Engineered meganucleases with specificity for recognition sequences in the transthyretin gene

Engineered meganucleases target the TTR gene to reduce TTR polypeptide levels by up to 80% in eukaryotic cells, addressing the limitations of current treatments for transthyretin amyloidosis.

JP7721637B2Active Publication Date: 2025-08-12PRECISION BIOSCIENCES INC

Patent Information

Application Number
JP2023512371
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-08-21
Filing Date
2021-08-20
Publication Date
2025-08-12
Estimated Expiration
2041-08-20

AI Technical Summary

Technical Problem

Current treatments for transthyretin amyloidosis, such as liver transplantation and CRISPR/Cas9 gene editing, are invasive, costly, or ineffective in reducing transthyretin (TTR) levels, necessitating alternative therapies for stable reduction of TTR levels in patients.

Method used

Engineered meganucleases are designed to recognize and cleave specific sequences in the TTR gene, inducing non-homologous end joining or homologous recombination to disrupt TTR expression, thereby reducing TTR polypeptide levels.

Benefits of technology

The engineered meganucleases effectively reduce TTR polypeptide levels by up to 80% in eukaryotic cells, providing a stable and less invasive treatment option for transthyretin amyloidosis and related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007721637000007
    Figure 0007721637000007
  • Figure 0007721637000008
    Figure 0007721637000008
  • Figure 0007721637000009
    Figure 0007721637000009
Patent Text Reader

Abstract

The present invention encompasses engineered meganucleases that bind to and cleave recognition sequences within the TTR gene. The present invention also encompasses methods of using such engineered meganucleases to generate genetically modified cells. Furthermore, the present invention encompasses pharmaceutical compositions comprising engineered meganuclease proteins or nucleic acids encoding the engineered meganucleases of the present invention, and the use of such compositions for the treatment of TTR-related diseases, such as transthyretin amyloidosis.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to the fields of oncology, molecular biology, and recombinant nucleic acid technology. In particular, the present invention relates to optimized engineered meganucleases with specificity for recognition sequences within the transthyretin (TTR) gene. Such engineered meganucleases are useful in methods for treating transthyretin amyloidosis.

[0002] Reference to a sequence listing submitted as a text file via EFS-Web This application contains a Sequence Listing that has been submitted in ASCII format via EFS-Web and is incorporated herein by reference in its entirety. The ASCII copy, created on August 20, 2021, is named P109070034WO00-SEQ-EPG and is 59,876 bytes in size. [Background technology]

[0003] Transthyretin amyloidosis (ATTR) is a progressive amyloid-type disease characterized by the formation and deposition of amyloid fibrils in various tissues and organ systems of the body. Normally, the TTR protein is a serum / plasma and cerebrospinal fluid protein responsible for transporting thyroxine and retinol. It is primarily synthesized by the liver and the choroid plexus of the brain, with only minor synthesis in the human retina. Liver-synthesized TTR is secreted into the bloodstream, while choroid plexus-originating TTR is transported to the cerebrospinal fluid.

[0004] TTR disease is caused by over 100 known point mutations in the transthyretin (TTR) protein. These point mutations lead to protein misfolding and the formation of amyloid fibrils. ATTR disease is caused by the aggregation of misfolded proteins, which is thought to cause neuronal and cellular dysfunction rather than loss of TTR protein function. There are three main forms of the disease: neuropathic ATTR, leptomeningeal ATTR, and cardiac ATTR. ATTR is also associated with the relatively common disorders senile systemic amyloidosis (SSA), familial amyloid polyneuropathy (FAP), and familial amyloid cardiomyopathy (FAC). Recent epidemiological studies have shown that TTR-related SSA disorders can affect as many as 25% of the elderly population (Non-Patent Document 1). Biochemically, TTR has been identified as the major protein component in amyloid deposits in FAP patients (Non-Patent Document 2).

[0005] It was later discovered that a methionine instead of a valine at position 30 of the protein (V30M) was found to be the most common molecular defect causing the disease (Non-Patent Document 3). In FAP, widespread systemic extracellular deposition of TTR aggregates and amyloid fibrils occurs throughout connective tissue, particularly in the peripheral nervous system (Non-Patent Document 4). After TTR deposition, axonal degeneration occurs, beginning with small-diameter unmyelinated and myelinated fibers, ultimately resulting in neuronal loss in ganglionic sites.

[0006] The neuropathic form of the disease affects the peripheral and autonomic nervous systems, resulting in peripheral neuropathy and decreased control of bodily functions (including sexual impotence, diarrhea, constipation, urinary problems, and orthostatic hypotension, among others). Furthermore, problems with the kidneys, eyes, and wrists (carpal tunnel syndrome) are common. Accumulation of TTR protein in the leptomeninges can lead to stroke and intracerebral hemorrhage, hydrocephalus, ataxia, spastic paralysis, seizures, dementia, and various eye disorders. Patients with cardiac amyloidosis may present with arrhythmias, cardiac hypertrophy, or orthostatic hypertension, potentially leading to heart failure and death.

[0007] TTR amyloidosis typically leads to death within 10 years of diagnosis or symptom onset and, until recently, was considered incurable. Because the liver is typically the source of amyloidogenic TTR, liver transplantation can be an effective means of replacing the disease-associated allele with the wild-type (WT) allele in familial cases. While liver transplantation is effective as a form of gene therapy, it is not without its problems. Transplantation is complicated by the need for invasive surgery for both the recipient and donor, prolonged post-transplant immunosuppressive therapy, donor shortages, high costs, and the large number of TTR patients who are not good candidates due to advanced disease progression. Unfortunately, cardiac amyloidosis progresses in some familial patients even after liver transplantation because WT TTR often continues to be deposited. Transplantation is not a viable option for senile systemic amyloidosis (SSA), the most common TTR disease, which affects approximately 25% of individuals over the age of 80 due to WT TTR deposition.

[0008] Alternative treatment options for ATTR under development include, for example, antisense technology, as described in Patent Document 1, and lipid nanoparticle (LNP)-encapsulated siRNA patisiran, as described by Non-Patent Document 5. In addition, the CRISPR / Cas9 gene editing system has been used to reduce serum TTR levels in mice (see Non-Patent Document 6). Despite these recent efforts, there remains a need for alternative therapies that achieve a stable reduction in TTR levels in patients with ATTR disease.

[0009] Thus, methods and compositions for achieving reduced TTR levels using engineered homing endonucleases (also called "meganucleases") are described herein. Homing endonucleases are a group of naturally occurring nucleases that recognize 15-40 base pair cleavage sites commonly found in plant and fungal genomes. They are often associated with parasitic DNA elements such as group 1 self-splicing introns and inteins. They naturally promote homologous recombination or gene insertion at specific locations in the host genome by generating double-strand breaks in the chromosome, which then recruits the cellular DNA repair machinery (Non-Patent Document 7). Homing endonucleases are generally classified into four families: the LAGLIDADG (SEQ ID NO: 2) family, the GIY-YIG family, the His-Cys box family, and the HNH family. These families are characterized by structural motifs that affect catalytic activity and recognition sequences. For example, members of the LAGLIDADG (SEQ ID NO: 2) family are characterized by having either one or two copies of the conserved LAGLIDADG (SEQ ID NO: 2) motif (see Non-Patent Document 8). LAGLIDADG (SEQ ID NO: 2) homing endonucleases with a single copy of the LAGLIDADG (SEQ ID NO: 2) motif form homodimers, while members with two copies of the LAGLIDADG (SEQ ID NO: 2) motif are found as monomers. Methods for generating homing endonucleases are known in the art.

[0010] I-CreI (SEQ ID NO: 1) is a member of the LAGLIDADG (SEQ ID NO: 2) family of homing endonucleases that recognizes and cleaves a 22-base pair recognition sequence in the chloroplast chromosome of the alga Chlamydomonas reinhardtii. Genetic selection techniques were used to alter the preference of the wild-type I-CreI cleavage site (Non-Patent Document 9; Non-Patent Document 10; Non-Patent Document 11; Non-Patent Document 12). A method for rationally designing mono-LAGLIDADG (SEQ ID NO: 2) homing endonucleases has been described that can comprehensively redesign I-CreI and other homing endonucleases to target a wide variety of DNA sites, including those in mammalian, yeast, plant, bacterial, and viral genomes (Patent Document 2).

[0011] As first described in Patent Document 3, I-CreI and its engineered derivatives are usually dimeric, but can be fused into a single polypeptide using a short peptide linker connecting the C-terminus of the first subunit to the N-terminus of the second subunit (Non-Patent Document 13; Non-Patent Document 14). Thus, a functional "single-chain" meganuclease can be expressed from a single transcript. This, combined with the extremely low frequency of off-target cleavage observed with engineered meganucleases, makes them preferred endonucleases for the present invention.

[0012] Thus, the present invention fulfills the need in the art for a gene therapy approach to treating ATTR or other TTR-related diseases. [Prior art documents] [Patent documents]

[0013] [Patent Document 1] U.S. Patent Application Publication No. 2011 / 0294868 [Patent Document 2] International Publication No. WO2007 / 047859 [Patent Document 3] International Publication No. WO2009 / 059195

Non-licensed literature

[0014]

Non-patent document 1

Non-patent document 2

Non-patent document 3

Non-patent document 4

Non-patented document 5

Non-patent document 6

Non-patent document 7

Non-patent document 8

Non-patented document 9

Non-patent document 10

Non-patent document 11

[0015] The present invention provides engineered meganucleases that bind to and cleave recognition sequences in exon 1 or exon 3 of the transthyretin (TTR) gene (e.g., the TTR 15-16 recognition sequence (SEQ ID NO: 7) or the TTR 5-6 recognition sequence (SEQ ID NO: 9), which are conserved in mouse, human, and non-human primate TTR genes). Cleavage at the recognition sequence by the engineered meganucleases disclosed herein can alter TTR expression due to non-homologous end joining (NHEJ) at the cleavage site. NHEJ can result in insertions, deletions, or frameshift mutations that can interfere with gene expression. Alternatively, a sequence of interest can be introduced into the TTR gene by homologous recombination. Thus, by disrupting normal gene expression, expression of endogenous TTR polypeptides can be reduced according to the methods disclosed herein. Thus, such meganucleases are useful for reducing TTR polypeptide levels in individuals with transthyretin amyloidosis (ATTR) or other TTR-related diseases, such as senile systemic amyloidosis (SSA), familial amyloid polyneuropathy (FAP), or familial amyloid cardiomyopathy (FAC). Accordingly, the present invention also provides pharmaceutical compositions and methods for treating subjects with ATTR or other TTR-related diseases, which utilize engineered meganucleases with specificity for a recognition sequence comprising SEQ ID NO: 7 or 9 within the TTR gene. [Means for solving the problem]

[0016] Thus, in one aspect, the present invention provides an engineered meganuclease that recognizes and cleaves a recognition sequence within the transthyretin (TTR) gene, comprising a first subunit and a second subunit, wherein the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and the second subunit binds to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region. In some embodiments, the recognition sequence comprises SEQ ID NO:7.

[0017] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more sequence identity to the amino acid sequence corresponding to residues 24-79 of any one of SEQ ID NOs: 11-14. In certain embodiments, the HVR1 region comprises the amino acid sequence corresponding to residues 24-79 of any one of SEQ ID NOs: 11-14 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions.

[0018] In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 11-14. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 11-14.

[0019] In certain embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of any one of SEQ ID NOs: 11-14.

[0020] In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 48, 50, and 71-73 of any one of SEQ ID NOs: 11-14.

[0021] In certain embodiments, the HVR1 region comprises residues 24-79 of any one of SEQ ID NOs: 11-14.

[0022] In certain embodiments, the first subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more sequence identity to the amino acid sequence corresponding to residues 7-153 of any one of SEQ ID NOs: 11-14. In certain embodiments, the first subunit comprises an amino acid sequence corresponding to residues 7-153 of any one of SEQ ID NOs: 11-14 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.

[0023] In certain embodiments, the first subunit comprises a G, S, or A at the residue corresponding to residue 19 of any one of SEQ ID NOs: 11-14.

[0024] In some embodiments, the first subunit comprises residues corresponding to residues 19 and 139 of any one of SEQ ID NOs: 11-14.

[0025] In certain embodiments, the first subunit comprises an E, Q, or K at the residue corresponding to residue 80 of any one of SEQ ID NOs: 11-14.

[0026] In some embodiments, the first subunit comprises a residue corresponding to residue 80 of any one of SEQ ID NOs: 11-14. In particular embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NOs: 11-14.

[0027] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more sequence identity to the amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NOs: 11-14. In certain embodiments, the HVR2 region comprises an amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NOs: 11-14 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions.

[0028] In certain embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 11-14. In certain embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 11-14.

[0029] In certain embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of any one of SEQ ID NOs: 11-14.

[0030] In certain embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NOs: 11-14.

[0031] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more sequence identity to the amino acid sequence corresponding to residues 198-344 of any one of SEQ ID NOs: 11-14. In certain embodiments, the second subunit comprises an amino acid sequence corresponding to residues 198-344 of any one of SEQ ID NOs: 11-14 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.

[0032] In certain embodiments, the second subunit comprises a G, an S, or an A at the residue corresponding to residue 210 of any one of SEQ ID NOs: 11-14.

[0033] In certain embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of any one of SEQ ID NOs: 11-14. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of any one of SEQ ID NOs: 11.

[0034] In certain embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NOs: 11-14.

[0035] In some embodiments, the first subunit of the engineered meganuclease has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to the amino acid sequence corresponding to residues 7-153 of any one of SEQ ID NOs: 11-14, and the second subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to the amino acid sequence corresponding to residues 198-344 of any one of SEQ ID NOs: 11-14. In certain embodiments, the first subunit and / or the second subunit may contain up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions relative to residues 7-153 and residues 198-344, respectively, of any one of SEQ ID NOs: 11-14.

[0036] In certain embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, which covalently links the first subunit and the second subunit.

[0037] In certain embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to any one of SEQ ID NOs: 11-14.

[0038] In certain embodiments, the engineered meganuclease comprises the amino acid sequence of any one of SEQ ID NOs: 11-14.

[0039] In certain embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to any one of SEQ ID NOs: 66-69.

[0040] In certain embodiments, the engineered meganuclease is encoded by the nucleic acid sequence of any one of SEQ ID NOs: 66-69.

[0041] In some embodiments, the recognition sequence comprises SEQ ID NO:9.

[0042] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more sequence identity to the amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 15. In certain embodiments, the first subunit comprises an amino acid sequence corresponding to residues 7-153 of SEQ ID NO: 15 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.

[0043] In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 15. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 15.

[0044] In certain embodiments, the HVR1 region comprises Y, R, K, or D at the residue corresponding to residue 66 of SEQ ID NO:15.

[0045] In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:15.

[0046] In certain embodiments, the first subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more sequence identity to the amino acid sequence corresponding to residues 7-153 of SEQ ID NO: 15. In certain embodiments, the first subunit comprises an amino acid sequence corresponding to residues 7-153 of SEQ ID NO: 15 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.

[0047] In certain embodiments, the first subunit comprises a G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:15.

[0048] In certain embodiments, the first subunit comprises an E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO: 15. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 15.

[0049] In certain embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 15. In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more sequence identity to the amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 15. In certain embodiments, the second subunit comprises an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 15 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.

[0050] In certain embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 15. In certain embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 15.

[0051] In certain embodiments, the HVR2 region comprises Y, R, K, or D at the residue corresponding to residue 257 of SEQ ID NO:15.

[0052] In certain embodiments, the HVR2 region comprises one or more residues corresponding to residues 239, 241, and 263-265 of SEQ ID NO: 15. In some embodiments, the HVR2 region comprises residues corresponding to residues 239, 241, and 263-265 of SEQ ID NO: 15.

[0053] In a specific embodiment, the HVR2 region comprises residues 215-270 of SEQ ID NO:15.

[0054] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more sequence identity to the amino acid sequence corresponding to residues 198-344 of SEQ ID NO: 15. In certain embodiments, the second subunit comprises an amino acid sequence corresponding to residues 198-344 of SEQ ID NO: 15 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.

[0055] In certain embodiments, the second subunit comprises a G, S, or A at the residue corresponding to residue 210 of SEQ ID NO: 15. In some embodiments, the second subunit comprises a residue corresponding to residue 210 of SEQ ID NO: 15.

[0056] In certain embodiments, the second subunit comprises an E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO: 15. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 15.

[0057] In certain embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:15.

[0058] In some embodiments, a first subunit of the engineered meganuclease has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to an amino acid sequence corresponding to residues 7-153 of SEQ ID NO:15, and a second subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to an amino acid sequence corresponding to residues 198-344 of SEQ ID NO:15. In certain embodiments, the first subunit and / or the second subunit may contain up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions relative to residues 7-153 and residues 198-344 of SEQ ID NO:15, respectively.

[0059] In certain embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, which covalently links the first subunit and the second subunit.

[0060] In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to the amino acid sequence of SEQ ID NO:15.

[0061] In certain embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO:15.

[0062] In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to the nucleic acid sequence of SEQ ID NO:70.

[0063] In some embodiments, the engineered meganuclease is encoded by the nucleic acid sequence of SEQ ID NO:70.

[0064] In another aspect, the present invention provides a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease described herein.

[0065] In certain embodiments, the polynucleotide is mRNA.

[0066] In another aspect, the present invention provides a recombinant DNA construct comprising a polynucleotide comprising a nucleic acid sequence described herein.

[0067] In certain embodiments, the recombinant DNA construct encodes a recombinant virus comprising a polynucleotide comprising a nucleic acid sequence encoding the engineered meganuclease disclosed herein. In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adeno-associated virus (AAV). In certain embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV encoded by the recombinant DNA construct has the AAV8 serotype. In some embodiments, the nucleic acid sequence comprises a promoter sequence operably linked to the nucleic acid sequence encoding the engineered meganuclease. In some embodiments, the promoter is a liver-specific promoter. In some embodiments, the liver-specific promoter comprises a human thyroxine-binding globulin (TBG) promoter, a human alpha-1 antitrypsin promoter, a hybrid liver-specific promoter, or an apolipoprotein A-II promoter.

[0068] In another aspect, the present invention provides a recombinant virus comprising a polynucleotide comprising a nucleic acid sequence encoding the engineered meganuclease described herein.In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant AAV.In certain embodiments, the recombinant virus is a recombinant AAV.In some embodiments, the recombinant AAV has an AAV8 serotype.

[0069] In another aspect, the present invention provides a method for generating a genetically modified eukaryotic cell having an interrupted target sequence in the chromosome of the genetically modified eukaryotic cell, comprising the steps of introducing into the eukaryotic cell a polynucleotide comprising a nucleic acid sequence encoding any of the engineered meganucleases of the present invention, wherein the engineered meganuclease is expressed in the eukaryotic cell; the engineered meganuclease generates a cleavage site in the chromosome with a recognition sequence comprising SEQ ID NO: 7 or 9, and the target sequence is modified by non-homologous end joining at the cleavage site.

[0070] In some embodiments, the methods generate modified TTR genes that do not encode full-length endogenous TTR polypeptides. In some embodiments, the methods are effective to reduce the level of endogenous TTR polypeptide in a cell by at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, or at least about 80% relative to a reference level. In some embodiments, the TTR polypeptide level is reduced by about 1-5%, 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, or 70-80% relative to a reference level.

[0071] In some embodiments, the eukaryotic cell is a mammalian cell. In one such embodiment, the mammalian cell is selected from a human cell, a non-human primate cell, or a mouse cell. In one embodiment, the mammalian cell is a hepatocyte. In certain embodiments, the hepatocyte is in the liver of a human, a non-human primate, or a mouse.

[0072] In some embodiments, nucleic acid is introduced into eukaryotic cells by mRNA or recombinant virus.In one such embodiment, mRNA is packaged in lipid nanoparticles.In another such embodiment, recombinant virus is recombinant adenovirus, recombinant lentivirus, recombinant retrovirus or recombinant AAV.In certain embodiments, recombinant virus is recombinant AAV.

[0073] In another aspect, the present invention provides a method for generating a genetically modified eukaryotic cell having an interrupted target sequence in the chromosome of the genetically modified eukaryotic cell, comprising the step of introducing any of the engineered meganucleases of the present invention into the eukaryotic cell; wherein the engineered meganuclease generates a cleavage site in the chromosome with a recognition sequence comprising SEQ ID NO: 7 or 9, and the target sequence is modified by non-homologous end joining at the cleavage site.

[0074] In one embodiment, the method generates a modified TTR gene that does not encode a full-length endogenous TTR polypeptide. In some embodiments, the method is effective for reducing expression of endogenous TTR polypeptide in a cell, thereby reducing TTR polypeptide levels by at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, or at least about 80% relative to a reference level. In some embodiments, TTR polypeptide levels are reduced by about 1-5%, 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, or 70-80% relative to a reference level.

[0075] In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is selected from a human cell, a non-human primate cell, or a mouse cell. In certain embodiments, the mammalian cell is a hepatocyte. In some embodiments, the hepatocyte is in the liver of a human, a non-human primate, or a mouse.

[0076] In another aspect, the present invention provides a method for generating a genetically modified eukaryotic cell comprising an exogenous sequence of interest inserted into a chromosome of said genetically modified eukaryotic cell, the method comprising the steps of introducing into a eukaryotic cell one or more polynucleotides comprising: (a) a first nucleic acid sequence encoding any of the engineered meganucleases of the present invention, wherein the engineered meganuclease is expressed in the eukaryotic cell; and (b) a second nucleic acid sequence comprising the sequence of interest; wherein the engineered meganuclease generates a cleavage site in the chromosome with a recognition sequence comprising SEQ ID NO: 7 or 9; and the sequence of interest is inserted into the chromosome at the cleavage site.

[0077] In some embodiments, the second nucleic acid sequence further comprises a nucleic acid sequence homologous to a nucleic acid sequence adjacent to the cleavage site, and the sequence of interest is inserted into the cleavage site by homologous recombination.

[0078] In some embodiments, the methods generate modified TTR genes that do not encode full-length endogenous TTR polypeptide. In some embodiments, the methods are effective to reduce expression of endogenous TTR polypeptide in cells, thereby reducing TTR polypeptide levels by at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, or more relative to a reference level. In some embodiments, TTR polypeptide levels are reduced by about 1% to 5%, 5% to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, or 70% to 80%, or more, relative to the reference level.

[0079] In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is selected from a human cell, a non-human primate cell, or a mouse cell. In certain embodiments, the mammalian cell is a hepatocyte. In some embodiments, the hepatocyte is in the liver of a human, a non-human primate, or a mouse. In some embodiments, the polynucleotide comprising the first nucleic acid sequence is introduced into the eukaryotic cell by mRNA or a recombinant virus. In one such embodiment, the mRNA is packaged in a lipid nanoparticle. In another such embodiment, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant AAV. In certain embodiments, the recombinant virus is a recombinant AAV.

[0080] In some embodiments, the polynucleotide comprising the second nucleic acid sequence is introduced into eukaryotic cells by recombinant virus.In one such embodiment, recombinant virus is recombinant adenovirus, recombinant lentivirus, recombinant retrovirus or recombinant AAV.In certain embodiments, recombinant virus is recombinant AAV.

[0081] In another aspect, the present invention provides a method for generating a genetically modified eukaryotic cell comprising an exogenous sequence of interest inserted into the chromosome of said genetically modified eukaryotic cell, the method comprising the steps of: (a) introducing into the eukaryotic cell any of the engineered meganucleases of the present invention; and (b) introducing into the eukaryotic cell a polynucleotide comprising a nucleic acid sequence comprising the sequence of interest, wherein the engineered meganuclease generates a cleavage site in the chromosome with a recognition sequence comprising SEQ ID NO: 7 or 9, and the sequence of interest is inserted into the chromosome at the cleavage site.

[0082] In some embodiments, the polynucleotide further comprises a nucleic acid sequence homologous to a nucleic acid sequence flanking the cleavage site, and the sequence of interest is inserted into the cleavage site by homologous recombination. In some embodiments, the method generates a modified TTR gene that does not encode a full-length endogenous TTR polypeptide. In some embodiments, the method is effective to reduce TTR polypeptide levels in a cell by at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, or more relative to a reference level. In some embodiments, TTR polypeptide levels are reduced by about 1% to 5%, 5% to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80%, or more relative to the reference level.

[0083] In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is selected from a human cell, a non-human primate cell, or a mouse cell. In certain embodiments, the mammalian cell is a hepatocyte. In some embodiments, the hepatocyte is in the liver of a human, a non-human primate, or a mouse.

[0084] In some embodiments, polynucleotide is introduced into eukaryotic cells by mRNA or recombinant virus.In one such embodiment, mRNA is packaged in lipid nanoparticles.In another such embodiment, recombinant virus is recombinant adenovirus, recombinant lentivirus, recombinant retrovirus or recombinant AAV.In certain embodiments, recombinant virus is recombinant AAV.

[0085] In another aspect, the present invention provides a method for generating a genetically modified eukaryotic cell containing a modified TTR gene, comprising the step of introducing into the eukaryotic cell: (a) a polynucleotide comprising a nucleic acid sequence encoding an engineered nuclease having specificity for a recognition sequence within the TTR gene, wherein the engineered nuclease is expressed in the eukaryotic cell; or (b) an engineered nuclease having specificity for a recognition sequence within the TTR gene, wherein the engineered nuclease generates a cleavage site within the recognition sequence, resulting in a modified TTR gene that does not encode a full-length endogenous TTR polypeptide.

