Tobacco plants and tobacco products

Abstract

The present invention relates to a tobacco plant. This tobacco plant contains a nitrate reductase in which the amino acid residue that corresponds to position 525 in the amino acid sequence corresponding to sequence number 2 or 4 is mutated from proline to an amino acid residue other than proline. This tobacco plant has one or more of properties (a)-(c) below: (a) the activity of the nitrate reductase in dark conditions is at least 80% of the activity of the nitrate reductase in bright conditions; (b) individual growth is substantially equivalent to controls; (c) nitrates are reduced relative to controls. Said controls include nitrate reductase comprising the amino acid sequence of sequence number 2 or 4.

Description

Technical Field

[0001] The present invention relates to tobacco plants and methods for producing the same, as well as tobacco products and the like.

Background Art

[0002] Tobacco-specific nitrosamines (TSNAs) are nitrosation products of tobacco alkaloids mainly produced during the drying of tobacco leaves. Tobacco plants accumulate high levels of free nitrates in their leaves, which is related to the production of TSNAs. It is considered that the substance directly involved in the production of TSNAs during the drying of tobacco leaves is nitrite. The free nitrates accumulated in the leaves of tobacco plants are converted into nitrites by the nitrate reductase (NR) possessed by tobacco, but since nitrites are cytotoxic and are rapidly metabolized, the amount of endogenous nitrites generally contained in plant tissues is very small. Most of the nitrites involved in the production of TSNAs during the drying of tobacco leaves are thought to be produced from nitrates by microorganisms living on the leaf surface. That is, in the drying process of tobacco leaves, as the leaf tissue is decomposed, the nitrates accumulated in the leaves are eluted and converted into nitrites by the nitrate reductase (NR) possessed by the microorganisms living on the leaf surface.

[0003] Nitrate reductase is an enzyme that catalyzes the first step of reducing nitrate nitrogen in plants to an organic form and is regulated at the transcriptional, translational, and post-translational levels. The dark environment inactivates nitrate reductase by phosphorylation and subsequent binding of 14-3-3 proteins (Lillo et al. 2004).

[0004] The Plant Cell, 8 (1996), 505 - 517 (Non - Patent Document 1) discloses that, using synthetic peptides, Ser543 of spinach nitrate reductase is a phosphorylation site involved in post - translational regulation, and investigates the effect of substitution of surrounding amino acid residues on the affinity with NR kinase. Among them, the change of the arginine residue (R540) at the - 3 position or the leucine (L538) at the - 5 position from Ser543 to alanine is shown to significantly impair the affinity with NR kinase. On the other hand, the change of the lysine (K539) at the - 4 position, the proline (P545) at the + 2 position, and the methionine (M547) at the + 4 position to alanine is shown not to have a significant effect on the affinity with NR kinase. Also, Figure 8 of Non - Patent Document 1 shows a regulatory phosphorylation site that is highly conserved regardless of plant species in nitrate reductase, and in tobacco NIA2, serine at position 523 corresponds to this site.

[0005] Plant physiology., 140 (2006), 1085 - 1094 (Non - Patent Document 2) describes that, when the nitrate reductase (S521D - NR) gene in which serine at position 521 of NIA2 was converted to aspartic acid was introduced into tobacco plant Nicotiana plumbaginifolia E23 mutant and overexpressed under the CaMV 35S promoter, the plants (S521D lines) into which the S521D - NR gene was introduced constantly maintained high nitrate reductase activity day and night, and the nitrate content of the individuals remained at a low and almost constant level day and night. Plant J., 35 (2003), 566 - 573 (Non - Patent Document 3) partly shares the same authors as Non - Patent Document 2 and describes the construction of the S521D - NR construct of tobacco and the S521D - NR - introduced tobacco.

[0006] Considering the description in Non - Patent Document 1, it is clear that "S521D" in Non - Patent Documents 2 and 3 is a misprint of "S523D".

[0007] WO2016 / 046288 (Patent Document 1) (corresponding to Special Table 2017-529850) describes a tobacco product having reduced tobacco-specific nitrosamines (TSNA) produced from tobacco plants. The tobacco plants (i) a polynucleotide consisting of a sequence encoding a relaxed nitrate reductase enzyme, comprising a sequence encoding a relaxed nitrate reductase enzyme, or consisting essentially of a sequence encoding a relaxed nitrate reductase enzyme, (ii) a polypeptide encoded by the polynucleotide described in (i), (iii) a polypeptide consisting of a relaxed nitrate reductase enzyme, comprising a relaxed nitrate reductase enzyme, or consisting essentially of a relaxed nitrate reductase enzyme, or (iv) a construct, vector, or Expression vector comprising the polynucleotide described in (i), wherein the expression or activity of the nitrate reductase is attenuated as compared to a control unmodified tobacco plant, and the attenuated nitrate reductase enzyme (a) a nitrate reductase polypeptide comprising an amino acid substitution at a position corresponding to position 523 of SEQ ID NO: 4, or (b) a nitrate reductase polypeptide comprising an amino acid substitution at a position corresponding to position 523 of SEQ ID NO: 4, which is modified such that the amino acid at position 523 of SEQ ID NO: 4 is substituted with aspartic acid, is identified.

[0008] Examples in Patent Document 1 disclose data showing that the nitrate content in the leaves of the S523D mutant of the tobacco nitrate reductase gene (Nia2) decreased, and data showing that TSNA in dry leaves and tobacco smoke decreased. The S523D mutant in the examples of this document is one in which the S523D mutant Nia2 is constitutively expressed under the 35S promoter.

[0009] WO2020 / 141062 (Patent Document 2) describes a variant in which the methionine residue at position 527 of the tobacco nitrate reductase protein is substituted with another amino acid residue. The examples in Patent Document 2 describe that for the M527I variant (only homozygous) of the tobacco nitrate reductase gene (Nia2), the amount of nitrate in the leaves decreased.

Prior Art Documents

Patent Documents

[0010]

Patent Document 1

Patent Document 2

Non-Patent Documents

[0011]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Summary of the Invention

Problems to be Solved by the Invention

[0012] The S523D recombinants of Non-Patent Documents 2 and 3 and Patent Document 1 are those in which the Nia2 gene having an amino acid substitution mutation is constitutively expressed under the 35S promoter. As confirmed by the present applicant, it has become clear that this gene recombinant is accompanied by extremely poor growth. Further, Patent Document 2 describes that since M527 is mutated to I and is more easily phosphorylated, the NR activity is considered to be decreased. However, the reason for the decrease in the amount of nitric acid contained is not described. Further, heterozygotes having the mutation heterozygously are not disclosed. Further, for the Nia1 gene, mutants, gene-modified variants, and gene recombinants have not been obtained in any of the prior art documents.

[0013] Proline 525 (P525) of the nitrate reductase protein of tobacco plants is located two positions plus from serine 523 (S523) at the phosphorylation site. Although this proline is known to be widely conserved in plants (Figure 8 of Non-Patent Document 1), it has been shown that the change of this proline to alanine does not significantly affect the recognition by NR kinase (Table 3 of Non-Patent Document 1).

[0014] However, the present inventors have created a number of mutants in which two types of nitrate reductases NIA1 and NIA2 are mutated in tobacco plants. Among them, tobacco plants containing a nitrate reductase in which the amino acid residue corresponding to position 525 of the amino acid sequence of the nitrate reductase protein is mutated from proline to an amino acid residue other than proline have the following excellent properties: (a) the activity of nitrate reductase is less likely to decrease even under dark conditions, (b) the growth of individuals is essentially the same as that of the control, and (c) the nitrate is reduced as compared with the control. The present invention was conceived based on these findings.

Means for Solving the Problems

[0015] The present invention includes the following aspects, although not limited thereto. [Aspect 1] A tobacco plant comprising a nitrate reductase in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to an amino acid residue other than proline. [Aspect 2] Having one or more of the following properties (a)-(c): (a) The activity of nitrate reductase under dark conditions is 80% or more of the activity of nitrate reductase under light conditions; (b) The growth of the individual is essentially equivalent to that of the control; and / or (c) Nitrate is reduced as compared to the control. Here, the control is a tobacco plant comprising a nitrate reductase consisting of the amino acid sequence of SEQ ID NO: 2 or 4. The tobacco plant according to Aspect 1. [Aspect 3] The tobacco plant according to Aspect 1 or 2, comprising a nitrate reductase in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to leucine or serine. [Aspect 4] The tobacco plant according to any one of Aspects 1-3, wherein in the amino acid sequence of the mutated nitrate reductase, the amino acid residue corresponding to position 523 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is serine. [Aspect 5] The tobacco plant according to any one of Aspects 1-4, wherein the mutated nitrate reductase has an amino acid sequence that is 80% or more identical to the amino acid sequence of SEQ ID NO: 2 or 4. [Aspect 6] The tobacco plant according to any one of Aspects 1-5, wherein the mutated nitrate reductase has an amino acid sequence corresponding to any one of SEQ ID NOs: 5-8. [Aspect 7] The tobacco plant according to any one of Aspects 2-6, wherein nitrate is reduced by at least 10% as compared to the control. [Aspect 8] The tobacco plant according to any one of Aspects 1-7, which is a mutant or a genetically modified variant. [Aspect 9] The tobacco plant according to any one of aspects 1-8, wherein the tobacco plant is Nicotiana tabacum. [Aspect 10] (i) Modifying the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 of the nitrate reductase of a tobacco plant to an amino acid residue other than proline, or (ii) Selecting, by mutation, a tobacco plant in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 of the nitrate reductase has mutated from proline to an amino acid residue other than proline, A method for producing a tobacco plant according to any one of aspects 1-9, comprising the above. [Aspect 11] Leaf tobacco harvested from the tobacco plant according to any one of aspects 1-9. [Aspect 12] Dried leaves produced from the leaf tobacco according to aspect 11. [Aspect 13] Cut filler, powder, sheet, midrib, granule, or extract produced from the dried leaves according to aspect 12. [Aspect 14] A tobacco product comprising the dried leaves according to aspect 12 and / or the cut filler, powder, sheet, midrib, granule, or extract according to aspect 13. [Advantages of the Invention]

