Although rare, the colon can acutely dilate and increase in size when the inflammation becomes very severe. This condition is called toxic megacolon. Patients with toxic megacolon are extremely ill due to fever, abdominal pain and distension, dehydration, and malnutrition. Usually, surgery is necessary to prevent colon rupture unless the patient rapidly improves with medication.

[0031] CD can occur in all regions of the gastrointestinal tract. With this disease, intestinal obstruction due to inflammation and fibrosis occurs in many patients. Granulomas and fistula formation are frequent complications of CD. The outcomes of disease progression include intravenous nutrition, surgery, and creation of a colostomy.

[0032] The remission of IBD can be measured in many ways. Clinical remission refers to the absence of disease symptoms. Histologic and endoscopic remission refer to the absence of inflammation in biopsy intestinal tissue removed during an endoscopic procedure.

[0033] Isolated: An "isolated" biological component (e.g., a nucleic acid, protein, cell, or nanovesicle, etc.) is substantially separated or purified from other biological components that are naturally occurring components within a cell of an organism or within the ECM. "Isolated" nucleic acids and proteins include nucleic acids and proteins purified by standard purification methods. The isolated MBV has been removed from the fibrous material of the ECM. This term also encompasses nucleic acids and proteins prepared by recombinant expression in a host cell, as well as chemically synthesized nucleic acids.

[0034] Lysyl oxidase (Lox): A copper-dependent enzyme that catalyzes the formation of aldehydes from lysine residues of collagen and elastin precursors. These aldehydes are highly reactive and undergo spontaneous chemical reactions with other lysyl oxidase-derived aldehyde residues or with unmodified lysine residues. In vivo, this results in the cross-linking of collagen and elastin, which plays a role in the stabilization of collagen fibrils and in the integrity and elasticity of mature elastin. Complex cross-links with different structures are formed in collagen (pyridinoline derived from three lysine residues) and in elastin (desmosine derived from four lysine residues). Genes encoding the Lox enzyme have been cloned from various organisms (Hamalainen et al., Genomics 11: 508, 1991; Trackman et al., Biochemistry 29: 4863, 1990; incorporated herein by reference). Residues 153 - 417 and residues 201 - 417 of the sequence of human lysyl oxidase have been shown to be important for catalytic function. There are four Lox-like isoforms designated LoxL1, LoxL2, LoxL3, and LoxL4.

[0035] Macrophages: A type of white blood cell that phagocytizes and decomposes cell debris, foreign substances, microorganisms, and cancer cells. In addition to their role in phagocytosis, these cells play important roles in both innate and adaptive immunity in terms of development, tissue maintenance and repair, and mobilizing and influencing other cells, including immune cells such as lymphocytes. Macrophages can exist in many phenotypes, including those designated as M1 and M2. Macrophages that mainly perform pro-inflammatory functions are called M1 macrophages (CD86 + / CD68 + ), while macrophages that reduce inflammation and also stimulate and regulate tissue repair are called M2 macrophages (CD206 + / CD68 + ). Markers for identifying the various phenotypes of macrophages vary among species. It should be noted that the macrophage phenotype is represented by a continuum between the extremes of M1 and M2. F4 / 80 (encoded by the adhesion G protein-coupled receptor E1 (ADGRE1) gene) is a macrophage marker. See GENBANK® accession numbers NP_001243181.1, April 6, 2018 and NP_001965, March 5, 2018, both of which are incorporated herein by reference. MBV has the ability to modulate the phenotype of macrophages and thus is thought to result in an increase in M2-like, regulatory or remodeling-promoting macrophages. Accordingly, MBV can be used to induce the M2 phenotype of macrophages and inhibit M1 macrophages in a subject.

[0036] MicroRNA: A small non-coding RNA approximately 17 to approximately 25 nucleotide bases in length that generally post-transcriptionally regulates gene expression by suppressing the translation of target mRNA. miRNAs can function as negative regulators, and thus, an abundance of a particular miRNA correlates with low levels of target gene expression. There are three forms of miRNAs: primary miRNAs (pri-miRNAs), immature miRNAs (pre-miRNAs), and mature miRNAs. Primary miRNAs (pri-miRNAs) are expressed as stem-loop structured transcripts ranging from approximately several hundred bases to over 1 kb. Pri-miRNA transcripts are cleaved in the nucleus by an RNase II endonuclease called Drosha that cleaves both strands of the stem near the base of the stem-loop. Drosha cleaves the RNA duplex in an alternating fashion, leaving a 5’ phosphate and a 2-nucleotide overhang at the 3’ end. The cleavage product, the immature miRNA (pre-miRNA), is approximately 60 to approximately 110 nucleotides in length and has a hairpin structure formed in a fold-back manner. Pre-miRNAs are transported from the nucleus to the cytoplasm by Ran-GTP and exportin-5. Pre-miRNAs are further processed in the cytoplasm by another RNase II endonuclease called Dicer. Dicer recognizes the 5’ phosphate and 3’ overhangs and cleaves the loop at the stem-loop junction to form the miRNA duplex. The miRNA duplex binds to the RNA-induced silencing complex (RISC), where the antisense strand is preferentially degraded and the sense strand mature miRNA directs the RISC to its target site. Mature miRNAs are the biologically active form of miRNAs and are approximately 17 to approximately 25 nucleotides in length.

[0037] Multiple sclerosis (MS): An autoimmune disease classically described as a temporally and spatially disseminated central nervous system white matter disorder that presents as a relapsing-remitting disease in 80 - 85% of patients. MS is a chronic and usually progressive disease associated with damage to the sheaths of nerve cells in the brain and spinal cord. Diagnosis can be made by brain and spinal cord magnetic resonance imaging (MRI), analysis of somatosensory evoked potentials, and analysis of cerebrospinal fluid to detect increased amounts of immunoglobulins or oligoclonal bands. MRI is a particularly sensitive diagnostic tool. MRI abnormalities indicating the presence or progression of MS include high-intensity white matter signals on T2-weighted and fluid-attenuated inversion recovery images, gadolinium enhancement of active lesions, low-signal "black holes" (representing gliosis and axonal pathology), and brain atrophy on T1-weighted studies. Serial MRI studies can be used to demonstrate disease progression. The status of MS patients can be evaluated by long-term monthly follow-up of magnetic resonance (MRI) activity in the brains of MS patients. MRI provides a unique set of assessment criteria for phase I / II clinical trials in small patient cohorts and is thus well-suited for establishing data for proof-of-concept of new treatment strategies (see, for example, Harris et al., Ann. Neurol. 29:548 - 555, 1991; MacFarland et al., Ann. Neurol. 32:758 - 766, 1992; Stone et al., Ann. Neurol. 37:611 - 619, 1995).

[0038] Relapsing-remitting multiple sclerosis is the clinical course of MS characterized by clearly defined acute attacks with complete or partial recovery and no disease progression between attacks. During remission, all symptoms may disappear, or some symptoms may persist permanently. However, there is no obvious progression of the disease during the remission period.

[0039] Secondary progressive multiple sclerosis is the clinical course of MS that initially is relapsing-remitting and then becomes progressive at a variable rate, with occasional relapses and minor remissions according to some. Primary progressive multiple sclerosis presents as progressive from the beginning.

[0040] Symptoms of MS include numbness, language and muscle coordination disorders, blurred vision, and severe fatigue.

[0041] Treatments for MS include interferon beta-1a, interferon beta-1b, glatiramer acetate, mitoxantrone, natalizumab, fingolimod, teriflunomide, dimethyl fumarate, alemtuzumab, ocrelizumab, siponimod, cladribine, ocrelizumab, rituximab, and alternative / complementary medicines. In some embodiments, the compositions and methods disclosed herein can be used to treat MS.

[0042] Nanovesicles: Extracellular vesicles that are nanoparticles with a diameter of about 10 to about 1,000 nm. Nanovesicles are lipid membrane-bound particles that carry biologically active signaling molecules (e.g., microRNAs, proteins) among other molecules. Generally, nanovesicles are delimited by a lipid bilayer and can encapsulate and / or embed biomolecules in the bilayer. Thus, nanovesicles contain a lumen surrounded by a plasma membrane. Different types of vesicles can be distinguished based on their origin, such as diameter, intracellular origin, density, shape, sedimentation rate, lipid composition, protein markers, nucleic acid content, and whether they are derived from the extracellular matrix or secreted. Nanovesicles can be identified by their origin, protein content, and / or miR content, such as matrix-bound nanovesicles derived from the ECM (see above).

[0043] "Exosome" or "liquid-phase extracellular vesicle (EV)" is a membrane-like vesicle secreted by cells with a diameter ranging from 10 to 150 nm. Generally, late endosomes or multivesicular bodies contain intraluminal vesicles formed by the inward budding and cleavage of vesicles from the limited endosomal membrane into these enclosed vesicles. Then, upon fusion with the plasma membrane, these intraluminal vesicles are released from the multivesicular body lumen into the extracellular environment, generally into body fluids such as blood, cerebrospinal fluid or saliva during exocytosis. When segments of the membrane invaginate and are taken up by endocytosis, exosomes are generated intracellularly. Internally translocated segments that are degraded into smaller vesicles and ultimately expelled from the cell contain proteins as well as RNA molecules such as mRNA and miRNA. Plasma-derived exosomes are almost devoid of ribosomal RNA. Exosomes derived from the extracellular matrix contain specific miRNA and protein components and have been shown to be present in virtually all body fluids such as blood, urine, saliva, semen, and cerebrospinal fluid. Exosomes may express CD11c, CD63, CD81, and / or CD9, and thus, CD11c + and / or CD63 + and / or C81 + and / or CD9 + can be. Exosomes do not have a high level of lysyl oxidase on their surface.

[0044] "ECM-derived nanovesicles", "matrix-bound nanovesicles", "MBV", or "ECM-derived nanovesicles" all refer to the same membrane-bound particles, which range in size from 10 nm to 1000 nm, are present in the extracellular matrix, and contain biologically active signaling molecules such as proteins, lipids, nucleic acids, growth factors, and cytokines that affect cell behavior. These terms are interchangeable and refer to the same vesicles. These nanovesicles are embedded in and bound to the ECM and are not simply attached to the surface or freely circulating in body fluids. These nanovesicles are resistant to harsh isolation conditions such as freeze-thaw and digestion by proteases such as pepsin, elastase, hyaluronidase, proteinase K, and collagenase, as well as digestion by detergents. MBV is distinct from other extracellular vesicles, including exosomes, and has a distinct phospholipid composition from exosomes. In certain situations, MBV can also be distinguished from exosomes based on the absence of certain markers typically associated with exosomes. In some embodiments, MBV is characterized by one or more of the following features with respect to protein expression or lipid content: (i) MBV may not express one or more of CD63 and / or CD81 and / or CD9, or may express CD63 and / or CD81 and / or CD9 at low levels or at levels only slightly detectable compared to other vesicles such as exosomes (CD63 lo and / or CD81 lo and / or CD9 loIt may also have (see, for example, Example 1). Various methods, such as antibody-based methods, such as Western blotting or flow cytometry, etc., can be used to distinguish low expression, barely detectable expression, or absence of expression of CD63 and / or CD81 and / or CD9 in MBV (see, for example, Bashashati and Brinkman, Adv Bioinformatics, 2009: 584603). In some embodiments, the MBV expression of CD63 and / or CD81 and / or CD9 is considered low or barely detectable compared to other vesicles when the expression of CD63 and / or CD81 and / or CD9 in MBV is at least 1 standard deviation or at least 2 standard deviations below the average expression of other vesicles such as exosomes; (ii) MBV has a phospholipid content in which at least 55% of the total phospholipids are composed of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI); (iii) MBV has a phospholipid content in which 10% or less of the total phospholipids are composed of sphingomyelin (SM); (iv) MBV has a phospholipid content in which 20% or less of the total phospholipids are composed of phosphatidylethanolamine (PE); (v) MBV has a phospholipid content in which 15% or more of the total phospholipid content is composed of phosphatidylinositol (PI), and this percentage represents the percentage of lipid concentration.

[0045] In some embodiments, MBV is characterized by all of the following features: (i) Does not express one or more of CD63 and / or CD81 and / or CD9, or expresses CD63 and / or CD81 and / or CD9 at a low level or a barely detectable level (CD63 lo and / or CD81 lo and / or CD9 lo ) as further described above; (ii) The phospholipid content, wherein at least 55% of the total phospholipids are composed of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI); (iii) The phospholipid content, wherein 10% or less of the total phospholipids are composed of sphingomyelin (SM); (iv) The phospholipid content, wherein 20% or less of the total phospholipids are composed of phosphatidylethanolamine (PE); and (v) The phospholipid content, wherein 15% or more of the total phospholipid content is phosphatidylinositol (PI).

[0046] In some embodiments, MBV is characterized by all of the following features: (i) The phospholipid content, wherein at least 55% of the total phospholipids are composed of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI); (ii) The phospholipid content, wherein 10% or less of the total phospholipids are composed of sphingomyelin (SM); (iii) The phospholipid content, wherein 20% or less of the total phospholipids are composed of phosphatidylethanolamine (PE); and (iv) The phospholipid content, wherein 15% or more of the total phospholipid content is phosphatidylinositol (PI).

[0047] In some embodiments, MBV is characterized by one or more of the following features: (i) The phospholipid content, wherein at least 55% of the total phospholipids are composed of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI); (ii) The phospholipid content, wherein 10% or less of the total phospholipids are composed of sphingomyelin (SM); (iii) The phospholipid content, wherein 20% or less of the total phospholipids are composed of phosphatidylethanolamine (PE); and (iv) a phospholipid content in which 15% or more of the total phospholipid content is phosphatidylinositol (PI).

[0048] The ECM from which the MBV is isolated can be ECM from tissue, can be produced from cells under culture, or can be purchased from a commercial source.

[0049] Pemphigus: An autoimmune disease that affects the skin and mucous membranes. Autoantibodies are formed against desmoglein, which forms the adhesion between adjacent epithelial cells by desmosomes. The autoantibodies attack desmoglein, thereby separating the cells from the epidermis ("acantholysis"), forming blisters, and those blisters peel off and become erosions. The blisters can spread over a significant area of the skin. Various types of pemphigus are included, such as pemphigus vulgaris, pemphigus foliaceus, intraepidermal neutrophilic IgA dermatosis, paraneoplastic pemphigus, and endemic pemphigus foliaceus. Treatments for pemphigus include topical steroids (e.g., clobetasol, etc.), intralesional injection of steroids (e.g., dexamethasone, etc.), immunosuppressive drugs (e.g., CELLCEPT® or mycophenolic acid, etc.), serum or plasma pool products (e.g., intravenous gamma globulin (IVIG) etc. especially for severe pemphigus, such as paraneoplastic pemphigus), and biologic agents (e.g., Rituxan®, or rituximab etc. especially for severe cases of refractory pemphigus vulgaris). In some embodiments, the compositions and methods disclosed herein can be used to treat pemphigus.

[0050] Pemphigoid: A rare autoimmune disease that presents as blistering of the skin. Pemphigoid appears similar to pemphigus but does not involve acantholysis. Pemphigoid is more commonly seen in women and people over 60 years of age. Various types of pemphigoid are included, such as IgG-mediated pemphigoid, for example, gestational, bullous, and cicatricial pemphigoid, and IgA-mediated pemphigoid, for example, IgA-mediated immunobullous disease. Treatments can include Rituxan® or rituximab, corticosteroids (such as topical and systemic corticosteroids), glucocorticoid-sparing agents, immunosuppressive drugs, anti-inflammatory drugs, biologic therapies, and intravenous immunoglobulin. In some embodiments, the compositions and methods disclosed herein can be used to treat pemphigoid.

[0051] Pharmaceutically acceptable carrier: The pharmaceutically acceptable carriers useful in the pharmaceutical preparations described in the claims are conventional. Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975) describes compositions and formulations suitable for the pharmaceutical delivery of the fusion proteins disclosed herein.

[0052] Generally, the nature of the carrier depends on the particular dosage form being used. For example, parenteral formulations typically include injectable solutions that contain pharmaceutically and physiologically acceptable fluids such as water, saline, balanced salt solutions, aqueous dextrose, glycerol, etc. as a vehicle. For solid compositions (such as in the form of powders, pills, tablets, or capsules), conventional non-toxic solid carriers can include, for example, pharmaceutical grade mannitol, lactose, starch, or magnesium stearate. The pharmaceutical preparations to be administered can contain, in addition to the biologically neutral carrier, trace amounts of non-toxic auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents, for example, sodium acetate or sorbitan monolaurate.

[0053] Drug: A chemical compound or composition that can produce a desired therapeutic or prophylactic effect when properly administered to a subject or cell.

[0054] Phospholipid: A class of lipids having a structure consisting of two hydrophobic fatty acid tails and a hydrophilic head consisting of a phosphate group. Major classes of phospholipids include phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI), phosphatidylserine (PS), phosphatidylglycerol (PG), sphingomyelin (SM), cardiolipin (CL), phosphatidic acid (PA), and bis - monoacylglycerophosphate (BMP). Phospholipids can be measured in various ways. For example, comprehensive lipidomics and redox lipidomics based on LC - MS can be used. In some embodiments, a specific phospholipid content is expressed as a percent concentration of total phospholipids (such as total phospholipids in MBV, etc.), and this percent concentration is weight / weight.

[0055] Polynucleotide: A nucleic acid sequence of any length (e.g., a linear sequence, etc.). Thus, a polynucleotide includes oligonucleotides and also includes gene sequences found within chromosomes. An "oligonucleotide" is a plurality of linked nucleotides joined by native phosphodiester bonds. An oligonucleotide is a polynucleotide between 6 nucleotides in length and 300 nucleotides in length. An oligonucleotide analog refers to a moiety that functions similarly to an oligonucleotide but has a moiety that does not occur naturally. For example, an oligonucleotide analog may contain non - naturally occurring moieties such as a modified sugar moiety or sugar - sugar linkage, such as phosphorothioate oligodeoxynucleotides. Functional analogs of naturally occurring polynucleotides can bind to RNA or DNA and include peptide nucleic acid (PNA) molecules.

[0056] Psoriasis: An autoimmune disease characterized by abnormal patches of skin, such as red or purple, dry, itchy, and scaly patches, and abnormal overgrowth and rapid growth of the epidermal layer of the skin. The symptoms of psoriasis can range from small, localized patches to widespread areas of the body. Various types of psoriasis, such as plaque psoriasis, guttate psoriasis, inverse psoriasis, pustular psoriasis, and erythrodermic psoriasis, are included. The pathogenesis involves an immune system reaction against skin cells, and treatments can include steroid creams, vitamin D3 creams, ultraviolet light, and immunosuppressive medications, such as methotrexate. Psoriasis is associated with an increased risk of psoriatic arthritis, lymphoma, cardiovascular disease, Crohn's disease, and depression. In some embodiments, the compositions and methods disclosed herein can be used to treat psoriasis. The recurrence of psoriasis can be triggered by dry or cold weather, stress, or skin trauma, resulting in the formation of dry, itchy patches characteristic of this disorder.

[0057] Purified: The term "purified" is not meant to require absolute purity, but is intended as a relative term. Thus, for example, a purified preparation of nucleic acid molecules is one in which the nucleic acid referred to in the preparation is more pure than the nucleic acid in its natural environment within a cell. For example, a preparation of nucleic acid is purified such that the nucleic acid constitutes at least 50% of the total protein content of the preparation. Similarly, a purified preparation of MBV is one in which the exosomes in the preparation are more pure than exosomes in an environment in which microvesicles and cells containing exosomes are present. A purified population of nucleic acid or MBV is one that is greater than about 90%, greater than about 91%, greater than about 92%, greater than about 93%, greater than about 94%, greater than about 95%, greater than about 96%, greater than about 97%, greater than about 98%, greater than about 99% or 100% pure, or contains no other nucleic acid or cellular components.

[0058] Prevention or treatment of diseases: "Prevention" of a disease refers to, for example, inhibiting the occurrence of the disease in a person known to have a predisposition to the disease. Examples of persons known to have a predisposition include those with a family history of the disease in the family, or those who have been exposed to factors that give rise to the predisposition of the condition in the subject. "Treatment" refers to therapeutic intervention to improve the signs or symptoms after the disease or pathological condition has begun to occur.

[0059] Remission: A disease state characterized by the absence of clinically detectable signs or symptoms of the disease and / or the absence of disease progression. What constitutes remission can vary depending on the autoimmune disorder in question.

[0060] Relapse: The return of signs or symptoms of the disease or disease progression after a remission period, or the worsening of signs or symptoms of the disease after a period of symptom improvement.

[0061] Relapsing-remitting disease: An autoimmune disorder characterized by periods of symptom improvement and absence of disease progression (remission), followed by worsening of the symptoms of the disorder and signs of disease progression, including increased inflammation in the affected tissues. Multiple sclerosis, systemic lupus erythematosus, inflammatory bowel disease (including Crohn's disease of the colon and ulcerative colitis), psoriasis, and rheumatoid arthritis are examples of relapsing-remitting autoimmune diseases.

[0062] Scleroderma: An autoimmune disease that can change the skin, blood vessels, muscles, and internal organs. The disease can be limited (e.g., to the skin) or affect other organs. Symptoms can include areas of thickened skin, stiffness, fatigue, and poor blood flow to the fingers or toes upon cold exposure. Various types of scleroderma are included, such as localized scleroderma, for example localized morphea, morphea-sclerotic atrophic lichen overlap (LSA), generalized morphea, Pasini-Pierini skin atrophy, pansclerotic morphea, deep morphea, linear morphea, as well as systemic scleroderma, such as CREST syndrome and progressive systemic sclerosis. The pathogenesis involves abnormal growth of connective tissue, most likely due to the body's immune system attacking healthy tissue. This condition most often begins in middle age and is more frequent in women than in men.

[0063] The treatment may include corticosteroids, methotrexate, non-steroidal anti-inflammatory drugs (NSAIDs), vasodilators (such as calcium channel blockers, alpha blockers, serotonin receptor antagonists, angiotensin II receptor inhibitors, statins, topical nitrates, or iloprost, etc.), phosphodiesterase 5 inhibitors (such as sildenafil, etc.), bosentan, tetracycline, cyclophosphamide, azathioprine, endothelin receptor antagonists, prostanoids, antacids, gastrointestinal function improving drugs, angiotensin converting enzyme inhibitors, angiotensin II receptor antagonists, immunosuppressants (such as azathioprine, methotrexate, cyclophosphamide, mycophenolate, intravenous immunoglobulin, rituximab, sirolimus, alefacept, and tyrosine kinase inhibitors imatinib, nilotinib and dasatinib, etc.), endothelin receptor antagonists, beta-glucan peptides, halofuginone, basiliximab, alemtuzumab, abatacept, and hematopoietic stem cell transplantation. In some embodiments, the compositions and methods disclosed herein can be used to treat scleroderma.

