A fusion protein suitable for dissolving fibrin clots and a pharmaceutical composition containing the fusion protein

A fusion protein with a modified prourokinase variant and fibrin-binding antibody effectively dissolves fibrin clots with reduced systemic effects, addressing the limitations of current thrombolytic drugs and improving treatment outcomes for cerebrovascular disorders and myocardial infarction.

JP7704339B2Active Publication Date: 2025-07-08NATIONAL CANCER CENTER(JP) +1
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
JP2022512278
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-03-31
Filing Date
2021-03-30
Publication Date
2025-07-08
Estimated Expiration
2041-03-30

AI Technical Summary

Technical Problem

Current thrombolytic drugs like t-PA and u-PA have limitations such as low specificity and risk of hemorrhagic complications due to systemic fibrinolysis, and u-PA has low binding affinity to fibrin, necessitating the development of a more targeted and safer approach for dissolving fibrin clots.

Method used

A fusion protein is developed comprising an antibody or its antigen-binding fragment that binds to insoluble fibrin and a prourokinase variant with a modified kringle domain to resist plasmin cleavage, combined with a catalytic domain for enhanced fibrin clot dissolution.

Benefits of technology

The fusion protein effectively dissolves fibrin clots with reduced systemic effects, demonstrating superior blood vessel patency and lower plasminogen activation in vivo compared to conventional thrombolytic agents, making it suitable for treating cerebrovascular disorders and myocardial infarction.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007704339000001
    Figure 0007704339000001
  • Figure 0007704339000002
    Figure 0007704339000002
  • Figure 0007704339000003
    Figure 0007704339000003
Patent Text Reader

Abstract

The present invention provides a fusion protein suitable for dissolving a fibrin clot, and a pharmaceutical composition containing said fusion protein. The present invention provides: a fusion protein of an antibody that binds to insoluble fibrin or an antigen-binding fragment thereof and a prourokinase mutant in which the amino acid sequence of plasmin in the kringle domain is modified so as to be difficult to cleave with plasmin; and a pharmaceutical composition containing said fusion protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a fusion protein suitable for dissolving fibrin clots and a pharmaceutical composition containing the fusion protein.

Background Art

[0002] In the field of developing treatments for thrombosis, treatments have been developed that administer to patients drugs that dissolve thrombi formed in blood vessels. The formed thrombus can be decomposed into fibrin degradation products by plasmin. Thrombolytic drugs promote the dissolution of thrombi by converting plasminogen into plasmin.

[0003] Examples of thrombolytic drugs include tissue-type plasminogen activator (t-PA) and urokinase-type plasminogen activator (u-PA). The activation of plasminogen by t-PA (i.e., promotion of the production of plasmin from plasminogen) is greatly enhanced in the presence of fibrin. On the other hand, u-PA has low binding specificity to fibrin, and there are concerns about the risk of hemorrhagic complications due to systemic fibrinolysis enhancement upon administration. For the treatment of thrombosis, t-PA is preferably used rather than u-PA.

[0004] Antibodies that bind to fibrin with a stronger affinity than to fibrinogen have been developed (Patent Documents 1 and 2). In these patent documents, it is disclosed that the antibodies are used for the treatment of cancer.

Prior Art Documents

Patent Documents

[0005]

Patent Document 1

Patent Document 2

Summary of the Invention

[0006] The present invention provides a fusion protein suitable for dissolving fibrin clots and a pharmaceutical composition containing the fusion protein.

[0007] According to the present invention, the following inventions are provided. [1] A fusion protein of an antibody or an antigen-binding fragment thereof that binds to insoluble fibrin and a prourokinase variant, The prourokinase variant has a kringle domain and a catalytic domain, and the amino acid sequence of the plasmin cleavage site in the kringle domain is modified so that the cleavage site is more resistant to cleavage by plasmin (for example, a variant in which the plasmin cleavage site that is resistant to cleavage by plasmin is disrupted), the fusion protein. [2] The fusion protein according to [1] above, wherein the prourokinase variant further has an EGF-like domain. [3] The fusion protein according to [1] or [2] above, wherein the prourokinase variant has an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 2. [4] The fusion protein according to any one of [1] to [3] above, wherein the antibody or an antigen-binding fragment thereof that binds to insoluble fibrin binds to a peptide consisting of the amino acid sequence set forth in SEQ ID NO: 17 or 18 and binds to insoluble fibrin. [5] The insoluble fibrin antibody or an antigen-binding fragment thereof is A heavy chain variable region containing a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 11, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 12, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 13, A light chain variable region containing a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 14, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 15, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 16 And a light chain variable region containing a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 14, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 15, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 16 The fusion protein according to any one of [1] to [4] above. [6] A pharmaceutical composition containing the fusion protein according to any one of [1] to [5] above. [7] The pharmaceutical composition according to [6] above, for use in dissolving a fibrin clot. [8] The pharmaceutical composition according to [6] or [7] above, which is a thrombolytic agent or a fibrinolytic enzyme agent. [9] The pharmaceutical composition according to any one of [6] to [8] above, for use in treating a disease selected from cerebrovascular disorders and myocardial infarction.

[0008] (1) A fusion protein of an antibody that binds to insoluble fibrin or a heavy chain of an antigen-binding fragment thereof and a prourokinase variant, The prourokinase variant has a kringle domain and a catalytic domain, and the amino acid sequence of the plasmin cleavage site in the kringle domain is modified so that the cleavage site is more resistant to cleavage by plasmin (for example, a variant in which the plasmin cleavage site that is resistant to cleavage by plasmin is disrupted), the fusion protein. (2) The fusion protein according to (1) above, wherein the prourokinase variant further has an EGF-like domain. (3) The fusion protein according to (1) or (2) above, wherein the prourokinase variant has an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 2. (4) The fusion protein according to any one of (1) to (3) above, wherein the antibody that binds to insoluble fibrin or an antigen-binding fragment thereof binds to a peptide consisting of the amino acid sequence set forth in SEQ ID NO: 17 or 18 and binds to insoluble fibrin. (5) The insoluble fibrin antibody or an antigen-binding fragment thereof, A heavy chain variable region containing a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 11, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 12, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 13, A light chain variable region containing a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 14, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 15, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 16 The fusion protein according to any one of (1) to (4) above, which comprises (6) A pharmaceutical composition comprising the fusion protein according to any one of (1) to (5) above. (7) The pharmaceutical composition according to (6) above, which is used for dissolving a fibrin clot. (8) The pharmaceutical composition according to (6) or (7) above, which is a thrombolytic agent or a fibrinolytic enzyme agent. (9) The pharmaceutical composition according to any one of (6) to (8) above, which is used for treating a disease selected from cerebrovascular disorders and myocardial infarction.