[0086] In some embodiments, the modified TTR gene comprises an insertion or deletion within exon 1 or exon 3.

[0087] In some embodiments, the insertion or deletion is introduced into an engineered nuclease cleavage site.

[0088] In some embodiments, the engineered nuclease is an engineered nuclease that has specificity for a recognition sequence comprising SEQ ID NO: 7 or 9. In certain embodiments, the engineered nuclease has specificity for a recognition sequence comprising SEQ ID NO: 7. In other embodiments, the engineered nuclease has specificity for a recognition sequence comprising SEQ ID NO: 9.

[0089] In some embodiments, the engineered nuclease is any engineered meganuclease of the present invention.

[0090] In some embodiments, the method is effective to reduce TTR polypeptide levels in a cell by at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, or more relative to a reference level. In some embodiments, the TTR polypeptide level is reduced by about 1% to 5%, 5% to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80%, or more relative to a reference level.

[0091] In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is selected from a human cell, a non-human primate cell, or a mouse cell. In certain embodiments, the mammalian cell is a liver cell, such as a hepatocyte. In some embodiments, the liver cell or hepatocyte is in the liver of a human, a non-human primate, or a mouse. In some embodiments, the liver cell is a hepatic progenitor cell or stem cell.

[0092] In some embodiments, the method is performed in vitro. In some embodiments, the method is performed in vivo.

[0093] In some embodiments, the polynucleotide is a recombinant DNA construct.

[0094] In some embodiments, the polynucleotide is introduced into the eukaryotic cell via a lipid nanoparticle.

[0095] In some embodiments, polynucleotide is introduced into eukaryotic cells by mRNA or recombinant virus.In one such embodiment, mRNA is packaged in lipid nanoparticles.In another such embodiment, recombinant virus is recombinant adenovirus, recombinant lentivirus, recombinant retrovirus or recombinant AAV.In certain embodiments, recombinant virus is recombinant AAV.

[0096] In another aspect, the present invention provides a genetically modified eukaryotic cell prepared by any of the methods of the present invention.

[0097] In another aspect, the present invention provides a genetically modified eukaryotic cell comprising a modified TTR gene, wherein the modified TTR gene comprises an insertion or deletion at an engineered meganuclease cleavage site within SEQ ID NO:7 or SEQ ID NO:9, and wherein the modified TTR gene does not encode a full-length endogenous TTR polypeptide.

[0098] In some embodiments, the genetically modified eukaryotic cell has a reduction in TTR polypeptide levels relative to a reference level of at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, or more. In some embodiments, the TTR polypeptide level is reduced by about 1% to 5%, 5% to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80%, or more relative to a reference level.

[0099] In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is selected from a human cell, a non-human primate cell, or a mouse cell. In certain embodiments, the mammalian cell is a liver cell, such as a hepatocyte. In some embodiments, the liver cell or hepatocyte is in the liver of a human, a non-human primate, or a mouse. In some embodiments, the liver cell is a hepatic progenitor cell or stem cell.

[0100] In another aspect, the present invention provides a genetically modified eukaryotic cell in the liver of a primate comprising a modified TTR gene, wherein the modified TTR gene comprises an insertion or deletion within exon 1 or exon 3, and wherein the modified TTR gene does not encode a full-length endogenous TTR polypeptide.

[0101] In some embodiments, the insertion or deletion is located at an engineered nuclease cleavage site. In some embodiments, the insertion or deletion is within exon 3. In certain embodiments, the engineered nuclease cleavage site is within an engineered meganuclease recognition sequence comprising SEQ ID NO:7.

[0102] In some embodiments, the insertion or deletion is within exon 1. In certain embodiments, the engineered nuclease cleavage site is within an engineered meganuclease recognition sequence comprising SEQ ID NO:9.

[0103] In some embodiments, the genetically modified eukaryotic cell has a reduction in TTR polypeptide levels relative to a reference level of at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, or more. In some embodiments, the TTR polypeptide level is reduced by about 1-5%, 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, or more relative to a reference level.

[0104] In some embodiments, the genetically modified eukaryotic cells are mammalian cells. In some embodiments, the mammalian cells are selected from human cells, non-human primate cells, or mouse cells. In certain embodiments, the mammalian cells are liver cells, such as hepatocytes. In some embodiments, the liver cells or hepatocytes are located in the liver of a human, non-human primate, or mouse. In some embodiments, the liver cells are hepatic progenitor cells or stem cells.

[0105] In some embodiments, the genetically modified eukaryotic cell comprises a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease described herein.

[0106] In another aspect, the present invention provides pharmaceutical compositions comprising a pharmaceutically acceptable carrier and any of the engineered meganucleases of the present invention, or a polynucleotide comprising a nucleic acid sequence encoding any such engineered meganuclease.

[0107] In some embodiments, the polynucleotide is mRNA. In one such embodiment, the mRNA is packaged within a lipid nanoparticle.

[0108] In some embodiments of the pharmaceutical composition, the pharmaceutical composition comprises a recombinant DNA construct comprising the polynucleotide.

[0109] In some embodiments, the pharmaceutical composition comprises a recombinant virus comprising the polynucleotide. In some such embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant AAV. In certain embodiments, the recombinant virus is a recombinant AAV.

[0110] In some embodiments, the pharmaceutical composition comprises a lipid nanoparticle composition comprising lipid nanoparticles comprising a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease described herein. In some embodiments, the polynucleotide is mRNA.

[0111] In some embodiments, the pharmaceutical composition contains about 1×10 10 gc / kg ~ approx. 1×10 14 gc / kg (e.g., 1 × 10 10 gc / kg, 1 × 10 11 gc / kg, 1 × 10 12 gc / kg, 1 × 10 13 gc / kg, or 1 × 10 14 In some embodiments, the pharmaceutical composition comprises at least about 1 x 10 gc / kg of a polynucleotide comprising a nucleic acid sequence encoding the engineered meganuclease. 10 gc / kg, at least about 1 × 10 11 gc / kg, at least about 1 × 10 12 gc / kg, at least about 1 × 10 13 gc / kg, or at least about 1 × 10 14 In some embodiments, the pharmaceutical composition comprises about 1 x 10 gc / kg of a polynucleotide comprising a nucleic acid sequence encoding the engineered meganuclease. 10 gc / kg ~ approx. 1×10 11 gc / kg, approximately 1×10 11 gc / kg ~ approx. 1×10 12 gc / kg, approximately 1×1012 gc / kg ~ approx. 1×10 13 gc / kg, or approximately 1 × 10 13 gc / kg ~ approx. 1×10 14 In certain embodiments, the pharmaceutical composition comprises about 1 x 10 gc / kg of a polynucleotide comprising a nucleic acid sequence encoding the engineered meganuclease. 12 gc / kg ~ approx. 9×10 13 gc / kg (e.g., approximately 1 × 10 12 gc / kg, approx. 2×10 12 gc / kg, approx. 3×10 12 gc / kg, approx. 4×10 12 gc / kg, approx. 5×10 12 gc / kg, approximately 6×10 12 gc / kg, approximately 7×10 12 gc / kg, approximately 8×10 12 gc / kg, approx. 9×10 12 gc / kg, approximately 1×10 13 gc / kg, approx. 2×10 13 gc / kg, approx. 3×10 13 gc / kg, approx. 4×10 13 gc / kg, approx. 5×10 13 gc / kg, approximately 6×10 13 gc / kg, approximately 7×10 13 gc / kg, approximately 8×10 13 gc / kg, or approximately 9 × 10 13 gc / kg) of a polynucleotide comprising a nucleic acid sequence encoding the engineered meganuclease.

[0112] In some embodiments of the pharmaceutical composition, the pharmaceutical composition is for treating a subject with transthyretin amyloidosis (ATTR).

[0113] In another aspect, the present invention provides a method for reducing TTR levels in a subject, comprising delivering any of the engineered meganucleases of the present invention, or a polynucleotide comprising a nucleic acid sequence encoding the engineered meganuclease, to a target cell in the subject, wherein the method is effective in reducing TTR levels in the subject relative to a reference level.

[0114] In some embodiments of the method, the target cell is a mammalian cell. In some embodiments, the mammalian cell is selected from a human cell, a non-human primate cell, or a mouse cell. In certain embodiments, the mammalian cell is a hepatocyte. In some embodiments, the hepatocyte is in the liver of a human, a non-human primate, or a mouse.

[0115] In some embodiments, the polynucleotide is mRNA. In some embodiments, the polynucleotide is DNA.

[0116] In some embodiments, the polynucleotide is encapsulated in a lipid nanoparticle, and the lipid nanoparticle is delivered to target cells of a subject.

[0117] In some embodiments, polynucleotides are delivered to target cells using recombinant viruses that contain polynucleotides.In some such embodiments, the recombinant viruses are recombinant adenoviruses, recombinant lentiviruses, recombinant retroviruses, or recombinant AAVs.In certain embodiments, the recombinant viruses are recombinant AAVs.

[0118] In some embodiments, about 1 x 10 10 gc / kg ~ approx. 1×10 14 gc / kg (e.g., 1 × 10 10 gc / kg, 1 × 10 11 gc / kg, 1 × 10 12 gc / kg, 1 × 10 13 gc / kg, or 1 × 10 14 In some embodiments, at least about 1 x 10 gc / kg of a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease is administered to the subject. 10 gc / kg, at least about 1 × 10 11 gc / kg, at least about 1 × 10 12 gc / kg, at least about 1 × 10 13gc / kg, or at least about 1 × 10 14 gc / kg of a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease is administered to a subject. In some embodiments, about 1 x 10 10 gc / kg ~ approx. 1×10 11 gc / kg, approximately 1×10 11 gc / kg ~ approx. 1×10 12 gc / kg, approximately 1×10 12 gc / kg ~ approx. 1×10 13 gc / kg, or approximately 1 × 10 13 gc / kg ~ approx. 1×10 14 gc / kg of a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease is administered to a subject. In certain embodiments, about 1 x 10 12 gc / kg ~ approx. 9×10 13 gc / kg (e.g., approximately 1 × 10 12 gc / kg, approx. 2×10 12 gc / kg, approx. 3×10 12 gc / kg, approx. 4×10 12 gc / kg, approx. 5×10 12 gc / kg, approximately 6×10 12 gc / kg, approximately 7×10 12 gc / kg, approximately 8×10 12 gc / kg, approx. 9×10 12 gc / kg, approximately 1×10 13 gc / kg, approx. 2×10 13 gc / kg, approx. 3×10 13 gc / kg, approx. 4×10 13 gc / kg, approx. 5×10 13 gc / kg, approximately 6×10 13 gc / kg, approximately 7×10 13 gc / kg, approximately 8×10 13 gc / kg, or approximately 9 × 10 13 gc / kg) of a polynucleotide comprising a nucleic acid sequence encoding the engineered meganuclease is administered to the subject.

[0119] In some embodiments, circulating TTR levels are reduced in the subject relative to a reference control.

[0120] In some embodiments, the level is reduced in one or more organs of the subject, hi some embodiments, the organs include the brain, heart, kidney, eye, large intestine, small intestine, liver, or a combination thereof.

[0121] In some embodiments, TTR levels are reduced in one or more tissues of the subject relative to a reference control, hi some embodiments, the tissue comprises nervous tissue, muscle tissue, connective tissue, or meningeal tissue, or a combination thereof.

[0122] In some such embodiments, the level of TTR is reduced by about 10% to about 80% relative to a reference control. In some embodiments, the level of TTR is reduced by about 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80%, or more relative to the reference level. In some such embodiments, the level of TTR is reduced by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, or more relative to the reference level.

[0123] In some embodiments, TTR amyloid formation is reduced in a subject relative to a reference control. In some embodiments, TTR amyloid formation is reduced by about 10% to about 100% relative to a reference control. In some embodiments, TTR amyloid formation is reduced by about 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%, or 90% to 100% relative to the reference level. In some embodiments, TTR amyloid formation is reduced by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, or about 100% relative to reference levels.

[0124] In another aspect, the present invention provides a method for treating TTR amyloidosis or a TTR-related disease in a subject in need thereof, comprising delivering to a target cell in the subject a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease described herein, wherein the engineered meganuclease is expressed in the target cell, wherein the engineered meganuclease generates a cleavage site in a TTR gene with a recognition sequence comprising SEQ ID NO:7 or SEQ ID NO:9, and wherein expression of the TTR gene is disrupted by non-homologous end joining at the cleavage site.

[0125] In some embodiments, the methods comprise administering to a subject an effective amount of any of the pharmaceutical compositions of the present invention.

[0126] In some embodiments, the method generates a modified TTR gene in a target cell that does not encode a full-length endogenous TTR polypeptide. In some embodiments, expression of full-length endogenous TTR protein by the target cell is reduced compared to control cells. In some embodiments, expression of full-length endogenous TTR protein is reduced in the subject relative to a control subject.

[0127] In some embodiments of the method, the target cell is a mammalian cell. In some embodiments, the mammalian cell is selected from a human cell, a non-human primate cell, or a mouse cell. In certain embodiments, the mammalian cell is a liver cell, such as a hepatocyte. In some embodiments, the liver cell is in the liver of a human, a non-human primate, or a mouse. In some embodiments, the liver cell is a hepatic progenitor cell or stem cell.

[0128] In some embodiments, the polynucleotide is mRNA. In some embodiments, the polynucleotide is DNA (i.e., a recombinant DNA construct).

[0129] In some embodiments, the polynucleotide is encapsulated in a lipid nanoparticle, and the lipid nanoparticle is delivered to target cells of a subject.

[0130] In some embodiments, the polynucleotide is delivered to the target cell by a recombinant virus containing the polynucleotide. In some such embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant AAV. In certain embodiments, the recombinant virus is a recombinant AAV.

[0131] In some embodiments, the method is effective to reduce TTR levels in the subject relative to a reference level.

[0132] In some embodiments, circulating TTR levels are reduced in the subject relative to a reference control.

[0133] In some embodiments, TTR levels in one or more organs of the subject are reduced relative to a reference control, in some embodiments, the organs include the brain, heart, kidney, eye, large intestine, small intestine, liver, or a combination thereof.

[0134] In some embodiments, TTR levels are reduced in one or more tissues of the subject relative to a reference control, hi some embodiments, the tissue comprises nervous tissue, muscle tissue, connective tissue, or meningeal tissue, or a combination thereof.

[0135] In some such embodiments, the level of TTR is reduced by about 10% to about 80% relative to a reference control. In some embodiments, the level of TTR is reduced by about 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, or 70% to 80% relative to the reference level. In some such embodiments, the level of TTR is reduced by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, or more relative to the reference level.

[0136] In some embodiments, TTR amyloid formation is reduced in a subject relative to a reference control. In some embodiments, TTR amyloid formation is reduced by about 10% to about 100% relative to a reference control. In some embodiments, TTR amyloid formation is reduced by about 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%, or 90% to 100% relative to the reference level. In some embodiments, TTR amyloid formation is reduced by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, or about 100% relative to reference levels.

[0137] In some embodiments, the subject is a human subject.

[0138] In some embodiments, the subject has a mutation in the TTR gene that affects one or more tissues, including the peripheral nervous system, autonomic nervous system, pia mater, or heart.

[0139] In some embodiments, the subject has one or more of the following amino acids: Gly6Ser, Cys10Arg, Leu12Pro, Aspl8Gly, Val20Ile, Ala25Thr, Val30Met, Val30Ala, Val30Leu, Val30Gly, Phe33Ile, Phe33Leu, Ala36Pro, Glu42Gly, Phe44Ser, Ala45Thr, Gly47Arg, Gly47Ala, Gly47Arg, Thr49Ala, Ser50Arg, Ser50Ile, Gly53Glu, Leu55Pro, Leu58His, Leu58Arg, Thr60Ala, Glu61Lys , Phe64Leu, Phe64Ser, Ile68Leu, Tyr69His, Lys70Asn, Val71Ala, Ser77Tyr, Ile84Ser, Glu89Gln, His90Asn, Ala97Gly, Ala97Ser, Arg104His, Ile107Val, Ala109Thr, Ala109Val, Leu111Met, Tyr114Cys, Tyr114His, Tyr116Val, Thr119Met, Val122Ile, Val122Del, or a combination thereof.

[0140] In another aspect, the present invention provides an engineered meganuclease described herein for use as a medicament. The present invention further provides use of an engineered meganuclease described herein in the manufacture of a medicament for treating a disease in a subject in need thereof (e.g., a subject with transthyretin amyloidosis) and / or for reducing the level of TTR in a subject.

[0141] In another aspect, the present invention provides a polynucleotide for use as a medicament, the polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease disclosed herein. The present invention further provides use of the polynucleotide in the manufacture of a medicament for treating a disease in a subject in need thereof (e.g., a subject with transthyretin amyloidosis) and / or for reducing the level of TTR in a subject.

[0142] In another aspect, the present invention provides a method for modifying a TTR gene in a target cell in a subject, the method comprising delivering to the target cell: (a) a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease described herein, wherein the engineered meganuclease is expressed in the target cell; or (b) an engineered meganuclease described herein, wherein the engineered meganuclease generates a cleavage site in the TTR gene at a recognition sequence comprising SEQ ID NO:7 or SEQ ID NO:9, resulting in a modified TTR gene in the target cell.

[0143] In some embodiments, the cleavage site is repaired by non-homologous end joining and the modified TTR gene contains an insertion or deletion that disrupts expression of the encoded TTR protein.

[0144] In some embodiments, the modified TTR gene does not encode the full-length endogenous TTR protein.

[0145] In some embodiments, expression of full-length endogenous TTR protein by target cells is reduced compared to control cells.

[0146] In some embodiments, expression of full-length endogenous TTR protein is reduced in the subject relative to a control subject.

[0147] In some embodiments, the subject is a mammal.

[0148] In some aspects, the target cells are liver cells, hi some embodiments, the target cells are hepatic progenitor or stem cells.

[0149] In some embodiments, the subject is a human.

[0150] In some embodiments, the polynucleotide is an mRNA, such as the mRNAs described herein.

[0151] In some embodiments, the polynucleotide is a recombinant DNA construct, such as a recombinant DNA construct described herein.

[0152] In some embodiments, the polynucleotide is delivered to the target cell by a lipid nanoparticle.

[0153] In some embodiments, the polynucleotide is delivered to the target cell by a recombinant virus, such as any of the recombinant viruses described herein.

[0154] In some embodiments, target cells containing a modified TTR gene contain reduced levels of full-length endogenous TTR protein compared to subject cells.

[0155] In some embodiments, the subject comprises reduced serum levels of full-length endogenous TTR protein compared to control subjects after modification of the TTR gene in the target cells.

[0156] In some embodiments, the subject exhibits a reduction in one or more symptoms of an ATTR or TTR-related disease after modification of the TTR gene in the target cells, compared to a control subject.

[0157] In some embodiments, the subject has a mutation in the TTR gene that affects one or more tissues, including the peripheral nervous system, autonomic nervous system, pia mater, or heart.

[0158] In some embodiments, the subject has one or more of the following nucleotides: Gly6Ser, Cys10Arg, Leu12Pro, Aspl8Gly, Val20Ile, Ala25Thr, Val30Met, Val30Ala, Val30Leu, Val30Gly, Phe33Ile, Phe33Leu, Ala36Pro, Glu42Gly, Phe44Ser, Ala45Thr, Gly47Arg, Gly47Ala, Gly47Arg, Thr49Ala, Ser50Arg, Ser50Ile, Gly53Glu, Leu55Pro, Leu58His, Leu58Arg, Thr60Ala, have a mutation in the TTR gene including Glu61Lys, Phe64Leu, Phe64Ser, Ile68Leu, Tyr69His, Lys70Asn, Val71Ala, Ser77Tyr, Ile84Ser, Glu89Gln, His90Asn, Ala97Gly, Ala97Ser, Arg104His, Ile107Val, Ala109Thr, Ala109Val, Leu111Met, Tyr114Cys, Tyr114His, Tyr116Val, Thr119Met, Val122Ile, Val122Del, or a combination thereof. [Brief explanation of the drawings]

[0159] [Figure 1] 1 shows the TTR15-16 recognition sequence in the human TTR gene. The TTR15-16 recognition sequence targeted by the recombinant meganuclease of the present invention contains two recognition half-sites. Each recognition half-site contains 9 base pairs separated by a 4-base pair central sequence. The TTR15-16 recognition sequence (SEQ ID NO: 7) spans nucleotides 3,377 to 3,398 of the human TTR gene (SEQ ID NO: 3) and contains two recognition half-sites designated TTR15-16(1) and TTR15-16(2). [Figure 2]1 shows the TTR5-6 recognition sequence in the human TTR gene. The TTR5-6 recognition sequence targeted by the recombinant meganuclease of the present invention contains two recognition half-sites. Each recognition half-site contains 9 base pairs separated by a 4-base pair central sequence. The TTR5-6 recognition sequence (SEQ ID NO: 9) spans nucleotides 170 to 191 of the human TTR gene (SEQ ID NO: 3) and contains two recognition half-sites designated TTR5-6(1) and TTR5-6(2). [Figure 3] The recombinant meganucleases described herein comprise two subunits, with a first subunit comprising the HVR1 region binding to a first recognition half-site (e.g., TTR5-6(1)) and a second subunit comprising the HVR2 region binding to a second recognition half-site (e.g., TTR5-6(2)). In embodiments where the recombinant meganuclease is a single-chain meganuclease, the first subunit comprising the HVR1 region can be positioned as either the N- or C-terminal subunit. Similarly, the second subunit comprising the HVR2 region can be positioned as either the N- or C-terminal subunit. [Figure 4A] FIG. 1 shows the sequence of the TTR5-6L.1204 meganuclease. [Figure 4B] Figure 1 shows a multiple sequence alignment between the TTR15-16L.164, TTR15-16L.161, TTR15-16x.81 and TTR15-16L.181 meganucleases. Asterisks indicate conserved residues among all aligned nucleases, and spaces indicate that at least one amino acid differs between the meganucleases. [Figure 5]Schematic diagram of a reporter assay in CHO cells to evaluate recombinant meganucleases targeting the recognition sequence (SEQ ID NO: 3) found in the TTR gene. For the recombinant meganucleases described herein, CHO cell lines were generated in which a reporter cassette was stably integrated into the cell's genome. The reporter cassette contained, in 5' to 3' order, the SV40 early promoter, the 5' 2 / 3 of the GFP gene, the recognition sequence for an engineered meganuclease described herein (e.g., the TTR5-6 or 15-16 recognition sequence); the recognition sequence for the CHO-23 / 24 meganuclease (WO / 2012 / 167192); and the 3' 2 / 3 of the GFP gene. Cells stably transfected with this cassette did not express GFP in the absence of a DNA cleavage-inducing agent. Meganucleases were introduced by transduction of mRNA encoding each meganuclease. When DNA breaks were induced at either of the meganuclease recognition sequences, the overlapping regions of the GFP gene recombined with each other to generate a functional GFP gene.The percentage of GFP-expressing cells could then be determined by flow cytometry as an indirect measure of the frequency of genome cleavage by the meganuclease. [Figure 6A-B] Figure 6 shows the efficiency of the engineered TTR5-6 meganuclease described herein to recognize and cleave human and non-human primate (NHP) recognition sequences in a CHO cell reporter assay. Activity indices represent the % GFP-positive cells for each cell line expressing the test meganuclease normalized to a cell line expressing the CHO-23 / 24 meganuclease, which accounts for the toxicity of the meganuclease. Figure 6A shows the results using the human recognition sequence, and Figure 6B shows the results using the model NHP recognition sequence. [Figure 7A-B] 7A and 7B are bar graphs showing the percentage of insertion and deletion (indel) frequencies of tested meganucleases targeting the TTR5-6 recognition sequence in HepG2 cells (FIG. 7A) and HEK293 cells (FIG. 7B). Meganucleases were tested at three time points (days 2, 6, and 9) after meganuclease transfection. [Figure 8]

[0023] Figure 1 shows the efficiency of engineered TTR15-16 meganucleases described herein to recognize and cleave the TTR15-16 recognition sequence in a CHO cell reporter assay. The activity index represents the % GFP-positive cells for each cell line expressing the tested meganuclease normalized to the cell line expressing CHO-23 / 24 meganuclease, which accounts for the toxicity of the meganuclease. [Figure 9A-C] 9A and 9B are bar graphs showing the percentage of insertion and deletion (indel) frequencies of TTR15-16x.81 meganuclease targeting the TTR15-16 recognition sequence in HepG2 cells (FIG. 9A) and HEK293 cells (FIG. 9B). The meganuclease was tested at two time points (day 2 and day 7) after transfection of the meganuclease in FIG. 9A and FIG. 9B. The dose-response curves of TTR15-16x.81 meganuclease in HepG2, HEK293, and Hep3B cells are shown in FIG. 9C. [Figure 10A-B] 10A and 10B are graphs showing indel frequencies in primary human hepatocytes transfected with the indicated amounts of TTR15-16x.81 mRNA. In Figure 10A, gray and black bars indicate indels measured at day 1 (D1) and day 7 (D7) after transfection, respectively. In Figure 10B, bars indicate indels measured at D7 at the indicated concentrations of meganuclease administered. [Figure 11] Figure 1 shows the indel frequency in FVB mice administered 5x10 VG AAV8 TTR5-6L.1204. Four weeks after AAV administration, mice were euthanized and liver tissue was collected for gDNA isolation and indel analysis by digital droplet PCR (ddPCR). [Figure 12]A bar graph showing the percentage of targeted insertions and deletions in endogenous non-human primates (NHPs) at the 5-6 target site by amplicon sequencing PCR analysis from liver gDNA collected at necropsy (day 364 after AAV administration). AAV containing the TTR5-6L.1204 meganuclease targeting the 5-6 recognition sequence was introduced into rhesus macaques at two concentrations: 6 x 10 GC / kg (animals RA3330 and RA3385) and 3 x 10 GC / kg (animals 15D003 and 15D020). [Figure 13] Figure 1 is a bar graph showing the abundance of AAV genomes per diploid cell as measured by ddPCR in liver samples from each animal taken at necropsy (day 364). AAV containing the TTR5-6L.1204 meganuclease was transduced into rhesus macaques at two concentrations: 6 x 10 12 [black bars] and 3 x 10 13 GC / kg [gray bars]. [Figure 14A-C] Bar graphs showing the percentage of targeted insertions and deletions in the TTR15-16 recognition sequence by amplicon NGS sequencing (FIG. 14A) and ddPCR (FIG. 14B) from liver biopsies taken 18 days (d18) after AAV administration. AAV containing the TTR15-16x.81 meganuclease targeting the 15-16 recognition sequence was transduced into rhesus macaques at two concentrations: 6×10 12 [black bars] and 3×10 13 GC / kg [gray bars]. Figure 14C shows the percentage of indels at d18 and 128 days (d128) post-AAV administration, representing the same data as shown in Figure 14B, assessed by ddPCR at two different doses (6x1012 [animals 1305048 and 1404128] and 3x1013 GC / kg [animals 1305168 and T1466224]). [Figure 15]1 is a bar graph showing the abundance of AAV genomes per diploid cell as measured by ddPCR in liver samples from each animal taken on day 18 and day 128. AAV containing the TTR5-6L.1204 meganuclease was transduced into rhesus macaques at two concentrations: 6 x 10 12 [animals 1305048 and 1404128] and 3 x 10 13 GC / kg [animals 1305168 and T1466224]. [Figure 16] A line graph showing serum TTR levels in NHPs administered AAV8 containing 6 x 10 GC / kg (black line) or 3 x 10 GC / kg (gray line) of TTR15-16x.81 meganuclease. The x-axis indicates days before (-7) and after (7-259) vector administration.

