SOD1 double expression vector and its use

Abstract

To provide compositions and methods useful for inhibiting SOD1 expression in cells (e.g., cells of a subject).SOLUTION: In some embodiments, the disclosure describes isolated nucleic acids engineered to express an inhibitory nucleic acid targeting endogenous SOD1 and an mRNA encoding a reinforced SOD1 protein. In some embodiments, compositions and methods described in the disclosure are useful for treating Amyotrophic Lateral Sclerosis (ALS) in a subject.SELECTED DRAWING: Figure 1

Description

Technical Field

[0001] Related Applications This application claims the benefit under 35 U.S.C. 119(e) of the filing date of U.S. Provisional Application No. 62 / 561,932, filed Sep. 22, 2017, entitled "SOD1 Dual Expression Vector and its Use", the entire content of which is incorporated herein by reference.

Background Art

[0002] Background Amyotrophic lateral sclerosis (ALS) is a progressive and generally fatal motor neuron disorder that sometimes progresses concomitantly with frontotemporal dementia (FTD). ALS occurs in both sporadic (SALS) and familial (FALS) forms. Approximately 10% of cases are inherited as an autosomal dominant trait. The only FDA-approved treatment for ALS is riluzole, a compound that extends survival by about 10%. In general, studies showing the benefit of SOD1 silencing in ALS cells and transgenic animals do not describe silencing of only the mutant allele. Rather, in most studies, silencing reduces the levels of both mutant toxic SOD1 protein and wild-type SOD1 protein. However, over-silencing of SOD1 from both mutant and wild-type alleles may be associated with undesirable biological consequences as a result of reduced activity or function of the wild-type SOD1 protein.

Summary of the Invention

[0003] Summary Aspects of the present disclosure relate to compositions and methods for modulating cytosolic Cu / Zn superoxide dismutase (SOD1) expression in cells. Accordingly, in some embodiments, methods useful for treating ALS are provided. In some embodiments, the present disclosure provides synthetic nucleic acids (such as synthetic microRNAs) engineered to inhibit the expression of endogenous SOD1 in cells or subjects. In some embodiments, the present disclosure provides nucleic acids engineered to express exogenous SOD1 in cells or subjects. In some embodiments, such exogenous SOD1 is resistant to targeting by synthetic nucleic acids (such as synthetic microRNAs) that target endogenous SOD1. Accordingly, in some embodiments, the present disclosure provides compositions and methods for linking (1) delivery of a synthetic microRNA that suppresses the expression of endogenous cytosolic Cu / Zn superoxide dismutase (SOD1) activity to (2) a second construct that expresses exogenous SOD1 that is resistant to the synthetic microRNA (miRNA).

[0004] The present disclosure addresses the problem of loss of neuroprotective activity due to SOD1 disproportionation by continuously including the cDNA of SOD1 expressed from an RNA engineered to be resistant to an anti-SOD1 miRNA, in the compositions and methods described herein. In some embodiments, the constructs described by the present disclosure allow for normal levels of SOD1 disproportionation activity (e.g., in cells or subjects to which the construct has been administered), even in the presence of complete silencing of both WT and mutant endogenous SOD1 alleles.

[0005] Accordingly, in some aspects, the present disclosure provides an isolated nucleic acid comprising: a first region encoding one or more first miRNAs having a sufficient sequence complementary to an endogenous mRNA of a subject, which hybridizes to the endogenous mRNA and inhibits the expression of the endogenous mRNA, wherein the endogenous mRNA encodes a SOD1 protein; and a second region encoding an exogenous mRNA encoding a wild-type SOD1 protein, wherein the one or more first miRNAs do not comprise a nucleic acid having a sufficient complementary sequence for hybridizing to the exogenous mRNA and inhibiting the expression of the exogenous mRNA. In some embodiments, the exogenous mRNA lacks a 5' untranslated region (5'UTR), lacks a 3' untranslated region (3'UTR), or lacks both a 5'UTR and a 3'UTR. In some embodiments, the exogenous mRNA encoding the SOD1 protein has one or more silent base pair mutations relative to the endogenous mRNA. In some embodiments, the exogenous mRNA comprises a nucleic acid sequence that is at least 95% identical to the endogenous mRNA.

[0006] In some embodiments, wild-type SOD1 is encoded by the nucleic acid sequence set forth in SEQ ID NO: 7 (enhanced SOD1 sequence). In some embodiments, the one or more first miRNAs target an untranslated region (e.g., 5'UTR or 3'UTR) of the nucleic acid encoding the endogenous mRNA. In some embodiments, the one or more first miRNAs target the coding sequence of the nucleic acid encoding the endogenous mRNA. In some embodiments, the one or more first miRNAs hybridize to a nucleic acid comprising 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the RNA encoded by the sequence set forth in SEQ ID NO: 3. In some embodiments, the one or more first miRNAs hybridize to a nucleic acid comprising 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the RNA encoded by the sequence set forth in SEQ ID NO: 2.

[0007] In some embodiments, one or more first miRNAs comprise or are encoded by 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the sequence set forth in SEQ ID NO: 4. In some embodiments, one or more first miRNAs comprise or are encoded by 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the sequence set forth in SEQ ID NO: 3. In some embodiments, the miRNA further comprises an adjacent region of miR-155 or an adjacent region of miR-30. In some embodiments, the isolated nucleic acid further comprises a first promoter. In some embodiments, the first promoter is operably linked to a first region of the isolated nucleic acid described by this disclosure. In some embodiments, the first promoter is an RNA polymerase III (pol III) promoter such as an H1 promoter or a U6 promoter.

[0008] In some embodiments, the first promoter is an RNA polymerase II (pol II) promoter such as a chicken beta-actin (CBA) promoter or an endogenous SOD1 promoter (e.g., SEQ ID NO: 16). In some embodiments, the isolated nucleic acid further comprises a second promoter. In some embodiments, the second promoter is operably linked to a second region of the isolated nucleic acid described by this disclosure. In some embodiments, the second promoter is a pol II promoter such as a chicken beta-actin (CBA) promoter or an endogenous SOD1 promoter. In some embodiments, the isolated nucleic acid further comprises an enhancer sequence such as a cytomegalovirus (CMV) enhancer.

[0009] In some embodiments, the first region is located within the untranslated region (e.g., UTR) of the second region. In some embodiments, the first region is located within the intron of the isolated nucleic acid. In some embodiments, the first region is located 5' to the second region. In some embodiments, the isolated nucleic acid further comprises at least one adeno-associated virus (AAV) inverted terminal repeat (ITR). In some embodiments, the isolated nucleic acid comprises a full-length ITR and a mutant ITR. In some embodiments, the ITR is adjacent to the first and second regions of the isolated nucleic acid described by the present disclosure. In some embodiments, the present disclosure provides a recombinant adeno-associated virus (rAAV) comprising the isolated nucleic acid and an AAV capsid protein described by the present disclosure.

[0010] In some embodiments, the rAAV targets CNS tissue. In some embodiments, the rAAV targets neurons. In some embodiments, the capsid protein is an AAV9 capsid protein or an AAVrh.10 capsid protein. In some aspects, the present disclosure provides a composition comprising the isolated nucleic acid described by the present disclosure or the rAAV described by the present disclosure, and a pharmaceutically acceptable excipient. In some aspects, the present disclosure provides a method for inhibiting SOD1 expression in a cell, comprising delivering the isolated nucleic acid described by the present disclosure or the rAAV described by the present disclosure to the cell.

[0011] In some embodiments, the cell comprises a nucleic acid sequence encoding a mutant SOD1 protein. In some aspects, the present disclosure provides a method for treating a subject having or suspected of having ALS, comprising administering to the subject an effective amount of the isolated nucleic acid described by the present disclosure, or an effective amount of the rAAV described by the present disclosure. In some embodiments, the subject comprises a nucleic acid sequence encoding a mutant SOD1 protein. In some embodiments, the subject is a mammalian subject, such as a human subject. Brief Description of the Drawings

Brief Description of the Drawings

[0012]

Figure 1

Figure 2

Figure 3

[0013]

Figure 4

Figure 5

[0014]

Figure 6

Figure 7

[0015]

Figure 8

Figure 9

[0016] Detailed description In some aspects, the present disclosure relates to compositions and methods for modulating the expression and / or activity of genes associated with amyotrophic lateral sclerosis (ALS) in cells (e.g., cells of a subject). For example, in some aspects, the present disclosure provides a composition (e.g., a bifunctional vector) that simultaneously expresses in a cell or subject (i) one or more synthetic nucleic acids that inhibit a gene associated with ALS (e.g., inhibitory RNAs such as miRNA, siRNA, shRNA) and (ii) an exogenous gene associated with ALS that encodes a protein that is resistant to the synthetic nucleic acid. Examples of genes associated with ALS include, but are not limited to, C9Orf72, SOD1, FUS, TARDBP, SQSTM1, VCP, OPTN, PFN1, UBQLN2, DCTN1, ALS2, CHMP2B, FIG4, HNRNAP1, ATXN2, ANG, SPG11, VAPB, NEFH, CHCHD10, ERBB4, PRPH, MATR3, SETX, SIGMAR1, TBK1, TRPM7, TUBA4A, ANXA11, NEK1, SARM1, UN13A, MOBP, SCFD1, C21Orf2, and others described (e.g., Renton et al. (2014) Nature Neuroscience 17(1):17-23). In some embodiments, the gene associated with ALS is a dominant negative gene associated with ALS (e.g., a gene encoding a dominant negative gene product such as a protein associated with ALS).

[0017] Aspects of the present disclosure relate to compositions and methods for modulating cytosolic Cu / Zn superoxide dismutase (SOD1) expression in cells. Accordingly, in some embodiments, methods useful for treating ALS are provided. In some embodiments, the present disclosure provides synthetic nucleic acids (such as synthetic microRNAs) engineered to inhibit the expression of endogenous SOD1 in a cell or subject. In some embodiments, the present disclosure provides nucleic acids engineered to express exogenous SOD1 in a cell or subject. In some embodiments, such exogenous SOD1 is resistant to targeting by synthetic nucleic acids (such as synthetic microRNAs) that target endogenous SOD1.

[0018] Aspects of the present disclosure relate to improved gene therapy compositions and related methods for treating ALS using recombinant adeno-associated virus (rAAV) vectors. In particular, rAAVs encapsulating nucleic acids engineered to express inhibitory nucleic acids that suppress genes such as SOD1 associated with ALS are provided. In some embodiments, the present disclosure utilizes recombinant AAVs (such as rAAV9, rAAV.Rh10, etc.) to deliver microRNAs to the CNS, thereby suppressing ALS genes such as SOD1. In some aspects, the present disclosure relates to the discovery of bifunctional vectors capable of knocking down endogenous SOD1 expression (such as wild-type SOD1 and mutant SOD1 expression) in a subject while expressing wild-type SOD1. Thus, the constructs described by the present disclosure, in some embodiments, enable normal levels of SOD1 dismutase activity (e.g., in a cell or subject to which the construct has been administered), even when accompanied by complete silencing of both WT and mutant endogenous SOD1 alleles.