[0064] Subjects: Humans and non-human animals including all vertebrates such as mammals and non-mammals such as non-human primates, mice, rabbits, sheep, dogs, cats, horses, cows, chickens, amphibians, and worms. In many embodiments of the described methods, the subject is a human. The term "subject" is used synonymously with the term "patient".

[0065] Systemic lupus erythematosus (SLE): Also known as lupus, SLE is an autoimmune disease in which the body's immune system (e.g., antinuclear antibodies, etc.) mistakenly attacks healthy tissue. Symptoms range from mild to severe and can vary depending on the subject and over time, which can include, for example, periods of illness or relapse, and periods of remission with few symptoms. Common symptoms include joint pain and swelling, fever, chest pain, hair loss, mouth ulcers, swollen lymph nodes, fatigue, and red rashes (e.g., on the face). Inflammation of the joints, skin, kidneys, brain, heart, or lungs may also occur. It most commonly begins between 15 and 45 years of age, but a wide range of ages can be affected. Women of childbearing age, as well as African, Caribbean, and Chinese women, are at higher risk.

[0066] Treatments can include tacrolimus, disease-modifying antirheumatic drugs (DMARDs, e.g., corticosteroids, etc.; antimalarial drugs, e.g., hydroxychloroquine, as well as immunosuppressive agents, e.g., methotrexate and azathioprine, etc.; hydroxychloroquine; cyclophosphamide; and mycophenolic acid), immunosuppressive drugs, analgesics (e.g., non-steroidal anti-inflammatory drugs, or NSAIDs, e.g., indomethacin and diclofenac, etc.), opioids, intravenous immunoglobulin (IVIG), lifestyle changes (e.g., avoidance of sunlight, and activities that induce fatigue, etc.), kidney transplantation (e.g., for treating lupus nephritis), and anticoagulants (e.g., for antiphospholipid syndrome). In some embodiments, the compositions and methods disclosed herein can be used to treat SLE.

[0067] Therapeutically effective amount: The amount of a particular substance, such as MBV, that is sufficient to achieve the desired effect in the subject being treated. When administered to a subject, the dosage that achieves the target tissue concentration (e.g., in bone or joint) at which the desired in vitro effect has been shown to be achieved is generally used.

[0068] "Total phospholipids" or "total phospholipid content": With respect to MBV, refers to the sum of all phospholipids present in a given amount of isolated MBV, i.e., MBV isolated from ECM. MBV can be isolated, for example, by enzymatic digestion of decellularized ECM and fractionation centrifugation. The total phospholipid content can be determined by methods such as LC-MS-based comprehensive lipidomics and redox lipidomics. The total phospholipid content is measured by weight. The percentage of total phospholipid content refers to the percent concentration on a weight / weight basis.

[0069] Transplantation: Placing a biocompatible substrate, such as MBV, within a subject in need thereof.

[0070] Treating, treatment, and therapy: Any success or indication of success regarding the attenuation or improvement of an injury, medical condition, or state, including any objective or subjective parameters such as the alleviation, remission, reduction, or the state becoming more tolerable to the patient, the rate of degeneration or decline slowing down, the end point of degeneration becoming less consumptive, or the physical or mental well-being of the subject improving. Treatment can be evaluated by objective or subjective parameters, including the results of physical examinations, neurological examinations, or psychiatric evaluations.

[0071] Unless otherwise noted, technical terms are used according to their conventional usage. Definitions of common terms in molecular biology can be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).

[0072] Summary It is disclosed herein that MBV has the ability to treat autoimmune disorders when administered to a subject suffering from an autoimmune disorder. In particular, it has been discovered that systemically delivered MBV has a therapeutic effect that is the same as the therapeutic effect obtained from local administration of MBV to the affected tissue in the treatment of symptoms of autoimmune disorders. Accordingly, the present invention positions MBV as a unique systemic therapy for autoimmune disorders.

[0073] It is also disclosed herein that local administration of MBV is particularly effective for some conditions, such as, but not limited to, psoriasis. For example, in the treatment of psoriasis, local cutaneous administration of MBV is particularly effective.

[0074] As described in Example 2 below, in a rat model of rheumatoid arthritis, the arthritis score of rats administered MBV systemically by intravenous injection into the tail vein or locally by perijoint injection was improved to the same extent as that of rats receiving perijoint methotrexate, which is the gold standard for the treatment of rheumatoid arthritis. Moreover, it was a surprising finding that the improvement in the arthritis score was equivalent among rats, whether they received systemic injection or local injection. In the theory, systemic injection of MBV was supposed to result in a dilution effect and, therefore, not produce any significant level of local therapeutic effect, but the opposite was found. Therefore, systemic administration of MBV has the potential to treat many autoimmune disorders that are not limited to a part of the body or not suitable for local treatment. Many autoimmune disorders cause systemic inflammation or are systemic disorders that affect many tissues. Therefore, local treatment is neither an effective nor an efficient treatment method. In disorders affecting the skin, such as pemphigus, local administration such as topical administration may not be practical when a significant area of the skin is affected by the disorder, and in many cases, topical application to the skin by the affected subjects may be impossible if they cannot reach the affected area to administer the treatment locally, and therefore, the option of systemic treatment may be more efficient and practical. Furthermore, in diseases such as rheumatoid arthritis, local injection of a therapeutic agent into the affected joint is extremely painful, and multiple joints in various parts of the body may be affected. Therefore, the option of systemic therapy not only provides a more comfortable treatment option but also a more efficient mechanism for treating the systemic inflammation caused by autoimmune disorders.

[0075] Local administration is contemplated for treating the autoimmune disorders disclosed herein. However, subjects having these disorders experience particular therapeutic benefits when MBV is administered as a systemic therapy, especially when the disorder affects sensitive tissues where local administration is not available or not suitable for treatment by local administration for other reasons, or when the disorder affects systemic locations and tissues (e.g., a systemic disorder). In the treatment of autoimmune disorders where symptoms are seen in more than one location of the body, systemic treatment with MBV provides an efficient and effective treatment of such disorders. The above-described therapeutic effects can be achieved using intravenous systemic administration, but other methods of systemic administration are also contemplated.

[0076] A method of treating an autoimmune disorder (e.g., a chronic autoimmune disorder, etc.) in a subject in need thereof, the method comprising administering to the subject a pharmaceutical preparation comprising a therapeutically effective amount of an isolated matrix-bound vesicle (MBV) derived from the extracellular matrix (e.g., an MBV derived from the extracellular matrix of the bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessel, lung, bone, muscle, pancreas, stomach, spleen, colon, adipose tissue or esophagus; e.g., the MBV is derived from a mammalian vertebrate selected from human, monkey, pig, cow or sheep, such as an MBV derived from urinary bladder matrix (UBM), small intestinal submucosa (SIS), or urinary bladder submucosa (UBS)), whereby the autoimmune disorder is treated, is disclosed herein. In some embodiments, the administration is systemic.

[0077] In some embodiments, the autoimmune disorder is an autoimmune disorder other than in the eye. In some embodiments, the autoimmune disorder is not rheumatoid arthritis, scleroderma, or ulcerative colitis. In some embodiments, the autoimmune disorder is Addison's disease, alopecia areata, ankylosing spondylitis, antiphospholipid antibody syndrome, autoimmune encephalitis, autoimmune hepatitis, celiac disease, Crohn's disease, Goodpasture syndrome, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, immune thrombocytopenia, IgA nephropathy, inflammatory bowel disease (IBD), multiple sclerosis, myasthenia gravis, pemphigoid, pemphigus, type 2 polyendocrine autoimmune syndrome, psoriasis, psoriatic arthritis, rheumatoid arthritis, scleroderma, Sjogren's syndrome, systemic lupus erythematosus, Takayasu arteritis, type 1 diabetes, ulcerative colitis, or undifferentiated connective tissue disease (UCTD). In other embodiments, the autoimmune disorder is Addison's disease, alopecia areata, ankylosing spondylitis, antiphospholipid antibody syndrome, autoimmune encephalitis, autoimmune hepatitis, celiac disease, Crohn's disease, Goodpasture syndrome, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, immune thrombocytopenia, IgA nephropathy, multiple sclerosis, myasthenia gravis, pemphigoid, pemphigus, type 2 polyendocrine autoimmune syndrome, psoriasis, psoriatic arthritis, Sjogren's syndrome, systemic lupus erythematosus, Takayasu arteritis, type 1 diabetes, or undifferentiated connective tissue disease (UCTD).

[0078] In some embodiments, the autoimmune disorder is rheumatoid arthritis. In certain non-limiting examples, the administration is systemic. In other embodiments, the autoimmune disorder is scleroderma. In further embodiments, the autoimmune disorder is ulcerative colitis. In further embodiments, the autoimmune disorder is pemphigus. In some embodiments, the autoimmune disorder is pemphigoid. In other embodiments, the autoimmune disorder is Crohn's disease. In further embodiments, the autoimmune disorder is psoriasis. In further embodiments, the autoimmune disorder is psoriatic arthritis. In still other embodiments, the autoimmune disorder is multiple sclerosis. In some embodiments, the autoimmune disorder is systemic lupus erythematosus. In some embodiments, the autoimmune disorder is autoimmune encephalitis.

[0079] In any of these embodiments, the method may include the step of selecting a subject for treatment. Administration may be systemic or local.

[0080] In the methods of treating an autoimmune disorder disclosed herein, a subject can experience a therapeutic benefit over a long period of time following administration of MBV. In some examples, the subject experiences a therapeutic benefit lasting for a period of at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, or at least 3 months following administration of MBV. In certain non-limiting examples, the therapeutic benefit from administration lasts for at least 1 week. In certain examples, the therapeutic benefit from administration lasts for at least 2 weeks. In certain non-limiting examples, the therapeutic benefit from administration lasts for at least 1 month. In certain non-limiting examples, the therapeutic benefit from administration lasts for at least 2 months. In certain examples, the therapeutic benefit from administration lasts for at least 3 months or longer. In some non-limiting examples, the therapeutic benefit is a reduction in the symptoms of the disease or disorder present at the time of administration. In some non-limiting examples, the therapeutic benefit is a decrease in the level of inflammation caused by the autoimmune disorder in the subject, relative to the level of inflammation caused by the autoimmune disorder prior to administration of MBV. In some non-limiting examples, the therapeutic benefit is remission of the disease or disorder. In some non-limiting examples, the therapeutic benefit is a reduction in the recurrence or disappearance of the recurrence of the symptoms of the disease or disorder during that period. In some embodiments, the disclosed methods reduce the recurrence of a disease, such as, but not limited to, rheumatoid arthritis, multiple sclerosis, or systemic lupus erythematosus.

[0081] In some embodiments, administration can be systemic. Systemic administration can be intravenous administration, oral administration, enteral administration, parenteral administration, intranasal administration, rectal administration, sublingual administration, buccal administration, sublabial administration, intraperitoneal administration, subcutaneous or intramuscular administration. In certain non-limiting examples, systemic administration is intravenous administration. In certain non-limiting examples, systemic administration is oral administration. In certain non-limiting examples, systemic administration is enteral administration. In certain non-limiting examples, systemic administration is parenteral administration. In certain non-limiting examples, systemic administration is intranasal administration. In certain non-limiting examples, systemic administration is rectal administration. In certain non-limiting examples, systemic administration is sublingual administration. In certain non-limiting examples, systemic administration is buccal administration. In certain non-limiting examples, systemic administration is sublabial administration. In certain non-limiting examples, systemic administration is intraperitoneal administration. In certain non-limiting examples, systemic administration is subcutaneous administration. In certain non-limiting examples, systemic administration is intramuscular administration.

[0082] Nanovesicles derived from the extracellular matrix (ECM) ECM-derived nanovesicles (also referred to as matrix-bound nanovesicles, MBV) are generally described in PCT Publications WO2017 / 151862 and WO2018 / 204848, which are incorporated herein by reference. It has been disclosed that the nanovesicles are embedded in the extracellular matrix. These MBVs can be isolated and are biologically active. Thus, these MBVs can be used for therapeutic purposes alone or in combination with another ECM. The extracellular matrix includes, but is not limited to, a complex mixture of structural and functional biomolecules and / or biopolymers, including structural proteins, special proteins, proteoglycans, glycosaminoglycans, and growth factors, that surround and support cells within mammalian tissues and are acellular unless otherwise specified. Generally, the disclosed MBVs are embedded in any type of extracellular matrix (ECM) and can be isolated from their location. Thus, MBVs are not present separately on the surface of the ECM and are not exosomes.

[0083] The extracellular matrix is disclosed, for example, without limitation only to, U.S. Patent Nos. 4,902,508; 4,956,178; 5,281,422; 5,352,463; 5,372,821; 5,554,389; 5,573,784; 5,645,860; 5,771,969; 5,753,267; 5,762,966; 5,866,414; 6,099,567; 6,485,723; 6,576,265; 6,579,538; 6,696,270; 6,783,776; 6,793,939; 6,849,273; 6,852,339; 6,861,074; 6,887,495; 6,890,562; 6,890,563; 6,890,564; and 6,893,666; each of which is incorporated by reference in its entirety). However, ECM can also be made from any tissue and can also be made from any in vitro source, in which case the ECM is produced by cultured cells and contains one or more polymer components (constituents) of native ECM. The ECM preparation can be considered "acellularized" or "cell-free", which means that the cells have been removed from the source tissue or culture.

[0084] In some embodiments, the ECM is isolated from vertebrates, such as, but not limited to, mammalian vertebrates including humans, monkeys, pigs, cows, sheep, etc. The ECM can be derived from any organ or tissue including, but not limited to, the bladder, intestine (e.g., small intestine or large intestine, etc.), heart, dermis, liver, kidney, uterus, brain, blood vessels, lungs, bone, muscle, pancreas, stomach, spleen, colon, adipose tissue or esophagus. In certain non-limiting examples, the extracellular matrix is isolated from esophageal tissue, bladder (e.g., bladder matrix or submucosal tissue of the bladder, etc.), submucosal tissue of the small intestine, dermis, umbilical cord, pericardium, heart tissue, or skeletal muscle. The ECM can include, for example, but not limited to, any part or tissue obtained from an organ including submucosal tissue, epithelial basement membrane, lamina propria, etc. In one non-limiting embodiment, the ECM is isolated from the bladder.

[0085] The ECM may or may not include a basement membrane. In another non-limiting embodiment, the ECM includes at least a portion of the basement membrane. The ECM material may or may not retain a part of the cellular elements that make up the original tissue, such as capillary endothelial cells or fibroblasts. In some embodiments, the ECM contains both a basement membrane surface and a non-basement membrane surface.

[0086] In a non-limiting embodiment, the ECM is harvested from a porcine bladder (also known as bladder matrix or UBM). Briefly, the ECM is prepared by removing bladder tissue from a mammal such as a pig and trimming away the outer connective tissue including the remaining adipose tissue. All remaining urine is removed by repeated washing with tap water. First, the tissue is delaminated by immersing the tissue in a de-epithelializing solution, such as, but not limited to, hypertonic saline (e.g., 1.0 N saline) for a period ranging from 10 minutes to 4 hours. Exposure to the hypertonic saline solution removes the epithelial cells from the underlying basement membrane. Optionally, a calcium chelating agent can be added to the saline solution. The remaining tissue after the first delamination procedure includes the epithelial basement membrane and the tissue layer on the anti-luminal side with respect to the epithelial basement membrane. The relatively fragile epithelial basement membrane is consistently damaged and removed by any mechanical delamination against the luminal surface. Next, the tissue is subjected to further processing to remove most of the anti-luminal tissue while maintaining the epithelial basement membrane and the lamina propria. Most of the outer serosa, adventitia, muscularis mucosa, submucosa, and muscularis mucosae are removed from the remaining de-epithelialized tissue by mechanical dissection or by a combination of enzymatic treatment (e.g., using trypsin or collagenase), subsequent hydration, and delamination. Mechanical removal of these tissues is achieved, for example, but not limited to, using Adson-Brown forceps and Metzenbaum scissors to remove mesenteric tissue and wiping longitudinally using a scalpel handle or other rigid body wrapped in moistened gauze to remove the muscularis and submucosa. Also contemplated are cutting blades, automated robotic procedures with lasers, and other tissue separation methods. After removing these tissues, the resulting ECM consists primarily of the epithelial basement membrane and the underlying lamina propria.

[0087] In another embodiment, the ECM is prepared by peeling the porcine bladder tissue using a wiping motion longitudinally with a scalpel handle and moistened gauze to remove the outer layer including both the serosa and muscularis. After turning the tissue segment inside out, the luminal portion of the mucosa is delaminated from the underlying tissue using the same wiping motion. Care is taken not to puncture the submucosal tissue. The ECM obtained after removing these tissues mainly consists of the submucosa (see Figure 2 of U.S. Patent No. 9,277,999, which is incorporated herein by reference).

[0088] The ECM can also be prepared as a powder. Such powder can be made according to the method of Gilbert et al., Biomaterials 26 (2005) 1431-1435, which is incorporated herein by reference in its entirety. For example, the UBM sheet can be lyophilized and then cut into small sheets for immersion in liquid nitrogen. The snap-frozen material can then be finely crushed so that the particles are small enough to enter a rotary knife mill, thereby pulverizing the ECM. Similarly, by precipitating NaCl within the ECM tissue, the material can be crushed into uniformly sized particles, snap-frozen, lyophilized, and powdered.

[0089] In a non-limiting embodiment, the ECM is derived from small intestinal submucosal tissue or SIS. Commercially available preparations include, but are not limited to, SURGISIS™, SURGISIS-ES™, STRATASIS™, and STRATASIS-ES™ (Cook Urological Inc.; Indianapolis, Ind.) and GRAFTPATCH™ (Organogenesis Inc.; Canton Mass.). In another non-limiting embodiment, the ECM is derived from dermis. Commercially available preparations include, but are not limited to, PELVICOL™ (sold as PERMACOL™ in Europe; Bard, Covington, Ga.), REPLIFORM™ (Microvasive; Boston, Mass.) and ALLODERM™ (LifeCell; Branchburg, N.J.). In another embodiment, the ECM is derived from bladder. Commercially available preparations include, but are not limited to, UBM (ACell Corporation; Jessup, Md.).

[0090] MBV can be extracted (and then released) from the extracellular matrix using the methods disclosed below. The methods are disclosed, for example, in Quijano et al., Tissue Engineering, part C, doi.org / 10.1089 / ten.TEC.2020.0243, October 3, 2020, which is incorporated herein by reference.

[0091] In some embodiments, the ECM is digested using enzymes such as pepsin, collagenase, elastase, hyaluronidase, liberase, or proteinase K, and the MBV is isolated. In other embodiments, the MBV is released and separated from the ECM by changing the pH using solutions such as glycine HCl, citric acid, ammonium hydroxide, etc., by using chelating agents such as, but not limited to, EDTA, EGTA, etc., salts such as, but not limited to, potassium chloride (KCl), sodium chloride, magnesium chloride, sodium iodide, sodium thiocyanate, etc. to affect the ionic strength and / or chaotropic effect, or by exposing the ECM to denaturing conditions such as guanidine HCl or urea.

[0092] In certain examples, the MBV is prepared after digestion of the ECM with enzymes such as pepsin, elastase, hyaluronidase, proteinase K, salt solutions or collagenase. The ECM may be freeze-thawed or subjected to mechanical disruption.

[0093] In some embodiments, the expression of CD63, CD81, and / or CD9 cannot be detected in MBV. Thus, in some embodiments, the MBV does not express CD63 and / or CD81 and / or CD9. In one particular example, CD63, CD81, and CD9 cannot be detected in the nanovesicles. In other embodiments, the MBV has a slightly detectable level of CD63, CD81, and CD9, such as those detectable by, for example, Western blot. These MBVs are CD63 lo CD81 lo CD9 lo and so on. In other embodiments, the MBV does not express one or more of CD63, CD81 or CD9 at a detectable level. In other embodiments, the MBV expresses one or more of CD63, CD81 or CD9 at a slightly detectable level. One of ordinary skill in the art can use, for example, antibodies that specifically bind to CD63, CD81, and CD9 to detect CD63 lo and / or CD81lo and / or CD9 lo MBV that is can be easily identified. Low levels of these markers can be established using procedures such as fluorescence-activated cell sorting (FACS) and fluorescently labeled antibodies to determine thresholds for low and high amounts of CD63, CD81, and CD9. The disclosed MBV is different from nanovesicles such as exosomes that can transiently adhere to the surface of the ECM, as these are present in biological fluids. This is because MBV is bound to the ECM in vivo and is not found in biological fluids.

[0094] MBV has a characteristic phospholipid content, for example, as compared to exosomes. In some embodiments, the total phospholipid content of MBV is at least 50%, 55%, 60%, 65%, 70%, 75%, 85%, or 90%, or about 50% - 90%, 50% - 65%, 50% - 60%, 50% - 70%, 60% - 70%, 60% - 90%, or 70% - 90% in combination of phosphatidylcholine (PC) and phosphatidylinositol (PI). In certain embodiments, the total phospholipid content of MBV is at least 55% in combination of phosphatidylcholine (PC) and phosphatidylinositol (PI). In certain embodiments, the total phospholipid content of MBV is at least 60% in combination of phosphatidylcholine (PC) and phosphatidylinositol (PI). In some embodiments, the phospholipid content of MBV includes a ratio of phosphatidylcholine (PC) to phosphatidylinositol (PI) of less than 8:1 (e.g., less than 7:1, less than 6:1, less than 5:1, less than 4:1, less than 3:1, or less than 2:1). In some embodiments, the phospholipid content of MBV includes a ratio of phosphatidylcholine (PC) to phosphatidylinositol (PI) in the range of 0.5 - 1:1, or 1:0.5 - 1, or 0.5 - 1:2, or 2:0.5 - 1, or 0.8 - 1:1, or 1:0.8 - 1. In one embodiment, the phospholipid content of MBV includes a ratio of phosphatidylcholine (PC) to phosphatidylinositol (PI) of about 1:1. In certain embodiments, the phospholipid content of MBV includes a ratio of phosphatidylcholine (PC) to phosphatidylinositol (PI) of about 0.9:1.

[0095] In some embodiments, the total phospholipid content of the MBV is 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4% or less, or about 5% - 10%, 5% - 15%, 10% - 15%, or 8% - 12% sphingomyelin (SM). In certain embodiments, the total phospholipid content of the MBV is 10% or less sphingomyelin (SM). In some embodiments, the total phospholipid content is 15% or less sphingomyelin (SM), 14% or less sphingomyelin, 13% or less sphingomyelin, 12% or less sphingomyelin, 11% or less sphingomyelin, 10% or less sphingomyelin, 9% or less sphingomyelin, 8% or less sphingomyelin, 7% or less sphingomyelin, 6% or less sphingomyelin, 5% or less sphingomyelin, or 4% or less sphingomyelin.