[0160] A brief description of arrays

[0161] SEQ ID NO: 1 shows the amino acid sequence of the wild-type I-CreI meganuclease from Chlamydomonas reinhardtii.

[0162] SEQ ID NO: 2 shows the amino acid sequence of the LAGLIDADG motif.

[0163] SEQ ID NO: 3 shows the nucleic acid sequence of the human TTR gene sequence (NCBI gene ID: 7276).

[0164] SEQ ID NO: 4 shows the amino acid sequence of the human TTR protein sequence.

[0165] SEQ ID NO: 5 shows the amino acid sequence of the mature human TTR protein sequence (the 127 amino acid processed protein without the first 20 amino acids that are part of the presegment).

[0166] SEQ ID NO: 6 shows the amino acid sequence of the mature human TTR protein sequence with the amino acid substitution V30M.

[0167] SEQ ID NO: 7 shows the nucleic acid sequence of the sense strand of the TTR15-16 recognition sequence.

[0168] SEQ ID NO: 8 shows the nucleic acid sequence of the antisense strand of the TTR15-16 recognition sequence.

[0169] SEQ ID NO: 9 shows the nucleic acid sequence of the sense strand of the TTR5-6 recognition sequence.

[0170] SEQ ID NO: 10 shows the nucleic acid sequence of the antisense strand of the TTR5-6 recognition sequence.

[0171] SEQ ID NO: 11 shows the amino acid sequence of the TTR15-16x.81 meganuclease.

[0172] SEQ ID NO: 12 shows the amino acid sequence of the TTR15-16L.161 meganuclease.

[0173] SEQ ID NO: 13 shows the amino acid sequence of the TTR15-16L.164 meganuclease.

[0174] SEQ ID NO: 14 shows the amino acid sequence of the TTR15-16L.181 meganuclease.

[0175] SEQ ID NO: 15 shows the amino acid sequence of the TTR5-6L.1204 meganuclease.

[0176] SEQ ID NO: 16 shows the amino acid sequence of the TTR15-16x.81 meganuclease TTR15-binding subunit.

[0177] SEQ ID NO: 17 shows the amino acid sequence of the TTR15-16L.161 meganuclease TTR15-binding subunit.

[0178] SEQ ID NO: 18 shows the amino acid sequence of the TTR15-16L.164 meganuclease TTR15-binding subunit.

[0179] SEQ ID NO: 19 shows the amino acid sequence of the TTR15-16L.181 meganuclease TTR15-binding subunit.

[0180] SEQ ID NO: 20 shows the amino acid sequence of the TTR15-16x.81 meganuclease TTR16 binding subunit.

[0181] SEQ ID NO: 21 shows the amino acid sequence of the TTR15-16L.161 meganuclease TTR16-binding subunit.

[0182] SEQ ID NO: 22 shows the amino acid sequence of the TTR15-16L.164 meganuclease TTR16-binding subunit.

[0183] SEQ ID NO: 23 shows the amino acid sequence of the TTR15-16L.181 meganuclease TTR16-binding subunit.

[0184] SEQ ID NO: 24 shows the amino acid sequence of the TTR5-6L.1204 meganuclease TTR5 binding subunit.

[0185] SEQ ID NO: 25 shows the amino acid sequence of the TTR5-6L.1204 meganuclease TTR6 binding subunit.

[0186] SEQ ID NO: 26 shows the nucleic acid sequence of the sense strand of the TTR15 half-site recognition sequence.

[0187] SEQ ID NO: 27 shows the nucleic acid sequence of the antisense strand of the TTR15 half-site recognition sequence.

[0188] SEQ ID NO: 28 shows the nucleic acid sequence of the sense strand of the TTR16 half-site recognition sequence.

[0189] SEQ ID NO: 29 shows the nucleic acid sequence of the sense and antisense strands of the TTR16 half-site recognition sequence.

[0190] SEQ ID NO: 30 shows the nucleic acid sequence of the sense strand of the TTR5 half-site recognition sequence.

[0191] SEQ ID NO: 31 shows the nucleic acid sequence of the antisense strand of the TTR5 half-site recognition sequence.

[0192] SEQ ID NO: 32 shows the nucleic acid sequence of the sense strand of the TTR6 half-site recognition sequence.

[0193] SEQ ID NO: 33 shows the nucleic acid sequence of the sense and antisense strands of the TTR6 half-site recognition sequence.

[0194] SEQ ID NO: 34 shows the TTR5-6 model NHP recognition sequence used in the GFP reporter assays of Examples 1 and 3.

[0195] SEQ ID NO: 35 shows the nucleic acid sequence of an artificial probe used in a digital PCR assay to assess the % indels at the TTR5-6 site in human cells.

[0196] SEQ ID NO: 36 shows the nucleic acid sequence of an artificial forward primer used in a digital PCR assay to assess the % indels at the TTR5-6 site in human cells.

[0197] SEQ ID NO: 37 shows the nucleic acid sequence of the artificial reverse primer used in a digital PCR assay to assess the % indels at the TTR5-6 site in human cells.

[0198] SEQ ID NO: 38 shows the nucleic acid sequence of an artificial probe used in a reference level digital PCR assay to assess the % indels at the TTR5-6 site in human cells.

[0199] SEQ ID NO: 39 shows the nucleic acid sequence of the artificial forward primer used in the reference level digital PCR assay to assess the % indels at the TTR5-6 site in human cells.

[0200] SEQ ID NO: 40 shows the nucleic acid sequence of the artificial reverse primer used in the reference level digital PCR assay to assess the % indels at the TTR5-6 site in human cells.

[0201] SEQ ID NO: 41 shows the nucleic acid sequence of an artificial probe used in a digital PCR assay to assess the % indels at the TTR15-16 site in human cells.

[0202] SEQ ID NO: 42 shows the nucleic acid sequence of an artificial forward primer used in a digital PCR assay to assess the % indels at the TTR15-16 site in human cells.

[0203] SEQ ID NO: 43 shows the nucleic acid sequence of the artificial reverse primer used in a digital PCR assay to assess the % indels at the TTR15-16 site in human cells.

[0204] SEQ ID NO: 44 shows the nucleic acid sequence of an artificial probe used in a reference level digital PCR assay to assess the % indels at the TTR15-16 site in human cells.

[0205] SEQ ID NO: 45 shows the nucleic acid sequence of the artificial forward primer used in the reference level digital PCR assay to assess the % indels at the TTR15-16 site in human cells.

[0206] SEQ ID NO: 46 shows the nucleic acid sequence of the artificial reverse primer used in the reference level digital PCR assay to assess the % indels at the TTR15-16 site in human cells.

[0207] SEQ ID NO: 47 shows the nucleic acid sequence of the artificial forward primer used in the reference level digital PCR assay to assess the % indels at the TTR5-6 site in mouse cells.

[0208] SEQ ID NO: 48 shows the nucleic acid sequence of the artificial reverse primer used in the reference level digital PCR assay to assess the % indels at the TTR5-6 site in mouse cells.

[0209] SEQ ID NO: 49 shows the nucleic acid sequence of an artificial probe used in a digital PCR assay to assess the % indels at the TTR5-6 site in mouse cells.

[0210] SEQ ID NO: 50 shows the nucleic acid sequence of an artificial probe used in a reference level digital PCR assay to assess the % indels at the TTR5-6 site in mouse cells.

[0211] SEQ ID NO: 51 shows the nucleic acid sequence of an artificial forward primer used in a digital PCR assay to assess the % indels at the TTR5-6 site in non-human primates.

[0212] SEQ ID NO: 52 shows the nucleic acid sequence of the artificial reverse primer used in the digital PCR assay to assess the % indels at the TTR5-6 site in non-human primates.

[0213] SEQ ID NO: 53 shows the nucleic acid sequence of an artificial probe used in a digital PCR assay to assess the % indels at the TTR5-6 site in non-human primates.

[0214] SEQ ID NO: 54 shows the nucleic acid sequence of the artificial forward primer used in the digital PCR assay to assess the % indels at the TTR5-6 site in non-human primates.

[0215] SEQ ID NO: 55 shows the nucleic acid sequence of the artificial reverse primer used in the digital PCR assay to assess the % indels at the TTR5-6 site in non-human primates.

[0216] SEQ ID NO: 56 shows the nucleic acid sequence of an artificial probe used in a digital PCR assay to assess the % indels at the TTR5-6 site in non-human primates.

[0217] SEQ ID NO: 57 shows the nucleic acid sequence of an artificial forward primer used in a digital PCR assay to assess AAV copy number in non-human primates transduced with AAV encoding TTR5-6L.1204 or TTR15-16x.81 meganuclease.

[0218] Sequence number 58 shows the nucleic acid sequence of an artificial reverse primer used in a reference level digital PCR assay to assess AAV copy number in non-human primates transduced with AAV encoding TTR5-6L.1204 or TTR15-16x.81 meganuclease.

[0219] SEQ ID NO: 59 shows the nucleic acid sequence of an artificial probe used in a digital PCR assay to assess AAV copy number in non-human primates transduced with AAV encoding TTR5-6L.1204 or TTR15-16x.81 meganuclease.

[0220] Sequence number 60 shows the nucleic acid sequence of an artificial forward primer used in a reference level digital PCR assay to assess AAV copy number in non-human primates transduced with AAV encoding TTR5-6L.1204 or TTR15-16x.81 meganuclease.

[0221] Sequence number 61 shows the nucleic acid sequence of an artificial reverse primer used in a reference level digital PCR assay to assess AAV copy number in non-human primates transduced with AAV encoding TTR5-6L.1204 or TTR15-16x.81 meganuclease.

[0222] SEQ ID NO: 62 shows the nucleic acid sequence of an artificial probe used in a digital PCR assay to assess AAV copy number in non-human primates transduced with AAV encoding TTR5-6L.1204 or TTR15-16x.81 meganuclease.

[0223] SEQ ID NO: 63 shows the nucleic acid sequence of an artificial forward primer used in a digital PCR assay to assess the % indels at the TTR15-16 site in non-human primates.

[0224] SEQ ID NO: 64 shows the nucleic acid sequence of the artificial reverse primer used in the digital PCR assay to assess the % indels at the TTR15-16 site in non-human primates.

[0225] SEQ ID NO: 65 shows the amino acid sequence of the polypeptide linker.

[0226] SEQ ID NO: 66 shows the amino acid sequence of the TTR15-16x.81 meganuclease.

[0227] SEQ ID NO: 67 shows the amino acid sequence of the TTR15-16L.161 meganuclease.

[0228] SEQ ID NO: 68 shows the amino acid sequence of the TTR15-16L.164 meganuclease.

[0229] SEQ ID NO: 69 shows the amino acid sequence of the TTR15-16L.181 meganuclease.

[0230] SEQ ID NO: 70 shows the amino acid sequence of the TTR5-6L.1204 meganuclease. DETAILED DESCRIPTION OF THE INVENTION

[0231] Detailed Description of the Invention 1.1 References and Definitions

[0232] The patent and scientific literature referred to herein establishes knowledge that is available to those skilled in the art. References cited herein, including issued U.S. patents, allowed applications, published foreign applications, and GenBank database sequences, are incorporated herein by reference to the same extent as if each were specifically and individually indicated to be incorporated by reference.

[0233] The present invention may be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art. For example, features illustrated with respect to one embodiment can be incorporated into other embodiments, and features illustrated with respect to a particular embodiment can be deleted from that embodiment. Additionally, numerous modifications and additions to the embodiments proposed herein will be apparent to those skilled in the art in light of this disclosure without departing from the invention.

[0234] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0235] All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.

[0236] As used herein, "a," "an," or "the" can mean one or more. For example, "a" cell can mean a single cell or multiple cells.

[0237] As used herein, unless otherwise expressly stated, the word "or" is used in the inclusive sense of "and / or" and not in the exclusive sense of "either / or."

[0238] As used herein, the terms "nuclease" and "endonuclease" are used interchangeably to refer to naturally occurring or engineered enzymes that cleave phosphodiester bonds within a polynucleotide chain.

[0239] As used herein, the term "cleave" or "cleavage" refers to the hydrolysis of a phosphodiester bond in the backbone of a recognition sequence within a target sequence, resulting in a double-stranded break within the target sequence, referred to herein as the "cleavage site."

[0240] As used herein, the term "meganuclease" refers to an endonuclease that binds to double-stranded DNA with a recognition sequence greater than 12 base pairs. In some embodiments, the recognition sequence of the meganuclease of the present disclosure is 22 base pairs. Meganucleases may be endonucleases derived from I-CreI (SEQ ID NO: 1) and may refer to engineered variants of I-CreI that have been modified relative to native I-CreI, for example, in terms of DNA-binding specificity, DNA-cleavage activity, DNA-binding affinity, or dimerization properties. Methods for producing such modified variants of I-CreI are known in the art (e.g., WO2007 / 047859, incorporated by reference in its entirety). Meganucleases as used herein bind to double-stranded DNA as heterodimers. Meganucleases may also be "single-chain meganucleases" in which a pair of DNA-binding domains are linked to a single polypeptide using a peptide linker. The term "homing endonuclease" is synonymous with the term "meganuclease." The meganucleases of the present disclosure are substantially non-toxic when expressed in targeted cells as described herein, such that the cells can be transfected and maintained at 37°C without observing any adverse effects on cell viability or significant reduction in meganuclease cleavage activity, as measured using the methods described herein.

[0241] As used herein, the term "single-chain meganuclease" refers to a polypeptide comprising a pair of nuclease subunits connected by a linker. Single-chain meganucleases have the following structure: N-terminal subunit-linker-C-terminal subunit. The two meganuclease subunits generally do not have identical amino acid sequences and bind to non-identical DNA sequences. Therefore, single-chain meganucleases typically cleave pseudo-palindromic or non-palindromic recognition sequences. Although single-chain meganucleases are not actually dimeric, they are sometimes referred to as "single-chain heterodimers" or "single-chain heterodimeric meganucleases." For clarity, unless otherwise specified, the term "meganuclease" can refer to dimeric or single-chain meganucleases.

[0242] As used herein, the term "linker" refers to an exogenous peptide sequence used to link two nuclease subunits into a single polypeptide. The linker may have a sequence found in a natural protein, or it may be an artificial sequence not found in a natural protein. The linker may be flexible and lacking secondary structure, or it may have a tendency to form a specific three-dimensional structure under physiological conditions. Linkers may include, but are not limited to, those contained in U.S. Patent Nos. 8,445,251, 9,340,777, 9,434,931, and 10,041,053, each of which is incorporated by reference in its entirety. In some embodiments, the linker can have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more sequence identity to SEQ ID NO: 65, which sets forth residues 154-195 of any one of SEQ ID NOs: 11-15. In some embodiments, the linker can have an amino acid sequence comprising SEQ ID NO: 51, which sets forth residues 154-195 of any one of SEQ ID NOs: 11-15.

[0243] As used herein, the terms "recombinant" or "engineered" with respect to a protein mean having an altered amino acid sequence as a result of the application of genetic engineering techniques to the nucleic acid encoding the protein and the cell or organism expressing the protein. With respect to a nucleic acid, the terms "recombinant" or "engineered" mean having an altered nucleic acid sequence as a result of the application of genetic engineering techniques. Genetic engineering techniques include, but are not limited to, PCR and DNA cloning techniques; transfection, transformation and other gene transfer techniques; homologous recombination; site-directed mutagenesis; and gene fusion. According to this definition, a protein having an amino acid sequence identical to a naturally occurring protein but produced by cloning and expression in a heterologous host is not considered recombinant or engineered.

[0244] As used herein, the term "wild-type" refers to the most common naturally occurring allele (i.e., polynucleotide sequence) in a population of alleles of the same type of gene, in which the polypeptide encoded by the wild-type allele retains its original function. The term "wild-type" also refers to the polypeptide encoded by the wild-type allele. Wild-type alleles (i.e., polynucleotides) and polypeptides can be distinguished from mutant or variant alleles and polypeptides that contain one or more mutations and / or substitutions relative to the wild-type sequence. A wild-type allele or polypeptide can confer a normal phenotype in an organism, while a mutant or variant allele or polypeptide can, in some cases, confer an altered phenotype. A wild-type nuclease can be distinguished from a recombinant nuclease or a non-naturally occurring nuclease. The term "wild-type" can also refer to a cell, organism, and / or subject that has a wild-type allele of a particular gene, or a cell, organism, and / or subject used for comparison purposes.

[0245] As used herein, the term "genetically modified" refers to a cell or organism whose genomic DNA sequence has been intentionally modified by recombinant technology, or whose ancestors have had their genomic DNA sequence intentionally modified by recombinant technology. As used herein, the term "genetically modified" encompasses the term "transgenic."

[0246] As used herein, the term "modification" in reference to a recombinant protein refers to any insertion, deletion, or substitution of amino acid residues in the recombinant sequence relative to a reference sequence (e.g., a wild-type or native sequence).

[0247] As used herein, the term "recognition sequence" or "recognition site" refers to a DNA sequence that is bound and cleaved by a nuclease. In meganucleases, the recognition sequence comprises a pair of inverted 9-base pair "half-sites" separated by 4 base pairs. In single-chain meganucleases, the N-terminal domain of the protein contacts the first half-site, and the C-terminal domain of the protein contacts the second half-site. Cleavage by a meganuclease results in a 4-base pair 3' overhang. An "overhang" or "sticky end" is a short single-stranded DNA segment that can be generated by endonuclease cleavage of a double-stranded DNA sequence. In the case of meganucleases derived from I-CreI and single-chain meganucleases, the overhang comprises bases 10-13 of the 22-base pair recognition sequence.

[0248] As used herein, the term "target site" or "target sequence" refers to a region of a cell's chromosomal DNA that contains a recognition sequence for a nuclease.

[0249] As used herein, the term "DNA binding affinity" or "binding affinity" refers to the tendency of a nuclease to bind non-covalently to a reference DNA molecule (e.g., a recognition sequence or any sequence). Binding affinity is measured by the dissociation constant Kd. As used herein, a nuclease has "altered" binding affinity if the Kd of the nuclease for the reference recognition sequence increases or decreases by a statistically significant percentage change relative to the reference nuclease.

[0250] As used herein, the term "specificity" refers to the ability of a nuclease to bind to and cut double-stranded DNA molecules only at a specific sequence of base pairs called recognition sequences, or at a specific set of recognition sequences.A set of recognition sequences share a certain conserved position or sequence motif, but can be degenerate at one or more positions.A highly specific nuclease can cut only one or a very small number of recognition sequences.Specificity can be determined by any method known in the art.

[0251] As used herein, the term "homologous recombination" or "HR" refers to the natural cellular process of repairing double-stranded DNA breaks using homologous DNA sequences as repair templates (see, for example, Cahill et al. (2006), Front.Biosci.11:1958-1976).The homologous DNA sequence can be an endogenous chromosomal sequence or an exogenous nucleic acid delivered to cells.

[0252] As used herein, the term "non-homologous end joining" or "NHEJ" refers to the natural cellular process in which double-stranded DNA breaks are repaired by the direct joining of two non-homologous DNA segments (see, for example, Cahill et al. (2006), Front. Biosci. 11:1958-1976). DNA repair by non-homologous end joining is prone to errors and frequently results in the untemplated addition or deletion of DNA sequences at the repair site. In some instances, cleavage at the target recognition sequence results in NHEJ at the target recognition site. Nuclease-induced cleavage of the target site in the coding sequence of a gene followed by DNA repair by NHEJ can introduce mutations, such as frameshift mutations, into the coding sequence, which disrupt gene function. Therefore, engineered nucleases can be used to effectively knock out genes in a cell population.

[0253] As used herein, the term "homologous arms" or "sequences homologous to sequences adjacent to a nuclease cleavage site" refers to sequences adjacent to the 5' and 3' ends of a nucleic acid molecule that facilitate insertion of the nucleic acid molecule into the cleavage site generated by the nuclease. Generally, homologous arms can have a length of at least 50 base pairs, preferably at least 100 base pairs, and up to 2000 base pairs or more, and can have at least 90%, preferably at least 95% or more sequence homology with their corresponding sequences in the genome. In some embodiments, the homologous arms are approximately 500 base pairs.

[0254] As used herein, for both amino acid and nucleic acid sequences, terms such as "percent identity," "sequence identity," "percentage similarity," "sequence similarity," and the like refer to a measure of the degree of similarity between two sequences based on the alignment of sequences that maximizes the similarity between aligned amino acid residues or nucleotides and is a function of the number of identical or similar residues or nucleotides, the total number of residues or nucleotides, and the presence and length of gaps in the sequence alignment. A variety of algorithms and computer programs are available for determining sequence similarity using standard parameters. As used herein, sequence similarity is measured using the BLASTp program for amino acid sequences and the BLASTn program for nucleic acid sequences, both of which are available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ) and are described, for example, in Altschul et al. (1990), J. Mol. Biol. 215:403-410; Gish and States (1993), Nature Genet. 3:266-272; Madden et al. (1996), Meth. Enzymol. 266:131-141; Altschul et al. (1997), Nucleic Acids Res. 25:33 89-3402; Zhang et al. (2000), J. Comput. Biol. 7(1-2):203-14. As used herein, the percent similarity of two amino acid sequences is a score based on the following parameters for the BLASTp algorithm: word size = 3; gap opening penalty = -11; gap extension penalty = -1; and score matrix = BLOSUM62. As used herein, the percent similarity of two nucleic acid sequences is a score based on the following parameters for the BLASTn algorithm: word size = 11; gap opening penalty = -5; gap extension penalty = -2; match reward = 1; mismatch penalty = -3.

[0255] As used herein, the term "corresponding" with respect to modifications of two proteins or amino acid sequences is used to indicate that a particular modification in a first protein is a substitution of the same amino acid residue as a modification in a second protein, and that when the two proteins are subjected to a standard sequence alignment (e.g., using a BLASTp program), the amino acid position of the modification in the first protein corresponds to or aligns with the amino acid position of the modification in the second protein. Thus, a modification of residue "X" in a first protein to amino acid "A" corresponds to a modification of residue "Y" in a second protein to amino acid "A" when residues X and Y correspond to each other in a sequence alignment, notwithstanding the fact that X and Y may be different numbers.

[0256] As used herein, the terms "recognition half-site," "recognition sequence half-site," or simply "half-site" refer to a nucleic acid sequence within a double-stranded DNA molecule that is recognized and bound by a monomer of a homodimeric or heterodimeric meganuclease, or by one subunit of a single-chain meganuclease, or by one subunit of a single-chain meganuclease.