[0019] In some aspects, the present disclosure provides an isolated nucleic acid comprising: a first region encoding one or more first miRNAs, the nucleic acid having a sufficient sequence complementary to an endogenous mRNA of a subject and hybridizing to the endogenous mRNA to inhibit expression of the endogenous mRNA, wherein the endogenous mRNA encodes a SOD1 protein; and a second region encoding an exogenous mRNA encoding a wild-type SOD1 protein, wherein the one or more first miRNAs do not comprise a nucleic acid having a sufficient complementary sequence for hybridizing to the exogenous mRNA and inhibiting expression of the exogenous mRNA.

[0020] SOD1 As used herein, "SOD1" refers to superoxide dismutase (SOD1), an enzyme encoded in humans by the SOD1 gene. Typically, SOD1 catalyzes the disproportionation of superoxide to hydrogen peroxide and dioxygen and functions to remove free radicals in the body. "Wild-type SOD1" refers to a gene product (e.g., a protein) encoded by the SOD1 gene that does not cause a gain of toxic function in a cell or subject (e.g., does not cause, or would not cause, the onset of ALS). In some embodiments, the wild-type SOD1 gene encodes an mRNA transcript (e.g., a mature mRNA transcript) having the sequence set forth in NCBI accession number NM_000454.4. "Mutant SOD1" refers to a gene product (e.g., a protein) that results from one or more mutations (e.g., missense mutations, nonsense mutations, frameshift mutations, insertions, deletions, etc.) that confer an altered function such as a gain of toxic function. Generally, a nucleic acid encoding a mutant SOD1 gene product does not include a silent mutation relative to a nucleic acid encoding a wild-type SOD1 gene product.

[0021] Mutations in the gene encoding superoxide dismutase (SOD1), which is located on chromosome 21, lead to familial amyotrophic lateral sclerosis. Superoxide dismutase (SOD1) is an enzyme encoded by the SOD1 gene. SOD1 is one of three superoxide dismutases that bind copper and zinc ions and cause the destruction of free superoxide radicals in the body. The encoded isozyme is a soluble cytoplasmic and mitochondrial intermembrane space protein that functions as a homodimer to convert naturally occurring but harmful superoxide radicals into molecular oxygen and hydrogen peroxide. Frequent SOD1 mutations that cause and give rise to ALS include A4V, H46R, and G93A. Additional SOD1 mutations are described, for example, by Banci et al. (2008) PLoS ONE 3(2): e1677.

[0022] The present disclosure is based in part on the discovery that a nucleic acid construct that simultaneously inhibits endogenous SOD1 expression in a non-allele-specific manner (e.g., inhibits endogenous wild-type and endogenous mutant SOD1) and expresses an exogenous SOD1 protein (e.g., exogenous wild-type SOD1 or exogenous enhanced SOD1 protein) allows for normal levels of SOD1 disproportionation activity even when both WT and mutant endogenous SOD1 alleles are completely silenced. As used herein, "endogenous" refers to a gene (e.g., the SOD1 gene) or gene product (e.g., the SOD1 protein) encoded by the natural DNA of a cell. "Exogenous" refers to a gene (e.g., a nucleic acid encoding an SOD1 protein such as SOD1 cDNA) or gene product (e.g., an SOD1 protein such as an enhanced SOD1 protein) that is derived from a source other than the natural DNA of a cell (e.g., introduced into the cell non-naturally).

[0023] In some embodiments, the exogenous SOD1 nucleic acid sequence encodes an enhanced SOD1 protein. As used herein, "enhanced SOD1" refers to a nucleic acid sequence encoding an SOD1 protein that encodes the same protein as the endogenous wild-type SOD1 protein but contains one or more silent mutations such that it has a different primary nucleic acid (e.g., DNA) sequence. Without wishing to be bound by any particular theory, the "enhanced SOD1" mRNA transcript is not inhibited by certain inhibitory RNAs (e.g., miRNAs) that target endogenous SOD1 RNA transcripts (e.g., wild-type SOD1 and mutant SOD1 transcripts).

[0024] The number of silent mutations in the enhanced SOD1 nucleic acid sequence can vary. In some embodiments, the nucleic acid sequence encoding enhanced SOD1 contains between about 1 and about 50 (e.g., any integer between 1 and 50, inclusive) silent mutations relative to the wild-type SOD1 nucleic acid sequence (e.g., SEQ ID NO: 1; the SOD1 coding sequence). In some embodiments, the nucleic acid sequence encoding enhanced SOD1 contains at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 silent mutations relative to the wild-type SOD1 nucleic acid sequence (e.g., SEQ ID NO: 1; the SOD1 coding sequence). In some embodiments, one or more of the silent mutations in the nucleic acid sequence encoding enhanced SOD1 are located in a seed region targeted by an inhibitory nucleic acid. In some embodiments, the seed region spans a range of about 3 to about 25 consecutive nucleotide lengths (e.g., any integer between 3 and 25, inclusive).

[0025] The nucleic acid (e.g., DNA) sequence identity between a nucleic acid encoding an exogenous (e.g., enhanced) SOD1 protein and a nucleic acid encoding an endogenous wild-type SOD1 protein can vary. In some embodiments, the nucleic acid sequence encoding the exogenous SOD1 protein is between about 99.9% and about 85% identical to the endogenous wild-type SOD1 nucleic acid sequence (e.g., SEQ ID NO: 1; SOD1 DNA coding sequence). In some embodiments, the nucleic acid sequence encoding the exogenous SOD1 protein is about 99.9%, about 99%, about 98%, about 97%, about 96%, about 95%, about 94%, about 93%, about 92%, about 91%, about 90%, about 89%, about 88%, about 87%, about 86%, or about 85% identical to the endogenous wild-type SOD1 nucleic acid sequence (e.g., SEQ ID NO: 1; SOD1 DNA coding sequence). In some embodiments, the nucleic acid sequence encodes an exogenous SOD1 protein having an amino acid sequence that is between about 99.9% and about 90% (e.g., about 99.9%, about 99%, about 98%, about 97%, about 96%, about 95%, about 94%, about 93%, about 92%, about 91%, or about 90%) identical to the endogenous wild-type SOD1 amino acid sequence (e.g., SEQ ID NO: 17).

[0026] Inhibitory nucleic acid Aspects of the present disclosure relate to inhibitory nucleic acids that target SOD1 (e.g., endogenous SOD1). In some embodiments, the inhibitory nucleic acid is a nucleic acid that hybridizes to at least a portion of a target nucleic acid such as RNA, pre-mRNA, mRNA, etc., and inhibits its function or expression. In some embodiments, the inhibitory nucleic acid is single-stranded or double-stranded. In some embodiments, the inhibitory nucleic acid comprises or is encoded by the sequence set forth in SEQ ID NO: 4: CTGCATGGATTCCATGTTCAT (miR-SOD-127). In some embodiments, the inhibitory nucleic acid comprises or is encoded by the sequence set forth in SEQ ID NO: 3: CTGCATGGATTCCATGTTCAT (miR-SOD-127). In some embodiments, the inhibitory nucleic acid is a mature miRNA comprising SEQ ID NO: 3 and SEQ ID NO: 4. In some embodiments, SEQ ID NO: 3 is the guide strand of the mature miRNA and SEQ ID NO: 4 is the passenger strand of the mature miRNA (e.g., miRNA * ).

[0027] In some embodiments, the inhibitory nucleic acid is 5 to 30 bases in length (e.g., 10 to 30, 15 to 25, 19 to 22). The inhibitory nucleic acid can also be 10 to 50, or 5 to 50 bases in length. For example, the inhibitory nucleic acid can be any one of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases in length. In some embodiments, the inhibitory nucleic acid comprises or consists of, or comprises a sequence of bases that is at least 80% or 90% complementary to at least 5, 10, 15, 20, 25 or 30 bases, or up to 30 or 40 bases of the target nucleic acid, or has up to 6 mismatches over 10, 15, 20, 25 or 30 bases of the target nucleic acid.

[0028] In some embodiments, any one or more thymidine (T) nucleotides or uridine (U) nucleotides within the sequences provided herein can be replaced with any other nucleotide suitable for base pairing with an adenosine nucleotide (e.g., via Watson-Crick base pairing). For example, T can be replaced with U, and U can be replaced with T. In some embodiments, inhibitory nucleic acids are provided that inhibit gene expression in cells of the central nervous system. In some embodiments, the cells are neurons, astrocytes, or oligodendrocytes.

[0029] In some embodiments, the inhibitory nucleic acid is a miRNA. "MicroRNA" or "miRNA" is a small non-coding RNA molecule that can mediate transcriptional or post-transcriptional gene silencing. Typically, miRNA is transcribed as a hairpin or stem-loop (e.g., having self-complementarity, a single-stranded backbone) double-stranded structure and is referred to as primary miRNA (pri-miRNA), and is enzymatically processed (e.g., by Drosha, DGCR8, Pasha, etc.) into pre-miRNA. The length of pri-miRNA can vary. In some embodiments, the pri-miRNA ranges in length from about 100 to about 5000 base pairs (e.g., about 100, about 200, about 500, about 1000, about 1200, about 1500, about 1800, or about 2000 base pairs). In some embodiments, the pri-miRNA is greater than 200 base pairs in length (e.g., 2500, 5000, 7000, or 9000 or more base pairs in length).

[0030] Pre-miRNA, which can also be characterized by a hairpin or stem-loop double-stranded structure, can also vary in length. In some embodiments, the pre-miRNA ranges in size from about 40 base pairs to about 500 base pairs in length. In some embodiments, the pre-miRNA ranges in size from about 50 to 100 base pairs in length. In some embodiments, the pre-miRNA ranges in size from about 50 to about 90 base pairs in length (e.g., about 50, about 52, about 54, about 56, about 58, about 60, about 62, about 64, about 66, about 68, about 70, about 72, about 74, about 76, about 78, about 80, about 82, about 84, about 86, about 88, or about 90 base pairs in length).