[0009] (1A) A fusion protein comprising an antibody or an antigen-binding fragment thereof that binds to insoluble fibrin and a catalytic domain of prourokinase, wherein the antibody or the antigen-binding fragment thereof and the catalytic domain of prourokinase are directly or linked via a linker. (2A) The fusion protein according to (1A) above, wherein the linker is a non-cleavable linker. (3A) The fusion protein according to (1A) or (2A) above, wherein the linker is a peptide linker. (4A) The fusion protein according to any one of (1A) to (3A) above, wherein the fusion protein further comprises a kringle domain, and the kringle domain and the catalytic domain are linked in this order. (5A) The fusion protein according to any one of (1A) to (4A) above, wherein the amino acid sequence of the plasmin cleavage site in the kringle domain is modified so that the cleavage site is more resistant to cleavage by plasmin. (6A) Further comprising an EGF-like domain, the EGF-like domain, The fusion protein according to (4A) or (5A) above, wherein the kringle domain and the catalytic domain are linked in this order. (7A) The fusion protein according to any one of (1A) to (6A) above, wherein the prourokinase variant has an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 2. (8A) An antibody or an antigen-binding fragment thereof that binds to insoluble fibrin binds to a peptide consisting of the amino acid sequence set forth in SEQ ID NO: 17 or 18 and binds to insoluble fibrin, and the fusion protein according to any one of (1A) to (7A) above. (9A) An insoluble fibrin antibody or an antigen-binding fragment thereof A heavy chain variable region comprising a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 11, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 12, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 13, and A light chain variable region comprising a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 14, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 15, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 16 The fusion protein according to any one of (1A) to (8A) above, comprising (10A) A pharmaceutical composition comprising the fusion protein according to any one of (1A) to (9A) above. (11A) The pharmaceutical composition according to (10A) above, for use in lysing a fibrin clot. (12A) The pharmaceutical composition according to (10A) or (11A) above, which is a thrombolytic agent or a fibrinolytic enzyme agent. (13A) The pharmaceutical composition according to any one of (10A) to (12A) above, for use in treating a disease selected from cerebrovascular disorders and myocardial infarction.

Brief Description of the Drawings

[0010]

Figure 1A

Figure 1B

Figure 2

Figure 3

Figure 4

Figure 5A

Figure 5B

Figure 5C

Figure 5D

Figure 6

[0011] As used herein, "subject" is a mammal and can be, for example, a dog, a cat, a cow, a horse, a pig, a primate (e.g., a monkey, a gorilla, an orangutan, a bonobo, a chimpanzee, and a human), and can be, for example, a human.

[0012] As used herein, "fibrin" is an insoluble clot formed by cleavage of the C-terminus of the three types of polypeptide chains (Aα chain, Bβ chain, and γ chain) that make up fibrinogen. In this specification, fibrin may be referred to as insoluble fibrin. More specifically, when the C-terminus of fibrinogen is cleaved, it becomes a state called a fibrin monomer, and the fibrin monomer polymerizes by the action of calcium to form a poorly soluble fibrin polymer. The fibrin polymer is cross-linked between polymers by the action of factor XIII to form stabilized fibrin (insoluble fibrin or fibrin gel as defined in this specification). Insoluble fibrin is degraded by plasmin. Plasmin is contained in plasma as a precursor, plasminogen. When the peptide between Arg and Val of plasminogen is degraded by a plasminogen activator (e.g., urokinase, tissue plasminogen activator, and streptokinase), plasmin is produced. Plasmin can be inhibited by a protein called a plasmin inhibitor, and its action can be restricted.

[0013] The Aα chain of fibrinogen can be the Aα chain of human fibrinogen. Examples of the Aα chain of human fibrinogen include the Aα chain of human fibrinogen having the amino acid sequence registered under GenBank accession number: AAI01936.1, and the Aα chain of human fibrinogen having an amino acid sequence corresponding to the amino acid sequence.

[0014] The Bβ chain of fibrinogen can be the Bβ chain of human fibrinogen. Examples of the Bβ chain of human fibrinogen include the β chain of human fibrinogen having the amino acid sequence registered under NCBI reference number: NP_005132.2, and the β chain of human fibrinogen having an amino acid sequence corresponding to the said amino acid sequence.

[0015] The γ chain of fibrinogen can be the γ chain of human fibrinogen. Examples of the γ chain of human fibrinogen include the γ chain of human fibrinogen having the amino acid sequence registered under GenBank accession number: AAH07044.1, and the γ chain of human fibrinogen having an amino acid sequence corresponding to the said amino acid sequence.

[0016] As used herein, "urokinase" is one of the serine proteases called urokinase-type plasminogen activator (uPA) (which can be, for example, the enzyme registered under EC 3.4.21.73). Urokinase is produced as its precursor, prourokinase, and the peptide bond between Lys158 and Ile159 thereof is cleaved to form active urokinase (the cleaved chains are linked to each other by disulfide bonds). Urokinase has three domains: an EGF-like domain, a kringle domain, and a catalytic domain. Also, the region between Lys135 and Lys136 is cleaved, and urokinase becomes low molecular weight urokinase. The amino acid numbers of prourokinase are defined based on the amino acid sequence after cleavage of the signal peptide of prourokinase. Examples of prourokinase include human prourokinase. Examples of human prourokinase include human prourokinase having the amino acid sequence registered under GenBank accession number: AAA61253.1 and human prourokinase having an amino acid sequence corresponding to the said amino acid sequence. In the amino acid sequence registered under GenBank accession number: AAA61253.1, the 1st to 20th amino acid sequences correspond to the signal peptide.

