Synthetic Lipids for mRNA Delivery

Abstract

Provided is a method for treating a lipoprotein metabolism disorder or a cardiovascular disease in a human, comprising administering to a subject in need thereof lipidoid nanoparticles comprising a lipid, CRISPR / Cas9 mRNA and a single guide RNA (sgRNA).

Description

Cross - Reference to Related Applications

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 857,111, filed on June 4, 2019, the content of which is incorporated herein by reference in its entirety. Government Support

[0002] This invention was made with government support under Grant Numbers EB024041 and TR002636 from the National Institutes of Health. The government has certain rights in the invention. BACKGROUND OF THE INVENTION

[0003] Angiopoietin-like 3 (ANGPTL3) is an enzyme that regulates plasma lipoprotein concentrations. There are humans with ANGPTL3 deficiency caused by naturally occurring loss-of-function mutations in the ANGPTL3 gene. These patients show a decrease in blood triglycerides (TG) and low-density lipoprotein cholesterol (LDL-C), but there are no obvious clinical risks or complications resulting from this deficiency. Recent genetic and pharmacological studies have validated this finding and shown that knockdown of ANGPTL3 may have some protective effect, making ANGPTL3 an attractive therapeutic target for treating human lipoprotein metabolism disorders. Two different therapeutic inhibition strategies for ANGPTL3 have recently been validated. In one clinical trial, the monoclonal antibody evinacumab, which targets ANGPTL3, was shown to effectively lower LDL-C and TG levels in healthy human volunteers. These results are consistent with studies that found that administration of antisense oligonucleotides (ASO) targeting the messenger RNA (mRNA) of ANGPTL3 achieved a decrease in lipid levels and suppression of the progression of atherosclerosis in mice. Furthermore, in humans, a decrease in atherogenic lipoprotein levels was also observed, and no serious adverse events were recorded in a phase I randomized clinical trial. These results strongly demonstrate that therapeutic antagonism of ANGPTL3 is effective and safe in lowering lipid levels and reducing the incidence of atherosclerotic cardiovascular disease.

[0004] The CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats [CRISPR] / CRISPR-associated protein 9) system is one of the most revolutionary genome editing tools. CRISPR / Cas9 introduces double-strand breaks (DSBs) in DNA in a targeted (sequence-specific) manner and then repairs the DSBs by non-homologous end joining (NHEJ) or homology directed repair (HDR). Compared with conventional ASO or antibody therapies that are transient, the CRISPR / Cas9 system can induce permanent loss-of-function target gene mutations that result in long-term therapeutic effects in edited cells, and CRISPR / Cas9 is considered a promising candidate for the treatment of human diseases. However, the safe, efficient, and specific delivery of the CRISPR / Cas9 machinery remains a very major technical challenge and limits the therapeutic application of this technology. The use of viral vectors (such as adenoviruses or adeno-associated viruses) often results in very high editing efficiency but has significant safety risks regarding unwanted insertional mutagenesis and potential biosafety concerns, thus restricting their application. In comparison, non-viral nanoparticles with better safety profiles (such as lipid nanoparticles (LNPs), gold nanoparticles, and polymer nanoparticles, etc.) have typically been developed for the delivery of CRISPR plasmid DNA, messenger RNA (mRNA), and ribonucleoprotein (RNP) at the expense of reduced delivery efficiency. CRISPR delivery in each of the DNA, mRNA, and RNP modalities has potential strengths, but mRNA delivery may be particularly promising for in vivo genome editing applications. Summary of the Invention Means for Solving the Problems

[0005] In one aspect, the present disclosure is a method for treating human lipoprotein metabolism disorders or cardiovascular diseases, comprising administering to a subject in need thereof a lipidoid nanoparticle comprising a lipid, CRISPR / Cas9 mRNA, and a single guide RNA (sgRNA), wherein the sgRNA is single guide angiopoietin-like protein 3 (sgANGPTL3) or single guide proprotein convertase subtilisin / kexin type 9 (sgPCSK9); the lipid is of formula I:

Chemical formula

Chemical formula

Chem.

[0006] In another aspect, the disclosure provides a lipid selected from the group consisting of the following.

Chem.

Brief Description of the Drawings

[0007]

Figure 1A

Figure 1B

Figure 2A

Figure 2B

Figure 2C

Figure 3A

Figure 3B

Figure 3C

Figure 3D

Figure 4A

Figure 4B

Figure 4C

Figure 4D

Figure 5A

Figure 5B

Figure 5C

Figure 6A

Figure 6B

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15A

Figure 15B

Figure 15C

Figure 16A

Figure 16B

Figure 16C

Figure 16D

Figure 16E

Figure 16F

Figure 17A

Figure 17B

Figure 17C

Figure 18A

Figure 18B

Figure 19A

Figure 19B

Figure 19C

Figure 20A

Figure 20B

Figure 21

Figure 22

Figure 23A

Figure 23B

Figure 24

Figure 25

Figure 26

Mode for Carrying Out the Invention

[0008] A new approach is disclosed for the systematic delivery of CRISPR / Cas9 by encapsulating Cas9 mRNA and sgRNA simultaneously into bioreducible lipid nanoparticles for efficient and very rapid genome editing in vitro and in vivo. Bioreducible lipid nanoparticles composed of hydrophobic tails containing disulfide bonds for mRNA delivery and CRISPR / Cas9 genome editing are also disclosed (Figure 1A and Figure 1B).

[0009] In the present disclosure, bioreducible lipids are identified to deliver reporter mRNA and Cas9 mRNA / sgRNA complexes both in vitro and in vivo by screening and optimization approaches. Bioreducible lipids can encapsulate mRNA via electrostatic interactions to assemble nanoparticles while releasing mRNA intracellularly in response to reductive chemical signals via a disulfide - bond exchange mechanism (Figure 1A).

[0010] The simultaneous delivery of Cas9 mRNA / sgRNA efficiently knocked out GFP expression in human embryonic kidney (HEK) cells, and effective gene knockout was observed more rapidly after Cas9 mRNA delivery, which represents a significant enhancement compared to Cas9 / sgRNA RNP delivery in terms of in vitro genome editing efficiency. Intravenous injection of the biodegradable lipid nanoparticles effectively knocked down mouse serum proprotein convertase subtilisin / kexin type 9 (PCSK9) to a very low level compared to untreated mice. The biodegradable lipid corresponds to one of the most efficient non-viral CRISPR / Cas9 genome editing deliveries reported to date.

[0011] In one aspect, the present disclosure is a method of treating human lipoprotein metabolism disorders or cardiovascular diseases, comprising administering to a subject in need thereof lipidoid nanoparticles comprising a lipid, CRISPR / Cas9 mRNA, and single-guide RNA (sgRNA), wherein the sgRNA is single-guide angiopoietin-like protein 3 (sgANGPTL3) or single-guide proprotein convertase subtilisin / kexin type 9 (sgPCSK9); the lipid is of formula I:

Chemical formula

Chemical formula

Chemical formula

[0012] In certain embodiments, R頭部 is [Chem.] .

[0013] In certain embodiments, R a and R a ’ are R 脂質 , H, or C 1 -C 20 alkyl.

[0014] In certain embodiments, R 頭部 is [Chem.] derived from a compound selected from the group consisting of.

[0015] In certain embodiments, R 1 and R 2 are H. In certain embodiments, R 1 is H; R 2 is OH.

[0016] In certain embodiments, R 3 and R 4 are H. In certain embodiments, R 3 and R 4 together form an oxo (=O) group.

[0017] In certain embodiments, Z is CH 2 , O, or NR 30 . In certain embodiments, Z is CH 2 . In certain embodiments, Z is O. In certain embodiments, Z is NR 30 .

[0018] In certain embodiments, m is 1 or 2.

[0019] In certain embodiments, n is an integer selected from 4 - 12. In certain embodiments, n is an integer selected from 6 - 10.

[0020] In certain embodiments, p is 0. In certain embodiments, p is 1.

[0021] In certain embodiments, q is an integer selected from 2 to 8. In certain embodiments, q is an integer selected from 4 to 8.

[0022] In certain embodiments, t is 0. In certain embodiments, t is 1.

[0023] In certain embodiments, R 脂質 is, independently of each other,

Chemical formula

[0024] In certain embodiments, the lipid is

Chemical formula

[0025] In certain embodiments, the ratio of lipid to CRISPR / Cas9 mRNA is from about 3:1 to about 15:1. In certain embodiments, the ratio of lipid to CRISPR / Cas9 mRNA is about 7.5:1.

[0026] In certain embodiments, the lipidoid nanoparticles further comprise cholesterol.

[0027] In certain embodiments, the ratio of lipid to cholesterol is from about 1:1 to about 2:1.

[0028] In certain embodiments, the lipidoid nanoparticles further comprise DOPE, DSPC, or DOPC, and DMG-PEG2K, DSPC has the following structure;

Chemical formula

[0029] In certain embodiments, the lipidoid nanoparticles further comprise DOPC and DMG-PEG2K.

[0030] In certain embodiments, the ratio of lipid to DOPC is from about 4:1 to about 6:1, and the ratio of lipid to DMG-PEG2K is from about 4:1 to about 100:1, or from about 4:1 to about 20:1.

[0031] In certain embodiments, the lipidoid nanoparticles have a particle size of from about 25 nm to about 1000 nm. In certain embodiments, the lipidoid nanoparticles have a particle size of from about 50 nm to about 500 nm.

[0032] In certain embodiments, human lipoprotein metabolism disorders are associated with loss-of-function mutations in the ANGPTL3 gene.

[0033] In certain embodiments, cardiovascular disease is associated with the proprotein convertase subtilisin / kexin type 9 gene (PCSK9).

[0034] In certain embodiments, human lipoprotein metabolism disorders are associated with a decrease in plasma high-density lipoprotein cholesterol, serum low-density lipoprotein cholesterol, or triglyceride levels.

[0035] In certain embodiments, human lipoprotein metabolism disorders are associated with low levels of plasma high density lipoprotein cholesterol, high levels of serum low density lipoprotein cholesterol, or high levels of triglycerides.

[0036] In certain embodiments, cardiovascular diseases are selected from the group consisting of homozygous familial hypercholesterolemia and hypercholesterolemia.

[0037] In another aspect, the present disclosure provides a lipid selected from the group consisting of the following.

Chemical formula

[0038] Definition Unless otherwise defined herein, scientific and technical terms used in this application shall have the meanings commonly understood by those skilled in the art. In general, the nomenclature and techniques described herein in connection with chemistry, cell and tissue culture, molecular biology, cell and cancer biology, neurobiology, neurochemistry, virology, immunology, microbiology, pharmacology, genetics, and protein and nucleic acid chemistry are well known and commonly used in the art.

[0039] The methods and techniques of the present disclosure, unless otherwise indicated, are generally carried out according to conventional methods described in various general and more specific references that are well known in the art and cited and discussed throughout this specification. See, for example, “Principles of Neural Science”, McGraw-Hill Medical, New York, N.Y. (2000); Motulsky, “Intuitive Biostatistics”, Oxford University Press, Inc. (1995); Lodish et al., “Molecular Cell Biology, 4th ed.”, W. H. Freeman & Co., New York (2000); Griffiths et al., “Introduction to Genetic Analysis, 7th ed.”, W. H. Freeman & Co., N.Y. (1999); and Gilbert et al., “Developmental Biology, 6th ed.”, Sinauer Associates, Inc., Sunderland, MA (2000).

[0040] Chemical terms used herein, unless otherwise defined herein, are used according to their conventional usage in the art as exemplified in “The McGraw-Hill Dictionary of Chemical Terms”, Parker S., Ed., McGraw-Hill, San Francisco, C.A. (1985).

[0041] As used herein, the terms “optional” or “optionally” mean that the subsequent recited event or circumstance may or may not occur, and that the description includes both the case where the event or circumstance occurs and the case where it does not. For example, “optionally substituted alkyl” means that the alkyl may or may not be substituted.

[0042] It is understood that the substituents and substitution patterns of the compounds of the present invention can be selected by those skilled in the art in order to result in chemically stable compounds that can be readily synthesized from starting materials readily available to those skilled in the art by techniques known in the art and the methods described below. When the substituent itself is substituted with a plurality of groups, it is understood that these plurality of groups may be on the same carbon or on different carbons as long as a stable structure is obtained.