[0257] As used herein, the term "hypervariable region" refers to a localized sequence within a meganuclease monomer or subunit that contains amino acids with relatively high variability. A hypervariable region can comprise approximately 50-60 consecutive residues, approximately 53-57 consecutive residues, or preferably approximately 56 residues. In some embodiments, the hypervariable region residues can correspond to positions 24-79 or 215-270 of any one of SEQ ID NOS: 11-15. A hypervariable region can include one or more residues that contact DNA bases in a recognition sequence and can be modified to alter the base preference of the monomer or subunit. A hypervariable region can also include one or more residues that bind to the DNA backbone when the meganuclease associates with a double-stranded DNA recognition sequence. Such residues can be modified to alter the binding affinity of the meganuclease to the DNA backbone and target recognition sequence. In various embodiments of the present invention, a hypervariable region can include 1-20 residues that exhibit variability and can be modified to affect base preference and / or DNA binding affinity. In certain embodiments, the hypervariable region contains approximately 15-20 residues that exhibit variability and can be modified to affect base preference and / or DNA binding affinity. In some embodiments, the variable residues in the hypervariable region correspond to one or more of positions 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 11-15. In certain embodiments, the variable residues in the hypervariable region can further correspond to residues 48, 50, and 71-73 of any one of SEQ ID NOs: 11-15. In other embodiments, the variable residues within the hypervariable region correspond to one or more of positions 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 239, 241, 259, 261, 262, 263, 264, 266, and 268 of any one of SEQ ID NOs: 11 through 15. In certain embodiments, the variable residues within the hypervariable region may further correspond to residues 239, 241, and 263-265 of SEQ ID NO: 15.

[0258] As used herein, the term "transthyretin" or "TTR" includes any TTR polynucleotide or polypeptide (e.g., precursor or mature polypeptide), including, but not limited to, mammalian TTR, e.g., human TTR, murine TTR, or non-human primate TTR, or pathogenic or potentially pathogenic variants thereof, including, but not limited to, Gly6Ser, Cys10Arg, Leu12Pro, Aspl8Gly, Val20Ile, Ala25Thr, Val30Met, Val30Ala, Val30Leu, Val30Gly, Phe33Ile, Phe33Leu, Ala36Pro, Glu42Gly, Phe44Ser, Ala45Thr, Gly47Arg, Gly47Ala , Gly47Arg, Thr49Ala, Ser50Arg, Ser50Ile, Gly53Glu, Leu55Pro, Leu58His, Leu58Arg, Thr60Ala, Glu61 Lys, Phe64Leu, Phe64Ser, Ile68Leu, Tyr69His, Lys70Asn, Val71Ala, Ser77Tyr, Ile84Ser, Glu89Gln, His TTR polypeptides include those with one or more amino acid substitutions selected from the group consisting of Asn, Ala97Gly, Ala97Ser, Arg104His, Ile107Val, Ala109Thr, Ala109Val, Leu111Met, Tyr114Cys, Tyr114His, Tyr116Val, Thr119Met, Val122Ile, and Val122Del. TTR is also known as prealbumin, HsT2651, PALB, and TBPA, among others. Normally, TTR protein is a serum / plasma and cerebrospinal fluid protein responsible for transporting thyroxine and retinol. It is primarily synthesized by the liver and the choroid plexus of the brain, with only a small amount synthesized in the human retina. Liver-synthesized TTR is secreted into the bloodstream, while choroid plexus-originating TTR is transported to the cerebrospinal fluid. The sequence of the human TTR mRNA transcript can be found at the National Center for Biotechnology Information (NCBI) RefSeq accession number NM_000371.3.The sequence of mouse TTR mRNA can be found at RefSeq accession number NM_013697.5. The sequence of rhesus monkey TTR mRNA can be found at RefSeq accession number NM_001261679.1.

[0259] As used herein, "TTR-related disease" includes any disease or condition caused by or correlated with one or more mutations in the TTR gene or polypeptide, as well as any disease or condition caused by wild-type or mutant TTR protein. Such diseases can be caused, for example, by excessive production of wild-type or other mutant TTR protein, accumulation of wild-type or other mutant TTR protein as amyloid deposits, by TTR gene mutations, by abnormal cleavage of the TTR protein, or by abnormal interactions between TTR and other proteins or other endogenous or exogenous substances. "TTR-related disease" includes any type of TTR amyloidosis (ATTR) in which TTR plays a role in the formation of abnormal extracellular aggregates or amyloid deposits. TTR-related diseases include, among others, senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloid polyneuropathy (FAP), familial amyloid heart disease (FAC), leptomeningeal / central nervous system (CNS) amyloidosis, amyloid vitreous opacities, carpal tunnel syndrome, and hyperthyroxinemia. Symptoms of ATTR include sensory neuropathy (e.g., paresthesias or hypoesthesia in the distal extremities), autonomic neuropathy (e.g., gastrointestinal dysfunction, e.g., gastric ulcers or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic dysfunction, cardiac disease, vitreous opacities, renal insufficiency, nephropathy, substantially reduced mBMI (modified body mass index), cranial nerve dysfunction, and corneal lattice dystrophy.

[0260] The term "TTR level," as used herein, refers to the level of TTR as measured in one or more cells, tissues, organs, and / or biological fluids (e.g., blood, serum, liver, or cerebrospinal fluid). TTR levels can be measured in controls or in cells or subjects treated with any meganuclease or meganuclease-encoding nucleic acid of the present invention. TTR levels can be assessed based on the level of any variable associated with TTR gene expression, such as TTR mRNA levels, TTR protein levels, retinol-binding protein levels, vitamin A levels, or the number or extent of amyloid deposits.

[0261] The term "decrease" or "reduction" in TTR levels refers to any decrease in the level of TTR expression compared to a reference level, including at least a 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% decrease in TTR expression compared to a reference level or control. In some embodiments, a decrease in TTR levels refers to a decrease in full-length TTR polypeptide expression compared to a reference level, including at least a 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% decrease in full-length TTR polypeptide expression compared to a reference level or control. In certain embodiments, a TTR polypeptide that is not a full-length polypeptide has at least 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% reduced amyloid formation compared to the amyloid formation of the full-length TTR polypeptide.

[0262] As used herein, the term "modified TTR gene" refers to any modification to the TTR gene, e.g., an insertion, deletion, or substitution within the TTR gene. In some embodiments, the modification to the TTR gene alters (e.g., decreases) TTR levels or otherwise reduces TTR amyloid levels in a cell or subject compared to a reference level.

[0263] As used herein, the term "reference level" refers to the level of TTR as measured, for example, in a control cell, a control cell population, or a control subject, at a previous time point in the control cell, control cell population, or subject undergoing treatment (e.g., a pre-dose baseline level obtained from the control cell, control cell population, or subject), or a predefined threshold level of TTR (e.g., a threshold level identified through previous experimentation).

[0264] As used herein, the term "control" or "control cell" refers to a cell that provides a reference point for measuring changes in the genotype or phenotype of a genetically modified cell. Control cells can include, for example, (a) wild-type cells, i.e., cells of the same genotype as the starting material for the genetic modification that resulted in the genetically modified cell; (b) cells of the same genotype as the genetically modified cell but transformed with a null construct (i.e., a construct that has no known effect on the trait of interest); or (c) cells that are genetically identical to the genetically modified cell but have not been exposed to conditions or stimuli that induce the expression of an altered genotype or phenotype or to further genetic modifications. Control subjects can include, for example, wild-type subjects, i.e., cells of the same genotype as the starting subject for the genetic modification that resulted in the genetically modified subject (e.g., a subject with the same mutation in the TTR gene), that have not been exposed to conditions or stimuli that induce the expression of an altered genotype or phenotype in the subject or to further genetic modifications.

[0265] As used herein, the terms "recombinant DNA construct," "recombinant construct," "expression cassette," "expression construct," "chimeric construct," "construct," and "recombinant DNA fragment" are used interchangeably herein and refer to single- or double-stranded polynucleotides. A recombinant construct includes an artificial combination of nucleic acid fragments, including, but not limited to, regulatory and coding sequences that are not found together in nature. For example, a recombinant DNA construct may contain regulatory and coding sequences obtained from different sources, or regulatory and coding sequences obtained from the same source and arranged in a manner different from that found in nature. Such constructs may be used alone or in combination with a vector.

[0266] As used herein, the term "vector" or "recombinant DNA vector" refers to a construct containing a replication system and sequences capable of transcribing and translating a polypeptide-encoding sequence in a given host cell. When a vector is used, the choice of vector depends on the method used to transform the host cell, as is well known to those skilled in the art. Vectors may include, but are not limited to, plasmid vectors and recombinant AAV vectors, or any other vector known in the art suitable for delivering genes to target cells. Those skilled in the art will be well aware of the genetic elements that must be present on a vector to successfully transform, select, and propagate host cells containing any of the isolated nucleotide or nucleic acid sequences of the present invention. In some embodiments, "vector" also refers to a viral vector. Viral vectors may include, but are not limited to, retroviral vectors, lentiviral vectors, adenoviral vectors, and adeno-associated viral vectors (AAV).

[0267] As used herein, the term "operably linked" is intended to mean a functional linkage between two or more elements. For example, an operable linkage between a nucleic acid sequence encoding a nuclease disclosed herein and a regulatory sequence (e.g., a promoter) is a functional linkage that allows expression of the nucleic acid sequence encoding the nuclease. Operable linked elements may be contiguous or discontinuous. When used to refer to the linkage of two protein coding regions, operably linked means that the coding regions are in the same reading frame.

[0268] As used herein, the term "self-cleaving" recombinant DNA construct refers to a DNA construct that contains at least one coding sequence for a nuclease and at least one recognition sequence for the same nuclease. When expressed in a cell (i.e., in vivo), the nuclease recognizes and cleaves the recognition sequence, resulting in linearization of the DNA construct.

[0269] As used herein, the terms "treatment" or "treating a subject" refer to administering an engineered meganuclease of the invention, or a nucleic acid encoding an engineered meganuclease of the invention, to a subject with a TTR-related disease (e.g., transthyretin amyloidosis) for the purpose of reducing TTR levels in the subject. Such treatment reduces TTR levels and provides partial or complete relief of one or more symptoms of the subject's TTR-related disease (e.g., transthyretin amyloidosis), including, but not limited to, sensory neuropathy (e.g., paresthesia or hypoesthesia in the distal extremities), autonomic neuropathy (e.g., gastrointestinal dysfunction, e.g., gastric ulcer or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic dysfunction, cardiac disease, vitreous opacities, renal dysfunction, nephropathy, substantially reduced mBMI (modified body mass index), cranial nerve dysfunction, and corneal lattice dystrophy. Means for assessing reduction in TTR levels can include measuring TTR levels based on the level of any variable associated with TTR gene expression, such as TTR mRNA levels, TTR protein levels, retinol-binding protein levels, vitamin A levels, or the number or extent of amyloid deposits. The terms "treatment" or "treating a subject" can also refer to the administration of cells (e.g., hepatocytes) containing a nucleic acid encoding an engineered meganuclease, which are delivered to a target tissue (e.g., the liver) and produce the engineered meganuclease in an amount sufficient to treat a TTR-related disease (e.g., transthyretin amyloidosis) in the subject, thereby resulting in partial or complete alleviation of one or more symptoms of the TTR-related disease. In some embodiments, the engineered meganucleases of the invention, nucleic acids encoding same, or genetically modified cells or cell populations described herein are administered during treatment in the form of pharmaceutical compositions of the invention.

[0270] As used herein, the term "gc / kg" or "gene copies / kilogram" refers to the number of copies of a nucleic acid encoding an engineered nuclease, or the number of copies of a template nucleic acid described herein per kilogram of body weight of a subject to whom the nucleic acid encoding the engineered nuclease and / or template nucleic acid is administered.

[0271] As used herein, the term "effective amount" or "therapeutically effective amount" refers to an amount sufficient to produce beneficial or desired biological and / or clinical results. The therapeutically effective amount varies depending on the formulation or composition used, the disease and its severity, and the age, weight, physical condition, and responsiveness of the subject being treated. In specific embodiments, an effective amount of an engineered meganuclease or pharmaceutical composition disclosed herein reduces TTR levels, reduces TTR amyloid levels, or reduces at least one symptom of a TTR-related disease (e.g., transthyretin amyloidosis) in a subject. In some specific embodiments, an effective amount of a nucleic acid encoding an engineered meganuclease is about 1×10 10 gc / kg ~ approx. 1×10 14 gc / kg (e.g., 1 × 10 10 gc / kg, 1 × 10 11 gc / kg, 1 × 10 12 gc / kg, 1 × 10 13 gc / kg, or 1 × 10 14 gc / kg) of a polynucleotide or template polynucleotide comprising a nucleic acid encoding an engineered nuclease. In certain embodiments, an effective amount of a polynucleotide and / or template polynucleotide comprising a nucleic acid sequence encoding an engineered nuclease, or a pharmaceutical composition comprising a polynucleotide and / or template polynucleotide comprising a nucleic acid sequence encoding an engineered nuclease disclosed herein, reduces at least one symptom of a disease in a subject.

[0272] As used herein, the term "lipid nanoparticle" refers to a lipid composition having a typically spherical structure with an average diameter of 10 to 1000 nanometers. In some formulations, the lipid nanoparticles may contain at least one cationic lipid, at least one non-cationic lipid, and at least one complex lipid. Lipid nanoparticles known in the art that are suitable for encapsulating nucleic acids, such as mRNA, are contemplated for use in the present invention.

[0273] As used herein, the recitation of a numerical range for a variable is intended to convey that the present disclosure can be practiced with the variable equal to any of the values within that range. Thus, for a variable that is discrete in nature, the variable can be equal to any integer value within the numerical range, including the end-points of the range. Similarly, for a variable that is continuous in nature, the variable can be equal to any real value within the numerical range, including the end-points of the range. By way of example and not limitation, a variable described as having a value between 0 and 2 can take on values of 0, 1, or 2 if the variable is discrete in nature, or 0.0, 0.1, 0.01, 0.001, or any other real value between 0 and 2 if the variable is continuous in nature.

[0274] 2.1 Principles of the invention

[0275] The present invention is based, in part, on the hypothesis that engineered meganucleases can be designed to bind to and cleave recognition sequences found within the TTR gene (e.g., the human TTR gene; SEQ ID NO: 3), particularly within exon 1 or exon 3. As further described herein, targeting meganucleases to recognition sites within exon 1 or exon 3 of the TTR gene is an effective approach for disrupting expression of TTR. Disrupting expression of TTR protein can reduce TTR levels or reduce TTR amyloid in subjects with TTR-related diseases (such as transthyretin amyloidosis).

[0276] In particular, truncations within exon 1 or exon 3 of the TTR gene (e.g., at the TTR5-6 or TTR15-16 recognition sequence) can allow non-homologous end joining (NHEJ) at the cleavage site, which can disrupt TTR expression due to NHEJ at the cleavage site resulting in insertion, deletion, or frameshift mutation. In addition, truncations within exon 1 or exon 3 of the TTR gene (e.g., at the TTR5-6 or TTR15-16 recognition sequence) can further enable direct homologous recombination of exogenous nucleic acid sequences into the TTR gene to disrupt TTR expression.

[0277] Thus, the present invention encompasses engineered meganucleases that bind to and cleave exon 1 or exon 3 of the TTR gene (e.g., at the TTR5-6 or TTR15-16 recognition sequence). The present invention also encompasses methods of using such engineered meganucleases to generate genetically modified cells. Furthermore, the present invention encompasses pharmaceutical compositions comprising engineered meganuclease proteins or nucleic acids encoding engineered meganucleases, and the use of such compositions for the treatment of TTR-related diseases, such as transthyretin amyloidosis.

[0278] 2.2 Meganuclease that binds to and cleaves the recognition sequence within the TTR gene

[0279] It is known in the art that site-specific nucleases can be used to make DNA breaks in the genome of living cells, and such DNA breaks can lead to the permanent modification of genome through homologous recombination with transgenic DNA sequences.The use of nucleases to induce double-strand breaks in target locus is known to stimulate the homologous recombination of transgenic DNA sequences, particularly those adjacent to the sequence homologous to genome target.In this way, exogenous nucleic acid sequences can be inserted into target locus.

[0280] It is further known in the art that site-specific nucleases can be used to create DNA breaks within the genome of living cells, and that such DNA breaks can result in permanent genome modification through mutagenic NHEJ repair or through homologous recombination with transgenic DNA sequences. NHEJ can cause mutagenesis at the break site, resulting in allele inactivation. NHEJ-associated mutagenesis can inactivate alleles through the generation of premature stop codons, frameshift mutations that produce abnormal, nonfunctional proteins, or mechanisms such as nonsense-mediated mRNA decay. The use of nucleases to induce mutagenesis via NHEJ can be used to target specific mutations or sequences present in wild-type alleles. Furthermore, the use of nucleases to induce double-strand breaks in target loci is known to stimulate homologous recombination, particularly of transgenic DNA sequences adjacent to sequences homologous to the genomic target. In this way, exogenous nucleic acid sequences can be inserted into target loci. Such exogenous nucleic acids can encode any sequence or polypeptide of interest.

[0281] In some embodiments, the nuclease used to carry out the present invention is a meganuclease. In certain embodiments, the nuclease used to carry out the present invention is a single-chain meganuclease. A single-chain meganuclease comprises an N-terminal subunit and a C-terminal subunit connected by a linker peptide. Each of the two domains recognizes and binds to half of a recognition sequence (i.e., a recognition half-site), and the site of DNA cleavage is located in the center of the recognition sequence near the interface between the two subunits. DNA strand cleavage is offset by four base pairs, so that DNA cleavage by the meganuclease generates a pair of four-base pair 3' single-stranded overhangs.

[0282] In other embodiments, nucleases of the invention are engineered to bind to and cleave the TTR15-16 recognition sequence (SEQ ID NO: 7). The TTR15-16 recognition sequence is located within exon 3 of the TTR gene. Exemplary TTR15-16 meganucleases (e.g., TTR15-16x.81, TTR15-16L.161, TTR15-16L.164, and TTR15-16L.181) are provided in SEQ ID NOs: 11-14.

[0283] In some embodiments, nucleases of the invention are engineered to bind to and cleave the TTR5-6 recognition sequence (SEQ ID NO: 9). The TTR5-6 recognition sequence is located within exon 1 of the TTR gene. An exemplary TTR5-6 meganuclease (e.g., TTR5-6L.1204) is provided in SEQ ID NO: 15.

[0284] The engineered meganuclease of the present invention comprises a first subunit comprising a first hypervariable (HVR1) region and a second subunit comprising a second hypervariable (HVR2) region. Furthermore, the first subunit binds to a first recognition half-site (i.e., a TTR5 or TTR15 half-site) in the recognition sequence, and the second subunit binds to a second recognition half-site (i.e., a TTR6 or TTR16 half-site) in the recognition sequence. In embodiments where the engineered meganuclease is a single-chain meganuclease, the first and second subunits can be oriented such that the first subunit comprising the HVR1 region and binding to the first half-site is positioned as the N-terminal subunit, and the second subunit comprising the HVR2 region and binding to the second half-site is positioned as the C-terminal subunit. In an alternative embodiment, the first and second subunits may be oriented such that the first subunit comprising the HVR1 region and binding to the first half-site is positioned as the C-terminal subunit, and the second subunit comprising the HVR2 region and binding to the second half-site is positioned as the N-terminal subunit. Exemplary TTR meganucleases of the invention are provided in SEQ ID NOs: 11-15 and summarized in Tables 1 and 2 and in the description below.

[0285] [Table 1]

[0286] "%TTR15 subunit" and "%TTR16 subunit" represent the amino acid sequence identity between the TTR15-binding subunit region and the TTR16-binding subunit region of each meganuclease and the TTR15-binding subunit region and the TTR16-binding subunit region of the TTR15-16x.81 meganuclease, respectively.

[0287] [Table 2]

[0288] In certain embodiments of the invention, an engineered meganuclease binds to and cleaves a recognition sequence comprising SEQ ID NO: 7 in the TTR gene, wherein the engineered meganuclease comprises a first subunit and a second subunit, wherein the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and the second subunit binds to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region.

[0289] TTR15-16x.81 (SEQ ID NO: 11)

[0290] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 11. In some such embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 11. In some such embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 11. In some such embodiments, the HVR1 region comprises a Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO:11. In some such embodiments, the HVR1 region comprises one or more residues corresponding to residues 48, 50, and 71-73 of SEQ ID NO:11. In some such embodiments, the HVR1 region comprises residues corresponding to residues 48, 50, and 71-73 of SEQ ID NO:11. In some such embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:11. In some such embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO:11. In some such embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO:11.In some such embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 11. In some such embodiments, the HVR2 region comprises Y, R, K, or D at the residue corresponding to residue 257 of SEQ ID NO: 11. In some such embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 11. In some such embodiments, the first subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to residues 7-153 of SEQ ID NO: 11, and the second subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to residues 198-344 of SEQ ID NO: 11. In some such embodiments, the first subunit comprises a G, S, or A at the residue corresponding to residue 19 of SEQ ID NO: 11. In some such embodiments, the first subunit comprises one or more residues corresponding to residues 19 and 139 of SEQ ID NO: 11. In some such embodiments, the first subunit comprises residues corresponding to residues 19 and 139 of SEQ ID NO:11. In some such embodiments, the first subunit comprises an E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:11. In some such embodiments, the second subunit comprises a G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:11. In some such embodiments, the second subunit comprises an E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:11. In some such embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:11.In some such embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 11. In some such embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently links the first and second subunits. In some such embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 11. In some such embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO: 11. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleic acid sequence of SEQ ID NO: 66. In some embodiments, the engineered meganuclease is encoded by the nucleic acid sequence of SEQ ID NO: 66.

[0291] TTR15-16L.161 (SEQ ID NO: 12)

[0292] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 12. In some such embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 12. In some such embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 12. In some such embodiments, the HVR1 region comprises a Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 12. In some such embodiments, the HVR1 region comprises one or more residues corresponding to residues 48, 50, and 71-73 of SEQ ID NO: 12. In some such embodiments, the HVR1 region comprises residues corresponding to residues 48, 50, and 71-73 of SEQ ID NO: 12. In some such embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 12. In some such embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 12. In some such embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO:12.In some such embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 12. In some such embodiments, the HVR2 region comprises Y, R, K, or D at the residue corresponding to residue 257 of SEQ ID NO: 12. In some such embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 12. In some such embodiments, the first subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to residues 7-153 of SEQ ID NO: 12, and the second subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to residues 198-344 of SEQ ID NO: 12. In some such embodiments, the first subunit comprises a G, S, or A at the residue corresponding to residue 19 of SEQ ID NO: 12. In some such embodiments, the first subunit comprises one or more residues corresponding to residues 19 and 139 of SEQ ID NO: 12. In some such embodiments, the first subunit comprises residues corresponding to residues 19 and 139 of SEQ ID NO:12. In some such embodiments, the first subunit comprises an E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:12. In some such embodiments, the second subunit comprises a G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:12. In some such embodiments, the second subunit comprises an E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:12. In some such embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:12.In some such embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 12. In some such embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently links the first and second subunits. In some such embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 12. In some such embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO: 12. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleic acid sequence of SEQ ID NO: 67. In some embodiments, the engineered meganuclease is encoded by the nucleic acid sequence of SEQ ID NO: 67.

[0293] TTR15-16L.164 (SEQ ID NO: 13)

[0294] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 13. In some such embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 13. In some such embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 13. In some such embodiments, the HVR1 region comprises a Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 13. In some such embodiments, the HVR1 region comprises one or more residues corresponding to residues 48, 50, and 71-73 of SEQ ID NO: 13. In some such embodiments, the HVR1 region comprises residues corresponding to residues 48, 50, and 71-73 of SEQ ID NO: 13. In some such embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 13. In some such embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 13. In some such embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO:13.In some such embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 13. In some such embodiments, the HVR2 region comprises Y, R, K, or D at the residue corresponding to residue 257 of SEQ ID NO: 13. In some such embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 13. In some such embodiments, the first subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to residues 7-153 of SEQ ID NO: 13, and the second subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to residues 198-344 of SEQ ID NO: 13. In some such embodiments, the first subunit comprises a G, S, or A at the residue corresponding to residue 19 of SEQ ID NO: 13. In some such embodiments, the first subunit comprises one or more residues corresponding to residues 19 and 139 of SEQ ID NO: 13. In some such embodiments, the first subunit comprises residues corresponding to residues 19 and 139 of SEQ ID NO: 13. In some such embodiments, the first subunit comprises an E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO: 13. In some such embodiments, the second subunit comprises a G, S, or A at the residue corresponding to residue 210 of SEQ ID NO: 13. In some such embodiments, the second subunit comprises an E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO: 13. In some such embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 13.In some such embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 13. In some such embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently links the first and second subunits. In some such embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 13. In some such embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO: 13. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleic acid sequence of SEQ ID NO: 68. In some embodiments, the engineered meganuclease is encoded by the nucleic acid sequence of SEQ ID NO: 68.