[0017] As used herein, "antibody" means immunoglobulin. The antibody can be antibodies of various isotypes, for example, it can be IgG. The antibody can preferably be a monoclonal antibody. The antibody can be a human chimeric antibody, a humanized antibody, or a human antibody. A human chimeric antibody can be prepared by replacing the constant region of a non-human antibody with the constant region of a human antibody. A humanized antibody can be prepared by replacing six CDRs of a human antibody with six corresponding CDRs of a non-human antibody. A human antibody can be prepared using an animal (e.g., mouse) in which at least the heavy chain variable region of the immunoglobulin is replaced with the corresponding region of a human locus. When the constant region is non-human, a human antibody can be obtained by replacing the constant region with the amino acid sequence of a human antibody. As used herein, the antibody can preferably be a humanized antibody. As used herein, the antibody can preferably be a human antibody. The antibody has a signal peptide when produced intracellularly, but the signal peptide is excised when secreted extracellularly. Therefore, when administered as a medicine, the antibody does not require a signal peptide.

[0018] As used herein, "CDR" refers to the complementarity-determining regions present in the heavy chain variable region and the light chain variable region of an antibody. There are three each in the heavy chain and light chain variable regions, and are called CDR1, CDR2, and CDR3 from the N-terminus. The CDR can be determined, for example, based on the numbering of Kabat et al. (Kabat, E.A. et al., Sequences of Proteins of Immunological Interest, 5th ed., 1991, Bethesda: US Dept. of Health and Human Services, PHS, NIH.).

[0019] As used herein, the "antigen-binding fragment of an antibody" means a fragment of an antibody that maintains the ability to bind to an antigen. Examples of antigen-binding fragments include Fab, Fab', F(ab')2, Fv, scFv (single-chain Fv), diabody, and sc(Fv)2 (single-chain (Fv)2). For example, when an antibody is digested with papain, Fab can be obtained. Alternatively, when an antibody is digested with pepsin, F(ab')2 can be obtained, and further reduction of F(ab')2 can yield Fab'. Other antigen-binding fragments of antibodies can be prepared by methods well known to those skilled in the art. Such antigen-binding fragments of antibodies can be used in the present invention.

[0020] As used herein, the "fusion protein" means a protein in which peptides derived from two or more different proteins are linked by peptide bonds. As used herein, the fusion protein of the first peptide and the second peptide may contain a third peptide and additional peptides, as long as the function of the invention is not significantly reduced, or may contain only the first peptide and the second peptide. As used herein, the fusion protein of the first peptide and the second peptide may be either a fusion protein containing the first peptide and the second peptide in this order or a fusion protein containing them in a different order, as long as the function of the invention is not significantly reduced. Preferably, it is a fusion protein containing the first peptide and the second peptide in this order. In a fusion protein, peptides derived from two or more different proteins may be linked either via a linker or without a linker, as long as the function of the invention is not significantly reduced. When linked via a linker, the linker may be a flexible linker.

[0021] According to the present invention, a fusion protein of an antibody or its antigen-binding fragment that binds to insoluble fibrin and prourokinase is provided. Prourokinase has at least a catalytic domain. Prourokinase may further have a kringle domain. Prourokinase may further have an EGF-like domain and a kringle domain.

[0022] Thus, according to the present invention, there is provided a fusion protein of, for example, an antibody that binds to insoluble fibrin or an antigen-binding fragment thereof and prourokinase, wherein the prourokinase has a kringle domain and a catalytic domain. Also, according to the present invention, there is provided a fusion protein of, for example, an antibody that binds to insoluble fibrin or an antigen-binding fragment thereof and prourokinase, wherein the prourokinase has an EGF-like domain, a kringle domain, and a catalytic domain. According to the present invention, in a preferred embodiment, the prourokinase is a mutant that has a kringle domain but does not have a plasmin cleavage site, or a mutant prourokinase mutant in which the amino acid sequence of the plasmin cleavage site in the kringle domain is modified such that cleavage by plasmin is reduced.

[0023] According to the present invention, a fusion protein of an antibody that binds to insoluble fibrin or an antigen-binding fragment thereof and a prourokinase mutant, wherein the prourokinase mutant has a kringle domain and a catalytic domain, and the amino acid sequence of the plasmin cleavage site in the kringle domain is modified such that cleavage by plasmin is reduced (for example, a mutant in which the plasmin cleavage site that is resistant to cleavage by plasmin is disrupted), is provided. In one embodiment, the mutant can be a mutant in which the plasmin cleavage site is disrupted. In one embodiment, the mutant can be a mutant in which the plasmin cleavage site is removed. is provided. In one embodiment, the mutant can be a mutant in which the plasmin cleavage site is disrupted. In one embodiment, the mutant can be a mutant in which the plasmin cleavage site is removed.

[0024] Strictly defined, the fusion protein of the present invention is a fusion protein of a heavy chain of an antibody or an antigen-binding fragment thereof that binds to insoluble fibrin and a prourokinase variant, or a fusion protein of a light chain of an antibody or an antigen-binding fragment thereof that binds to insoluble fibrin and a prourokinase variant. Further, when the antigen-binding fragment is single-chain, it can be a fusion protein of an antigen-binding fragment of an antibody that binds to insoluble fibrin and a prourokinase variant.

[0025] In the present specification, when used in an antigen-binding fragment, the terms "heavy chain" and "light chain" are terms indicating whether they are derived from either the "heavy chain" or "light chain" in the antibody from which they are derived, and do not indicate the size of the molecular weight in the antigen-binding fragment.

[0026] In the fusion protein of the present invention, the prourokinase variant has a kringle domain and a catalytic domain, the amino acid sequence of the plasmin cleavage site in the kringle domain is modified, and it is more resistant to cleavage by plasmin. Or, the prourokinase variant contains a kringle domain and a catalytic domain, and is a variant in which cleavage at the plasmin cleavage site in the kringle domain is reduced (or inhibited), that is, a variant in which cleavage to low molecular weight urokinase is reduced. The above reduction can be, for example, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more reduction compared to before modification (for example, prourokinase having the amino acid sequence of SEQ ID NO: 1). The above reduction can be confirmed by those skilled in the art in an in vitro assay system. Cleavage at the plasmin cleavage site in the kringle domain can occur between Lys135-Lys136 of human urokinase and between corresponding amino acids of urokinase. Therefore, the urokinase variant can be produced by modifying (substituting, inserting, and deleting) the amino acid sequence of the cleavage site. For example, it can be produced by substituting one or both of Lys135 and Lys136 with another amino acid, for example, substitution with glycine. The prourokinase variant can also be produced by modifying the amino acid sequence of its plasmin recognition site. Those skilled in the art can appropriately modify the amino acid sequences of the cleavage site and recognition site of plasmin. Although there is a plasmin cleavage site (between Lys158-Ile159) in the catalytic domain of the prourokinase variant, the two peptides generated after cleavage are linked by a disulfide bond between cysteine residues (Cys148 and Cys279) present in the catalytic domain of the peptide, respectively. Therefore, the two cysteine residues in the catalytic domain that provide the disulfide bond are conserved in the prourokinase variant. As the prourokinase variant, various prourokinase variants with reduced cleavage ability between Lys135 and Lys136 or between corresponding amino acids of human urokinase can be used as long as their plasminogen activator ability is not significantly reduced. For example, a prourokinase variant having an amino acid sequence with 90% or more, 95% or more, 98% or more, 99% or more, or 100% identity to the amino acid sequence of SEQ ID NO: 1 (provided that, as defined, it is a variant in which cleavage at the plasmin cleavage site in the kringle domain is reduced, for example, a variant in which the amino acid sequence of either or both of Lys135 and Lys136 is modified, for example, substituted with glycine; and the two cysteine residues in the catalytic domain that ligate the two peptides generated after cleavage between Lys158 and Ile159 are conserved), or a prourokinase variant having the amino acid sequence of SEQ ID NO: 2 can be mentioned.

