Nucleic acid medicine targeting MURF1

Abstract

The present inventor found that a nucleic acid targeting a specific sequence or a nucleic acid having a specific sequence has an excellent inhibitory activity on the expression of MURF1. A pharmaceutical composition that comprises the nucleic acid as an active ingredient is usable for treating or preventing a disease associated with one or more symptoms selected from the group consisting of decrease in muscle mass, decrease in muscle strength and muscular dysfunction.

Description

Technical Field

[0001] The present invention relates to a nucleic acid medicine targeting MURF1 (muscle RING finger 1). More specifically, it relates to a nucleic acid against MURF1 that is useful as a prophylactic or therapeutic agent for diseases accompanied by one or more symptoms selected from the group consisting of decreased muscle mass, decreased muscle strength, and decreased muscle function.

Background Art

[0002] Decrease in muscle mass, decrease in muscle strength, or decrease in muscle function are symptoms that appear due to aging, diseases, etc. Examples of diseases accompanied by one or more symptoms selected from the group consisting of decreased muscle mass, decreased muscle strength, and decreased muscle function include, for example, myogenic muscular atrophy caused by diseases of the muscle itself, neurogenic muscular atrophy caused by damage to motor nerves that supply commands and nutrients to the muscle, disuse muscular atrophy caused by immobility, low exercise, or bedridden state of the body due to some cause, cachexia caused by diseases such as COPD, heart failure, tuberculosis, and sarcopenia in which the amount of muscle decreases with aging. However, no therapeutic agent for muscular atrophy has been marketed so far, and suppression of decrease in muscle mass, decrease in muscle strength, or decrease in muscle function is an important preventive and clinical issue.

[0003] MURF1 (Muscle RING-Finger Protein-1) is one of the ubiquitin ligases, which are enzymes highly expressed in skeletal muscle and cardiac muscle, and is an enzyme involved in the degradation of muscle proteins. MURF1 is known to increase in expression during muscular atrophy, and gene-deficient mice have been shown to be resistant to various muscular atrophies, and an increase in expression has also been confirmed in various muscular atrophy patients in humans (Non-Patent Documents 1, 2, etc.). From these facts, it has been suggested that a pharmaceutical composition having MURF1 expression inhibitory activity can be used for the treatment or prevention of diseases accompanied by muscular atrophy.

[0004] Patent Document 1 exemplifies miRNAs and siRNAs as anti-atrophy agents containing inhibitors against the expression of MAFbx / atrogin-1 gene and / or Trim63 / MuRF1 gene. However, miR-23a is explicitly stated in the examples for miRNAs and there are also specific descriptions in the specification, while specific examples of siRNAs are not described and there is no suggestion of their structure or activity.

[0005] SiRNAs against MURF1 are sold as research reagents and are known from papers etc. For example, Non-Patent Document 3 describes siRNAs against rat MURF1. Also, Table 13 of Patent Document 2 describes siRNAs against a number of targets, and 99 siRNAs against human MURF1 are described as ID: 4862450 - 4862549, but no biological data including MURF1 expression inhibition is described.

Prior Art Documents

Patent Documents

[0006]

Patent Document 1

Patent Document 2

Non-Patent Documents

[0007]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Summary of the Invention

Problems to be Solved by the Invention

[0008] An object of the present invention is to provide a nucleic acid having excellent MURF1 expression inhibitory activity.

Means for Solving the Problems

[0009] As a result of intensive studies, the present inventors have successfully synthesized a novel nucleic acid (siRNA) having excellent MURF1 expression inhibitory activity (knockdown activity). Furthermore, the present inventors have found a target region particularly related to the knockdown activity of the nucleic acid among the mRNAs of MURF1. In addition, the nucleic acid of the present invention is sufficiently safe for use as a medicine.