[0096] In some embodiments, the total phospholipid content of the MBV is 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11% or 10% or less, or about 10% - 20%, 15% - 20%, 14% - 18%, or 12% - 16% phosphatidylethanolamine (PE). In certain embodiments, the total phospholipid content of the MBV is 20% or less phosphatidylethanolamine (PE).

[0097] In some embodiments, the total phospholipid content of the MBV is 5%, 10%, 12%, 15%, 18%, 20%, 25%, or 30% or more, or about 5% - 30%, 10% - 20%, 10 - 25%, 15% - 25%, or 12% - 18% phosphatidylinositol (PI). In certain embodiments, the MBV comprises a phospholipid content of 15% or more phosphatidylinositol (PI).

[0098] In certain embodiments, the total phospholipid content of the MBV consists of 15% or more phosphatidylinositol, 20% or less phosphatidylethanolamine, and 10% or less sphingomyelin. In certain embodiments, the total phospholipid content of the MBV is such that 15% or more is phosphatidylinositol and 20% or less is phosphatidylethanolamine. In certain embodiments, the total phospholipid content of the MBV is such that 15% or more is phosphatidylinositol and 10% or less is sphingomyelin. In certain embodiments, the total phospholipid content of the MBV consists of 20% or less phosphatidylethanolamine and 10% or less sphingomyelin. In certain embodiments, the total phospholipid content of the MBV is such that more than 15% is phosphatidylinositol, 20% or less is phosphatidylethanolamine, 10% or less is sphingomyelin, and together at least 55% is phosphatidylinositol and phosphatidylcholine. In one embodiment, the total phospholipid content of the MBV is such that together at least 55% is phosphatidylcholine (PC) and phosphatidylinositol (PI), and 10% or less is sphingomyelin (SM). In certain embodiments, the total phospholipid content of the MBV is such that together at least 55% is phosphatidylinositol and phosphatidylcholine, and more than 15% is phosphatidylinositol. In certain embodiments, the total phospholipid content of the MBV is such that together 55% is phosphatidylinositol and phosphatidylcholine, and 20% or less is phosphatidylethanolamine.

[0099] MBV may also include lysyl oxidase (Lox). Generally, nanovesicles derived from the ECM have a higher Lox content than exosomes. Lox is expressed on the surface of MBV. The Lox protein can be detected using nano LC MS / MS proteomics analysis. Quantification of Lox can be performed (see, for example, Hill RC, et al., Mol Cell Proteomics. 2015;14(4):961-73, which is hereby incorporated by reference in its entirety).

[0100] In certain embodiments, MBV includes one or more miRNAs. In certain non-limiting examples, MBV includes one, two, or all three of miR-143, miR-145, and miR-181. miR-143, miR-145, and miR-181 are known in the art.

[0101] The miR-145 nucleic acid sequence is provided by miRbase accession number MI0000461, which is incorporated herein by reference. The miR-145 nucleic acid sequence is CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU (SEQ ID NO: 1). The miR-181 nucleic acid sequence is provided by miRbase accession number MI0000269, which is incorporated herein by reference. The miR-181 nucleic acid sequence is AGAAGGGCUAUCAGGCCAGCCUUCAGAGGACUCCAAGGAACAUUCAACGCUGUCGGUGAGUUUGGGAUUUGAAAAAACCACUGACCGUUGACUGUACCUUGGGGUCCUUA (SEQ ID NO: 2). The miR-143 nucleic acid sequence is provided by NCBI accession number NR_029684.1, as of March 30, 2018, which is incorporated herein by reference. The DNA encoding the miR-143 nucleic acid sequence is GCGCAGCGCC CTGTCTCCCA GCCTGAGGTG CAGTGCTGCA TCTCTGGTCA GTTGGGAGTC TGAGATGAAG CACTGTAGCT CAGGAAGAGA GAAGTTGTTC TGCAGC (SEQ ID NO: 3).

[0102] After administration, MBV maintains the expression of F4 / 80 (a macrophage marker) and CD-11b in macrophages in the subject. Macrophages treated with nanovesicles are mainly F4 / 80+Fizz1+, indicating an M2 phenotype.

[0103] The MBV disclosed herein can be formulated into a composition for pharmaceutical delivery and used in biomatrices and devices. MBV is disclosed in PCT Publication No. WO2017 / 151862, which is incorporated herein by reference.

[0104] Isolation of MBV from ECM To produce the MBV, ECM can be produced in any desired cells or ECM from a commercial source can be utilized. See above. The MBV can be produced from the same species as the subject to be treated or from a different species. In some embodiments, these methods include the step of digesting the ECM with an enzyme to produce digested ECM. In certain embodiments, the ECM is digested with one or more of pepsin, elastase, hyaluronidase, collagenase, metalloproteinase, and / or proteinase K. In certain non-limiting examples, the ECM is digested with only elastase and / or metalloproteinase. In another non-limiting example, the ECM is not digested with collagenase and / or trypsin and / or proteinase K. In other embodiments, the ECM is treated with a surfactant. In further embodiments, the method does not include the use of an enzyme. In certain non-limiting examples, the method utilizes a chaotropic agent or ionic strength such as a salt such as potassium chloride to isolate the MBV. In additional embodiments, the ECM can be manipulated to increase the MBV content prior to isolation of the MBV. Methods for isolation of the MBV are disclosed, for example, in Quijano et al., Tissue Engineering, part C, doi.org / 10.1089 / ten.TEC.2020.0243, October 3, 2020, which is incorporated herein by reference.

[0105] In some embodiments, the ECM is digested with an enzyme. The ECM can be digested with an enzyme for about 12 to about 48 hours, such as about 12 to about 36 hours, etc. The ECM can be digested with an enzyme for about 12, about 24, about 36, or about 48 hours. In one particular non-limiting example, the ECM is digested with an enzyme at room temperature. However, the digestion can be performed at about 4°C, or at any temperature between about 4°C and 25°C. Generally, the ECM is digested with an enzyme at any temperature for any length of time sufficient to remove the collagen fibrils. The digestion process can vary depending on the tissue source. Optionally, the ECM is processed by freezing and thawing either before or after enzymatic digestion. The ECM can be treated with a surfactant including an ionic and / or non-ionic surfactant.

[0106] The digested ECM is then processed, for example by centrifugation, to isolate a supernatant free of fibrils. In some embodiments, the digested ECM is centrifuged at about 300 to about 1000 g as a first step. Thus, the digested ECM can be centrifuged at about 400 g to about 750 g, such as at about 400 g, about 450 g, about 500 g, or about 600 g. This centrifugation can be carried out for about 10 to about 15 minutes, such as for about 10 to about 12 minutes, such as for about 10, about 11, about 12, about 14, about 14, or about 15 minutes. The supernatant containing the digested ECM is collected.

[0107] The MBV contains Lox. In some embodiments, a method for isolating such MBV includes the steps of digesting an extracellular matrix with elastase and / or a metalloprotease to produce a digested extracellular matrix, centrifuging the digested extracellular matrix to remove collagen fibril remnants and thus produce a supernatant free of fibrils, centrifuging the supernatant free of fibrils to isolate a solid, and suspending the solid in a carrier.

[0108] In some embodiments, the digested ECM can be centrifuged at about 2000 g to about 3000 g as a second step. Thus, the digested ECM can be centrifuged at about 2,500 g to about 3,000 g, for example, at about 2,000 g, 2,500 g, 2,750 g, or 3,000 g. This centrifugation can be carried out over about 20 to about 30 minutes, for example, over about 20 to about 25 minutes, for example, over about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or about 30 minutes. The supernatant containing the digested ECM is collected.

[0109] In additional embodiments, the digested ECM can be centrifuged at about 10,000 to about 15,000 g as a third step. Thus, the digested ECM can be centrifuged at about 10,000 g to about 12,500 g, for example, at about 10,000 g, 11,000 g, or 12,000 g. This centrifugation can be carried out over about 25 to about 40 minutes, for example, over about 25 to about 30 minutes, for example, over about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or about 40 minutes. The supernatant containing the digested ECM is collected.

[0110] One, two, or all three of these centrifugation steps can be utilized independently. In some embodiments, all three centrifugation steps are utilized. The centrifugation step can be repeated, for example, 2, 3, 4, or 5 times. In one embodiment, all three centrifugation steps are repeated 3 times.

[0111] In some embodiments, the digested ECM is centrifuged at about 500 g for about 10 minutes, at about 2,500 g for about 20 minutes, and / or at about 10,000 g for about 30 minutes. These step(s), e.g., all three steps, can be repeated 2, 3, 4, or 5 times, e.g., 3 times. Thus, in a non-limiting example, the digested ECM is centrifuged at about 500 g for about 10 minutes, at about 2,500 g for about 20 minutes, and at about 10,000 g for about 30 minutes. These three steps are repeated 3 times. In this way, a supernatant free of fibrils is produced.

[0112] The supernatant free of fibrils is then centrifuged to isolate the MBV. In some embodiments, the supernatant free of fibrils is centrifuged at about 100,000 g to about 150,000 g. Thus, the supernatant free of fibrils is centrifuged at about 100,000 g to about 125,000 g, e.g., at about 100,000 g, about 105,000 g, about 110,000 g, about 115,000 g, or about 120,000 g. This centrifugation can be carried out over about 60 to about 90 minutes, e.g., about 70 to about 80 minutes, e.g., over about 60, about 65, about 70, about 75, about 80, about 85, or about 90 minutes. In a non-limiting example, the supernatant free of fibrils is centrifuged at about 100,000 g for about 70 minutes. The solids that are the MBV are collected. These MBV can then be resuspended in any suitable carrier for any purpose, such as, but not limited to, a buffer.

[0113] In further embodiments, the ECM is not digested with enzymes. In these methods, the ECM is suspended in an isotonic saline solution such as phosphate buffered saline. Then, salt is added to the suspension such that the final concentration of the salt is higher than about 0.1 M. The concentration can be, for example, up to about 3 M, for example, from about 0.1 M of salt to about 3 M, or from about 0.1 M to about 2 M. The salt can be, for example, about 0.1 M, 0.15 M, 0.2 M, 0.3 M, 0.4 M, 0.7 M, 0.6 M, 0.7 M, 0.8 M, 0.9 M, 1.0 M, 1.1 M, 1.2 M, 1.3 M, 1.4 M, 1.5 M, 1.6 M, 1.7 M, 1.8 M, 1.9 M, or 2 M. In some non-limiting examples, the salt is potassium chloride, sodium chloride, or magnesium chloride. In other embodiments, the salt is sodium chloride, magnesium chloride, sodium iodide, sodium thiocyanate, a sodium salt, a lithium salt, a cesium salt, or a calcium salt.

[0114] In some embodiments, the ECM is suspended in the salt solution for about 10 minutes to about 2 hours, for example, about 15 minutes to about 1 hour, about 30 minutes to about 1 hour, or about 45 minutes to about 1 hour. The ECM can be suspended in the salt solution for about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, or 120 minutes. The ECM can be suspended in the salt solution at a temperature from 4°C to about 50°C, for example, but not limited to, from about 4°C to about 25°C or from about 4°C to about 37°C. In certain non-limiting examples, the ECM is suspended in the salt solution at about 4°C. In other specific non-limiting examples, the ECM is suspended in the salt solution at about 22°C or about 25°C (room temperature). In another non-limiting example, the ECM is suspended in the salt solution at about 37°C.

[0115] In some embodiments, the method includes incubating the extracellular matrix at a salt concentration higher than about 0.4 M, centrifuging the digested extracellular matrix to remove collagen fibril remnants, isolating the supernatant, centrifuging the supernatant to isolate solids, and suspending the solids in a carrier, thereby isolating MBV from the extracellular matrix.

[0116] After incubation in a salt solution, the ECM is centrifuged to remove collagen fibrils. In some embodiments, the digested ECM can be centrifuged at about 2000 g to about 5000 g. Thus, the digested ECM can be centrifuged at about 2,500 g to about 4,500 g, for example, at about 2,500 g, about 3,000 g, 3,500, about 4,000 g, or about 4,500 g. In one specific non-limiting example, the centrifugation is performed at about 3,500 g. This centrifugation can be carried out over about 20 to about 40 minutes, for example, over about 25 to about 35 minutes, for example, over about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30 minutes, about 31, about 32, about 33, about 34 or about 35 minutes. The supernatant is then collected.

[0117] In additional embodiments, the supernatant can then be centrifuged as a third step at about 100,000 to about 150,000 g. Thus, the digested ECM can be centrifuged at about 100,000 g to about 125,000 g, for example, at about 100,000 g, 110,000 g or 120,000 g. This centrifugation can be carried out over about 30 minutes to about 2.5 hours, for example, over about 1 hour to about 3 hours, for example, over about 30 minutes, about 45 minutes, about 60 minutes, about 90 minutes, or about 120 minutes (2 hours). The solids are collected and suspended in a solution such as buffered saline, thereby isolating MBV.

[0118] In yet other embodiments, the ECM is suspended in an isotonic buffered salts solution such as, but not limited to, phosphate buffered saline. Large particles can be removed using centrifugation or other methods (see below). Next, ultrafiltration is utilized to isolate the MBV from the ECM, and the particles are between about 10 nm and about 10,000 nm, for example, between about 10 and about 1,000 nm, for example, between about 10 nm and about 300 nm.

[0119] In certain non-limiting examples, the isotonic buffered saline solution has a total salt concentration of about 0.164 mM and a pH of about 7.2 to about 7.4. In some embodiments, the isotonic buffered saline solution contains from 0.002 M KCl to about 0.164 M KCL, for example, about 0.0027 M KCl (the concentration of KCL in phosphate buffered saline). This suspension is then processed by ultracentrifugation.

[0120] After incubation in the isotonic buffered salts solution, the ECM is centrifuged to remove the collagen fibrils. In some embodiments, the digested ECM can also be centrifuged at about 2000 g to about 5000 g. Thus, the digested ECM can be centrifuged at about 2,500 g to about 4,500 g, for example, at about 2,500 g, about 3,000 g, 3,500, about 4,000 g, or about 4,500 g. In one particular non-limiting example, the centrifugation is performed at about 3,500 g. This centrifugation can be carried out over about 20 to about 40 minutes, for example, over about 25 to about 35 minutes, for example, over about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30 minutes, about 31, about 32, about 33, about 34 or about 35 minutes.

[0121] Precision filtration and centrifugation can be used and combined to remove high molecular weight materials from a suspension. In one embodiment, precision filtration is used to remove large molecular materials such as those exceeding 200 nm. In another embodiment, large-sized materials are removed by using centrifugation. In a third embodiment, both precision filtration and ultracentrifugation are used to remove high molecular weight materials. High molecular weight materials such as materials larger than about 10,000 nm, larger than about 1,000 nm, larger than about 500 nm, or larger than about 300 nm are removed from the suspended ECM.

[0122] The effluent of the precision filtration, or the supernatant, is then subjected to ultrafiltration. Thus, an effluent containing particles less than about 10,000 nm, less than about 1,000 nm, less than about 500 nm, or less than about 300 nm is collected and utilized. This effluent is then subjected to ultrafiltration using a membrane with a molecular weight cut-off (MWCO) of 3,000 - 100,000. A 100,000 MWCO was used in the examples.

[0123] Methods for treating autoimmune disorders Methods for treating autoimmune disorders (such as, inter alia, rheumatoid arthritis, scleroderma, ulcerative colitis, pemphigus, pemphigoid, Crohn's disease, psoriasis, psoriatic arthritis, multiple sclerosis, and / or systemic lupus erythematosus, etc.) in a subject in need thereof are also disclosed herein. These methods include the step of selecting a subject in need of treatment (e.g., with respect to a subject having an autoimmune disorder such as rheumatoid arthritis, scleroderma, ulcerative colitis, pemphigus, pemphigoid, Crohn's disease, psoriasis, psoriatic arthritis, multiple sclerosis, and / or systemic lupus erythematosus, etc.), and the step of administering to the subject a therapeutically effective amount of MBV (e.g., by administering a pharmaceutical preparation comprising a therapeutically effective amount of MBV) to reduce the autoimmune response, whereby the autoimmune response disorder is treated. In some examples, MBV can be administered systemically. In certain examples, MBV is administered by IV administration. In other examples, the autoimmune disease is rheumatoid arthritis. In other embodiments, MBV is administered topically. In certain non-limiting examples, the autoimmune disease is psoriasis.

[0124] The subject can be a vertebrate subject or a human. In non-limiting examples, the subject is a human. The subject can be a mammal. The subject can be a bird or a household pet, such as a cat, dog or rabbit. The subject can be a non-human primate (e.g., an ape), or a domestic animal including pigs, ruminants, horses and poultry. The method includes the steps of selecting a subject in need of treatment to reduce an autoimmune response, and administering to the subject a therapeutically effective amount of MBV (e.g., by administering a pharmaceutical preparation comprising a therapeutically effective amount of MBV). In some embodiments, MBV can be administered systemically. In other embodiments, MBV can be administered locally. MBV can be derived from the same species as the subject in need of a reduction in autoimmune activity, or from a species different from such a subject. MBV can be autologous.

[0125] The methods disclosed herein can result in a reduction in autoimmune activity in a subject. In some examples, the signs or symptoms of an autoimmune disorder are reduced or eliminated. For example, the methods herein can result in complete or partial remission of an autoimmune disorder in a subject. In some examples, the methods herein can be used to reduce or eliminate a relapse or recurrence of an autoimmune disorder in a subject. In some examples, the methods herein can be used to reduce or eliminate the frequency or intensity of a relapse of an autoimmune disorder in a subject. In some embodiments, the methods herein can be used to prevent the progression of an autoimmune disorder in a subject.

[0126] Administration of MBV (or a pharmaceutical preparation comprising MBV) can reduce or eliminate signs or symptoms of an autoimmune disorder in a subject over a long period of time. In some embodiments, the subject experiences a therapeutic effect of a course of treatment with MBV over a long period of time. Preferably, MBV is administered systemically. For example, this long period can be a period that starts at the time when the course of treatment is initiated and ends 1, 2, 3, 4, 5, or 6 months later. For example, this long period can be a period that starts at the time when the course of treatment ends and ends 1, 2, 3, 4, 5, or 6 months later. The therapeutic effects experienced by the subject can be (i) a decrease in the severity of the symptoms of the autoimmune disorder over said period compared to the severity of the symptoms before the course of treatment, (ii) a remission of the autoimmune disorder or its symptoms over said period, (iii) prevention of relapse or recurrence of the autoimmune disease during said period, (iv) a decrease in the severity of the symptoms experienced during relapse or recurrence during said period compared to the severity of the symptoms experienced before the course of treatment, (v) a decrease in the frequency of relapse or recurrence during said period compared to the frequency of relapse or recurrence before the course of treatment, or (vi) the absence of signs of disease progression during said period after completion of the course of treatment. For any given autoimmune disorder, a decrease or improvement in the severity of symptoms or remission of the disorder can be measured according to the clinical signs associated with the particular disorder and according to relevant objective clinical criteria, such as a scoring system for a particular disease or disorder. For example, a patient can experience a decrease in the clinical score of a disease or disorder that suggests improvement of the disorder compared to the score before the course of treatment as a result of a course of treatment with MBV during said period. A patient can experience a decrease in the autoimmune disorder score during said period compared to the score before treatment, and the score remains lower than the score before treatment during said period.

[0127] The subject can be administered one or more administrations of MBV that make up a treatment course. The treatment course is preferably administered systemically. The treatment course can be once a week for 4 weeks, once a week for 3 weeks, once a week for 2 weeks, once a week for 1 week (i.e., a single administration), twice a week for 4 weeks, twice a week for 3 weeks, twice a week for 2 weeks, twice a week for 1 week, three times a week for 4 weeks, three times a week for 3 weeks, three times a week for 2 weeks, three times a week for 1 week, four times a week for 1 week, four times a week for 2 weeks, four times a week for 3 weeks, or four times a week for 4 weeks of administration.

[0128] In one embodiment, the subject receives an initial treatment course of once a week for 4 weeks, once a week for 3 weeks, once a week for 2 weeks, once a week for 1 week (i.e., a single administration), twice a week for 4 weeks, twice a week for 3 weeks, twice a week for 2 weeks, twice a week for 1 week, three times a week for 4 weeks, three times a week for 3 weeks, three times a week for 2 weeks, three times a week for 1 week, four times a week for 1 week, four times a week for 2 weeks, four times a week for 3 weeks, or four times a week for 4 weeks, and then a maintenance course 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, or 12 months after completion of the initial treatment course. In one embodiment, the patient receives a maintenance course 6 months after the treatment course. The maintenance course may be the same as or different from the treatment course. The maintenance course can be once a week for 4 weeks, once a week for 3 weeks, once a week for 2 weeks, once a week for 1 week (i.e., a single administration), twice a week for 4 weeks, twice a week for 3 weeks, twice a week for 2 weeks, twice a week for 1 week, three times a week for 4 weeks, three times a week for 3 weeks, three times a week for 2 weeks, three times a week for 1 week, four times a week for 1 week, four times a week for 2 weeks, four times a week for 3 weeks, or four times a week for 4 weeks of administration. The maintenance course can be administered every 3 months, every 6 months, every 9 months, or annually. In one embodiment, the maintenance course is administered every 6 months.

[0129] According to some embodiments, for each kg of body weight per administration, 1×10 6 ~1×10 12 of MBV are administered to the subject. In another embodiment, for each kg of body weight per administration, 1×10 7 ~1×1011 units are administered. In another embodiment, for each kg of body weight of the subject per administration, MBV is 1×10 7 ~1×10 8 units are administered. In another embodiment, for each kg of body weight of the subject per administration, MBV is 1×10 8 ~1×10 10 units are administered. In another embodiment, for each kg of body weight of the subject per administration, MBV is 1×10 9 ~1×10 10 units are administered. In another embodiment, for each kg of body weight of the subject per administration, MBV is 1×10 6 ~1×10 8 units are administered. In another embodiment, for each kg of body weight of the subject per administration, MBV is 1×10 7 ~1×10 9 units are administered. In another embodiment, for each kg of body weight of the subject per administration, MBV is 1×10 8 ~1×10 11 units are administered. In another embodiment, for each kg of body weight of the subject per administration, MBV is 1×10 9 ~1×10 11 units are administered. In another embodiment, for each kg of body weight of the subject per administration, MBV is 1×10 6 ~1×10 14 units are administered. In another embodiment, for each kg of body weight of the subject per administration, MBV is 1×10 12 ~1×10 14 units are administered. In one embodiment, the administration of MBV in any of the above amounts is by systemic administration.