[0043] As used herein, the term "optionally substituted" refers to the substitution of 1 to 6 hydrogen radicals in a given structure with radicals of the specified substituents including, but not limited to, hydroxyl, hydroxyalkyl, alkoxy, halogen, alkyl, nitro, silyl, acyl, acyloxy, aryl, cycloalkyl, heterocyclyl, amino, aminoalkyl, cyano, haloalkyl, haloalkoxy, -OCO-CH 2 -O-alkyl, -OP(O)(O-alkyl) 2 or -CH 2 -OP(O)(O-alkyl) 2 Preferably, "optionally substituted" refers to the substitution of 1 to 4 hydrogen radicals in a given structure with the above substituents. More preferably, 1 to 3 hydrogen radicals are substituted with the above substituents. It is understood that the substituents may be further substituted.

[0044] Articles such as "a", "an", and "the" can mean one or more unless indicated to the contrary or not apparent from the context. A claim or description that includes "or" between one or more members of a group is considered satisfied if, unless indicated to the contrary or not apparent from the context, one, two or more, or all of the members of the group are present in, employed in, or relevant to a given product or process. The present invention includes embodiments where exactly one member of the group is present in, employed in, or relevant to a given product or process. The present invention includes embodiments where two or more, or all of the members of the group are present in, employed in, or relevant to a given product or process.

[0045] As used herein, the term "alkyl" refers to a saturated aliphatic group including, but not limited to, a straight-chain alkyl group of C 1 -C 10 or a branched-chain alkyl group of C 1 -C 10 Preferably, the "alkyl" group refers to a straight-chain alkyl group of C 1 -C 6 or a branched-chain alkyl group of C 1 -C 6 Most preferably, the "alkyl" group refers to a straight-chain alkyl group of C 1 -C 4 or a branched-chain alkyl group of C 1 -C 4 Examples of "alkyl" include, but are not limited to, methyl, ethyl, 1-propyl, 2-propyl, n-butyl, sec-butyl, tert-butyl, 1-pentyl, 2-pentyl, 3-pentyl, neopentyl, 1-hexyl, 2-hexyl, 3-hexyl, 1-heptyl, 2-heptyl, 3-heptyl, 4-heptyl, 1-octyl, 2-octyl, 3-octyl or 4-octyl. The "alkyl" group may optionally be substituted.

[0046] The term "acyl" is technically recognized and refers to a group represented by the general formula hydrocarbylC(O)-, preferably alkylC(O)-.

[0047] The term "acylamino" is technically recognized and means an amino group substituted with an acyl group, and can be represented, for example, by the formula hydrocarbyl C(O)NH-. Yes.

[0048] The term "acyloxy" is recognized in the art and refers to a group represented by the general formula hydrocarbyl C(O)O-, preferably alkyl C(O)O-.

[0049] The term "alkoxy" refers to an alkyl group having an oxygen atom attached thereto. Representative alkoxy groups include methoxy, ethoxy, propoxy, tert-butoxy, and the like.

[0050] The term "alkoxyalkyl" refers to an alkyl group substituted with an alkoxy group and can be represented by the general formula alkyl-O-alkyl.

[0051] The term "alkyl" refers to a saturated aliphatic group including straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl-substituted cycloalkyl groups, and cycloalkyl-substituted alkyl groups. In a preferred embodiment, the straight-chain or branched-chain alkyl has 30 or fewer carbon atoms in its backbone (e.g., C 1-30 , in the case of a straight chain, and C 3-30 ) in the case of a branched chain, and more preferably 20 or fewer carbon atoms.

[0052] Furthermore, the term "alkyl" as used throughout this specification, the examples, and the claims is intended to include both unsubstituted and substituted alkyl groups, the latter referring to an alkyl moiety having a substituent that replaces one or more hydrogens on one or more carbons of the hydrocarbon backbone, including haloalkyl groups such as trifluoromethyl and 2,2,2-trifluoroethyl.

[0053] "C x-y " or "C x -C yThe term "」", when used in combination with chemical moieties such as acyl, acyloxy, alkyl, alkenyl, alkynyl, or alkoxy, means a group containing from x to y carbons in the chain. C 0 Alkyl refers to hydrogen when the group is at the terminal portion and a bond when it is internal. For example, C 1-6 The alkyl group contains from 1 to 6 carbon atoms in the chain.

[0054] As used herein, the term "alkylamino" refers to an amino group substituted with at least one alkyl group.

[0055] As used herein, the term "alkylthio" refers to a thiol group substituted with an alkyl group and can be represented by the general formula alkylS-.

[0056] As used herein, the term "amide" refers to the following group:

Chemical formula

[0057] The terms "amine" and "amino" are recognized in the art and refer to both unsubstituted and substituted amines, as well as their salts, and refer to moieties that can be represented, for example, by the following formula:

Chemical formula

[0058] As used herein, the term "aminoalkyl" refers to an alkyl group substituted with an amino group.

[0059] As used herein, the term "aralkyl" refers to an alkyl group substituted with an aryl group.

[0060] As used herein, the term "aryl" includes substituted or unsubstituted monocyclic aromatic groups in which each atom of the ring is carbon. Preferably, the ring is a 5- to 7-membered ring, more preferably a 6-membered ring. The term "aryl" also includes polycyclic ring systems having two or more cyclic rings in which two or more carbons are common to two adjacent rings, at least one of those rings being aromatic. For example, the other cyclic rings can be cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, and / or heterocyclyl. Examples of aryl groups include benzene, naphthalene, phenanthrene, phenol, aniline, and the like.

[0061] The term "carbamate" is recognized in the art and refers to the following group:

Chemical formula

[0062] As used herein, the term "carbocyclic alkyl" refers to an alkyl group substituted with a carbocyclic (carbocyclic) group.

[0063] The term "carbocyclic ring" includes monocyclic rings of 5 to 7 members and bicyclic rings of 8 to 12 members. Each ring of the bicyclic carbocyclic ring can be selected from saturated, unsaturated, and aromatic rings. The carbocyclic ring also includes bicyclic molecules in which one, two, or more atoms are shared between two rings. "Fused carbocyclic ring" refers to a bicyclic carbocyclic ring in which each ring shares two adjacent atoms with another ring. Each ring of the fused carbocyclic ring can be selected from saturated, unsaturated, and aromatic rings. In an exemplary embodiment, an aromatic ring, such as phenyl, can be fused to a saturated or unsaturated ring, such as cyclohexane, cyclopentane, or cyclohexene. As far as valence allows, any combination of saturated, unsaturated, and aromatic bicyclic rings is included in the definition of the carbocyclic ring. Exemplary "carbocyclic rings" include cyclopentane, cyclohexane, bicyclo[2.2.1]heptane, 1,5-cyclooctadiene, 1,2,3,4-tetrahydronaphthalene, bicyclo[4.2.0]octa-3-ene, naphthalene, and adamantane. Exemplary fused carbocyclic rings include decalin, naphthalene, 1,2,3,4-tetrahydronaphthalene, bicyclo[4.2.0]octane, 4,5,6,7-tetrahydro-1H-indene, and bicyclo[4.1.0]hepta-3-ene. The "carbocyclic ring" may be substituted at any one or more positions where a hydrogen atom can be present.

[0064] As used herein, the term "carbocyclylalkyl" means an alkyl group substituted with a carbocyclyl (carbocyclic) group.

[0065] The term "carbonate" is recognized in the art and refers to the group -OCO 2 -.

[0066] As used herein, the term "carboxy" refers to the group represented by the formula -CO 2 H.

[0067] As used herein, the term "ester" refers to the group -C(O)OR 9 wherein R 9 represents a hydrocarbyl group.

[0068] As used herein, the term "ether" refers to a hydrocarbyl group bonded to another hydrocarbyl group through oxygen. Thus, an ether substituent of a hydrocarbyl group can be hydrocarbyl-O-. The ether may be symmetric or asymmetric. Examples of ethers include, but are not limited to, heterocycle-O-heterocycle and aryl-O-heterocycle. Ethers include "alkoxyalkyl" groups that can be represented by the general formula alkyl-O-alkyl.

[0069] As used herein, the terms "halo" and "halogen" mean halogen and include chloro, fluoro, bromo, and iodo.

[0070] As used herein, the terms "hetaralkyl" and "heteroalkyl" refer to an alkyl group substituted with a hetaryl group.

[0071] The terms "heteroaryl" and "hetaryl" include substituted or unsubstituted aromatic monocyclic structures, preferably 5- to 7-membered rings, more preferably 5- to 6-membered rings, and the ring structure contains at least one heteroatom, preferably 1 to 4 heteroatoms, more preferably 1 or 2 heteroatoms. The terms "heteroaryl" and "hetaryl" also include polycyclic ring systems having two or more cyclic rings in which two or more carbons are common to two adjacent rings, and at least one of those rings is a heteroaromatic ring. For example, the other cyclic rings can be cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, and / or heterocycle. Examples of heteroaryl groups include, for example, pyrrole group, furan group, thiophene group, imidazole group, oxazole group, thiazole group, pyrazole group, pyridine group, pyrazine group, pyridazine group, pyrimidine group, and the like.

[0072] As used herein, the term "heteroatom" means an atom of any element other than carbon or hydrogen. Preferred heteroatoms are nitrogen, oxygen, and sulfur.

[0073] As used herein, the term "heterocyclylalkyl" refers to an alkyl group substituted with a heterocyclic group.

[0074] The terms "heterocyclyl", "heterocyclic", and "heterocyclic ring" refer to a substituted or unsubstituted non-aromatic ring structure, preferably a 3- to 10-membered ring, more preferably a 3- to 7-membered ring, the ring structure of which contains at least one heteroatom, preferably 1 to 4 heteroatoms, more preferably 1 or 2 heteroatoms. Also, the terms "heterocyclyl" and "heterocyclic ring" include polycyclic ring systems having two or more rings in which two or more carbons are common to two adjacent rings, at least one of these rings being a heterocyclic ring, for example, the other rings may be cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, and / or heterocyclyl. Examples of heterocyclyl groups include piperidine, piperazine, pyrrolidine, morpholine, lactone, lactam, and the like.

[0075] As used herein, the term "hydrocarbyl" refers to a group bonded through a carbon atom that does not have a substituent of =O or =S, typically having at least one carbon-hydrogen bond and mainly a carbon skeleton, but optionally may contain a heteroatom. Thus, groups such as methyl, ethoxyethyl, 2-pyridyl, and even trifluoromethyl are considered hydrocarbyl for the purposes of this application, but substituents such as acetyl (having a =O substituent on the linking carbon) and ethoxy (linked through oxygen rather than carbon) are not. Hydrocarbyl groups include, but are not limited to, aryl, heteroaryl, carbocyclic, heterocyclic, alkyl, alkenyl, alkynyl, and combinations thereof.

[0076] As used herein, the term "hydroxyalkyl" refers to an alkyl group substituted with a hydroxy group.

[0077] The term "lower", when used in combination with chemical moieties such as acyl, acyloxy, alkyl, alkenyl, alkynyl, or alkoxy, means a group having 10 or fewer, preferably 6 or fewer, atoms in the substituent. For example, "lower alkyl" refers to an alkyl group containing 10 or fewer, preferably 6 or fewer, carbon atoms. In certain embodiments, the acyl, acyloxy, alkyl, alkenyl, alkynyl, or alkoxy substituents as defined herein are each lower acyl, lower acyloxy, lower alkyl, lower alkenyl, lower alkynyl, or lower alkoxy, whether they appear alone or in combination with other substituents such as hydroxyalkyl and aralkyl (in which case, for example, the atoms in the aryl group are not counted when counting the carbon atoms in the alkyl substituent).

[0078] The terms "policyclic", "polycyclic", and "polycyclic ring" refer to two or more rings (e.g., cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, and / or heterocyclyl) in which two or more atoms are common to two adjacent rings, e.g., the rings are "fused rings". Each ring of the polycycle may or may not be substituted. In certain embodiments, each ring of the polycycle contains from 3 to 10 atoms, preferably from 5 to 7 atoms, within the ring.

[0079] The term "sulfate" is recognized in the art and refers to the group -OSO 3 H, or a pharmaceutically acceptable salt thereof.

[0080] The term "sulfonamide" is recognized in the art and refers to a group represented by the following general formula:

Chemical formula

[0081] The term "sulfoxide" is recognized in the art and refers to the group -S(O)-.

[0082] The term "sulfonate" is recognized in the art and refers to the group SO 3 H, or a pharmaceutically acceptable salt thereof.

[0083] The term "sulfone" is recognized in the art and refers to the group -S(O) 2 -.