[0016] In the modified tobacco plant of the present invention, the nitrate accumulation amount in the leaves is reduced. By using the modified tobacco plant of the present invention, the TSNA of tobacco raw materials and tobacco products can be reduced. In the modified tobacco plant of the present invention, not only the amount of nitrate in the leaves decreases, but preferably, the growth of the plant body is also good. This is also an excellent and remarkable effect for use as a material for leaf tobacco for producing tobacco products. [Brief Description of the Drawings]

[0017]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7A

Figure 7B

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22A

Figure 22B

Mode for Carrying Out the Invention

[0018] The present invention includes, without limitation, the following aspects. Unless otherwise specified herein, the technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. The substances, materials, and examples disclosed herein are merely illustrative and are not intended to be limiting. When reference is made herein to "in one aspect", it means not limited to that aspect, i.e., it is non-limiting.

[0019] 1. Tobacco plant In one aspect, the present invention relates to a tobacco plant. The tobacco plant of the present invention contains a nitrate reductase in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to an amino acid residue other than proline (hereinafter sometimes referred to as "mutated nitrate reductase").

[0020] The "tobacco plant" refers to the genus Nicotiana of the Solanaceae family ( Nicotiana) is a plant, for example, Nicotiana acaulis, Nicotiana acuminata, Nicotiana acuminata var. multzjlora, Nicotiana africana, Nicotiana alata, Nicotiana amplexicaulis, Nicotiana arentsii, Nicotiana attenuata, Nicotiana benavidesii, Nicotiana benthamiana, Nicotiana bigelovii, Nicotiana bonariensis, Nicotiana cavicola, Nicotiana clevelandii, Nicotiana cordifolia, Nicotiana corymbosa, Nicotiana debneyi, Nicotiana excelsior, Nicotiana forgetiana, Nicotiana fragrans, Nicotiana glauca, Nicotiana glutinosa, Nicotiana goodspeedii, Nicotiana gossei, Nicotiana ingulba, Nicotiana kawakamii, Nicotiana knightiana, Nicotiana langsdorffilangsdorfi), Nicotiana linearis, Nicotiana longiflora, Nicotiana maritima, Nicotiana megalosiphon, Nicotiana miersii, Nicotiana noctiflora, Nicotiana nudicaulis, Nicotiana obtusifolia, Nicotiana occidentalis, Nicotiana occidentalis subsp. Hesperis, Nicotiana otophora, Nicotiana paniculata, Nicotiana pauczjlora, Nicotiana petunioides, Nicotiana plumbaginifolia, Nicotiana quadrivalvis, Nicotiana raimondii, Nicotiana repanda, Nicotiana rosulata, Nicotiana rosulata subsp. Ingulba, Nicotiana rotundifolia, Nicotiana rustica (wild tobacco), Nicotiana setchellii, Nicotiana simulans, Nicotiana solanifolia Nicotiana spegazzinii) Nicotiana stocktonii, Nicotiana suaveolens, Nicotiana sylvestris, Nicotiana tabacum, Nicotiana thyrsiflora, Nicotiana tomentosa, Nicotiana tomentosiformis ) Nicotiana trigonophylla, Nicotiana umbratica, Nicotiana undulata, Nicotiana velutina, Nicotiana wigandioides, and hybrids of tobacco plants, etc. are included. Although not limited, Nicotiana benthamiana, Nicotiana rustica, and Nicotiana tabacum are more preferred, and Nicotiana rustica and Nicotiana tabacum used as raw materials for leaf tobacco production are particularly preferred.

[0021] Tobacco plants can include not only adult and whole tobacco plants but also their parts. Without limitation, the said parts are selected from the group consisting of leaves (including leaf blades and petioles), stems, roots, seeds, flowers, pollens, anthers, ovules, pedicels, meristems, cotyledons, hypocotyls, sheaths, embryos, endosperms, explants, calluses, tissue cultures, buds, cells, and protoplasts.

[0022] "Nitrate reductase" (sometimes referred to as "NR") means an enzyme that is a type of nitrogen metabolism enzyme and reduces nitrate (NO3 - ) to nitrite (NO2 - ). Nitrate reductase is widely distributed in plants, yeasts, fungi, algae, etc. In plants, nitrate reductase is known in tobacco, Arabidopsis thaliana, Brassica napus, kidney beans, barley, pumpkins, maples, soybeans, corn, rice, spinach, etc. (Table 8 of Non-Patent Document 1).

[0023] In one aspect, the nitrate reductase is derived from a plant, preferably from a plant of the genus Nicotiana. In one aspect, the nitrate reductase is the nitrate reductase of Nicotiana tabacum. Nicotiana tabacum has two nitrogen metabolism enzyme genes with a high degree of homology called Nia1 and Nia2. The nitrate reductase herein, in one aspect, includes the NIA1 protein (the Nia1 gene is derived from the T genome) and its variants, and / or the NIA2 protein (the Nia2 gene is derived from the S genome) and its variants. In one aspect, the nitrate reductase herein includes the NIA1 protein (the Nia1 gene is derived from the T genome) and its variants.

[0024] The Nia1 gene and the Nia2 gene each have the nucleotide sequences of SEQ ID NO: 1 and 3. The NIA1 protein and the NIA2 protein each have the amino acid sequences of SEQ ID NO: 2 and 4 encoded by the nucleotide sequences of SEQ ID NO: 1 and 3.

[0025] The tobacco plant of the present invention contains a nitrate reductase in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to an amino acid residue other than proline. In the present specification, "containing a nitrate reductase" means, unless otherwise specified, containing a nitrate reductase protein or containing a nucleic acid encoding a nitrate reductase protein. The amino acid sequence of 518-528 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is "LKKSISTPFMN". The nitrate reductase proteins of plants other than Nicotiana tabacum also contain a site having an amino acid sequence similar to the amino acid sequence of 518-528 of "LKKSISTPFMN" in the amino acid sequence corresponding to SEQ ID NO: 2 or 4. This site may contain some mutations. For example, in Table 8 of Non-Patent Document 1, it is described that in 518-528 of the amino acid sequence corresponding to SEQ ID NO: 2 or 4, the nitrate reductase protein of each plant has the amino acid sequence of "LK(K / R)(S / T)(I / V / T / A)S(T / S)PFMN". The "amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4" is, for example, the amino acid residue following the wild-type S-(T / S) of the nitrate reductase protein and the amino acid residue following F-M, which is proline in the wild-type nitrate reductase protein.

[0026] In the tobacco plant of the present invention, proline at position 525 in the wild-type nitrate reductase protein is mutated to an amino acid residue other than proline. The mutation of the nitrate reductase gene may be heterozygous or homozygous. Also, when there are two types of nitrate reductase proteins, NIA1 protein and NIA2 protein, the mutation may be either in the NIA1 protein or the NIA2 protein.

[0027] In one aspect, the tobacco plant contains a nitrate reductase in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to leucine or serine.

[0028] In one aspect, in the amino acid sequence of the mutated nitrate reductase, the amino acid residue corresponding to position 523 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is serine. This means that the amino acid residue at this position has not mutated (including not being modified) from the wild-type nitrate reductase.

[0029] In one aspect, in the amino acid sequence of the mutated nitrate reductase, the amino acid residue corresponding to position 527 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is methionine. This means that the amino acid residue at this position has not mutated (including not being modified) from the wild-type nitrate reductase.

[0030] The amino acid sequence of the mutated nitrate reductase of the present invention is a nitrate reductase in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 has mutated from proline to an amino acid residue other than proline, and, preferably, as long as the condition that the amino acid residue corresponding to position 523 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is serine in the amino acid sequence of the nitrate reductase is satisfied, it may be a variant having some diversity (mutation) from SEQ ID NO: 2 or 4.

[0031] In one aspect, the mutated nitrate reductase has an amino acid sequence that is at least 80% identical to the amino acid sequence of SEQ ID NO: 2 or 4. Preferably, it is at least 82% identical, at least 85% identical, at least 88% identical, at least 90% identical, at least 92% identical, at least 95% identical, at least 97% identical, at least 98% identical, at least 99% identical to the amino acid sequence of SEQ ID NO: 2 or 4. In any case, it has the condition that the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 has mutated from proline to an amino acid residue other than proline.