[0130] According to one embodiment, when a subject experiences a relapse of symptoms associated with an autoimmune disorder, a treatment course of MBV is administered to the subject. According to one embodiment, when a subject experiences progression of an autoimmune disease or disorder after remission, a treatment course is administered to the subject. According to one embodiment, a treatment course of MBV is administered to a subject to prevent relapse or recurrence of an autoimmune disease or disorder. For example, to prevent relapse or recurrence, a treatment course is administered to the subject every 3 months, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 11 months, or once a year.

[0131] Various autoimmune disorders (e.g., chronic autoimmune disorders, etc.) are included. In some embodiments, the autoimmune disorder affects, or predominantly affects, the skin, respiratory system, genital system, cardiovascular system or nervous system. In some embodiments, the subject may have Addison's disease, alopecia areata, ankylosing spondylitis, antiphospholipid antibody syndrome, autoimmune hepatitis, celiac disease, Crohn's disease, Goodpasture's syndrome, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, immune thrombocytopenia, IgA nephropathy, inflammatory bowel disease (IBD), multiple sclerosis, myasthenia gravis, pemphigoid, pemphigus, type 2 polyglandular autoimmune syndrome, psoriasis, psoriatic arthritis, rheumatoid arthritis, scleroderma, Sjögren's syndrome, systemic lupus erythematosus, Takayasu's arteritis, type 1 diabetes, ulcerative colitis, or undifferentiated connective tissue disease (UCTD).

[0132] In some examples, the autoimmune disorder is an autoimmune disorder other than in the eye. In some embodiments, the autoimmune disorder affects, or predominantly affects, the skin, respiratory system, genital system, cardiovascular system, or nervous system. In some embodiments, the subject may have Addison's disease, alopecia areata, ankylosing spondylitis, antiphospholipid antibody syndrome, autoimmune hepatitis, celiac disease, Crohn's disease, Goodpasture's syndrome, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, immune thrombocytopenia, IgA nephropathy, multiple sclerosis, myasthenia gravis, pemphigoid, pemphigus, type 2 polyglandular autoimmune syndrome, psoriasis, psoriatic arthritis, Sjögren's syndrome, systemic lupus erythematosus, Takayasu arteritis, type 1 diabetes, or undifferentiated connective tissue disease (UCTD). In some examples, the autoimmune disorder is not rheumatoid arthritis, scleroderma, or ulcerative colitis.

[0133] In some embodiments, the subject has rheumatoid arthritis (RA). In some examples, the method includes the step of administering a therapeutically effective amount of MBV to a subject having RA (e.g., by administering a pharmaceutical preparation comprising a therapeutically effective amount of MBV), whereby the RA is treated. Preferably, MBV is administered systemically, e.g., by intravenous administration. MBV can also be administered systemically, e.g., by intraperitoneal, intramuscular, oral, enteral, parenteral, intranasal, rectal, sublingual, buccal, subcutaneous or sublabial administration. The method can include the step of selecting a subject having RA. Various techniques can be used to identify the subject's RA. For example, RA can be identified by imaging (e.g., synovial fluid from joints, bone erosion, bone loss near joints, soft tissue swelling, and abnormally small joint cavities, subluxations, using, e.g., X-rays, MRI or ultrasound), blood tests (e.g., rheumatoid factor (RF), anti-citrullinated protein antibody (ACPA, such as measured by anti-CCP antibody using ELISA, etc.), erythrocyte sedimentation rate (ESR), C-reactive protein, complete blood count, renal function, liver enzyme levels, or antinuclear antibody / ANA), and the 2010 ACR / EULAR Rheumatoid Arthritis Classification Criteria (which is incorporated herein by reference in its entirety, Aletaha et al., 2010 rheumatoid arthritis classification criteria: an American College of Rheumatology / European League Against Rheumatism collaborative initiative, Annals of the Rheumatic Diseases, 69 (9): 1580-8 (2010)). In some embodiments, MBV is administered systemically to treat RA. In certain examples, MBV is administered by IV administration. In other examples, MBV is administered by oral administration. In other embodiments, MBV is administered by intramuscular, subcutaneous or intraperitoneal administration. In some embodiments, the method can reduce the severity or frequency of RA flares.For example, in some embodiments, the subject experiences a treatment effect that persists over a long period from the treatment course of MBV in the treatment of RA. Preferably, MBV is administered systemically. For example, this long period can be a period of 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months from the start of the treatment course. For example, this long period can be a period of 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months from the end of the treatment course. The treatment effect experienced by the subject can be (i) a decrease in the severity of RA symptoms over said period compared to the severity of symptoms before the treatment course, (ii) remission of RA or its symptoms over said period, (iii) prevention of RA flare or recurrence during said period, (iv) a decrease in the severity of symptoms experienced during RA flare or recurrence during said period compared to the severity of symptoms experienced before the treatment course, (v) a decrease in the frequency of RA flare or recurrence during said period compared to the frequency of recurrence or flare before the treatment course, or (vi) the absence of signs of RA disease progression during said period after completion of the treatment course. For RA, a decrease or improvement in the severity of symptoms or remission of the disorder can be measured according to relevant clinical signs and according to relevant objective clinical criteria, such as a scoring system such as DAS28 for RA. For example, in one embodiment, the subject experiences a decrease in arthritis score over a period of 1 month, 2 months, or 3 months from the start of the treatment course compared to the subject's arthritis score before the treatment course, and this score decrease is maintained even after the treatment course ends. In some embodiments, administration of MBV results in remission of RA within 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months from the start of the treatment course, and the remission is maintained even after the treatment course ends. In some embodiments, administration of MBV results in a decrease in the subject's DAS28 score to less than 5.1 during the period from the start of the treatment course to the end 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months later. In some embodiments, administration of the MBV treatment course results in a decrease (low disease activity) in the subject's DAS28 score to less than 3.2 during the period from the start of the treatment course to the end 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months later.In some embodiments, administration of MBV results in a decrease in the subject's DAS28 score to less than 2.6 during the period from the start of the treatment course to the end 1, 2, 3, 4, 5, or 6 months later, i.e., remission is obtained by this administration. In one embodiment, the subject experiences a decrease in the DAS28 score during the period measured from the start of the treatment course to the end 1, 2, 3, 4, 5, or 6 months later. In some embodiments, the decrease in the DAS28 score is maintained even after the end of a treatment course of 1, 2, 3, 4, 5, 6 months or longer. In one embodiment, the decrease in the DAS28 score is achieved by systemic administration of MBV. In one embodiment, the therapeutic effect of the treatment of RA extends beyond the duration of the treatment course, for example, 1, 2, 3, 4, 5, 6 months or longer.

[0134] In some embodiments, the subject has scleroderma. In some examples, the method includes the step of administering a therapeutically effective amount of MBV (e.g., by administering a pharmaceutical preparation comprising a therapeutically effective amount of MBV), whereby the scleroderma is treated. Preferably, MBV is administered systemically, for example, by intravenous administration. Various types of scleroderma, such as localized scleroderma, for example, localized morphea, morphea - lichen sclerosus et atrophicus overlap (LSA), generalized morphea, Pasini - Pierini cutaneous atrophy, pansclerotic morphea, deep morphea, linear morphea, and systemic scleroderma, such as CREST syndrome and progressive systemic sclerosis, etc., can be treated using the disclosed method. In some embodiments, MBV is administered systemically for treating scleroderma. In certain examples, MBV is administered by IV or oral administration. MBV can also be administered by intraperitoneal, subcutaneous, or intramuscular administration. The method can reduce the severity or frequency of scleroderma relapse. The method can also bring about remission of scleroderma.

[0135] The method may include the step of selecting a subject having scleroderma. Various techniques can be used to identify a subject having scleroderma. For example, tests for scleroderma can include clinical diagnosis (such as those identifying areas of thickened skin, stiffness, fatigue, and poor blood flow to fingers or toes upon cold exposure, etc.), blood tests (such as those for elevated levels of immunological factors, also known as antinuclear antibodies, etc.), pulmonary function tests (such as those using X-rays or computed tomography (CT scans) to measure pulmonary function, e.g., for identifying lung damage, etc.), electrocardiograms (such as those for identifying congestive heart failure or cardiac electrical activity disorders, etc.), echocardiograms (such as those for identifying pulmonary hypertension or congestive heart failure, etc.), gastrointestinal tests (such as endoscopy or manometry, etc.), or kidney tests (such as those using blood tests to identify high levels of protein, etc.). In some embodiments, MBV is administered systemically to treat scleroderma. In certain examples, MBV is administered by intravenous (IV) administration. In other examples, MBV is administered orally. In other embodiments, MBV is administered locally, e.g., to the skin. The method of administration can reduce the frequency and severity of scleroderma relapse. The method can also bring about remission of scleroderma. For example, the severity of scleroderma can be measured using the original or modified Rodnan score. The Rodnan score is determined by assigning a score of 0 - 3 to the severity of skin thickening in 17 anatomical surface areas of the body and summing all the surface scores. A surface score of 3 represents significantly thickened skin that cannot be pinched and folded. A surface score of 0 is healthy for adults, although children may have a healthy score of 0 or 1. In one embodiment, the subject experiences a decrease in the surface score to 0 or 1 as a result of MBV administration and experiences remission. In another embodiment, the subject experiences a decrease in the surface score to 2 or less as a result of MBV administration (3 indicates severe disease). In one embodiment, the subject experiences a decrease in the Rodnan score from the time of MBV administration and maintains the decreased state over 1, 2, or 3 months from administration.In one embodiment, this decrease is achieved by systemic administration of MBV. In one embodiment, the therapeutic effect of the treatment of scleroderma extends beyond the duration of the treatment course, for example, for 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or longer.

[0136] In some embodiments, the subject has ulcerative colitis. In some examples, the method includes the step of administering a therapeutically effective amount of MBV (e.g., by administering a pharmaceutical preparation comprising a therapeutically effective amount of MBV), whereby the ulcerative colitis is treated. Preferably, MBV is administered systemically, e.g., by intravenous administration. The method may include the step of selecting a subject having ulcerative colitis. Various techniques can be used to identify a subject having ulcerative colitis. For example, tests for ulcerative colitis can include a complete blood count (e.g., for identifying anemia or thrombocytosis), electrolyte or renal function tests (e.g., for identifying hypokalemia, hypomagnesemia or prerenal renal failure), liver function tests (e.g., for identifying primary sclerosing cholangitis), x-rays, urine tests, stool cultures (e.g., for identifying parasites or infectious pathogens), erythrocyte sedimentation rate or C-reactive protein measurements (e.g., for identifying inflammation), or sigmoidoscopy (e.g., for identifying ulcers in the large intestine). In some examples, the clinical colitis activity index can be used to assess the severity of ulcerative colitis. In some embodiments, MBV is administered systemically to treat ulcerative colitis. In certain examples, MBV is administered by IV administration. In other examples, MBV is administered orally. In some examples, MBV is administered by intraperitoneal, subcutaneous or intramuscular administration. MBV can be administered locally, e.g., to the gastrointestinal tract. The method can reduce the severity or frequency of relapse of ulcerative colitis. The method can also result in clinical and endoscopic remission of the ulcerative colitis disease. For example, in some embodiments, administration of MBV results in a decrease in the Mayo score for ulcerative colitis or the ulcerative colitis disease activity index (UCDAI) compared to the score prior to treatment. In one embodiment, the patient experiences a decrease to a Mayo score of 2 or less and experiences remission. In another embodiment, the patient experiences a decrease to a Mayo score of 5 or less. In another embodiment, the patient experiences a decrease to a Mayo score of less than 10.In one embodiment, the subject experiences a decrease in the Mayo score or UCDAI score measured from the start of the MBV treatment course and then maintains the decreased state over 1 month, 2 months, or 3 months. In one embodiment, this decrease is achieved by systemic administration of MBV. In one embodiment, the therapeutic effect of the treatment of ulcerative colitis extends beyond the duration of the treatment course, for example, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or longer.

[0137] In some embodiments, the subject has Crohn's disease. In some examples, the method includes the step of administering a therapeutically effective amount of MBV (e.g., by administering a pharmaceutical preparation comprising a therapeutically effective amount of MBV), whereby the Crohn's disease is treated. Preferably, MBV is administered systemically, e.g., by intravenous administration. In some examples, MBV is administered by intraperitoneal, subcutaneous, or intramuscular administration. Using the disclosed method, various types of Crohn's disease can be treated, including ileocolonic Crohn's disease, colonic Crohn's disease, gastroduodenal Crohn's disease, and jejunoileitis. Crohn's disease caused by an agent, e.g., Crohn's disease caused by immune system dysfunction (e.g., autoimmune or innate immune disorders), genetic factors, changes in intestinal bacteria, and environmental factors, can be treated. The method may include the step of selecting a subject having Crohn's disease. Various techniques can be used to identify a subject having Crohn's disease. For example, tests for Crohn's disease can include endoscopy (e.g., colonoscopy, etc.), imaging (e.g., those using barium contrast X-ray, CT scan, and MRI scan), and blood tests (e.g., those for identifying iron, vitamin D or vitamin B12 deficiency, erythrocyte sedimentation rate (ESR), and C-reactive protein level, etc.). In some embodiments, MBV is administered systemically to treat Crohn's disease. In certain examples, MBV is administered by IV administration. In other examples, MBV is administered by oral administration. MBV can be administered locally, e.g., to the gastrointestinal tract. The method can reduce the severity or frequency of Crohn's disease relapse. The method can also bring about clinical and endoscopic remission of Crohn's disease. For example, in some embodiments, administration of MBV results in a decrease in the Crohn's Disease Activity Index (CDAI) compared to the score before treatment. In one embodiment, the patient experiences a decrease in the CDAI score to less than 150 and experiences remission. In another embodiment, the patient experiences a decrease in the CDAI score to less than 450 (a score of 450 or greater suggests severe disease). In another embodiment, the patient experiences a drop of at least 70 CDAI points (suggesting a treatment response) as a result of MBV treatment.For example, in another embodiment, the patient experiences a decrease of at least 70 CDAI points from the time of MBV administration (suggesting a treatment response) as a result of the MBV treatment and maintains the decreased state for 1 month, 2 months, 3 months or longer from the administration. In one embodiment, the subject experiences a decrease in the CDAI score from the time of MBV administration and maintains the decreased state for 1 month, 2 months or 3 months from the administration. In one embodiment, this decrease is achieved by systemic administration of MBV. In one embodiment, the therapeutic effect of the treatment of Crohn's disease extends beyond the duration of the treatment course, for example, for 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or longer.

[0138] In some embodiments, the subject has pemphigus. In some examples, the method includes the step of administering a therapeutically effective amount of MBV (e.g., by administering a pharmaceutical preparation comprising a therapeutically effective amount of MBV), whereby the pemphigus is treated. Preferably, MBV is administered systemically, for example, by intravenous administration. In some examples, MBV is administered by intraperitoneal, subcutaneous, or intramuscular administration. In some examples, MBV is administered topically by topical skin administration. Various types of pemphigus, such as pemphigus vulgaris, pemphigus foliaceus, IgA pemphigus, or paraneoplastic pemphigus, etc., can be treated using the disclosed method. The method can include the step of selecting a subject having pemphigus. Various techniques can be used to identify a subject having pemphigus. For example, tests for pemphigus can include clinical diagnosis (e.g., by lesions in the eyes and oral mucosa), skin or mucosal biopsy (e.g., for identifying intraepidermal vesicles caused by acantholysis, etc.), and ELISA for blood samples or immunofluorescence tests for skin biopsies (e.g., for identifying anti-desmoglein autoantibodies, etc.). In some embodiments, MBV is administered systemically to treat pemphigus. In certain examples, MBV is administered by IV administration. In other examples, MBV is administered orally. In other embodiments, MBV is administered topically to the skin. The method can reduce the severity or frequency of pemphigus relapse. The method can also bring about remission of pemphigus. The reduction in symptom severity can be based on a decrease in the PDAI (pemphigus disease index) or a decrease in the autoimmune blistering skin disorder intensity score (ABSIS) from the time of MBV administration. Moderate disease is PDAI < 15 or ABSIS < 17, significant disease is PDAI between 15 - 44 or ABSIS between 17 - 53, and extensive disease is PDAI > 45 or ABSIS > 53. In one embodiment, the subject experiences a decrease to a PDAI score of less than 15 or an ABSIS score of less than 17 and experiences remission.In another embodiment, the subject experiences a decrease to a PDAI score of less than 45 or an ABSIS score of less than 53 (a PDAI score of 45 or greater or an ABSIS score of 53 or greater indicates severe disease). In one embodiment, the subject experiences a decrease in the PDAI score from the time of MBV administration and maintains the decreased state over 1 month, 2 months, or 3 months from administration. In one embodiment, this decrease is achieved by systemic administration of MBV. In one embodiment, the therapeutic effect of the treatment of pemphigus extends beyond the duration of the treatment course, for example, for 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, or longer.

[0139] In other embodiments, the subject has pemphigoid. In some examples, the method includes the step of administering a therapeutically effective amount of MBV (e.g., by administering a pharmaceutical preparation comprising a therapeutically effective amount of MBV), whereby the pemphigoid is treated. Preferably, MBV is administered systemically, e.g., by intravenous administration. In some examples, MBV is administered by intraperitoneal, subcutaneous, or intramuscular administration. In some examples, MBV is administered topically by topical cutaneous administration. Various types of pemphigoid, such as IgG-mediated pemphigoid, e.g., gestational, bullous, and cicatricial pemphigoid, and IgA-mediated pemphigoid, e.g., IgA-mediated immunobullous disease, etc., can be treated using the disclosed method. The method can include the step of selecting a subject having pemphigoid. Various techniques can be used to select a subject having pemphigoid. For example, tests for pemphigoid can include clinical diagnosis (e.g., tense blisters and erosions of the skin without another identifiable cause; desquamative gingivitis, or mucositis affecting the mucosa of the oral cavity, eyes, nose, genitalia, anus, pharynx, larynx, and / or esophagus; or for identifying sores, pruritic eczematous rashes, or urticarial-like situations of unknown origin, etc.), histopathological diagnosis (e.g., for identifying lesional tissue using, e.g., punch biopsy and hematoxylin and eosin (H&E) staining, etc.), direct immunofluorescence test (DIF; e.g., for identifying tissue-bound antibodies in a biopsy specimen, etc.), indirect immunofluorescence test (e.g., for identifying circulating antibodies targeting antigens in the basement membrane zone using, e.g., saliva samples, etc.), and antigen-specific serological tests (e.g., for identifying autoantibodies against NC16A, BP180, BP230, laminin 332, or type VII collagen using, e.g., ELISA, etc.). In some embodiments, MBV is administered systemically to treat pemphigoid. In certain examples, MBV is administered by IV administration. In other examples, MBV is administered orally. In other embodiments, MBV is administered topically to the skin. The method can reduce the severity and frequency of pemphigoid relapse. The method can also bring about remission of pemphigoid.Reduction in symptom severity can be based on a decrease in the PDAI (pemphigus disease activity index) or a decrease in the autoimmune blistering skin disorder intensity score (ABSIS) from the time of MBV administration. Moderate disease is defined as PDAI < 15 or ABSIS < 17, significant disease is defined as PDAI between 15 - 44 or ABSIS between 17 - 53, and extensive disease is defined as PDAI > 45 or ABSIS > 53. In one embodiment, the subject experiences a reduction to a PDAI score of less than 15 or an ABSIS score of less than 17 and experiences remission. In another embodiment, the subject experiences a reduction to a PDAI score of less than 45 or an ABSIS score of less than 53 (a PDAI score of 45 or greater or an ABSIS score of 53 or greater indicates severe disease). In one embodiment, the subject experiences a decrease in the PDAI or ABSIS score from the time of MBV administration and maintains the decreased state over 1, 2, or 3 months from administration. In one embodiment, this decrease is achieved by systemic administration of MBV. In one embodiment, the treatment effect of the treatment of pemphigoid disease extends beyond the duration of the treatment course, for example, for 1, 2, 3, 4, 5, 6 months or longer.

[0140] In further embodiments, the subject has psoriasis. In some examples, the method includes the step of administering a therapeutically effective amount of MBV (e.g., by administering a pharmaceutical preparation comprising a therapeutically effective amount of MBV), whereby the psoriasis is treated. In some embodiments, a method for treating psoriasis in a subject in need thereof, the method comprising administering to the subject a pharmaceutical preparation comprising a therapeutically effective amount of isolated MBV derived from the extracellular matrix, whereby the psoriasis in the subject is treated, is disclosed. The pharmaceutical preparation can be administered systemically. The pharmaceutical composition can be administered topically, such as to the skin of the subject. In some embodiments, the pharmaceutical composition is administered to one or more aspects of the skin of the subject. A variety of types of psoriasis are included, such as plaque psoriasis, guttate psoriasis, inverse psoriasis, pustular psoriasis, and erythrodermic psoriasis. The method can include the step of selecting a subject having psoriasis. A variety of techniques can be used to identify the subject's psoriasis. For example, the examination for psoriasis can include a clinical diagnosis (e.g., by identifying scaly erythematous aspects, papules or patches of the skin, which can be painful and itchy) or a skin biopsy or scraping (e.g., for identifying club-shaped epidermal projections that engage the dermis, epidermal hyperplasia, abnormal skin cells from the outermost layer of the skin, or inflammatory infiltrates). In some embodiments, MBV is administered systemically to treat psoriasis. In certain examples, MBV is administered by IV administration. In other examples, MBV is administered by oral administration. In other embodiments, MBV is administered topically to the skin or lesions. The method can reduce the frequency or severity of psoriasis relapse. The method can result in remission of psoriasis. The reduction in symptom severity, or remission, can be based on a decrease in the PASI score (Psoriasis Area and Severity Index), with scores between 0 and 4 assigned to multiple criteria and those criteria being summed. Mild psoriasis is a PASI score between 0 and 5, moderate psoriasis is a PASI score between 5 and 12, severe psoriasis is a PASI score between 12 and 20, and very severe psoriasis is a PASI score greater than 20.In one embodiment, the subject experiences PASI75, an improvement of 75% or more of the PASI score from baseline, which indicates a treatment response, as a result of a course of MBV treatment. In one embodiment, the subject experiences a decrease of the PASI score to about 0 and experiences remission as a result of a course of MBV treatment. In another embodiment, the subject experiences a decrease of the PASI score to less than 20 as a result of a course of MBV treatment (a score of 20 or greater indicates severe disease). In one embodiment, the subject experiences a decrease in the PASI score from the start of the course of MBV treatment and maintains the decreased state for 1 month, 2 months, or 3 months or longer after administration. In one embodiment, this decrease is achieved by systemic administration of MBV. In one embodiment, the therapeutic effect of the treatment of psoriasis extends beyond the duration of the treatment course, for example, for 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or longer.