[0027] In the fusion protein of the present invention, the catalytic domain can be a catalytic domain composed of one peptide (i.e., the catalytic domain before cleavage between Lys158 and Ile159), or a catalytic domain composed of two peptides (i.e., a complex in which the two peptides generated by cleavage between Lys158 and Ile159 (i.e., the peptide from the N-terminus to Lys158 and the peptide from Ile150 to the C-terminal side) are linked by a disulfide bond, or a complex in which the two peptides generated by cleavage between Lys158 and Ile159 (i.e., the peptide from the N-terminus to Lys158 and the peptide from Ile150 to the C-terminal side) are linked by crosslinking (e.g., crosslinking between amino acid side chains)). In the fusion protein of the present invention, preferably, the catalytic domain is a catalytic domain composed of one peptide (i.e., the catalytic domain before cleavage between Lys158 and Ile159).

[0028] Prourokinase or its catalytic domain or a variant of prourokinase may have a signal peptide. However, in the dosage form, since the signal peptide is unnecessary, prourokinase may not have a signal peptide.

[0029] The prourokinase or its variant may have, for example, an EGF-like domain, a kringle domain, and a catalytic domain.

[0030] In the fusion protein of the present invention, the antibody that binds to insoluble fibrin is an antibody that binds to insoluble fibrin with a stronger affinity than to fibrinogen (i.e., an antibody that binds to insoluble fibrin with a lower dissociation constant K D than that for fibrinogen). An antibody that binds to insoluble fibrin with a stronger affinity than to fibrinogen can be, for example, an antibody that binds to a peptide consisting of the amino acid sequence set forth in SEQ ID NO: 17 or 18 (see WO2014 / 133093). The amino acid sequence set forth in SEQ ID NO: 17 corresponds to the amino acid sequence set forth in SEQ ID NO: 1 of WO2014 / 133093, and the amino acid sequence set forth in SEQ ID NO: 18 corresponds to the amino acid sequence set forth in SEQ ID NO: 2 of WO2014 / 133093. In a preferred embodiment, the antibody that binds to insoluble fibrin with a stronger affinity than to fibrinogen binds to insoluble fibrin with an affinity that is 2-fold or more, 3-fold or more, 4-fold or more, 5-fold or more, 6-fold or more, 7-fold or more, 8-fold or more, 9-fold or more, 10-fold or more, 20-fold or more, 30-fold or more, 40-fold or more, 50-fold or more, 60-fold or more, 70-fold or more, 80-fold or more, 90-fold or more, 100-fold or more, 200-fold or more, 300-fold or more, 400-fold or more, 500-fold or more, 600-fold or more, 700-fold or more, 800-fold or more, 900-fold or more, 1,000-fold or more, 10,000-fold or more, 100,000-fold or more stronger than that for fibrinogen {wherein the greater the difference in affinity, the more preferred}.

[0031] Examples of the antibody or its antigen-binding fragment that binds to insoluble fibrin with a stronger affinity than to fibrinogen include, for example, an antibody or its antigen-binding fragment having, as corresponding CDRs, the heavy-chain CDR1-3 and the light-chain CDR1-3 of an antibody selected from the group consisting of the 10-102 antibody, 34-105 antibody, and Fib-0355 antibody disclosed in WO2014 / 133093.

[0032] Examples of the antibody or its antigen-binding fragment that binds to insoluble fibrin with a stronger affinity than to fibrinogen also include, for example, an antibody or its antigen-binding fragment having, as corresponding CDRs, the heavy-chain CDR1-3 and the light-chain CDR1-3 of an antibody selected from the group consisting of the 99 antibody, 1101 antibody, and 0211 antibody disclosed in WO2018 / 203517.

[0033] In the fusion protein of the present invention, examples of the antibody or its antigen-binding fragment that binds to insoluble fibrin with a stronger affinity than to fibrinogen further include a heavy-chain variable region comprising a heavy-chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 11, a heavy-chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 12, and a heavy-chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 13, and a light-chain variable region comprising a light-chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 14, a light-chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 15, and a light-chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 16 including an antibody or its antigen-binding fragment. The antibody can be a human chimeric antibody or a humanized antibody. According to the present invention, a humanized antibody having the above heavy-chain variable region and light-chain variable region is also provided.

[0034] In the fusion protein of the present invention, examples of the antibody or its antigen-binding fragment that binds to insoluble fibrin with a stronger affinity than to fibrinogen include, for example, A heavy chain variable region having the amino acid sequence from position 20 to position 139 of the amino acid sequence set forth in SEQ ID NO: 5, and a light chain variable region having the amino acid sequence from position 23 to position 130 of the amino acid sequence set forth in SEQ ID NO: 4, and including antibodies or antigen-binding fragments thereof. In the fusion protein of the present invention, the antibody may further include a heavy chain constant region or a part thereof within the Fab fragment in addition to the heavy chain variable region. In the fusion protein of the present invention, the antibody can be a human chimeric antibody or a humanized antibody. According to the present invention, a humanized antibody having the above heavy chain variable region and light chain variable region is also provided.