[0032] In one aspect, the mutated nitrate reductase is encoded by a nucleic acid having a nucleotide sequence that is at least 80% identical to the nucleotide sequence corresponding to SEQ ID NO: 1 or 3. Preferably, it is encoded by a nucleic acid having a nucleotide sequence that is at least 82%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 1 or 3. In any case, it satisfies the condition that the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to an amino acid residue other than proline.

[0033] In this specification, the identity percentage of two amino acid sequences can be determined by visual inspection and mathematical calculation. It can also be determined using a computer program. Examples of such computer programs include BLAST and ClustalW. In particular, the various conditions (parameters) for identity search by the BLAST program are those described by Altschul et al. (Nucl. Acids Res., 25, p. 3389-3402, 1997) and can be publicly obtained from the websites of NCBI and DNA Data Bank of Japan (DDBJ) (BLAST Manual, Altschul et al., NCB / NLM / NIH Bethesda, MD 20894; Altschul et al.). It can also be determined using programs such as the genetic information processing software GENETYX Ver. 7 (Genetics), DNASIS Pro (Hitachi Software), and Vector NTI (Infomax).

[0034] In this specification, the identity percentage of two nucleotide sequences can be determined by visual inspection and mathematical calculation. It can also be determined using a computer program. Examples of such sequence comparison computer programs include, for example, the BLASTN program available from the website of the National Library of Medicine, USA: https: / / blast.ncbi.nlm.nih.gov / Blast.cgi (Altschul et al. (1990) J. Mol. Biol. 215: p. 403-10): version 2.2.7, or the WU-BLAST2.0 algorithm, etc. The standard default parameter settings for WU-BLAST2.0 can be those described on the following Internet site: http: / / blast.wustl.edu.

[0035] In one aspect, the mutated nitrate reductase may have an amino acid sequence in which one or several amino acids are deleted, substituted, inserted, or added in the amino acid sequence of SEQ ID NO: 2 or 4. However, the nitrate reductase has the condition that the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to an amino acid residue other than proline.

[0036] When it is said that "one or several amino acids are deleted, substituted, inserted, or added", it refers to an amino acid sequence in which one or several amino acids are deleted, substituted with other amino acids, inserted with other amino acids, and / or added with other amino acids in the target amino acid sequence. "Several amino acids" means, without limitation, within 200, within 100, within 50, within 30, within 20, within 15, within 12, within 10, within 8, within 6, within 4, within 3, or within 2 amino acids. Alternatively, several amino acids means 30%, preferably 25%, 20%, 15%, 10%, 5%, 3%, 2%, or 1% of the amino acids with respect to the full length of the amino acid sequence.

[0037] Among the above, the substitution is preferably a conservative substitution. A conservative substitution is to replace a specific amino acid residue with a residue having similar physicochemical characteristics, but any substitution may be used as long as it does not substantially change the characteristics related to the structure of the original sequence. For example, any substitution may be used as long as the substituted amino acid does not disrupt the helix present in the original sequence or other types of secondary structures that characterize the original sequence. Hereinafter, conservative substitutions of amino acid residues will be classified and exemplified for each substitutable residue, but the substitutable amino acid residues are not limited to those described below.

[0038] Group A: Leucine, Isoleucine, Valine, Alanine, Methionine, Glycine, Cysteine, Proline Group B: Aspartic acid, Glutamic acid Group C: Asparagine, Glutamine Group D: Lysine, Arginine Group E: Serine, Threonine Group F: Phenylalanine, Tyrosine, Tryptophan, Histidine In the case of non-conservative substitution, one member of the above types can be exchanged with a member of another type. For example, in order to eliminate inadvertent sugar chain modification, the amino acids in Groups B, D, and E above may be substituted with amino acids in other groups. Alternatively, cysteine may be deleted or substituted with other amino acids in order to prevent folding in the protein in the tertiary structure. Alternatively, the amino acid may be substituted in consideration of the hydrophobicity / hydrophilicity index of the amino acid (J. Kyte and R. Doolittle, J. Mol. Biol., Vol. 157, p. 105-132, 1982), which is an index of hydrophobicity / hydrophilicity regarding amino acids, so as to maintain the balance of hydrophilicity / hydrophobicity or increase the hydrophilicity for easy synthesis.

[0039] As another aspect, substitution with an amino acid having less steric hindrance than the original amino acid, for example, substitution from Group F to Groups A, B, C, D, and E; substitution from a charged amino acid to an uncharged amino acid, for example, substitution from Group B to Group C, may be performed.

[0040] In one aspect, the mutated nitrate reductase has an amino acid sequence corresponding to any one of SEQ ID NOs: 5-8. SEQ ID NOs: 5 and 6 are amino acid sequences in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to leucine, respectively. SEQ ID NOs: 7 and 8 are amino acid sequences in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to serine, respectively.

[0041] In one aspect, the tobacco plant may be a mutant or a genetically modified plant.

[0042] As used herein, a "mutant" is a modified tobacco plant due to a random mutation that occurs naturally or artificially. The method for creating mutants is described in detail in "3. Method for Creating Tobacco Plants" below. Also, mutants include, but are not limited to, tobacco plants selected from the progeny of crossing a mutant with a tobacco plant as one parent, which have a nucleic acid encoding a nitrate reductase protein in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to an amino acid residue other than proline, or their progeny.

[0043] A "genetically modified plant" is a tobacco plant in which the endogenous gene encoding the protein has been modified so that the tobacco plant expresses a nitrate reductase protein in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to an amino acid residue other than proline, including its progeny.

[0044] "Mutants" and "genetically modified plants" may include not only the whole adult tobacco plants but also their parts. Non-limitingly, the parts are selected from the group consisting of leaves (including leaf blades and petioles), stems, roots, seeds, flowers, pollen, anthers, ovules, pedicels, meristems, cotyledons, hypocotyls, sheaths, embryos, endosperms, explants, calli, tissue cultures, buds, cells, and protoplasts.

[0045] Also, in one aspect, the tobacco plant may be a recombinant and its progeny in which a nucleic acid encoding the protein is introduced from the outside by artificial manipulation so as to express a nitrate reductase protein in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to an amino acid residue other than proline. Although not limited, it is preferable that the nucleic acid encoding the protein is stably integrated into the genome so as to be transmitted to progeny.

[0046] 2. Properties of tobacco plants Non-limitingly, the tobacco plant of the present invention has one or more of the following properties (a)-(c): (a) The activity of nitrate reductase under dark conditions is 80% or more of the activity of nitrate reductase under light conditions; (b) The growth of the individual is essentially the same as that of the control; and / or (c) Nitrate is reduced as compared with the control.

[0047] Here, the control is a tobacco plant containing nitrate reductase consisting of the amino acid sequence of SEQ ID NO: 2 or 4. The nitrate reductase consisting of the amino acid sequence of SEQ ID NO: 2 or 4 is the nitrate reductase possessed by wild-type tobacco plants and has not been modified at all. In one aspect, the control may be Nicotiana tabacum, preferably wild-type Nicotiana tabacum, containing nitrate reductase consisting of the amino acid sequence of SEQ ID NO: 2 or 4. Wild-type Nicotiana tabacum contains nitrate reductase consisting of the amino acid sequence of SEQ ID NO: 2 or 4, and its expression and activity have not been modified at all.

[0048] In one aspect, the tobacco plant of the present invention has two or more, or all three, of the properties (a)-(c).

[0049] "The activity of nitrate reductase" can be measured, for example, by the method described in (5) "NR enzyme activity" of Comparative Example 2 in this specification, without limitation. For example, the tissue of the leaves (laminae) of the collected tobacco plants is freeze-dried to prepare a crude extract. NR activity measurement buffer is added to this crude extract and reacted, and the amount of nitrous acid generated in the reaction solution is measured.

[0050] Alternatively, "the activity of nitrate reductase" can also be measured by a method of measuring the absorbance at 340 nm using 0.5 mM potassium ferricyanide and 0.1 mM NADH instead of quantifying nitrous acid, a method of measuring its oxidation using reduced methyl viologen or bromophenol blue, etc.

[0051] That is, without limitation, in this specification, "the activity of nitrate reductase" may be the activity measured by the above-described methods and techniques for the tissue of the target tobacco plant.

[0052] The dark condition means, without limitation, keeping it in a condition where light does not reach (for example, an illuminance of 1 lux or less, preferably 0.1 lux or less) for 30 minutes or more, 60 minutes or more, 90 minutes or more, 120 minutes or more. In contrast, the light condition means keeping it in a condition where light reaches (for example, 5000 lux or more, preferably 10000 lux or more) for 30 minutes or more, 60 minutes or more, 90 minutes or more, 120 minutes or more.