[0141] In a further embodiment, the subject has psoriatic arthritis. In some examples, the method includes the step of administering a therapeutically effective amount of MBV (e.g., by administering a pharmaceutical preparation comprising a therapeutically effective amount of MBV), whereby the psoriatic arthritis is treated. Preferably, the administration of MBV is for each of the various types of psoriatic arthritis such as oligoarticular, polyarticular, erosive arthritis, destructive arthritis, spondyloarthritis and distal interphalangeal arthritis that can be treated using the disclosed method. The method can include the step of selecting a subject having psoriatic arthritis. Various techniques can be used to identify a subject having psoriatic arthritis. For example, tests for psoriatic arthritis can include clinical diagnosis (e.g., for identifying a family history of psoriasis or psoriatic arthritis, onycholysi, distal interphalangeal joints of the hands, enthesitis, or dactylitis, etc.), blood tests (e.g., for confirming a negative result for rheumatoid factor, etc.), and X-rays (e.g., for identifying degenerative joint changes, etc.). In some embodiments, MBV is administered systemically to treat psoriatic arthritis. In certain examples, MBV is administered by IV administration. In other examples, MBV is administered orally. In other embodiments, MBV is administered locally, e.g., into the joint. The method can reduce the frequency or severity of flares of psoriatic arthritis. The method can bring about remission of psoriatic arthritis. The response can be determined using a decrease in the Disease Activity Index for Psoriatic Arthritis (DAPSA) score. In one embodiment, the subject experiences a decrease in the DAPSA score to less than 4 and experiences remission as a result of the MBV treatment course. In some embodiments, the subject experiences a 50%, 75% or 85% decrease in the DAPSA score as a result of the MBV treatment course, which suggests a treatment response. In another embodiment, the subject experiences a decrease in the DAPSA score to less than 28 as a result of the MBV treatment course (a score of 28 or higher suggests high disease activity). In one embodiment, the subject experiences a decrease in the DAPSA score as a result of the administration of MBV and maintains the decreased state over 1 month, 2 months or 3 months from the start of the MBV treatment course. In one embodiment, this decrease is achieved by systemic administration of MBV.In one embodiment, the treatment effect of the treatment of psoriatic arthritis extends beyond the duration of the treatment course, for example, for 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or longer.

[0142] In some embodiments, the subject has multiple sclerosis. In some examples, the method includes the step of administering a therapeutically effective amount of MBV (e.g., by administering a pharmaceutical preparation comprising a therapeutically effective amount of MBV), whereby multiple sclerosis is treated. Preferably, MBV is delivered by systemic administration, such as intravenous administration. In some examples, MBV is administered by intraperitoneal, subcutaneous, or intramuscular administration. Various types of multiple sclerosis, such as relapsing-remitting, secondary progressive, primary progressive, and clinically isolated syndrome multiple sclerosis, can be treated using the disclosed method. The method can include the step of selecting a subject having multiple sclerosis. Various techniques can be used to identify a subject having multiple sclerosis. For example, tests for multiple sclerosis can include clinical diagnosis (e.g., physical, mental, and psychiatric symptoms, such as diplopia, unilateral blindness, muscle weakness, sensory or coordination disorders), imaging (e.g., for identifying areas of demyelination, such as by lesions or plaques), lumbar puncture (e.g., for identifying oligoclonal bands of IgG, such as in cerebrospinal fluid, e.g., by electrophoresis), visual and sensory evoked potentials, and biopsy. In some embodiments, MBV is systemically administered to treat multiple sclerosis. In certain examples, MBV is administered by IV administration. In other embodiments, MBV is administered by oral administration. The method can reduce the frequency or severity of relapse of multiple sclerosis. The method can bring about remission of multiple sclerosis. The method can also prevent disease progression. Response can be determined using a decrease in the Expanded Disability Status Scale (EDSS). In one embodiment, the patient experiences a decrease in the EDSS score to 1.5 or less, which suggests remission of physical disability, as a result of the MBV treatment course. In another embodiment, the subject's ability to walk 25 feet improves as a result of the MBV treatment course. In another embodiment, the patient experiences a decrease in the EDSS score to less than 8.5 (a score of 8.5 or greater suggests very severe physical disability).In one embodiment, the subject experiences a decrease in EDSS score as a result of MBV administration and maintains the decreased state over 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months from the start of the MBV treatment course. In one embodiment, this decrease is achieved by systemic administration of MBV. In one embodiment, the therapeutic effect of the treatment of MS extends beyond the duration of the treatment course, for example, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or longer.

[0143] In a further embodiment, the subject has systemic lupus erythematosus (SLE). In some examples, the method includes the step of administering a therapeutically effective amount of MBV (e.g., by administering a pharmaceutical preparation comprising a therapeutically effective amount of MBV), whereby the SLE is treated. Preferably, MBV is administered by systemic administration, e.g., by intravenous administration. In some examples, MBV is administered by intraperitoneal, subcutaneous, or intramuscular administration. Systemic lupus erythematosus caused by various reasons, such as SLE caused by genetic factors, drug reactions, or other lupus (e.g., discoid, cutaneous lupus), can be treated using the disclosed method. The method can include the step of selecting a subject having SLE. Various techniques can be used to select a subject having SLE. For example, tests for SLE can include serological tests (e.g., for antinuclear antibody (ANA), anti-extractable nuclear antigen (anti-ENA), anti-dsDNA, anti-U1 RNP (which also appears in systemic sclerosis and mixed connective tissue disease), SS-A (or anti-Ro), and SS-B (or anti-La), etc.), complement system levels, electrolyte levels and renal function, liver enzyme levels, complete blood count, and lupus (LE) cell tests. In some embodiments, MBV is administered systemically to treat SLE. In certain examples, MBV is administered by IV administration. In other embodiments, MBV is administered by oral administration. The method can reduce the severity or frequency of SLE flares. The method can result in remission of SLE. Disease severity can be measured by the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI) or the BILAG score. In one embodiment, the subject experiences a decrease in the SLEDAI score to 3 or less or a decrease in the BILAG score to D or E, indicative of remission, as a result of the MBV treatment course. In one embodiment, the subject experiences a decrease in the SLEDAI score of 4 or greater or a decrease in the BILAG score to C or less, indicative of a treatment response, as a result of the MBV treatment course.In another embodiment, the subject experiences a decrease to less than 7.5 in the SLEDAI or a decrease from A to B in the BILAG score as a result of the MBV treatment course (a SLEDAI score of 7.5 or greater or a BILAG score of A indicates severe disease). In one embodiment, the subject experiences a decrease in the SLEDAI or BILAG score as a result of MBV administration and maintains the decreased state over 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months from the start of the MBV treatment course. In one embodiment, this decrease is achieved by systemic administration of MBV. In one embodiment, the therapeutic effect of the treatment of MS extends beyond the duration of the treatment course, for example, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or longer.

[0144] The method may include a step of selecting a subject having autoimmune encephalitis. In some examples, the method includes a step of administering a therapeutically effective amount of MBV (e.g., by administering a pharmaceutical preparation comprising a therapeutically effective amount of MBV), whereby the autoimmune encephalitis is treated. Various techniques can be used to select a subject having autoimmune encephalitis. For example, the step of selecting a subject having encephalitis may include a brain scan for determining inflammation (e.g., using MRI, etc.); EEG (e.g., monitoring brain activity such that encephalitis would produce abnormal signals), lumbar puncture (spinal tap), blood tests, urine tests, and polymerase chain reaction (PCR) tests of cerebrospinal fluid for detecting the presence of viral DNA (e.g., for identifying viral encephalitis). In some embodiments, MBV is administered systemically to treat autoimmune encephalitis. In certain examples, MBV is administered by IV or oral administration. In some embodiments, MBV is administered by systemic administration, e.g., by intravenous administration. In some examples, MBV is administered by intraperitoneal, subcutaneous or intramuscular administration. In other embodiments, MBV is administered locally to the brain, e.g., by intracerebral injection. In some embodiments, the administration method can reduce the frequency or severity of relapse of autoimmune encephalitis, or can reduce the inflammation associated with autoimmune encephalitis, such that the patient no longer has autoimmune encephalitis or the autoimmune encephalitis is in remission. In one embodiment, the therapeutic effect of the treatment of autoimmune encephalitis extends beyond the duration of the treatment course, e.g., for 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or longer.

[0145] Administration can be systemic. Exemplary routes of systemic administration include, but are not limited to, intravenous administration, oral administration, enteral administration, parenteral administration, intranasal administration, rectal administration, sublingual administration, buccal administration, sublabial administration, intraperitoneal administration, transdermal, transmucosal, subcutaneous or intramuscular administration. In a particular, non-limiting example, systemic administration is intravenous administration.

[0146] Administration can be local. Exemplary routes of local administration include intra-articular injection, topical skin administration, intrathecal administration and intradermal administration, or by direct injection or application onto or into the tissue or organ of interest.

[0147] The dosing regimen can ultimately be a single-dose schedule or a multiple-dose schedule to deliver from 1×10 6 to 1×10 12 particles (i.e., the absolute number of vesicles) per kg body weight per administration. Administration can be provided as a single administration, as a periodic bolus, or as a continuous infusion, for example, a sustained release from a sustained release drug or drug delivery device for a specific period of time. A dosage appropriate to the amount appropriate for the subject can be administered. When multiple administrations are given, the administrations can be intermittent. In an exemplary embodiment, administration of a therapeutically effective amount of MBV (e.g., systemic administration, e.g., intravenous administration, or any other route of administration, etc.) can be performed once, or repeated, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times, etc. In an exemplary embodiment, administration can be performed every other week, weekly, every two weeks, monthly, or every 2, 3, 4, 5 or 6 months. In other embodiments, only a single administration is required to obtain a therapeutic benefit. In other embodiments, only one course of treatment is required to obtain a therapeutic benefit for 1, 2, 3, 4, 5 or 6 months from the start of the treatment course. In other embodiments, only one course of treatment is required to obtain a therapeutic benefit that lasts for 1, 2, 3, 4, 5 or 6 months from the end of the treatment course.

[0148] Individual dosages are typically above the amount necessary to produce a measurable effect on a subject and can be determined based on the pharmacokinetics and pharmacology of absorption, distribution, metabolism, and excretion ("ADME") of the subject composition or its by-products, and thus based on the nature of the composition in the subject's body. This includes consideration of the route of administration as well as the dosage, which can be adjusted for local and systemic (e.g., intravenous) application. The effective amount and / or dosing regimen of administration can be readily determined empirically from preclinical assays, safety and escalating and dose range studies, the relationship of the individual clinician and patient, and in vitro and in vivo assays. Generally, these assays will be for evaluating autoimmune disorders (such as rheumatoid arthritis, scleroderma, ulcerative colitis, pemphigus, Crohn's disease, psoriasis, psoriatic arthritis, sclerosis, or systemic lupus erythematosus, etc.).

[0149] The therapeutically effective amount of MBV can be resuspended, for example, in a pharmaceutically acceptable carrier (such as in a pharmaceutical preparation) in an isotonic buffer at a pH of about 3.0 to about 8.0, preferably about 3.5 to about 7.4, 3.5 to 6.0, or 3.5 to about 5.0. Useful buffers include sodium citrate - citric acid, and sodium phosphate - phosphoric acid, and sodium acetate / acetic acid buffers. Other agents, such as preservatives and antibacterial agents, etc., can be added to the composition. These compositions can be administered locally or systemically, for example intravenously.

[0150] A pharmaceutical preparation containing a therapeutically effective amount of MBV can be formulated into unit dosage forms suitable for individual administration of precise dosages. The amount of the active compound to be administered will depend on the subject being treated, the severity of the disease, and the mode of administration, and it is best to leave it to the judgment of the prescribing clinician. Among these constraints, the preparation to be administered will contain an amount of the active ingredient effective to achieve the desired effect in the subject being treated. In an exemplary embodiment, treatment with MBV results in a decrease or reduction in the signs or symptoms of an autoimmune disorder (such as rheumatoid arthritis, scleroderma, ulcerative colitis, pemphigus, Crohn's disease, psoriasis, psoriatic arthritis, sclerosis, or systemic lupus erythematosus, etc.) present at the time of administration.

[0151] Administration of MBV provides a therapeutic benefit to the subject. The therapeutic benefit can vary, for example, as a function of time and / or intensity. In an exemplary embodiment, the subject experiences a therapeutic benefit over a long period of time after administration of MBV. For example, the subject can experience a therapeutic benefit lasting at least 3 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months or longer.

[0152] In some embodiments, the subject experiences a therapeutic benefit that lasts for a period of at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, or at least 3 months from the administration of MBV. In further embodiments, the therapeutic benefit from administration continues for at least an additional 1 week even after the treatment course is completed. In still other embodiments, the therapeutic benefit from administration continues for at least an additional 2 weeks even after the treatment course is completed. In further embodiments, the therapeutic benefit from administration continues for at least an additional 1 month even after the treatment course is completed. In some embodiments, the therapeutic benefit from administration continues for at least an additional 2 months even after the treatment course is completed. In further embodiments, the therapeutic benefit from administration continues for at least an additional 3 months or longer even after the treatment course is completed. In further embodiments, the therapeutic benefit from administration continues for at least an additional 6 months or longer even after the treatment course is completed. In still other embodiments, the therapeutic benefit is a reduction in the symptoms of the disorder present at the time of administration.

[0153] In some examples, treatment with MBV can result in a decrease or reduction in autoimmunity in the subject as compared to the autoimmunity activity level prior to administration of MBV. In some examples, treatment with MBV can result in remission of an autoimmune disorder. In some examples, treatment with MBV can result in a reduction or disappearance of a recurrence of the signs or symptoms of an autoimmune disorder (such as rheumatoid arthritis, scleroderma, ulcerative colitis, pemphigus, Crohn's disease, psoriasis, psoriatic arthritis, sclerosis, or systemic lupus erythematosus, etc.). For example, treatment with MBV can result in a reduction or disappearance of a recurrence of an autoimmune disorder, or a reduction or elimination of signs or symptoms, for a longer period (such as a period of at least 3 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, or at least 6 months, etc.) even after the treatment course is completed. The treatment can result in remission of the disease or disorder.

[0154] An additional therapeutic agent can be administered to the subject in the same or a different composition or pharmaceutical preparation. In an exemplary embodiment, the subject has an autoimmune disorder (such as rheumatoid arthritis, scleroderma, ulcerative colitis, pemphigus, Crohn's disease, psoriasis, psoriatic arthritis, sclerosis, or systemic lupus erythematosus, etc.), and an additional therapeutic agent, such as an anti-inflammatory drug, etc., is administered to the subject, and / or an immunosuppressive drug can be administered.

[0155] In some embodiments, the method includes the step of detecting that a therapeutic benefit has been achieved. The method of measuring therapeutic efficacy is applicable to the specific disease being modified, and those skilled in the art will know the detection methods suitable for use in measuring therapeutic efficacy. The subject can be evaluated for response using any method known in the art. In an exemplary embodiment, the subject has an autoimmune disorder (such as rheumatoid arthritis, scleroderma, ulcerative colitis, pemphigus, Crohn's disease, psoriasis, psoriatic arthritis, sclerosis, or systemic lupus erythematosus, etc.), and the therapeutic response in the subject can be measured by an antinuclear antibody test (ANA), or specific autoantibodies produced in a certain autoimmune type, tests for inflammation in the body, etc.

[0156] Exemplary methods are disclosed below.

Examples

[0157] The present disclosure generally described herein will be more readily understood by reference to the following examples. The following examples are included only for the purpose of illustrating certain aspects and embodiments of the present disclosure and are not intended to limit the scope of the present disclosure in any way.

[0158] (Example 1) Differentiation of Matrix-Bound Vesicles (MBV) and Extracellular Vesicles (EV) by Lipidomics and RNA Sequencing Matrix-bound nanovesicles (MBVs) have been reported as an essential component of the ECM biomatrix. Liquid-phase extracellular vesicles (EVs) have been the subject of intensive investigation, but their similarities to MBVs are limited to size and shape. This example performed a detailed comparison of liquid-phase EV lipids and MBV lipids using LC-MS-based lipidomics and redox lipidomics. Together with comprehensive RNA sequencing and bioinformatic analysis of the cargo within the vesicles, this example demonstrated that MBVs are a distinct and distinguishable subpopulation of EVs, indicating the distinctive features of ECM-based biomaterials.

[0159] This example identifies the similarities and differences between the liquid phase of EVs (i.e., exosomes) and the matrix-bound form (i.e., MBVs). However, considering that EVs present in biological fluids, as well as MBVs present in native tissue ECM and ECM-based biomaterials, correspond to heterogeneous populations secreted from multiple cell sources, there are problems with direct comparison in vivo analysis between these putative EV populations. As an alternative to using body fluid- or tissue-derived vesicles, ECM and conditioned media produced in vitro by cultured cells can be isolated (Fitzpatrick et al., Biomater Sci., 3, 12-24 (2015)). This approach has several advantages, such as removing any doubts regarding the origin of the vesicles by using a single cell type source; being able to selectively recover vesicles from either the liquid or solid phase compartments; and being able to control the cell culture environment and, therefore, also the vesicle composition and cargo.

[0160] Materials and Methods Preparation of in vitro cell-derived ECM: Human bone marrow stem cell (BMSC), human adipose stem cell (ASC), and human umbilical cord stem cell (UCSC) ECM plates were provided by StemBioSys (San Antonio, Texas) and were prepared according to the published protocol (Lai et al., Stem cells and development 19, 1095-1107 (2010)). Briefly, human BMSCs, human ASCs, or human UCSCs were seeded at a cell density of 3,500 cells per cm 2 in a 75 cm 2 cell culture flask coated with human fibronectin (for 1 hour at 37°C) and cultured in α-MEM medium supplemented with 20% fetal bovine serum (FBS) and 1% penicillin-streptomycin for 14 days. The medium was refreshed on the day after the initial seeding and then every 3 days. On day 7, ascorbic acid 2-phosphate (Sigma Aldrich) was added to the medium at a final concentration of 50 μM. On day 14, the plates were decellularized using 0.5% Triton in 20 mM ammonium hydroxide for 5 minutes, rinsed twice with Hank's balanced salt solution containing both calcium and magnesium (HBSS+ / +), and rinsed once with ultrapure H 2 2O. Mouse NIH 3T3 fibroblasts were seeded at a cell density of 3,500 cells per cm 2 in a 75 cm 2 cell culture flask and cultured in DMEM medium supplemented with exosome-depleted FBS (G. V. Shelke, et al, Journal of extracellular vesicles 3, 24783 (2014)), 1% penicillin-streptomycin, and ascorbic acid 2-phosphate (Sigma Aldrich) at a final concentration of 50 μM for 7 days. On day 7, the supernatant was collected from the cultured 3T3 fibroblasts, the plated cultures were washed three times with PBS, decellularized using 0.5% Triton in 20 mM ammonium hydroxide for 5 minutes, and then rinsed three times with ultrapure H 2 2O.

[0161] Isolation of MBV and liquid-phase EVs: MBV was isolated (L. Huleihel et al., Science advances 2, e1600502 (2016)). Briefly, decellularized ECM was enzymatically digested with 100 ng / mL Liberase DL (Roche) in buffer (50 mM Tris pH 7.5, 5 mM CaCl 2 , 150 mM NaCl) for 1 hour at 37 °C. Cell culture supernatant containing liquid-phase EVs and digested ECM containing MBV were subjected to differential centrifugation at 500 g (10 minutes), 2500 g (20 minutes), and 10,000 g (30 minutes), and the supernatant was passed through a 0.22-μm filter (Millipore). Subsequently, the clarified supernatant containing released MBV or liquid-phase EVs was centrifuged at 100,000 × g for 70 minutes at 4 °C (Beckman Coulter Optima L-90K Ultracentrifuge) to pellet the vesicles. The vesicle pellet was then washed and resuspended in 1× PBS and stored at -20 °C until further use.

[0162] Preparation of urinary bladder matrix (UBM): UBM was prepared from market-weight pigs (Tissue Source; LLC, Lafayette, IN) (L. Huleihel et al., Science advances 2, e1600502 (2016)). Briefly, the serosa, outer muscular layer, submucosa, and muscularis mucosa were removed by mechanical dissection, and the urothelial cells of the mucosa were dissociated from the basement membrane by washing with deionized water. The remaining basement membrane and lamina propria (collectively called UBM) were decellularized by stirring at 300 rpm for 2 hours in 0.1% peracetic acid containing 4% ethanol, followed by washing with phosphate-buffered saline (PBS) and type 1 water. The UBM was then lyophilized and milled using a Wiley Mill equipped with a #60 mesh screen.

[0163] Scanning Electron Microscopy (SEM): The UBM was fixed with 2.5% glutaraldehyde at low temperature for 24 hours, followed by three 30-minute washes with 1×PBS. During this process, the samples were dehydrated with a stepwise alcohol series (30%, 50%, 70%, 90%, 100% ethanol) for 30 minutes each time during washing, and then placed in 100% ethanol at 4°C overnight. The samples were washed three more times with 100% ethanol for 30 minutes each time and then critical point dried using a Leica EM CPD030 Critical Point Dryer (Leica Microsystems, Buffalo Grove, IL, USA) with carbon dioxide as the transfer medium. Next, a 4.5 nm thick gold / palladium alloy coating was sputter-coated onto the samples using a Sputter Coater 108 Auto (Cressington Scientific Instruments, UK), and they were imaged with a JEOL JSM6330f scanning electron microscope (JEOL, Peabody, MA, USA).

[0164] Transmission Electron Microscopy (TEM): TEM imaging was performed using MBV or liquid-phase EV fixed with 4% paraformaldehyde and placed on a carbon-coated grid (L. Huleihel et al., Science advances 2, e1600502 (2016)). The grids were imaged at 80 kV using a JEOL 1210 TEM equipped with a high-resolution Advanced Microscopy Techniques digital camera. The size of MBV was determined from representative images using JEOL TEM software.

[0165] Nanoparticle tracking analysis (NTA): The particle size and concentration of liquid-phase EVs and MBVs were calculated using a Nanosight (NS300) instrument equipped with high-speed video capture and particle tracking software. Samples were diluted 1:500 using particle-free water to a final volume of 1000 μl. The samples were metered into the system using a syringe pump. Measurements were made from three 45-second captures for each sample. The detection threshold was adjusted to 4 for video processing and particle counting. Data for each of the samples evaluated are presented as concentration versus particle size.

[0166] RNA isolation: Total RNA was isolated from 3T3 cells, liquid-phase EVs, and MBVs using an RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. Prior to RNA isolation, liquid-phase EV and MBV samples were treated with RNase A (10 μg / ml) at 37 °C for 30 minutes to degrade any contaminating RNA. The amount of RNA was determined using a NanoDrop spectrophotometer, and its quality was determined by an Agilent Bioanalyzer 2100 (Agilent Technologies).