[0035] Pro-urokinase or its catalytic domain or a mutant of pro-urokinase may be linked to an antibody or its antigen-binding fragment that binds to insoluble fibrin, either via a linker or without a linker. As the linker, various linkers can be used as long as the effects of the invention are not significantly reduced. For example, a peptide linker can be used. For example, a flexible linker (or flexible peptide linker) can be used. For example, a linker consisting of glycine and serine (GS linker) can be mentioned. As the GS linker, for example, (GGGGS) n {where n is any natural number from 1 to 5, preferably any natural number from 2 to 3, preferably 3} can be mentioned. As the flexible linker, for example, a linker having the amino acid sequence set forth in SEQ ID NO: 19 can also be mentioned.

[0036] The fusion protein of the present invention can be in the form of a complex with the light chain variable region when the antibody or its antigen-binding fragment requires the light chain variable region for antigen recognition. When the fusion protein of the present invention does not need to form a complex with an additional peptide for binding to an antigen (for example, when the fusion protein contains a light chain variable region or the fragment is an scFv, etc.), formation of a complex with an additional light chain is not necessary (that is, it can be in a free form). Here, the free form means a form in which no complex is formed with the light chain.

[0037] In a preferred embodiment, the fusion protein of the present invention can be a fusion protein of an antibody or an antigen-binding fragment thereof that binds to fibrin and a prourokinase variant containing a Fab region of the heavy chain of the antibody that binds to fibrin, an EGF-like domain, a kringle domain, and a catalytic domain. The fusion protein can be in the form of a complex with the light chain of the antibody that binds to the fibrin. In this embodiment, the antigen-binding fragment of the antibody that binds to fibrin is a heavy chain variable region containing a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 11, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 12, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 13, and a light chain variable region containing a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 14, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 15, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 16 and may more preferably contain a heavy chain variable region having the amino acid sequence of positions 20 to 139 of the amino acid sequence set forth in SEQ ID NO: 5, and a light chain variable region having the amino acid sequence of positions 23 to 130 of the amino acid sequence set forth in SEQ ID NO: 4 In the above, the heavy chain variable region may further contain the heavy chain constant region of its Fab region or a part thereof. In the above embodiment, preferably, both Lys135-Lys136, which is the plasmin cleavage site of the kringle domain, can be modified to glycine.

[0038] According to the present invention, the fusion protein of the present invention can be prepared by methods well known to those skilled in the art. For example, the fusion protein of the present invention can be expressed in cells (insect cells, avian cells, Escherichia coli, yeast, and mammalian cells), preferably mammalian cells (for example, mammalian cells suitable for protein expression, such as Chinese hamster ovary cells (CHO cells) and 293 cells and human cells such as their derived cells, etc.). Expression can be carried out, for example, using an expression vector containing a nucleic acid encoding the fusion protein of the present invention operably linked to a promoter that can be driven in the expression cell. When a light chain is required for the fusion protein, the light chain can be co-expressed in the expression cell. According to the present invention, the fusion protein of the present invention can be purified by purification methods well known to those skilled in the art. Purification can be carried out using an affinity column containing an antigen, an affinity column for a tag attached to the fusion protein, and the like.

[0039] According to the present invention, there are provided a composition and a pharmaceutical composition comprising the fusion protein of the present invention (for example, a fusion protein of an antibody of the present invention or an antigen-binding fragment thereof and a prourokinase variant). The pharmaceutical composition of the present invention may further contain a pharmaceutically acceptable excipient in addition to the fusion protein of the present invention (for example, a fusion protein of an antibody of the present invention or an antigen-binding fragment thereof and a prourokinase variant). Examples of pharmaceutically acceptable excipients include salts, isotonic agents, pH adjusters, and water. In one aspect, the pharmaceutical composition of the present invention can be a kit (i.e., a ready-to-prepare kit) containing a freeze-dried pharmaceutical composition and water for injection.

[0040] The pharmaceutical composition containing the fusion protein of the present invention (for example, the fusion protein of the antibody of the present invention or its antigen-binding fragment and the prourokinase variant) can be administered by parenteral administration (for example, intravascular administration, for example, intravenous administration). Intravascular administration can be performed, for example, near a thrombus, particularly upstream of the thrombus with respect to the blood flow (the direction in which the blood flows). Further, when the pharmaceutical composition of the present invention is for intravenous administration, it can be a formulation suitable for intravenous administration. Such a pharmaceutical composition can be appropriately prepared by those skilled in the art. For example, it can be prepared in the same manner as protein formulations and antibody formulations. The dosage, administration timing, administration route, etc. can be appropriately determined by a doctor. For example, the pharmaceutical composition of the present invention can be intravenously administered within several hours (for example, 4 hours) after the onset of thrombosis.

[0041] The pharmaceutical composition of the present invention may contain the fusion protein of the present invention (for example, the fusion protein of an antibody or its antigen-binding fragment and the prourokinase variant), and a therapeutically effective amount of the fusion protein may be included. A therapeutically effective amount means an amount that exhibits a therapeutic effect in thrombosis or a disease caused by thrombosis. The therapeutic effect may depend on the recanalization of blood vessels and the restoration of blood flow due to the dissolution of the thrombus.

[0042] The pharmaceutical composition of the present invention can be used to dissolve a fibrin clot. The fibrin clot can be a thrombus.

[0043] The pharmaceutical composition of the present invention can be a thrombolytic agent or a fibrinolytic enzyme agent.

[0044] The pharmaceutical composition of the present invention can be used for the treatment of thrombosis, and can be used, for example, for the treatment of diseases selected from cerebrovascular disorders and myocardial infarction. The disease can be a disease caused by a fibrin thrombus. The disease can be a disease for which the dissolution of a fibrin clot is suitable as a treatment method. The disease can be imaged in vivo by an antibody that binds to fibrin (and a conjugate of the antibody and a contrast agent).

[0045] According to the present invention, there is provided the use of a protein selected from the group consisting of an antibody that binds to fibrin of the present invention or an antigen-binding fragment thereof, a prourokinase variant of the present invention, and a fusion protein of the present invention in the manufacture of a medicament for use in dissolving a fibrin clot. According to the present invention, there is provided the use of a protein selected from the group consisting of an antibody that binds to fibrin of the present invention or an antigen-binding fragment thereof, a prourokinase variant of the present invention, and a fusion protein of the present invention in the manufacture of a medicament that is a thrombolytic agent or a fibrinolytic enzyme agent. According to the present invention, there is provided the use of a protein selected from the group consisting of an antibody that binds to fibrin of the present invention or an antigen-binding fragment thereof, a prourokinase variant of the present invention, and a fusion protein of the present invention in the manufacture of a medicament that is a thrombolytic agent or a fibrinolytic enzyme agent. According to the present invention, there is provided the use of a protein selected from the group consisting of an antibody that binds to fibrin of the present invention or an antigen-binding fragment thereof, a prourokinase variant of the present invention, and a fusion protein of the present invention in the manufacture of a medicament for use in treating a disease selected from cerebrovascular disorders and myocardial infarction.