[0084] The term "substituted" refers to a moiety having a substituent that replaces a hydrogen on one or more carbons of a backbone. "Substitution" or "substituted with" is understood to include the implicit condition that such substitution results in a stable compound that follows the valences of the substituted atoms and substituents and further does not spontaneously undergo transformations such as rearrangement, cyclization, elimination, etc. As used herein, the term "substituted" is intended to include all acceptable substituents of an organic compound. In a broad aspect, acceptable substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and non-aromatic substituents of an organic compound. Acceptable substituents can be one or more and can be the same or different for a suitable organic compound. For the purposes of the present invention, a heteroatom such as nitrogen can have any acceptable substituent of the organic compounds described herein that satisfies the valence of the hydrogen substituent and / or the heteroatom. Substituents can include any of the substituents described herein, for example, halogen, hydroxyl, carbonyl (such as carboxyl, alkoxycarbonyl, formyl, or acyl), thiocarbonyl (such as thioester, thioacetate, or thioformate), alkoxyl, phosphoryl, phosphate, phosphonate, phosphinate, amino, amide, amidine, imine, cyano, nitro, azide, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamide, sulfonyl, heterocyclyl, aralkyl, or an aromatic or heteroaromatic moiety. It will be understood by those skilled in the art that moieties substituted on a hydrocarbon chain can themselves be substituted where appropriate.

[0085] As used herein, the term "thioalkyl" refers to an alkyl group substituted with a thiol group.

[0086] The term "thioester" as used herein refers to the group -C(O)SR 9 or -SC(O)R 9 wherein R 9 represents a hydrocarbyl.

[0087] As used herein, the term "thioether" is equivalent to an ether in which oxygen is replaced by sulfur.

[0088] The term "urea" is recognized in the art and can be represented by the following general formula: [Chemical formula] wherein R 9 and R 10 each independently represents hydrogen or hydrocarbyl.

[0089] As used herein, the term "modulate" includes inhibiting or suppressing a function or activity (such as cell proliferation), as well as enhancing a function or activity.

[0090] The phrase "pharmaceutically acceptable" is recognized in the art. In certain embodiments, this term refers to compositions, excipients, adjuvants, polymers, and other materials and / or dosage forms that are suitable for use in contact with human and animal tissues within the scope of sound medical judgment, without undue toxicity, irritation, allergic reaction, or other problems or complications, and commensurate with a reasonable benefit / risk ratio.

[0091] As used herein, the term "salt" is used to refer to an acid addition salt or a base addition salt.

[0092] Many of the compounds useful in the methods and compositions of the present disclosure have at least one stereocenter in their structure. This stereocenter can exist in the R or S configuration, and the R and S notations are used in accordance with the rules described in Pure Appl. Chem. (1976), 45, 11-30. The present disclosure contemplates all stereoisomers (including all possible mixtures of stereoisomers) such as enantiomers and diastereoisomers of compounds, salts, prodrugs, or mixtures thereof. See, for example, WO 01 / 062726.

[0093] Furthermore, certain compounds containing an alkenyl group can exist as Z (zameen) or E (entgegen) isomers. In each case, this disclosure includes both the mixed isomers and the individual isomers.

[0094] Some of the compounds may exist in tautomeric forms. Such forms are not explicitly represented by the formulas described herein but are intended to be included within the scope of this disclosure.

[0095] "Pharmaceutically acceptable" means approved or approvable by a regulatory agency of the Federal or State government or the corresponding agency of a country other than the United States, or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeias for use in animals, particularly humans.

[0096] "Pharmaceutically acceptable salts" refer to salts of the compounds of the present invention that are pharmaceutically acceptable and have the desired pharmacological activity of the parent compound. In particular, such salts are non-toxic and can be inorganic or organic acid addition salts and base addition salts. Specifically, the following salts can be mentioned: (1) formed using inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid; or acetic acid, propionic acid, hexanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, 3-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, mandelic acid cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethanedisulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo[2.2.2]-oct-2-ene-1-carboxylic acid, glucoheptonic acid, 3-phenylpropionic acid, trimethylacetic acid, t-butylacetic acid, lauryl sulfuric acid, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid, mucic acid, etc., acid addition salts; or (2) when the acidic proton present in the parent compound is replaced by a metal ion, such as an alkali metal ion, alkaline earth ion, or aluminum ion, etc.; or when coordinated with an organic base such as ethanolamine, diethanolamine, triethanolamine, N-methylglucamine, etc. The salts further include, by way of mere example, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, etc.; and when the compound has a basic functional group, salts of non-toxic organic or inorganic acids such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, oxalate, etc.

[0097] "Pharmaceutically acceptable cation" refers to an acceptable cationic counterion of an acidic functional group. Examples of such cations include sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium cations, etc. (see, for example, Berge, et al., J. Pharm. Sci. 66 (1):1-79 (January 77)).

[0098] "Pharmaceutically acceptable vehicle" refers to a diluent, adjuvant, excipient or carrier with which the compounds of the present invention are administered.

[0099] "Pharmaceutically acceptable metabolically cleavable group" refers to a group that is cleaved in vivo to afford the parent molecule of the structural formula shown herein. Examples of metabolically cleavable groups include -COR, -COOR, -CONRR and -CH 2 OR radicals, where R is independently at each occurrence selected from alkyl, trialkylsilyl, carbocyclic aryl, or carbocyclic aryl substituted with one or more of alkyl, halogen, hydroxy or alkoxy. Specific examples of representative metabolically cleavable groups include acetyl group, methoxycarbonyl group, benzoyl group, methoxymethyl group, and trimethylsilyl group, etc.

[0100] "Prodrug" refers to a compound that has a cleavable group, including derivatives of the compounds of the present invention, and that becomes a pharmaceutically active compound of the present invention in vivo by solvolysis or under physiological conditions. Such examples include, but are not limited to, choline ester derivatives, N-alkylmorpholine esters, etc. Other derivatives of the compounds of the present invention are active in both their acid form and acid derivative form, but in the acid-sensitive form, often provide advantages in solubility, tissue compatibility, or sustained release in mammalian organisms (see Bundgard, H., Design of Prodrugs, pp. 7-9, 21-24, Elsevier, Amsterdam 1985). Prodrugs include acid derivatives well known to those skilled in the art, such as esters prepared by reaction of a parent acid with a suitable alcohol, amides prepared by reaction of a parent acid compound with a substituted or unsubstituted amine, acid anhydrides, or mixed anhydrides, etc. Simple aliphatic or aromatic esters, amides, and anhydrides derived from acidic groups pendant to the compounds of the present invention are specific prodrugs. In some cases, it is desirable to prepare double ester-type prodrugs such as (acyloxy)alkyl esters or (alkoxycarbonyl)oxy)alkyl esters. In particular, the C 1 -C 8 alkyl, C 2 -C 8 alkenyl, C 2 -C 8 alkynyl, aryl, C 7 -C 12 substituted aryl, and C 7 -C 12 are arylalkyl esters.

[0101] A "solvate" generally refers to a form of a compound associated with a solvent or water (also called a "hydrate") through a solvolysis reaction. This physical association includes hydrogen bonding. Conventional solvents include water, ethanol, acetic acid, etc. The compounds of the present invention can be prepared, for example, in crystalline form and can be solvated or hydrated. Suitable solvates include pharmaceutically acceptable solvates such as hydrates, and further include both stoichiometric solvates and non-stoichiometric solvates. In certain examples, a "solvate" can be separated, for example, when one or more solvent molecules are incorporated into the crystal lattice of a crystalline solid. A "solvate" encompasses both the solution phase and separable solvates. Representative solvates include hydrates, ethanolates, methanolates, etc.

[0102] The "subject" for which administration is contemplated includes humans (males or females of any age group, e.g., pediatric subjects (e.g., infants, children, adolescents) or adult subjects (e.g., young adults, middle-aged adults, elderly adults)), and / or non-human animals, such as mammals including, but not limited to, primates (e.g., cynomolgus monkeys, rhesus monkeys), cows, pigs, horses, sheep, goats, rodents, cats, and / or dogs. In certain embodiments, the subject is a human. In certain embodiments, the subject is a non-human animal. The terms "human", "patient", and "subject" are used interchangeably herein.

[0103] "Effective amount" means an amount of a compound that is sufficient to effect such treatment or prevention when administered to a subject for treating or preventing a disease. The "effective amount" can vary depending on the compound, the disease and its severity, and the age, weight, etc. of the subject to be treated. A "therapeutically effective amount" refers to an effective amount for therapeutic treatment. Also, a "prophylactically effective amount" refers to an effective amount for prophylactic treatment.

[0104] "Prevent" or "prevention" or "preventive measure" refers to reducing the risk of acquiring or developing a disease or disorder (i.e., not developing at least one clinical symptom of the disease in a subject who has not yet been exposed to the substance causing the disease or is susceptible to the disease prior to the onset of the disease).

[0105] The term "Prophylaxis" is related to "prevention" and refers to means and measures for the purpose of prevention, rather than the treatment or cure of diseases. Non-limiting examples of preventive measures may include the administration of vaccines; the administration of low molecular weight heparin to inpatients at risk of thrombosis due to immobility; and the administration of antimalarial agents such as chloroquine prior to visiting areas where malaria is endemic or where there is a high risk of contracting malaria.

[0106] "Treating" or "treatment" or "therapeutic treatment" of any disease or disorder, in one embodiment, refers to improving the disease or disorder (i.e., stopping the disease or reducing the signs, degree or severity of at least one of its clinical symptoms). In another embodiment, "treating" or "treatment" refers to improving at least one physical parameter, which need not be recognized by the subject. In yet another embodiment, "treating" or "treatment" refers to modulating the disease or disorder physically (e.g., stabilization of recognizable symptoms), physiologically (e.g., stabilization of physical parameters), or both. In a further embodiment, "treating" or "treatment" relates to slowing the progression of the disease.

[0107] As used herein, the term "isotope variant" refers to a compound that contains isotopes in unnatural ratios in one or more of the atoms that make up such a compound. For example, an "isotope variant" of a compound is, for example, deuterium ( 2 H or D), carbon-13 ( 13 C), nitrogen-15 ( 15can contain one or more non-radioactive isotopes such as (N). In such compounds with isotope substitution, when present, the following atoms may be different. For example, any hydrogen may be 2 H / D, any carbon may be 13 C, or any nitrogen may be 15 N. It will be understood that the presence and arrangement of such atoms can be determined within the skill of those skilled in the art. Similarly, the present invention can include the preparation of isotope variants using radioactive isotopes, for example, when the resulting compounds can be used in tissue distribution studies of drugs and / or substrates. Tritium ( 3 H) and carbon-14 ( 14 C), which are radioactive isotopes, are particularly useful for this purpose from the viewpoint of easy incorporation and easy detection. Furthermore, 11 C, 18 F, 15 O, 13 N, etc., substituted compounds can also be prepared, which are useful for positron emission tomography (PET) studies to examine the occupancy of substrate receptors. All isotope variants of the compounds provided herein are intended to be included within the scope of the present invention, whether or not they are radioactive substances.

[0108] It should also be understood that compounds having the same molecular formula but different in the nature and order of atomic bonds and the arrangement of those atoms in space are called "isomers". Isomers that differ in the arrangement of atoms in space are called "stereoisomers".

[0109] Stereoisomers that are not mirror images of each other are called "diastereomers", and those that are mirror images that cannot be superimposed on each other are called "enantiomers (optical isomers)". When a compound has an asymmetric center, for example, when bonded to four different groups, a pair of enantiomers is possible. Enantiomers are characterized by the absolute configuration of their asymmetric centers and are described by the Cahn and Prelog R- and S-configuration rules, or by the manner in which the molecule rotates the plane of polarization, and are designated as dextrorotatory or levorotatory (i.e., (+)- or (-)-isomers, respectively). Chiral compounds can exist as individual enantiomers or as mixtures thereof. A mixture containing equal ratios of enantiomers is called a "racemic mixture".

[0110] "Tautomers" are interchangeable forms of a particular compound structure and refer to compounds that differ in the displacement of a hydrogen atom and electrons. Thus, the two structures can be in equilibrium by the movement of electrons and atoms (usually H). For example, enol and ketone are tautomers because they are rapidly interconverted by treatment with either an acid or a base. Another example of tautomerism is the acyl- and nitro-forms of phenylnitromethane, which are similarly formed by treatment with an acid or a base. Tautomers can be relevant to achieving the optimal chemical reactivity and biological activity of the compound of interest.

[0111] As used herein, a pure enantiomeric compound is substantially free of other enantiomers or stereoisomers of that compound (i.e., is enantiomerically pure). In other words, the "S" form of a compound is substantially free of the "R" form of the compound and thus is enantiomerically pure with respect to the "R" form. The terms "enantiomerically pure" or "pure enantiomer" mean that the compound contains greater than 95%, greater than 96%, greater than 97%, greater than 98%, greater than 98.5%, greater than 99%, greater than 99.2%, greater than 99.5%, greater than 99.6%, greater than 99.7%, greater than 99.8%, or greater than 99.9% enantiomer. In certain embodiments, weight is based on the total weight of all enantiomers or stereoisomers of the compound.