[0167] RNA Sequencing and Bioinformatics Analysis: Using 100 ng of each sample, miRNA library preparation was initiated using the QIAseq™ miRNA Library Kit (Qiagen) according to the manufacturer's instructions. Briefly, adapters were ligated to the 3' and 5' ends of mature miRNAs. The ligated miRNAs were then reverse transcribed into cDNA using a reverse transcription (RT) primer with a unique molecular identifier (UMI). The cDNA was then purified to remove adapter primers, followed by amplification of the library using a universal forward primer and one of 48 reverse primers specifying the sample index. Quality control before sequencing was performed using the Agilent RNA ScreenTape System. Next-generation sequencing was performed using the NextSeq 500 instrument at a loading of 2.5 pM. Bioinformatics analysis was performed by Genevia Technologies (Tampere, Finland). The FastQC software was used to investigate the quality of the sequencing reads. TrimGalore! [version 0.4.5;] was used to remove the adapter sequences with default settings in all samples. The fastx_trimmer software (FASTX Toolkit by Hannon Lab; version 0.0.14) was used to shorten all reads to 21 bases, the typical size of microRNAs. The reads of each sample were then aligned against the corresponding reference genome (hg38, GRCm38). The software bowtie [version 1.2.2] and miRDeep2 [version 0.0.8] were used to create a table of miRNA count values across the samples. In this process, the precursor miRNA and mature miRNA sequences for various species involved in this study were obtained from miRbase. The count values of mature miRNAs were obtained by using the median of all precursor miRNAs associated with them. The count values of mature miRNAs for all samples were normalized using DESeq2.Prior to further analysis, principal component analysis (PCA) was performed to ensure data quality, and the results were visualized separately for mouse and human samples using ggplot2. Normalization of mature miRNA data and statistical testing between sample groups were performed using DESeq2. The Benjamini-Hochberg method was used to correct the P-values for multiple testing. miRNAs with an adjusted p-value < 0.05 and an absolute log2 fold change > 1 were considered to be differentially expressed. Using the mirTARbase database of experimentally tested miRNA-target interactions, their targets and their confidence annotations were added to the list of differentially expressed miRNAs. Predicted target annotations were also added to the differentially expressed miRNAs using the R package miRNAtap. miRNAtap aggregates miRNA target predictions from five different databases (PicTar, DIANA, TargetScan, miRanda, miRDB) and calculates a combined miRNA target score. The minimum number of database sources required to include potential miRNA-target interactions in the annotation was three.

[0168] Ingenuity pathway analysis (IPA): Ingenuity Pathway Analysis software (version 01-14) was used for functional analysis of differentially expressed (DE) miRNAs. miRNA targets were identified using IPA Core Analysis. Filters were set on the experimentally observed results to obtain information on significantly enriched molecular and cellular functions, as well as physiological system development functions affected by miRNAs.

[0169] qPCR verification: Reverse transcription (RT) and quantitative polymerase chain reaction (qPCR) were performed using the TaqMan® Advanced miRNA Assays Protocol (Applied Biosystems). Briefly, 10 ng of total RNA was used with the TaqMan® Advanced miRNA cDNA Synthesis Kit (Applied Biosystems, catalog number A28007) to synthesize a 3'-poly(A) tail and adapt it to miRNA. cDNA was synthesized in the RT reaction using a universal RT primer that recognizes the poly(A) tail, followed by an miR-AMP step using miR-AMP forward and reverse universal primers to increase the number of cDNA molecules. qPCR was performed on a QuantStudio™ system machine using TaqMan® Fast Advanced Master Mix (Applied Biosystems, catalog number 4444556) and specific TaqMan® Advanced miRNA Assays (Applied Biosystems, catalog number A25576) that recognize mmu-miR-163-5p, mmu-miR-27a-5p, mmu-miR-92a-1-5p, mmu-miR-451a, mmu-miR-93-5p, and mmu-miR-99b-5p. The fold change in expression for each specific target regarding the MBV sample was calculated using the liquid-phase EV as a reference.

[0170] Immunoblot and silver staining assays: Liquid-phase EVs and MBVs obtained from three separate cultures of 3T3 fibroblasts were pooled and quantified by nanoparticle tracking analysis. For both immunoblot and silver staining analysis, the same number of vesicles for both the liquid-phase EV sample and the MBV sample were loaded onto the gel. MBV or liquid-phase EV 21×10 11Individuals were mixed with 2× Laemmli buffer (R&D Systems) containing 5% β-mercaptoethanol (Sigma-Aldrich), separated by 4–20% gradient SDS-PAGE (Bio-Rad), and then transferred to a PVDF membrane. The membrane was incubated overnight with the following primary antibodies: rabbit anti-CD63, rabbit anti-CD81, rabbit anti-CD9, and rabbit anti-Hsp70 (System Biosciences) at a 1:1000 dilution. The membrane was washed three times for 15 minutes each, either before or after incubation with a 1:5,000 dilution of goat anti-rabbit secondary antibody (System Biosciences). The washed membrane was exposed to a chemiluminescent substrate (Bio-Rad) and then visualized using a ChemiDoc Touch instrument (Bio-Rad). Gel silver staining was performed using a Silver Stain Plus Kit (Bio-Rad) according to the manufacturer's instructions and visualized using a ChemiDoc Touch instrument (Bio-Rad).

[0171] LC / MS Analysis of Phospholipids: Lipids were extracted from 3T3 cells, exosomes, and MBV by the Folch procedure (J. Folch, et al, J biol Chem 226, 497-509 (1957)). MS analysis of phospholipids and their oxygenated products was performed on an Orbitrap™ Fusion™ Lumos™ mass spectrometer (ThermoFisher) (Y. Y. Tyurina et al., ACS nano 5, 7342-7353 (2011)). Briefly, phospholipids were separated at a flow rate of 0.2 ml / min using a normal-phase column (Luna 3μm Silica(2)100Å, 150×2.0 mm (Phenomenex)) on a Dionex Ultimate 3000 HPLC system. The column was maintained at 35 °C. Analysis was performed using gradient solvents (A and B) containing 10 mM ammonium acetate. Solvent A contained propanol:hexane:water (285:215:5, v / v / v), and solvent B contained propanol:hexane:water (285:215:40, v / v / v). All solvents were LC / MS grade. The column was eluted with a linear gradient of 10% - 32% B from 0 - 23 minutes, a linear gradient of 32 - 65% B from 23 - 32 minutes, a linear gradient of 65 - 100% B from 32 - 35 minutes, held at 100% B from 35 - 62 minutes, eluted with a linear gradient of 100% - 10% B from 62 - 64 minutes, and subsequently equilibrated at 10% B from 64 - 80 minutes. Spectra were acquired in negative ion mode. Deuterated phospholipids were used as internal standards (Avanti Polar Lipids). Technical replicates were performed three times for each sample to evaluate reproducibility. LC / MS data were analyzed using the software package Compound Discoverer™ (ThermoFisher) and in-house generated analysis workflows and non-oxidized / oxidized lipid databases. Lipids were further filtered by retention time and confirmed by fragmentation mass spectra.

[0172] LC / MS analysis of free fatty acids and their oxidation products: Free fatty acids were analyzed by LC / MS using a Dionex Ultimate™ 3000 HPLC system (Thermo Fisher Scientific, San Jose, CA) online coupled to a Q-Exactive hybrid quadrupole orbitrap mass spectrometer (Y. Y. Tyurina et al., Nature chemistry 6, 542 (2014)). Briefly, fatty acids and their oxidative derivatives were separated on a C18 column (Accliam PepMap RSLC, 300 μm 15 cm, Thermo Scientific) using a solvent gradient (A: methanol (20%) / water (80%) (v / v) and B: methanol (90%) / water (10%) (v / v), both containing 5 mM ammonium acetate). The column was eluted at a flow rate of 12 μL / min using a linear gradient from 30% solvent B to 95% solvent B over 70 min, held at 95% B from 70 to 80 min, then returned to the initial conditions by 83 min and re-equilibrated for an additional 7 min. Spectra were acquired in negative ion mode. Analytical data were acquired and analyzed using Xcalibur software. At least three technical replicates were performed for each sample to increase reproducibility.

[0173] Results Isolation of Liquid-Phase EVs and Matrix-Bound Nanovesicles: Scanning electron microscopy (SEM) was performed to obtain high-resolution, high-magnification imaging of MBVs embedded within an ECM scaffold derived from porcine bladder matrix (UBM). SEM images revealed individual spheres approximately 100 nm in diameter dispersed throughout the collagen fibers (Figure 1A). To investigate whether MBVs accumulated within the solid ECM substrate represent a distinct class of extracellular vesicles separate from liquid-phase secreted EVs, an in vitro 3T3 fibroblast culture model enabling selective recovery of vesicles from liquid or solid extracellular compartments was used (Figure 1B). Phase contrast microscopy and representative images from H&E and DAPI-stained sections showed no visible residual cells or intact nuclei after decellularization of the cell culture plates (Figure 1C). Transmission electron microscopy (TEM) imaging of liquid-phase EVs recovered from cell culture supernatants and MBVs isolated from decellularized ECM (Figure 1D) showed that these two populations of vesicles shared similar morphologies. Furthermore, nanoparticle tracking analysis (NTA) distribution plots showed similar vesicle sizes for both liquid-phase EVs and MBVs, with most vesicles having a diameter <200 nm (Figure 1E). Immunoblot analysis for CD63, CD81, CD9, and Hsp70 was performed to determine whether MBVs contain markers commonly attributed to exosomes (J. Lotvall et al. (Taylor & Francis, 2014)). The results showed that, in contrast to liquid-phase EVs, MBVs exhibited a marked decrease in CD63, CD81, and CD9. MBVs expressed CD9 and CD81 at levels that were barely detectable by immunoblot assay and were significantly decreased compared to levels expressed in EVs. MBVs also showed significantly lower CD63 expression than that observed in EVs (Figure 1F). In other words, liquid-phase EVs (i.e., exosomes) are enriched in the expression levels of CD63, CD81, and CD9 compared to MBVs. Furthermore, silver staining of proteins separated by electrophoresis showed that MBVs contain a protein cargo that is clearly distinct from that of liquid-phase EVs (Figure 1G). This suggests that MBVs may represent a distinct subpopulation of nanovesicles.

[0174] miRNAs are selectively packaged into liquid-phase EVs and MBVs derived from 3T3 fibroblasts: Using comprehensive next-generation RNA sequencing (RNA-seq), a catalog of miRNAs that were differentially expressed in MBVs and liquid-phase EVs compared to the 3T3 fibroblast parental cells from which these vesicles originated was generated. Bioanalyzer analysis demonstrated the absence of 18S and 28S ribosomal RNAs and enrichment of small RNA molecules (<200 nt) in total RNA isolated from liquid-phase EVs and MBVs. However, the size distribution of small RNAs from liquid-phase EVs was much broader than that of MBVs, with small RNA molecules between 100 and 200 nt being significantly enriched in liquid-phase EVs (Figure 2A). Next-generation sequencing of miRNA libraries generated from parental cell RNA, liquid-phase EVs, and MBV isolates (n = 3 per group) focused the analysis on differential miRNA signatures. Principal component analysis (PCA) showed that replicate miRNA profiles clustered closely together within each group (Figure 2B).

[0175] Significant differences in miRNA content were observed between parental cells and isolates of liquid-phase EVs and MBVs. Overall, 28 (50.91%) miRNAs were found to be differentially expressed at least two-fold in MBVs compared to liquid-phase EVs (Figure 2C). Additionally, the miRNA profiles of each liquid-phase EV or MBV and parental cells were clearly distinct (Figure 2B, Figure 2C). To validate the results of miRNA sequencing, RT-qPCR was performed to detect three miRNAs (miR-163-5p, miR-27a-5p, miR-92a-1-5p) upregulated and three miRNAs (miR-451a, miR-93b-5p, miR-99b-5p) downregulated in MBVs compared to liquid-phase EVs isolated from 3T3 fibroblasts (Figure 2D). The results showed that the levels of miR-163-5p, miR-27a-5p, and miR-92a-1-5p were upregulated and those of miR-451a, miR-93b-5p, and miR-99b-5p were downregulated in MBVs compared to liquid-phase EVs, thereby verifying the results from miRNA sequencing data. Ingenuity Pathway Analysis (IPA) of miRNAs differentially enriched in MBVs compared to liquid-phase EVs showed strong associations with organ and system development and function. In contrast, miRNAs differentially enriched in liquid-phase EVs compared to MBVs were associated with pathways involved in cell growth, development, proliferation, and morphology (Figure 2E).

[0176] The MBV miRNA content is specific to cell origin: Results in the 3T3 fibroblast model showed selective packaging of miRNAs into MBVs accumulated within the ECM compared to the liquid-phase EVs secreted into the cell culture supernatant. To determine whether the MBV miRNA cargo is specific to cell origin, the miRNA composition of MBVs isolated from ECMs produced in vitro by bone marrow-derived stem cells (BMSCs), adipose stem cells (ASCs), and umbilical cord stem cells (UCSCs) isolated from different human donors was characterized and compared by next-generation sequencing. Representative phase-contrast microscopy images of decellularized BMSC cell culture plates showed the absence of cells and the presence of a branched fibrillar structure (Figure 3A). TEM imaging of MBVs isolated from decellularized BMSC cell culture plates showed a characteristic morphology attributable to extracellular vesicles (Figure 3B). Furthermore, nanoparticle tracking analysis showed similar distribution plots between BMSC-derived MBVs, ASC-derived MBVs, and UCSC-derived MBVs, with the majority of vesicles having a diameter <200 nm (Figures 3C–3E). After isolation of total RNA from these samples, Bioanalyzer analysis showed the absence of ribosomal RNA and enrichment of small RNA molecules (<200 nt) (Figure 3F). miRNA libraries were generated from samples (BMSCs, n = 3 human donors; ASCs, n = 3 human donors; UCSCs, n = 3 human donors) and subjected to miRNA sequencing. Principal component analysis showed that the samples clustered mainly by the cell type from which they were derived (Figure 3G). Despite using three separate human donors for each cell type used to generate the MBV samples, principal component analysis showed a high degree of homogeneity in the miRNA profiles within each group (Figure 3G). In addition, volcano plots showed that there was less differential expression of miRNAs between BMSC-derived MBVs and UCSC-derived MBVs than between BMSC-ASC and UCSC-ASC.

[0177] Lipid profiles of liquid-phase EVs, MBVs, and parental cells: The lipid composition of EVs has been characterized by several studies (T. Skotland, et al, Journal of lipid research 60, 9-18 (2019)). However, there is no data on the phospholipid composition of MBVs. Therefore, LC-MS-based comprehensive lipidomics and redox lipidomics analyses were performed to comparatively evaluate the phospholipid compositions of MBVs and liquid-phase EVs compared to their 3T3 fibroblast parental cells (Figure 4A, Figure 4D). Nine major phospholipid classes were detected across the three types of samples, and the total 536 detected molecular species were distributed among the following major classes: bis-monacylglycerophosphate (BMP) - 59 species, phosphatidylglycerol (PG) - 37 species, cardiolipin (CL) - 117 species, phosphatidylinositol (PI) - 33 species, phosphatidylethanolamine (PE) - 102 species, phosphatidylserine (PS) - 45 species, phosphatidic acid (PA) - 26 species, phosphatidylcholine (PC) - 107 species, and sphingomyelin (SM) - 10 species (Figure 4D). In terms of their content of polyunsaturated fatty acid (PUFA) residues, PE, PI, PC, and PS corresponded to the major reservoirs of these polyunsaturated PL species containing 4 - 7 double bonds (Figure 4B). These PUFAs correspond to potent precursors of signaling lipid mediators. The formation of mediators occurs by catalytic oxygenation of PUFA phospholipids by 5-lipoxygenase or 15-lipoxygenase to yield oxygenated phospholipids, which are then hydrolyzed by one of the specific phospholipases A2 to release oxygenated fatty acids (lipid mediators) (Z. Zhao et al., Endocrinology 151, 3038-3048 (2010); Y. Y. Tyurina et al., Journal of leukocyte biology, (2019)).In addition, oxidized PUFA phospholipids act as signaling molecules that coordinate a number of intracellular processes and cellular responses, including apoptosis, ferroptosis, and inflammation (Y. Y. Tyurina et al., Antioxidants & redox signaling 29, 1333-1358 (2018)). A significant difference was observed between liquid-phase EVs and MBVs in the molecular speciation of these phospholipids and their relative contents (Figure 4E). With the obvious exception of SM, arachidonic acid (AA) residues and docosahexaenoic acid (DHA) residues were detected in all phospholipids (Figure 4E). For many phospholipids, the amounts were significantly higher in MBVs compared to liquid-phase EVs and parental cells (Figure 4E), indicating that MBVs are considered a rich reservoir of PUFA-phospholipids. PUFA phospholipids are PLA. 2It can be hydrolyzed, resulting in the release of free PUFA and LPL (V. D. Mouchlis, et al, Biochimica et Biophysica Acta (BBA)-Molecular and Cell Biology of Lipids 1864, 766-771 (2019)). The former can be further utilized by two major oxygenases, COX and LOX, to generate lipid mediators with pro-inflammatory or anti-inflammatory capabilities (Y. Y. Tyurina et al., Redox (phospho) lipidomics of signaling in inflammation and programmed cell death. Journal of leukocyte biology, (2019); C. A. Rouzer, et al., Chemical reviews 103, 2239-2304 (2003); H. Kuhn, et al., Biochimica et Biophysica Acta (BBA)-Molecular and Cell Biology of Lipids 1851, 308-330 (2015)). This finding identifies MBV as a potential precursor for the synthesis of these lipid mediators depending on the cell / tissue context (Y. Y. Tyurina et al., Journal of leukocyte biology, (2019).). Quantitatively, MBV is enriched in PI, PS, PG, and BMP (Figure 4C and Table 2). The phospholipid content shown in Figure 4C is also provided in Table 1. [Table 1]

[0178] In contrast, the contents of PE, PA, and SM were higher in the liquid-phase EVs. PC was the major phospholipid in both cells and liquid-phase EVs. The content of cardiolipin (CL), a unique mitochondrial phospholipid, was significantly lower in liquid-phase EVs compared to MBV and parental cells (Figure 4F). Since CL is a unique mitochondrial-specific phospholipid mainly localized in the inner mitochondrial membrane (M. Schlame, et al., Biochimica et Biophysica Acta (BBA)-Molecular and Cell Biology of Lipids 1862, 3-7 (2017)), this finding implies that MBV biosynthesis may be associated with the mitochondrial compartment of the cell. Plasmalogen phospholipids (or ether phospholipids) structurally differ from diacyl-phospholipids (or ester-phospholipids) (M. Schlame, et al., Biochimica et Biophysica Acta (BBA)-Molecular and Cell Biology of Lipids 1862, 3-7 (2017)). In plasmalogens, a vinyl ether bond links an sn-1 saturated or monounsaturated chain to the glycerol backbone of the phospholipid (N. E. Braverman, et al., Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease 1822, 1442-1452 (2012)). The ether lipids PE and PC plasmalogens have been shown to be able to facilitate membrane fusion (P. E. Glaser, et al., Biochemistry 33, 5805-5812 (1994)) and increase the membrane thickness of extracellular vesicles (X. Han, et al., Biochemistry 29, 4992-4996 (1990); T. Rog, et al., Biochimica et Biophysica Acta (BBA)-Biomembranes 1858, 97-103 (2016)), and thus may be involved in the cellular uptake of nanovesicles.Detailed MS / MS analysis showed high levels of ether PE and PC species (plasmalogens) in both liquid-phase EV and MBV. These species were identified as PE-16:0p / 20:4, PE-16:1p / 20:4, PE-18:1p / 20:4, PE-18:1p / 22:6 and PC-16:0p / 20:4, PC-18:0p / 20:4, PC-20:0p / 20:4, PC-18:0p / 22:6, respectively (Figure 4E).

Table 2

[0179] Liquid-phase EV, MBV, and parental cell lysophospholipid profiles: Lysophospholipids (LPLs), hydrolytic metabolites of phospholipids generated by phospholipase A, are bioactive signaling molecules that modulate various physiological responses, including macrophage activation (R. Ray, et al., Blood 129, 1177-1183 (2017)), inflammation and fibrosis (A. M. Tager et al., Nature medicine 14, 45 (2008)), tissue repair and remodeling (K. Masuda, et al., The FEBS journal 280, 6600-6612 (2013)), and wound healing (K. M. Hines et al., Analytical chemistry 85, 3651-3659 (2013)). LC-MS analysis showed that LPLs were present in all three types of samples, with their total contents in MBV and liquid-phase EV being 1.7- to 1.8-fold higher compared to parental cells. More specifically, seven classes of LPLs were identified: lysophosphatidylethanolamine (LPE), lysophosphatidylcholine (LPC), lysophosphatidylserine (LPS), lysophosphoinositol (LPI), lysophosphatidic acid (LPA), lysophosphatidylglycerol (LPG), and monolysocardiolipin (mCL) (Figure 5A). MBV was enriched in LPE, LPA, and LPG compared to parental cells (Figure 5B). The contents of LPI and mCL were significantly lower in MBV and liquid-phase EV compared to cells. The contents of LPA and LPG were significantly higher in MBV compared to EV. The levels of mLCL and LPI in MBV were 3-fold and 6.3-fold higher than in EV, but 1 / 3.3 and 1 / 1.9 compared to cells (Figure 5C, Figure 5D). No significant changes in the contents of LPE, LPC, and LPS were observed between MBV and EV. Non-oxidized molecular species containing 16:0, 16:1, 18:0, and 18:1 were the major types found in all detected LPL species (Figure 5C).These findings suggest that the high levels of lysophospholipids, bioactive molecules important for macrophage differentiation, tissue repair, remodeling, and wound healing, are a distinctive feature of MBV.

[0180] Analysis of free and oxygenated fatty acids in MBV and liquid-phase EVs: Exposure of mouse bone marrow-derived macrophages to MBV results in the expression of Fizz1 and Arg1, M2-like markers associated with the constitutive macrophage phenotype (L. Huleihel et al., Science advances 2, e1600502 (2016)). Therefore, LC / MS analysis of PUFAs and their oxygenated products in MBV, liquid-phase EVs, and parental cells was performed. MBV was strongly enriched in arachidonic fatty acid (20:4, AA), docosahexaenoic fatty acid (22:6, DHA), and docosapentaenoic fatty acid (22:5, DPA) (Figure 6A). In other words, MBV corresponds to a reservoir of substrates for the biosynthesis of signaling lipid mediators by the respective enzymatic machinery - COX and -LOX. In liquid-phase EVs, the major PUFAs were linoleic acid (18:2) and linolenic acid (18:3) (Figure 6A).