[0053] "The activity of nitrate reductase under dark conditions is 80% or more of the activity of nitrate reductase under light conditions" means that the activity of nitrate reductase under dark conditions is 80% or more of the activity of nitrate reductase under light conditions measured by the same method under the same conditions except for the light conditions. Non-limitingly, preferably, the activity of nitrate reductase under dark conditions is 85% or more, 88% or more, 90% or more, 92% or more, 95% or more, 97% or more, 98% or more, 99% or more of the activity of nitrate reductase under light conditions. In one aspect, the activity of nitrate reductase under dark conditions does not substantially decrease as compared with the activity of nitrate reductase under light conditions, that is, it is substantially the same. In one aspect, the activity of nitrate reductase under dark conditions is the same as the activity of nitrate reductase under light conditions. A tobacco plant (control) containing nitrate reductase consisting of the amino acid sequence of SEQ ID NO: 2 or 4 has the activity of nitrate reductase suppressed under dark conditions as compared with light conditions. In contrast, a tobacco plant containing nitrate reductase in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to an amino acid residue other than proline does not have the activity of nitrate reductase suppressed under dark conditions in the same manner as under light conditions, or is less likely to be suppressed. In one aspect, regarding the mutation of the nitrate reductase gene, not only the mutant homozygote but also the mutant heterozygote is less likely to have a decrease in the activity of nitrate reductase under dark conditions.

[0054] In one aspect, the tobacco plant contains nitrate reductase consisting of the amino acid sequence of SEQ ID NO: 2 or 4, and the individual growth is essentially equivalent to that of a control which is a tobacco plant.

[0055] As shown in Comparative Example 2 of the present specification, in wild-type NIA2_WT, no significant difference in growth was observed regardless of the presence or absence of constitutive expression. The genetically modified tobacco in which NIA2_S523D described in Patent Document 1 is constitutively expressed showed dwarfism with a smaller individual size (Figure 3). In Example 6, in the line in which NIA2_S523D is constitutively expressed, significant growth retardation was observed as compared with the line in which it was not expressed, and furthermore, the flowering period was also delayed.

[0056] In contrast, a tobacco plant containing a nitrate reductase in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to an amino acid residue other than proline had substantially the same individual growth as a control tobacco plant containing a nitrate reductase consisting of the amino acid sequence of SEQ ID NO: 2 or 4. In Example 6, no abnormal growth was observed in the lines in which the amino acid substitution mutations of P525L and P525S of NIA1 were homozygous.

[0057] "Substantially the same individual growth" means that the size (growth) of the individual plant, such as the height of the plant, the number of leaves, the size of the leaves, the mass (e.g., the dry weight of the above-ground leaves (biomass)), and the flowering time are substantially the same. Non-limitingly, for example, when comparing heights, it means that the difference is within 20%, within 15%, within 10%, or within 5%.

[0058] In one aspect, the tobacco plant has a reduced amount of nitrate contained therein as compared to the control. Nitrate can be measured, non-limitingly, for example, by the method described in (2) Nitrate Quantification in Comparative Example 2 of this specification. For example, leaves collected from a tobacco plant may be dried, extracted with water, and then the filtered filtrate may be used as a measurement sample.

[0059] In one aspect, in the tobacco plant, nitrate is preferably reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% as compared to the control.

[0060] One or more of the above properties (a)-(c) are preferably inherited not only in the M1 generation, which is a mutant or genetically modified variant, but also in subsequent generations (M2 generation, M3 generation, and so on).

[0061] 3. Method for Creating a Tobacco Plant In one aspect, the present invention relates to a method for creating a tobacco plant. The method for creating a tobacco plant is (i) Modifying the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 of the nitrate reductase of a tobacco plant from proline to an amino acid residue other than proline, or (ii) Selecting a tobacco plant in which, due to mutation, the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 of the nitrate reductase has mutated from proline to an amino acid residue other than proline, including this.

[0062] The meanings of "nitrate reductase", "the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 has mutated from proline to an amino acid residue other than proline", etc. are as described up to "2. Properties of tobacco plants".

[0063] The modification of the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 of the nitrate reductase protein in a tobacco plant from proline to an amino acid residue other than proline can be carried out by modifying the endogenous gene encoding the protein so that the tobacco plant expresses a nitrate reductase protein in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 has mutated from proline to an amino acid residue other than proline.

[0064] Modification of the endogenous gene may be performed, for example, using a genome editing system. The genome editing system can bind or cleave the endogenous nitrate reductase gene at a specific position to create a nitrate reductase protein having a mutation at position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4. The endogenous nitrate reductase gene can be modified by a genome editing system comprising a site-specific nuclease that binds and cleaves the endogenous nitrate reductase gene. The genome editing system can also utilize nuclease-mediated non-homologous end joining or homologous recombination repair. The site-specific nuclease can be modified. For example, the modified site-specific nuclease may be a CRISPR / Cas9 system, ZFN, or TALEN. The site-specific nuclease can bind and cleave the endogenous nitrate reductase gene. As the genome editing system, a modified CRISPR / Cas system such as a modified CRISPR / Cas-9 system, a modified transcription activator-like effector nuclease, a modified zinc finger nuclease, or a modified meganuclease may be utilized.

[0065] The method for creating the tobacco plant may include a step of selecting, by mutation, a tobacco plant in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 of the nitrate reductase protein has mutated from proline to an amino acid residue other than proline.

[0066] Methods for inducing mutations in plants are well known in the art and can create mutations in the nitrate reductase genes of plants using mutagens that primarily create point mutations and short deletions, insertions, base conversions, and / or translocations, including chemical mutagens or radiation. Chemical mutagens include, but are not limited to, ethyl methanesulfonate, methyl methanesulfonate, N-ethyl-N-nitrosourea, triethylmelamine, N-methyl-N-nitrosourea, procarbazine, chlorambucil, cyclophosphamide, diethyl sulfate, acrylamide monomer, melphalan, nitrogen mustard, vincristine, dimethylnitrosamine, N-methyl-N'-nitro-nitrosoguanidine, nitrosoguanidine, 2-aminopurine, 7,12-dimethyl-benz(a)anthracene, Ethylene oxide , hexamethylphosphoramide, bisulfan, diepoxyalkanes (diepoxyoctane, diepoxybutane, and the like), 2-methoxy-6-chloro-9[3-(ethyl-2-chloro-ethyl)aminopropylamino]acridine dihydrochloride, and formaldehyde, among others. Radiation includes, but is not limited to, gamma rays, heavy ion beams, X-rays, neutron beams, or UV.

[0067] The step of selecting a tobacco plant in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 of the nitrate reductase protein has mutated from proline to an amino acid residue other than proline due to mutation may include one or more crossing steps. In one embodiment, after inducing mutations in seeds from a plant body, the seeds are sown and cultivated to obtain a first-generation plant body, and the second-generation plant body obtained by self-pollinating this may be screened for mutants. The advantage of screening the second-generation plant body is that the mutation is a mutation derived from germ cells. The subject of mutation induction is not limited, but may be seeds or pollen. When inducing mutations in pollen, mutants may be screened for the plant body grown from the seeds obtained by mating the pollen with a plant body that has not undergone mutation induction.

[0068] In addition, as a method for creating the tobacco plant, a nucleic acid encoding a nitrate reductase protein in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to an amino acid residue other than proline is introduced into the tobacco plant by artificial manipulation so that the tobacco plant expresses the protein. This can also be done.

[0069] The method for introducing the nucleic acid is not particularly limited, and known methods for nucleic acid introduction can be used. For example, physicochemical methods (direct DNA introduction methods) such as the polyethylene glycol method (PEG method), electroporation method, particle gun method, microinjection method, and whisker method, or biological methods (indirect DNA introduction methods) such as the Agrobacterium method can be preferably used.

[0070] The amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 Mutated The selection of the target gene variant, mutant, or recombinant can be made, non - limitatively, for example, by extracting genomic DNA from the tobacco plant, amplifying it by PCR or the like, and analyzing the base sequence of the DNA encoding the portion containing the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4. In addition, methods such as the method of detecting differences in sequences using the SSCP (Single strand conformation Polymorphism) method by differences in electrophoresis distances, T7 EndonucleaseI methods such as methods of detecting the presence or absence of mutations by cleaving mismatch sites using such methods, etc., can be selected.

[0071] In one aspect, the present invention may be a selection nucleic acid marker for use in selecting a tobacco plant comprising a nitrate reductase in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to an amino acid residue other than proline. Alternatively, it may be a detection polynucleotide for use in detecting a mutation of the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 of nitrate reductase from proline to an amino acid residue other than proline. Non-limitingly, the selection nucleic acid marker or the detection polynucleotide may be a nucleic acid amplification primer for amplifying the base sequence of DNA encoding a portion containing the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4, a sequencing primer for the base sequence of DNA encoding a portion containing the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4, or a probe that binds to DNA encoding a portion containing the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4. Those skilled in the art can appropriately select these selection nucleic acid markers or detection polynucleotides based on known techniques.

[0072] In one aspect, the present invention may be a kit comprising a selection nucleic acid marker for use in selecting a tobacco plant comprising a nitrate reductase in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to an amino acid residue other than proline, or a detection polynucleotide for use in detecting a mutation of the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 of the nitrate reductase protein from proline to an amino acid residue other than proline.

[0073] In one aspect, the present invention may be a tobacco plant in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to an amino acid residue other than proline, and a tobacco plant obtained by crossing the tobacco plant with a tobacco plant in which the amount of nitrate and / or TSNA is reduced by a mechanism different from that of the tobacco plant of the present invention, and its progeny. Examples of such crossing parents include mutants modified so that CYP82E4, a major nicotine demethylase, does not function, and mutants of nitrate transporters.