[0295] TTR15-16L.181 (SEQ ID NO: 14)

[0296] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 14. In some such embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 14. In some such embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 14. In some such embodiments, the HVR1 region comprises a Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 14. In some such embodiments, the HVR1 region comprises one or more residues corresponding to residues 48, 50, and 71-73 of SEQ ID NO: 14. In some such embodiments, the HVR1 region comprises residues corresponding to residues 48, 50, and 71-73 of SEQ ID NO: 14. In some such embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 14. In some such embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 14. In some such embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO:14.In some such embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 14. In some such embodiments, the HVR2 region comprises Y, R, K, or D at the residue corresponding to residue 257 of SEQ ID NO: 14. In some such embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 14. In some such embodiments, the first subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to residues 7-153 of SEQ ID NO: 14, and the second subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to residues 198-344 of SEQ ID NO: 14. In some such embodiments, the first subunit comprises a G, S, or A at the residue corresponding to residue 19 of SEQ ID NO: 14. In some such embodiments, the first subunit comprises one or more residues corresponding to residues 19 and 139 of SEQ ID NO: 14. In some such embodiments, the first subunit comprises residues corresponding to residues 19 and 139 of SEQ ID NO: 14. In some such embodiments, the first subunit comprises an E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO: 14. In some such embodiments, the second subunit comprises a G, S, or A at the residue corresponding to residue 210 of SEQ ID NO: 14. In some such embodiments, the second subunit comprises an E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO: 14. In some such embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 14.In some such embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 14. In some such embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently links the first and second subunits. In some such embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 14. In some such embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO: 14. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleic acid sequence of SEQ ID NO: 69. In some embodiments, the engineered meganuclease is encoded by the nucleic acid sequence of SEQ ID NO: 69.

[0297] In certain embodiments of the invention, an engineered meganuclease binds to and cleaves a recognition sequence comprising SEQ ID NO:9 in the TTR gene, wherein the engineered meganuclease comprises a first subunit and a second subunit, wherein the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and the second subunit binds to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region.

[0298] TTR5-6L.1204 (SEQ ID NO: 15)

[0299] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 15. In some such embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 15. In some such embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 15. In some such embodiments, the HVR1 region comprises a Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 15. In some such embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 15. In some such embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 15. In some such embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 15. In some such embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 15. In some such embodiments, the HVR2 region comprises Y, R, K, or D at the residue corresponding to residue 257 of SEQ ID NO: 15.In some such embodiments, the HVR2 region comprises one or more residues corresponding to residues 239, 241, and 263-265 of SEQ ID NO: 15. In some such embodiments, the HVR2 region comprises residues corresponding to residues 239, 241, and 263-265 of SEQ ID NO: 15. In some such embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 15. In some such embodiments, the first subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to residues 7-153 of SEQ ID NO: 15, and the second subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to residues 198-344 of SEQ ID NO: 15. In some such embodiments, the first subunit comprises a G, S, or A at the residue corresponding to residue 19 of SEQ ID NO: 15. In some such embodiments, the first subunit comprises an E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO: 15. In some such embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 15. In some such embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 15. In some such embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 15. In some such embodiments, the second subunit comprises a residue corresponding to residue 210 of SEQ ID NO: 15. In some such embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 15.In some such embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently links the first subunit and the second subunit. In some such embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 15. In some such embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO: 15. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleic acid sequence of SEQ ID NO: 70. In some embodiments, the engineered meganuclease is encoded by the nucleic acid sequence of SEQ ID NO:70.

[0300] 2.3 Methods for delivering and expressing meganucleases

[0301] The present invention provides methods for generating genetically modified cells using engineered nucleases that bind to and cleave recognition sequences found within the TTR gene (e.g., the human TTR gene; SEQ ID NO: 3). Cleavage at such recognition sequences allows for the insertion of exogenous sequences by NHEJ and / or homologous recombination at the cleavage site, thereby disrupting expression of endogenous TTR polypeptide in the genetically modified cells. The present invention further provides methods for treating a disease in a subject by administering a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a nucleic acid encoding the engineered nuclease or engineered nuclease polypeptide. In each case, the present invention encompasses that the engineered nuclease of the present invention, or a nucleic acid encoding the engineered nuclease, can be delivered (i.e., introduced) into cells that would typically produce a TTR gene product (e.g., a TTR polypeptide).

[0302] Thus, provided herein are methods for treating a TTR-related disease (e.g., transthyretin amyloidosis), reducing TTR levels, reducing TTR amyloid levels, or reducing symptoms associated with a TTR-related disease (e.g., transthyretin amyloidosis) in a subject. In particular, provided are methods for administering a pharmaceutical composition comprising a pharmaceutically acceptable carrier and an engineered meganuclease disclosed herein (or a nucleic acid encoding the engineered meganuclease or a cell expressing the engineered meganuclease). The engineered nuclease of the present invention can be delivered to cells in the form of a protein, or preferably as a nucleic acid encoding the engineered nuclease. Such nucleic acids may be DNA (e.g., circular or linear plasmid DNA or PCR product) or RNA (e.g., mRNA).

[0303] The method of the present invention can be used in the treatment of any TTR-related disease in which TTR plays a role in the formation of abnormal extracellular aggregates or amyloid deposits, such as TTR amyloidosis (ATTR).TTR-related diseases include senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloid polyneuropathy (FAP), familial amyloid heart disease (FAC), leptomeningeal / central nervous system (CNS) amyloidosis, amyloid vitreous opacities, carpal tunnel syndrome, and hyperthyroxinemia.In certain embodiments, the method is effective in treating ATTR.In certain embodiments, the ATTR is neuropathic ATTR, leptomeningeal ATTR, or cardiac ATTR.

[0304] Additionally, the methods may be effective in reducing one or more symptoms of TTR amyloidosis, including sensory neuropathy (e.g., paresthesias or hypoesthesia in the distal extremities), autonomic neuropathy (e.g., gastrointestinal dysfunction, such as gastric ulcers or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic dysfunction, cardiac disease, vitreous opacities, renal dysfunction, nephropathy, substantially reduced mBMI (modified body mass index), cranial nerve dysfunction, and / or corneal lattice dystrophy.

[0305] Subjects with TTR-related diseases or subjects who are particularly amenable to treatment with the engineered meganucleases herein can be identified by identifying the presence or absence of one or more risk factors, diagnostic indicators, or prognostic indicators, such as those described herein.For example, in some cases, subjects have mutations in the TTR gene that affect the peripheral nervous system, autonomic nervous system, pia mater, and / or heart.In certain cases, subjects receiving treatment with the methods and compositions provided herein can be characterized by one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 27) mutations in the TTR gene or polypeptide. For example, a subject undergoing treatment may have any of the following amino acids: Gly6Ser, Cys10Arg, Leu12Pro, Asp18Gly, Val20Ile, Ala25Thr, Val30Met, Val30Ala, Val30Leu, Val30Gly, Phe33Ile, Phe33Leu, Ala36Pro, Glu42Gly, Phe44Ser, Ala45Thr, Gly47Arg, Gly47Ala, Gly47Arg, Thr49Ala, Ser50Arg, Ser50Ile, Gly53Glu, Leu55Pro, Leu58His, Leu58Arg, Thr60Ala, Glu61Lys, Phe6 The subject may have a TTR gene encoding a TTR polypeptide with one or more amino acid substitutions selected from 4Leu, Phe64Ser, Ile68Leu, Tyr69His, Lys70Asn, Val71Ala, Ser77Tyr, Ile84Ser, Glu89Gln, His90Asn, Ala97Gly, Ala97Ser, Arg104His, Ile107Val, Ala109Thr, Ala109Val, Leu111Met, Tyr114Cys, Tyr114His, Tyr116Val, Thr119Met, Val122Ile, or Val122Del mutations. In certain embodiments, the subject receiving treatment has a Val30Met (V30M) amino acid substitution in the TTR polypeptide (SEQ ID NO: 6).

[0306] TTR expression in genetically modified cells or subjects can be detected using standard methods in the art.For example, TTR level can be evaluated based on the level of any variable associated with TTR gene expression, such as TTR mRNA level, TTR protein level, retinol-binding protein level, vitamin A level, or the number or extent of amyloid deposits.The reduction of TTR level or expression can be evaluated by the absolute or relative level decrease of one or more of these variables compared with reference level.TTR level can be measured in biological samples isolated from subjects, such as tissue biopsy, or body fluids including blood, serum, plasma, cerebrospinal fluid, or urine.Optionally, TTR level is normalized to standard protein or substance in the sample.In addition, TTR level can be evaluated at any time before, during, or after treatment according to the method herein.

[0307] The methods include administering any of the engineered meganucleases described herein, or a nucleic acid encoding a meganuclease, to reduce TTR levels in a genetically modified cell or subject (e.g., as measured in a cell, tissue, organ, or biological sample obtained from the subject) by at least 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% relative to a reference level, or to reduce TTR amyloid formation. In some embodiments, the methods herein are effective to reduce TTR levels by about 10% to about 80% (e.g., 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80%, or more) relative to a reference level. In some embodiments, a decrease in TTR levels refers to a decrease in full-length TTR polypeptide expression compared to a reference level, including at least a 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% decrease in full-length TTR polypeptide expression compared to a reference level or control. In certain embodiments, a TTR polypeptide that is not a full-length polypeptide has reduced activity compared to the activity of a full-length TTR polypeptide, including at least a 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% decrease in activity.

[0308] In certain embodiments, the methods herein can be effective in reducing TTR amyloid formation in a subject. For example, TTR amyloid formation can be reduced by about 10% to about 100% (e.g., 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%, or 90% to 100%) relative to a reference level. In some embodiments, TTR amyloid formation is reduced by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, or about 100% relative to a reference level.

[0309] The engineered meganucleases disclosed herein can be delivered to cells in the form of proteins or preferably as nucleic acids encoding the engineered meganucleases. Such nucleic acids can be DNA (e.g., circular or linear plasmid DNA or PCR products) or RNA (e.g., mRNA). In embodiments where the engineered meganuclease coding sequence is delivered in DNA form, it should be operably linked to a promoter to promote transcription of the nuclease gene. Mammalian promoters suitable for the present invention include constitutive promoters such as the cytomegalovirus early (CMV) promoter (Thomsen et al. (1984), Proc Natl Acad Sci USA. 81(3):659-63) or the SV40 early promoter (Benoist and Chambon (1981), Nature. 290(5804):304-10), and inducible promoters such as the tetracycline-inducible promoter (Dingermann et al. (1992), Mol Cell Biol. 12(9):4038-45). The engineered nucleases of the present invention can also be operably linked to synthetic promoters. Synthetic promoters can include, but are not limited to, the JeT promoter (WO 2002 / 012514). In certain embodiments, the nucleic acid sequence encoding the engineered nucleases of the present invention is operably linked to a tissue-specific promoter, such as a liver-specific promoter. Examples of liver-specific promoters include, but are not limited to, the human thyroxine-binding globulin (TBG) promoter, the human alpha-1 antitrypsin promoter, a hybrid liver-specific promoter (the liver locus control region from the ApoE gene (ApoE-HCR) and the liver-specific alpha-1 antitrypsin promoter), and the apolipoprotein A-II promoter.

[0310] In certain embodiments, the nucleic acid sequence encoding at least one engineered nuclease is delivered on a recombinant DNA construct or expression cassette. For example, the recombinant DNA construct can include an expression cassette (i.e., "cassette") that includes a promoter and a nucleic acid sequence encoding an engineered nuclease described herein.

[0311] In some embodiments, mRNA encoding the engineered nuclease is delivered to the cell so that the likelihood of the gene encoding the engineered nuclease being integrated into the cell's genome is reduced.

[0312] Such mRNA encoding engineered meganucleases can be generated using methods known in the art, such as in vitro transcription. In some embodiments, the mRNA is 5'-capped with 7-methyl-guanosine, anti-reverse cap analog (ARCA) (US Pat. No. 7,074,596), CleanCap® analogs, such as Cap1 analogs (Trilink, San Diego, CA), or enzymatically capped with vaccinia capping enzyme or the like. In some embodiments, the mRNA can be polyadenylated. The mRNA can contain various 5' and 3' untranslated sequence elements to enhance expression of the encoded engineered meganuclease and / or the stability of the mRNA itself. Such elements can include post-translational regulatory elements, such as woodchuck hepatitis virus post-translational regulatory elements. The mRNA can contain nucleoside analogs or naturally occurring nucleosides, such as pseudouridine, 5-methylcytidine, N6-methyladenosine, 5-methyluridine, or 2-thiouridine. Further nucleoside analogues include, for example, those described in US Pat. No. 8,278,036.

[0313] Purified nuclease proteins can be delivered to cells to cleave genomic DNA, allowing homologous recombination or non-homologous end joining at the cleavage site with an exogenous nucleic acid molecule encoding a polypeptide of interest as described herein by a variety of different mechanisms known in the art, including those further detailed herein.

[0314] In another specific embodiment, the nucleic acid encoding the nuclease of the present invention is introduced into a cell using a single-stranded DNA template. The single-stranded DNA may further comprise 5' and / or 3' AAV inverted terminal repeats (ITRs) upstream and / or downstream of the sequence encoding the engineered nuclease. The single-stranded DNA may further comprise 5' and / or 3' homology arms upstream and / or downstream of the sequence encoding the engineered meganuclease.

[0315] In another specific embodiment, the gene encoding the nuclease of the present invention is introduced into cells using linear DNA template.This linear DNA template can be produced by methods known in the art.For example, the plasmid DNA encoding the nuclease can be digested by one or more restriction enzymes so that circular plasmid DNA is linearized before being introduced into cells.

[0316] Purified engineered nuclease proteins, or nucleic acids encoding engineered nucleases, can be delivered to cells to cleave genomic DNA by a variety of different mechanisms known in the art, including those further detailed herein below.

[0317] In some embodiments, the nuclease protein, the DNA / mRNA encoding the nuclease, or the cells expressing the nuclease protein are formulated in a pharmaceutically acceptable carrier for systemic administration or administration to a target tissue according to known techniques. See, for example, Remington, The Science and Practice of Pharmacy (21st ed., Philadelphia, Lippincott, Williams & Wilkins, 2005). In preparing a pharmaceutical formulation according to the present invention, the protein / RNA / mRNA / cells are typically mixed with a pharmaceutically acceptable carrier. The carrier must be acceptable in the sense of being compatible with any other ingredients in the formulation and not harmful to the patient. The carrier can be solid or liquid, or both, and can be formulated with the compound as a unit-dose formulation.

[0318] In some embodiments, nuclease protein or DNA / mRNA encoding nuclease is linked to cell-penetrating peptide or targeting ligand to facilitate cellular uptake.Examples of cell-penetrating peptides known in the art include polyarginine (Jearawiriyapaisarn, et al. (2008) Mol Ther.16:1624-9), TAT peptide from HIV virus (Hudecz et al. (2005) Med.Res.Rev.25:679-736), MPG (Simeoni, et al. (2003) Nucleic Acids Res.31:2717-2724), Pep-1 (Deshayes et al. (2004) Biochemistry43:7698-7706) and HSV-1 VP-22 (Deshayes et al. (2005) Cell Mol Life Sci.62:1839-49). In an alternative embodiment, the engineered nuclease, or the DNA / mRNA encoding the nuclease, is covalently or non-covalently linked to an antibody that recognizes a specific cell surface receptor expressed on the target cell, so that the nuclease protein / DNA / mRNA binds to and is internalized by the target cell. Alternatively, the engineered nuclease protein / DNA / mRNA can be covalently or non-covalently linked to the natural ligand (or part of the natural ligand) of such a cell surface receptor (McCall, et al. (2014) Tissue Barriers. 2(4): e944449; Dinda, et al. (2013) Curr Pharm Biotechnol. 14: 1264-74; Kang, et al. (2014) Curr Pharm Biotechnol. 15(3): 220-30; Qian et al. (2014) Expert Opin Drug Metab Toxicol. 10(11): 1491-508).

[0319] In some embodiments, nuclease proteins or DNA / mRNA encoding the nucleases are encapsulated in biodegradable hydrogels for injection or implantation into desired areas of the liver (e.g., adjacent to hepatic sinusoidal endothelial cells or hemogenic endothelial cells, or precursor cells that differentiate into them). Hydrogels can provide sustained and tunable release of therapeutic payloads to desired areas of target tissue without the need for frequent injections, and stimuli-responsive materials (e.g., temperature- and pH-responsive hydrogels) can be designed to release payloads in response to environmental or externally applied cues (Kang Derwent et al. (2008) Trans Am Ophthalmol Soc. 106:206-214).

[0320] In some embodiments, meganuclease proteins, or DNA / mRNA encoding meganucleases, are covalently or preferably non-covalently bound to nanoparticles or encapsulated within such nanoparticles using methods known in the art (Sharma, et al. (2014) Biomed Res Int. 2014). Nanoparticles are nanoscale delivery systems with length scales of less than 1 μm, preferably less than 100 nm. Such nanoparticles can be designed with cores composed of metals, lipids, polymers, or biological macromolecules, and multiple copies of meganuclease proteins, mRNA, or DNA can be bound to or encapsulated in the nanoparticle core. This increases the number of copies of protein / mRNA / DNA delivered to each cell, thus increasing the intracellular expression of each meganuclease and maximizing the likelihood that the target recognition sequence will be cleaved. The surface of such nanoparticles can be further modified with polymers or lipids (e.g., chitosan, cationic polymers, or cationic lipids) to form core-shell nanoparticles whose surfaces impart additional functionality for enhancing cellular delivery and payload uptake (Jian et al. (2012) Biomaterials. 33(30):7621-30). Nanoparticles can be further advantageously conjugated to targeting molecules to direct the nanoparticles to the appropriate cell type and / or to increase the likelihood of cellular uptake. Examples of such targeting molecules include antibodies specific for cell surface receptors and the natural ligands (or portions of the natural ligands) of cell surface receptors.

[0321] In some embodiments, the nuclease protein or DNA / mRNA encoding the nuclease is encapsulated in a liposome or complexed with a cationic lipid (e.g., LIPOFECTAMINE™, Life Technologies Corp., Carlsbad, CA; see Zuris et al. (2015) Nat Biotechnol. 33:73-80; Mishra et al. (2011) J Drug Deliv. 2011:863734). Liposome and lipoplex formulations can protect the payload from degradation, enhance accumulation and retention at the target site, and promote cellular uptake and delivery efficiency through fusion with and / or disruption of the target cell membrane.

[0322] In some embodiments, meganuclease proteins, or DNA / mRNA encoding meganucleases, are encapsulated within polymer scaffolds (e.g., PLGA) or complexed using cationic polymers (e.g., PEI, PLL) (Tamboli et al. (2011) Ther Deliv. 2(4):523-536). Polymeric carriers can be designed to provide tunable drug release rates through control of polymer erosion and drug diffusion, and high drug encapsulation efficiency can provide protection of the therapeutic payload until intracellular delivery to the desired target cell population.

[0323] In some embodiments, meganuclease proteins, or DNA / mRNA encoding engineered meganucleases, are combined with amphiphilic molecules that self-assemble into micelles (Tong et al. (2007) J Gene Med. 9(11):956-66). Polymeric micelles can contain a micellar shell formed of a hydrophilic polymer (e.g., polyethylene glycol) that can prevent aggregation, mask charge interactions, and reduce nonspecific interactions.

[0324] In some embodiments, meganuclease proteins or DNA / mRNA encoding meganucleases are formulated into emulsions or nanoemulsions (i.e., with an average particle size of less than 1 nm) for administration and / or delivery to target cells. The term "emulsion" refers to any oil-in-water, water-in-oil, water-in-oil-in-water, or oil-in-water-in-oil dispersion or droplet, including, but not limited to, lipid structures that can form when a water-immiscible phase is mixed with an aqueous phase as a result of hydrophobic forces that direct nonpolar residues (e.g., long hydrocarbon chains) away from water and polar head groups toward water. These other lipid structures include, but are not limited to, unilamellar, paucilamellar, and multilamellar lipid vesicles, micelles, and lamellar phases. Emulsions are composed of an aqueous phase and a lipophilic phase (typically containing oil and an organic solvent). Emulsions also often contain one or more surfactants. Nanoemulsion formulations are well known, as described, for example, in U.S. Pat. No. 6,015,832, U.S. Pat. No. 6,506,803, U.S. Pat. No. 6,635,676, U.S. Pat. No. 6,559,189, and U.S. Pat. No. 7,767,216, each of which is incorporated herein by reference in its entirety.

[0325] In some embodiments, meganuclease proteins or DNA / mRNA encoding meganucleases are covalently linked or non-covalently associated with multifunctional polymer conjugates, DNA dendrimers, and polymer dendrimers (Mastorakos et al. (2015) Nanoscale. 7(9):3845-56; Cheng et al. (2008) J Pharm Sci. 97(1):123-43). Dendrimer production allows for control of payload capacity and size, and can provide high payload capacity. Furthermore, the display of multiple surface groups can be utilized to improve stability, reduce nonspecific interactions, and enhance cell-specific targeting and drug release.

[0326] In some embodiments, the nuclease-encoding gene is introduced into cells using a recombinant virus (i.e., a recombinant viral vector). Such recombinant viruses are known in the art and include recombinant retroviruses, lentiviruses, adenoviruses, and adeno-associated viruses (AAV) (discussed in Vannucci, et al. (2013 New Microbiol. 36:1-22)). Recombinant AAV useful in the present invention can have any serotype that allows viral transduction into target cell types and expression of the nuclease gene in the target cells. For example, in some embodiments, the recombinant AAV has the serotype AAV2, AAV6, AAV8, or AAV9. In some embodiments, the recombinant virus is directly injected into the target tissue. In alternative embodiments, the recombinant virus is delivered systemically via the circulatory system. It is known in the art that different AAVs tend to localize in different tissues. In liver target tissues, effective transduction of hepatocytes has been demonstrated with, for example, AAV serotypes 2, 8, and 9 (Sands (2011) Methods Mol. Biol. 807:141-157). Thus, in some embodiments, the AAV serotype is AAV2. In alternative embodiments, the AAV serotype is AAV6. In other embodiments, the AAV serotype is AAV8. In yet other embodiments, the AAV serotype is AAV9. AAV can also be self-complementary, so as not to require second-strand DNA synthesis in the host cell (McCarty, et al. (2001) Gene Ther. 8:1248-54). Nucleic acid molecules delivered by recombinant AAV can include left (5') and right (3') inverted terminal repeat sequences.

[0327] In one embodiment, the recombinant virus used for meganuclease gene delivery is a self-limiting recombinant virus. Self-limiting viruses can have a limited duration in cells or organisms due to the presence of a meganuclease recognition sequence engineered into the viral genome. Therefore, self-limiting recombinant viruses can be engineered to encode a promoter within the ITR, a meganuclease described herein, and a meganuclease recognition site. The self-limiting recombinant virus delivers the meganuclease gene to cells, tissues, or organisms so that the meganuclease can be expressed and cleave the cell's genome at the endogenous recognition sequence within the genome. The delivered meganuclease also finds its target site within the self-limiting recombinant viral genome and cleaves the recombinant viral genome at this target site. Upon cleavage, the 5' and 3' ends of the viral genome are exposed and degraded by exonucleases, thus killing the virus and halting meganuclease production.

[0328] When meganuclease genes are delivered in DNA form (e.g., plasmid) and / or via recombinant virus (e.g., AAV), they can be operably linked to a promoter. In some embodiments, this can be an endogenous promoter from a recombinant virus (e.g., the LTR of a lentivirus) or a viral promoter such as the well-known cytomegalovirus or SV40 virus early promoter. In certain embodiments, the nuclease gene is operably linked to a promoter that preferentially drives gene expression in target cells. Examples of liver-specific promoters include, but are not limited to, the human alpha-1 antitrypsin promoter, hybrid liver-specific promoters (hepatic locus control region (ApoE-HCR) from the ApoE gene and the liver-specific alpha-1 antitrypsin promoter), the human thyroxine-binding globulin (TBG) promoter, and the apolipoprotein A-II promoter.

[0329] In some embodiments, the subject receives about 1×10 10 gc / kg ~ approx. 1×10 14gc / kg (e.g., 1 × 10 10 gc / kg, 1 × 10 11 gc / kg, 1 × 10 12 gc / kg, 1 × 10 13 gc / kg, or 1 × 10 14 In some embodiments, the subject is administered a pharmaceutical composition at a dose of at least about 1 x 10 gc / kg of a polynucleotide comprising a nucleic acid sequence encoding an engineered nuclease. 10 gc / kg, at least about 1 × 10 11 gc / kg, at least about 1 × 10 12 gc / kg, at least about 1 × 10 13 gc / kg, or at least about 1 × 10 14 The subject is administered the pharmaceutical composition at a dose of about 1 x 10 gc / kg of a polynucleotide comprising a nucleic acid sequence encoding an engineered nuclease. 10 gc / kg ~ approx. 1×10 11 gc / kg, approximately 1×10 11 gc / kg ~ approx. 1×10 12 gc / kg, approximately 1×10 12 gc / kg ~ approx. 1×10 13 gc / kg, or approximately 1 × 10 13 gc / kg ~ approx. 1×10 14 The subject is administered the pharmaceutical composition at a dose of about 1 x 10 gc / kg of a polynucleotide comprising a nucleic acid sequence encoding an engineered nuclease. 12 gc / kg ~ approx. 9×10 13 gc / kg (e.g., approximately 1 × 10 12 gc / kg, approx. 2×10 12 gc / kg, approx. 3×10 12 gc / kg, approx. 4×10 12 gc / kg, approx. 5×10 12 gc / kg, approximately 6×10 12 gc / kg, approximately 7×10 12 gc / kg, approximately 8×10 12 gc / kg, approx. 9×10 12 gc / kg, approximately 1×10 13 gc / kg, approx. 2×10 13 gc / kg, approx. 3×1013 gc / kg, approx. 4×10 13 gc / kg, approx. 5×10 13 gc / kg, approximately 6×10 13 gc / kg, approximately 7×10 13 gc / kg, approximately 8×10 13 gc / kg, or approximately 9 × 10 13 The pharmaceutical composition is administered at a dose of 1000 mg / kg (1000 mg / kg) of a polynucleotide comprising a nucleic acid sequence encoding an engineered nuclease.