[0010] That is, the present invention relates to the following. (1-1) A nucleic acid that suppresses the expression of MURF1, comprising an oligonucleotide consisting of 15 to 30 nucleotides having a base sequence of at least 15 bases or more complementary to the base sequence consisting of positions 188 to 229, 1039 to 1060, 1427 to 1447, 1510 to 1530, or 1715 to 1737 of SEQ ID NO: 609. (1-2) The nucleic acid according to (1-1), comprising a base sequence complementary to the base sequence. (2-1) The nucleic acid according to (1-1) or (1-2), comprising the following base sequence (a) or (b): (a) The base sequence of SEQ ID NO: 619, 622, or 623; (b) A continuous base sequence of at least 15 bases among the base sequences of SEQ ID NO: 620 or 621. (2-2) The nucleic acid according to (2-1), comprising a base sequence complementary to the base sequence. (3-1) The base sequence of SEQ ID NO: 24, 26, 30, 56, 60, 104, 106, 146, 212, 218, 314, 360, 382, 384, 388, 390, 484, 504, 514, 536, 556, 584, 586, 588, 594, 596, 606, or 608; or A nucleotide sequence in which 1 to 3 bases are deleted, substituted or inserted in the nucleotide sequence of SEQ ID NO: 24, 26, 30, 56, 60, 104, 106, 146, 212, 218, 314, 360, 382, 384, 388, 390, 484, 504, 514, 536, 556, 584, 586, 588, 594, 596, 606 or 608; A nucleic acid comprising the same and suppressing the expression of MURF1. (3-2) The nucleic acid according to (3-1), comprising a nucleotide sequence complementary to the nucleotide sequence. (4-1) The nucleotide sequence of SEQ ID NO: 22, 34, 38, 50, 76, 80, 158, 176, 188, 194, 210, 216, 222, 226, 232, 236, 244, 254, 266, 278, 282, 302, 336, 364, 386, 394, 464, 472, 476, 482, 510, 564, 568, 574 or 578; or, A nucleotide sequence in which 1 to 3 bases are deleted, substituted or inserted at positions 2 to 18 of the nucleotide sequence of SEQ ID NO: 22, 34, 38, 50, 76, 80, 158, 176, 188, 194, 210, 216, 222, 226, 232, 236, 244, 254, 266, 278, 282, 302, 336, 364, 386, 394, 464, 472, 476, 482, 510, 564, 568, 574 or 578; A nucleic acid comprising the same and suppressing the expression of MURF1. (4-2) The nucleic acid according to (4-1), comprising a nucleotide sequence complementary to the nucleotide sequence. (5) A double-stranded nucleic acid comprising any of the following combinations: An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 21 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 22, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 23 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 24, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 25 or 624 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 26, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 29 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 30, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 33 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 34, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 37 or 625 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 38, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 626 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 42, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 49 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 50, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 55 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 56, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 59 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 60, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 75 or 627 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 76, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 79 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 80, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 103 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 104, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 105 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 106, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 145 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 146, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 157 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 158, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 175 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 176, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 187 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 188, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 193 or 628 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 194, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 209 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 210, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 211 or 629 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 212, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 215 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 216, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 217 or 630 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 218, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 221 or 631 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 222, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 225 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 226, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 231 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 232, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 235 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 236, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 243 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 244, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 253 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 254, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 265 or 632 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 266, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 277 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 278, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 281 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 282, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 301 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 302, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 313 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 314, The oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 335 and the oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 336, The oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 359 and the oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 360, The oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 363 and the oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 364, The oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 381 and the oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 382, The oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 383 and the oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 384, The oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 385 and the oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 386, The oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 387 or 633 and the oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 388, The oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 389 or 634 and the oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 390, The oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 393 and the oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 394, The oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 635 and the oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 402, The oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 463 and the oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 464, The oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 471 and the oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 472, The oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 475 and the oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 476, The oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 481 or 636 and the oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 482, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 483 or 637 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 484, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 503 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 504, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 509 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 510, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 513 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 514, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 535 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 536, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 555 or 638 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 556, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 563 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 564, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 567 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 568, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 573 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 574, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 577 or 639 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 578, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 583 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 584, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 585 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 586, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 587 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 588, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 593 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 594, Oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 595 and oligonucleotides consisting of the nucleotide sequence of SEQ ID NO: 596, An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 605 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 606, or The sequence of an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 607 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 608. (6) The nucleic acid according to (5), which suppresses the expression of MURF1. (7) The nucleic acid according to any one of (1-1) to (6), which is siRNA, an antisense oligonucleotide, shRNA or miRNA. (8) The nucleic acid according to (7), which is siRNA containing an overhang at the 3' end of the sense strand and / or the antisense strand. (9) A pharmaceutical composition containing the nucleic acid according to any one of (1-1) to (8). (10) The pharmaceutical composition according to (9), which is used for the prevention or treatment of a disease associated with MURF1. (11) The pharmaceutical composition according to (10), wherein the disease is a disease accompanied by one or more symptoms selected from the group consisting of a decrease in muscle mass, a decrease in muscle strength, and a decrease in muscle function.

[0011] (12) A method for preventing or treating a disease associated with MURF1, which comprises administering the nucleic acid according to any one of (1-1) to (8). (13) The nucleic acid according to any one of (1-1) to (8), which is used for producing a prophylactic or therapeutic agent for a disease associated with MURF1. (14) The nucleic acid according to any one of (1-1) to (8), which is used for the prevention or treatment of a disease associated with MURF1. (15) The method according to (12) or the nucleic acid according to (13) or (14), wherein the disease is a disease accompanied by one or more symptoms selected from the group consisting of a decrease in muscle mass, a decrease in muscle strength, and a decrease in muscle function. [Effect of the Invention]

[0012] The nucleic acid of the present invention exhibits excellent MURF1 expression inhibitory activity and is very useful as a medicament for the prevention or treatment of diseases, particularly diseases associated with one or more symptoms selected from the group consisting of muscle mass reduction, muscle strength reduction, and muscle function reduction.

Mode for Carrying Out the Invention

[0013] The terms used in the present specification are used in the meanings commonly used in the art, unless otherwise specified. In the present invention, genetic engineering techniques known in the art can be utilized. For example, methods described in Molecular Cloning, A Laboratory Manual, Forth Edition, Cold Spring Harbor Laboratory Press (2012), Current Protocols Essential Laboratory Techniques, Current Protocols (2012), etc. can be mentioned.

[0014] The "nucleic acid" of the present invention can be any nucleic acid known in the art as a nucleic acid that can be used as a medicament. For example, siRNA, antisense oligonucleotides, shRNA, miRNA, etc. can be mentioned. The siRNA also includes single-stranded oligonucleotide siRNA (see WO2015 / 168661, etc.). In the case of antisense oligonucleotides, a double-stranded oligonucleotide may be formed together with a hybridizable sequence (see WO2013 / 089283, etc.).

[0015] Examples of the target gene of the nucleic acid of the present invention include MURF1. For example, human MURF1, mouse Murf1, etc. can be mentioned, but are not limited thereto.

[0016] "MURF1" is a known protein. The mRNA sequence of human MURF1 (GenBank: NM_032588.3) is described as SEQ ID NO: 609 in the Sequence Listing, and the amino acid sequence (GenPept: NP_115977.2) is described as SEQ ID NO: 610. The mRNA sequence of mouse Murf1 (GenBank: NM_001039048.2) is described as SEQ ID NO: 611 in the Sequence Listing, and the amino acid sequence (GenPept: NP_115977.2) is described as SEQ ID NO: 612. "MURF1" in the present invention is not limited to these sequences, and there are no restrictions on the number of amino acid or mRNA mutations and mutation sites as long as the function of the protein consisting of the amino acid sequence of SEQ ID NO: 610 or 612 is retained.