[0112] As used herein, unless otherwise indicated, the term "enantiomerically pure R compound" refers to at least about 95% by weight R-compound and at most about 5% by weight S-compound, at least about 99% by weight R-compound and at most about 1% by weight S-compound, or at least about 99.9% by weight R-compound and at most about 0.1% by weight S-compound. In certain embodiments, weight is based on the total weight of the compound.

[0113] As used herein, unless otherwise indicated, the term "enantiomerically pure S compound" or "S compound" refers to at least about 95% by weight S-compound and at most about 5% by weight R-compound, at least about 99% by weight S-compound and at most about 1% by weight R-compound, or at least about 99.9% by weight S-compound and at most about 0.1% by weight R-compound. In certain embodiments, weight is based on the total weight of the compound.

[0114] As used herein, an enantiomerically pure compound, or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof, can be present together with other active or inactive ingredients. For example, a pharmaceutical composition containing an enantiomerically pure R compound can contain, for example, about 90% excipient and about 10% enantiomerically pure R compound. In certain embodiments, the enantiomerically pure R compound in such a composition can contain, for example, at least about 95% by weight of the R compound and up to about 5% by weight of the S compound, based on the total weight of the compound. For example, a pharmaceutical composition containing an enantiomerically pure S - compound can contain, for example, about 90% excipient and about 10% enantiomerically pure S compound. In certain embodiments, the enantiomerically pure S compound in such a composition can contain, for example, at least about 95% by weight of the S compound and up to about 5% by weight of the R compound, based on the total weight of the compound. In certain embodiments, the active ingredient can be formulated with little or no excipient or carrier.

[0115] The compounds of the invention can have one or more chiral centers; thus, such compounds can be made as individual (R)- or (S)-stereoisomers or as mixtures thereof.

[0116] Unless otherwise indicated, the description or naming of a particular compound herein and in the claims is intended to include both the individual enantiomers and mixtures thereof (racemic or otherwise). Methods for the determination of stereochemistry and the separation of stereoisomers are well known in the art.

[0117] One of ordinary skill in organic synthesis will recognize that the maximum number of heteroatoms contained in a chemically realizable and stable heterocyclic ring, whether aromatic or non - aromatic, is determined by the ring size, degree of unsaturation, and valence of the heteroatoms. Generally, a heterocyclic ring can have from 1 to 4 heteroatoms, provided that the heteroaromatic ring is chemically realizable and stable.

Examples

[0118] To more fully understand the invention described herein, the following examples are provided. The examples described in this application are provided to illustrate the compounds, compositions, materials, devices, and methods provided herein and should in no way be construed as limiting the scope thereof.

[0119] I. In Vivo CRISPR / Cas9 Genome Editing Enabled by Bioreducible Lipids and Messenger RNA Nanoparticles Materials and Methods All chemicals used for lipid synthesis were purchased from Aladdin, TCI, and Sigma-Aldrich and used as received. Firefly luciferase (L-7602) and Cas9 messenger RNA (mRNA) (L-7606) were purchased from Tri-Link Biotechnologies. Mouse serum PCSK9 was determined using a PCSK9 ELISA kit (Sino Biological, China). Cell viability was determined using the Alamar Blue assay or an SRB cell proliferation and cytotoxicity assay kit (Yeasen Biotech Co., Ltd., China). Cy3-RNA (43nt) was purchased from Biosyntech (Suzhou, China). gRNA targeting GFP was prepared according to our previous report, and mouse PCSK9 and human HPV18 target sgRNAs were prepared using in vitro transcription according to the reported methods. mRNA encoding RFP was prepared using the RiboMAX (trademark) Large Scale RNA Production Systems (Promega, USA) with an in vitro transcription method using pcDNA3.1-RFP (Yingrun, Changsha, China) as a template. Flow cytometry was performed on a Beckman Coulter CytoFLEX. HeLa, A375, and HEK-GFP cells were maintained in DMEM (Sigma-Aldrich) supplemented with 10% FBS (Sigma-Aldrich) and 1% penicillin-streptomycin (Life Technologies). All animal care and experimental procedures were approved by the Institutional Animal Care and Use Committees (IUCAC) of the National Center for Nanoscience and Technology of China (NCNTC).

[0120]

Table 1

[0121] Lipid Nanoparticle Formulations Lipids were synthesized by heating an amine with acrylate or acrylamide using the method described according to our previous report (9) and purified using flash chromatography on silica gel. To prepare lipid nanoparticles for mRNA delivery, the purified lipid was mixed with cholesterol, DOPE, and DSPE-PEG2000 at a weight / weight ratio of 16:8:4:1 in chloroform in a 2 mL vial, the organic solvent was evaporated under vacuum, and the resulting mixture was further dried overnight to form a thin film. This lipid film was hydrated with ethanol / sodium acetate buffer (200 mM, pH = 5.2) and dropped into an aqueous solution of DSPE-PEG2000. The resulting nanoparticles were dialyzed against phosphate-buffered saline (PBS) to remove excess ethanol.

[0122] Intracellular Delivery of Luciferase and RFP mRNA To screen for lipid nanoparticles effective for the delivery of luciferase mRNA, A375 cells were seeded at a density of 50K per well in a 24-well plate the day before the experiment. On the day of the experiment, 160 ng / mL of luciferase mRNA was mixed with different lipid nanoparticles at 3 μg / mL in sodium acetate buffer (25 mM, pH = 5.2) (all concentrations refer to the final RNA and lipid concentrations added to the cells), and then incubated at room temperature for 15 minutes. Next, the resulting mRNA-lipoplexes were added to the cells, and after further incubation with the cells for 6 hours, the cell culture medium was refreshed. Luciferase activity was measured using a firefly luciferase activity assay kit according to the manufacturer's instructions (Promega, USA).

[0123] In the cytotoxicity assay of BAMEA-O16B / luciferase mRNA nanoparticles, HEK cells were treated with 160 ng / mL of luciferase mRNA nanoparticles or different lipid nanoparticles as in the genome editing efficiency study. Cell viability was determined using the Alamar Blue or SRB cell proliferation and cytotoxicity assay 24 hours after delivery.

[0124] For RFP mRNA delivery, HeLa cells (25K cells / well) seeded in 48-well plates were treated with BAMEA-O16B / RFP mRNA nanoparticles under optimized conditions for 8 hours, and then the fresh cell culture medium was replaced. The expression profile of RFP was imaged using CLSM of an Olympus FV-IX81 confocal system 24 hours after mRNA delivery, or quantified by flow cytometry on a Beckman Coulter CytoFLEX.

[0125] Cell Uptake and Endosomal Escape Studies of BAMEA-O16B / RNA Nanoparticles To confirm the effectiveness of designing bio-reducible lipid nanoparticles to promote the release of RNA in response to the reducing intracellular environment, BAMEA-O16B or BAMEA-O16 was complexed with RFP mRNA at a weight ratio of 15:1 in sodium acetate buffer (25 mM, pH = 5.2), and then incubated at room temperature for 15 minutes. The obtained nano-complexes were treated with 5 mM GSH at 37 °C for 4 hours, followed by agarose gel electrophoresis and comparison with the mRNA nano-complexes without GSH treatment.

[0126] In the cell uptake study of RNA nanoparticles, 43-nucleotide RNA labeled with Cy3 was mixed with BAMEA-O16B or BAMEA-O16 nanoparticles at a weight ratio of 30:1 and then added to HeLa cells. In the CLSM imaging study, HeLa cells were treated with Cy3-RNA nanoparticles for 8 hours and endosomes were co-stained with LysoTracker Green (Thermo Fisher Scientific, USA). For comparison of the cell uptake efficiency of BAMEA-O16B or BAMEA-O16 / RNA nanoparticles, cells treated with different concentrations of the above RNA nanoparticles were analyzed using flow cytometry and Cy3-positive cells were quantified.

[0127] Delivery of Cas9 mRNA / sgRNA and Genome Editing in vitro HEK cells stably expressing GFP were seeded at a density of 25K per well in a 48-well plate the day before the experiment. On the day of the experiment, 13 nM of GFP-targeting sgRNA was mixed with different doses of Cas9 mRNA and 5 μg / mL of BAMEA-O16B (all concentrations indicate the final concentrations of RNA and lipid added to the cells) in sodium acetate buffer (25 mM, pH = 5.2), and then incubated at room temperature for 15 minutes. Next, BAMEA-O16B / Cas9 mRNA / sgGFP nanoparticles were added to the cells. After incubating for 10 hours, the fresh cell culture medium was replaced. At different time points after Cas9 mRNA delivery, the expression profile of GFP was imaged using CLSM or quantified using flow cytometry analysis, normalized to cells without Cas9 mRNA / sgGFP delivery, and the genome editing efficiency was determined. Furthermore, to confirm sequence-specific genome editing by the delivery of Cas9 mRNA / sgGFP, sgGFP was replaced with scrambled sgRNA and delivered to HEK-GFP cells in the same manner as Cas9 mRNA / sgGFP delivery.

[0128] In the cytotoxicity assay of BAMEA-O16B / Cas9 mRNA / sgGFP nanoparticles, HEK cells were treated with different concentrations of Cas9 mRNA nanoparticles in the same manner as in the study of genome editing efficiency. Forty-eight hours after Cas9 mRNA delivery, the cell viability was determined using Alamar Blue.

[0129] To confirm the effectiveness of BAMEA-O16B / Cas9 mRNA delivery for editing endogenous genes for potential gene therapy, HeLa cells seeded in a 48-well plate were treated with BAMEA-O16B / Cas9 mRNA alone containing the same scrambled RNA sequence as the sgHPV18 or GFP knockout test, and the cell viability was determined using the Alamar Blue assay 48 hours after Cas9 mRNA delivery.

[0130] Delivery of Cas9 mRNA / sgRNA and Genome Editing in vivo For in vivo delivery of luciferase mRNA, female thymus-deficient nude mice were injected via the tail vein with BAMEA-O16B / Luci-mRNA nanoparticles at an mRNA dose of 0.6 mg / kg, or the same dose of free mRNA. Twenty-four hours after injection of the nanoparticles or free mRNA, the mice were sacrificed for bioluminescence imaging with an IVIS Spectrum In Vivo Imaging System (Perkin Elmer, USA), and various tissues were collected. To examine the delivery of mRNA to hepatocytes, BAMEA-O16B / RFP mRNA nanoparticles were injected into C57BL / 6 mice in the same manner as the delivery of luciferase mRNA. Twenty-four hours after nanoparticle delivery, the mice were sacrificed for fluorescence imaging studies, and the livers were collected.

[0131] For in vivo delivery of Cas9 mRNA / Cy3-RNA, female thymus-deficient nude mice were injected via the tail vein with BAMEA-O16B / Cas9 mRNA / Cy3-RNA nanoparticles at a dose of 9 mg / kg BAMEA-O16B, 0.6 mg / kg Cas9 mRNA, and 0.8 mg / kg Cy3-RNA, or the same dose of free mRNA. Six hours after injection of the nanoparticles or free mRNA, the mice were sacrificed for bioluminescence imaging with an IVIS Spectrum In Vivo Imaging System (Perkin Elmer, USA), and various tissues were collected.

[0132] For in vivo delivery of Cas9 mRNA and PCSK9 gene editing, C57BL / 6 mice were injected via the tail vein with BAMEA-O16B / Cas9 mRNA / sgPCSK9, or BAMEA-O16B / Cas9 mRNA / sgRNA with a scrambled sgRNA sequence, at a dose of 9 mg / kg BAMEA-016B, 0.6 mg / kg Cas9 mRNA, and 0.8 mg / kg sgRNA. Two days after nanoparticle injection, the mice were sacrificed, and mouse serum was taken out for PCSK9 and hepatotoxicity assays. On the other hand, liver tissues were collected for H&E staining to examine the possibility of liver injury caused by nanoparticle injection.

[0133] Example 1. Synthesis and Screening of Lipids Effective for mRNA Delivery Figures 2A to 2C are graphs and images showing intracellular delivery of luciferase and RFP mRNA.