[0330] In some embodiments, the subject is administered a lipid nanoparticle formulation at a dose of about 0.1 mg / kg to about 3 mg / kg of mRNA encoding an engineered nuclease. In some embodiments, the subject is administered a lipid nanoparticle formulation at a dose of at least about 0.1 mg / kg, at least about 0.25 mg / kg, at least about 0.5 mg / kg, at least about 0.75 mg / kg, at least about 1.0 mg / kg, at least about 1.5 mg / kg, at least about 2.0 mg / kg, at least about 2.5 mg / kg, or at least about 3.0 mg / kg of mRNA encoding an engineered nuclease. In some embodiments, the subject is administered a lipid nanoparticle formulation at a dose of about 0.1 mg / kg to about 0.25 mg / kg, about 0.25 mg / kg to about 0.5 mg / kg, about 0.5 mg / kg to about 0.75 mg / kg, about 0.75 mg / kg to about 1.0 mg / kg, about 1.0 mg / kg to about 1.5 mg / kg, about 1.5 mg / kg to about 2.0 mg / kg, about 2.0 mg / kg to about 2.5 mg / kg, or about 2.5 mg / kg to about 3.0 mg / kg of mRNA encoding the engineered nuclease.

[0331] Target tissues for delivery of the engineered meganucleases of the present invention include, but are not limited to, hepatocytes or preferably primary hepatocytes, more preferably human hepatocytes or primary human hepatocytes, liver cells such as HepG2.2.15 or HepG2-hNTCP cells. As discussed, the meganucleases of the present invention can be delivered as purified proteins or as RNA or DNA encoding the meganuclease. In one embodiment, the meganuclease protein or mRNA or DNA vector encoding the meganuclease is delivered to target cells (e.g., liver cells) via direct injection into the target tissue. Alternatively, the meganuclease protein, mRNA, DNA, or cells expressing the meganuclease can be delivered systemically via the circulatory system.

[0332] Methods and compositions are provided for delivering the nucleases disclosed herein to a subject's liver. In one embodiment, native hepatocytes removed from a mammal can be transduced with a vector encoding the engineered nuclease. Alternatively, native hepatocytes of a subject can be transduced ex vivo with a recombinant virus, e.g., a recombinant AAV, encoding the engineered nuclease and / or a molecule that stimulates liver regeneration, such as a hepatotoxin. Preferably, the hepatotoxin is uPA, which, once expressed by the recombinant virus, has been modified to inhibit its secretion from hepatocytes. In another embodiment, the recombinant virus contains a nucleic acid sequence encoding tPA, which can stimulate hepatocyte regeneration de novo. The transduced hepatocytes removed from the mammal can then be returned to the mammal, where conditions conducive to expression of the engineered nuclease are provided. Typically, the transduced hepatocytes can be returned to the patient by infusion via the spleen or portal vasculature, and administration can be single or multiple times over a period of 1 to 5 days or more.

[0333] In the in vivo embodiment of the method of the present invention, a retrovirus, pseudotype or recombinant AAV is constructed that encodes an engineered nuclease and is administered to a subject.The administration of the recombinant virus that contains the nucleic acid sequence that encodes the engineered nuclease can be carried out together with the administration of a recombinant AAV that contains the nucleic acid sequence that encodes a secreted hepatotoxin or that stimulates hepatocyte regeneration without acting as a hepatotoxin.

[0334] In various embodiments of the methods described herein, one or more engineered nucleases described herein, polynucleotides comprising nucleic acid sequences encoding such engineered nucleases, or recombinant viruses comprising one or more polynucleotides comprising nucleotide sequences encoding such engineered nucleases can be administered via any suitable administration route known in the art. Thus, one or more engineered nucleases described herein, polynucleotides encoding such engineered nucleases, or vectors comprising one or more polynucleotides encoding such engineered nucleases can be administered via administration routes including intravenous, intramuscular, intraperitoneal, subcutaneous, intrahepatic, transmucosal, transdermal, intraarterial, and sublingual. In some embodiments, the nuclease protein, or mRNA or DNA vector encoding the nuclease, is delivered to target cells (e.g., liver cells) via direct injection into the target tissue. Other suitable administration routes for engineered nucleases, polynucleotides encoding such engineered nucleases, or recombinant viruses comprising one or more polynucleotides encoding such engineered nucleases can be readily determined by the treating physician as needed.

[0335] In some embodiments, a therapeutically effective amount of the engineered nuclease described herein is administered to a subject in need thereof. If necessary, the dosage or frequency of administration of the engineered nuclease may be adjusted over the course of treatment based on the judgment of the administering physician. The appropriate dose will depend, among other factors, on the specifics of the selected AAV (e.g., serotype, etc.), the route of administration, the subject being treated (i.e., the subject's age, weight, sex, and general condition), and the mode of administration. Therefore, the appropriate dosage may vary from patient to patient. An appropriate effective amount can be readily determined by one of skill in the art. Dosage treatment may be a single-dose schedule or a multiple-dose schedule. Furthermore, a subject may be administered any number of doses, if appropriate. One of skill in the art can readily determine the appropriate number of doses. The dosage may need to be adjusted to account for alternative routes of administration or to balance the therapeutic benefit with any side effects.

[0336] In some embodiments, the method comprises delivering an engineered meganuclease described herein (or a polynucleotide comprising a nucleic acid sequence encoding it) and a polynucleotide comprising a nucleic acid sequence homologous to a nucleic acid sequence encoding a sequence of interest and a nucleic acid sequence adjacent to a meganuclease cleavage site, wherein the engineered meganuclease recognizes and cleaves a recognition sequence comprising SEQ ID NO:7 or SEQ ID NO:9 within the TTR gene, thus cleaving the TTR gene, and the sequence of interest is inserted into the cleavage site by homologous recombination.

[0337] The exogenous nucleic acid molecule of the present invention can be introduced into cells and / or delivered to a subject by any of the aforementioned means. In certain embodiments, the exogenous nucleic acid molecule is introduced by a recombinant virus (i.e., a viral vector), such as a recombinant lentivirus, recombinant retrovirus, recombinant adenovirus, or recombinant AAV. Recombinant AAV useful for introducing exogenous nucleic acid molecules can have any serotype that allows the virus to transduce cells and insert the exogenous nucleic acid molecule sequence into the cellular genome. In some embodiments, the recombinant AAV has the AAV2, AAV6, AAV8, or AAV9 serotype. In some embodiments, the recombinant AAV has the AAV2 serotype. In some embodiments, the recombinant AAV has the AAV6 serotype. In some embodiments, the recombinant AAV has the AAV8 serotype. Recombinant AAV can also be self-complementary so as not to require second-strand DNA synthesis in the host cell. Exogenous nucleic acid molecules introduced using recombinant AAV can be flanked by 5' (left) and 3' (right) inverted terminal repeats.

[0338] In another specific embodiment, exogenous nucleic acid molecules can be introduced into cells using single-stranded DNA templates.The single-stranded DNA can include exogenous nucleic acid molecules, and in certain embodiments, can include 5' and 3' homologous arms to facilitate the insertion of nucleic acid sequences into nuclease cleavage sites by homologous recombination.The single-stranded DNA can further include a 5' AAV inverted terminal repeat (ITR) sequence 5' upstream of the 5' homologous arm and a 3' AAV ITR sequence 3' downstream of the 3' homologous arm.

[0339] In another specific embodiment, genes encoding the nucleases of the present invention and / or exogenous nucleic acid molecules of the present invention can be introduced into cells by transfection with a linear DNA template. Plasmid DNA encoding the engineered nucleases and / or exogenous nucleic acid molecules can be digested with one or more restriction enzymes, for example, so that the circular plasmid DNA is linearized before transfection into cells.

[0340] When delivered to a cell, the exogenous nucleic acid of the present invention can be operably linked to any promoter suitable for expressing the encoded polypeptide in the cell, including the aforementioned mammalian promoters and inducible promoters. The exogenous nucleic acid of the present invention can also be operably linked to a synthetic promoter. Synthetic promoters can include, but are not limited to, the JeT promoter (WO2002 / 012514). In certain embodiments, the nucleic acid sequence encoding the engineered meganuclease disclosed herein can be operably linked to a liver-specific promoter. Examples of liver-specific promoters include, but are not limited to, the human alpha-1 antitrypsin promoter and the apolipoprotein A-II promoter.

[0341] 2.4 Pharmaceutical Compositions

[0342] In some embodiments, the present invention provides pharmaceutical compositions comprising a pharmaceutically acceptable carrier and an engineered meganuclease of the present invention, or a pharmaceutically acceptable carrier and an isolated polynucleotide comprising a nucleic acid encoding an engineered meganuclease of the present invention. In other embodiments, the present invention provides pharmaceutical compositions comprising a pharmaceutically acceptable carrier and a genetically modified cell of the present invention, which can be delivered to a target tissue where the cells express the engineered meganuclease disclosed herein. In particular, pharmaceutical compositions are provided comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of an engineered meganuclease-encoding nucleic acid or engineered meganuclease, wherein the engineered nuclease has specificity for a recognition sequence within the TTR gene, such as TTR5-6 (SEQ ID NO:9) or TTR15-16 (SEQ ID NO:7).

[0343] Thus, the pharmaceutical compositions of the present invention can be useful for treating TTR-related diseases (e.g., transthyretin amyloidosis) in a subject, reducing TTR levels, reducing TTR amyloid levels, or reducing symptoms associated with TTR-related diseases (e.g., transthyretin amyloidosis). Subjects with TTR-related diseases or who may be particularly amenable to treatment with the engineered meganucleases herein can be identified by determining the presence or absence of one or more risk factors, diagnostic indicators, or prognostic indicators, such as those described herein. For example, in some cases, subjects have a mutation in the TTR gene that affects the peripheral nervous system, autonomic nervous system, pia mater, and / or heart. In certain cases, subjects receiving treatment with the methods and compositions provided herein can be characterized by one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or more) mutations in the TTR gene.For example, a subject undergoing treatment may have any of the following amino acids: Gly6Ser, Cys10Arg, Leu12Pro, Asp18Gly, Val20Ile, Ala25Thr, Val30Met, Val30Ala, Val30Leu, Val30Gly, Phe33Ile, Phe33Leu, Ala36Pro, Glu42Gly, Phe44Ser, Ala45Thr, Gly47Arg, Gly47Ala, Gly47Arg, Thr49Ala, Ser50Arg, Ser50Ile, Gly53Glu, Leu55Pro, Leu58His, Leu58Arg, Thr60Ala, Glu61Lys, Phe6 have a mutation in the TTR gene encoding a TTR polypeptide containing one or more amino acid substitutions, including a 4Leu, Phe64Ser, Ile68Leu, Tyr69His, Lys70Asn, Val71Ala, Ser77Tyr, Ile84Ser, Glu89Gln, His90Asn, Ala97Gly, Ala97Ser, Arg104His, Ile107Val, Ala109Thr, Ala109Val, Leu111Met, Tyr114Cys, Tyr114His, Tyr116Val, Thr119Met, Val122Ile, or Val122Del mutation.

[0344] TTR level can be evaluated at any time before, during or after treatment according to the method herein using any method known in the art.TTR level can be evaluated based on the level of any variable associated with TTR gene expression, such as TTR mRNA level, TTR protein level, retinol-binding protein level, vitamin A level, or the number or extent of amyloid deposits.The reduction of TTR level or expression can be evaluated by the absolute or relative level decrease of one or more of these variables compared with reference level.TTR level can be measured in biological samples isolated from subjects, such as tissue biopsies, or body fluids including blood, serum, plasma, cerebrospinal fluid or urine.Optionally, TTR level is normalized to a standard protein or substance in the sample. In some embodiments, the claimed methods include administration of any of the engineered meganucleases described herein, or nucleic acids encoding meganucleases, to reduce TTR levels in a subject by at least 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% relative to a reference level.

[0345] Such pharmaceutical compositions can be prepared according to known techniques. See, for example, Remington, The Science And Practice of Pharmacy (21st ed., Philadelphia, Lippincott, Williams & Wilkins, 2005). In preparing pharmaceutical formulations according to the present invention, the meganuclease polypeptide (or DNA / RNA encoding it or cells expressing it) is typically mixed with a pharmaceutically acceptable carrier, and the resulting composition is administered to a subject. The carrier must be acceptable in the sense of being compatible with any other ingredients in the formulation and not harmful to the subject. In some embodiments, the pharmaceutical compositions of the present invention may further comprise one or more additional drugs or biological molecules useful for treating a disease in a subject. Similarly, the additional drugs and / or biological molecules may be co-administered as separate compositions.

[0346] The pharmaceutical compositions described herein can comprise an effective amount of any meganuclease of the present invention, or a nucleic acid encoding any meganuclease. In some embodiments, the pharmaceutical composition comprises about 1×10 10 gc / kg ~ approx. 1×10 14 gc / kg (e.g., 1 × 10 10 gc / kg, 1 × 10 11 gc / kg, 1 × 10 12 gc / kg, 1 × 10 13 gc / kg, or 1 × 10 14 In some embodiments, the pharmaceutical composition comprises at least about 1 x 10 gc / kg of a polynucleotide comprising a nucleic acid sequence encoding the engineered nuclease. 10 gc / kg, at least about 1 × 10 11 gc / kg, at least about 1 × 10 12 gc / kg, at least about 1 × 10 13 gc / kg, or at least about 1 × 10 14 In some embodiments, the pharmaceutical composition comprises about 1 x 10 gc / kg of a polynucleotide comprising a nucleic acid sequence encoding an engineered nuclease. 10 gc / kg ~ approx. 1×10 11 gc / kg, approximately 1×10 11 gc / kg ~ approx. 1×10 12 gc / kg, approximately 1×10 12 gc / kg ~ approx. 1×10 13 gc / kg, or approximately 1 × 10 13 gc / kg ~ approx. 1×10 14 In certain embodiments, the pharmaceutical composition comprises about 1 x 10 gc / kg of a polynucleotide comprising a nucleic acid sequence encoding an engineered nuclease. 12 gc / kg ~ approx. 9×10 13 gc / kg (e.g., approximately 1 × 10 12 gc / kg, approx. 2×10 12 gc / kg, approx. 3×10 12 gc / kg, approx. 4×10 12 gc / kg, approx. 5×10 12 gc / kg, approximately 6×10 12gc / kg, approximately 7×10 12 gc / kg, approximately 8×10 12 gc / kg, approx. 9×10 12 gc / kg, approximately 1×10 13 gc / kg, approx. 2×10 13 gc / kg, approx. 3×10 13 gc / kg, approx. 4×10 13 gc / kg, approx. 5×10 13 gc / kg, approximately 6×10 13 gc / kg, approximately 7×10 13 gc / kg, approximately 8×10 13 gc / kg, or approximately 9 × 10 13 gc / kg) of a polynucleotide comprising a nucleic acid sequence encoding the engineered meganuclease.

[0347] In certain embodiments of the present invention, pharmaceutical compositions may comprise one or more mRNAs described herein encapsulated within lipid nanoparticles as described elsewhere herein. In certain embodiments, lipid nanoparticles may comprise two or more mRNAs as described herein. In other embodiments, lipid nanoparticles may comprise at least two mRNAs, where at least one first mRNA is an mRNA described herein that encodes an engineered meganuclease that recognizes and cleaves the TTR5-6 recognition sequence, and at least one second mRNA encodes a second engineered meganuclease that recognizes and cleaves a recognition sequence within the TTR gene other than the TTR5-6 recognition sequence (e.g., TTR15-16).

[0348] Some lipid nanoparticles contemplated for use in the present invention may contain at least one cationic lipid, at least one non-cationic lipid, and at least one complex lipid. In more specific examples, the lipid nanoparticles may contain about 50 mol% to about 85 mol% cationic lipid, about 13 mol% to about 49.5 mol% non-cationic lipid, and about 0.5 mol% to about 10 mol% lipid complexes, and are manufactured in a manner that results in a non-lamellar (i.e., non-bilayer) morphology. In other specific examples, the lipid nanoparticles may contain about 40 mol% to about 85 mol% cationic lipid, about 13 mol% to about 49.5 mol% non-cationic lipid, and about 0.5 mol% to about 10 mol% lipid complexes, and are manufactured in a manner that results in a non-lamellar (i.e., non-bilayer) morphology.

[0349] The cationic lipid may include, for example, one or more of the following: palmitoyl-oleoyl-nor-arginine (PONA), MPDACA, GUADACA, ((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate) (MC3), LenMC3, CP-LenMC3, γ-LenMC3, CP-γ-LenMC3, MC3MC, MC2MC, MC3 ether, MC4 ether, MC3 amide, Pan-MC3, Pan-MC4, and Pan MC5, 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-K-C2-DMA; "XTC2"), 2,2-dilinoleyl-4-(3-dimethylaminopropyl)-[1,3]-dioxolane DLin-K-C3-DMA), 2,2-Dilinoleyl-4-(4-dimethylaminobutyl)-[1,3]-dioxolane (DLin-K-C4-DMA), 2,2-Dilinoleyl-5-dimethylaminomethyl-[1,3]-dioxane (DLin-K6-DMA), 2,2-Dilinoleyl-4-N-methylpepiazino-[1,3]-dioxolane (DLin-K-MPZ), 2,2-Dilinoleyl-4-di Methylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), 1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-dilinoleyloxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 2-dilinoleyloxy-3-morpholinopropane (DLin-MA), 1,2-dilinoleoyl-3-dimethylaminopropane (DLin DAP), 1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), 3-(N,N-dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-dioleylamino)-1,2-propanediol (DOAP), 1,2-dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), 1,2-dioleyloxy-N,N-dimethyl N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), 3-(N-(N',N'-dimethylaminoethane)-carbamoyl)- (DC-Chol), N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), dioctadecylamidoglycylspermine (DOGS), 3-dimethylamino-2-(cholest-5-ene-3-beta-oxybutan-4-ol) 2-[5'-(cholest-5-ene-3-beta-oxy)-3'-oxapentoxy]-3-dimethyl-1-(cis,cis-9',1-2'-octadecadienoxy)propane (CpLinDMA), N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA), 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP), 1,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP), or a mixture thereof. The cationic lipid may also be DLinDMA, DLin-K-C2-DMA ("XTC2"), MC3, LenMC3, CP-LenMC3, γ-LenMC3, CP-γ-LenMC3, MC3MC, MC2MC, MC3 ether, MC4 ether, MC3 amide, Pan-MC3, Pan-MC4, Pan-MC5, or a mixture thereof.

[0350] In various embodiments, the cationic lipid may comprise from about 50 mol% to about 90 mol%, from about 50 mol% to about 85 mol%, from about 50 mol% to about 80 mol%, from about 50 mol% to about 75 mol%, from about 50 mol% to about 70 mol%, from about 50 mol% to about 65 mol%, or from about 50 mol% to about 60 mol% of the total lipid present in the particle.

[0351] In other embodiments, the cationic lipid may constitute about 40 mol% to about 90 mol%, about 40 mol% to about 85 mol%, about 40 mol% to about 80 mol%, about 40 mol% to about 75 mol%, about 40 mol% to about 70 mol%, about 40 mol% to about 65 mol%, or about 40 mol% to about 60 mol% of the total lipid present in the particle.

[0352] Non-cationic lipids can include, for example, one or more anionic lipids and / or neutral lipids.In certain embodiments, non-cationic lipids include one of the following neutral lipid components: (1) cholesterol or its derivatives; (2) phospholipids; or (3) a mixture of phospholipids and cholesterol or its derivatives.Examples of cholesterol derivatives include, but are not limited to, cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, cholesteryl-4'-hydroxybutyl ether, and mixtures thereof. The phospholipid may be a neutral lipid, including, but not limited to, dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoyl-phosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), palmitoyloleoyl-phosphatidylglycerol (POPG), dipalmitoyl-phosphatidylethanolamine (DPPE), dimyristoyl-phosphatidylethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), monomethyl-phosphatidylethanolamine, dimethyl-phosphatidylethanolamine, dielaidoyl-phosphatidylethanolamine (DEPE), stearoyloleoyl-phosphatidylethanolamine (SOPE), egg phosphatidylcholine (EPC), and mixtures thereof. In certain embodiments, the phospholipid is DPPC, DSPC, or a mixture thereof.

[0353] In some embodiments, the non-cationic lipid (e.g., one or more phospholipids and / or cholesterol) may comprise about 10 mol% to about 60 mol%, about 15 mol% to about 60 mol%, about 20 mol% to about 60 mol%, about 25 mol% to about 60 mol%, about 30 mol% to about 60 mol%, about 10 mol% to about 55 mol%, about 15 mol% to about 55 mol%, about 20 mol% to about 55 mol%, about 25 mol% to about 55 mol%, about 30 mol% to about 55 mol%, about 13 mol% to about 50 mol%, about 15 mol% to about 50 mol%, or about 20 mol% to about 50 mol% of the total lipid present in the particle. When the non-cationic lipid is a mixture of phospholipid and cholesterol or cholesterol derivative, the mixture may comprise up to about 40, 50, or 60 mol% of the total lipid present in the particle.

[0354] The conjugated lipid that inhibits particle aggregation can include, for example, one or more of polyethylene glycol (PEG)-lipid conjugates, polyamide (ATTA)-lipid conjugates, cationic polymer-lipid conjugates (CPL), or mixtures thereof. In one specific embodiment, the nucleic acid-lipid particles include either PEG-lipid conjugates or ATTA-lipid conjugates. In certain embodiments, the PEG-lipid conjugates or ATTA-lipid conjugates are used together with CPL. The conjugated lipid that inhibits particle aggregation can include, for example, PEG-lipids including PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), or mixtures thereof. The PEG-DAA conjugate can be PEG-dilauryloxypropyl (C12), PEG-dimyristyloxypropyl (C14), PEG-dipalmityloxypropyl (C16), PEG-distearyloxypropyl (C18), or mixtures thereof.

[0355] Other PEG-lipid conjugates suitable for use in the present invention include, but are not limited to, mPEG2000-1,2-di-O-alkyl-sn3-carbomoylglyceride (PEG-C-DOMG).The synthesis of PEG-C-DOMG is described in PCT application number PCT / US08 / 88676.Other PEG-lipid conjugates suitable for use in the present invention include, but are not limited to, 1-[8'-(1,2-dimyristoyl-3-propanoxy)-carboxamido-3',6'-dioxaoctanyl]carbamoyl-ω-methyl-poly(ethylene glycol) (2KPEG-DMG).The synthesis of 2KPEG-DMG is described in US Patent No. 7,404,969.

[0356] In some cases, the conjugated lipid (e.g., PEG-lipid conjugate) that inhibits particle aggregation may comprise about 0.1 mol% to about 2 mol%, about 0.5 mol% to about 2 mol%, about 1 mol% to about 2 mol%, about 0.6 mol% to about 1.9 mol%, about 0.7 mol% to about 1.8 mol%, about 0.8 mol% to about 1.7 mol%, about 1 mol% to about 1.8 mol%, about 1.2 mol% to about 1.8 mol%, about 1.2 mol% to about 1.7 mol%, about 1.3 mol% to about 1.6 mol%, about 1.4 mol% to about 1.5 mol%, or about 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mol% (or any fraction or range thereof) of the total lipid present in the particle. Typically, in such cases, the PEG moiety has an average molecular weight of about 2,000 daltons. In other cases, the conjugated lipid (e.g., PEG-lipid conjugate) that inhibits particle aggregation can comprise about 5.0 mol% to about 10 mol%, about 5 mol% to about 9 mol%, about 5 mol% to about 8 mol%, about 6 mol% to about 9 mol%, about 6 mol% to about 8 mol%, or about 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, or 10 mol% (or any fraction or range thereof) of the total lipid present in the particle. Typically, in such cases, the PEG moiety has an average molecular weight of about 750 daltons.

[0357] In other embodiments, the composition may comprise amphoteric liposomes containing at least one positive charge carrier and at least one negative charge carrier different from the positive charge carrier, the isoelectric point of the liposomes being between 4 and 8. This objective is achieved by the fact that the liposomes are prepared with a pH-dependent varying charge.

[0358] Liposome structures with desired properties are formed, for example, when the amount of membrane-forming or membrane-based cationic charge carriers exceeds the amount of anionic charge carriers at low pH and the ratio is reversed at high pH. This is always the case when the ionizable components have pKa values between 4 and 9. As the pH of the medium decreases, all cationic charge carriers become more charged and all anionic charge carriers lose their charge.