[0017] As the "nucleic acid" of the present invention, A nucleic acid that suppresses the expression of MURF1, including an oligonucleotide consisting of 15 to 30 nucleotides having at least 15 bases or more complementary to the base sequence consisting of positions 188 to 229 (more preferably positions 193 to 229), 1039 to 1060, 1427 to 1447, 1510 to 1530, or 1715 to 1737 of SEQ ID NO: 609 is mentioned. The nucleic acid may further contain a base sequence complementary to the base sequence. Each of the above target regions is a region particularly related to the knockdown activity of the nucleic acid in the mRNA of human MURF1. The "complementary" oligonucleotide to the target region is included in the nucleic acid of the present invention as long as it is a substantially complementary sequence, regardless of the length, nucleotide modification, or presence or absence of mutations. The "substantially complementary sequence" refers to an oligonucleotide having at least 70% or more, preferably 80% or more, more preferably 90% or more, and most preferably 95% or more homology with the complete complementary sequence of the above base sequence. Here, homology is indicated by a score using, for example, the search program BLAST using the algorithm developed by Altschul et al. (The Journal of Molecular Biology, 215, 403 - 410 (1990)).

[0018] As a nucleic acid that suppresses the expression of MURF1 and contains an oligonucleotide consisting of 15 to 30 nucleotides having a base sequence of at least 15 bases or more complementary to the base sequence consisting of positions 188 to 229 of SEQ ID NO: 609, for example, SNG-1 to SNG-19, SNG-305, and SNG-306 can be mentioned. As a nucleic acid that suppresses the expression of MURF1 and contains an oligonucleotide consisting of 15 to 30 nucleotides having a base sequence of at least 15 bases or more complementary to the base sequence consisting of positions 1039 to 1060 of SEQ ID NO: 609, for example, SNG-191 to SNG-195, SNG-314, and SNG-315 can be mentioned. As a nucleic acid that suppresses the expression of MURF1 and contains an oligonucleotide consisting of 15 to 30 nucleotides having a base sequence of at least 15 bases or more complementary to the base sequence consisting of positions 1427 to 1447 of SEQ ID NO: 609, for example, SNG-239 to SNG-242, SNG-317, and SNG-318 can be mentioned. As a nucleic acid that suppresses the expression of MURF1 and contains an oligonucleotide consisting of 15 to 30 nucleotides having a base sequence of at least 15 bases or more complementary to the base sequence consisting of positions 1510 to 1530 of SEQ ID NO: 609, for example, SNG-285 to SNG-298 can be mentioned. As a nucleic acid that suppresses the expression of MURF1 and contains an oligonucleotide consisting of 15 to 30 nucleotides having a base sequence of at least 15 bases or more complementary to the base sequence consisting of positions 1715 to 1737 of SEQ ID NO: 609, for example, SNG-300 to SNG-304 can be mentioned.

[0019] The MURF1 expression inhibitory activity (knockdown activity) can be measured by a known method. For example, it can be measured by the method described in the examples below.

[0020] As the "nucleic acid" of the present invention, more preferably, a nucleic acid containing the following base sequence of (a) or (b) can be mentioned. (a) The base sequence of SEQ ID NO: 619, 622, or 623; (b) A continuous nucleotide sequence of at least 15 nucleotides among the nucleotide sequences of SEQ ID NO: 620 or 621. The nucleic acid may further contain a nucleotide sequence complementary to the nucleotide sequence.

[0021] Examples of the nucleic acid containing the nucleotide sequence of SEQ ID NO: 619 (5'-AACAUCUCCAGGCA-3') include SNG-13 to SNG-19, SNG-305, and SNG-306. Examples of the nucleic acid containing the nucleotide sequence of SEQ ID NO: 622 (5'-AAGCACCAAAUUG-3') include SNG-291 to SNG-298. Examples of the nucleic acid containing the nucleotide sequence of SEQ ID NO: 623 (5'-ACAACAUAUAACACA-3') include SNG-300 to SNG-304. Examples of the nucleic acid containing a continuous nucleotide sequence of at least 15 nucleotides among the nucleotide sequence of SEQ ID NO: 620 (5'-UCCAUGUUCUCAAAGC-3') include SNG-191 to SNG-195, SNG-314, and SNG-315. Examples of the nucleic acid containing a continuous nucleotide sequence of at least 15 nucleotides among the nucleotide sequence of SEQ ID NO: 621 (5'-UAGAAAAGUGUCCUGUG-3') include SNG-239 to SNG-242, SNG-317, and SNG-318.

[0022] Other embodiments of the "nucleic acid" of the present invention include the following. (c) A nucleic acid containing the nucleotide sequence of SEQ ID NO: 24, 26, 30, 56, 60, 104, 106, 146, 212, 218, 314, 360, 382, 384, 388, 390, 484, 504, 514, 536, 556, 584, 586, 588, 594, 596, 606, or 608 and suppressing the expression of MURF1; (d) A nucleic acid comprising a nucleotide sequence in which 1 to 3 bases are deleted, substituted or inserted in the nucleotide sequence of SEQ ID NO: 24, 26, 30, 56, 60, 104, 106, 146, 212, 218, 314, 360, 382, 384, 388, 390, 484, 504, 514, 536, 556, 584, 586, 588, 594, 596, 606 or 608, and suppressing the expression of MURF1; (e) A nucleic acid comprising the nucleotide sequence of SEQ ID NO: 22, 34, 38, 50, 76, 80, 158, 176, 188, 194, 210, 216, 222, 226, 232, 236, 244, 254, 266, 278, 282, 302, 336, 364, 386, 394, 464, 472, 476, 482, 510, 564, 568, 574 or 578, and suppressing the expression of MURF1; or, (f) A nucleic acid comprising a nucleotide sequence in which 1 to 3 bases are deleted, substituted or inserted at positions 2 to 18 of the nucleotide sequence of SEQ ID NO: 22, 34, 38, 50, 76, 80, 158, 176, 188, 194, 210, 216, 222, 226, 232, 236, 244, 254, 266, 278, 282, 302, 336, 364, 386, 394, 464, 472, 476, 482, 510, 564, 568, 574 or 578, and suppressing the expression of MURF1. The nucleic acid may further comprise a nucleotide sequence complementary to the nucleotide sequence. The "nucleic acid" of the present invention includes the nucleic acid of the present invention regardless of its length or the presence or absence of nucleotide modification as long as it contains the nucleotide sequence and has the activity of suppressing human MURF1 expression.