[0074] In the examples of this specification, a tobacco plant containing a nitrate reductase in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to leucine or serine was obtained. The base sequence mutation for causing the amino acid change from proline to leucine was CCA→CTA, and the base sequence mutation for causing the amino acid change from proline to serine was CCA→TCA, both of which were single-base mutations.

[0075] In order to obtain the nitrate reductase S523D described in Non-Patent Documents 2 and 3, three base substitutions of TCA→GAT are required to cause an amino acid change from serine to aspartic acid at position 523. The fact that three base substitutions are required means that it is extremely difficult to obtain the S523D mutant by modifying the endogenous nitrate reductase gene by mutation with a drug or the like. In contrast, a tobacco plant containing a nitrate reductase in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to leucine or serine is also easily obtained by mutation. Considering that it is institutionally difficult to cultivate genetically modified crops in countries including Europe, the mutant is industrially effective.

[0076] In nitrate reductase, a poorly conserved region (hinge 1 region) connecting between conserved domains is known. S523D described in Non-Patent Documents 2 and 3 is present in this hinge 1 region. In the present invention, 26 types of tobacco plants having a nitrate reductase with an amino acid mutation in the hinge 1 region were obtained, and the amount of nitrate in their leaves was examined. As a result, only the two types of P525 mutants of the present invention showed a reduction.

[0077] 4. Leaf tobacco and dried leaves In one aspect, the present invention relates to leaf tobacco harvested from the tobacco plants of the present invention. The present invention also relates to dried leaves produced from the leaf tobacco of the present invention.

[0078] The meaning of "the tobacco leaves of the present invention" is as described up to "3. Method for creating tobacco plants".

[0079] The step of creating dried leaves from leaf tobacco is not particularly limited, and known methods can be used. The tobacco plants can have their leaves harvested and used as materials for manufacturing tobacco products and the like. The tobacco leaves may be air-dried, fire-dried, yellow-dried, or sun-dried. Non-limitingly, for air-drying, the leaves are hung in a well-ventilated shed and exposed to air for 4 to 8 weeks to dry. Fire-dried tobacco is hung in a large shed and heated and dried continuously or intermittently by fire for 3 days to 10 weeks depending on the process and the tobacco. Obtained by For yellow-dried tobacco, the tobacco is lined up and hung in a drying shed, and the temperature is slowly raised over usually about one week to dry. Obtained by Sun-dried tobacco is dried in the sun. Obtained by This method is used for manufacturing oriental leaf tobacco in Turkey, Greece, and other Mediterranean countries.

[0080] In one aspect, the present invention relates to dried leaves derived from the leaf tobacco of the present invention, the dried leaves of leaf tobacco.

[0081] In one aspect, the fresh tobacco and the dried leaf contain a nitrate reductase protein in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to an amino acid residue other than proline, or a nucleic acid encoding the protein.

[0082] In one aspect, the dried leaf has a reduced amount of tobacco-specific nitrosamines (TSNAs) as compared to the dried leaf produced from the fresh tobacco of the tobacco plant which is the control described in "2. Properties of tobacco plants".

[0083] Four components of TSNA N-Nitrosonornicotine (NNN) N-Nitrosoanatabine (NAT) N-Nitrosoanabasine (NAB) Nicotine-derived nitrosoketone (NNK) In Example 7, the total of the four components (NNN, NAT, NAB, and NNK) of TSNA was reduced by 34 - 36% in the homozygotes of P525L and P525S as compared to the dried leaf produced from the fresh tobacco of the control tobacco plant. In one aspect, the tobacco plant has at least one component of TSNA, or the total of the components of TSNA, reduced by at least 5%, 10%, 15%, 20%, 25%, or 30% as compared to the control.

[0084] 5. Cut filler, powder, sheet, midrib, granule, extract, composition In one aspect, the present invention relates to a cut filler, powder, sheet, midrib, granule, or extract produced from the dried leaf of the present invention.

[0085] The meaning of "the dried leaf of the present invention" is as described up to "4. Fresh tobacco and dried leaf".

[0086] "Cut filler" means dried tobacco leaves shredded into long, narrow strips and used for rolled tobacco.

[0087] "Midrib" means the thickest leaf vein running through the center of the leaf.

[0088] "Powder" refers to dried tobacco leaves that have been pulverized into a powdery form.

[0089] "Granule" refers to a product obtained by forming powder into granules.

[0090] "Extract" is obtained by extracting materials such as leaves and stems derived from tobacco plants (including "parts", preferably "non-proliferative parts") for the purpose of improving the flavor of tobacco products or reducing the content of specific components in tobacco products. Components from The extraction method can use known methods for extracting essential oils and specific components from plants.

[0091] Non-limitingly, the present invention relates to a composition comprising a tobacco plant (including parts) of the present invention, or dried leaves, or a tobacco material (such as cut filler) derived therefrom. The composition may use the tobacco plant or its part as it is, or may use those obtained by cutting, pulverizing or grinding into flaky, slurry-like or finely powdered forms. As the composition, the tobacco plant or its part may be used as it is harvested from a field or the like, or may be used after partially dissipating moisture indoors or outdoors for a predetermined period, or may be used after almost completely dissipating moisture with a dryer or the like.

[0092] Non-limitingly, the composition may include cut filler, powder, sheet, midrib, granule, or extract produced from the dried leaves of the present invention.

[0093] In one aspect, the cut filler, powder, sheet, midrib, granule, or extract of the present invention, and the composition include non-proliferative parts of the tobacco plant.

[0094] In one aspect, the cut filler, powder, sheet, midrib, granule, or extract of the present invention, and the composition include a nucleic acid encoding a nitrate reductase in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to an amino acid residue other than proline.

[0095] 6. Product In one aspect, the present invention relates to a tobacco product comprising the dried leaves of the present invention and / or the cut filler, powder, sheet, midrib, granule, or extract of the present invention.

[0096] The meaning of "the dried leaves of the present invention and / or the cut filler, powder, sheet, midrib, granule, or extract of the present invention" is as described up to "5. Cut filler, powder, sheet, midrib, granule, extract, composition".

[0097] The type of "tobacco product" is not particularly limited. In addition to cigarettes, it includes cigars, pipe tobacco, sniffing tobacco (including snus, snuff), chewing tobacco, cut tobacco (including fine cut tobacco), water pipe tobacco, etc. Furthermore, it also includes non-combustion heated tobacco products using the aerosol generated by heating tobacco as an aerosol source, non-heated tobacco products that inhale the flavor of tobacco without heating, and the like.

[0098] Non-limitingly, "tobacco product" includes non-proliferative parts of tobacco plants.

[0099] In one aspect, the present invention provides the use of the tobacco plant, leaf tobacco, and dried leaves of the present invention for manufacturing a tobacco product.

[0100] In one aspect, the present invention relates to the use of the tobacco plant, leaf tobacco, and dried leaves of the present invention as a tobacco product.

[0101] In one aspect, the present invention relates to a tobacco product of the tobacco plant, leaf tobacco, and dried leaves of the invention for use as a tobacco product.

[0102] In one aspect, the present invention includes a method for manufacturing a tobacco product. Without limitation, the method for manufacturing a tobacco product includes preparing a tobacco plant-derived material from a modified tobacco plant containing a nitrate reductase in which the amino acid residue corresponding to position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to an amino acid residue other than proline. The manufacturing method may include a step of collecting leaves from the tobacco plant and preparing dried leaves. As the method for manufacturing a tobacco product, known methods can be used. For example, from the modified tobacco plant, the collected leaves (leaf tobacco) can be processed through a raw material process (grading, boning, conditioning / drying, storage / aging), a raw material processing process (sheet, extraction, granulation, heating, flavoring), and a product process (blending, cutting, rolling, packaging) to manufacture a tobacco product.

[0103] The definition of "tobacco product" is as described above.

Example

[0104] Hereinafter, the present invention will be described in detail based on examples, but the present invention is not limited to these examples. Those skilled in the art can easily modify and change the present invention based on the description in this specification, and these are included in the technical scope of the present invention.

[0105] Comparative Example 1: Preparation of S523D and WT constitutive expression recombinants In this comparative example, S523D and WT constitutive expression recombinants were prepared.

[0106] (1) Vector construction For the ORF (S523D) in which a mutation was introduced so that the 523rd serine (S) of the NIA2 polypeptide (SEQ ID NO: 4) becomes aspartic acid (D), and the ORF (WT) of wild-type NIA2, synthetic DNAs were purchased from Genewiz. By adding CAT to the 5' end and GTCGAC to the 3' end, they were made to be cleaved with NdeI and SalI, respectively. Also, in order to be distinguishable from endogenous NIA2 without causing amino acid substitution mutations, the TTC at positions 1869 - 71 of the ORF (SEQ ID NO: 3) of wild-type NIA2 was replaced with AAG (corresponding to bases 1872 - 74 of SEQ ID NO: 25), and a HindIII site was introduced. The nucleotide sequence of the synthetic DNA encoding S523D of NIA2 is shown in SEQ ID NO: 24, and the nucleotide sequence of the synthetic DNA encoding wild-type NIA2 is shown in SEQ ID NO: 25.