[0359] Cationic compounds useful for amphoteric liposomes include those described herein above. Strong cationic compounds include, but are not limited to, DC-Chol 3-β-[N—(N′,N′-dimethylmethane)carbamoyl]cholesterol, TC-Chol 3-β-[N—(N′,N′,N′-trimethylaminoethane)carbamoylcholesterol, BGSC bisguanidinium-spermidine-cholesterol, BGTC bis-guanidinium-tren-cholesterol, DOTAP (1,2-dioleoyloxypropyl)-N,N,N-trimethylammonium chloride, DOSPER (1,3-dioleoyloxy-2-(6-carboxy-spermyl)-propylarnide, DOTMA (1,2-dioleoyloxypropyl)-N,N,N-trimethylammonium chloride) (Lipofectin®), DORIE (1,2-dioleoyloxypropyl)-3-dimethylammonium chloride, DOSPER (1,3-dioleoyloxy-2-(6-carboxy-spermyl)-propylarnide), DOTMA (1,2-dioleoyloxypropyl)-N,N,N-trimethylammonium chloride) (Lipofectin®), DORIE (1,2-dioleoyloxypropyl)-3-dimethylammonium chloride, DOSPER (1,3-dioleoyloxy-2-(6-carboxy-spermyl)-propylarnide), DOTMA (1,2-dioleoyloxypropyl)-N,N,N-trimethylammonium chloride) (Lipofectin®), DORIE (1,2-dioleoyloxypropyl)-3-dimethylammonium chloride), ... Examples of suitable oleoyl compounds include cetyl hydroxyethyl ammonium bromide, DOSC (1,2-dioleoyl-sn-glyceryl choline ester), DOGSDSO (1,2-dioleoyl-sn-glycero-3-succinyl-2-hydroxyethyl disulfide omitin), DDAB (dimethyldioctadecylammonium bromide), DOGS ((C18)2GlySper3+) N,N-dioctadecylamido-glycol-spermine (Transfectam®) (C18)2Gly+N,N-dioctadecylamido-glycine, CTAB cetyltrimethylammonium bromide, CpyC cetylpyridinium chloride, DOEPC 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine or other O-alkyl-phosphatidylcholines or ethanolamines, amides from lysine, arginine or ornithine and phosphatidylethanolamine.

[0360] Examples of weakly cationic compounds include, but are not limited to, His-Chol (histamine-cholesterol hemisuccinate), Mo-Chol (morpholine-N-ethylamino-cholesterol hemisuccinate) or histidinyl-PE.

[0361] Examples of neutral compounds include, but are not limited to, cholesterol, ceramide, phosphatidylcholine, phosphatidylethanolamine, tetraether lipids, or diacylglycerol.

[0362] Anionic compounds useful for amphoteric liposomes include the non-cationic compounds previously described herein. Examples of weakly anionic compounds include, but are not limited to, CHEMS (cholesterol hemisuccinate), alkylcarboxylic acids having 8 to 25 carbon atoms, or diacylglycerol hemisuccinate. Additional weakly anionic compounds include amides of aspartic acid or glutamic acid, as well as PE and PS and their amides with glycine, alanine, glutamine, asparagine, serine, cysteine, threonine, tyrosine, glutamic acid, aspartic acid, or other amino acids or aminodicarboxylic acids. By a similar principle, esters of hydroxycarboxylic acids or hydroxydicarboxylic acids with PS are also weakly anionic compounds.

[0363] In some embodiments, amphoteric liposome can contain complex lipids such as those described hereinabove.Specific examples of useful complex lipids include, but are not limited to, PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide complex (for example, PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamine and PEG-modified 1,2-diacyloxypropan-3-amine.Specific examples are PEG-modified diacylglycerol and dialkylglycerol.

[0364] In some embodiments, the neutral lipids may constitute about 10 mol% to about 60 mol%, about 15 mol% to about 60 mol%, about 20 mol% to about 60 mol%, about 25 mol% to about 60 mol%, about 30 mol% to about 60 mol%, about 10 mol% to about 55 mol%, about 15 mol% to about 55 mol%, about 20 mol% to about 55 mol%, about 25 mol% to about 55 mol%, about 30 mol% to about 55 mol%, about 13 mol% to about 50 mol%, about 15 mol% to about 50 mol%, or about 20 mol% to about 50 mol% of the total lipids present in the particles.

[0365] In some cases, the conjugated lipid (e.g., PEG-lipid conjugate) that inhibits particle aggregation may comprise about 0.1 mol% to about 2 mol%, about 0.5 mol% to about 2 mol%, about 1 mol% to about 2 mol%, about 0.6 mol% to about 1.9 mol%, about 0.7 mol% to about 1.8 mol%, about 0.8 mol% to about 1.7 mol%, about 1 mol% to about 1.8 mol%, about 1.2 mol% to about 1.8 mol%, about 1.2 mol% to about 1.7 mol%, about 1.3 mol% to about 1.6 mol%, about 1.4 mol% to about 1.5 mol%, or about 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mol% (or any fraction or range thereof) of the total lipid present in the particle. Typically, in such cases, the PEG moiety has an average molecular weight of about 2,000 daltons. In other cases, the conjugated lipid (e.g., PEG-lipid conjugate) that inhibits particle aggregation can comprise about 5.0 mol% to about 10 mol%, about 5 mol% to about 9 mol%, about 5 mol% to about 8 mol%, about 6 mol% to about 9 mol%, about 6 mol% to about 8 mol%, or about 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, or 10 mol% (or any fraction or range thereof) of the total lipid present in the particle. Typically, in such cases, the PEG moiety has an average molecular weight of about 750 daltons.

[0366] Considering the total amount of neutral lipids and complex lipids, the remaining balance of the amphoteric liposomes may contain a mixture of cationic and anionic compounds formulated in various ratios. The ratio of cationic to anionic lipids can be selected to achieve the desired properties of nucleic acid sealing, zeta potential, pKa, or other physicochemical properties that depend at least in part on the presence of charged lipid components.

[0367] In some embodiments, the lipid nanoparticles have a composition that specifically enhances delivery and uptake within the liver, particularly hepatocytes.

[0368] In some embodiments, the pharmaceutical compositions of the present invention may further comprise one or more additional agents useful for treating a TTR-related disease (e.g., transthyretin amyloidosis) in a subject.

[0369] The present disclosure also provides the engineered meganucleases described herein (or nucleic acids encoding same or cells expressing the engineered meganucleases) for use as a pharmaceutical. The present disclosure further provides the use of the engineered meganucleases described herein (or nucleic acids encoding same or cells expressing the engineered meganucleases) in the manufacture of a medicament for treating a TTR-related disease (e.g., transthyretin amyloidosis), for reducing levels of TTR, for reducing levels of TTR amyloid, or for reducing symptoms associated with a TTR-related disease (e.g., transthyretin amyloidosis).

[0370] 2.5 Methods for generating recombinant viruses

[0371] In some embodiments, the present invention provides recombinant viruses (i.e., recombinant viral vectors; e.g., recombinant AAV vectors) for use in the methods of the present invention. Recombinant AAV is typically produced in mammalian cell lines such as HEK-293. The viral cap and rep genes are removed from the recombinant virus to prevent its autonomous replication and allow for the delivery of a therapeutic gene (e.g., a meganuclease gene), and therefore must be provided in trans to the packaging cell line. In addition, the "helper" (e.g., adenovirus) components necessary to support replication must be provided (Cots D et al., (2013) Curr. Gene Ther. 13(5):370-81). Recombinant AAV is often produced using triple transfection, in which a cell line is transfected with a first plasmid encoding the "helper" components, a second plasmid containing the cap and rep genes, and a third plasmid containing the viral ITRs containing the intervening DNA sequence to be packaged into the virus. The viral particles containing the encapsidated genome (ITRs and intervening gene of interest) are then isolated from the cells by freeze-thaw cycles, sonication, detergents, or other means known in the art. The particles are then purified using cesium chloride density gradient centrifugation or affinity chromatography, and subsequently delivered to the gene of interest in a cell, tissue, or organism, such as a human patient.

[0372] Because recombinant AAV particles are typically produced (manufactured) intracellularly, care must be taken to ensure that the engineered meganuclease is not expressed in the packaging cells when implementing the present invention. Because the recombinant viral genome of the present invention may contain a meganuclease recognition sequence, any meganuclease expressed in the packaging cell line may cleave the viral genome before it can be packaged into viral particles. This results in reduced packaging efficiency and / or packaging of fragmented genomes. Several approaches can be used to prevent meganuclease expression in packaging cells.

[0373] The nuclease can be placed under the control of a tissue-specific promoter that is not active in packaging cells. For example, when developing a recombinant virus for delivering a meganuclease gene to muscle tissue, a muscle-specific promoter can be used. Examples of muscle-specific promoters include C5-12 (Liu, et al. (2004) Hum Gene Ther. 15:783-92), muscle-specific creatine kinase (MCK) promoter (Yuasa, et al. (2002) Gene Ther. 9:1576-88), or smooth muscle 22 (SM22) promoter (Haase, et al. (2013) BMC Biotechnol. 13:49-54). Examples of CNS (neuron)-specific promoters include NSE, synapsin, and MeCP2 promoters (Lentz, et al. (2012) Neurobiol Dis. 48:179-88). Examples of liver-specific promoters include albumin promoters (such as Palb), human alpha 1-antitrypsin (such as Pa1AT), and hemopexin (such as Phpx) (Kramer et al., (2003) Mol. Therapy 7:375-85), hybrid liver-specific promoters (hepatic locus control region (ApoE-HCR) from the ApoE gene and the liver-specific alpha 1-antitrypsin promoter), human thyroxine-binding globulin (TBG) promoter, and apolipoprotein A-II promoter. Examples of eye-specific promoters include opsin and the corneal epithelium-specific K12 promoter (Martin et al., (2002) Methods (28):267-75) (Tong et al., (2007) J Gene Med, 9:956-66). These promoters, or other tissue-specific promoters known in the art, are not highly active in HEK-293 cells and therefore, when incorporated into the viral vectors of the present invention, are not expected to result in significant levels of meganuclease gene expression in packaging cells.Similarly, the recombinant viruses of the present invention are intended for use with other cell lines that use incompatible tissue-specific promoters (i.e., the well-known HeLa cell line (human epithelial cells) and the liver-specific hemopexin promoter). Other examples of tissue-specific promoters include synovial sarcoma PDZD4 (cerebellum), C6 (liver), ASB5 (muscle), PPP1R12B (heart), SLC5A12 (kidney), cholesterol-regulated APOM (liver), ADPRHL1 (heart), and monogenic malformation syndrome TP73L (muscle) (Jacox et al., (2010), PLoS One v.5(8):e12274).

[0374] Alternatively, recombinant viruses can be packaged in cells from various species in which meganucleases are poorly expressed. For example, viral particles can be produced in microbial, insect, or plant cells using mammalian promoters, such as the well-known cytomegalovirus or SV40 virus early promoters, which are not active in non-mammalian packaging cells. In certain embodiments, viral particles are produced in insect cells using the baculovirus system described by Gao et al. (Gao et al. (2007), J. Biotechnol. 131(2):138-43). Meganucleases under the control of mammalian promoters are unlikely to be expressed in these cells (Airenne et al. (2013), Mol. Ther. 21(4):739-49). Furthermore, insect cells utilize mRNA splicing motifs that differ from mammalian cells. Therefore, it is possible to incorporate mammalian introns, such as the human growth hormone (HGH) intron or the SV40 large T antigen intron, into the meganuclease coding sequence. Because these introns are not efficiently spliced from the pre-mRNA transcript in insect cells, the insect cells do not express a functional meganuclease and package the full-length genome. In contrast, mammalian cells into which the resulting recombinant AAV particles are delivered properly splice the pre-mRNA and express a functional meganuclease protein. Haifeng Chen has reported the use of HGH and the SV40 large T antigen intron to attenuate the expression of the toxic proteins barnase and diphtheria toxin fragment A in insect packaging cells, enabling the generation of recombinant AAV vectors carrying these toxin genes (Chen, H (2012) Mol Ther Nucleic Acids. 1(11):e57).

[0375] The meganuclease gene can be operably linked to an inducible promoter so that a small molecule inducer is required for meganuclease expression. Examples of inducible promoters include the Tet-On system (Clontech; Chen et al. (2015), BMC Biotechnol. 15(1):4) and the RheoSwitch system (Intrexon; Sowa et al. (2011), Spine, 36(10):E623-8). Both systems, as well as similar systems known in the art, rely on ligand-inducible transcription factors (mutants of the Tet repressor and ecdysone receptor, respectively) that activate transcription in response to small molecule activators (doxycycline or ecdysone, respectively). Practicing the present invention using such a ligand-inducible transcriptional activator involves 1) placing the meganuclease gene under the control of a promoter responsive to the corresponding transcription factor (the meganuclease gene has one or more binding sites for the transcription factor), and 2) including a gene encoding the transcription factor in the packaged viral genome. The latter step is necessary because the meganuclease will not be expressed in target cells or tissues after recombinant AAV delivery unless the transcriptional activator is also provided in the same cells. The transcriptional activator then induces meganuclease gene expression only in cells or tissues treated with the cognate small molecule activator. This approach is advantageous because it allows for spatiotemporal control of meganuclease gene expression by selecting when and to which tissues the small molecule inducer is delivered. However, the need to include the inducer in the viral genome, which has a significantly limited carrying capacity, presents a drawback to this approach.

[0376] In another specific embodiment, recombinant AAV particles are produced in a mammalian cell line expressing a transcriptional repressor that prevents meganuclease expression. Transcriptional repressors are known in the art and include the Tet repressor, Lac repressor, Cro repressor, and lambda repressor. Many nuclear hormone receptors, such as the ecdysone receptor, also act as transcriptional repressors in the absence of their cognate hormone ligands. To practice the present invention, packaging cells are transfected / transduced with a vector encoding the transcriptional repressor, and the meganuclease gene in the viral genome (packaging vector) is operably linked to a promoter modified to contain a repressor binding site so that the repressor silences the promoter. The gene encoding the transcriptional repressor can be located in various locations. It can be encoded on a separate vector, incorporated into the packaging vector outside the ITR sequence, incorporated into a cap / rep vector or adenovirus helper vector, or stably integrated into the genome of the packaging cell so that it is constitutively expressed. Methods for modifying common mammalian promoters to incorporate transcriptional repressor sites are known in the art. For example, Chang and Roninson modified the strong constitutive CMV and RSV promoters to include the Lac repressor operator and showed that gene expression from the modified promoter was greatly attenuated in cells expressing the repressor (Chang and Roninson (1996), Gene 183:137-42). The use of a non-human transcriptional repressor ensures that the transcription of the meganuclease gene is only repressed in packaging cells expressing the repressor, and not in target cells or tissues transduced with the resulting recombinant AAV.

[0377] 2.6 Engineered meganuclease variants

[0378] Embodiments of the present invention include the engineered meganucleases described herein and variants thereof. Further embodiments of the present invention include isolated polynucleotides comprising nucleic acid sequences encoding the meganucleases described herein, and variants of such polynucleotides.

[0379] As used herein, "variant" is intended to mean a substantially similar sequence. A "variant" polypeptide is intended to mean a polypeptide derived from a "native" polypeptide by deletion or addition of one or more amino acids at one or more internal sites of the native protein and / or substitution of one or more amino acids at one or more sites of the native polypeptide. As used herein, a "native" polynucleotide or polypeptide includes the parent sequence from which a variant is derived. Variant polypeptides encompassed by embodiments are biologically active. In other words, they retain the desired biological activity of the native protein, i.e., the ability to bind to and cleave the TTR5-6 recognition sequence (SEQ ID NO: 7) within the TTR gene or the TTR15-16 recognition sequence (SEQ ID NO: 9). Such variants may result, for example, from artificial manipulation. Biologically active variants of the native polypeptides of the embodiments (e.g., SEQ ID NOS: 11-15), or biologically active variants of the recognition half-site binding subunits described herein, have at least about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the amino acid sequence of a native polypeptide, native subunit, native HVR1 region and / or native HVR2 region, as determined by sequence alignment programs and parameters described elsewhere herein. A biologically active variant of a polypeptide or subunit of the embodiments may differ from the polypeptide or subunit by no more than about 1-40 amino acid residues, no more than about 1-20 amino acid residues, no more than about 1-10 amino acid residues, no more than about 5 amino acid residues, no more than 4 amino acid residues, 3 amino acid residues, 2 amino acid residues, or even 1 amino acid residue.

[0380] The polypeptides of the embodiments can be modified in various ways, including amino acid substitution, deletion, truncation, and insertion. Methods for such manipulation are generally known in the art. For example, amino acid sequence variants can be prepared by mutations in DNA. Methods for mutagenesis and polynucleotide alterations are well known in the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382; U.S. Patent No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and the references cited therein. Guidance regarding appropriate amino acid substitutions that do not affect the biological activity of the protein of interest can be found in the model Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC), which is incorporated herein by reference. Conservative substitutions, such as exchanging one amino acid for another with similar properties, may be optimal. In some embodiments, engineered meganucleases of the invention can comprise variants of the HVR1 and HVR2 regions disclosed herein. The parent HVR regions can comprise, for example, residues 24-79 or residues 215-270 of an exemplary engineered meganuclease. Thus, variant HVRs can comprise amino acid sequences that have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more sequence identity to the amino acid sequences corresponding to residues 24-79 or residues 215-270 of the exemplary engineered meganucleases herein, such that the variant HVR regions maintain the biological activity of the engineered meganuclease (i.e., binding to and cleavage of a recognition sequence). Furthermore, in some embodiments of the invention, variant HVR1 or HVR2 regions can comprise residues corresponding to amino acid residues found at specific positions within the parent HVRs. In this context, "corresponding to" means that the amino acid residue in the variant HVR is the same amino acid residue (i.e., a separate and identical residue) that is present in the parent HVR sequence at the same relative position (i.e., relative to the remaining amino acids in the parent sequence). By way of example, if the parent HVR sequence contains a serine residue at position 26, then a variant HVR "comprising a residue corresponding to" residue 26 will also contain a serine at a position relative to (i.e., corresponding to) parent position 26.

[0381] In certain embodiments, an engineered meganuclease of the invention comprises an HVR1 having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of any one of SEQ ID NOs: 11-15.

[0382] In certain embodiments, an engineered meganuclease of the invention comprises an HVR2 having 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to the amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NOs: 11-15.

[0383] A significant number of amino acid modifications to the DNA recognition domain of wild-type I-CreI meganuclease have previously been identified (e.g., U.S. Patent No. 8,021,867), which, alone or in combination, result in engineered meganucleases with altered specificity at individual bases within the DNA recognition sequence half-site, such that the resulting rationally designed meganucleases have half-site specificity that differs from the wild-type enzyme. Table 3 shows potential substitutions that can be made in engineered meganuclease monomers or subunits to enhance specificity based on the base present at each half-site position (-1 to -9) of the recognition half-site.

[0384] [Table 3]

[0385] Entries in bold are wild-type contact residues and do not constitute "alterations" as used herein. An asterisk indicates that the residue contacts a base on the antisense strand.

[0386] Certain modifications can be made in engineered meganuclease monomers or subunits to modulate DNA binding affinity and / or activity. For example, the engineered meganuclease monomers or subunits described herein can contain G, S, or A at the residue corresponding to position 19 of I-CreI or any one of SEQ ID NOS: 11-15 (WO2009001159), Y, R, K, or D at the residue corresponding to position 66 of I-CreI or any one of SEQ ID NOS: 11-15, and / or E, Q, or K at the residue corresponding to position 80 of I-CreI or any one of SEQ ID NOS: 11-15 (US8021867).

[0387] In the case of polynucleotides, "variants" include deletions and / or additions of one or more nucleotides at one or more sites within the native polynucleotide. Those skilled in the art will recognize that variants of the nucleic acids of the embodiments are constructed so that the open reading frame is maintained. In the case of polynucleotides, conservative variants include sequences that, due to the degeneracy of the genetic code, encode the amino acid sequence of one of the polypeptides of the embodiments. Variant polynucleotides include synthetically derived polynucleotides, such as those generated, for example, by using site-directed mutagenesis, but still encoding the recombinant nucleases of the embodiments. Generally, a variant of a particular polynucleotide of the embodiments will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the particular polynucleotide as determined by sequence alignment programs and parameters described elsewhere herein. Variants of particular polynucleotides of the embodiments (i.e., reference polynucleotides) can also be evaluated by comparing the percent sequence identity between the polypeptides encoded by the variant polynucleotides and the reference polynucleotides.

[0388] The deletion, insertion and substitution of the protein sequence encompassed herein are not expected to cause fundamental changes in the characteristics of the polypeptide.However, if it is difficult to predict the exact effect of substitution, deletion or insertion in advance, those skilled in the art will understand that the effect will be evaluated by screening the polypeptide with its intended activity.For example, engineered nuclease mutants will be screened for their ability to preferentially bind and cleave the recognition sequence found in the TTR gene. [Example]

[0389] The present invention is further illustrated by the following examples, which should not be construed as limiting. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific substances and procedures described herein. Such equivalents are intended to be encompassed by the claims that follow the examples below.

[0390] Example 1 Characterization of a meganuclease that binds to and cleaves the TTR5-6 recognition sequence

[0391] 1. Meganuclease that binds to and cleaves the TTR5-6 recognition sequence

[0392] Recombinant meganucleases targeting the TTR5-6 recognition site (SEQ ID NO: 15), collectively referred to herein as "TTR5-6 meganucleases," were engineered to bind to and cleave the TTR5-6 recognition sequence (SEQ ID NO: 9) in the human or non-human primate (NHP) genome. Each recognition sequence is present in the TTR gene, specifically in exon 1. Each TTR5-6 recombinant meganuclease comprises an N-terminal nuclease localization signal derived from SV40, a first meganuclease subunit, a linker sequence, and a second meganuclease subunit. The first subunit in each TTR5-6 meganuclease binds to the first TTR5-6 recognition half-site (SEQ ID NO: 30), while the second subunit binds to the second TTR5-6 recognition half-site (SEQ ID NO: 32; see Figure 1).

[0393] Each TTR5-6 binding subunit contains 56 base pair hypervariable regions designated HVR1 and HVR2, respectively. The HVR1 region of each TTR5-6 meganuclease binding subunit consists of residues 24-79 of SEQ ID NO: 15. The HVR2 region of each TTR5-6 meganuclease consists of residues 215-270 of SEQ ID NO: 15. The TTR5-6 binding regions of SEQ ID NO: 15 are provided as SEQ ID NOs: 24-25.

[0394] 2. Cleavage of the TTR5-6 recognition sequence in a CHO cell reporter assay

[0395] To determine whether the TTR5-6 meganuclease could bind to and cleave both the human and non-human primate 5-6 recognition sequences (SEQ ID NO: 9), each recombinant meganuclease was evaluated using a previously described CHO cell reporter assay (see WO / 2012 / 167192 and Figure 5). To perform the assay, a CHO cell reporter line was generated that had a non-functional green fluorescent protein (GFP) gene expression cassette integrated into the cell's genome. The GFP gene in each cell line was interrupted by a pair of recognition sequences, such that intracellular cleavage of either recognition sequence by the meganuclease stimulated a homologous recombination event resulting in a functional GFP gene.

[0396] In the CHO reporter cell line developed for this study, one recognition sequence inserted into the GFP gene was the human 5-6 recognition sequence (SEQ ID NO: 9) or the model NHP target sequence (SEQ ID NO: 34). The 5-6 target site in humans, mice, and NHPs is conserved and identical to SEQ ID NO: 9. However, the immediately upstream genomic sequence in mice and NHPs contains a CpG island that may represent a potential methylation site that could affect meganuclease binding and cleavage. Therefore, a model NHP target sequence (SEQ ID NO: 34) was prepared to determine the efficiency of the 5-6 meganuclease in the GFP reporter assay. The second recognition sequence inserted into the GFP gene was the CHO-23 / 24 recognition sequence, which is recognized and cleaved by a control meganuclease designated "CHO-23 / 24." CHO reporter cells containing the human TTR 5-6 recognition sequence and the CHO-23 / 24 recognition sequence are referred to as "TTR 5-6h cells." CHO reporter cells containing the model NHP5-6 recognition sequence and the CHO-23 / 24 recognition sequence are referred to as "TTR5-6nhp cells."

[0397] CHO reporter cells were transfected with mRNA encoding the TTR5-6L.1204 meganuclease. CHO reporter cells were also transfected with mRNA encoding the CHO-23 / 24 meganuclease. For each assay, 5e4 CHO reporter cells were transfected with 90 ng of mRNA in a 96-well plate using Lipofectamine® MessengerMax (ThermoFisher) according to the manufacturer's instructions. TTR5-6h and TTR5-6nhp cells were evaluated by flow cytometry 2, 5, and 7 days after transfection to determine the percentage of GFP-positive cells compared to an untransfected negative control. Data obtained at each time point were normalized to the % GFP-positive cells observed using the CHO-23 / 24 meganuclease to determine an "activity score," and normalized data from the earliest time point were subtracted from the most recent time point to determine a "toxicity score." The activity and toxicity scores were then added together to determine an "activity index," which was then normalized to the activity index of the CHO-23 / 24 meganuclease to compare data between cell lines.

[0398] 3.Results

[0399] As shown in Figures 6A and 6B, the TTR5-6L.1204 meganuclease cleaved its recognition sequences in both human (Figure 6A) and model NHPs (Figure 6B) with high frequency.

[0400] 4. Conclusion

[0401] These studies demonstrated that engineered meganucleases targeting the TTR5-6 recognition site encompassed by the present invention (e.g., the meganuclease of SEQ ID NO: 15) can efficiently target and cleave their respective recognition sequences in cells harboring human or model NHP recognition sequences.