[0023] Note that "1 to 3 bases" preferably means 1 or 2 bases. Also, when 2 or 3 bases are mutated, the types of mutations may be the same or different, and are 1 or more selected from deletion, substitution and insertion. As long as deletion, substitution or insertion has the effect of suppressing the expression of the target gene (MURF1), it is included in the nucleic acid of the present invention.

[0024] Other embodiments of the "nucleic acid" of the present invention include the following. A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 21 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 22 (e.g., SNG-11); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 23 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 24 (e.g., SNG-12); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 25 or 624 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 26 (e.g., SNG-13 or SNG-305); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 29 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 30 (e.g., SNG-15); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 33 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 34 (e.g., SNG-17); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 37 or 625 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 38 (e.g., SNG-19 or SNG-306); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 41 or 626 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 42 (e.g., SNG-21 or SNG-307); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 49 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 50 (e.g., SNG-25); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 55 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 56 (e.g., SNG-28); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 59 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 60 (e.g., SNG-30); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 75 or 627 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 76 (e.g., SNG-38 or SNG-308); A double-stranded nucleic acid (e.g., SNG-40) comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 79 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 80; A double-stranded nucleic acid (e.g., SNG-52) comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 103 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 104; A double-stranded nucleic acid (e.g., SNG-53) comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 105 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 106; A double-stranded nucleic acid (e.g., SNG-73) comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 145 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 146; A double-stranded nucleic acid (e.g., SNG-79) comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 157 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 158; A double-stranded nucleic acid (e.g., SNG-88) comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 175 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 176; A double-stranded nucleic acid (e.g., SNG-94) comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 187 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 188; A double-stranded nucleic acid (e.g., SNG-97 or SNG-309) comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 193 or 628 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 194; A double-stranded nucleic acid (e.g., SNG-105) comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 209 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 210; A double-stranded nucleic acid (e.g., SNG-106 or SNG-310) comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 211 or 629 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 212; A double-stranded nucleic acid (e.g., SNG-108) comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 215 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 216; A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 217 or 630 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 218 (e.g., SNG-109 or SNG-311); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 221 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 222 (e.g., SNG-111); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 225 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 226 (e.g., SNG-113); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 231 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 232 (e.g., SNG-116); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 235 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 236 (e.g., SNG-118); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 243 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 244 (e.g., SNG-122); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 253 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 254 (e.g., SNG-127); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 265 or 632 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 266 (e.g., SNG-133 or SNG-313); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 277 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 278 (e.g., SNG-139); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 281 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 282 (e.g., SNG-141); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 301 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 302 (e.g., SNG-151); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 313 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 314 (e.g., SNG-157); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 335 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 336 (e.g., SNG-168); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 359 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 360 (e.g., SNG-180); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 363 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 364 (e.g., SNG-182); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 381 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 382 (e.g., SNG-191); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 383 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 384 (e.g., SNG-192); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 385 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 386 (e.g., SNG-193); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 387 or 633 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 388 (e.g., SNG-194 or SNG-314); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 389 or 634 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 390 (e.g., SNG-195 or SNG-315); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 393 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 394 (e.g., SNG-197); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 401 or 635 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 402 (e.g., SNG-201 or SNG-316); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 463 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 464 (e.g., SNG-232); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 471 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 472 (e.g., SNG-236); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 475 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 476 (e.g., SNG-238); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 481 or 636 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 482 (e.g., SNG-241 or SNG-317); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 483 or 637 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 484 (e.g., SNG-242 or SNG-318); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 503 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 504 (e.g., SNG-252); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 509 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 510 (e.g., SNG-255); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 513 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 514 (e.g., SNG-257); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 535 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 536 (e.g., SNG-268); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 555 or 638 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 556 (e.g., SNG-278 or SNG-319); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 561 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 562 (e.g., SNG-281); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 563 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 564 (for example, SNG-282); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 567 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 568 (for example, SNG-284); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 573 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 574 (for example, SNG-287); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 577 or 639 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 578 (for example, SNG-289 or SNG-320); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 583 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 584 (for example, SNG-292); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 585 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 586 (for example, SNG-293); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 587 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 588 (for example, SNG-294); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 593 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 594 (for example, SNG-297); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 595 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 596 (for example, SNG-298); A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 605 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 606 (for example, SNG-303); or A double-stranded nucleic acid comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 607 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 608 (for example, SNG-304).

[0025] The "nucleic acid" of the present invention preferably includes siRNA (including single-stranded oligonucleotide siRNA), antisense oligonucleotide, shRNA or miRNA. More preferably, it is siRNA or antisense oligonucleotide. Particularly preferably, it is siRNA or antisense oligonucleotide having an oligonucleotide consisting of the nucleotide sequence described in the above (3-1), (3-2), (4-1) or (4-2), or siRNA having the nucleotide sequence described in the above (5). The length of each strand constituting the nucleic acid without the following overhangs or terminal modifications is preferably 15 to 30 nucleotides. For example, lengths of 15 to 25, 17 to 25, 17 to 23, 17 to 21, 19 to 21 nucleotides can be mentioned.

[0026] When the "nucleic acid" of the present invention is siRNA, it may contain an overhang at the 3'-end of the sense strand and / or the antisense strand. The "overhang" means a nucleotide that protrudes from the double-stranded structure when the 3'-end of a single strand of siRNA extends beyond the 5'-end of the other strand (or vice versa). Any nucleotide known in the art and used as an overhang can be used. For example, 1 to 6 nucleotides, 1 to 5 nucleotides, 1 to 3 nucleotides, 2 or 3 nucleotides (dTdT, U(2'-OMe)U(2'-OMe), U(2'-OMe)A(2'-OMe), A(2'-OMe)U(2'-OMe), A(2'-OMe)A(2'-OMe), U(2'-F)U(2'-F), etc.) can be mentioned. It may be complementary or non-complementary to the mRNA of the target sequence.