[0107] The NdeI / SalI digestion fragment of the above DNA was introduced into pRI201-AN (Takara Bio) having a 35S promoter. The sequence of the entire insertion including the binding site with the vector was confirmed using sequencing primers (Table 1).

[0108] [Table 1] The plasmid with the confirmed sequence was transformed into Agrobacterium tumefaciens LBA4404 by electroporation and used for tobacco transformation.

[0109] (2) Tobacco transformation Tobacco (cultivar: Petit Havana SR-1) was individually transformed with Agrobacterium having the two constructs prepared in (1). For individuals in which rooting was confirmed, the expression of the introduced gene in the leaves of the shoots was analyzed. Individuals in which the expression of the introduced gene was confirmed by the method described in "(3) Confirmation of the expression of the introduced gene" below were transplanted into No. 3 pots filled with fertile soil. These T0 generation individuals were cultivated in a genetically modified greenhouse, and self-propagated T1 seeds were harvested. In

[0110] (3) Confirmation of the expression of the introduced gene​ RNA was extracted from leaves using the RNeasy Plant Mini Kit (QIAGEN), cDNA was synthesized using the PrimeScript™ RT reagent Kit with gDNA Eraser (Takara Bio), and the expression level derived from the introduced mutant NIA2 cDNA was analyzed using Taq Man Fast Advanced Master Mix (Thermo Fisher) and the Step OnePlus Real-Time PCR Systems (Thermo Fisher).

[0111] The primer and probe sequences are as shown in Table 2. The elongation factor-1α gene (accession No. AF120093, elf) was used as a control, and the relative expression level (dCt) compared to the control was analyzed.

[0112]

Table 2

[0113] (1) Hydroponic cultivation with liquid fertilizer The T1 seeds of Comparative Example 1(2) were sown and transplanted after about 2 weeks of temporary planting, and the seedlings about 2 weeks after temporary planting were transplanted into No. 4 pots. The temporarily planted seedlings were transferred with the fertile soil, and about 400 ml of vermiculite was filled. Nitrate liquid fertilizer (20 mM as NO3: 4 mM Ca(NO3)2, 4 mM Mg(NO3)2, 4 mM KNO3) was applied, and cultivation was carried out in a phytotron under the conditions of 25°C during the light period / 18°C during the dark period, 12-hour day length, and 60% humidity. The light period was at a brightness of 10000 lux to 15000 lux, and the dark period was cultivated under a light-shielding condition where all the lamps in the phytotron were turned off.

[0114] (2) Nitrate quantification Leaves (3 - 8 pieces) were collected, and the lamina with the midrib removed was dried at 80 °C overnight or longer. To 100 mg of these dry powders, 1 ml of MQ water was added, and they were shaken and extracted for 1 hour or longer. Using the filtrate as a measurement sample, Nitrachek404 Nitric acid was measured using a Meter (KPG Products Ltd) according to the attached manual.

[0115] As reported previously (for example, Patent Document 1, Non-Patent Document 2), it was confirmed that the constitutive expression of NIA2 (NIA2_S523D) having the S523D mutation dramatically reduced the amount of nitric acid in leaves (lamina) (Figure 1). On the other hand, even with the constitutive expression of wild-type NIA2 (NIA2_WT), a reduction in the amount of nitric acid by about 1 / 2 to 1 / 4 was observed compared to the control in which NIA2 was not constitutively expressed (Figure 1).

[0116] Regarding growth, no significant difference was observed in NIA2_WT regardless of the presence or absence of constitutive expression, but NIA2_S523D showed dwarfism with a smaller plant size due to constitutive expression (Figure 2). This dwarf trait was observed from the early growth stage (Figure 3).

[0117] (3) Nitrite quantification To 100 μl of the sample, 50 μl of colorimetric reagent 1 (2% sulfanilamide in 3N HCl) was mixed and reacted at room temperature for 5 minutes. 50 μl of colorimetric reagent 2 (0.1% N-naphthylethylenediamine in water) was added / mixed and reacted at room temperature for 10 minutes. A540 and A700 as a control were measured using a microplate reader Infinite 200 PRO (TECAN), and A540 - A700 (difference) was used as the measured value. For the calibration curve, NaNO2 (Wako Pure Chemical Industries, special grade) was also measured in the same way as 100 μl, and the calibration curve was drawn to calculate the amount of nitrite.

[0118] (4) Dark nitrite elution test Referencing the method of Lea et al. (Non-Patent Document 4), a dark nitrite elution test was conducted. Leaf discs of NIA2_S523D were immersed in elution buffer (50 mM Hepes-NaOH pH 7, 50 mM KNO3), shielded from light with aluminum foil, and subjected to a shaking reaction at 28 °C and 100 rpm for 5 hours. The elution buffer was collected, and nitrite was quantified by the method described in "(3) Nitrite Quantification". 200 μl of elution buffer was used per leaf disc with a diameter of 4 mm.

[0119] Control SR-1, NIA2_S523D constitutive expression recombinant, and NIA2_WT constitutive expression recombinant were transplanted into No. 4 pots. Five leaf discs (4 mm in diameter) were collected from tobacco grown with liquid fertilizer for 10 days, weighed, and then immersed in 1 ml of elution buffer. Nitrite eluted in the elution buffer was expressed per fresh leaf weight.

[0120] In wild-type SR-1 and NIA2_WT constitutive expression recombinants, almost no nitrite elution was observed in the dark, whereas significant elution was observed in the NIA2_S523D constitutive expression recombinant (Figure 4).

[0121] (5) NR enzyme activity (1) The plants transplanted in (1) were placed under light conditions (L) or dark conditions (D). For both light and dark conditions, the room temperature was 25 °C and the humidity was 60%. The light conditions were set at a brightness of 10,000 lux to 15,000 lux, and the dark conditions were achieved by turning off all the lamps in the coitotron and shielding from light. After 2 hours, approximately 0.1 g of leaf (lamina) was collected into a 2 ml tube and immediately frozen with liquid nitrogen. The collected leaf tissue was cryogenically disrupted (1000 rpm, 30 seconds, 2 times) using a Shake Master Neo (BioMedical Science). An 8-fold volume of extraction buffer (final concentration; 0.1 M Hepes pH 7.5, 10 mM MgCl2, 3% PVP, 1X cOmplete TM, EDTA-free (Roche), 2 mM DTT) was added to the frozen and disrupted tissue, mixed well, and placed on ice. Centrifugation (6000 rpm, 4 °C, 15 minutes) was performed, and the supernatant was collected in a 1.5 ml tube (crude extract). Then, a part of it was transferred to another 1.5 ml tube and diluted 5-fold with ultrapure water. Depending on the case, crude extracts were prepared by adding 10 mM MgCl2 at a final concentration or 10 mM EDTA at a final concentration to the extraction buffer.

[0122] Activity measurement was carried out as follows. 20 μl of the 5-fold diluted crude extract was added to 80 μl of the activity measurement buffer (final concentration; 50 mM Hepes pH 7.5, 10 mM KNO3, 10 mM MgCl2, 5 μM FAD, 0.15 mM NADH), and the reaction was carried out (30 °C, 60 minutes). The reaction was carried out in two ways for each crude extract by adding 10 mM MgCl2 at a final concentration or 10 mM EDTA at a final concentration to the activity measurement buffer. According to the nitrite quantification method described in "(3) Nitrite quantification", the amount of nitrite generated in the reaction solution was measured. The ratio of the values measured by the above two methods was taken to obtain the activity of nitrate reductase (NR activation rate).

[0123] In the wild-type SR-1 and the NIA2_WT constitutive expression recombinant, the NR activation rate under dark conditions (D) was significantly lower than that under light conditions (L), whereas in the NIA2_S523D constitutive expression recombinant, no reduction in the NR activation rate under dark conditions was observed (Figure 5).

[0124] Example 1: Creation and selection of ethyl methanesulfonate (EMS) mutants In this example, ethyl methanesulfonate (EMS) mutants of tobacco plants were created.

[0125] (1) Mutation introduction by EMS treatment A mutant panel (TUM) was created by treating seeds of tobacco (cultivar: Tsukuba No. 1) with ethyl methanesulfonate (EMS) (2011 Annual Meeting of the Japanese Phytopathological Society) P258, Generation of a tobacco mutant panel: Non-Patent Document 5). Specifically, 200 mg of seeds, 1 ml of water, and 6 - 8 μl of EMS (Sigma-Aldrich) were added to a 2 ml screw-cap tube, stirred well by inverting up and down, etc., and after mixing, shaken at 60 rpm for 18 hours at room temperature. The tube was centrifuged to remove the supernatant, 1 ml of water was added, and shaken for 30 minutes for washing. The centrifuged supernatant was removed, 1 ml of water was added, and the tube was inverted up and down, etc., to rinse the seeds. This rinsing operation was repeated 3 times. After repeating this washing and rinsing operation 2 more times, the seeds were dried on filter paper. The dried seeds were cultivated in fertile soil, and self-propagated M2 seeds were harvested. A part of each M2 seed was sown, and genomic DNA was extracted from 8 individual seedlings using the Gentra Puregene Tissue Kit (Qiagen). The extracted genomic DNA was adjusted to a concentration of 10 ng / μl. The mutant panel consists of this set of M2 seeds and the extracted bulk genomic DNA.