[0402] Example 2 Characterization of insertions and deletions of a meganuclease that binds to and cleaves the TTR5-6 recognition sequence

[0403] 1. Method

[0404] To evaluate TTR5-6 nuclease, 1e6 HepG2 cells were electroporated with 500ng of mRNA encoding each TTR nuclease or GFP using a Lonza Amaxa 4D system. Additionally, 7e5 HEK293 cells were electroporated with 700ng of mRNA for TTR nuclease or GFP. Cells were harvested 2 days after electroporation for gDNA preparation and assessed for transfection efficiency using a Beckman Coulter CytoFlex S cytometer. Transfection efficiency exceeded 90% in both cell lines. Additional time points were harvested 6 and 9 days after electroporation for gDNA extraction. gDNA was prepared using a Macherey Nagel NucleoSpin Blood QuickPure kit.

[0405] Digital droplet PCR was used to determine the frequency of targeted insertions and deletions (indels%) at the TTR5-6 binding site using primers P1, F1, and R1 to generate an amplicon surrounding the binding site and primers P2, F2, and R2 to generate a reference amplicon. Amplifications were multiplexed in 20 μL reactions containing 1× ddPCR Supermix for Probes (without dUTP, BioRad), 250 nM of each probe, 900 nM of each primer, 5 U of HindIII-HF, and approximately 50 ng of cellular gDNA. Droplets were generated using a QX100 droplet generator (BioRad). Cycling conditions were as follows: 1 cycle at 95°C (2°C / sec ramp) for 10 min, 45 cycles at 94°C (2°C / sec ramp) for 10 s, 60°C (2°C / sec ramp) for 30 s, 72°C (2°C / sec ramp) for 1 min, 98°C for 10 min, and a 4°C hold. Droplets were analyzed using a QX200 droplet reader (BioRad), and data were acquired and analyzed using QuantaSoft analysis software (BioRad). Indel frequencies were calculated by dividing the number of positive copies of the binding site probe by the number of positive copies of the reference probe and comparing the loss of FAM+ copies in nuclease-treated cells with those in mock-transfected cells.

[0406] P1:56-FAM / TGCTGGACT / ZEN / GGTATTTGTGTCTGA / 3IABkFQ (SEQ ID NO: 35) F1: CCACTCATTCTTGGCAGGAT (SEQ ID NO: 36) R1: CACAGAAACACTCACCGTAGG (SEQ ID NO: 37) P2: 5HEX / AAATTCCTC / ZEN / CTCAGTTGTGAGCCC / 3IABkFQ (SEQ ID NO: 38) F2: AGTCTGGAGAGCTGCAT (SEQ ID NO: 39) R2: CCAGTAAGATTTGGTGTCTATTTC (SEQ ID NO: 40)

[0407] 2.Results

[0408] An engineered meganuclease was designed against the TTR5-6 binding site and evaluated for indel formation in two cell lines. TTR5-6L.1204 showed activity in each cell line, generating approximately 25% indels in HepG2 cells (Figure 7A) and approximately 15% indels in HEK293 cells (Figure 7B). This meganuclease showed stable indels 2, 6, and 9 days after electroporation in both cell lines, indicating that they were well tolerated (see Figures 7A and 7B).

[0409] 3. Conclusion

[0410] These data demonstrate that TTR meganucleases produce high levels of on-target editing at the TTR5-6 site in vitro. The nucleases tested showed consistent editing throughout the course of the experiment, indicating that they were well tolerated by cells and that genome editing was durable.

[0411] Example 3 Characterization of a meganuclease that binds to and cleaves the TTR15-16 recognition sequence

[0412] 1. Meganuclease that binds to and cleaves the TTR15-16 recognition sequence

[0413] Recombinant meganucleases targeting the TTR15-16 recognition site (SEQ ID NOS: 11-14), collectively referred to herein as "TTR15-16 meganucleases," were engineered to bind to and cleave the TTR15-16 recognition sequence (SEQ ID NOS: 7) in the human genome. Each recognition sequence is present in the TTR gene, specifically in exon 3. Each TTR15-16 recombinant meganuclease comprises an N-terminal nuclease localization signal derived from SV40, a first meganuclease subunit, a linker sequence, and a second meganuclease subunit. The first subunit in each TTR15-16 meganuclease binds to the first TTR15-16 recognition half-site (SEQ ID NOS: 26), while the second subunit binds to the second TTR15-16 recognition half-site (SEQ ID NOS: 28; see Figure 2).

[0414] Each TTR15-16 binding subunit contains a 56 base pair hypervariable region designated HVR1 and HVR2, respectively. The HVR1 region of each TTR15-16 meganuclease binding subunit consists of residues 24-79 of any one of SEQ ID NOs: 11-14. The HVR2 region of each TTR15-16 meganuclease consists of residues 215-270 of any one of SEQ ID NOs: 11-14. The TTR15-16 binding regions of SEQ ID NOs: 11-14 are provided as SEQ ID NOs: 16-23, respectively.

[0415] 2. Cleavage of the TTR15-16 recognition sequence in a CHO cell reporter assay

[0416] To determine whether the TTR15-16 meganuclease can bind to and cleave the human 15-16 recognition sequence (SEQ ID NO: 7), recombinant meganucleases TTR15-16x.81, TTR15-16L.161, TTR15-16L.164 and TTR15-16L.181 were evaluated using a previously described CHO cell reporter assay (see WO / 2012 / 167192, Figure 5, and as described in Example 1 above).

[0417] In the CHO reporter cell line developed for this study, one recognition sequence inserted into the GFP gene was the human TTR 15-16 recognition sequence (SEQ ID NO: 7). As described for Example 1, the second recognition sequence inserted into the GFP gene was the CHO-23 / 24 recognition sequence, which is recognized and cleaved by a control meganuclease designated "CHO-23 / 24." CHO reporter cells were transfected with mRNA encoding the TTR15-16x.81, TTR15-16L.161, TTR15-16L.164, and TTR15-16L.181 meganucleases. CHO reporter cells were also transfected with mRNA encoding the CHO-23 / 24 meganuclease, and data were obtained and analyzed as described in Example 1.

[0418] 3.Results

[0419] As shown in Figure 9, the TTR15-16x.81, TTR15-16L.161, TTR15-16L.164, and TTR15-16L.181 meganucleases cleaved the human TTR15-16 recognition sequence with high frequency.

[0420] 3. Conclusion

[0421] These studies demonstrated that engineered meganucleases targeting the TTR15-16 recognition site encompassed by the present invention (e.g., meganucleases of SEQ ID NOs: 11-14) can efficiently target and cleave their respective recognition sequences in cells.

[0422] Example 4 Characterization of insertions and deletions of a meganuclease that binds to and cleaves the TTR15-16 recognition sequence

[0423] 1. Method

[0424] To evaluate the TTR15-16 meganuclease, HepG2 and HEK293 cells were electroporated with mRNA encoding each TTR15-16 meganuclease or GFP, harvested, and analyzed for transfection efficiency as described in Example 3. Transfection efficiency exceeded 90% in both cell lines. Additional time points were collected 6 or 7 days after electroporation for gDNA extraction, as described in Example 3. Further experiments were performed to determine indel frequencies across different dosages in HepG2, HEK293, and Hep3B cells.

[0425] Digital droplet PCR (ddPCR) was used to determine the indel frequency at the TTR15-16 binding site, using oligos P3, F3, and R3 to generate an amplicon surrounding the binding site and P4, F4, and R4 to generate a reference amplicon. The ddPCR assay was performed as described in Example 2.

[0426] P3:56-FAM / ATGGGCTCA / ZEN / CAACTGAGGAGGAAT / 3IABkFQ (SEQ ID NO: 41) F3: TCCAGACTTTCACACCTTATAG (SEQ ID NO: 42) R3: TCCACTTTGTATATCCCTTCTAC (SEQ ID NO: 43) P4:5HEX / TGCTGGACT / ZEN / GGTATTTGTGTCTGA / 3IABkFQ (SEQ ID NO: 44) F4: CCACTCATTCTTGGCAGGAT (SEQ ID NO: 45) R4: CACAGAAACACTCACCGTAGG (SEQ ID NO: 46)

[0427] 2.Results

[0428] The TTR15-16x.81 meganuclease demonstrated high levels of activity in HEK293 cells with approximately 85% indels (see Figure 9A). This highly potent nuclease was further evaluated in HepG2 cells to confirm activity in the hepatic cell line. Again, TTR15-16x.81 produced a high frequency of indels, ranging from 70% to 85% (see Figure 9B). Finally, the indel frequency demonstrated a dose-response, with increasing amounts of nuclease providing increased indel percentages in the three cell lines tested (Figure 9C).

[0429] 3. Conclusion

[0430] These studies demonstrate the ability to utilize engineered meganucleases to successfully edit the TTR15-16 binding site. The tested TTR15-16x.81 meganuclease demonstrated high levels of on-target editing in HEK293 cells and the HepG2 liver cell line, with 75-85% editing as assessed by % indels. TTR15-16x.81 demonstrated high levels of indels 2 days after electroporation, and indels were maintained through day 7. A dose-response to % indels was demonstrated for the TTR15-16x.81 nuclease. Collectively, these data demonstrate a very high frequency of on-target indels in both HEK293, HepG2, and Hep3B cell lines following treatment with the TTR15-16x.81 engineered meganuclease.

[0431] Example 5 TTR editing in primary human hepatocytes

[0432] 1. Method

[0433] Primary human hepatocytes (PHH) were seeded in 24-well plates at a density of 3.5e5 cells / well. Two hours after seeding, cells were transfected in duplicate using Lipofectamine MessengerMax (Thermo Fisher Scientific) and varying amounts of TTR15-16x.81 mRNA (0.5-2 μg). Cells were harvested, and gDNA was isolated as described previously 1 and 7 days after transfection for indel analysis using ddPCR using the primers and probes described in Example 4 and the method described in Example 2.

[0434] 2.Results

[0435] PHH cells were transfected with mRNA encoding TTR15-16x.81, and indels at the TTR15-16 target site were quantified using ddPCR. At all doses tested, approximately 45% editing was observed 1 day after transfection, and approximately 30-35% indels were observed 7 days after transfection (Figure 10A). Further dose expansion analysis with additional concentrations of nuclease at D7 provided similar results at 0.5 μg of meganuclease. However, the percentage of indels decreased substantially at lower doses down to 0.010 μg of meganuclease (Figure 10B).

[0436] 3. Conclusion

[0437] These data support the ability of TTR15-16x.81 nuclease to edit the TTR15-16 target site in primary human hepatocytes. Interestingly, high levels of cleavage were observed 1 day after transfection, which decreased by day 7. We hypothesize that earlier time points represent both insertions and deletions that occurred at the target site, as well as de novo edits that had not yet been repaired. By day 7, some of the remaining edits may have been repaired to wild-type sequences, which may explain the decrease in editing observed at this time point. Furthermore, meganuclease levels below 0.5 μg tend to result in a dose-dependent decrease in indel activity.

[0438] Example 6 Quantification of indels in the liver of FVB mice carrying TTR5-6 meganuclease

[0439] 1. Method

[0440] To characterize the targeted indels in mice, the TTR5-6L.1204 meganuclease (SEQ ID NO: 15) was tested in FVB mice. A total of six mice were injected with 5x10 of AAV8 expressing the TTR5-6 meganuclease. 11 The viral genome was injected via the tail vein. AAV was generated by triple transfection of HEK293T cells with AAV8 capsids. Additionally, a control group of three FVB mice received a control injection of PBS. Four weeks after AAV administration, the animals were sacrificed, and their livers were collected for genomic DNA isolation.

[0441] 1.1 gDNA isolation from mouse liver

[0442] gDNA was isolated from mouse liver using the NucleoSpin Tissue Kit (reference number 740952.250) from Machery-Nagel. The protocol was followed according to the kit manufacturer's product manual. Briefly, small liver slices were placed in a 1.5 ml tube. Lysis was achieved by incubating the sample at 65°C in a solution containing SDS and proteinase K. Conditions suitable for binding DNA to the silica membrane of the NucleoSpin® Tissue Column were created by adding a large amount of chaotropic ions and ethanol to the lysate. The binding process is reversible and specific for nucleic acids. Contaminants were removed by efficient washing with buffer. Finally, pure genomic DNA was eluted in water under low ionic strength conditions.

[0443] 1.2 Indel analysis by ddPCR

[0444] Genomic DNA was used for indel quantification using Bio-Rad's QX200 Droplet Digital PCR system. To quantify indels, forward and reverse primers were used to generate amplicons surrounding the TTR5-6 target site. A hydrolysis probe was designed to recognize the wild-type TTR5-6 target site. Another probe was designed within the amplicon to serve as a reference. Indels were calculated for TTR5-6 meganuclease by comparing double-positive droplets with single-positive droplets. The primer and probe sequences for this assay are shown in Table 4 below:

[0445] [Table 4]

[0446] Digital PCR reactions were set up using ddPCR Supermix for Probes (without dUTP) (Bio-Rad catalog number 1863024), primers, target probe (in FAM), reference probe (in HEX), and HindIII-HF enzyme (NEB catalog number R3104S) to fragment genomic DNA. A total of 5,000 genome copies of mock and treated samples were input as templates for the PCR reactions.

[0447] 2.Results

[0448] gDNA isolated from mouse liver was used as a template in a digital droplet PCR drop-off assay to quantify on-target indels (Figure 11). Mice receiving the TTR5-6 meganuclease AAV showed on-target indels. TTR5-6L.1204 showed approximately 12% indel editing. No editing was detected in mice receiving PBS mock injections.

[0449] 3. Conclusion

[0450] These results indicate that the TTR5-6 meganuclease is active in vivo and successfully cleaves the TTR5-6 recognition site. Collectively, these data demonstrate the ability of TTR meganuclease to edit the TTR gene in vivo.

[0451] Example 7 In vivo generation of targeted indels in non-human primates

[0452] 1. Method

[0453] 1.1 Experimental design

[0454] Next, we tested whether administration of an engineered meganuclease targeting the 5-6 recognition site could target the endogenous TTR gene in non-human primates (NHPs). An AAV8 vector encoding the TTR5-6L.1204 meganuclease with a 3'WPRE and driven by the TBG promoter was administered to 6 × 10 12 GC / kg or 3 x 10 13 Rhesus macaques were administered either GC / kg. Liver ultrasounds were performed on animals before vector administration and continued to be performed every 6 months throughout the study. All NHPs received oral prednisolone at a dose of 1 mg / kg / day from the day of vector administration until weeks 8–12. After weeks 8–12 of vector administration, animals were tapered off prednisolone by stepwise reductions in daily dose. Liver biopsies were performed on days 18 and 128. Necropsies were performed 1 year after AAV administration. Liver tissue collected at necropsy was used to determine AAV copy number and on-target indel frequency.

[0455] 1.2 In vivo indel % on-target analysis

[0456] Liver tissue was collected for indel analysis at necropsy on day 364. Genomic DNA was isolated using a Geno Grinder (SPEX Sample Prep) to homogenize the tissue and a NucleoSpin Blood QuickPure Mini Kit (Machery-Nagel). The percentage of indels at the target cleavage site within the 5-6 recognition sequence was determined using drop-off ddPCR as described above with the primers in Table 5 below. Indels were calculated using the loss of HEX-positive droplets normalized to FAM-positive droplets.

[0457] [Table 5]

[0458] 1.3 Liver AAV copy number analysis

[0459] Liver tissue and cellular DNA collected at necropsy on day 364 was analyzed for AAV copy number using ddPCR as previously described with the primers listed in Table 6 below, at an annealing temperature of 58°C.

[0460] [Table 6]

[0461] 2.Results

[0462] As shown in Figure 12, administration of the TTR5-6L.1204 meganuclease resulted in a dose-dependent indel frequency. At autopsy, 6x10 12 No indels were observed at the higher dose of 3 × 10 GC / kg (animals RA3330 and RA3385). 13 In animals receiving GC / kg (animals 15D003 and 15D020), there were approximately 15-20% indels at the on-target TTR5-6 site (Figure 12).

[0463] AAV copy number was determined in liver tissue collected at necropsy. Figure 13 shows that the amount of AAV detected correlates with dose, with 3 x 10 13 GC / kg animals were found to have approximately 2 and 8 AAV genomes / diploid cell, with 6 × 10 12 GC / kg animals had approximately 0.5 and 1 AAV genome / diploid cell.

[0464] 3. Conclusion

[0465] This study demonstrates that an engineered meganuclease targeting the TTR5-6 site results in dose-dependent editing of the endogenous TTR gene in NHPs, with indels persisting in animals treated with high-dose AAV up to 364 days after vector administration.

[0466] Example 8 In vivo generation of targeted indels at the TTR15-16 site in non-human primates

[0467] 1. Method

[0468] 1.1 Experimental design

[0469] Next, we tested whether administration of an engineered meganuclease targeting the 15-16 recognition site could edit the endogenous TTR gene in non-human primates (NHPs). An AAV8 vector encoding the TTR15-16x.81 meganuclease with a 3'WPRE and driven by the TBG promoter was administered to 6 × 10 12 GC / kg or 3 x 10 13Rhesus macaques were administered either GC / kg. Liver ultrasounds were performed on animals before vector administration and continued every 6 months throughout the study. From the day of vector administration until weeks 8–12, all NHPs were orally administered prednisolone at a dose of 1 mg / kg / day. After weeks 8–12 of vector administration, animals were tapered off prednisolone by stepwise reductions in daily dose. Liver biopsies were performed on day 18. Next-generation sequencing and ddPCR were performed from each liver biopsy to determine the in vivo indel percentage. Additionally, AAV vector copy numbers were determined in d18 and d128 liver biopsies. Blood was collected throughout the course of the study to measure serum TTR levels.

[0470] 1.2 In vivo indel % on-target analysis

[0471] Liver biopsies were performed 18 and 128 days after vector administration according to the experimental protocol described above. The percentage of indels at the target cleavage site within the 15-16 recognition sequence was determined by amplicon sequencing analysis using primers F9 and R9 shown below. Indels were also quantified using ddPCR and the primers and probes described in Example 6. The loss of FAM-positive copies relative to HEX-positive copies was used to calculate TTR15-16 indels.

[0472] F9: GCCATGCCATTTGTTTCCTCCATG (SEQ ID NO: 63) R9: GCATGCTCATGGAATGGG (SEQ ID NO: 64)

[0473] 1.3 AAV copy number analysis

[0474] AAV copy number was quantified in liver tissue collected at day 18 and day 128 biopsies as previously described in Example 6.

[0475] 1.4 Serum TTR analysis

[0476] Serum was collected from all animals throughout the course of the study. Serum analysis was completed using a hybrid ligand binding assay / liquid chromatography-high-resolution mass spectrometry (Lanshoeft et al., Anal. Chem. 2017, 89, 4, 2628-2635).

[0477] 2.Results

[0478] As shown in Figure 14, administration of AAV8 harboring the TTR15-16x.81 meganuclease resulted in high levels of on-target editing in all animals. 12 In two animals administered GC / kg (black bars), we observed 21% and 52% indels by NGS (Figure 14A) and 35% and 67% indels by ddPCR (Figure 14B), respectively. 13 At the GC / kg dose (gray bars), we found 30% and 42% indels by NGS (Figure 14A) and 56% and 62% indels by ddPCR (Figure 14B), respectively. When further assessed by ddPCR analysis, these indel percentages remained largely unchanged over 128 days (Figure 14C).

[0479] Figure 15 shows the quantification of AAV genomes present in the liver in each biopsy. The amount of AAV per diploid cell correlated with the dose of AAV. 6 x 10 12 Animals receiving the GC / kg AAV8 dose had approximately 12 and 19 AAV copies per diploid cell, whereas 3 × 10 12 The GC / kg doses showed approximately 10 and 10 AAV copies per diploid cell at d 18. The AAV copy number was substantially reduced and approached 0 at d 128 for both doses.

[0480] When examining the abundance of TTR protein present in the serum of these animals, we observe a significant reduction from the baseline bleed taken 7 days prior to vector administration (day -7) (Figure 16). In three of the four animals, we observe a greater than 90% reduction in serum TTR protein levels by day 21, a reduction that is maintained for more than 250 days after vector administration. 6x10 12 One animal in the GC / kg group showed a more modest reduction in serum TTR protein levels, averaging approximately a 40% reduction from baseline.

[0481] 3. Conclusion

[0482] Taken together, these data demonstrate the ability of the engineered meganuclease to successfully edit the TTR15-16 target site in vivo. Using both ddPCR and NGS, we are able to detect high levels of editing in all treated animals. Compared to NGS, the ddPCR method results in higher editing rates due to the assay's ability to detect larger insertions and deletions in the TTR15-16 target site. Interestingly, we found that 6 x 10 12Variable levels of editing were observed in two animals treated with GC / kg, likely due to reduced transduction in one animal, as supported by the AAV copy number data. A sustained reduction in circulating serum TTR levels was observed in all animals, correlating with liver editing frequency. Advantageously, a substantial, near-complete reduction in AAV copy number was observed by 128 days post-injection at both the low and high doses. This result indicates that while the amount of intracellular AAV genome is reduced, high levels of indels are maintained in animals treated with TTR15-16x.81 meganuclease. Additionally, the level of indels at the TTR15-16 site observed with TTR15-16x.81 meganuclease was significantly greater than that observed at the TTR5-6 site with the TTR5-6L.1204-engineered meganuclease, as demonstrated in Example 7. In that example, the TTR5-6L.1204 meganuclease reduced 6×10 indels compared to up to 67% indels at the TTR15-16 site with the TTR15-16x.81 meganuclease. 12 At a dose of 3 × 10 GC / kg, the TTR15-16L.1204 meganuclease showed little to no indels, approximately 15%–20% of the 3 × 10 13 Although higher doses of GC / kg showed indels, this was significantly lower than the indels observed at the TTR15-16 site with the TTR15-16x.81 meganuclease, which also produced over 60% indels by 128 days post-injection. These results demonstrate that engineered meganucleases targeting the TTR15-16 site in an in vivo NHP animal model produce unexpectedly high indels compared to other sites in the TTR locus (e.g., the TTR5-6 site).

Claims

1. 1. An engineered meganuclease that binds to and cleaves a recognition sequence within a transthyretin (TTR) gene, comprising a first subunit and a second subunit, wherein the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and the second subunit binds to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region, (a) the recognition sequence consists of SEQ ID NO: 7 and the engineered meganuclease comprises the amino acid sequence of any one of SEQ ID NOs: 11-14; or (b) an engineered meganuclease, wherein the recognition sequence consists of SEQ ID NO:9 and the engineered meganuclease comprises the amino acid sequence of SEQ ID NO:

15.

2. A polynucleotide comprising a nucleic acid sequence encoding the engineered meganuclease of claim 1.

3. The polynucleotide of claim 2 which is mRNA.

4. A recombinant DNA construct comprising a polynucleotide comprising a nucleic acid sequence encoding the engineered meganuclease of claim 1.

5. A recombinant virus comprising a polynucleotide comprising a nucleic acid sequence encoding the engineered meganuclease of claim 1.

6. The recombinant virus of claim 5, which is a recombinant AAV.

7. The recombinant virus of claim 6 , wherein the recombinant AAV has the AAV8 serotype.

8. 6. The recombinant virus of claim 5, wherein the nucleic acid sequence comprises a promoter sequence operably linked to the nucleic acid sequence encoding the engineered meganuclease.

9. The recombinant virus of claim 8, wherein the promoter is a liver-specific promoter.

10. A method for generating genetically modified human liver cells containing a modified TTR gene in vitro, comprising: (a) a polynucleotide comprising a nucleic acid sequence encoding the engineered nuclease of claim 1, wherein the engineered nuclease is expressed in the human liver cell; or (b) the engineered nuclease of claim 1. introducing wherein the engineered nuclease generates a cleavage site within the recognition sequence consisting of SEQ ID NO: 7 or 9, resulting in a modified FAP gene containing an insertion or deletion within exon 1 or exon 3 that does not encode a full-length endogenous FAP polypeptide.

11. The method of claim 10, wherein the polynucleotide is introduced into the human liver cells by mRNA or a recombinant virus.

12. Genetically modified human liver cells prepared by the method of claim 10.

13. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and the engineered meganuclease of claim 1 or a polynucleotide comprising a nucleic acid sequence encoding the engineered meganuclease.

14. A lipid nanoparticle composition comprising lipid nanoparticles comprising a polynucleotide, wherein the polynucleotide comprises a nucleic acid sequence encoding the engineered meganuclease of claim 1.

15. The lipid nanoparticle composition of claim 14, wherein the polynucleotide is mRNA.

Citation Information

Patent Citations

  • Custom-made meganucleases and their uses

    JP2006516403A

  • Engineered meganuclease with a recognition sequence found in the human β-2 microglobulin gene

    JP2018538000A

  • Modulation of transthyretin expression

    US20110294868A1

  • Rationally-designed meganucleases with altered sequence specificity and DNA-binding affinity

    WO2007047859A2

  • Rationally-designed single-chain meganucleases with non-palindromic recognition sequences

    WO2009059195A2

Cited By

  • Engineered meganucleases having specificity for recognition sequence in transthyretin gene

    JP2025172742A