[0027] The nucleic acid of the present invention not only has the activity of suppressing MURF1 expression, but also has utility as a medicine and has one or more, or all, of the following excellent characteristics. a) Improves one or more symptoms selected from the group consisting of decrease in muscle mass, decrease in muscle strength, and decrease in muscle function. b) Has a weak inhibitory effect on CYP enzymes (for example, CYP1A2, CYP2C9, CYP2C19, CYP2D6, CYP3A4, etc.). c) It exhibits good pharmacokinetics. d) It has high metabolic stability. e) It has no mutagenicity. f) It has a low cardiovascular risk. g) It exhibits high solubility.

[0028] In the nucleic acid of the present invention, the nucleotide may be modified. The appropriately modified nucleic acid has any one or all of the following characteristics as compared with the unmodified nucleic acid. a) It has a high affinity for the target gene. b) It has high resistance to nucleases. c) Its pharmacokinetics is improved. d) Its tissue migration property is enhanced. e) Its immune response and cytotoxicity are low. Therefore, the modified nucleic acid is less likely to be decomposed in vivo as compared with the unmodified nucleic acid, and can more stably inhibit the expression of the target gene.

[0029] Any modification of nucleotides known in the art can be used for the nucleic acid of the present invention. As modifications of nucleotides, phosphate modification, nucleobase modification, and sugar modification are known. Examples of phosphate modification include, for example, the phosphodiester bond possessed by natural nucleic acids, S-oligo(phosphorothioate), D-oligo(phosphodiester), M-oligo(methylphosphonate), boranophosphate, and the like. Examples of nucleobase modification include, for example, 5-methylcytosine, 5-hydroxymethylcytosine, 5-propynylcytosine, and the like. Examples of sugar modification include, for example, 2´-O-CH2-CH2-O-CH3 (2´MOE), LNA (Locked nucleic acid), 2´-OMe, 2´-Fluoro, BNA (Bridged Nucleic Acid), AmNA (see WO2011 / 052436), TrNA (see WO2014 / 126229), 2´-Deoxy, and the like.

[0030] Regarding nucleotide modifications and modification methods known in the art, they are also disclosed in, for example, the following patent documents. WO98 / 39352, WO99 / 014226, WO2000 / 056748, WO2003 / 068795, WO2004 / 016749, WO2005 / 021570, WO2005 / 083124, WO2007 / 143315, WO2009 / 071680, WO2011 / 052436, WO2014 / 112463, WO2014 / 126229, etc.

[0031] The 3'-end and / or 5'-end of the nucleic acid of the present invention may have a modifying group. Examples include protecting groups for hydroxyl groups, abasic nucleotides, phosphate ester moieties (groups represented by the formula: -O-P(=O)(OH)OH or groups represented by the formula: -O-P(=S)(OH)OH or modified groups thereof), etc. In addition, as long as the nucleic acid of the present invention has the above base sequence, abasic nucleotides may be inserted into the nucleic acid.

[0032] The 3'-end and / or 5'-end of the nucleic acid of the present invention (including nucleic acids containing overhangs and terminal modifications) may have a known ligand added thereto. For the purpose of enabling the tracking of the nucleic acid of the present invention, improving the pharmacokinetics or pharmacodynamics of the nucleic acid of the present invention, enhancing the stability or binding affinity of the nucleic acid of the present invention, improving the intracellular dynamics including the intracellular uptake of the nucleic acid of the present invention, or achieving all or any of them, ligands known in the art can be used as components of a transport carrier (liposomes, lipid nanoparticles (LNP), polymers, micelles, virus particles, etc.) composed of a single molecule or multiple types of macromolecules. Examples include reporter molecules, lipids (fatty acids, fatty chains, cholesterol, phospholipids, etc.), sugars (N-acetyl-galactosamine, etc.), vitamins, peptides (membrane-permeable peptides, cell-targeting peptides, receptor-binding peptides, endosome escape-promoting peptides, RGD peptides, peptides with high affinity for blood components, tissue-targeting peptides, etc.), PEG (polyethylene glycol), dyes, fluorescent molecules, etc.

[0033] When the above-mentioned ligand is added to the nucleic acid of the present invention, it may be via a linker. Any linker used in the art can be utilized as the "linker". For example, polar linkers (e.g., oligonucleotide linkers), alkylene linkers, ethylene glycol linkers, ethylenediamine linkers, etc. can be mentioned. The linker can be synthesized with reference to methods known in the art.

[0034] Preferably, the linker is an oligonucleotide linker. The length of the oligonucleotide linker is 2 to 10 bases, 2 to 5 bases, 2 bases, 3 bases, 4 bases, or 5 bases. For example, dG, dGdG, dGdGdGdG, dGdGdGdGdG, dT, dTdT, dTdTdTdT, dTdTdTdTdT, etc. can be mentioned.

[0035] Regarding ligands or linkers known in the art and their synthesis methods, they are also disclosed in, for example, the following patent documents. WO2009 / 126933, WO2012 / 037254, WO2009 / 069313, WO2009 / 123185, WO2013 / 089283, WO2015 / 105083, WO2018 / 181428, etc.

[0036] The nucleic acid (or its modified form) of the present invention can be synthesized by conventional methods. For example, it can be easily synthesized by a commercially available nucleic acid automatic synthesizer (e.g., manufactured by Applied Biosystems, manufactured by Dainippon Seiki Co., Ltd., etc.). The synthesis methods include solid-phase synthesis methods using phosphoramidites, solid-phase synthesis methods using hydrogen phosphonates, etc. For example, it is disclosed in Tetrahedron Letters 22, 1859-1862 (1981), WO2011 / 052436, etc.