[0126] (2) PCR Using the genomic DNA of the mutant panel created in “(1) Mutation introduction by EMS treatment” as a template, By PCR the hinge 1 region was amplified.

[0127] Specifically, using TKS Gflex DNA Polymerase (Takara Bio), according to the manual attached to the kit, it was carried out at (95°C; 1 minute, [98°C; 10 seconds, 55°C; 15 seconds, 68°C; 1 minute] × 35 - 40 cycles, 68°C; 1 minute). The reaction time at 68°C was increased or decreased so that it was 1 minute per 1 kb according to the estimated size of the amplified fragment.

[0128] The following were used as primers for amplifying the hinge 1 region.

[0129] NIA1 NIA1_hinge1_F2 (TTAGGTGAAATAACGCTCTTACAC) (SEQ ID NO: 20) NIA1_hinge1_R2 (CCTAATTGGAGAGAATCAAGGTAT) (SEQ ID NO: 21) NIA2 NIA2_hinge1_F2 (ATTGTGCTATGTTGCAATGTTCAG) (SEQ ID NO: 22) NIA2_hinge1_R1 (GGAAGAAGATCCGTGCACG) was used. (SEQ ID NO: 23) (3) Sequence analysis The DNA used as a template was reacted (94°C for 30 seconds, 96°C for 10 seconds / 50°C for 5 seconds / 60°C for 2 minutes x 25 cycles) using the Big Dye Terminator v.3.1 cycle sequencing kit (Thermo Fisher) according to the method attached to the kit. Next, it was purified using the BigDye XTerminator (trademark) Purification Kit (Thermo Fisher) according to the method attached to the kit. Sequence information was obtained using an Applied Biosystems (registered trademark) 3730 DNA Analyzer (Thermo Fisher) and analyzed using sequence assembly software ATGC (GENETYX).

[0130] Those described in SEQ ID NOs: 20 and 22 were used as primers for sequencing.

[0131] (4) EMS mutants As a result of the sequence analysis in “(3) Sequence analysis”, 26 missense mutants having amino acid substitutions in the hinge 1 regions of NIA1 and NIA2 were selected from the M2 lines obtained from the mutant panel (Tables 3 and 4).

[0132]

Table 3

[0133]

Table 4

[0134] The method of cultivating tobacco plants and quantifying nitrate was carried out in the same manner as in “(1) Hydroponic cultivation” and “(2) Nitrate quantification” of Comparative Example 2. Sixteen lines of NIA1 mutants and ten lines of NIA2 mutants (Table 3) having missense substitution mutations in the hinge 1 region detected in Example 1 were targeted. Among the 26 mutants, only two lines, NIA1_P525L and NIA1_P525S, in which substitution mutations were introduced at the 525th amino acid in the NIA1 gene, showed a significant reduction in nitrate (Figs. 6 - 8).

[0135] Example 3: NR activity analysis of NIA1_P525L and NIA1_P525S In this example, the NR activity analysis of NIA1_P525L and NIA1_P525S was carried out.

[0136] In Example 2, for P525L and P525S in which nitrate reduction in the lamina was confirmed, the activation rate of NR enzyme activity was analyzed under light and dark conditions. The method was carried out in the same manner as in “(5) NR enzyme activity” of Comparative Example 2.

[0137] (1) Enzyme activity The NR enzyme activation rate, expressed as a percentage (%), of the NR activity value when Mg was added relative to the NR activity value when EDTA was added during activity measurement (NR maximum activity) was analyzed. As a result, in both mutant lines NIA1_P525L and NIA1_P525S, the NR activation rate was high to the same extent under both light and dark conditions, regardless of whether they were homozygous or heterozygous (Figure 9). On the other hand, the segregating WT (wild type) without the mutation had a significantly lower NR activation rate under dark conditions compared to light conditions. From these results, it was considered that the accumulation amount of nitrate was reduced in both mutants because their activity was not suppressed in the dark. Also, not only in the mutant homozygotes, but also in the mutant heterozygotes, the decrease in the activation rate under dark conditions was slight, and this result is consistent with the results of Example 2 where nitrate reduction was also observed in mutant heterozygotes (Figures 7-6, 7-7).

[0138] Example 4: Reconfirmation in the M3 generation of NIA1_P525L and NIA1_P525S In this example, the nitrate levels and NR activity in the dark of the M3 generation of NIA1_P525L and NIA1_P525S were analyzed.

[0139] For both mutant lines NIA1_P525L and NIA1_P525S, in which high NR activation rates and nitrate reduction were confirmed in the dark in the M2 generation, a reconfirmation test was conducted in the M3 generation. The method was the same as in Comparative Example 2's (1) hydroponic cultivation with liquid fertilizer, (2) nitrate quantification, and (4) nitrite elution test in the dark. However, in the nitrite elution test in the dark, the amount of nitrite eluted per leaf disk was For calculated.

[0140] (1) Nitrite elution in the dark In both mutant lines NIA1_P525L and NIA1_P525S, significant nitrite elution was observed in the homozygotes (Figure 10). On the other hand, in the segregating WT (without the P525 mutation), almost no nitrite elution was observed, similar to the wild-type Tsukuba 1. From this, it was reconfirmed that both mutant homozygotes of NIA1_P525L and NIA1_P525S have high NR activity in the dark.

[0141] (2) Nitrate quantification In both the NIA1_P525L and NIA1_P525S mutant lines, both homozygotes and heterozygotes had Significant reduced nitrate compared to the segregating WT individuals (Figure 11). The nitrate levels were 68% for NIA1_P525L and 34% for NIA1_P525S relative to the control.

[0142] Also, unlike the NIA2_S523D constitutive expression recombinant, neither of the NIA1_P525L and NIA1_P525S mutant lines showed growth abnormalities depending on the presence or absence of the mutation (Figure 12).

[0143] Example 5: Nitrate content in field-grown individuals of NIA1-P525L and NIA1 P525S In this example, the nitrate content of field-grown individuals was examined for NIA1_P525L and NIA1_P525S.

[0144] TN90 (Burley variety) was crossed with mutants having amino acid substitution mutations of P525L and P525 on the NIA1 gene As to obtain BC1F1 lines. In the self-propagated BC1F2 generation, homozygotes, heterozygotes of the amino acid substitution mutation of NIA1, and segregating WT individuals without the mutation were cultivated in the field. They were cultivated using the standard cultivation method for the Burley variety, but at the heart-stopping stage, 60% of the base fertilizer amount was top-dressed between the rows.

[0145] Three upper leaves 36 days after the heart-stopping stage were used as nitrate analysis samples. They were dried using a programmed dryer (ESPEC). Drying was carried out for 5 days under yellowing conditions (temperature 38°C, relative humidity 80%RH), for 14 days under browning conditions (temperature 32°C, relative humidity: 85%RH for the upper two leaves, 90%RH for the lower leaf), and for 3 days under midrib drying conditions (temperature 50°C, relative humidity 40%RH). The lamina of the dried leaves was ground, and nitrate nitrogen was analyzed using an autoanalyzer QuAAtro 2HR (Behitech Co., Ltd.) according to the operation manual.

[0146] The nitrate nitrogen concentration in the dry leaves of homozygotes or heterozygotes with the P525L mutation was about 1 / 2 compared to the control (WT without the mutation) (Figure 13). Similarly, the nitrate nitrogen concentration in the dry leaves of individuals homozygous (homozygotes) or heterozygous (heterozygotes) for the P525S mutation was also about 1 / 2 compared to the control (WT without the mutation).

[0147] Example 6: Growth, biomass, and flowering of S523D constitutive expression recombinants and P525 mutants In this example, the growth, biomass, and flowering of the S523D constitutive expression recombinant and the P525 mutant were examined.

[0148] (1) Poor growth of the S523D constitutive expression recombinant Using the method described in "Comparative Example 1 Preparation of S523D and WT Constitutive Expression Recombinants (1), (2)", TN90 (barley variety) was transformed and T1 seeds were collected. Individuals with high expression of the transgene (S523D-OE, WT-OE) and individuals with no expression (null segregant. S523D-null, WT-null) in the T1 generation were selected and used for the test. Specifically, three lines each of the T1 generation self-propagated from the T0 generation into which NIA2_S523D was introduced (S523D-OE_1, 2, 3 and S523D-null_1, 2, 3), two lines each of the T1 generation self-propagated from the T0 generation into which NIA2_WT was introduced (WT-OE_1, 2 and WT-null_1, 2), and TN90, the host of the transformation, was used as the wild type for the test.

[0149] Using the leaves of young plants cultivated in a closed greenhouse at 25°C, individuals with high expression of the transgene (S523D-OE, WT-OE) and individuals with no expression (S523D-null, WT-null) were selected by the method described in "Comparative Example 1 Preparation of S523D and WT Constitutive Expression Recombinants (3)". Each selected individual was transplanted into a pot and cultivation was continued. Eight days after transplantation, photos of the individuals of each line were recorded. All three lines of the T1 generation with high expression of NIA2_S523D, S523D-OE was clearly inferior in growth compared to S523D-null (Figure 14). On the other hand, there was no significant difference in growth between WT-OE and WT-null of the two lines of the T1 generation with high expression of NIA2_WT (Figure 14).