[0046] According to the present invention, there is provided a method of administering a medicament to a subject, wherein the medicament is the fusion protein of the present invention. According to the present invention, there is provided a method of dissolving a fibrin clot in a subject in need thereof, comprising administering the fusion protein of the present invention. According to the present invention, the subject in need thereof may be a subject having a thrombus. According to the present invention, there is provided a method of treating a disease in a subject in need thereof, comprising administering the fusion protein of the present invention. Here, the disease may be a disease caused by a thrombus, a disease treated by thrombolysis, and examples thereof include diseases selected from cerebrovascular disorders (e.g., cerebral infarction) and myocardial infarction.

[0047] Example 1: Preparation of a fusion protein of an anti-fibrin antibody and a prourokinase variant In this example, the fusion protein was designed and prepared.

[0048] [Design of Fusion Protein] Design of the prourokinase variant The Fab region of the humanized anti-Fibrin antibody was designed using the CDR regions of the anti-fibrin antibody 1101 (see WO2018 / 203517 for the 1101 clone). Also, one of the plasmin cleavage sites of prourokinase (SEQ ID NO: 1), 135Lys-136Lys, was modified to 135Gly-136Gly (SEQ ID NO: 2). By this modification, the same site is not cleaved by plasmin activated on insoluble fibrin, and the active domain of urokinase can continue to dissolve insoluble fibrin (see Figure 1).

[0049] Design of the fusion protein Based on the antibody produced by the above 1101 clone, its Fab region and the above prourokinase variant were linked via a linker to design the fusion protein described in SEQ ID NO: 3. A His tag was attached to the C-terminus of the fusion protein. Also, a light chain having the amino acid sequence described in SEQ ID NO: 4 was designed. The designed fusion protein may be referred to as the AMU1114 heavy chain. The fusion protein having the amino acid sequence described in SEQ ID NO: 3 has a structure in which the Fab region of the antibody described in SEQ ID NO: 5 is linked to the prourokinase variant described in SEQ ID NO: 2 via the linker described in SEQ ID NO: 19. The light chain was expressed as a separate peptide and complexed with the above AMU1114 heavy chain.

[0050] Specifically, a gene encoding the Fab region was amplified from the heavy chain gene of the anti-fibrin antibody produced by the above 1101 clone by the PCR method. Also, the gene of prourokinase was amplified by the PCR method, and a mutation was introduced into the prourokinase gene by the site-directed mutagenesis method to obtain the above variant.

[0051] The primers used were as follows. ACTTGAATTCCACCATGGGCTCTACAGCAATCCTCGCTTTG (SEQ ID NO: 6) ATAAGGATCCTTTACCCGGAGACAGGGAGAGGCTCTTC (SEQ ID NO: 7) GAGGCTCGAGTCTTAAGTTTCAATGCGGCCAG (SEQ ID NO: 8) ATAAGCGGCCGCTCAATGGTGGTGGTGGTGATGATGGTGACTTGCTCCGCCTGCGGAAAGCGCCAGACCATTTTCTTC (SEQ ID NO: 9)

[0052] After purifying the amplification product using the Promega Wizard SV gal and PCR clean-up system kit, pcDNA3.3 and the PCR product were each subjected to restriction enzyme treatment with EcoRI and NotI and cloned. Thereafter, a fusion protein was obtained by a further PCR method using primers containing the following linker sequence. GAAGAGCCTCTCCCTGTCTCCGGGTAAAGGATCCGGTGGAGGTGGCAGTGGTGGGGGAGGCTCAGGAGGCTCGAGTCTTAAGTTTCAATGCGGCCAGAAAAC (SEQ ID NO: 10)

[0053] [Expression and purification of the fusion protein] The fusion protein and the light chain peptide were transiently expressed using the ExpiCHO Expression System (Thermo Fisher). To suppress enzyme activity, FBS was added to the medium to a concentration of 20%. The transiently expressed culture supernatant was applied to a Superdex 75pg (GE) gel filtration column equilibrated with 50 mM Tris-HCl pH 8.5, 300 mM NaCl. The elution region of the target product was recovered from the gel filtration column, purified using a Ni column, and then purified using a Superdex 200pg (GE) gel filtration column to obtain the final product.

[0054] [Confirmation of the final product] The final product was analyzed by SDS-PAGE under reducing and non-reducing conditions. Under non-reducing conditions, it is presumed that the fusion protein forms a complex with the light chain (hereinafter sometimes referred to as the "AMU1114 complex" or simply "AMU1114"). According to the electrophoresis photograph in the left panel of FIG. 1B, the complex was observed as a single band at approximately 100 kDa. Under reducing conditions, it is presumed that the SS bond connecting the fusion protein and the light chain is cleaved, and the fusion protein and the light chain are detected separately. According to the electrophoresis photograph in the right panel of FIG. 1B, the fusion protein (AMU1114 heavy chain) was observed as a single band at approximately 75 kDa, and the light chain was observed as a single band at approximately 25 kDa, which was consistent with the theoretical value presumed.

[0055] Example 2: In vitro fibrin gel lysis test In this example, the fibrin gel-lysing activities of AMU1114 and existing thrombolytic agents (actibasin (t-PA, generic name: alteplase) and urokinase (u-PA, generic name: urokinase)) were compared in an in vitro system.

[0056] Fibrin gel (insoluble fibrin) was prepared as follows. After blood was collected using a vacuum blood collection tube (Venoject II vacuum blood collection tube VP-P070K30 Terumo), it was centrifuged at room temperature for 13 minutes using a Medifuge to collect plasma. Human fibrinogen labeled with Alexa Fluor647 (human fibrinogen AF647) was added to the collected plasma in an amount of 1 / 100 of the plasma volume. The plasma mixed with human fibrinogen AF647 was dispensed into a 96-well plate at 140 μL per well, and then 7.5 μL / well of thrombin at 20 NIH units / mL was added and allowed to stand at room temperature for 15 minutes. After confirming that the plasma had coagulated, it was centrifuged at 500×g for 3 minutes to prepare fibrin gel. It was washed 5 times with 100 μL of PBS to wash away impurities.