[0031] Generally, pre-miRNA is exported to the cytoplasm and enzymatically processed by Dicer to initially generate an incomplete miRNA / miRNA * double-strand, then generate a single-stranded mature miRNA molecule, and subsequently be loaded into the RNA-induced silencing complex (RISC). Typically, mature miRNA molecules range in size from about 19 to about 30 base pairs in length. In some embodiments, the mature miRNA molecule is about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or 30 base pairs in length. In some embodiments, the isolated nucleic acid of the present disclosure comprises or is encoded by the sequence set forth in SEQ ID NO: 4 (miR-SOD-127) and / or SEQ ID NO: 3, and comprises a sequence encoding a pri-miRNA, pre-miRNA, or mature miRNA.

[0032] In some aspects, the present disclosure provides an isolated nucleic acid and a vector (e.g., an rAAV vector) encoding one or more artificial miRNAs. As used herein, "artificial miRNA" or "amiRNA" refers to an endogenous pri-miRNA or pre-miRNA (e.g., a miRNA backbone that is a precursor miRNA capable of generating a functional mature miRNA), miRNA and miRNA *(As an example, the passenger strand) sequence of the miRNA duplex is replaced with the corresponding amiRNA / amiRNA sequence that directs highly efficient RNA silencing of the targeted gene, as described, for example, in Eamens et al. (2014), Methods Mol. Biol. 1062:211-224. * For example, in some embodiments, the artificial miRNA comprises a miR-155 pri-miRNA backbone in which the sequence encoding the mature SOD1-specific miRNA (e.g., SEQ ID NO: 3 and / or 4; miR-SOD-127) is inserted in place of the sequence encoding the endogenous miR-155 mature miRNA. In some embodiments, the miRNA (e.g., artificial miRNA) described by the present disclosure comprises a miR-155 backbone sequence, a miR-30 backbone sequence, a mir-64 backbone sequence, a miR-106 backbone, a miR-21 backbone, a miR-1 backbone, a miR-451 backbone, a miR-126 backbone, or a miR-122 backbone sequence. In some embodiments, the inhibitory nucleic acid is a microRNA comprising a targeting sequence having an adjacent region of miR-155 or miR-30.

[0033] It should be understood that in some embodiments, an isolated nucleic acid or vector (e.g., an rAAV vector) comprises a nucleic acid sequence encoding more than one (e.g., a plurality such as 2, 3, 4, 5, or 10 or more) miRNA. In some embodiments, each of the more than one miRNA targets (e.g., hybridizes or specifically binds to) the same target gene (e.g., an isolated nucleic acid encoding 3 unique miRNAs each targeting the SOD1 gene). In some embodiments, each of the more than one miRNA targets (e.g., hybridizes or specifically binds to) a different target gene.

[0034] Isolated nucleic acid In some aspects, the present disclosure relates to an isolated nucleic acid comprising a first expression construct encoding a synthetic microRNA for inhibiting the expression of endogenous SOD1 and a second expression construct expressing exogenous SOD1 that is resistant to the synthetic microRNA (miRNA).

[0035] A "nucleic acid" sequence refers to a DNA sequence or an RNA sequence. In some embodiments, the proteins and nucleic acids of the present disclosure are isolated. As used herein, the term "isolated" means artificially produced. As used herein with respect to nucleic acids, the term "isolated" means: (i) amplified in vitro, for example by polymerase chain reaction (PCR); (ii) recombinantly produced by cloning; (iii) purified, as by cleavage and gel separation; or (iv) synthesized, for example by chemical synthesis. Isolated nucleic acids are readily manipulable by recombinant DNA techniques well known in the art. Thus, a nucleotide sequence contained in a vector for which the 5' and 3' restriction sites are known or for which polymerase chain reaction (PCR) primer sequences are disclosed is considered to be isolated, whereas a nucleic acid sequence existing in its natural host in its natural state is not. An isolated nucleic acid can be substantially purified, but it need not be. For example, a nucleic acid isolated within a cloning or expression vector may not be pure in that it contains only a very small percentage of material in the cell in which it is present. However, such nucleic acids are isolated as the term is used herein because they can be readily manipulated by standard techniques known to those of skill in the art. As used herein with respect to a protein or peptide, the term "isolated" refers to a protein or peptide that has been isolated from its natural environment or artificially generated (e.g., by chemical synthesis, recombinant DNA technology, etc.).

[0036] The isolated nucleic acids of the present disclosure typically include one or more regions encoding one or more inhibitory RNAs that target endogenous mRNA of a subject (e.g., mRNA encoding endogenous wild-type SOD1 and / or endogenous mutant SOD1). The isolated nucleic acids also typically include one or more regions encoding one or more exogenous mRNAs. The protein(s) encoded by the one or more exogenous mRNAs may or may not have a different sequence composition from the protein(s) encoded by the one or more endogenous mRNAs. For example, the one or more endogenous mRNAs may encode wild-type and mutant forms of a particular protein, such as when the subject is heterozygous for a particular mutation and the exogenous mRNA can encode the wild-type mRNA of the same particular protein. In this case, typically, the sequences of the exogenous mRNA and the endogenous mRNA encoding the wild-type protein are sufficiently different so that the exogenous mRNA is not targeted by the one or more inhibitory RNAs. This can be achieved, for example, by introducing one or more silent mutations into the exogenous mRNA such that it has a different nucleic acid sequence but encodes the same protein as the endogenous mRNA. In this case, the exogenous mRNA can be referred to as “enhanced.” Alternatively, the inhibitory RNA (e.g., miRNA) can target the 5′ and / or 3′ untranslated regions of the endogenous mRNA. These 5′ and / or 3′ regions can then be removed or replaced in the exogenous mRNA so that the exogenous mRNA is not targeted by the one or more inhibitory RNAs.

[0037] In another example, one or more endogenous mRNAs may encode only the mutant version of a particular protein, such as when the subject is homozygous for a particular mutation, and the exogenous mRNA can encode the wild-type mRNA of the same particular protein. In this case, the sequence of the exogenous mRNA can be enhanced as described above, or the one or more inhibitory RNAs can be designed to distinguish the mutant endogenous mRNA from the exogenous mRNA. In some embodiments, the isolated nucleic acid typically comprises one or more first inhibitory RNAs (e.g., miRNA) that hybridize to an endogenous mRNA of a subject and inhibit the expression of the endogenous mRNA (e.g., endogenous SOD1 mRNA), and that comprise a first region encoding a nucleic acid having a sufficient sequence complementary to the endogenous mRNA. The isolated nucleic acid also typically comprises a second region encoding an exogenous mRNA (e.g., exogenous SOD1), wherein the protein encoded by the exogenous mRNA has an amino acid sequence that is at least 95% identical to a first protein, and the one or more first inhibitory RNAs do not comprise a nucleic acid having a sufficient complementary sequence to hybridize to the exogenous mRNA and inhibit the expression of the exogenous mRNA. For example, the first region can be located in any suitable location. The first region can be located within the untranslated portion of the second region. The first region can be located in any untranslated portion of the nucleic acid, including, for example, an intron, a 5' or 3' untranslated region, and the like.

[0038] The region containing the inhibitory nucleic acid (e.g., the first region) can be located in any suitable location of the isolated nucleic acid. The region can be located in any untranslated portion of the nucleic acid, including, for example, an intron, a 5' or 3' untranslated region, and the like. In some cases, it may be desirable to place a region (e.g., the first region) upstream of the first codon of a nucleic acid sequence encoding a protein (such as the second region encoding the exogenous SOD1 protein coding sequence). For example, the region can be located between the first codon of the protein coding sequence and 2000 nucleotides upstream of the first codon. The region can be located between the first codon of the protein coding sequence and 1000 nucleotides upstream of the first codon. The region can be located between the first codon of the protein coding sequence and 500 nucleotides upstream of the first codon. The region can be located between the first codon of the protein coding sequence and 250 nucleotides upstream of the first codon. The region can be located between the first codon of the protein coding sequence and 150 nucleotides upstream of the first codon.

[0039] In some cases, it may be desirable to place a region (for example, a region encoding an inhibitory nucleic acid such as a first region) upstream of the polyA tail of the region encoding the exogenous SOD1 protein. For example, the region may be placed between the first base of the polyA tail and 2000 nucleotides upstream of the first base. The region may be placed between the first base of the polyA tail and 1000 nucleotides upstream of the first base. The region may be placed between the first base of the polyA tail and 500 nucleotides upstream of the first base. The region may be placed between the first base of the polyA tail and 250 nucleotides upstream of the first base. The region may be placed between the first base of the polyA tail and 150 nucleotides upstream of the first base. The region may be placed between the first base of the polyA tail and 100 nucleotides upstream of the first base. The region may be placed between the first base of the polyA tail and 50 nucleotides upstream of the first base. The region may be placed between the first base of the polyA tail and 20 nucleotides upstream of the first base. In some embodiments, the region is placed between the last nucleotide base of the promoter sequence and the first nucleotide base of the polyA tail sequence.

[0040] In some cases, the region encoding the inhibitory nucleic acid (for example, the first region) may be placed downstream of the last base of the polyA tail of the region encoding the exogenous SOD1 protein. The region may be between the last base of the polyA tail and the position of 2000 nucleotides downstream of the last base. The region may be between the last base of the polyA tail and the position of 1000 nucleotides downstream of the last base. The region may be between the last base of the polyA tail and the position of 500 nucleotides downstream of the last base. The region may be between the last base of the polyA tail and the position of 250 nucleotides downstream of the last base. The region may be between the last base of the polyA tail and the position of 150 nucleotides downstream of the last base. It should be understood that when an isolated nucleic acid encodes more than one miRNA, each miRNA can be placed at any suitable location within the construct. For example, the nucleic acid encoding the first miRNA can be placed in the intron of the region encoding the exogenous SOD1 protein, and the nucleic acid sequence encoding the second miRNA can be placed in another region (for example, between the protein-coding sequence and the first base of the polyA tail of the transgene).

[0041] In some embodiments, the isolated nucleic acid further comprises a nucleic acid sequence encoding one or more expression control sequences (such as, for example, a promoter). Expression control sequences include appropriate transcription start, termination, promoter, and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequences); sequences that enhance protein stability; and, if desired, sequences that enhance the secretion of the encoded product. Most expression control sequences, including constitutive, inducible, and / or tissue-specific promoters, are known in the art and may be utilized. "Promoter" refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, necessary to initiate specific transcription of a gene. The phrases "operably disposed," "under control," or "under transcriptional control" mean that the promoter is in the correct location and orientation with respect to the nucleic acid and controls the initiation of RNA polymerase and the expression of the gene.