[0150] Growth retardation specific to S523D-OE was already observed at the seedling stage. Twenty-three days after transplantation, the number of above-ground leaves, stem length, and dry weight of above-ground leaves were measured for four individuals of each line. The number of above-ground leaves in S523D-OE was 2 - 3 less than that in S523D-null, but there was no significant difference between WT-OE and WT-null (Figure 15). Regarding stem length and dry weight (biomass) of above-ground leaves, S523D-OE was significantly lower than S523D-null, and there was no significant difference between WT-OE and WT-null (Figures 16 and 17).

[0151] From the above, it was shown that the high expression of NIA2_S523D caused significant growth retardation in TN90 (flue-cured variety). Since no growth retardation was observed in WT-OE, it was considered to be the effect of the high expression of the mutant (NIA2_S523D) NR protein that is not inhibited in the dark, rather than the effect of the high expression of the NR protein itself.

[0152] (2) Growth comparison between the S523D constitutive expression recombinant and the P525 mutant Using Tsukuba No. 1 (yellow variety) as the host instead of TN90, transformants were prepared in the same manner as described in (1) and analyzed in the same way. Three lines of the T1 generation obtained by self-breeding the T0 generation with high expression of NIA2_S523D were used for the test.

[0153] Using the leaves of young plants cultivated in a closed greenhouse at a constant temperature of 25°C, individuals with high expression of the transgene (S523D-OE) and those without expression (S523D-null) were selected, transplanted into pots, and cultivation was continued. At the same time, two lines each of the M3 generation homozygous for the amino acid substitution mutations of P525L and P525S in NIA1 were cultivated in the same way. Thirty-four days after transplantation, the number of above-ground leaves, stem length, and dry weight of above-ground leaves were measured for three individuals of each line. The three lines with high expression of S523D-OE and the two lines each of the homozygotes for the amino acid substitution mutations of P525L and P525S in NIA1 were aggregated and compared by summarizing the results of multiple lines respectively.

[0154] The line highly expressing NIA2_S523D (S523D-OE) had one less above-ground leaf than the control (S523D-null) (Figure 18). On the other hand, the homozygotes of the amino acid substitution mutations of P525L and P525S of NIA1 were equivalent to the control (S523D-null). Regarding the plant height as well as the number of above-ground leaves, a significant difference was observed only for the line highly expressing NIA2_S523D (S523D-OE), which was lower than the control (Figure 19).

[0155] The dry weight (biomass) of the above-ground leaves also showed a significant difference, being approximately half that of the control (S523D-null) only for the line highly expressing NIA2_S523D (S523D-OE) (Figure 20).

[0156] From these results, even in the genetic background of Tsukuba No. 1 (yellow variety), significant growth retardation was shown by highly expressing NIA2_S523D. On the other hand, unlike the line highly expressing NIA2_S523D (S523D-OE), no growth abnormality was observed in the homozygotes of the amino acid substitution mutations of P525L and P525S of NIA1.

[0157] Cultivation was continued under constant conditions of 25°C until flowering, and the flowering time was also investigated. The line highly expressing NIA2_S523D (S523D-OE) tended to flower later than the control (S523D-null) (Figure 21).

[0158] Example 7: Leaf components (nicotine, TSNAs) of field-grown P525L and P525S mutants For the backcross line BC1F1 described in Example 5, a BC2F1 line obtained by further backcrossing with TN90 was isolated. From this line, a BC2F3 generation obtained by self-fertilizing for two generations was isolated and cultivated in the field. P525L_Homo and P525S_Homo are homozygotes that homozygously have the P525L or P525S mutation in the NIA1 gene, respectively. P525L_WT and P525S_WT are lines isolated as individuals without mutations in the NIA1 gene in the BC2F2 generation, respectively. The genotypes of each isolated line were determined by amplifying the NIA1_hinge1 region of the NIA1 gene by PCR and analyzing its nucleotide sequence according to the method described in the selection of the EMS mutant in Example 1 Determined 。

[0159] Cultivated using the standard cultivation method for burley tobacco (planting density: 2,380 plants / 10 a, chemical fertilizer Burley S625: 216 kg / 10 a), and 8 days after topping, 50% amount chemical fertilizer was top-dressed. Topping was carried out at the flowering stage about 2 months after transplantation, and then the lower leaves were removed in about 3 times. 56 days after topping, the top 2 leaves were sampled and dried under the conditions described in Table 5 using a thermo-hygrostat (ESPEC).

[0160]

Table 5

[0161] For the 4 components of TSNA (NNN, NAT, NAB, and NNK), 20 ml of 0.1M ammonium acetate was added to 0.5 g of the sample, shaken for extraction, and after dilution 10-fold with 0.1M ammonium acetate, measured by liquid chromatography-mass spectrometry / mass spectrometry (LC-MS / MS) analysis.

[0162] There was no significant difference in nicotine among P525L_Homo, P525S_Homo, and WT (Figure 22A). The nicotine contents of WT for P525L and P525S were 6.3% and 5.8%, respectively. On the other hand, for TSNA, the total analytical values of NNN, NAT, NAB, and NNK were compared as TSNA. In both P525L and P525S homozygotes, the levels were significantly reduced by 34 - 36% compared to WT (Figure 22B). The TSNA contents of WT for P525L and P525S were 3.8 ppm and 1.0 ppm, respectively. From these results, it was confirmed that in mutants having the P525L and P525S mutations in the NIA1 gene, the reduction of nitrate levels led to the reduction of TSNA levels in cured leaves.

Industrial Applicability

[0163] By using the modified tobacco plants of the present invention with reduced nitrate accumulation, the TSNA in tobacco raw materials and tobacco products can be reduced. In the modified tobacco plants of the present invention, not only was the amount of nitrate in the leaves reduced, but preferably, the growth of the plants was also good. This makes it possible to use them as materials for leaf tobacco for manufacturing tobacco products.

Claims

1. A tobacco plant comprising a nitrate reductase in which the amino acid residue corresponding to position 525 is mutated from proline to leucine or serine in an amino acid sequence that is 90% or more identical to the amino acid sequence of SEQ ID NO:

2. A mutant having a nucleic acid encoding a nitrate reductase protein in which the amino acid residue corresponding to position 525 is mutated from proline to leucine or serine in an amino acid sequence that is 90% or more identical to the amino acid sequence of SEQ ID NO: 2 due to a naturally occurring or artificially induced mutation, or A genetically modified plant in which an endogenous gene encoding the protein is modified so as to express a nitrate reductase protein in which the amino acid residue corresponding to position 525 is mutated from proline to leucine or serine in an amino acid sequence that is 90% or more identical to the amino acid sequence of SEQ ID NO:

2. The tobacco plant as described above.

2. Having one or more of the following properties (a)-(c): (a) The activity of nitrate reductase under dark conditions is 80% or more of the activity of nitrate reductase under light conditions; (b) The growth of the individual is essentially the same as that of the control; and / or (c) Nitrate is reduced as compared to the control. Here, the control is a tobacco plant comprising a nitrate reductase consisting of the amino acid sequence of SEQ ID NO:

2. The tobacco plant according to Claim 1.

3. The tobacco plant according to Claim 1 or 2, comprising a nitrate reductase in which the amino acid residue corresponding to position 525 is mutated from proline to serine in an amino acid sequence that is 90% or more identical to the amino acid sequence of SEQ ID NO:

2.

4. The tobacco plant according to any one of Claims 1-3, wherein the mutated nitrate reductase has an amino acid sequence that is 95% or more identical to the amino acid sequence of SEQ ID NO:

2.

5. The tobacco plant according to any one of claims 1-4, wherein the mutated nitrate reductase has the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO:

7.

6. The tobacco plant according to any one of claims 2-5, wherein the nitrate is at least 10% reduced as compared to the control.

7. The tobacco plant according to any one of claims 1-6, wherein the tobacco plant is Nicotiana tabacum.

8. (i) Modifying the amino acid residue corresponding to position 525 from proline to leucine or serine in an amino acid sequence that is 90% or more identical to the amino acid sequence of SEQ ID NO: 2 of the nitrate reductase of a tobacco plant, or, (ii) Selecting a tobacco plant in which the amino acid residue corresponding to position 525 has mutated from proline to leucine or serine in an amino acid sequence that is 90% or more identical to the amino acid sequence of SEQ ID NO: 2 of the nitrate reductase due to mutation, The method for creating a tobacco plant according to any one of claims 1-7, comprising the above.

9. Leaf tobacco harvested from the tobacco plant according to any one of claims 1-7.

10. Dried leaf produced from the leaf tobacco according to claim 9.

11. Cut filler, powder, sheet, midrib, granule, or extract produced from the dried leaf according to claim 10.

12. A tobacco product comprising the dried leaf according to claim 10 and / or the cut filler, powder, sheet, midrib, granule, or extract according to claim 11.

Images