[0057] The fibrin gel dissolution test was conducted as follows. Activase 6 million units for injection (Kyowa Kirin), urokinase for intravenous injection 120,000 units (Mochida Pharmaceutical), and AMU1114 were each adjusted with PBS to concentrations of 2 mg / mL, 1 mg / mL, and 0.5 mg / mL. Each sample was diluted 10-fold with human plasma (Kojin Bio) and reacted at 37°C for 120 minutes. Each reacted sample was further diluted 10-fold with human plasma and added to the fibrin gel (150 μL / well). After adding to the fibrin gel, it was reacted at 37°C for 1 hour, and Alexa Fluor647 (Ex647 / Em680) eluted in the supernatant was measured. In this test system, an increase in this fluorescence intensity means dissolution of the fibrin gel.

[0058] The results were as shown in Figure 2. As shown in Figure 2, it was revealed that all of Activase, urokinase, and AMU1114 had the activity to dissolve the fibrin gel upon addition to the fibrin gel. In the fibrin gel dissolution activity, since the activity of 10 μg / mL of Activase and urokinase was equal to that of 20 μg / mL of AMU1114, in the following examples, this concentration ratio (i.e., 1:1:2) was used. As shown in Figure 1B, since AMU1114 has a molecular weight approximately twice that of Activase and urokinase, it is clear that at the above concentrations, Activase, urokinase, and AMU1114 have equivalent molar concentrations.

[0059] Example 3: Influence of drug administration on the amount of plasminogen in blood in vivo When a urokinase preparation is administered into the blood, blood plasma plasminogen is decomposed to produce plasmin. Since plasmin has the activity to decompose fibrin generated in the blood, an increase in blood plasma plasminogen concentration may lead to anticoagulant side effects throughout the body. In this example, the effects of Activase, urokinase, and AMU1114 on the amount of blood plasma plasminogen in vivo were examined.

[0060] Activacin and uronase were each adjusted to 2 mg / mL with PBS as the drugs to be administered. AMU1114 was also adjusted to 4 mg / mL. This was administered to mice (C57BL / 6J, n=3, each weighing 20 g) at 100 μL per mouse via the tail vein. Thirty minutes later, 500 μL of blood was collected from the mice anesthetized with isoflurane by cardiac blood collection. The blood was quickly transferred to a 1.5 mL tube and cooled with a cooling agent until the next step. A syringe that had previously drawn 50 μL of 19% sodium citrate solution was used for blood collection. The collected blood was immediately centrifuged at 10,000 × g for 2 minutes, and the plasma was collected and frozen at -80°C.

[0061] Each plasma frozen at -80°C was thawed on ice. After thawing, it was diluted 40 times with TBS, and 20 μL of the diluted sample was mixed with 100 μL of 250 units / mL uronase. In addition, 20 μL of the diluted sample was mixed with 100 μL of TBS as a negative control sample. The mixed sample was reacted for 1 hour at 37°C. Then, it was mixed with 20 μL of substrate (Test Team S PLG, Sekisui Medical) and reacted for 6 hours at 37°C. After the reaction, the absorbance at 405 / 505 was measured. From the measured absorbance, the ratio (%) of each to the untreated sample was calculated based on the value of plasminogen in the plasma taken from the untreated mouse (untreated).

[0062] The results are shown in Figure 3. As shown in Figure 3, it was confirmed that the amount of plasminogen in the blood was reduced by Activacin and Uronase, but the amount of reduction was smaller by AMU1114. In particular, AMU1114 had a lower ability to activate plasminogen in the blood compared to Activacin (t-PA).

[0063] Example 4: Thrombosis formation and thrombus recanalization experiment in vivo In this example, a thrombus was formed in the carotid artery of a mouse by the PIT method, and then a drug was administered to determine the time during which the carotid artery was patent and the time during which it was occluded. In the PIT method, when rose bengal is irradiated with light having a wavelength of 540 nm, singlet oxygen is generated at the irradiation site, damaging endothelial cells, inducing platelet aggregation, and promoting thrombus formation, as follows is utilized.

[0064] For mice with an average body weight of 30 g (n = 10 for each administration group), activase was administered at 3 mg / kg in a volume of 90 μL, and AMU1114 was administered at 6 mg / kg in a volume of 180 μL. At these doses, activase and AMU1114 exhibit equivalent activity in an in vitro system. The experiment was commissioned to LSI Medience Corporation, which has extensive experience in mouse thrombus experiments.

[0065] In each experiment, rose bengal dye was administered at the 0-minute time point, and light irradiation was performed to initiate thrombus formation in the carotid artery. Five minutes after the start of thrombus formation, PBS, AMU1114, or activase was administered. Irradiation was stopped 30 minutes after the start of thrombus formation. Observation was terminated 60 minutes after the start of thrombus formation. The time during which the carotid artery was occluded and the time during which it was patent were determined during the 60-minute observation period.

[0066] The summary of the results was as shown in Figure 4. As shown in Figure 4, it was clear that the patency time of the blood vessel (the ratio of the patency time to the total time) was significantly greater in the activase administration group compared to the negative control, and it was even greater in the AMU1114 administration group.

[0067] The details of the results were as shown in Fig. 5A (negative control group), Fig. 5B (AMU1114 administration group), and Fig. 5C (activase administration group). In the negative control group, 10 out of 10 blood vessels were occluded at the end of the experiment (see Fig. 5A). In contrast, as shown in Fig. 5B, in the AMU1114 administration group, only 1 out of 10 blood vessels was occluded, and 9 blood vessels were patent. Also, as shown in Fig. 5C, in the activase administration group, 5 out of 10 blood vessels were occluded.

[0068] When comparing the results of Fig. 5B and Fig. 5C, as shown in Fig. 5D, in the AMU1114 administration group, more individuals had patent blood vessels than in the activase administration group. It was revealed that AMU1114 is superior to conventional thrombolytic agents (especially t-PA) in terms of blood vessel patency ability in vivo. Considering that the administered drugs showed equivalent activity in vitro, the high in vivo blood vessel patency ability in the AMU1114 administration group was beyond expectation.