[0042] For nucleic acids encoding proteins, the polyadenylation sequence is generally inserted after the transgene sequence and before the 3' AAV ITR sequence. rAAV constructs useful in the present disclosure may also contain an intron desirably positioned between the promoter / enhancer sequence and the transgene. One possible intron sequence is derived from SV-40 and is referred to as the SV-40 T intron sequence. Another vector element that may be used is an internal ribosome entry site (IRES). The IRES sequence is used to produce more than one polypeptide from a single gene transcript. The IRES sequence will be used to produce proteins containing more than one polypeptide chain. The selection of these and other common vector elements is conventional and many such sequences are available [see, for example, Sambrook et al., and the references cited therein, e.g., pages 3.18 - 3.26 and 16.17 - 16.27, and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989]. In some embodiments, the foot-and-mouth disease virus 2A sequence is incorporated into the polyprotein; this is a small peptide (approximately 18 amino acids in length) that has been shown to mediate cleavage of the polyprotein (Ryan, M D et al., EMBO, 1994; 4: 928 - 933; Mattion, N M et al., J Virology, November 1996; p. 8124 - 8127; Furler, S et al., Gene Therapy, 2001; 8: 864 - 873; and Halpin, C et al., The Plant Journal, 1999; 4: 453 - 459).The cleavage activity of the 2A sequence has hitherto been demonstrated in artificial systems including plasmids and gene therapy vectors (AAV and retroviruses) (Ryan, M D et al., EMBO, 1994; 4: 928-933; Mattion, N M et al., J Virology, November 1996; p. 8124-8127; Furler, S et al., Gene Therapy, 2001; 8: 864-873; and Halpin, C et al., The Plant Journal, 1999; 4: 453-459; de Felipe, P et al., Gene Therapy, 1999; 6: 198-208; de Felipe, P et al., Human Gene Therapy, 2000; 11: 1921-1931.; and Klump, H et al., Gene Therapy, 2001; 8: 811-817).

[0043] Examples of constitutive promoters include, without limitation, the Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), a cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, for example, Boshart et al, Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter (e.g., the CBA promoter), the phosphoglycerol kinase (PGK) promoter, and the EF1α promoter [Invitrogen]. In some embodiments, the promoter is the enhanced chicken β-actin promoter (CAG promoter). In some embodiments, the promoter is the H1 promoter or the U6 promoter.

[0044] Inducible promoters allow for the regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, for example the acute phase, the specific differentiation state of the cell, or only in replicating cells. Inducible promoters and induction systems are available from a variety of commercial sources including, without limitation, Invitrogen, Clontech, and Ariad. Many other systems have also been described and can be readily selected by those skilled in the art. Examples of inducible promoters regulated by exogenously supplied promoters include the zinc-inducible sheep metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088); the ecdyson insect promoter (No et al, Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline repression system (Gossen et al, Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline induction system (see also Gossen et al, Science, 268:1766-1769 (1995), and Harvey et al, Curr. Opin. Chem. Biol., 2:512-518 (1998)), the RU486 induction system (Wang et al, Nat. Biotech., 15:239-243 (1997) and Wang et al, Gene Ther., 4:432-441 (1997)) and the rapamycin induction system (Magari et al, J. Clin. Invest., 100:2865-2872 (1997)). Still other types of inducible promoters that may be useful in this context are those regulated by a specific physiological state, for example temperature, the acute phase, the specific differentiation state of the cell, or only in replicating cells.

[0045] In another aspect, a native promoter for SOD1 (e.g., SEQ ID NO: 16) will be used. A native promoter may be preferred when it is desired that the expression of the transgene mimic native expression. A native promoter may be used when the expression of the transgene must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to specific transcriptional stimuli. In a further aspect, other native expression control elements, such as enhancer elements, polyadenylation sites, or Kozak consensus sequences, may also be used to mimic native expression.

[0046] In some embodiments, the regulatory sequences confer tissue-specific gene expression ability. In some cases, the tissue-specific regulatory sequences bind to tissue-specific transcription factors that induce transcription in a tissue-specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are well known in the art. Exemplary tissue-specific regulatory sequences include, but are not limited to, the following tissue-specific promoters: liver-specific thyroxine-binding globulin (TBG) promoter, insulin promoter, glucagon promoter, somatostatin promoter, pancreatic polypeptide (PPY) promoter, synapsin-1 (Syn) promoter, creatine kinase (MCK) promoter, mammalian desmin (DES) promoter, α-myosin heavy chain (a-MHC) promoter, or cardiac troponin T (cTnT) promoter.Other exemplary promoters include the beta-actin promoter, hepatitis B virus core promoter, Sandig et al., Gene Ther., 3:1002-9 (1996); alpha-fetoprotein (AFP) promoter, Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)), bone osteocalcin promoter (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)); bone sialoprotein promoter (Chen et al., J. Bone Miner. Res., 11:654-64 (1996)), CD2 promoter (Hansal et al., J. Immunol., 161:1063-8 (1998)); immunoglobulin heavy chain promoter; T cell receptor alpha chain promoter, of neurons, for example neuron-specific, enolase (NSE) promoter (Andersen et al., Cell. Mol. Neurobiol., 13:503-15 (1993)), neurofilament light chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)), and neuron-specific vgf gene promoter (Piccioli et al., Neuron, 15:373-84 (1995)), and also include those that will be apparent to those skilled in the art among many others.

[0047] Aspects of the disclosure relate to isolated nucleic acids comprising more than one promoter (e.g., 2, 3, 4, or 5 or more promoters). For example, in the context of a construct having a transgene comprising a first region encoding an inhibitory RNA (e.g., miRNA) and a second region encoding an exogenous SOD1 protein, it may be desired to drive the expression of the inhibitory RNA coding region using a first promoter sequence (e.g., a first promoter sequence operably linked to the inhibitory nucleic acid coding region), and to drive the expression of the exogenous SOD1 coding region with a second promoter sequence (e.g., a second promoter sequence operably linked to the exogenous SOD1 coding region). Generally, the first promoter sequence and the second promoter sequence can be the same promoter sequence or different promoter sequences. In some aspects, the first promoter sequence (e.g., a promoter driving the expression of a protein coding region) is an RNA polymerase III (pol III) promoter sequence. Non-limiting examples of pol III promoter sequences include U6 and H1 promoter sequences. In some aspects, the second promoter sequence (e.g., a promoter sequence driving the expression of exogenous SOD1 RNA) is an RNA polymerase II (pol II) promoter sequence. Non-limiting examples of pol II promoter sequences include the chicken beta-actin promoter (CBA), T7, T3, SP6, RSV, and cytomegalovirus promoter sequences. In some aspects, the pol III promoter sequence drives the expression of an inhibitory RNA (e.g., miRNA) coding region. In some aspects, the pol II promoter sequence drives the expression of a protein coding region. As further described below, the isolated nucleic acid can include inverted terminal repeats (ITRs) of an AAV serotype selected from the group consisting of AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11, and variants thereof.

[0048] Multicistronic construct Some aspects of the present invention provide a multi-cistronic (e.g., bicistronic) expression construct that includes two or more expression cassettes in various configurations. In different embodiments, multi-cistronic (e.g., bicistronic) expression constructs are provided in which the expression cassettes are arranged in different ways. For example, in some embodiments, a multi-cistronic expression construct is provided in which a first expression cassette is arranged adjacent to a second expression cassette. In some embodiments, a multi-cistronic expression construct is provided in which the first expression cassette includes an intron and the second expression cassette is arranged within the intron of the first expression cassette. In some embodiments, the second expression cassette arranged within the intron of the first expression cassette includes a promoter and a nucleic acid sequence encoding a gene product operably linked to the promoter.

[0049] In different embodiments, multi-cistronic (e.g., bicistronic) expression constructs are provided in which the expression cassettes are oriented in different ways. For example, in some embodiments, a multi-cistronic expression construct is provided in which the first expression cassette is in the same orientation as the second expression cassette. In some embodiments, a multi-cistronic expression construct is provided that includes first and second expression cassettes in opposite orientations. The term "orientation" as used herein in connection with an expression cassette refers to the directional characteristics of a given cassette or structure. In some embodiments, an expression cassette encompasses a 5' promoter of a coding nucleic acid sequence and transcription of the coding nucleic acid sequence proceeds from the 5' end to the 3' end of the sense strand, making this a directional cassette (e.g., 5'-promoter / (intron) / coding sequence-3'). Since virtually all expression cassettes are directional in this sense, one of ordinary skill in the art can readily determine the orientation of a given expression cassette in relation to a second nucleic acid structure, e.g., a second expression cassette, a viral genome, or, if the cassette is included in an AAV structure, in relation to the AAV ITR.

[0050] For example, if a given nucleic acid construct contains two expression cassettes in the configuration 5'-promoter1 / coding sequence1---promoter2 / coding sequence2-3',

Chem.

Chem.

[0051] In another example, when the expression cassette is included in an AAV construct, the cassette can be in either the same orientation as the AAV ITR (such as the structure shown in Figure 5, for example) or the opposite orientation. The AAV ITR has a directionality. For example, the mutant 5' ITR illustrated in Figure 5 is in the same orientation as the expression cassette encoding the H1 promoter / inhibitory RNA, but will be in the opposite orientation to the 3' ITR if both the ITR and the expression cassette are on the same nucleic acid strand.

[0052] rAAV vector The isolated nucleic acid of the present invention can be a recombinant adeno-associated virus (AAV) vector (rAAV vector). In some embodiments, the isolated nucleic acid described by the present disclosure includes a region (e.g., a first region) containing a first adeno-associated virus (AAV) inverted terminal repeat (ITR) or a variant thereof. The isolated nucleic acid (e.g., a recombinant AAV vector) can be packaged into a capsid protein, administered to a subject, and / or delivered to a selected target cell. A "recombinant AAV (rAAV) vector" typically consists of at least a transgene and its regulatory sequences, and 5' and 3' AAV inverted terminal repeats (ITRs). The transgene can include one or more regions encoding one or more inhibitory RNAs (e.g., miRNA) that target the endogenous mRNA of the subject, as disclosed elsewhere herein. The transgene can also include a region encoding, for example, a protein and / or an expression control sequence (e.g., a polyA tail), as described elsewhere in the present disclosure.

[0053] Generally, the ITR sequences are about 145 base pairs (bp) in length. Preferably, the entire sequence encoding substantially the ITRs is used in the molecule, although some minor modifications of these sequences are tolerated. The ability to modify these ITR sequences is within the skill of the art. (See, for example, texts such as Sambrook et al., "Molecular Cloning. A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J Virol., 70:520 532 (1996)). An example of such a molecule used in the present invention is a "cis-acting" plasmid containing a selected transgene sequence and a transgene in which the associated regulatory elements are flanked by 5' and 3' AAV ITR sequences. The AAV ITR sequences can be obtained from any known AAV, including currently identified mammalian AAV species. In some embodiments, the isolated nucleic acid (e.g., rAAV vector) comprises at least one ITR having a serotype selected from AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11, and variants thereof. In some embodiments, the isolated nucleic acid comprises a region encoding the AAV2 ITR (e.g., the first region).