[0134] According to our previous report, a bioreducible lipid was synthesized by heating an amine and an acrylate or acrylamide having a disulfide bond (Figure 1A). The lipid was named by attaching O16B or N16B after the amine number or name to distinguish the use of acrylate or acrylamide, respectively (Figure 1B). The lipid as purified was mixed with cholesterol, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), and DSPE-PEG 2000It was formulated together and used in all cell delivery experiments of this study (please refer to "Materials and Methods" for details). To facilitate the screening of lipids effective for mRNA delivery, mRNA encoding luciferase was combined with various lipids at a weight ratio of 1:15, and A375 human melanoma cells were transfected. The luciferase expression of the transfected A375 cells was measured and compared with cells treated with luciferase mRNA alone or luciferase mRNA complexed with a commercially available transfection lipid, Lipofectamine 2000 (LPF2K). As shown in Figure 2A, cells treated with mRNA alone did not show detectable luciferase expression, indicating that mRNA alone could not penetrate into cells. On the other hand, cells treated with the mRNA-lipid complex showed luciferase expression that varied depending on the amine and tail structures of the lipid. Two bioreducible lipids, BAMEA-O16B (amine 11) and PPPDA-N16B (amine 13), delivered luciferase mRNA with an efficiency equivalent to that of LPF2K. Further studies on the biocompatibility of the two lipids showed that the mRNA lipoplexes of BAMEA-O16B and PPPDA-N16B had lower cytotoxicity than LPF2K (Figure 6A and Figure 6B), which emphasized the advantages and necessity of designing combinatorial lipid nanoparticles for discovering efficient and biocompatible nanocarriers for mRNA delivery. The representative lipid, BAMEA-O16B, was selected for detailed mRNA delivery and CRISPR / Cas9 genome editing studies.

[0135] A representative lipid, BAMEA-O16B, is a common nanocarrier for mRNA delivery, as demonstrated by its ability and high efficiency to deliver mRNA encoding red fluorescent protein (RFP) to HeLa cells. Treatment of human cervical cancer cells (HeLa) with BAMEA-016B / RFP mRNA nanoparticles resulted in efficient RFP expression (Figure 2B). Flow cytometry analysis (Figure 2C) showed that RFP-positive cells were dependent on the mRNA dose and that when 160 ng / mL of RFP mRNA was delivered to HeLa cells, the transfection efficiency could reach up to 90%. In summary, both the delivery of luciferase mRNA and RFP mRNA demonstrated the effectiveness of BAMEA-016B nanoparticles for efficient and safe mRNA delivery.

[0136] Example 2. mRNA Delivery Using BAMEA-O16B or BAMEA-O16 Figures 3A - 3D are graphs and images showing the cell uptake and endosomal escape studies of BAMEA-O16B / RNA nanoparticles.

[0137] Figures 4A - 4D are the delivery and genome editing of CRISPR / Cas9 mRNA in cultured cells.

[0138] To further elaborate on the introduction of disulfide bonds into BAMEA-O16B to promote intracellular mRNA release and enhance mRNA transfection efficiency, a control lipid with a chemical structure similar to BAMEA-O16B but lacking disulfide bonds was synthesized and named BAMEA-O16 (Figure 3A). Agarose gel electrophoresis studies showed that BAMEA-O16B and BAMEA-O16 exhibited comparable mRNA encapsulation efficiency (Figure 7). Interestingly, glutathione (GSH) treatment (5 mM) resulted in efficient release of mRNA from the BAMEA-O16B / mRNA complex but not from the BAMEA-O16 / mRNA complex. As revealed by dynamic light scattering (DLS) analysis, similar mRNA encapsulation ability was further confirmed by the comparable size and zeta potential of the two mRNA complexes (Table 2).

[0139]

Table 2

[0140] It is also worth noting that BAMEA-O16B or BAMEA-O16 showed comparable RNA delivery efficiency. Treatment of HeLa cells with fluorescently labeled RNA complexes of BAMEA-O16B or BAMEA-O16 (10 nM) resulted in RNA uptake efficiencies higher than 90% at different ratios of all lipids to RNA (Figure 3B). However, confocal laser scanning microscopy (CLSM) imaging of HeLa cells showed that BAMEA-O16B / RNA-treated cells exhibited higher endosomal escape efficiency than BAMEA-016 / RNA treatment (Figure 3C), which is mainly due to the bioreductive nature of BAMEA-O16B that more efficiently promotes the release of RNA in response to the reducing intracellular environment. Furthermore, delivery of RFP mRNA using BAMEA-O16B nanoparticles resulted in higher RFP expression in HeLa cells than BAMEA-O16-promoted mRNA delivery. For example, delivery of 160 ng / mL of RFP mRNA using BAMEA-O16B resulted in a 4-fold enhanced RFP expression compared to using BAMEA-O16 nanoparticles (Figure 3D).

[0141] We demonstrated the effectiveness of using BAMEA-O16B for reporter mRNA delivery and then examined the ability of BAMEA-O16B to co-deliver Cas9 mRNA and sgRNA for genome editing. Cas9 mRNA is approximately 4,500 nucleotides in size, much longer than luciferase or RFP mRNA (approximately 1,000 nt), making intracellular delivery very difficult. Therefore, to further elaborate on the effectiveness of a library of bioreducible lipids for Cas9 mRNA delivery and genome editing, HEK cells stably expressing GFP were treated with lipid nanoparticles encapsulating Cas9 mRNA and GFP-targeting sgRNA, and the change in GFP expression levels before and after mRNA delivery was monitored. It was found that on-target GFP genome editing can induce a shift in the reading frame of the GFP gene, thereby preventing GFP expression. As shown in Figure 8, 7 out of 32 lipids were able to efficiently deliver Cas9 mRNA and sgRNA and knock down GFP expression in HEK cells, with lipid BAMEA-O16B showing the highest genome editing and GFP knockout efficiency. It was found that electrostatic interaction between BAMEA-O16B and Cas9 mRNA / sgRNA assembled well-dispersed nanoparticles with a size of approximately 230 nm (Table 2, Figure 9). On the other hand, the BAMEA-O16B / Cas9 mRNA nanocomplex has high biocompatibility suitable for genome editing delivery. HEK cells treated with different concentrations of the BAMEA-O16B / Cas9 mRNA nanocomplex all maintained a viability of over 90%, which is higher than that of HEK cells treated with the LPF2K / Cas9 mRNA / sgRNA nanocomplex (Figure 10).

[0142] CLSM imaging showed that treatment with BAMEA-O16B / Cas9 mRNA / sgGFP nanoparticles resulted in complete loss of GFP fluorescence in HEK-GFP cells, while treatment with free Cas9 mRNA and sgRNA did not show a similar GFP knockout effect (Figure 4A). Quantitative analysis of GFP expression in HEK-GFP cells showed that as the concentration of Cas9 mRNA delivered to the cells increased from 20 ng / mL to 160 ng / mL, the GFP knockout efficiency increased from 35% to over 90% (Figure 4B). On the other hand, when sgGFP was replaced with scrambled sgRNA, no effective genome editing and loss of GFP in the cells was observed (Figure 4C). It is noteworthy that BAMEA-O16B / Cas9 mRNA / sgRNA treatment knocked out GFP expression very rapidly at the protein level (Figure 4B). As early as 24 hours after Cas9 mRNA delivery, 40% GFP knockout was observed, and this percentage increased to 90% 36 hours after Cas9 mRNA delivery, but the genome editing efficiency did not increase further with further extension of the delivery time.

[0143] Example 3. BAMEA-O16B-Mediated Cas9 mRNA Delivery Can Regulate Endogenous Gene Expression Figures 5A - 5C are graphs and images showing Cas9 mRNA / sgRNA delivery and genome editing in vivo.

[0144] Furthermore, BAMEA-O16B-mediated Cas9 mRNA delivery has been shown to have great potential for developing novel gene therapies because it can regulate endogenous gene expression. Human papillomavirus type 18 (HPV18), an essential gene that promotes the progression of human cervical cancer, was selected as the research target. An SgRNA targeting HPV18 was delivered to HeLa cells together with Cas9 mRNA using BAMEA-O16B, and the viability of HeLa cells after treatment was measured and compared with the viability of treatment with scrambled sgRNA and Cas9 mRNA. As shown in Figure 4D, BAMEA-O16B / Cas9 mRNA / sgHPV18 treatment significantly inhibited HeLa growth compared to the delivery of scrambled sgRNA and Cas9 mRNA (Figure 4D). For example, the delivery of 320 ng / mL of Cas9 mRNA and 26 nM of sgHPV18 reduced the viability of HeLa cells to 30%, but replacing sgHPV18 with scrambled sgRNA did not show a similar effect on inhibiting HeLa cell growth.

[0145] To further demonstrate the potential of BAMEA-O16B nanoparticles for in vivo mRNA delivery and CRISPR / Cas9 genome editing, proprotein convertase subtilisin / kexin type 9 (PCSK9), an enzyme secreted by hepatocytes and involved in cholesterol homeostasis, was selected as the research target. PCSK9 plays an important role in lipid metabolism by regulating the density of low-density lipoprotein cholesterol receptors (LDL-R) in the liver, and genetic studies have revealed that the loss of PCSK9 is associated with a reduced risk of cardiovascular disease.

[0146] First, the biodistribution of BAMEA-O16B nanoparticles for in vivo mRNA delivery was investigated. For this purpose, BAMEA-O16B / luciferase mRNA nanoparticles or fluorescently labeled BAMEA-O16B / Cas9 mRNA / Cy3-RNA nanoparticles were formulated and intravenously injected into mice via the tail vein at an mRNA dose of sgRNA of 0.6 mg / kg or 0.8 mg / kg, and then bioluminescence or fluorescence imaging of tissues and organs was performed to examine the biodistribution of the nanoparticles. As shown in Figures 11 and 5A, injection of BAMEA-O16B / luciferase mRNA nanoparticles resulted in effective expression of luciferase in the liver of mice, while administration of BAMEA-O16B / Cas9 mRNA / Cy3-RNA nanoparticles showed effective accumulation of fluorescent signals in the liver of mice. Detailed cellular localization studies by delivering BAMEA-O16B / RFP mRNA nanoparticles revealed that BAMEA-O16B / RFP mRNA nanoparticles were mainly accumulated in hepatocytes (Figure 5B), which can be utilized for PCSK9 genome editing in hepatocytes as described below.

[0147] After injecting BAMEA-O16B nanoparticles into C57BL / 6 mice, the serum PCSK9 levels were quantified and the in vivo genome editing effect was evaluated to examine the potential and efficacy of BAMEA-016B nanoparticles for in vivo genome editing. As shown in Figure 5C, when BAMEA-O16B / Cas9 mRNA / sgPCSK9 nanoparticles were intravenously injected, the serum PCSK9 in mice decreased to 20% of that when injected with DPBS or BAMEA-O16B / Cas9 mRNA / scramble sgRNA nanoparticles (Figure 5C). On the other hand, histological examination using hematoxylin and eosin (H&E) staining of the livers of mice after treatment with BAMEA-O16B / Cas9 mRNA / sgRNA nanoparticles showed no signs of inflammation (Figure 12). Furthermore, nanoparticle injection did not induce obvious hepatocyte damage, as evidenced by minimal changes in serum aspartate transaminase (AST), alanine aminotransferase (ALT), and total bilirubin in all injected mice (Figure 13). The above results clearly demonstrated that BAMEA-O16B nanoparticles have high efficacy and biocompatibility for in vivo genome editing.

[0148] II. Lipid nanoparticle-mediated delivery of CRISPR / Cas9 mRNA for in vivo genome editing of ANGPTL3 Materials and Methods LNP Formulations Lipidoids were synthesized according to our previous report. LNPs were prepared using a NanoAssemblr microfluidic system (Precision Nanosystems). Briefly, lipidoids, cholesterol (Sigma), phospholipids (DSPC, DOPE, and DOPC, Avanti Polar Lipids), and DMG-PEG (Avanti Polar Lipids) were dissolved in 100% ethanol at a final lipidoid concentration of 10 mg / mL and a molar ratio of 50 / 38.5 / 10 / 1.5. Cas9 mRNA and gRNA (either sgANGPTL3 or sgLoxP) were mixed at an appropriate weight ratio in sodium acetate buffer (25 mM, pH 5.2). When the mRNA solution and the lipid solution were injected into the NanoAssemblr microfluidic device at a ratio of 3:1 each, the device resulted in rapid mixing of the two components and thus self-assembly of LNPs. Furthermore, the formulation was dialyzed against PBS (10 mM, pH 7.4) at 4 °C overnight using a dialysis cassette. The particle size of the formulation was measured by dynamic light scattering (DLS) using a ZetaPALS DLS instrument (Brookhaven Instruments). The RNA encapsulation efficiency was evaluated by a Ribogreen assay.