[0037] When administered to animals including humans, the nucleic acids of the present invention include any pharmaceutically acceptable salt, ester, or salt of such an ester, or any other equivalent that can (directly or indirectly) provide a biologically active metabolite or its residue. That is, it includes prodrugs and pharmaceutically acceptable salts of the nucleic acids of the present invention, pharmaceutically acceptable salts of the prodrugs, and other biological equivalents.

[0038] A "prodrug" is an inactive or less active form derivative that is converted into an active form (i.e., a drug) in vivo or within cells by the action and / or state of endogenous enzymes or other chemical substances. The prodrugs of the nucleic acids of the present invention can be prepared according to the methods described in WO93 / 24510, WO94 / 26764, WO2004 / 063331, etc.

[0039] "Pharmaceutically acceptable salts" refer to physiologically and pharmaceutically acceptable salts of the nucleic acids of the present invention, i.e., salts that retain the desired biological activity of the nucleic acids and do not give undesired toxicological effects.

[0040] Pharmaceutically acceptable salts include, for example, salts with alkali metals (e.g., lithium, sodium, potassium, etc.), alkaline earth metals (e.g., calcium, barium, etc.), magnesium, transition metals (e.g., zinc, iron, etc.), ammonia, organic bases (e.g., trimethylamine, triethylamine, dicyclohexylamine, ethanolamine, diethanolamine, triethanolamine, meglumine, diethanolamine, ethylenediamine, pyridine, picoline, quinoline, etc.), and amino acids, or inorganic acids (e.g., hydrochloric acid, sulfuric acid, nitric acid, carbonic acid, hydrobromic acid, phosphoric acid, hydroiodic acid, etc.), and organic acids (e.g., formic acid, acetic acid, propionic acid, trifluoroacetic acid, citric acid, lactic acid, tartaric acid, oxalic acid, maleic acid, fumaric acid, mandelic acid, glutaric acid, malic acid, benzoic acid, phthalic acid, ascorbic acid, benzenesulfonic acid, p-toluenesulfonic acid, methanesulfonic acid, ethanesulfonic acid, etc.). Particularly, salts with hydrochloric acid, sulfuric acid, phosphoric acid, tartaric acid, methanesulfonic acid, etc. are included. These salts can be formed by commonly practiced methods.

[0041] The present invention also encompasses a pharmaceutical composition containing the nucleic acid of the present invention. The administration methods and formulations of the pharmaceutical composition of the present invention can be any administration methods and formulations known in the art other than the above-described methods of modification and methods of adding ligands. The administration methods and formulations of nucleic acids are also disclosed, for example, in the following documents. WO2008 / 042973, WO2009 / 127060, WO2011 / 064130, WO2011 / 123468, WO2011 / 153542, WO2013 / 074974, WO2013 / 075035, WO2013 / 163258, WO2013 / 192486, etc.

[0042] The pharmaceutical composition of the present invention can be administered by various methods depending on whether local or systemic treatment is desired or according to the area to be treated. Examples of administration methods include, for example, local (including ophthalmic, intravaginal, rectal, intranasal, transdermal), oral, or parenteral. Examples of parenteral administration include intravenous injection or infusion, subcutaneous, intraperitoneal or intramuscular injection, pulmonary administration by aspiration or inhalation, subdural cavity administration, intraventricular administration, etc.

[0043] When the pharmaceutical composition of the present invention is administered locally, preparations such as transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, solutions, powders, etc. can be used. Examples of compositions for oral administration include powders, granules, suspensions or solutions dissolved in water or non-aqueous media, capsules, powders, tablets, etc. Examples of compositions for parenteral, subdural cavity, or intraventricular administration include sterile aqueous solutions containing buffers, diluents and other appropriate additives.

[0044] The pharmaceutical composition of the present invention can be obtained by mixing an effective amount of the nucleic acid of the present invention with various pharmaceutical additives such as excipients, binders, wetting agents, disintegrants, lubricants, diluents, etc. suitable for its dosage form as needed. In the case of injections, it may be formulated by performing a sterilization treatment together with a suitable carrier.

[0045] Examples of excipients include lactose, sucrose, glucose, starch, calcium carbonate, or crystalline cellulose. Examples of binders include methylcellulose, carboxymethylcellulose, hydroxypropylcellulose, gelatin, or polyvinylpyrrolidone. Examples of disintegrants include carboxymethylcellulose, sodium carboxymethylcellulose, starch, sodium alginate, agar powder, or sodium lauryl sulfate. Examples of lubricants include talc, magnesium stearate, or macrogol. As the suppository base, cacao butter, macrogol, or methylcellulose can be used. Further, when preparing a solution, an oil-in-water emulsion, or a suspension for injection, solubilizers, suspending agents, emulsifiers, stabilizers, preservatives, isotonic agents, etc., which are usually used, may be appropriately added. For oral administration, flavoring agents, fragrances, etc. may be added.

[0046] Administration depends on the severity and responsiveness of the condition being treated, and the treatment course lasts from several days to several months, or until cure is achieved, or until remission of the condition is achieved. The optimal dosing schedule can be calculated from measurements of drug accumulation in the body. A person skilled in the art can determine the optimal dose, administration method, and frequency of repetition. The optimal dose varies depending on the relative potency of each nucleic acid, but generally can be calculated based on the IC50 or EC50 in in vitro and in vivo animal experiments. For example, if the molecular weight of the nucleic acid (derived from the nucleic acid sequence and chemical structure) and an effective dose such as the IC50 (experimentally derived) are given, the dose expressed in mg / kg is calculated according to a general rule. For example, 0.001 to 10 mg / kg per day can be mentioned. In the case of an injection, it can be administered over a certain period, for example, 5 to 180 minutes. It can also be administered once to several times a day, or at intervals of one day to several days (for example, every two weeks).