[0054] In some embodiments, the isolated nucleic acid further comprises a region comprising a second AAV ITR (e.g., a second region, a third region, a fourth region, etc.). In some embodiments, the second AAV ITR has a serotype selected from AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11, and variants thereof. In some embodiments, the second ITR is a mutant ITR lacking a functional terminal resolution site (TRS). The term "lacking a terminal resolution site" can refer to an AAV ITR comprising a mutation (e.g., a sense mutation such as a non-synonymous mutation or a missense mutation) that inactivates the function of the terminal resolution site (TRS) of the ITR, or a truncated AAV ITR lacking a nucleic acid sequence encoding a functional TRS (e.g., a ΔTRS ITR). Without wishing to be bound by any particular theory, an rAAV vector comprising an ITR lacking a functional TRS generates, for example, a self-complementary rAAV vector as described in McCarthy (2008) Molecular Therapy 16(10):1648-1656.

[0055] In addition to the major elements identified above for the recombinant AAV vector, the vector also includes conventional control elements operably linked to the transgene element in a manner that allows for its transcription, translation, and / or expression in cells transfected with the vector or cells infected with the virus produced by the invention. As used herein, an "operably linked" sequence includes both expression control sequences contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest. Expression control sequences include appropriate transcription initiation, termination, promoter, and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequences); sequences that enhance protein stability; and, when desired, sequences that enhance the secretion of the encoded product. Many expression control sequences, including promoters that are natural, constitutive, inducible, and / or tissue-specific, are known in the art and can be utilized.

[0056] As used herein, a nucleic acid sequence (e.g., a coding sequence) and a regulatory sequence are said to be operably linked when they are covalently linked in such a way as to place the expression or transcription of the nucleic acid sequence under the influence or control of the regulatory sequence. When it is desired to translate a nucleic acid sequence into a functional protein, the introduction of a promoter in the 5' regulatory sequence results in the transcription of the coding sequence, and the nature of the linkage between the two DNA sequences is such that (1) it does not result in the introduction of a frameshift mutation, (2) it does not interfere with the ability of the promoter region to direct the transcription of the coding sequence, or (3) it does not interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, the two DNA sequences are said to be operably linked if the promoter region can effect the transcription of its DNA sequence and the resulting transcript can be translated into the desired protein or polypeptide. Similarly, two or more coding regions are operably linked when they are linked in such a way that their transcription from a common promoter results in the expression of two or more proteins that are translated in-frame. In some embodiments, the operably linked coding sequences result in a fusion protein.

[0057] Recombinant adeno-associated virus (rAAV) In some aspects, the disclosure provides an isolated AAV. As used herein with respect to AAV, the term "isolated" refers to an AAV that has been artificially produced or obtained. The isolated AAV may be produced using recombinant methods. Such AAVs are referred to herein as "recombinant AAVs" or "rAAVs". Recombinant AAVs (rAAVs) preferably have tissue-specific targeting ability such that the nuclease and / or transgene of the rAAV is specifically delivered to one or more predetermined tissues. The AAV capsid is an important factor in determining these tissue-specific targeting abilities. Thus, an rAAV having an appropriate capsid for the tissue to be targeted can be selected.

[0058] Methods for obtaining recombinant AAVs with the desired capsid protein are well known in the art. (See, e.g., US2003 / 0138772, the contents of which are incorporated herein by reference in their entirety). Typically, the method involves culturing a host cell containing a nucleic acid sequence encoding an AAV capsid protein; a functional rep gene; a recombinant AAV vector composed of AAV inverted terminal repeats (ITRs) and a transgene; and helper functions sufficient to permit packaging of the recombinant AAV vector into the AAV capsid protein. In some embodiments, the capsid protein is a structural protein encoded by the AAV cap gene. AAV contains three capsid proteins, virion proteins 1-3 (designated VP1, VP2, and VP3), all of which are transcribed from a single cap gene via alternative splicing. In some embodiments, the molecular weights of VP1, VP2, and VP3 are approximately 87 kDa, approximately 72 kDa, and approximately 62 kDa, respectively. In some embodiments, upon translation, the capsid protein forms a 60-mer spherical protein shell around the viral genome. In some embodiments, the function of the capsid protein is to protect the viral genome, deliver the genome, and interact with the host. In some aspects, the capsid protein delivers the viral genome to the host in a tissue-specific manner.

[0059] In some embodiments, the AAV capsid protein is of an AAV serotype selected from the group consisting of AAV2, AAV3, AAV4, AAV5, AAV6, AAV8, AAVrh8, AAV9, AAV10, AAVrh.10, AAV AAV.PHB, and any variants of the foregoing. In some embodiments, the AAV capsid protein is of a serotype derived from a non-human primate animal, such as the AAVrh10 serotype. In some embodiments, the AAV capsid protein is of the AAV9 serotype.

[0060] The components to be cultured in a host cell for packaging an rAAV vector into an AAV capsid can be provided to the host cell in trans. Alternatively, any one or more of the required components (e.g., a recombinant AAV vector, a rep sequence, a cap sequence, and / or a helper function) can be provided by a stable host cell that has been engineered to contain one or more of the required components using methods known to those of skill in the art. Most preferably, such a stable host cell will contain the required component(s) under the control of an inducible promoter. However, the required component(s) may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein in the context of considerations of regulatory elements suitable for use with a transgene. In yet another alternative, a selected stable host cell may contain a selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters. For example, stable host cells can be generated that are derived from 293 cells (which contain an E1 helper function under the control of a constitutive promoter), but contain a rep protein and / or a cap protein under the control of an inducible promoter. Still other stable host cells can be generated by those of skill in the art.

[0061] In some embodiments, the disclosure relates to a host cell comprising a nucleic acid comprising a sequence encoding an inhibitory nucleic acid targeting endogenous SOD1 and a sequence encoding an exogenous protein (e.g., an exogenous SOD1 protein, optionally a "boosted" exogenous SOD1 protein). In some embodiments, the disclosure relates to a composition comprising a host cell as described above. In some embodiments, the composition comprising the host cell above further comprises a cryopreservative.

[0062] The recombinant AAV vectors, rep sequences, cap sequences, and helper functions required to produce the rAAV of the present disclosure can be delivered to packaging host cells using any suitable genetic element (vector). The genetic element selected can be delivered by any suitable method, including the methods described herein. The methods used to construct any aspect of the present disclosure are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. Similarly, methods for generating rAAV virions are well known, and the choice of suitable method is not limiting to the present disclosure. See, for example, K. Fisher et al., J. Virol., 70:520-532 (1993) and U.S. Patent No. 5,478,745.

[0063] In some embodiments, recombinant AAV can be produced using a triple transfection method (described in detail in U.S. Patent No. 6,001,650). Typically, recombinant AAV is produced by transfecting a host cell with a recombinant AAV vector (containing the transgene) to be packaged into AAV particles, an AAV helper function vector, and an accessory function vector. The AAV helper function vector encodes "AAV helper function" sequences (i.e., rep and cap) that function in trans for more productive AAV replication and capsid formation. Preferably, the AAV helper function vector does not generate any detectable wild-type AAV virions (i.e., AAV virions containing functional rep and cap genes), but rather promotes efficient AAV vector production. Non-limiting examples of vectors suitable for use with the present disclosure include pHLP19 described in U.S. Patent No. 6,001,650, and the pRep6cap6 vector described in U.S. Patent No. 6,156,303 (both of which are incorporated herein by reference in their entirety). The accessory function vector encodes nucleotide sequences for non-AAV-derived viral functions and / or cellular functions (i.e., "accessory functions") upon which AAV depends for replication. Accessory functions include those functions required for AAV replication, but are not limited to, activation of AAV gene transcription, stage-specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and those moieties involved in AAV capsid assembly. Viral-based accessory functions can be derived from any of the known helper viruses, such as adenovirus, herpesvirus (other than herpes simplex virus type 1), and vaccinia virus.

[0064] In some aspects, the disclosure provides a transfected host cell. The term "transfection" is used to refer to the uptake of foreign DNA by a cell, and a cell is "transfected" when foreign DNA has been introduced inside the cell membrane. Numerous transfection techniques are generally known in the art. See, for example, Graham et al. (1973) Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, laboratory manual, Cold Spring Harbor Laboratories, New York, Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu et al. (1981) Gene 13:197. Such techniques can be used to introduce one or more foreign nucleic acids, such as nucleotide integration vectors and other nucleic acid molecules, into a suitable host cell.

[0065] "Host cell" refers to any cell that either encapsulates or is capable of encapsulating a substance of interest. Often the host cell is a mammalian cell. The host cell may be used as a recipient of an AAV helper construct, an AAV mini-gene plasmid, an accessory function vector, or other transfer DNA associated with the production of recombinant AAV. The term includes progeny of the transfected original cell. Thus, "host cell" as used herein may also refer to a cell into which a foreign DNA sequence has been transfected. It is understood that the progeny of a single parental cell need not be completely identical to the original parent, either morphologically or in the genome or total DNA complement, due to natural, accidental, or intentional mutations. As used herein, the term "cell line" refers to a population of cells capable of continuous or sustained growth and division in vitro. Often, a cell line is a clonal population derived from a single progenitor cell. It is further known in the art that spontaneous or induced changes may occur in the karyotype during the storage or transfer of such clonal populations. Thus, cells derived from the cell line referred to may not be exactly identical to the progenitor cells or cultures, and the cell line referred to encompasses such variants. As used herein, the term "recombinant cell" refers to a cell into which an exogenous DNA segment, such as a DNA segment that leads to the transcription of a biologically active polypeptide or the production of a biologically active nucleic acid such as RNA, has been introduced.

[0066] As used herein, the term "vector" encompasses any genetic element that is capable of replicating when associated with appropriate control elements and of transferring a gene sequence between cells, such as, for example, plasmids, phages, transposons, cosmids, chromosomes, artificial chromosomes, viruses, virions, and the like. Thus, the term includes cloning and expression vehicles, as well as viral vectors. In some embodiments, useful vectors are contemplated to be those in which the nucleic acid segment to be transcribed is positioned under the transcriptional control of a promoter. A "promoter" refers to a DNA sequence recognized by the synthetic machinery of a cell or an introduced synthetic machinery required to initiate specific transcription of a gene. By the phrase "under control" or "under transcriptional control," "operatively positioned" means that the promoter is in the correct location and orientation with respect to the nucleic acid that controls the initiation of RNA polymerase and the expression of the gene. The term "expression vector or construct" also means any type of genetic construct that contains a nucleic acid in which some or all of the nucleic acid encoding the sequence is capable of being transcribed. In some embodiments, expression includes transcription of a nucleic acid, such as a transcribed gene, to produce a biologically active polypeptide product or a functional RNA (by way of example, a guide RNA) from the nucleic acid. The above methods for packaging recombinant vectors into the AAV capsids desired for producing the rAAV of the present disclosure are not intended to be limiting, and other suitable methods will be apparent to those skilled in the art.