[0149] In vivo LNP Delivery All procedures in animal experiments were carried out with the approval of the Tufts University Institutional Animal Care and Use Committee (IACUC) and in accordance with the guidelines for the care and use of laboratory animals of the National Institutes of Health (NIH). All animals were obtained from Charles River. Female Balb / c mice (6 - 8 weeks old) were used for the screening of in vivo encapsulated luciferase mRNA (fLuc mRNA, TriLink Biotechnologies) in lipid nanoparticles (LNPs) and the optimization of formulations. Briefly, fLuc mRNA LNPs were intravenously injected into mice at a dose of 0.5 mg / kg mRNA. At a given time point, mice were injected with 100 μL of D - luciferin potassium salt (Goldbio) solution (15 mg / mL in PBS), anesthetized with isoflurane, and measured by an IVIS imaging system (Caliper Life Sciences).

[0150] In vivo Cas9 mRNA / sgLoxP Delivery Cas9 mRNA (TriLink Biotechnologies) and LoxP - targeted single - guide RNA (sgLoxP, sequence: 5’ - AAGTAAAACCTCTACAAATG, Synthego) were co - loaded into 306 - O12B LNPs and intravenously injected into female Ai14 mice at a total RNA dose of 1.65 mg / kg. Organs of the mice were harvested on the 7th day after injection, and images were taken by IVIS to detect the expression of tdTomato. The liver tissue was further sectioned.

[0151] Immunostaining After embedding the tissue sample with OCT, it was completely frozen with liquid nitrogen and stored at -80°C until ready for sectioning. The frozen tissue block was sectioned to the desired thickness (10 μm) using a cryotome and placed on a glass slide suitable for immunofluorescence staining. The tissue sections were fixed with pre-cooled acetone (-20°C) for 10 minutes and then washed twice with PBS for 5 minutes each. The fixed tissue sections were incubated in 10% BSA blocking buffer at room temperature (r.t.) for 1 hour and then washed with PBS. A hepatocyte-specific primary antibody (diluted 1:100 in 1% BSA buffer, anti-hepatocyte-specific antigen (HepPar1), manufactured by Novus) was added to the sections on the slide and incubated overnight at 4°C in a humidified chamber. The slides were rinsed by changing the PBS twice for 5 minutes each, stained with eFlour660-conjugated F(ab’)2-goat anti-mouse secondary antibody (1:50, Invitrogen), incubated at room temperature for 1 hour in a light-shielded humidified chamber, and then washed three times with PBS. The slides were covered with a coverslip using a fluorescent mounting medium containing DAPI (Sigma). The sections were analyzed using a Leica SP8 confocal microscope.

[0152] In vivo Genome Editing of ANGPTL3 Guide RNA sequences targeting the ANGPTL3 gene were designed using Benchling software. 306-O12B LNPs co-loaded with Cas9 mRNA and ANGPTL3-targeting single guide RNA (sgAngptl3, sequence: 5’-AGCCCTTCAACACAAGGTCA, Synthego) were intravenously administered to female wild-type C57BL / 6 mice at total RNA doses of 1.0, 2.0, and 3.0 mg / kg. Mice administered PBS were used as negative controls. Mice were sacrificed on day 7 after injection, blood was collected for quantification of circulating ANGPTL3 protein and blood lipids by ELISA, and liver tissue was collected from the median and left lateral lobes for DNA extraction and next-generation sequencing (NGS) analysis. Also, to evaluate in vivo toxicity and immune response, blood from mice was collected 2 days after injection and processed into serum. Aspartate aminotransferase (AST) and alanine aminotransferase (ALT), and tumor necrosis factor alpha (TNF-α) were measured according to the manufacturer's protocol using assay kits for AST (G-Biosciences), ALT (G-Biosciences), and TNF-α (R&D Systems).

[0153] NGS Sequencing Analysis DNA was extracted from the median and left lateral lobes of the liver using a commercially available extraction kit (Qiagen DNEasy Blood&Tissue). PCR primers were designed to amplify the region surrounding the target site of the Angptl3 gene or the region surrounding the predicted off-target site (Table S1). Off-target sites were predicted using Cas Off Finder software (rgenome.net / cas-offinder / ). PCR amplicons were prepared for sequencing on an Illumina MiSeq (Tufts Genomics Core Facility). Sequencing data were analyzed using OutKnocker2 software (outknocker.org / outknocker2.htm).

[0154] Analysis of ANGPTL3 Protein, Low-Density Lipoprotein Cholesterol (LDL-C), and Triglyceride (TG) in Serum Mouse blood was collected without using an anticoagulant and allowed to clot at room temperature (r.t.) for 2 hours. After that, it was centrifuged at 2000 × g for 15 - 20 minutes at room temperature to collect mouse serum. The serum levels of ANGPTL3 protein, LDL-C, and TG were measured using a Mouse Angiopoietin-like Protein 3 Quantikine ELISA kit (R&D systems), a Mouse LDL-cholesterol kit (Crystal Chem), and a Triglyceride Colorimetric Assay kit (Cayman Chemical) according to the manufacturer's protocols, respectively.

[0155] T7E1 Cleavage Assay The genomic region adjacent to the on-target site was amplified using the extracted genomic DNA template, Platinum SuperFi Green DNA polymerase (Invitrogen), and specific primers (Table 3).

[0156]

Table 3

[0157] The following cycles were performed: 30 seconds at 98°C, followed by 10 seconds at 98°C, 15 seconds at 65°C, and 30 seconds at 72°C for 33 cycles, followed by 10 minutes at 72°C. The PCR products were purified using the GeneJET PCR Purification Kit (Thermo Scientific). 400 ng of the purified PCR products were heated to 95°C for 5 minutes in NEBuffer 2 (New England Biolabs) using an Applied Biosystems PCR system (Thermo Fisher Scientific), and then hybridized by decreasing the temperature to 85°C at 2°C / second and further to 25°C at 0.1°C / second. The annealed samples were digested with T7 endonuclease I (New England Biolabs) at 37°C for 15 minutes and then incubated at 65°C for 5 minutes to stop the reaction. The products were further purified and electrophoresed on a 4 - 20% Novex TBE gel (Invitrogen).

[0158] Statistical Analysis Data were represented as mean ± SD. All data were analyzed using Graphpad Prism software. *p < 0.05 was considered significant, **p < 0.01, and ***p < 0.001 were considered highly significant.

[0159] Example 4. In vivo Screening of Lipid Nanoparticles for mRNA Delivery Figures 15A - 15C represent the synthesis of lipidoid nanoparticles.

[0160] Tail-branched bioreducible lipidoids were prepared via a combinatorial solvent-free Michael addition reaction between an acrylate lipid tail incorporating a disulfide bond and an amine-containing head (Figure 15A). The in vivo mRNA delivery effects of these lipids were first evaluated by encapsulating firefly luciferase mRNA (fLuc mRNA) into LNPs and intravenously delivering these LNPs to female wild-type Balb / c mice. These LNPs were formulated with excipient compounds such as cholesterol, DSPC, and DMG-PEG in addition to our ionizable synthetic lipid. Representative transmission electron micrographs of blank (unloaded) and fLuc mRNA-loaded LNPs are shown in Figures 20A and 20B. The gold standard MC-3 LNP was included as a positive control. Six hours after mRNA delivery, luciferin substrate was intraperitoneally injected into the mice, and whole-body fLuc activity was measured using an IVIS in vivo imaging system (PerkinElmer). As shown in Figure 15B, mRNA delivery using 306-O12B, 113-O12B, and 306-O10B LNPs resulted in equivalent or higher luciferase bioluminescence intensities compared to MC-3 LNP delivery. In vivo images of the mice clearly showed that the luciferase protein was mainly expressed in the liver (Figure 21). 306-O12B was used as a representative lipid for further experiments. fLuc mRNA was efficiently encapsulated into 306-O12B LNPs with an encapsulation efficiency of approximately 98% (Figure 22). After encapsulation of fLuc mRNA, 306-O12B LNPs had an average diameter of 112 nm (Figure 15C).

[0161] Example 5. Optimization of 306-O12B LNP Formulations Figures 16A-16F show the optimization of the fLuc mRNA 306-O12B LNP formulation.

[0162] To further enhance luciferase expression in vivo, various formulation parameters used in the assembly of these LNPs were optimized, such as the identity of the excipient lipid, the molar composition ratio of the four components of the LNP formulation, and the lipid / mRNA weight ratio of the fLuc mRNA-encapsulated 306-O12B LNP.

[0163] First, to evaluate the effect of the phospholipid excipient on luciferase expression in vivo, two phospholipids, DOPE and DOPC (Figure 16A), which have a similar structure but different head group and tail saturations compared to the original DSPC phospholipid, were selected. DOPC and DOPE each contain one degree of unsaturation in the carbon tail, while DSPC is fully saturated. Furthermore, DSPC and DOPC each contain a quaternary amine head group, while DOPE contains a primary amine head group. These characteristics have each been reported in the literature to affect LNP delivery efficiency. The quaternized amine head group has been reported to exhibit a stronger proton sponge effect than the primary amine head, which can facilitate the escape of cargo mRNA from the endosome to the cytoplasm and thus increase translation from mRNA to protein. Additionally, the saturation of the lipid tail has been shown to affect membrane fluidity, which may also impact endosomal escape. Unsaturated lipid tails result in higher membrane fluidity, which may also help improve endosomal escape through destabilization of the endosomal membrane upon fusion of the LNP with the membrane. Taken together, it was hypothesized that LNPs formed using DOPC, which contains a quaternary amine and an unsaturated tail, would exhibit the most efficient delivery of fLuc. As shown in Figures 16B and 16C, fLuc mRNA LNPs formulated with DOPC resulted in significantly higher luciferase expression in the liver compared to LNPs formed using DOPE or the original DSPC phospholipid. fLuc mRNA delivered in DOPC-containing LNPs resulted in a luminescence signal approximately four-fold higher than that of the original DSPC-containing LNPs.

[0164] In the initial screening, the active lipid and excipient components were formulated with a molar ratio of [lipid:cholesterol:DSPC:DMG-PEG] of [50:38.5:10:1.5]. After identifying the optimal phospholipid as DOPC and adjusting the formulation accordingly, LNPs formulated at various molar ratios were tested to identify the optimal parameters (Figure 16D). As shown in Figure 16E, the original formulation O (molar ratio of 306-O12B:cholesterol:DOPC:DMG-PEG of 50:38.5:10:1.5) showed the highest luciferase bioluminescence intensity; none of the new formulation parameters could exceed the original formulation.

[0165] In an effort to further enhance in vivo efficacy, LNPs with this optimal ratio of the four components were formulated using different weight ratios of active lipid 306-O12B:mRNA in the range of 5:1 to 25:1. Interestingly, it was found that the highest efficacy was achieved when the weight ratio was 7.5:1. Increasing the amount of lipid beyond this point does not seem to benefit the efficacy of in vivo delivery (Figure 16F). In summary, these results indicate that the optimized formulation of 306-O12B LNP had a molar composition of 50% 306-O12B, 38.5% cholesterol, 10% DOPC, and 1.5% DMG-PEG at a 306-O12B / mRNA weight ratio of 7.5 / 1.

[0166] Example 6. In vivo Hepatocyte-Specific Delivery of Cas9 mRNA and sgRNA Using mRNA-Optimized LNPs Figures 17A - 17C show that 306-O12B LNP enabled Cas9 / sgLoxP-mediated genome editing in Ai14 mice.

[0167] Figures 23A - 23B are images showing that 306-O12B LNP enabled sgLoxP-mediated genome editing in Ai14 / Cas9 crossed mice.

[0168] Identifying the specific cell types edited by Cas9 mRNA / sgRNA LNPs is extremely important in predicting the potential applications of CRISPR delivery systems. We used the Ai14 reporter mouse strain genetically engineered with a LoxP-Flanked STOP cassette that controls tdTomato expression. This mouse strain is commonly used with Cre recombinase, and successful CRISPR-mediated excision of the LoxP-flanked stop codon also induces the expression of tdTomato. By examining cells with tdTomato expression, we can identify the cell types that our LNP delivery system can successfully target.

[0169] To validate this approach, first, we delivered the LoxP-targeted sgRNA (sgLoxP) to mice engineered to express both the Ai14 construct and the constitutively expressed Cas9 construct (Ai14+ / Cas9+ mouse model) using the 306-O12B LNP. As shown in Figures 23A and 23B, delivery of sgLoxP using our LNP system resulted in red fluorescence specifically detected in the liver. Interestingly, further histological analysis revealed that the tdTomato signal was mainly observed in hepatocytes of the liver, indicating that the 306-O12B LNP can specifically deliver the sgRNA to the cell types relevant to this therapy.