[0047] Since the pharmaceutical composition of the present invention has MURF1 expression inhibitory activity, it can be used for the prevention or treatment of diseases associated with MURF1. Diseases associated with MURF1 include diseases accompanied by one or more symptoms selected from the group consisting of decreased muscle mass, decreased muscle strength, and decreased muscle function. For example, disuse atrophy (patients who are expected to be hospitalized for a certain period of time or have muscle inactivity due to femoral fractures, pneumonia, etc., or those caused by the use of casts, etc.), locomotor instability syndrome, locomotor syndrome, cachexia, ICU-acquired weakness (muscle strength decline occurring during ICU stay), disease-related muscle atrophy (caused by COPD (Chronic Obstructive Pulmonary Disease), heart failure, tuberculosis, cancer, diabetes, AIDS (Acquired Immunodeficiency Syndrome), sepsis, chronic kidney disease, peripheral neuropathy, sarcopenia, etc.), drug-induced myopathy (muscle atrophy caused by steroid treatment, cancer chemotherapy, etc.), one or more symptoms selected from the group consisting of decreased muscle mass, decreased muscle strength, and decreased muscle function due to aging (such as sarcopenia), amyotrophic lateral sclerosis (ALS), muscular dystrophy, spinal and bulbar muscular atrophy (SBMA), spinal muscular atrophy (SMA), Charcot-Marie-Tooth disease (CMT), congenital myopathy, Guillain-Barré syndrome, mitochondrial encephalomyopathy, congenital metabolic disorder myopathy, polymyositis, dermatomyositis, inclusion body myositis, dysphagia (caused by stroke, cerebrovascular disease, cerebral infarction, intracerebral hemorrhage, Parkinson's disease, radiotherapy, aging, etc.), Cushing's syndrome, primary and / or secondary osteoporosis, osteoarthritis, low back pain, metabolic diseases (diabetes, dyslipidemia, etc.), one or more symptoms selected from the group consisting of decreased muscle mass, decreased muscle strength, and decreased muscle function of the diaphragm caused by the use of ventilators, etc., reduction of fracture risk and / or fall risk (femur, radius, spine, humerus, etc.), one or more symptoms selected from the group consisting of decreased muscle mass, decreased muscle strength, and decreased muscle function in a low-gravity environment, and other intractable / genetic muscle diseases, etc.

Example

[0048] The present invention will be described in more detail with reference to the following examples of the present invention, but the present invention is not limited thereto.

[0049] Example 1 Design of siRNA Homologous to Human and Mouse siRNAs targeting human and mouse MURF1 mRNAs were designed. The mRNA sequences used in the design were human MURF1 (GenBank: NM_032588.3, SEQ ID NO: 609) and mouse Murf1 (GenBank: NM_001039048.2, SEQ ID NO: 611). The designed siRNAs are double-stranded, and the double-strand consists of a 19-base antisense strand and a 19-base sense strand. The antisense strand is the complementary sequence of the mRNA sequence, and the sense strand is the complementary sequence of the antisense strand. The siRNAs were designed such that bases 2 to 17 at the 5'-end of the antisense strand have 100% homology to human and mouse mRNAs. The designed sequences (SNG-1 to SNG320) are shown in Tables 1 to 16. In the tables, the target site indicates the position in SEQ ID NO: 609, and the capital letters in the nucleotide sequence mean RNA.

[0050] [Table 1]

[0051] [Table 2]

[0052] [Table 3]

[0053] [Table 4]

[0054] [Table 5]

[0055] [Table 6]

[0056]

Table 7

[0057]

Table 8

[0058]

Table 9

[0059]

Table 10

[0060]

Table 11

[0061]

Table 12

[0062]

Table 13

[0063]

Table 14

[0064]

Table 15

[0065]

Table 16

[0066] Example 2 In Vitro Model Mouse Cell Culture Mouse melanoma cell line B16 was cultured in MEM (Thermo Fisher Scientific) + 10% fetal bovine serum (FBS) (HyClone) + penicillin (100 units / mL) (Thermo Fisher Scientific) + streptomycin (100 μg / mL) (Thermo Fisher Scientific) and maintained at 37 °C, 95 - 98% humidity and 5% CO2.

[0067] Example 3 Evaluation of siRNA against Murf1 An siRNA duplex with dTdT added as an overhang to the 3´ ends of the antisense strand and sense strand of the siRNA designed in Example 1 was purchased from SIGMA. Using the purchased siRNA duplex, a knockdown experiment was performed on mouse B16 cells cultured under the conditions of Example 2. The siRNA duplex was introduced into the cells using Lipofectamine® 3000 (Thermo Fisher Scientific), and added to the cell culture medium so that the final concentration of the siRNA duplex was 10 nmol / L. 24 hours after introduction, cells were collected using the CellAmp TM Direct RNA Prep Kit for RT-PCR (Takara Bio) and real-time PCR was performed. Gapdh was used as an endogenous control.

[0068] The primer sequences used to measure the expression level of mouse Murf1 were Fw primer: (SEQ ID NO: 613); TGTCTCACGTGTGAGGTGCCTA Rv primer: (SEQ ID NO: 614); CACCAGCATGGAGATGCAGTTAC were used, The primer sequences used to measure the expression level of mouse Gapdh were Fw primer: (SEQ ID NO: 615); TGTGTCCGTCGTGGATCTGA Rv primer: (SEQ ID NO: 616); TTGCTGTTGAAGTCGCAGGAG were used. The results of the knockdown activity are shown in Table 17.

[0069]

Table 17

[0070] The knockdown activity was obtained by relatively comparing the difference (ΔCt) between the expression level (Ct value) of mouse Murf1 and the expression level (Ct value) of mouse Gapdh in cells transfected with each siRNA duplex with the activity of SNG-305 described in Table 18 (ΔΔCt). ΔΔCt = (Expression level of Gapdh - Expression level of SNG-305)(ΔCt) - (Expression level of Gapdh - Expression level of each siRNA duplex)(ΔCt) The knockdown activity of SNG-305 was set as ΔΔCt = 0. siRNAs showing higher activity than the knockdown activity of SNG-305 showed positive values, and siRNAs showing lower activity showed negative values. In the base sequences of Table 18, capital letters represent RNA and lowercase letters represent DNA.