[0067] Mode of administration The isolated nucleic acids and rAAVs of the present disclosure can be delivered to cells or a subject in a composition according to any suitable method known in the art. For example, rAAV suspended preferably in a physiologically compatible carrier (i.e., a composition) can be administered to a subject, i.e., a human, mouse, rat, cat, dog, sheep, rabbit, horse, cow, goat, pig, guinea pig, hamster, chicken, turkey, or a non-human primate animal (e.g., a macaque). In some embodiments, the host animal does not include humans.

[0068] Delivery of rAAV to a mammalian subject can be, for example, by intramuscular injection or by administration to the bloodstream of the mammalian subject. Administration to the bloodstream can be by injection into a vein, artery, or any other vascular conduit. In some embodiments, rAAV is administered to the bloodstream by isolated limb perfusion, a technique well known in the surgical arts that essentially enables one of ordinary skill in the art to isolate a limb from the systemic circulation prior to administration of the rAAV virions. Variants of the isolated limb perfusion technique described in U.S. Patent No. 6,177,403 can also be used by one of ordinary skill in the art to administer virions to the vasculature of an isolated limb to potentially enhance transduction into muscle cells or tissues. Further, in certain instances, it may be desirable to deliver the virions to the CNS of the subject. "CNS" means all cells and tissues of the brain and spinal cord of a vertebrate. Thus, the term includes, but is not limited to, neurons, glial cells, astrocytes, cerebrospinal fluid (CSF), interstitial spaces, bone, cartilage, and the like. Recombinant AAV can be delivered directly to the CNS or brain using neurosurgical techniques known in the art such as stereotactic injection, using a needle, catheter, or related device, for example, by injection into the ventricular region, as well as the striatum (e.g., the caudate nucleus or the putamen of the striatum), spinal cord, and neuromuscular junction, or cerebellar lobules (see, e.g., Stein et al., J Virol 73:3424-3429, 1999; Davidson et al., PNAS 97:3428-3432, 2000; Davidson et al., Nat. Genet. 3:219-223, 1993; and Alisky and Davidson, Hum. Gene Ther. 11:2315-2329, 2000). In some embodiments, the rAAV described in the present disclosure is administered by intravenous injection. In some embodiments, rAAV is administered by intracerebral injection. In some embodiments, rAAV is administered by intrathecal injection. In some embodiments, rAAV is administered by intracerebral injection. In some embodiments, rAAV is delivered by intracranial injection. In some embodiments, rAAV is delivered by cisternal injection.In some embodiments, rAAV is delivered by intracerebroventricular injection.

[0069] Aspects of the disclosure relate to compositions comprising recombinant AAVs comprising a capsid protein and a nucleic acid encoding a transgene, wherein the transgene comprises a nucleic acid sequence encoding one or more miRNAs. In some embodiments, each miRNA comprises, or is encoded by, the sequence set forth in SEQ ID NO: 3 and / or 4 (miR-SOD-127). In some embodiments, each miRNA comprises, or is encoded by, the sequence set forth in SEQ ID NO: 5 and / or 6. In some embodiments, the nucleic acid further comprises AAV ITRs. In some embodiments, the rAAV comprises, or is part of, an rAAV vector represented by the sequence set forth in any one of SEQ ID NOs: 8-15 (AAV vector sequences). In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the compositions of the disclosure may comprise rAAV alone or in combination with one or more other viruses (e.g., a second rAAV encoding one or more different transgenes). In some embodiments, the composition comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different rAAVs (each having one or more different transgenes).

[0070] Suitable carriers can be readily selected by one of ordinary skill in the art considering the indication to which the rAAV is directed. For example, one suitable carrier includes saline that may be formulated with various buffer solutions (e.g., phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The choice of carrier is not limiting of the disclosure. Optionally, in addition to rAAV and the carrier(s), the compositions of the present disclosure may contain other conventional pharmaceutical ingredients such as preservatives or chemical stabilizers. Exemplary suitable preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Exemplary suitable chemical stabilizers include gelatin and albumin.

[0071] rAAV is administered in an amount sufficient to transfect the cells of the desired tissue without undue adverse effects and to provide sufficient levels of gene transfer and expression. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to the selected organ (e.g., intraportal delivery to the liver), oral, inhalation (including nasal and intratracheal delivery), intraocular, intravenous, intramuscular, subcutaneous, intradermal, intratumoral, and other parenteral routes of administration. Routes of administration may be combined if desired. The unit of dosage of rAAV virions required to achieve a specific “therapeutic effect,” e.g., the dosage in terms of genome copies per kilogram body weight (GC / kg), will vary based on multiple factors including, but not limited to: the route of administration of the rAAV virions, the level of gene or RNA expression required to achieve the therapeutic effect, the specific disease or disorder being treated, and the stability of the gene or RNA product. One of ordinary skill in the art can readily determine the rAAV virion dosage range for treating a patient having a specific disease or disorder based on the foregoing factors as well as other factors well known in the art.

[0072] An effective amount of rAAV is an amount sufficient to target infect the animal and target the desired tissue. In some embodiments, an effective amount of rAAV is an amount sufficient to produce a stable somatic gene transfer animal model. The effective amount depends primarily on factors such as the species, age, weight, health status, and tissue to be targeted of the subject, and thus may vary between animals and tissues. For example, an effective amount of rAAV is generally about 10 9 ~1016 It ranges from about 1 ml to about 100 ml of a solution containing genomic copies. In some cases, about 10 11 ~10 13 The dosage between rAAV genomic copies is appropriate. In one embodiment, 10 12 or 10 13 rAAV genomic copies are effective for targeting CNS tissue. In some cases, stable transgenic animals are produced by multiple doses of rAAV.

[0073] In some embodiments, the dose of rAAV is administered to the subject no more than once per calendar day (e.g., 24 hours). In some embodiments, the dose of rAAV is administered to the subject no more than once per 2, 3, 4, 5, 6, or 7 calendar days. In some embodiments, the dose of rAAV is administered to the subject no more than once per calendar week (e.g., 7 calendar days). In some embodiments, the dose of rAAV is administered to the subject no more than once every other week (e.g., once every 2 calendar weeks). In some embodiments, the dose of rAAV is administered to the subject no more than once per calendar month (e.g., once every 30 calendar days). In some embodiments, the dose of rAAV is administered to the subject no more than once every 6 calendar months. In some embodiments, the dose of rAAV is administered to the subject no more than once per calendar year (e.g., 365 days or 366 days in a leap year).

[0074] In some embodiments, the rAAV composition is formulated to reduce aggregation of AAV particles in the composition, specifically in a composition where rAAV is present at a high concentration (e.g., ~10 13 GC / ml or higher). Methods for reducing aggregation of rAAV are well known in the art and may include, for example, addition of surfactants, pH adjustment, salt concentration adjustment, etc. (See, e.g., Wright FR, et al., Molecular Therapy (2005) 12, 171-178, the entire contents of which are incorporated herein by reference.) The formulation of pharmaceutically acceptable excipients and carrier solutions is well known to those of ordinary skill in the art, as is the development of suitable dosing and treatment regimens for using the specific compositions described herein in various treatment regimens.

[0075] Typically, these formulations may contain at least about 0.1% or more of the active compound, although the percentage of the active ingredient(s) can of course vary, and may conveniently be between about 1 or 2% and about 70% or 80% or more of the total formulation weight or volume. Of course, the amount of the active compound in each therapeutically useful composition may be prepared such that a suitable dosage is obtained for any unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, and other pharmacological considerations will be contemplated by those of ordinary skill in the art in preparing such pharmaceutical formulations. With this in mind, various dosages and treatment regimens may be desired. In certain circumstances, it may be desirable to deliver the rAAV-based therapeutic construct as a pharmaceutically suitable composition disclosed herein, subcutaneously, intra-pancreatically, intranasally, parenterally, intravenously, intramuscularly, intrathecally, or orally, intraperitoneally, or by inhalation. In some embodiments, modes of administration as described in U.S. Patent Nos. 5,543,158; 5,641,515 and 5,399,363 (each specifically incorporated herein by reference in its entirety) may be used to deliver rAAV. In some embodiments, the preferred mode of administration is by portal vein injection.

[0076] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the immediate preparation of sterile injectable solutions or dispersions. The dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, as well as in oils. Under normal conditions of storage and use, these preparations contain preservatives to prevent the growth of microorganisms. In many cases, the form is sterile and fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyols (such as glycerol, propylene glycol, and liquid polyethylene glycols), suitable mixtures thereof, and / or vegetable oils. Suitable fluidity may be maintained, for example, by the use of coating agents such as lecithin, by the maintenance of the required particle size in the case of dispersion media, and by the use of surfactants. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable composition can be brought about by the use in the composition of agents that delay absorption, for example, aluminum monostearate and gelatin.

[0077] For administration of an injectable aqueous solution, for example, the solution may be suitably buffered if necessary, and the liquid diluent is first made isotonic with sufficient saline or glucose. These specific aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, the sterile aqueous media that can be used will be known to those skilled in the art. For example, one dosage may be either dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous infusion fluid or injected at the proposed injection site (see, for example, "Remington's Pharmaceutical Sciences", 15th Edition, pages 1035 - 1038 and 1570 - 1580). Some variations in dosage will necessarily occur depending on the condition of the host. The person responsible for administration will in any event determine the appropriate dosage for the individual host.

[0078] The sterile injectable solution is prepared by incorporating the required amount of the active rAAV, along with the various other ingredients listed herein (when so required), into a suitable solvent, followed by filtration sterilization. Generally, the dispersion is prepared by incorporating the various sterile active ingredients into a sterile vehicle containing a base dispersion medium and the required other ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying techniques and lyophilization techniques, which produce the powder of the active ingredient, with any desired additional ingredients, from its solution that has been previously sterile filtered.