[0170] Next, Cas9 mRNA and sgLoxP were co-formulated into a single LNP and injected into Ai14 mice via the tail vein at a total RNA dose of 1.65 mg / kg (Figure 17A). Organs were harvested 7 days after delivery and imaged ex vivo using the IVIS system. Ex vivo images of mouse organs analyzed by the IVIS system showed that the system could actually induce red fluorescence, indicating successful functional co-delivery of both the mRNA and sgRNA components, and further showed that the tdTomato signal was mainly detected in the liver (Figure 17B). Furthermore, immunofluorescence staining using a hepatocyte-specific biomarker was performed, and confocal images demonstrated that most of the tdTomato protein was expressed in hepatocytes (Figure 17C). These findings strongly indicated that the 306-O12B LNP could specifically deliver the CRISPR machinery to hepatocytes in the liver.

[0171] Example 7. In vivo Genome Editing of ANGPTL3 Figures 18A-18B show significant levels of in vivo genome editing of ANGPTL3 mediated by 306-O12B LNP in wild-type C57BL / 6 mice.

[0172] Figures 19A-19C show that 306-O12B LNP is more efficient than MC-3 LNP in inducing loss-of-function mutations of ANGPTL3 by CRISPR / Cas9-based genome editing.

[0173] Next, the ability of 306-O12B LNP to deliver CRISPR / Cas9 mRNA and manipulate the expression of functional endogenous genes was verified. The angiopoietin-like protein 3 (ANGPTL3) gene, which encodes ANGPTL3, a central regulator of lipoprotein metabolism that inhibits both lipoprotein lipase activity and endothelial lipase activity, was selected as the research target. Using wild-type C57BL / 6 mice, non-viral Cas9 mRNA / sgAngptl3 LNP-mediated in vivo genome editing of ANGPTL3 was investigated. Cas9 mRNA and sgAngptl3 were co-encapsulated in 306-O12B LNP. Since the CRISPR / Cas9 system consists of two elements, Cas9 mRNA and sgRNA, the ratio of these two elements may affect the effect of in vivo genome editing. Therefore, 306-O12B LNP formulated with Cas9 mRNA and sgAngptl3 at different mass ratios of 2:1, 1:1.2, and 1:2 were injected into mice at a total RNA amount of 3.0 mg / kg. On the 7th day after injection, serum was collected for ELISA analysis of serum ANGPTL3 protein levels, and liver tissue samples were collected for DNA extraction and NGS sequencing to identify targeted Cas9-mediated genome editing. Genome editing in the mouse liver and a decrease in serum ANGPTL3 protein levels were observed at all Cas9 mRNA / sgAngptl3 ratios, but no significant differences were found among these groups (Figures 18A and 18B). The Cas9 mRNA / sgAngptl3 ratio of 1:1.2 was used in the following experiments. 306-O12B LNP encapsulating Cas9 mRNA / sgAngptl3 had an average size of 110 nm and had similar properties to fLuc mRNA LNP (Figure 24).

[0174] Since intentional levels of editing were observed, more detailed in vivo editing experiments were planned and conducted. As a gold standard, our 306-O12B LNPs encapsulating the RNA component were compared to LNPs (MC3-LNPs) composed of the FDA-approved liver delivery lipid MC-3 encapsulating the exact same RNA component. Note that the same ratio of excipient lipid was used in both 306-O12B LNPs and MC3-LNPs, and the formulation of this particular excipient has already been published for use in MC3-LNPs. Mice were administered 306-O12B LNPs or MC-3-LNPs at a total RNA dose of 3.0 mg / kg. On day 7 post-administration, editing at the desired site in the liver was observed using the T7E1 assay (Figure 25). Furthermore, next-generation sequencing (NGS) of the ANGPTL3 target site in liver samples demonstrated that 306-O12B-LNP-mediated delivery resulted in a significantly higher median editing rate of 38.5% compared to MC-3-mediated delivery (14.6%) (Figure 19A). More importantly, serum analysis revealed that serum ANGPTL3 protein, LDL-C, and TG levels (decreases of 65.2%, 56.8%, and 29.4%, respectively) in the 306-O12B LNP treatment group were significantly lower than those in MC-3 LNP-treated mice (decreases of 25%, 15.7%, and 16.3%, respectively) (Figure 19A). Detailed analysis of the NGS sequencing results revealed that the most frequent editing event was a 1-nt deletion at the precisely predicted Cas9 cleavage site, followed by a 1-nt insertion at the same position (Figure 19B). As expected, the same editing events were observed in both MC3 LNP-treated and 306-012B LNP-treated livers, and the main difference was the frequency of these events. This represents that the observed decrease in serum components was indeed the result of Cas9-mediated genome editing, suggesting that the observed difference in results between the two lipids was due not to a change in the innate activity of Cas9 mRNA, but simply to differences in delivery efficiency.

[0175] For any CRISPR delivery system, care must be taken to avoid off-target editing events and delivery-induced toxicity. The nine most likely top off-target genome mutagenesis sites were computationally predicted, and these loci were examined by NGS sequencing of DNA extracted from the liver. No evidence of editing was observed at any of the top nine predicted off-target mutagenesis sites (Figure 19C). To evaluate in vivo toxicity and potential immune-inflammatory responses, the serum levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT), which are liver function markers, and tumor necrosis factor-α (TNF-α), an inflammation-inducing cytokine, were measured (Figure 26). No significant changes in these parameters were detected after treatment with CRISPR / Cas9 LNP, further demonstrating that systemic toxicity is negligible. References