[0069] In addition, a portion with a thrombus was found in the blood vessels of the normal tissue part of a human lung cancer resection specimen. Immunohistochemical staining was performed on this thrombus using humanized 1101 antibody and humanized 99 antibody in the same manner as above. The results were as shown in Fig. 6. As shown in Fig. 6, the humanized 1101 antibody and the humanized 99 antibody were each able to visualize the thrombus site. That is, it was also shown that the humanized 1101 antibody and the humanized 99 antibody bind to human thrombi.

[0070] Sequence Listing SEQ ID NO: 1: An example of the amino acid sequence of prourokinase (signal peptide removed) SEQ ID NO: 2: An example of the amino acid sequence of a prourokinase variant (signal peptide removed) SEQ ID NO: 3: An example of a fusion protein of the Fab region of the heavy chain of anti-fibrin antibody clone 1101 and a prourokinase variant (without His tag) SEQ ID NO: 4: Amino acid sequence of the light chain of anti-fibrin antibody clone 1101 (wherein the amino acid sequence from positions 1 to 22 is the signal sequence, the amino acid sequence from positions 23 to 130 is the amino acid sequence of the variable region of the antibody light chain, and the amino acid sequence from positions 131 to 236 is the amino acid sequence of the constant region of the antibody light chain) SEQ ID NO: 5: Amino acid sequence of the Fab region of the heavy chain of anti-fibrin antibody clone 1101 (wherein the amino acid sequence from positions 1 to 19 is the signal sequence, the amino acid sequence from positions 20 to 139 is the amino acid sequence of the variable region of the antibody heavy chain, and the amino acid sequence from positions 140 to 242 is the amino acid sequence of the heavy chain constant region contained in Fab) SEQ ID NO: 6: Nucleotide sequence of primer 1 SEQ ID NO: 7: Nucleotide sequence of primer 2 SEQ ID NO: 8: Nucleotide sequence of primer 3 SEQ ID NO: 9: Nucleotide sequence of primer 4 SEQ ID NO: 10: Nucleotide sequence of primer 5 SEQ ID NO: 11: Amino acid sequence of the heavy chain CDR1 of humanized anti-fibrin antibody clone 1101 used in the fusion protein of the present invention SEQ ID NO: 12: Amino acid sequence of the heavy chain CDR2 of humanized anti-fibrin antibody clone 1101 used in the fusion protein of the present invention SEQ ID NO: 13: Amino acid sequence of the heavy chain CDR3 of humanized anti-fibrin antibody clone 1101 used in the fusion protein of the present invention SEQ ID NO: 14: Amino acid sequence of the light chain CDR1 of humanized anti-fibrin antibody clone 1101 used in the fusion protein of the present invention SEQ ID NO: 15: Amino acid sequence of the light chain CDR2 of humanized anti-fibrin antibody clone 1101 used in the fusion protein of the present invention SEQ ID NO: 16: Amino acid sequence of the light chain CDR3 of humanized anti-fibrin antibody clone 1101 used in the fusion protein of the present invention SEQ ID NO: 17: An example of the amino acid sequence exposed in insoluble fibrin (β chain) SEQ ID NO: 18: An example of the amino acid sequence exposed in insoluble fibrin (γ chain) SEQ ID NO: 19: The linker sequence used in the examples

Claims

1. A fusion protein comprising an antibody or an antigen-binding fragment thereof that binds to insoluble fibrin, and a region comprising the EGF-like domain, kringle domain, and catalytic domain of prourokinase, wherein the antibody or the antigen-binding fragment thereof and the region are directly or indirectly linked via a linker, the antibody and the antigen-binding fragment thereof bind to a peptide consisting of the amino acid sequence set forth in SEQ ID NO: 17 or 18 and bind to insoluble fibrin, the antibody or the antigen-binding fragment thereof, and the region comprising the EGF-like domain, kringle domain, and catalytic domain of prourokinase are linked in this order, in a mouse model in which thrombosis is induced in the carotid artery by the PIT method of irradiating rose bengal with light having a wavelength of 540 nm to generate singlet oxygen at the irradiation site, damaging endothelial cells, and inducing platelet aggregation, the carotid artery occluded by the thrombus can be opened, A fusion protein.

2. The fusion protein according to claim 1, wherein the antigen-binding fragment is a Fab fragment.

3. The fusion protein according to claim 1 or 2, wherein the catalytic domain is composed of a single peptide before cleavage between the amino acids corresponding to Lys158-Ile159 in the amino acid sequence of SEQ ID NO:

1.

4. The fusion protein according to claim 1 or 2, wherein the catalytic domain is cleaved between the amino acids corresponding to Lys158-Ile159 in the amino acid sequence of SEQ ID NO: 1, and the peptide from the N-terminus to Lys158 and the peptide from Ile159 to the C-terminus are linked by a disulfide bond.

5. The fusion protein according to any one of claims 1 to 4, wherein the amino acid sequence of the plasmin cleavage site in the kringle domain is modified so that the cleavage site is more resistant to cleavage by plasmin.

6. The fusion protein according to any one of claims 1 to 5, wherein the 135th and 136th amino acids in the amino acid sequence of SEQ ID NO: 1 are modified, thereby making it more resistant to cleavage by plasmin.

7. The fusion protein according to any one of claims 1 to 6, wherein prourokinase has an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO:

2.

8. The insoluble fibrin antibody or an antigen-binding fragment thereof comprises a heavy chain variable region containing a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 11, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 12, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 13, and a light chain variable region containing a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 14, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 15, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 16, and the fusion protein according to any one of claims 1 to 7. **Claim 9** A pharmaceutical composition comprising the fusion protein according to any one of claims 1 to 8. **Claim 10** The pharmaceutical composition according to claim 9, for use in lysing a fibrin clot. **Claim 11** The pharmaceutical composition according to claim 9 or 10, which is a thrombolytic agent or a fibrinolytic enzyme agent. **Claim 12** The pharmaceutical composition according to any one of claims 9 to 11, for use in treating a disease selected from cerebrovascular disorders and myocardial infarction.

Citation Information

Patent Citations

  • Stabilized human prourokinase

    JP1987143686A

  • Hybrid plasminogen activator-like polypeptide

    JP1987272975A

  • Recombination hybrid immunoglobulin molecule and method of its use

    JP1993199888A

  • Antibody against insoluble fibrin

    WO2014133093A1

  • Plasmin-cleavable Anti-insoluble fibrin antibody-drug conjugate

    WO2018203517A1