[0079] The rAAV compositions disclosed herein may also be formulated in neutral or salt form. Pharmaceutically acceptable salts include acid addition salts (formed with the free amino groups of the protein), as well as acid addition salts formed with inorganic acids such as hydrochloric acid or phosphoric acid, or organic acids such as acetic acid, oxalic acid, tartaric acid, mandelic acid, etc. Salts formed with free carboxyl groups may also be derived from inorganic bases such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide or iron hydroxide, and organic bases such as isopropylamine, trimethylamine, histidine, procaine, etc. When formulated, the solution will be administered in a manner compatible with the dosage formulation and in an amount therapeutically effective. The formulations are readily administered in various dosage forms such as injectable solutions, drug release capsules, etc.

[0080] As used herein, "carrier" includes any solvent, dispersion medium, vehicle, coating agent, diluent, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, etc. The use of such media and agents for pharmaceutically active substances is well known in the art. Auxiliary active ingredients may also be incorporated into the composition. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce allergic or similar adverse reactions when administered to a host. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc. may be used for the introduction of the compositions of the present disclosure into suitable host cells. In particular, the transgene delivered by the rAAV vector may be formulated for delivery encapsulated in any of lipid particles, liposomes, vesicles, nanospheres, or nanoparticles, or the like.

[0081] Such formulations may also be preferred for the introduction of pharmaceutically acceptable formulations of the nucleic acids or rAAV constructs disclosed herein. The formation and use of liposomes are generally known to those skilled in the art. In recent years, liposomes with improved serum stability and circulation half-life have been developed (U.S. Patent No. 5,741,516). In addition, various methods of liposomes and liposome-like preparations as potential drug carriers have been described (U.S. Patents Nos. 5,567,434; 5,552,157; 5,565,213; 5,738,868 and 5,795,587). Liposomes have generally been successfully used with numerous cell types that are resistant to transfection by other procedures. In addition, liposomes are not restricted by the DNA lengths typical of virus-based delivery systems. Liposomes have been effectively used to introduce genes, drugs, radiotherapeutic agents, viruses, transcription factors, and allosteric effectors into various cultured cell lines and animals. In addition, several successful clinical trials have been completed to test the effectiveness of liposome-mediated drug delivery.

[0082] Liposomes are formed from phospholipids dispersed in an aqueous medium and spontaneously form multilamellar concentric bilayer vesicles (also called multilamellar vesicles (MLV)). MLV generally have diameters ranging from 25 nm to 4 μm. Sonication of MLV results in the formation of small unilamellar vesicles (SUV) with diameters in the range of 200 - 500 angstroms, which contain an aqueous solution in the core. Alternatively, a nanocapsule formulation of rAAV may be used. Nanocapsules can generally encapsulate substances in a stable and reproducible manner. Such ultrafine particles (which are approximately 0.1 μm in size) should be designed using polymers that can be degraded in vivo in order to avoid side effects due to intracellular polymeric overloading. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use.

[0083] In addition to the delivery methods described above, the following techniques are also contemplated as alternative methods for delivering rAAV compositions to a host. Sonophoresis (i.e., ultrasound) has been used and described in U.S. Patent No. 5,656,016 as a device for enhancing the rate and effectiveness of drug penetration within and through the circulatory system. Other contemplated options for drug delivery are intraosseous injection (U.S. Patent No. 5,779,708), microchip devices (U.S. Patent No. 5,797,898), ophthalmic formulations (Bourlais et al., 1998), transdermal matrices (U.S. Patents Nos. 5,770,219 and 5,783,208), and feedback-controlled delivery (U.S. Patent No. 5,697,899).

[0084] Method of Use Provided herein are methods for inhibiting the expression of genes such as SOD1 associated with FTD and / or ALS. In some embodiments, the methods described by the present disclosure are useful for treating subjects having or suspected of having ALS and / or FTD. As used herein, "treating" or "treatment" refers to (a) preventing or delaying the onset of a neurodegenerative disease (e.g., ALS / FTD, etc.); (b) reducing the severity of ALS / FTD; (c) reducing or preventing the onset of symptoms characteristic of ALS / FTD; and / or (d) preventing the worsening of symptoms characteristic of ALS / FTD.

[0085] In some embodiments, methods are provided for inhibiting endogenous SOD1 protein expression in a subject (e.g., the central nervous system (CNS) of the subject). In some embodiments, the methods comprise administering to the subject (e.g., administering to the CNS of the subject) an inhibitory nucleic acid that targets endogenous SOD1 mRNA and an isolated nucleic acid or rAAV engineered to express an exogenous SOD1 mRNA transcript that is resistant to the inhibitory nucleic acid. In some embodiments, the subject has or is suspected of having FTD or ALS (e.g., identified as having an SOD1 gene with one or more mutations that result in a toxic gain of function, and / or exhibiting one or more signs or symptoms of ALS, such as by a diagnostic DNA test). In some embodiments, the methods comprise administering to the subject an effective amount of recombinant adeno-associated virus (rAAV) encapsulating a nucleic acid engineered to express an inhibitory nucleic acid that targets endogenous SOD1 mRNA in the cells of the subject. In some embodiments, the inhibitory nucleic acid comprises or is encoded by the sequence set forth in SEQ ID NO: 3 (GACGTACCTAAGGTACAAGTA) and / or 4 (miR-SOD-127). In some embodiments, the inhibitory nucleic acid comprises or is encoded by the sequence set forth in SEQ ID NO: 5 and / or 6.

[0086] In some embodiments, methods are provided for inhibiting SOD1 expression in a cell. In some embodiments, the methods comprise delivering to the cell an isolated nucleic acid or rAAV as described by the present disclosure, wherein the inhibitory RNA comprises or is encoded by a miRNA comprising 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the sequence set forth in SEQ ID NO: 3 (GACGTACCTAAGGTACAAGTA) and / or 4 (CTGCATGGATTCCATGTTCAT) or a complementary sequence thereof.

[0087] Accordingly, the specific methods provided herein include administering to a subject an effective amount of recombinant adeno-associated virus (rAAV) that encompasses any of the recombinant nucleic acids disclosed herein. Generally, an "effective amount" of rAAV refers to an amount sufficient to induce a desired biological response. In some embodiments, the effective amount refers to an amount of rAAV effective to transduce cells or tissues ex vivo. In other embodiments, the effective amount refers to an amount of rAAV effective for direct administration to a subject. As will be understood by those skilled in the art, the effective amount of the recombinant AAV of the invention will vary depending on factors such as the desired biological endpoint, the pharmacokinetics of the expression product, the condition being treated, the mode of administration, and the subject. Typically, rAAV is administered with a pharmaceutically acceptable carrier as described elsewhere in this disclosure.

[0088] In some examples, after administration of rAAV, at least one clinical outcome parameter or biomarker associated with FTD or ALS (e.g., intranuclear G4C2 RNA foci, RAN protein expression, etc.) is evaluated in the subject. Typically, the clinical outcome parameter or biomarker evaluated after administration of rAAV is compared to the clinical outcome parameter or biomarker determined at a time point prior to administration of rAAV to determine the efficacy of rAAV. In many cases, an improvement in the clinical outcome parameter or biomarker after rAAV administration indicates the efficacy of rAAV. Any suitable clinical outcome parameter or biomarker can be used. Typically, the clinical outcome parameter or biomarker indicates one or more signs of FTD or ALS. For example, in some embodiments, the clinical outcome parameter or biomarker can be endogenous SOD1 expression, memory loss, or the presence or absence of movement disorders such as instability, rigidity, slowness, spasticity, muscle weakness or dysphagia, aphasia and speech difficulties, muscle spasms (contractures) and cramps (including those of the extremities).

[0089] Kits and related compositions The recombinant nucleic acids, compositions, rAAV vectors, rAAVs, etc. described herein can, in some embodiments, be assembled into a medicament or a diagnostic or research kit to facilitate their use in therapeutic, diagnostic, or research applications. The kit can include one or more containers that house the components of the invention and instructions for use. Specifically, such a kit can include one or more agents described herein, as well as instructions that explain the intended use and the proper use of these agents. In one embodiment, the agents in the kit can be pharmaceutical formulations and dosages suitable for a particular use and method of administration of the agent. Kits for research purposes can include appropriate concentrations or amounts of components for performing various experiments.

[0090] The kit can be designed to facilitate the use of the methods described herein by researchers and can take many forms. Each composition of the kit can be provided, where applicable, in liquid form (e.g., a solution) or solid form (e.g., a dry powder). In some cases, some of the compositions can be configurable or otherwise processable (e.g., into an active form) by, for example, the addition of a suitable solvent or other species (e.g., water or cell culture medium), which can or cannot be provided with the kit. As used herein, "instructions" can define the components of the description and / or the promotion and typically include a written description on or associated with the packaging of the invention. The instructions can also include any oral or electronic instructions provided in any manner such that the user is clearly aware that the instructions should be associated with the kit, such as, for example, audio-visual (e.g., a videotape, a DVD, etc.), Internet, and / or web-based communication. The written instructions can be in a format specified by a government agency that regulates the manufacture, use, or sale of a pharmaceutical or biological product, and the instructions can also reflect the approval by an agency for the manufacture, use, or sale for animal administration.

[0091] The kit may include any one or more of the components described herein in one or more containers. As an example, in one aspect, the kit may include instructions for mixing one or more of the components of the kit and / or for isolating and mixing a sample for application to a subject. The kit may include a container containing the agent described herein. The agent may be in the form of a liquid, gel or solid (powder). The agent may be prepared aseptically, packaged in a syringe and transported refrigerated. Alternatively, it may be contained in a vial or other container for storage. The second container may have another agent prepared aseptically. Alternatively, the kit may include an active agent pre-mixed and transported in a syringe, vial, tube, or other container. The kit may have one or all of the components necessary for administering the agent to a subject, such as a syringe, topical application device, or IV needle tube and bag. Exemplary aspects of the invention will be described in more detail by the following examples. These aspects are illustrative of the invention, and those skilled in the art will recognize that they are not limited to the illustrative aspects.

[0092] Example Example 1 This example describes a dual-expression gene therapy vector that delivers a first construct engineered to express a synthetic microRNA that suppresses the expression of endogenous cytosolic Cu / Zn superoxide dismutase (SOD1) activity and that is linked to a second construct engineered to express wild-type SOD1 that is resistant to the synthetic microRNA.