[0176] 1. P. D. Hsu, E. S. Lander, F. Zhang, Cell 2014, 157, 1262. 2. M. Jinek, K. Chylinski, I. Fonfara, M. Hauer, J. A. Doudna, E. Charpentier, Science 2012, 337, 816. 3. L. Cong, F. A. Ran, D. Cox, S. Lin, R. Barretto, N. Habib, P. D. Hsu, X. Wu, W. Jiang, L. A. Marraffini, F. Zhang, Science 2013, 339, 819. 4. G. J. Knott, J. A. Doudna, Science 2018, 361, 866. 5. H. X. Wang, M. Li, C. M. Lee, S. Chakraborty, H. W. Kim, G. Bao, K. W. Leong, Chem. Rev. 2017,117, 9874. 6. H. Yin, K. J. Kauffman, D. G. Anderson, Nat. Rev. Drug Discov. 2017, 16, 387. 7. Z. Glass, M. Lee, Y. Li, Q. Xu, Trends in Biotechnol. 2018, 36, 173. 8. H. Yin, C. Q. Song, J. R. Dorkin, L. J. Zhu, Y. Li, Q. Wu, A. Park, J. Yang, S. Suresh, A. Bizhanova, A. Gupta, M. F. Bolukbasi, S. Walsh, R. L. Bogorad, G. Gao, Z. Weng, Y. Dong, V. Koteliansky, S. A. Wolfe, R. Langer, W. Xue, D. G. Anderson, Nat. Biotechnol. 2016, 34, 328. 9. M. Wang, J. A. Zuris, F. Meng, H. Rees, S. Sun, P. Deng, Y. Han, X. Gao, D. Pouli, Q. Wu, I. Georgakoudi, D. R. Liu, Q. Xu, Proc. Natl. Acad. Sci. USA 2016, 113, 2868. 10. L. Li, L. Song, X. Liu, X. Yang, X. Li, T. He, N. Wang, S. Yang, C. Yu, T. Yin, Y. Wen, Z. He, X. Wei, W. Su, Q. Wu, S. Yao, C. Gong, Y. Wei, ACS Nano 2017, 11, 95. 11. W. Sun, W. Ji, J. M. Hall, Q. Hu, C. Wang, C. L. Beisel, Z. Gu, Angew. Chem., Int. Ed. 2015, 54, 12029. 12. Q. Liu, K. Zhao, C. Wang, Z. Zhang, C. Zheng, Y. Zhao, Y. Zheng, C. Liu, Y. An, L. Shi, C. Kang, Y. Liu, Adv. Sci. 2019, 6, 1801423. 13. W. Zhou, H. Cui, L. Ying, X. F. Yu, Angew. Chem., Int. Ed. 2018, 57, 10268. 14. P. Wang, L. Zhang, W. Zheng, L. Cong, Z. Guo, Y. Xie, L. Wang, R. Tang, Q. Feng, Y. Hamada, K. Gonda, Z. Hu, X. Wu, X. Jiang, Angew. Chem., Int. Ed. 2018, 57, 1491. 15. K. Lee, M. Conboy, H. M. Park, F. Jiang, H. J. Kim, M. A. Dewitt, V. A. Mackley, K. Chang, A. Rao, C. Skinner, T. Shobha, M. Mehdipour, H. Liu, W. Huang, F. Lan, N. L. Bray, S. Li, J. E. Corn, K. Kataoka, J. A. Doudna, I. Conboy, N. Murthy, Nat. Biomed. Eng. 2017, 1, 889. 16. C. D. Sago, M. P. Lokugamage, K. Paunovska, D. A. Vanover, C. M. Monaco, N. N. Shah, M. G. Castro, S. E. Anderson, T. G. Rudoltz, G. N. Lando, P. M. Tiwari, J. L. Kirschman, N. Willett, Y. C. Jang, P. J. Santangelo, A. V. Bryksin, J. E. Dahlman, Proc. Natl. Acad. Sci. USA 2018, 115, E9944. 17. C. Xu, Z. Lu, Y. Luo, Y. Liu, Z. Cao, S. Shen, H. Li, J. Liu, K. Chen, Z. Chen, X. Yang, Z. Gu, J. Wang, Nat. Commun. 2018, 9, 1. 18. U. Sahin, K. Kariko, O. Tureci, Nat. Rev. Drug Discov. 2014, 13, 759. 19. X. Liang, J. Potter, S. Kumar, Y. Zou, R. Quintanilla, M. Sridharan, J. Carte, W. Chen, N. Roark, S. Ranganathan, N. Ravinder, J. D. Chesnut, J. Biotechnol. 2015, 208, 44. 20. C. J. McKinlay, J. R. Vargas, T. R. Blake, J. W. Hardy, M. Kanada, C. H. Contag, P. A. Wender, R. M. Waymouth, Proc. Natl. Acad. Sci. USA 2017, 114, E448. 21. C. J. McKinlay, N. L. Benner, O. A. Haabeth, R. M. Waymouth, P. A. Wender, Proc. Natl. Acad. Sci. USA 2018, 115, E5859. 22. Y. Li, J. Bolinger, Y. Yu, Z. Glass, N. Shi, L. Yang, M. Wang, Q. Xu, Biomater. Sci. 2019, 7, 596. 22. X. Yang, Q. Tang, Y. Jiang, M. Zhang, M. Wang, L. Mao, J. Am. Chem. Soc. 2019, 141, 3782. 23. M. Wang, K. Alberti, S. Sun, C. L. Arellano, Q. Xu, Angew. Chem., Int. Ed. 2014, 53, 2893. 24. M. Wang, S. Sun, C. I. Neufeld, B. Perez-Ramirez, Q. Xu, Angew. Chem., Int. Ed. 2014, 53, 13444. 25. M. Wang, J. A. Zuris, F. Meng, H. Rees, S. Sun, P. Deng, Y. Han, X. Gao, D. Pouli, Q. Wu, I. Georgakoudi, D. R. Liu, Q. Xu, Proc. Natl. Acad. Sci. USA 2016, 113, 2868. 26. J. Chang, X. Chen, Z. Glass, F. Gao, L. Mao, M. Wang, Q. Xu, Acc. Chem. Res. 2019, 52, 665. 27. J. B. Miller, S. Zhang, P. Kos, H. Xiong, K. Zhou, S. S. Perelman, H. Zhu, D. J. Siegwart, Angew. Chem., Int. Ed. 2017, 56, 1059. 28. E. M. Kennedy, A. V. Kornepati, M. Goldstein, H. P. Bogerd, B. C. Poling, A. W. Whisnant, M. B. Kastan, B. R. Cullen, J. Virol. 2014, 88, 11965. 29. C. Jiang, M. Mei, B. Li, X. Zhu, W. Zu, Y. Tian, Q. Wang, Y. Guo, Y. Dong, X. Tan, Cell Res. 2017, 27, 440. 30. M. Abifadel, M. Varret, J. Rabes, D. Allard, K. Ouguerram, M. Devillers, C. Cruaud, S. Benjannet, L. Wickham, D. Erilich, A. Derre, L. Villeger, M. Farnier, I. Beucler, E. Bruckert, J. Chambaz, B. Chanu, J. M. Lecerf, G. Luc, P. Moulin, J. Weissenbach, A. Part, M. Krempf, C. Junien, N. G. Seidah, C. Boileau, Nat. Genet. 2003, 34, 154. 31. F. A. Ran, L. Cong, W. X. Yan, D. A. Scott, J. S. Gootenberg, A. J. Kriz, B. Zetsche, O. Shalem, X. W u, K. S. Makarova, E. V. Koonin, P. A. Sharp, F. Zhang, Nature 2015, 520, 186. 32. Raal, F. J. et al. Inclisiran for the Treatment of Heterozygous Familial Hypercholesterolemia. N. Engl. J. Med. 382, 1520-1530, (2020). 33. Ray, K. K. et al. Two Phase 3 Trials of Inclisiran in Patients with Elevated LDL Cholesterol. N. Engl. J. Med. 382, 1507-1519, (2020). 34. Koishi, R. et al. Angptl3 regulates lipid metabolism in mice. Nature Genet. 30, 151-157, (2002). 35. Romeo, S. et al. Rare loss-of-function mutations in ANGPTL family members contribute to plasma triglyceride levels in humans. J. Clin. Invest. 119, 70-79, (2009). 36. Tarugi, P., Bertolini, S. & Calandra, S. Angiopoietin-like protein 3 (ANGPTL3) deficiency and familial combined hypolipidemia. J. Biomed. Res. 33, 73-81, (2019). 37. Stitziel, N. O. et al. ANGPTL3 Deficiency and Protection Against Coronary Artery Disease. J. Am. Coll. Cardiol. 69, 2054-2063, (2017). 38. Musunuru, K. & Kathiresan, S. CARDIOVASCULAR ENDOCRINOLOGY Is ANGPTL3 the next PCSK9? Nat. Rev. Endocrinol. 13, 502-503, (2017). 39. Dewey, F. E. et al. Genetic and Pharmacologic Inactivation of ANGPTL3 and Cardiovascular Disease. N. Engl. J. Med. 377, 211-221, (2017). 40. Ahmad, Z. et al. Inhibition of Angiopoietin-Like Protein 3 With a Monoclonal Antibody Reduces Triglycerides in Hypertriglyceridemia. Circulation 140, 470-486, (2019). 41. Graham, M. J. et al. Cardiovascular and Metabolic Effects of ANGPTL3 Antisense Oligonucleotides. N. Engl. J. Med. 377, 222-232, (2017). 42. Hsu, P. D., Lander, E. S. & Zhang, F. Development and Applications of CRISPR-Cas9 for Genome Engineering. Cell 157, 1262-1278, (2014). 43. Doudna, J. A. & Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science 346, 1077-+, (2014). 44. Chen, X. & Goncalves, M. Engineered Viruses as Genome Editing Devices. Mol. Ther. 24, 447-457, (2016). 45. Yin, H., Kauffman, K. J. & Anderson, D. G. Delivery technologies for genome editing. Nat. Rev. Drug Discov. 16, 387-399, (2017). 46. Glass, Z., Lee, M., Li, Y. M. & Xu, Q. B. Engineering the Delivery System for CRISPR-Based Genome Editing. Trends Biotechnol. 36, 173-185, (2018). 47. Yin, H. et al. Non-viral vectors for gene-based therapy. Nat. Rev. Genet. 15, 541-555, (2014). 48. Wang, M., Glass, Z. A. & Xu, Q. Non-viral delivery of genome-editing nucleases for gene therapy. Gene Ther. 24, 144-150, (2017). 49. Qiu, M., Glass, Z. & Xu, Q. B. Nonviral Nanoparticles for CRISPR-Based Genome Editing: Is It Just a Simple Adaption of What Have Been Developed for Nucleic Acid Delivery? Biomacromolecules 20, 3333-3339, (2019). 50. Wang, M. et al. Efficient delivery of genome-editing proteins using bioreducible lipid nanoparticles. Proc. Natl. Acad. Sci. U. S. A. 113, 2868-2873, (2016). 51. Finn, J. D. et al. A Single Administration of CRISPR / Cas9 Lipid Nanoparticles Achieves Robust and Persistent In Vivo Genome Editing. Cell Reports 22, 2227-2235, (2018). 52. Miller, J. B. et al. Non-Viral CRISPR / Cas Gene Editing In Vitro and In Vivo Enabled by Synthetic Nanoparticle Co-Delivery of Cas9 mRNA and sgRNA. Angew. Chem.-Int. Edit. 56, 1059-1063, (2017). 53. Jiang, C. et al. A non-viral CRISPR / Cas9 delivery system for therapeutically targeting HBV DNA and pcsk9 in vivo. Cell Res. 27, 440-443, (2017). 54. Liu, J. et al. Fast and Efficient CRISPR / Cas9 Genome Editing In Vivo Enabled by Bioreducible Lipid and Messenger RNA Nanoparticles. Adv. Mater. 31, 7, (2019). 55. Chadwick, A. C., Evitt, N. H., Lv, W. J. & Musunuru, K. Reduced Blood Lipid Levels With In Vivo CRISPR-Cas9 Base Editing of ANGPTL3. Circulation 137, 975-977, (2018). 56. Akinc, A. et al. The Onpattro story and the clinical translation of nanomedicines containing nucleic acid-based drugs. Nat. Nanotechnol. 14, 1084-1087, (2019). 57. Wang, M. et al. Enhanced Intracellular siRNA Delivery using Bioreducible Lipid-Like Nanoparticles. Adv. Healthc. Mater. 3, 1398-1403, (2014). 58. Zhi, D. F. et al. Transfection Efficiency of Cationic Lipids with Different Hydrophobic Domains in Gene Delivery. Bioconjugate Chem. 21, 563-577, (2010). 59. Wang, M., Sun, S., Alberti, K. A. & Xu, Q. B. A Combinatorial Library of Unsaturated Lipidoids for Efficient Intracellular Gene Delivery. ACS Synth. Biol. 1, 403-407, (2012). 60. Kauffman, K. J. et al. Optimization of Lipid Nanoparticle Formulations for mRNA Delivery in Vivo with Fractional Factorial and Definitive Screening Designs. Nano Lett. 15, 7300-7306, (2015). 61. Sedic, M. et al. Safety Evaluation of Lipid Nanoparticle-Formulated Modified mRNA in the Sprague-Dawley Rat and Cynomolgus Monkey. Vet. Pathol. 55, 341-354, (2018). 62. Madisen, L. et al. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat. Neurosci. 13, 133-U311, (2010). 63. Tabebordbar, M. et al. In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science 351, 407-411, (2016). 64. Platt, R. J. et al. CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell 159, 440-455, (2014). 65. Mout, R., Ray, M., Lee, Y. W., Scaletti, F. & Rotello, V. M. In Vivo Delivery of CRISPR / Cas9 for Therapeutic Gene Editing: Progress and Challenges. Bioconjugate Chem. 28, 880-884, (2017). 66. Tong, S., Moyo, B., Lee, C. M., Leong, K. & Bao, G. Engineered materials for in vivo delivery of genome-editing machinery. Nat. Rev. Mater. 4, 726-737, (2019). 67. Komor, A. C., Badran, A. H. & Liu, D. R. CRISPR-Based Technologies for the Manipulation of Eukaryotic Genomes. Cell 168, 20-36, (2017). 68. Liang, X. Q. et al. Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection. J. Biotechnol. 208, 44-53, (2015). 69. Ramaswamy, S. et al. Systemic delivery of factor IX messenger RNA for protein replacement therapy. Proc. Natl. Acad. Sci. U. S. A. 114, E1941-E1950, (2017). 70. Sabnis, S. et al. A Novel Amino Lipid Series for mRNA Delivery: Improved Endosomal Escape and Sustained Pharmacology and Safety in Non-human Primates. Mol. Ther. 26, 1509-1519, (2018). 71. Hou, X. C. et al. Vitamin lipid nanoparticles enable adoptive macrophage transfer for the treatment of multidrug-resistant bacterial sepsis. Nat. Nanotechnol. 15, 41-+, (2020). 72. Fenton, O. S. et al. Bioinspired Alkenyl Amino Alcohol Ionizable Lipid Materials for Highly Potent In Vivo mRNA Delivery. Adv. Mater. 28, 2939-2943, (2016). 73. Bae, S., Park, J. & Kim, J. S. Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics 30, 1473-1475, (2014). 74. Schmid-Burgk, J. L. et al. Out Knocker: a web tool for rapid and simple genotyping of designer nuclease edited cell lines. Genome Res. 24, 1719-1723, (2014).

Claims

1. A composition for treating human lipoprotein metabolism disorders or cardiovascular diseases, comprising lipidoid nanoparticles containing a lipid, CRISPR / Cas9 mRNA, and single-guide RNA (sgRNA), wherein the sgRNA is sgRNA targeting angiopoietin-like protein 3 (sgANGPTL3) or sgRNA targeting proprotein convertase subtilisin / kexin type 9 (sgPCSK9), wherein the lipid is of formula I: 【Chemical 1】 or a pharmaceutically acceptable salt thereof, wherein, R 頭部 is 【Chemical 2】 [The wavy line represents the binding site to R lipid] is; R 脂質 are each independently 【Chemical Formula 3】 [wherein, R １ and R ２ is H, OH, NHR ３０ or SH; R ３ and R ４ are both H, or R ３ and R ４ together form an oxo (=O) group; However, R １ , R ２ , R ３ and R ４ will not all be H; X is CH ２ , O, NR ３０ , or S; R ３０ is H, C １－６ alkyl, C １－６ alkenyl, or C １－６ alkynyl; m is an integer selected from 1 to 3; n is an integer selected from 1 to 14; p is 0 or 1; q is an integer selected from 1 to 10; t is 0, 1, or 2; [The wavy line represents the binding site to R head] A composition.

2. R 頭部 is 【Chemical Formula 4】 The composition according to claim 1, which is

3. R １ and R ２ is H, or R １ is H and R ２ is OH, the composition according to claim 1 or 2.

4. X is CH ２ , O, or NR ３０ The composition according to any one of claims 1 to 3.

5. The composition according to any one of claims 1 to 4, wherein m is 1 or 2.

6. The composition according to any one of claims 1 to 5, wherein n is an integer selected from 4 to 12.

7. The composition according to any one of claims 1 to 5, wherein n is an integer selected from 6 to 10.

8. The composition according to any one of claims 1 to 7, wherein p is 1.

9. The composition according to any one of claims 1 to 8, wherein q is an integer selected from 2 to 8.

10. The composition according to any one of claims 1 to 8, wherein q is an integer selected from 4 to 8.

11. The composition according to any one of claims 1 to 10, wherein t is 0 or 1.

12. R 脂質 are each independently 【Chemical Formula 5】 The composition according to any one of claims 1 to 11, which is selected from the group consisting of

13. wherein the lipid is [[Chemical Formula 6]] The composition according to any one of claims 1 to 12, which is selected from the group consisting of

14. The composition according to any one of claims 1 to 13, wherein the weight ratio of the lipid to CRISPR / Cas9 mRNA is 3:1 to 15:

1.

15. The composition according to any one of claims 1 to 13, wherein the weight ratio of the lipid to CRISPR / Cas9 mRNA is 7.5:

1.

16. The composition according to any one of claims 1 to 15, wherein the lipidoid nanoparticles further contain cholesterol.

17. The composition according to claim 16, wherein the molar ratio of the lipid to cholesterol is 1:1 to 2:

1.

18. The lipidoid nanoparticles further comprise DOPE, DSPC, or DOPC and DMG-PEG2K, DSPC has the following structure: 【Chemical Formula 7】 having DOPE has the following structure: 【Chemical Formula 8】 having DOPC has the following structure: 【Chemical Formula 9】 having DMG-PEG2K has the following structure: 【Chemical 10】 having, the composition according to any one of claims 1 to 17.

19. The composition according to claim 18, wherein the lipidoid nanoparticles comprise DOPC and DMG-PEG2K.

20. The molar ratio of the lipid to DOPC is 4:1 to 6:1; and the molar ratio of the lipid to DMG-PEG2K is 4:1 to 100:1, the composition according to claim 19.

21. The composition according to any one of claims 1 to 20, wherein the lipidoid nanoparticles have a particle size of 25 nm to 1000 nm.

22. The composition according to any one of claims 1 to 21, wherein the lipidoid nanoparticles have a particle size of 50 nm to 500 nm.

23. Human lipoprotein metabolism disorder is associated with a loss-of-function mutation of the ANGPTL3 gene, or Human lipoprotein metabolism disorder is associated with low plasma high-density lipoprotein cholesterol, high serum low-density lipoprotein cholesterol, or high triglyceride levels, the composition according to any one of claims 1 to 22.

24. Cardiovascular disease is associated with the proprotein convertase subtilisin / kexin type 9 gene (PCSK9), or Cardiovascular disease is selected from the group consisting of homozygous familial hypercholesterolemia and hypercholesterolemia, the composition according to any one of claims 1 to 22.

Images