[0181] Since extracellular vesicles contain the enzymatic machinery for the biosynthesis of AA-derived lipid mediators (E. Boilard, Journal of lipid research 59, 2037-2046 (2018)), redox lipidomics analysis of oxygenated fatty acids was performed. High levels of AA metabolites, such as 12-HETE, 15-HETE, lipoxin A 4 were seen in liquid-phase EVs compared to MBV (Figure 6B). In relation to tissue repair, lipoxin A 4 (LXA 4) and D-series resolvin D1 (RvD1)-produced by 12 / 15-LOX from arachidonic acid (20:4, AA) and docosahexaenoic acid (22:6, DHA)-stimulate macrophage activation to an M2-like phenotype (C. N. Serhan, The American journal of pathology 177, 1576-1591 (2010)). Finally, oxidized phospholipids containing oxygenated AA and DHA in MBV and liquid-phase EVs were characterized. The levels of oxygenated species were higher in MBV than in liquid-phase EVs where PS, PI, and PC were presented by monooxygenated species. BMP, PG, and CL contained single and double oxygenated AA and DHA residues, and trioxygenated PUFAs were seen only in PE (Figure 6C). Overall, the results of lipidomics and redox lipidomics show that the levels of free AA, DHA, and DPA and PUFA-containing phospholipids and their oxidatively modified molecular species are higher in MBV compared to levels in liquid-phase EVs. Unlike liquid-phase EVs, MBV represents a potential reservoir of oxidized and oxidatively esterified PL species due to enrichment with PUFA non-oxygenated and oxygenated phospholipids and thus represents a potential source of lipid mediators activated by different phospholipases depending on the pro-inflammatory / anti-inflammatory status of the extracellular environment.

[0182] We undertook the above LC-MS-based lipidomics and redox lipidomics studies to perform a detailed comparison of liquid-phase EV lipids and MBV lipids. Combined with comprehensive RNA sequencing and bioinformatic analysis of the vesicular cargo, these data show that MBV is a distinct and clearly distinguishable subpopulation of EVs, separate from liquid-phase EVs (i.e., exosomes), and exhibit discriminative features of ECM-based biomaterials where the similarity is limited to vesicle size and shape.

[0183] In this specification, the vesicle populations were fractionated based on their partitioning into either the liquid-phase cell culture medium or the solid-phase ECM substrate. With respect to composition, MBVs isolated from the ECM of 3T3 fibroblasts had differential miRNA and lipid signatures compared to liquid-phase EVs and parental cells. These data evoke a scenario where molecular sorting occurs during vesicle biogenesis to specifically distribute miRNAs and lipids to vesicles destined for different extracellular locations. Furthermore, the cell's ability to distinguish between the liquid interface and the solid substrate, and the cell's ability to selectively accumulate a compatible subpopulation of vesicles with distinct lipid signatures in these completely different compartments provide evidence of an unrelated membrane biogenesis for MBVs, distinct from the biogenesis of EVs secreted into the liquid phase. Considering that MBVs have been shown to be incorporated into the dense fibrous network of the extracellular matrix, MBVs should be secreted by cells in coordination with ECM components during matrix accumulation during tissue development and homeostasis, as well as during dynamic matrix remodeling after injury. Furthermore, considering that the ECM is a complex mixture of proteins, proteoglycans, and glycosaminoglycans arranged in a tissue-specific 3D structure (Hussey et al., Nature Review Materials, 3(7):159-173, 2018), the MBV cargo and lipid content should also be unique to the tissue and cell origin. MBVs isolated from ECM scaffolds derived from anatomically distinct tissue origins had differential miRNA signatures (Huleihel et al., Science Advances, 2, e1600502, 2016). Results from this study further show that MBVs isolated from ECMs produced in vitro by bone marrow-derived stem cells, adipose stem cells, and umbilical cord stem cells from different human donors had unique miRNA signatures specific to the cell source.In addition, it was found that fewer miRNAs were differentially expressed between BMSC-derived MBVs and UCSC-derived MBVs than between BMSC-ASCs and UCSC-ASCs, a finding that can be attributed to the tissue-specific differentiation potential of adipose stem cells (L. Xu et al., Stem cell research & therapy 8, 275 (2017)). These findings further emphasize the cell-specific characteristics of the MBV miRNA profile that were not significantly affected by donor endogenous variability. However, considering that all three human donors were male, further studies are needed to determine gender-related variations in the miRNA cargo of MBVs from stem cell samples. Importantly, principal component analysis showed a high degree of consistency between batches of miRNA cargo from MBVs accumulated by specific cell types isolated from different human donors, supporting the manufacture of MBV and ECM biomaterials as research tools or clinical therapies. This study confirms that MBVs incorporated into the matrix are a unique subset of EVs. In addition, MBVs showed a marked decrease in proteins commonly associated with exosomes (e.g., CD63, CD81, CD9).

[0184] In contrast to EVs that are secreted into body fluids and readily available for intercellular communication, MBVs embedded within the tissue ECM are stably associated with the matrix and can only be isolated after degradation of the ECM material (Huleihel et al., Science advances 2, e1600502 (2016)). The requirement for matrix degradation to release MBVs may partially define their mechanisms of action, including those related to their ability to generate anti-inflammatory lipid mediators. Since MBVs remain intact and attached to the ECM even after decellularization, the molecular speciation of their constituent phospholipids is likely to facilitate such MBV-ECM interactions. Detailed characterization of the molecular speciation of MBV phospholipids, lysophospholipids, and oxygenated and non-oxygenated PUFAs was performed using LC-MS-based lipidomics and redox lipidomics approaches. High levels of lysophospholipids, bioactive molecules important for macrophage differentiation, tissue repair, remodeling, and wound healing, are a distinctive feature of MBVs. In addition, as fusogenic lipids, lysophospholipids can facilitate the transfer of vesicle contents to intracellular targets. Unlike liquid-phase EVs, MBVs represent a potential reservoir of oxidized and oxidatively esterified PL species due to their enrichment in PUFA non-oxygenated and oxygenated phospholipids. Notably, PUFA-enriched MBVs are an important source of lipid mediators that are activated by different phospholipases depending on the pro-inflammatory / anti-inflammatory status of the extracellular environment.

[0185] (Example 2) Use of MBV for the treatment of pristane-induced arthritis The bladder matrix was prepared using the methodology described in Example 1.

[0186] MBVs were obtained from laboratory-generated porcine UBM using an orbital shaker in buffer (50 mM Tris pH 7.5, 5 mM CaCl 2Isolated by 24-hour enzymatic digestion at room temperature with Liberase TL (high-purity collagenase I and collagenase II) in 150 mM NaCl. The digested ECM was then subjected to centrifugation at 10,000×g for 30 minutes to remove ECM debris. The clarified supernatant containing the released MBV was then centrifuged at 100,000×g for 2 hours at 4°C (Beckman Coulter Optima L-90K Ultracentrifuge) to pellet the MBV.

[0187] The rat pristane-induced arthritis model has been established as a clinically relevant animal model for the study of rheumatoid arthritis (Tuncel et al. PLoS One. 2016; 11(5):e0155936). Pristane-induced arthritis was induced in 8-week-old female Sprague-Dawley rats by intradermal injection of 300 μL of pristane (2,6,10,14-tetramethylpentadecane) to the dorsal side of the tail 1 cm distal from the base on day 0 of the study. Negative control animals were not given an intradermal injection of pristane on day 0. A second dose of 300 μL of pristane was administered intradermally approximately 1 cm distal from the base of the tail dorsally on day 4. Animals given pristane were housed together in a cage. Animals given pristane were randomly assigned to the following experimental groups: pristane only + PBS, pristane + i.p. methotrexate (MTX), pristane + periaxial (p.a.) MBV, and intravenous (i.v.) MBV. A depiction of the periaxial and intravenous MBV administration routes is shown in Figure 7.

[0188] The arthritis score was determined for each animal on days 7, 10, 14, 17, 21, 28, and then weekly until the 100-day endpoint. Photographs of the front and hind paws were taken from the perspective of the plantar and plantar surfaces of the foot. Two independent reviewers evaluated the qualitative arthritis sensitivity using the following 60-point arthritis scoring criteria: 1 point was assigned to each inflamed finger joint or toe, and 5 points or less were assigned to the affected paw joint (15 points per paw, 60 points per rat). Animals designated as pristane only + PBS received no treatment on days 7, 10, 14, 17, and 21. Animals in the pristane + i.p. methotrexate group received 0.1 mg / kg of methotrexate in 1× sterile PBS (pH 7.4) by intraperitoneal (i.p.) delivery on days 7, 10, 14, 17, and 21. Animals in the pristane + perijoint MBV group received 25 μL of 500 μg / mL porcine-derived UBM MBV (1×10 11 particles per mL) by delivery to the plantar and plantar surfaces of the hind and front paws, respectively. Animals in the intravenous MBV group received 100 μL of 500 μg / mL UBM MBV (1×10 11 particles per mL) by intravenous delivery into the lateral tail vein of the animal. (Figure 12A) Four animals per group were assigned to the 28-day short-term study, and four animals per group were assigned to the 100-day study. The sample size was determined using alpha 0.05 and beta 0.80 and the previously published effect size of methotrexate. The arthritis score was expressed as the mean ± standard error of the mean. Days 7 to 21 represent an n of 8 for each group, and then days 28 and later represent an n of 4 for each group. Two-way analysis of variance with Tukey's post hoc correction was used to analyze the group differences. Significance was determined as p <.05 prior to the study.

[0189] Administration of MBV, whether by targeted PA (peri - articular) or systemic IV administration, significantly reduced the severity of arthritis in rats and demonstrated efficacy similar to that of methotrexate, the gold standard of care. All rats presented an arthritis score of 0 on day 7 (Figure 8A), but as early as day 10, high arthritis scores were observed in pristane - only rats, and all treated rats presented lower arthritis scores (Figure 8B). Surprisingly, even when initiated on day 13, MBV treatment was as effective as methotrexate, the gold standard of arthritis treatment (Figures 8C and 8D). By day 21, MBV - treated rats (both IV - treated and PA - treated rats) presented lower arthritis scores than methotrexate - treated rats (Figure 8E). Photographs taken of the rats' feet demonstrate the differences in erythema and edema in pristane - only and methotrexate - and MBV - treated rats (Figures 9A - 9B). The mean arthritis scores for the treatment groups during the first 21 days of the experiment are shown in Figure 10. PA administration of MBV showed an equivalent reduction in arthritis scores compared to pristane - only rats and an equivalent reduction in arthritis scores to methotrexate treatment. Unexpectedly, however, it was discovered that IV administration had the same efficacy as PA and methotrexate in reducing arthritis scores. IV administration was predicted to dilute the potency of MBV and thus its effect on inflamed joints would be limited if any, but this was not observed. Surprisingly, both PA and IV administration routes of MBV showed an equivalent reduction in arthritis scores compared to pristane - only rats, and both reduced arthritis scores to a similar extent as methotrexate treatment. Peri - articular injection into the inflamed site is painful and many joints in an individual may be inflamed, so the unexpected finding that IV administration of MBV is as effective as PA administration suggests that a systemic delivery route can be used for a less invasive yet equally effective therapeutic effect, thus requiring only a single injection per administration (rather than multiple injections per joint) and therefore being more comfortable for the patient.

[0190] Surprisingly, in rats that received MBV by both IV and PA administration, recurrence of inflammation was also reduced. Data collected up to day 77 of the experiment support MBV treatment as an effective therapy for chronic and recurrent stage arthritis of inflammation. Phenotypically, as shown in the photograph of Figure 11A, the feet of rats treated with PA or IV MBV present erythema and edema equivalent to those treated with methotrexate. PA and IV MBV reduce pristane-induced arthritis clinical scoring in the chronic and recurrent stages of inflammation with the same efficacy as methotrexate, which is the gold standard care for rheumatoid arthritis (Figure 11B). Analysis of tissues from the rat model of rheumatoid arthritis resulted in a reduction of tissue inflammation and the space between tissues. In the MBV-treated samples, there was a recovery of space and a reduction of inflammation equivalent to those observed with methotrexate treatment. This demonstrates the effectiveness of MBV at both the biological and tissue levels.

[0191] In the acute phase of the designated disease from day 0 to 42, the visual disease severity in vehicle-treated diseased animals (pristane + PBS) reached a peak on day 17, and the peak disease score was 14.8 ± 0.8. Intraperitoneal (i.p.) MTX treatment of diseased animals (pristane + i.p. MTX) reduced the acute disease severity on days 10, 14, 17, and 21, and the peak disease score (9.8 ± 0.8) was on day 21 (Figure 12C, p <.05). Local, periarticular (pristane + p.a. MBV) administration reduced the disease severity on days 10, 14, 17, 21, and 28, and the peak disease score of 6.9 ± 0.9 was on day 10 (Figure 12D, p <.05). Systemic, intravenous (pristane + i.v. MBV) administration reduced the disease severity on days 10, 14, 17, 21, and 28, and the peak disease score of 8.0 ± 0.6 was on day 10 (Figure 12E, p <.05). There was no significant difference among the three treatment groups in the acute phase (p >.05), and all three treatment groups were different from the disease-free control group (p >.05). In short, i.p. MTX, p.a. MBV, and i.v. MBV are equally effective in reducing the severity of pristane-induced RA disease in the acute phase of the disease.

[0192] Since RA is a disease with a chronic relapsing-remitting phenotype, animals were observed after the acute phase to determine the long-term effects of MBV administration on the development of chronic disease. After day 28 and until the end of the 100-day study, no additional MTX treatment or additional MBV treatment was administered. At the start of the chronic phase (day 42), disease severity had waned and there was no difference between the following groups from days 42 to 63 (p >.05): pristane + PBS, pristane + i.p. MTX, pristane + p.a. MBV, and pristane + i.v. MBV. At day 70, the pristane + PBS group began to experience secondary disease relapse, and this relapse continued to increase until day 100, at which point the final disease severity score was 17.3 ± 5.1. In contrast, the pristane + MTX, + p.a. MBV, and + i.v. MBV groups did not show this upward trend until day 100. Furthermore, in contrast, administration of MTX, p.a. MBV, and i.v. MBV resulted in a significant decrease in disease severity at days 84 to 100 for MTX (Figure 12C, p <.05), at days 70 to 100 for p.a. MBV (Figure 12D, p <.05), and at days 70 to 100 for i.v. MBV (Figure 12E, p <.05). All three treatment conditions prevented disease severity relapse at day 100, and moreover, there was no difference in disease scores between the three treatment groups (p >.05). This data surprisingly shows that systemic administration is effective and non-toxic and does not show the dilution effect as predicted.

[0193] The data suggest that locally and systemically delivered MBV prevents the acute and chronic development of pristane-induced arthritis with efficacy equivalent to methotrexate.

[0194] Surprisingly, in the initial treatment course of MBV, either systemically or locally, MBV can have a therapeutic effect in alleviating arthritis symptoms for several weeks to several months after the initial treatment course of MBV is completed, whereby the severity or frequency of subsequent flares of rheumatoid arthritis symptoms is reduced, or even such flares disappear, resulting in remission. Furthermore, surprisingly, systemically administered MBV was found not to experience a dilution effect and to be as effective as locally administered MBV around the joints.

[0195] (Example 3) Matrix-bound nanovesicles reduce synovial inflammatory infiltration, articular cartilage destruction and articular proteoglycan loss in pristane-induced arthritis. Synovitis, cartilage destruction and proteoglycan loss are the basic histopathological changes that occur during the progression of RA disease. To determine the effect of MBV treatment on these histopathological parameters, rat hind paws for histopathological imaging and analysis were collected at the end of the study (day 100) from the animals from Example 2.

[0196] One hind paw from each animal was used for histopathological analysis. Tissue specimens were fixed in 10% formalin in PBS, pH 7.4, decalcified using 5% formic acid, and embedded in paraffin wax. Sections were stained with hematoxylin and eosin (H&E) for examination by light microscopy for joint tissue diagnosis and pathological diagnosis. Sections were stained with both toluidine blue and eosin contrast stain for examination by light microscopy to evaluate the proteoglycan composition of articular cartilage.

[0197] The tibio-talar joint inflammation and joint damage were investigated by using an adaptive three-parameter scoring system. Inflammation was scored on a scale of 0 to 3 (0 indicating no inflammation and 3 indicating a severely inflamed joint) depending on the relative ratio of inflammatory cells in the synovial tissue. Cartilage destruction was scored on a scale of 0 to 3, with the results ranging from the appearance of dead chondrocytes and empty lacunae to the complete loss of articular cartilage. The loss of proteoglycan in cartilage was scored on a scale of 0 to 3, with the results here ranging from cartilage completely stained by toluidine blue to the complete loss of articular cartilage. For each group, a composite score was calculated for all parameters. The tissue diagnosis score was expressed as mean ± standard error.

[0198] Vehicle-treated animals developed significant arthropathy characterized by synovial inflammatory cell infiltration, articular cartilage degradation, and increased loss of articular proteoglycans (Figure 13A). Compared with the control + PBS group, the pristane + PBS group had increased synovial inflammation (2.7 ± 0.3 vs. 0.0 ± 0.0), increased cartilage destruction (2.0 ± 1.0 vs. 0.0 ± 0.0), and increased loss of proteoglycans (2.7 ± 0.3 vs. 0.0 ± 0.0) compared with the negative control animal group (Figure 13A - 13E, p <.05). Compared with the pristane + PBS group (2.7 ± 0.3), all treatment groups - pristane + MTX (0.7 ± 0.3), p.a. MBV (1.7 ± 0.7), and i.v. MBV (0.7 ± 0.3) - showed reduced synovial infiltration and synovial inflammation by histological scoring (Figure 13A - 13E, p <.05). There was no significant difference between the pristane + PBS group and the three treatment groups with respect to cartilage destruction and loss of proteoglycans, but all three treatment groups showed a reduction in these parameters (Figure 13C and D., p >.05). Compared with the pristane + PBS group, all treatment groups - again pristane + MTX, p.a. MBV, and i.v. MBV - showed a decrease in the cumulative score of all three parameters (pristane + PBS (7.3 ± 1.2) vs. pristane + MTX (2.3 ± 0.3), and pristane + i.v. MBV (2.3 ± 0.3)) (Figure 2.E., p <.05). No difference was observed among the three treatment groups across all three histological parameters (Figure 12A - 13E, p >.05). This data indicates that systemic administration is effective and non-toxic.

[0199] (Example 4) Matrix-bound nanovesicles reduce inflammatory cell infiltration and promote the modulation of pro-inflammatory synovial M1-like macrophages to anti-inflammatory M2-like macrophages. Using tissue sections from the aforementioned samples, the macrophage phenotypes in synovial tissue adjacent to the tibio-talar joint were evaluated using immunohistochemistry. Paraffin-embedded tissue sections were deparaffinized using three progressive washes with xylene, followed by rehydration using an ethanol exchange that gradually decreased from 100% to 70% ethanol. Antigen retrieval was performed using a commercially available DeCal solution according to the manufacturer's protocol (BioGenex). Sections were then blocked for 1 hour at room temperature using 5% bovine serum albumin in 1× tris-buffered saline, pH 7.4. After blocking, sections were incubated for approximately 18 hours at 4°C with the following primary antibodies and dilutions: goat anti-CD68 (1:100), rabbit anti-TNF alpha (1:100), and mouse anti-CD206 (1:100). After primary antibody incubation, sections were incubated for 1 hour at room temperature with the following fluorescent-conjugated secondary antibodies: anti-rabbit ALEXAFLUOR® 300, anti-mouse ALEXAFLUOR® 488, and anti-goat ALEXAFLUOR® 594. Sections were counterstained with DRAQ5 nuclear stain and imaged.

[0200] The imbalance between inflammatory promoting M1-like macrophages and M2-like macrophages is an important component of the RA pathology. Compared with control + PBS, pristane + PBS increased the ratio of synovial TNF-alpha+ / CD68+, M1-like macrophages to synovial CD206+ / CD68+, M2 macrophages (3.9 ± 0.9 vs. 1.5 ± 0.2, Figures 14A and 14B, p <.05). The ratio of M1-like macrophages:M2-like macrophages was decreased in pristane + MTX (0.7 ± 0.4, Figures 14A and 14B, p <.05), pristane + p.a. MBV (1.0 ± 0.4, Figures 14A and 14B, p <.05), and pristane + i.v. MBV (0.7 ± 0.4, Figures 14A and 14B., p <.05) compared with pristane + PBS. There was no significant difference in the ratio of M1-like macrophages:M2-like macrophages between treatment conditions, nor was there a significant difference between treatment conditions and the control + PBS group (Figures 14A and 14B, p >.05). There was no difference in the ratio of M2-like macrophages:M1-like macrophages between the treatment groups, the control + PBS group, and the pristane + PBS group (Figures 14A and 14C). Although not statistically significant, an increase in the ratio of M2-like macrophages:M1-like macrophages was observed in the synovium of animals in all three experimental treatment groups compared with control + PBS and pristane + PBS (Figures 14A and 14C).

[0201] (Example 5) Matrix-bound nanovesicles prevent detrimental bone remodeling and joint destruction in a pristane-induced arthritis model Micro-computed tomography (micro-CT) images of the hind paws were acquired after sacrifice on day 100 of the animals studied in Example 2. 3D images were rendered using composite serial cross-sectional images. They are shown in Figures 15A - B.

[0202] Compared to the pristane + PBS group, all three treatment groups substantially reduced qualitative bone damage and joint degeneration when observed by micro-CT imaging and 3D reconstruction of the joints. In the front paws, i.p. MTX, p.a. MBV, and i.v. MBV administration substantially prevented harmful bone remodeling compared to the vehicle control. These preventive changes occurred in both the front and hind paws of the animals. In the front paws, damage was observed at the joints of the ulna and radius and the small carpal bones of the front paws, with slight changes in the more distal interphalangeal and metacarpophalangeal joints (Figure 15A). In the hind paws, harmful remodeling was observed mainly at the joints of the tibia and talus, as revealed by the fusion (ligamentous union) and absence of this joint by micro-CT (Figure 15B). Again, this data indicates that systemic administration of MBV significantly reduces qualitative bone and joint damage caused by RA. These effects were similar to those of perijoint administration of MBV. This surprisingly indicates that there was no dilution effect with systemic administration of MBV.

[0203] (Example 6) Use of Matrix-Bound Vesicles (MBV) for the Treatment of Collagen-Induced Arthritis UBM, and MBV derived from UBM, are prepared using the methodology described in Example 2.