[0071]

Table 18

[0072] SNG-305 is a siRNA duplex designed for mouse Murf1 mRNA and has no homology with human MURF1. However, in mouse B16 cells, Lipofectamine 3000 was used to add the siRNA duplex at a final concentration of 10 nmol / L. It showed a strong knockdown activity of 89% 24 hours after transfection, so it was used as a positive control. As a result, since the siRNA of the present application showed a knockdown activity almost equivalent to that of SNG-305, it was found that the expression of mouse Murf1 was suppressed. Furthermore, since the siRNA of the present application has homology with human MURF1, it was suggested that the expression of human MURF1 was suppressed.

[0073] Example 4 In Vitro Model Human Cell Culture Human skeletal muscle myoblasts were cultured using SkGM-2 BulletKit (Lonza), and then further cultured in DMEM (Thermo Fisher Scientific) + 2% fetal bovine serum (Thermo Fisher Scientific) + penicillin (100 units / mL) (Thermo Fisher Scientific) + streptomycin (100 μg / mL) (Thermo Fisher Scientific), and maintained at 37 °C, 95 - 98% humidity, and 5% CO₂. The culture vessels were used after being coated with Matrigel (Corning).

[0074] Example 5 Evaluation of siRNA against MURF1 SiRNA duplexes with dTdT added as an overhang at the 3´ ends of the antisense and sense strands of some of the siRNAs designed in Example 1 were purchased from SIGMA. Using the purchased siRNA duplexes, knockdown experiments were performed on human skeletal muscle myoblasts cultured under the conditions of Example 4. The siRNA duplexes were introduced into the cells using Lipofectamine® 3000 (Thermo Fisher Scientific), and added to the cell culture medium so that the final concentration of the siRNA duplexes was 20 nmol / L. 24 hours after the introduction, CellAmp TM The cells were harvested using the Direct RNA Prep Kit for RT-PCR (Takara Bio), and real-time PCR was performed. GAPDH was used as the endogenous control.

[0075] The primer sequences used to measure the expression level of human MURF1 were Fw primer: (SEQ ID NO: 640); CGTGTGCAGACCATCATCACTC Rv primer: (SEQ ID NO: 641); CAACGTGTCAAACTTCTGGCTCA Using The primer sequences used to measure the expression level of human GAPDH were Fw primer: (SEQ ID NO: 642); GCACCGTCAAGGCTGAGAAC Rv primer: (SEQ ID NO: 643); TGGTGAAGACGCCAGTGGA was used. The results of the mRNA residual rate are shown in Table 19.

[0076]

Table 19

[0077] The mRNA residual rate was calculated by the following method. All treatment groups were carried out with N = 3. First, the difference (ΔCt) between the expression level (Ct value) of human MURF1 and the expression level (Ct value) of human GAPDH in the cells of the untreated (Non-treated: NT) group was calculated. Then, the average value of each ΔCt was calculated as ΔCt (NT_ave.) . Subsequently, the difference between the expression level (Ct value) of human MURF1 and the expression level (Ct value) of human GAPDH in the cells transfected with each siRNA duplex was calculated (ΔCt (siRNA) ). Then, after calculating the difference (ΔΔCt) between each ΔCt (siRNA) and ΔCt (NT_ave.) , the mRNA residual rate was calculated for each using the following formula. mRNA residual rate = 2 ΔΔCt × 100 (%), ΔΔCt = ΔCt (siRNA) - ΔCt (NT_ave.) Finally, the average value of the mRNA residual rate in each treatment group was calculated. As a result, it was found that the siRNA of the present application has a low mRNA residual rate and strongly suppresses the expression of human MURF1.

Industrial Applicability

[0078] The nucleic acid of the present invention exhibits MURF1 expression inhibitory activity. Therefore, the compound of the present invention is very useful as a medicament for the prevention or treatment of diseases accompanied by one or more symptoms selected from the group consisting of a decrease in muscle mass, a decrease in muscle strength, and a decrease in muscle function.

Claims

1. A nucleic acid that suppresses the expression of MURF1 and contains an oligonucleotide consisting of 15 to 30 nucleotides having a base sequence of at least 15 bases or more complementary to the base sequence consisting of positions 1427 to 1447 of SEQ ID NO:

609.

2. The nucleic acid according to claim 1, which contains a continuous base sequence of at least 15 bases in the base sequence of SEQ ID NO:

621.

3. A nucleic acid that contains the base sequence of SEQ ID NO: 484 and suppresses the expression of MURF1.

4. A nucleic acid that contains the base sequence of SEQ ID NO: 482 and suppresses the expression of MURF1.

5. A double-stranded nucleic acid containing any of the following combinations: An oligonucleotide consisting of the base sequence of SEQ ID NO: 481 or 636 and an oligonucleotide consisting of the base sequence of SEQ ID NO: 482, An oligonucleotide consisting of the base sequence of SEQ ID NO: 483 or 637 and an oligonucleotide consisting of the base sequence of SEQ ID NO:

484.

6. The nucleic acid according to claim 5, which suppresses the expression of MURF1.

7. The nucleic acid according to any one of claims 1 to 6, which is siRNA, an antisense oligonucleotide, shRNA or miRNA.

8. The nucleic acid according to claim 7, which is siRNA containing an overhang at the 3'-end of the sense strand and / or the antisense strand.

9. A pharmaceutical composition containing the nucleic acid according to any one of claims 1 to 8.

10. The pharmaceutical composition according to claim 9, which is used for the prevention or treatment of diseases related to MURF1.

11. The pharmaceutical composition according to claim 10, wherein the disease is a disease accompanied by one or more symptoms selected from the group consisting of a decrease in muscle mass, a decrease in muscle strength, and a decrease in muscle function.

Images