[0093] The rationale for linking SOD1 silencing via AAVrh10 - anti - SOD1 - miRNA to the expression of WT SOD1 that is resistant to synthetic microRNA is based on two factors. First, the dismutase activity of the SOD1 protein has neuroprotective properties. Second, tissues in ALS cases where SOD1 is suppressed (specifically, motor neurons) are abnormal because they express both wild - type (WT) and mutant SOD1. Indeed, when SOD1 silencing studies are initiated after disease onset, motor neurons (and some non - neuronal cells) are already clearly observed to be pathological. In this context, eliminating the SOD1 dismutase activity conferred by WT SOD1 molecules (and also any dismutase activity arising from some mutant SOD1 proteins) is also to eliminate the potential neuroprotective effects conferred by that activity. Thus, the net effect on cells reflects the balance of two opposing factors: (a) silencing of the mutant protein and its neurotoxicity versus (b) elimination of the neuroprotective effects of SOD1 dismutase activity. In diseased motor neurons, it is thought that the net effect can further impair the survival rate of target cells despite the simultaneous decrease in the level of the mutant protein. Consistent with this finding, it should be noted that mice lacking intrinsic SOD1 activity do not develop severe ALS during normal development, but their motor neurons are highly sensitive to overlapping damage. Facial nerve injury in these SOD1 - negative mice results in a much more extensive loss of facial nerve than in WT mice. Moreover, in old age, these SOD1 - negative mice have been observed to develop a slowly progressive late - onset motor neuropathy.

[0094] The dual-expression gene constructs described by the present disclosure address the problem of loss of neuroprotective activity from SOD1 disproportionation. The arrangement of the gene expression cassettes in the constructs of the present disclosure allows for normal levels of SOD1 disproportionation activity (e.g., expression of WT SOD1), even when complete silencing of both the WT and mutant endogenous SOD1 alleles occurs. Thus, the net effect of the constructs described herein is a reduction in the level of mutant SOD1 protein (but not WT SOD1 protein), which is beneficial for SOD1-mediated ALS.

[0095] The dual-expression constructs of the present disclosure are constructed as follows: An AAV construct is made that expresses both an artificial miRNA targeting SOD1 and an SOD1 cDNA with silent base pair modifications that render it resistant to the artificial miRNA. This construct allows for simultaneous silencing of mutant SOD1 and enhanced expression of wild-type SOD1 from a single AAV vector. In some embodiments, the construct is bicistronic as shown in FIG. 1, where the construct has two promoters; for example, anti-SOD1 expression is driven by the H1 promoter and SOD1 cDNA expression is driven by the CBA promoter. Anti-SOD1-miR expression can also be driven by another Pol III promoter such as the U6 promoter, or by a Pol II promoter that restricts miRNA expression to a particular cell or organ type. The second part of the construct typically has a Pol II promoter (e.g., CBA in FIG. 1) that expresses the miRNA-resistant SOD1 cDNA. This second promoter can also be the endogenous SOD1 promoter, or another promoter such as the synapsin promoter if restricted expression of the SOD1 cDNA to a particular cell population is desired.

[0096] In some embodiments, the dual-functional vector is a single pol II promoter (e.g., CBA) that expresses both the artificial miR and the miR-resistant cDNA, as shown in FIG. 2. In this embodiment, the anti-SOD1-miR can be expressed from an intron within the SOD1 cDNA expression cassette or, alternatively, as part of the 3’UTR (or 5’UTR) of the mIR-resistant SOD1 cDNA expression cassette. Additional non-limiting examples of dual-functional vector constructs are shown in FIGS. 3-8 and described in SEQ ID NOs: 8-15. FIG. 9 shows a nucleic acid sequence alignment of the wild-type SOD1 coding sequence (SEQ ID NO: 1) with an example of an “enhanced” SOD1 coding sequence (SEQ ID NO: 7).

[0097] Sequence >Human SOD1 coding sequence (NCBI reference NM_000454.4) (SEQ ID NO: 1)

Chemical Structure

[0098] >SOD1 miR target sequence 5’-3’; Note that in some embodiments, “T” is replaced by “U” (SEQ ID NO: 2)

Chemical Structure

[0099] >SOD1 miR mature miRNA 5 ’- 3 ’; Note that in some embodiments, “T” is replaced by “U” (SEQ ID NO: 3)

Chemical Structure

[0100] >SOD-miR-127 mature miRNA 5’-3’; Note that in some embodiments, “T” is replaced by “U” (SEQ ID NO: 4)

Chemical Structure

[0101] >miR-SOD1 5'-3' strand (SEQ ID NO: 5); note that in some embodiments, "T" is replaced by "U"

Chemical formula

[0102] >miR-SOD1 5 ’- 3 ’ strand (SEQ ID NO: 6); note that in some embodiments, "T" is replaced by "U"

Chemical formula

[0103] >Enhanced SOD1 coding sequence (SEQ ID NO: 7); silent base pair mutations (bold) compared to the wild-type SOD1 coding sequence

Chemical formula

[0104] >2-cistronic H1-miR and CB-Sod1 sequence (SEQ ID NO: 8)

Chemical formula

Chemical formula

Chemical formula

[0105] >CB-anti-Sod1 miR and miRNA-resistant Sod1 sequence (SEQ ID NO: 9)

Chemical formula

Chemical formula

[0106] >Sequence of 2-cistronic H1-SOD1-miR-CB-SOD1 (SEQ ID NO: 10); miR-resistant SOD1 target (bold); SOD1 coding sequence (lowercase)

Chem.

[0107] >Sequence of CB-miR-CB-SOD1 (SEQ ID NO: 11); miR-resistant SOD1 target (bold); SOD1 coding sequence (lowercase)

Chem.

Chem.

[0108] >Sequence of self-complementary H1-SOD1-miR-CB-SOD1 (with 3’UTR) (SEQ ID NO: 12); AAV ITR (bold)

Chem.

Chem.

[0109] >Sequence of self-complementary H1-SOD1-miR-CB-SOD1 (without 3’UTR) (SEQ ID NO: 13); AAV ITR (bold)

Chem.

Chem.

[0110] >Sequence of single-stranded CB-miR-CB-SOD1 (with 3’UTR) (SEQ ID NO: 14); AAV ITR (bold)

Chem.

Chem.

[0111] >Sequence of a single-stranded CB-miR-CB-SOD1 (having 3’UTR); AAV ITR (boldface)

Chem.

Chem.

[0112] >SOD1 promoter insertion sequence (SEQ ID NO: 16)

Chem.

Chem.

[0113] >Wild-type SOD1 amino acid sequence; NCBI reference sequence NP_000445.1 (SEQ ID NO: 17)

Chem.

Claims

**Claim 1** The following: (a) A first region encoding one or more first miRNAs, the one or more first miRNAs comprising a nucleic acid having a sufficient sequence complementary to the endogenous mRNA that hybridizes to the endogenous mRNA of interest and inhibits the expression of the endogenous mRNA, wherein the one or more first miRNAs comprise the sequence of SEQ ID NO: 5 and / or SEQ ID NO: 6, and wherein the endogenous mRNA encodes a SOD1 protein; and (b) A second region encoding an exogenous mRNA encoding a wild-type SOD1 protein, wherein the exogenous mRNA comprises the sequence of SEQ ID NO: 7, An isolated nucleic acid comprising, wherein the one or more first miRNAs do not comprise a nucleic acid having sufficient sequence complementarity to hybridize to the exogenous mRNA and inhibit its expression. **Claim 2** (a) The exogenous mRNA lacks a 5' untranslated region (5'UTR), lacks a 3' untranslated region (3'UTR), or lacks both a 5'UTR and a 3'UTR; and / or (b) The exogenous mRNA encoding the SOD1 protein has one or more silent base pair mutations relative to the endogenous mRNA, optionally wherein the exogenous mRNA comprises a nucleic acid sequence that is at least 95% identical to the endogenous mRNA, The isolated nucleic acid according to claim 1. **Claim 3** The isolated nucleic acid according to claim 1 or 2, wherein the one or more first miRNAs further comprise a flanking region of miR-155 or miR-30. **Claim 4** The isolated nucleic acid according to any one of claims 1 to 3, further comprising a first promoter operably linked to the first region, optionally wherein the first promoter is (a) An RNA polymerase III (pol III) promoter, optionally wherein the pol III promoter is an H1 promoter or a U6 promoter; Or (b) An RNA polymerase II (pol II) promoter, optionally wherein the pol II promoter is a chicken beta-actin (CBA) promoter or an endogenous SOD1 promoter (e.g., SEQ ID NO: 16). **Claim 5** An isolated nucleic acid according to claim 4, comprising a second promoter operably linked to a second region, wherein optionally here, the second promoter is a pol II promoter, and optionally here, the pol II promoter is a chicken beta-actin (CBA) promoter or an endogenous SOD1 promoter, said isolated nucleic acid.

6. An isolated nucleic acid according to any one of claims 1-5, further comprising an enhancer sequence, wherein optionally here, the enhancer is a cytomegalovirus (CMV) enhancer.

7. An isolated nucleic acid according to any one of claims 1-6, wherein the first region is located within the untranslated region (e.g., UTR) of the second region, and optionally here, the first region is located within an intron of the isolated nucleic acid.

8. An isolated nucleic acid according to any one of claims 1-7, wherein the first region is located 5' to the second region.

9. An isolated nucleic acid according to any one of claims 1-8, further comprising at least one adeno-associated virus (AAV) inverted terminal repeat (ITR), wherein optionally here, said isolated nucleic acid comprises a full-length ITR and a mutant ITR, and here, the ITR is adjacent to the first and second regions, said isolated nucleic acid.

10. The following: (a) an isolated nucleic acid according to any one of claims 1-9; and (b) an AAV capsid protein comprising a recombinant adeno-associated virus (rAAV).

11. An rAAV according to claim 10, wherein (a) said rAAV targets CNS tissue, and optionally here, said rAAV targets neurons; and / or (b) the capsid protein is an AAV9 capsid protein or an AAVrh.10 capsid protein, said rAAV.

12. A composition comprising an isolated nucleic acid according to any one of claims 1-9, or an rAAV according to claim 10 or 11, and a pharmaceutically acceptable excipient.

13. A composition comprising an isolated nucleic acid according to any one of claims 1 to 9 or an rAAV according to claim 10 or 11 for use in a method for inhibiting SOD1 expression in cells, wherein the method comprises delivering to the cells an isolated nucleic acid according to any one of claims 1 to 9 or an rAAV according to claim 10 or 11, and optionally wherein the cells comprise a nucleic acid sequence encoding a mutant SOD1 protein, said composition.

14. A composition comprising an isolated nucleic acid according to any one of claims 1 to 9 or an rAAV according to claim 10 or 11 for use in a method for treating a subject having or suspected of having ALS, wherein the method comprises administering to the subject an effective amount of an isolated nucleic acid according to any one of claims 1 to 9 or an effective amount of an rAAV according to claim 10 or 11, and optionally wherein the subject is a mammal, and optionally wherein the mammal is a human, said composition.

15. The composition according to claim 14, wherein the subject comprises a nucleic acid sequence encoding a mutant SOD1 protein, and optionally wherein the subject is a mammal, and optionally wherein the mammal is a human.

Images