[0204] In 8-week-old female Sprague-Dawley rats, collagen-induced arthritis is induced by subcutaneous injection of 100 μL of 200 μg / mL type II bovine collagen in an emulsion containing Freund's incomplete adjuvant into the dorsal side of the tail, 1 cm distal from the base on day 0 of the study. Control animals are not given an intradermal type II collagen emulsion on day 0. A second dose of 100 μL of 200 μg / mL type II collagen emulsion is administered subcutaneously approximately 1 cm distal from the base of the tail on the back on day 7. Animals given the type II collagen emulsion are housed together in a cage. Animals given the type II collagen emulsion are randomly assigned to the following experimental groups: type II collagen emulsion only, methotrexate, perijoint MBV, and intravenous MBV. Arthritis scores are determined for each animal on days 7, 10, 14, 17, 21, 28, and then weekly until day 100. Photographs of each forepaw and hindpaw are taken from the perspective of the plantar and palmar surfaces, respectively. Arthritis is evaluated using a 60-point arthritis scoring criterion: 1 point is given to each inflamed knuckle or toe, and 5 points or less are assigned to the affected ankle joint (15 points per foot, 60 points per rat). Animals designated for type II collagen emulsion only are not given any treatment on days 7, 10, 14, 17, and 21. Methotrexate animals are given 0.1 mg / kg of methotrexate in 1× sterile PBS by intraperitoneal delivery on days 7, 10, 14, 17, and 21. Perijoint MBV animals are given 25 μL of 500 μg / mL porcine-derived UBM MBV by delivery to the plantar and palmar surfaces of the hindpaw and forepaw, respectively. Intravenous MBV group animals are given 100 μL of 500 μg / mL UBM MBV by intravenous delivery into the lateral tail vein of the animal. Four animals in each group are assigned to a 28-day short-term study, and four animals are assigned to a 100-day study. The sample size is determined using a pre-determined effect size of methotrexate with alpha 0.05 and beta 0.80. Arthritis scores are expressed as the mean + / - standard error of the mean. Two-way analysis of variance with Tukey's post hoc correction is used to analyze group differences. Significance is determined with an alpha of 0.05 prior to the study.

[0205] The results demonstrate that animals treated with MBV exhibit significantly reduced arthritis scores compared to untreated control animals, and that the arthritis scores of MBV-treated animals are equivalent to those of methotrexate-treated animals. Furthermore, intravenous MBV treatment is found to be as effective as perijoint MBV treatment. These data demonstrate that MBV treatment for arthritis is as effective as methotrexate, the gold standard for the treatment of arthritis. Additionally, the data demonstrate that systemic administration of MBV has the same therapeutic efficacy as local administration in the treatment of rheumatoid arthritis, and that the initial administration of MBV, either systemically or locally, can have a therapeutic effect in alleviating arthritis symptoms for several weeks to several months after the initial administration of MBV, thereby reducing the severity or frequency of subsequent flares of rheumatoid arthritis symptoms, or even eliminating such flares.

[0206] (Example 7) Use of matrix-bound vesicles (MBV) for the treatment of psoriasis Preparation of urinary bladder matrix (UBM): UBM was prepared as previously described (Mase VJ, et al. Orthopedics. 2010; 33 (7): 511). Porcine bladders from market-weight animals were obtained from Tissue Source, LLC. Briefly, the serosa, outer muscular layer, submucosa, and muscularis mucosa were mechanically removed. The luminal urothelial cells of the mucosa were dissociated from the basement membrane by washing with deionized water. The remaining tissue consisted of the basement membrane and the underlying lamina propria of the mucosa and was decellularized by stirring at 300 rpm for 2 hours in 0.1% peracetic acid containing 4% ethanol. The tissue was then extensively rinsed with PBS and sterile water. The UBM was then lyophilized and crushed into microparticles using a Wiley Mill with a #60 mesh screen.

[0207] Isolation of Matrix-Bound Nanovesicles: MBVs were isolated from porcine bladder matrix (UBM) generated in the laboratory by enzymatic digestion with Liberase TL (high-purity collagenase I and collagenase II) in buffer (50 mM Tris pH 7.5, 5 mM CaCl 2 , 150 mM NaCl) for 24 hours at room temperature using an orbital shaker. The digested ECM was then subjected to centrifugation at 10,000×g (30 minutes) to remove ECM debris. The clarified supernatant containing the released MBVs was then centrifuged at 100,000×g (Beckman Coulter Optima L-90K Ultracentrifuge) for 2 hours at 4°C to pellet the MBVs.

[0208] Induction and treatment regimen of psoriasis: In 8-week-old female C57 / bl6 mice, psoriasis was induced by daily topical application of 62.5 mg of 5% imiquimod cream to the shaved back and right auricle of the mice for 7 days. Images of the shaved back and right auricle of the animals over 7 days are shown in Figure 16. Control animals were not topically treated with imiquimod throughout the study. Instead, they were given topical administration of petrolatum to the shaved back and right auricle. The treatment groups and treatment paradigms were divided into prevention of psoriasis flares and management of existing flares. Animals receiving preventive treatment were treated between days 0 and 16 of the study, and animals receiving management therapy were treated between days 7 and 16 of the study. Animals receiving intravenous MBV were given 500 μg / mL of porcine-derived UBM MBV on each day of the study as specified by the treatment timeline. From day 0 to day 7, erythema, scaling, and thickness were scored using an objective scoring system modified from the clinical psoriasis area severity index (PASI) by two independent reviewers. Scores of 0 to 4, where 0 = none, 1 = mild, 2 = moderate, 3 = marked, 4 = very marked, were assigned to erythema and scaling. On each day, the thickness of the right auricle was measured using a micrometer, and the skin thickness was scored based on the increase in thickness compared to a predetermined day (-1 day: 20 - 40%, -2 days: 40 - 60%, -3 days: 60 - 80%, -4 days: >80%). The total scores from each index were summed, and the overall measure of psoriatic inflammation was represented as a 12-point overall scale (0 - 12). The cumulative psoriasis score (PASI) of the animals from day 0 to day 7 is shown in Figure 17.

[0209] Statistical analysis: The sample size was determined using a pre-determined effect size of acitretin with alpha 0.05 and beta 0.80. The psoriasis area severity index (PASI) scores were expressed as mean ± standard error of the mean. Two-way analysis of variance with Tukey's post hoc correction was used to analyze group differences. Significance was determined with an alpha of 0.05 before the study.

[0210] As demonstrated by the provided PASI scores and images of the animals, systemic administration of MBV reduces erythema and scaling in imiquimod-induced psoriasis. In addition, systemic administration of MBV reduces skin thickness in imiquimod-induced psoriasis. The PASI scores of MBV-treated animals were significantly lower than those of untreated animals. This indicates that systemic MBV is a viable treatment for treating psoriasis.

[0211] (Example 8) MBV does not produce an immunosuppressive effect The immunotoxicity of systemically delivered MBV was evaluated using an immunosuppression and immunotoxicity keyhole limpet hemocyanin (KLH) rat model. Eight-week-old Sprague-Dawley rats were divided into four separate groups: a KLH control used to demonstrate a normal anti-KLH response after immunization with KLH, a vehicle control used to account for any potential effects unrelated to treatment or KLH immunization, a cyclophosphamide positive control as a potent immunosuppressant, and an MBV treatment group to evaluate the effect of MBV administration on systemic immunity. On day 0, cyclophosphamide-treated animals were given 200 mg / kg i.p., and MBV-treated animals were given 1 mg / ml UBM MBV by intravenous delivery on days 0, 3, and 6. On day 7, all groups except the vehicle control were immunized i.p. with 0.4 mL of 1000 μg / ml reconstituted KLH in Freund's incomplete adjuvant. On days 14, 21, and 28 (7, 14, and 21 days after immunization), whole blood was collected from the lateral tail vein, and serum was isolated for analysis of anti-KLH IgM and IgG. Anti-KLH IgM and IgG were evaluated in the sera of all animals using ELISA. The results are shown in Figure 18 (anti-KLH IgM levels) and Figure 19 (anti-KLH IgG levels).

[0212] As shown in FIGS. 18 and 19, systemic administration of MBV prior to immunization with KLH does not affect the ability of the host animal to initiate a normal IgG or IgM antibody response to the KLH antigen. Cyclophosphamide, a known immunosuppressant, significantly reduces anti-KLH IgG and IgM levels on days 7, 14, and 21 compared to the vehicle + KLH control. There is no significant difference in the levels of IgG or IgM produced between the vehicle + KLH control animals and the MBV-treated animals.

[0213] These results demonstrate that systemic administration of MBV does not suppress the physiological antibody immune response, and in contrast to other standard treatments for autoimmune diseases, such as immunosuppressive agents (like methotrexate and cyclophosphamide), MBV can be used to treat RA and other autoimmune diseases without suppressing the immune system. Thus, the use of MBV to treat autoimmune diseases can avoid the side effects of immunosuppressive therapy, such as infections and cancers.

[0214] Considering the many possible embodiments to which the principles of the disclosed subject matter can be applied, it should be understood that the described embodiments are merely examples of the present disclosure and should not be construed as limiting the scope of the present disclosure. More precisely, the scope of the present disclosure is defined by the following claims. (Item 1) A method for treating an autoimmune disorder in a subject in need thereof, comprising the step of administering to the subject, by systemic administration, a pharmaceutical preparation comprising a therapeutically effective amount of isolated matrix-bound vesicles (MBVs) derived from the extracellular matrix, whereby the autoimmune disorder is treated. (Item 2) The method according to item 1, wherein the autoimmune disorder is an autoimmune disorder other than in the eye. (Item 3) The method according to item 1 or 2, wherein the autoimmune disorder is not rheumatoid arthritis, scleroderma, or ulcerative colitis. (Item 4) The method according to item 1 or 2, wherein the autoimmune disorder is selected from Addison's disease, alopecia areata, ankylosing spondylitis, antiphospholipid antibody syndrome, autoimmune hepatitis, celiac disease, Crohn's disease, Goodpasture syndrome, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, immune thrombocytopenia, IgA nephropathy, inflammatory bowel disease (IBD), multiple sclerosis, myasthenia gravis, pemphigoid, pemphigus, type 2 polyendocrine autoimmune syndrome, psoriasis, psoriatic arthritis, rheumatoid arthritis, scleroderma, Sjögren's syndrome, systemic lupus erythematosus, Takayasu arteritis, type 1 diabetes, ulcerative colitis, autoimmune encephalitis, or undifferentiated connective tissue disease (UCTD). (Item 5) The method according to any one of items 1 to 3, wherein the autoimmune disorder is selected from Addison's disease, alopecia areata, ankylosing spondylitis, antiphospholipid antibody syndrome, autoimmune hepatitis, celiac disease, Crohn's disease, Goodpasture syndrome, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, immune thrombocytopenia, IgA nephropathy, multiple sclerosis, myasthenia gravis, pemphigoid, pemphigus, type 2 polyendocrine autoimmune syndrome, psoriasis, psoriatic arthritis, Sjögren's syndrome, systemic lupus erythematosus, Takayasu arteritis, type 1 diabetes, autoimmune encephalitis, or undifferentiated connective tissue disease (UCTD). (Item 6) The method according to item 1, 2 or 4, wherein the autoimmune disorder is rheumatoid arthritis. (Item 7) The method according to item 1, 2 or 4, wherein the autoimmune disorder is scleroderma. (Item 8) The method according to item 1, 2 or 4, wherein the autoimmune disorder is ulcerative colitis. (Item 9) The method according to any one of items 1 to 5, wherein the autoimmune disorder is pemphigus. (Item 10) The method according to any one of items 1 to 5, wherein the autoimmune disorder is pemphigoid. (Item 11) The method according to any one of items 1 to 5, wherein the autoimmune disorder is Crohn's disease. (Item 12) The method according to any one of items 1 to 5, wherein the autoimmune disorder is psoriasis. (Item 13) The method according to any one of items 1 to 5, wherein the autoimmune disorder is psoriatic arthritis. (Item 14) The method according to any one of items 1 to 5, wherein the autoimmune disorder is multiple sclerosis. (Item 15) The method according to any one of items 1 to 5, wherein the autoimmune disorder is systemic lupus erythematosus. (Item 16) The method according to any one of items 1 to 5, wherein the autoimmune disorder is autoimmune encephalitis. (Item 17) The method according to any one of items 1 to 16, wherein the subject experiences a therapeutic benefit over a long period measured from the start of administration of the MBV or measured from the end of administration of the MBV. (Item 18) The method according to any one of items 1 to 17, wherein the subject experiences a therapeutic benefit lasting for at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, or at least 3 months starting from the administration of MBV. (Item 19) The method according to any one of items 1 to 17, wherein the subject experiences a therapeutic benefit lasting for at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, or at least 3 months measured from the end of administration of the MBV. (Item 20) The method according to item 18 or item 19, wherein the therapeutic benefit from the administration lasts for at least 1 month. (Item 21) The method according to item 18 or item 19, wherein the therapeutic benefit from the administration lasts for at least 2 months. (Item 22) The method according to item 18 or item 19, wherein the therapeutic benefit from the administration lasts for at least 3 months or longer. (Item 23) The method according to item 18 or item 19, wherein the therapeutic benefit from the administration lasts for at least 6 months. (Item 24) The method according to any one of items 1 to 23, wherein the systemic administration is selected from intravenous administration, oral administration, enteral administration, parenteral administration, intranasal administration, rectal administration, sublingual administration, oral administration, sublabial administration, intraperitoneal administration, subcutaneous or intramuscular administration. (Item 25) The method according to item 24, wherein the systemic administration is intravenous administration. (Item 26) The MBV is administered in an amount of 1×10 6 ~1×10 12 per 1 kg of body weight per administration, according to any one of items 1 to 25. (Item 27) The method according to item 26, wherein the MBV is administered intravenously. (Item 28) The MBV is administered once a week for 4 weeks, once a week for 3 weeks, once a week for 2 weeks, once a week for 1 week, twice a week for 4 weeks, twice a week for 3 weeks, twice a week for 2 weeks, twice a week for 1 week, three times a week for 4 weeks, three times a week for 3 weeks, three times a week for 2 weeks, three times a week for 1 week, four times a week for 1 week, four times a week for 2 weeks, four times a week for 3 weeks, or four times a week for 4 weeks, according to any one of items 1 to 18. (Item 29) A method for treating psoriasis in a subject in need thereof, comprising administering to the subject a pharmaceutical preparation comprising a therapeutically effective amount of an isolated MBV derived from the extracellular matrix, whereby the psoriasis in the subject is treated. (Item 30) The method according to item 29, comprising the step of systemically administering the pharmaceutical preparation to the subject. (Item 31) The method according to item 29, comprising the step of topically administering the pharmaceutical preparation to the subject. (Item 32) The method according to any one of items 1 to 31, wherein the therapeutic benefit to the subject is a reduction in the symptoms of the disorder that existed prior to administration of the MBV. (Item 33) The method according to any one of items 1 to 32, wherein the therapeutic benefit to the subject is a decrease in the level of inflammation in the subject compared to the level of inflammation prior to administration of the MBV. (Item 34) The method according to any one of items 1 to 33, wherein the therapeutic benefit is remission of the disorder. (Item 35) The method according to any one of items 1 to 34, wherein the therapeutic benefit is a reduction in the flare of the symptoms of the disorder or the disappearance of the flare of the symptoms of the disorder during the above period. (Item 36) (i) The MBV does not express one or more of CD63, CD81, and / or CD9, or has CD63, CD81, and / or CD9 at levels that are hardly detectable; and / or (ii) The MBV is (a) A phospholipid content composed of at least 55% phosphatidylcholine (PC) and phosphatidylinositol (PI) combined; (b) A phospholipid content composed of sphingomyelin (SM) of 10% or less; (c) A phospholipid content composed of phosphatidylethanolamine (PE) of 20% or less; and / or (d) A phospholipid content composed of phosphatidylinositol (PI) of 15% or more The method according to any one of items 1 to 35, comprising the above. (Item 37) The method according to any one of items 1 to 36, wherein the MBV is derived from the extracellular matrix of cells of the bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessel, lung, bone, muscle, pancreas, stomach, spleen, colon, adipose tissue or esophagus. (Item 38) The method according to any one of items 1 to 36, wherein the MBV is derived from bladder matrix (UBM), small intestinal submucosa (SIS), or urinary bladder submucosa (UBS). (Item 39) The method according to any one of items 1 to 38, wherein the MBV is derived from the extracellular matrix of mammalian vertebrates selected from humans, monkeys, pigs, cows or sheep. (Item 40) A pharmaceutical preparation comprising a therapeutically effective amount of extracellular matrix-derived isolated matrix-bound vesicles (MBV) for use in the method according to any one of items 1 to 39. (Item 41) The pharmaceutical preparation according to item 40, formulated for systemic administration. (Item 42) The pharmaceutical preparation according to item 41, wherein the systemic administration is intravenous administration. (Item 43) The pharmaceutical preparation according to item 41, wherein the autoimmune disorder is rheumatoid arthritis. (Item 44) The pharmaceutical preparation according to item 40, wherein the autoimmune disorder is psoriasis. (Item 45) The pharmaceutical preparation according to item 44, formulated for topical administration. (Item 46) The pharmaceutical preparation according to item 45, wherein the topical administration is topical skin administration.

Claims

**Claim 1** A pharmaceutical preparation for treating autoimmune disorders in a subject in need thereof, comprising isolated matrix-bound vesicles (MBVs) derived from the extracellular matrix of urinary bladder matrix (UBM), small intestinal submucosa (SIS), or urinary bladder submucosa (UBS), characterized in that it is administered to the subject by systemic administration, whereby the autoimmune disorder is treated, and the autoimmune disorder is rheumatoid arthritis, psoriasis, or psoriatic arthritis. **Claim 2** The pharmaceutical preparation according to claim 1, wherein the autoimmune disorder is rheumatoid arthritis. **Claim 3** The pharmaceutical preparation according to claim 1, wherein the autoimmune disorder is psoriasis. **Claim 4** The pharmaceutical preparation according to claim 1, wherein the autoimmune disorder is psoriatic arthritis. **Claim 5** The subject experiences a therapeutic benefit lasting for at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, or at least 6 months measured from the start of administration of the pharmaceutical preparation, or ii) experiences a therapeutic benefit lasting for at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, or at least 6 months measured from the end of administration of the pharmaceutical preparation. The pharmaceutical preparation according to any one of claims 1 to 4. **Claim 6** The subject experiences a therapeutic benefit lasting for at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, or at least 3 months measured from the start of administration of the pharmaceutical preparation. The pharmaceutical preparation according to any one of claims 1 to 5. **Claim 7** The subject experiences a therapeutic benefit lasting for at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, or at least 3 months measured from the end of administration of the pharmaceutical preparation. The pharmaceutical preparation according to any one of claims 1 to 5. **Claim 8** The pharmaceutical preparation according to claim 6 or claim 7, wherein the therapeutic benefit from the administration lasts for at least 1 month. **Claim 9** The pharmaceutical preparation according to claim 6 or claim 7, wherein the therapeutic benefit from the administration lasts for at least 2 months. **Claim 10** The pharmaceutical preparation according to claim 6 or claim 7, wherein the therapeutic benefit from the administration lasts for at least 3 months or longer. **Claim 11** The pharmaceutical preparation according to claim 6 or claim 7, wherein the therapeutic benefit from said administration persists for at least 6 months.

12. The pharmaceutical preparation according to any one of claims 1 to 11, wherein the systemic administration is intravenous administration, oral administration, enteral administration, parenteral administration, intranasal administration, rectal administration, sublingual administration, oral administration, sublabial administration, intraperitoneal administration, subcutaneous or intramuscular administration.

13. The pharmaceutical preparation according to any one of claims 1 to 11, wherein the systemic administration is intravenous administration.

14. The MBV is administered in an amount of 1×10 ６ to 1×10 １２ per kg of body weight per administration, and the pharmaceutical preparation according to any one of claims 1 to 13.

15. The pharmaceutical preparation according to claim 14, which is administered intravenously.

16. The pharmaceutical preparation according to any one of claims 1 to 6, which is administered once a week for 4 weeks, once a week for 3 weeks, once a week for 2 weeks, once a week for 1 week, twice a week for 4 weeks, twice a week for 3 weeks, twice a week for 2 weeks, twice a week for 1 week, three times a week for 4 weeks, three times a week for 3 weeks, three times a week for 2 weeks, three times a week for 1 week, four times a week for 1 week, four times a week for 2 weeks, four times a week for 3 weeks, or four times a week for 4 weeks.

17. A pharmaceutical preparation comprising isolated MBV derived from the extracellular matrix of bladder matrix (UBM), small intestinal submucosa (SIS), or urinary bladder submucosa (UBS) for treating psoriasis in a subject in need thereof, characterized in that it is administered to the subject, whereby the psoriasis in the subject is treated.

18. The pharmaceutical preparation according to claim 17, characterized in that it is systemically administered to the subject.

19. The pharmaceutical preparation according to claim 17, characterized in that it is topically administered to the subject.

20. The pharmaceutical preparation according to any one of claims 1 to 16, wherein the therapeutic benefit for the subject is a reduction in the symptoms of the disorder that existed prior to administration of the pharmaceutical preparation.

21. The pharmaceutical preparation according to any one of claims 1 to 16 and 20, wherein the therapeutic benefit for the subject is a decrease in the level of inflammation in the subject compared to the level of inflammation prior to administration of the pharmaceutical preparation.

22. The pharmaceutical preparation according to any one of claims 1 to 16, 20, and 21, wherein the therapeutic benefit is remission of the disorder.

23. The pharmaceutical preparation according to any one of claims 5 to 11, wherein the therapeutic benefit is a reduction in the flare of the symptoms of the disorder or the disappearance of the flare of the symptoms of the disorder during the above period.

24. (i) the MBV does not express one or more of CD63, CD81, and / or CD9, or has a level of CD63, CD81, and / or CD9 that is hardly detectable; and / or (ii) the MBV (a) a phospholipid content composed of at least 55% phosphatidylcholine (PC) and phosphatidylinositol (PI) combined; (b) a phospholipid content composed of 10% or less sphingomyelin (SM); (c) a phospholipid content composed of 20% or less phosphatidylethanolamine (PE); and / or (d) a phospholipid content composed of 15% or more phosphatidylinositol (PI) The pharmaceutical preparation according to any one of claims 1 to 23, comprising.

25. The pharmaceutical preparation according to any one of claims 1 to 24, wherein the MBV is derived from an extracellular matrix from a mammalian vertebrate selected from human, monkey, pig, cow, or sheep.

26. The pharmaceutical preparation according to any one of claims 1 to 25, wherein the MBV is derived from urinary bladder matrix (UBM) or urinary bladder submucosa (UBS).

Images