Cleavable lipids
Novel cationic lipids with cleavable functional groups address the challenges of liposome delivery by improving stability and reducing toxicity, enabling efficient nucleic acid delivery and transfection into target cells.
Patent Information
- Application Number
- JP2023207803
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2011-06-08
- Filing Date
- 2023-12-08
- Publication Date
- 2025-08-13
- Estimated Expiration
- 2032-06-08
AI Technical Summary
Efficient delivery of nucleic acids to target cells and tissues remains a challenge due to instability of liposome-based systems and toxicity of cationic lipids, limiting their effectiveness in delivering encapsulated materials.
Development of novel cationic and/or ionizable lipids with cleavable functional groups, such as disulfides, that facilitate delivery and release of encapsulated materials by promoting phase transition and membrane fusion, enhancing transfection efficiency and reducing toxicity.
The novel lipids improve the delivery and release of nucleic acids into target cells, enhancing transfection efficiency and reducing toxicity, while maintaining stability and specificity.
Smart Images

Figure 0007723064000045 
Figure 0007723064000046 
Figure 0007723064000001
Abstract
Description
[Background technology]
[0001] Liposome delivery of nucleic acids has been employed for site-specific delivery of encapsulated plasmid DNA, antisense oligonucleotides, short interfering RNA, and microRNA-based therapies. However, efficient delivery of nucleic acids to target cells and tissues, and subsequent transfection of such target cells and tissues, remains a technical challenge. Despite the availability of many liposome-based systems and vehicles to facilitate delivery of therapeutic agents to target cells and tissues, many problems still exist in both in vivo and in vitro applications. For example, a major drawback of liposome delivery systems relates to the construction of liposomes with sufficient cell culture or in vivo stability to reach the desired target cells and / or intracellular compartments, and the ability of such liposome delivery systems to efficiently release their encapsulated materials into such target cells. Furthermore, many of the cationic lipids employed to construct such liposome-based vehicles are generally toxic to target cells, and therefore may have limited use, especially in the amounts required to successfully deliver encapsulated materials to such target cells.
[0002] Despite the aforementioned limitations, and due to their ability to protect encapsulated materials and facilitate their delivery to one or more target cells, liposome-based vehicles are considered attractive carriers for therapeutic drugs and are still being developed. Although liposome-based vehicles containing cationic lipid components have shown promising results in terms of encapsulation, stability, and site localization, there remains a great need for improved liposome-based delivery systems. In particular, there remains a need for improved cationic lipids and lipids that can deliver macromolecules, such as nucleic acids, to a wide range of cell types and tissues with enhanced efficiency. There also remains a need for the identification of novel lipids that incorporate multifunctional approaches for delivering encapsulated nucleic acids and polynucleotides. Summary of the Invention [Means for solving the problem]
[0003] Thus, the present invention provides novel compounds, pharmaceutical compositions comprising such compounds, and related methods of use thereof. In some embodiments, the compounds described herein are useful as liposome compositions or components of liposome compositions to facilitate delivery to, and subsequent transfection of, one or more target cells. In certain embodiments, the compositions disclosed herein are cationic and / or ionizable lipids. In some embodiments, the compounds described herein are designed based on desired characteristics or properties, e.g., to enhance transfection efficiency or promote a specific biological outcome. Furthermore, in certain embodiments, the compounds described herein employ a multifunctional strategy to facilitate delivery of encapsulated material (e.g., one or more polynucleotides) to, and subsequent transfection of, one or more target cells. For example, in certain embodiments, the compounds described herein are characterized by one or more of the following properties: fusogenicity, endosomal, or lysosomal disruption and / or release potential, providing such compounds advantages over other similarly classified lipids.
[0004] The compounds disclosed herein generally contain one or more cleavable (e.g., cleavable enzymatically or by reduction, oxidation, or hydrolysis) functional groups that are attached (e.g., covalently bonded) to two or more functional groups or moieties (e.g., a hydrophobic R1 group and a hydrophilic R2 group). For example, compounds containing a cleavable disulfide (SS) functional group are disclosed herein. Any group that is capable of cleavage, for example, upon exposure to biological conditions, and for that purpose, such groups may include, but are not limited to, esters and ethers. Compounds containing any functional group are also contemplated. In certain embodiments, two or more functional groups (e.g., a head group and a tail group) comprising a compound confer amphiphilic properties to such a compound. For example, in certain embodiments, at least one of the functional groups is a non-polar, lipophilic, or hydrophobic tail group (e.g., cholesterol or C6-C 20In certain embodiments, at least one of the functional groups is a polar or hydrophilic head group (e.g., imidazole).
[0005] In certain embodiments, the compounds described herein (e.g., HGT4001, HGT4002, HGT4003, HGT4004, and / or HGT4005) are cationic or ionizable lipids that can be used as components of liposome compositions to facilitate or enhance the delivery and release of encapsulated materials (e.g., one or more therapeutic agents) into one or more target cells (e.g., by permeation or fusion with the lipid membrane of such target cells). In certain embodiments, such compounds comprise one or more cleavable functional groups (e.g., disulfides), e.g., that dissociate the hydrophilic functional head group from the lipophilic functional tail group of the compound (e.g., upon exposure to oxidizing, reducing, or acidic conditions), thereby facilitating a phase transition in the lipid bilayer of one or more target cells. For example, when a liposome composition (e.g., lipid nanoparticle) comprises one or more of the compounds disclosed herein, a phase transition in the lipid bilayer of one or more target cells facilitates the delivery of encapsulated materials (e.g., one or more therapeutic polynucleotides encapsulated in the lipid nanoparticles) to one or more target cells. Similarly, enriching liposome compositions with one or more of the compounds disclosed herein can improve the fusogenicity of such liposome compositions, thereby enhancing the ability of such compounds to deliver encapsulated materials (e.g., polynucleotides) within cells.
[0006] In certain embodiments, the compound has formula (I): [ka] having the structure
[0007] wherein R1 is selected from the group consisting of imidazole, guanidium, amino, imine, enamine, optionally substituted alkylamino (e.g., alkylamino such as dimethylamino), and pyridyl; and R2 is a group selected from the group consisting of Formula II and Formula III. [ka] is selected from the group consisting of
[0008] wherein R3 and R4 are each independently an optionally substituted variably saturated or unsaturated C6-C 20 Alkyl and optionally substituted variably saturated or unsaturated C-C 20 acyl, wherein n is 0 or any positive integer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more). In certain embodiments, R3 and R4 are each an optionally substituted polyunsaturated C 18 alkyl, while in other embodiments, R and R are each an unsubstituted polyunsaturated C 18 In certain embodiments, one or more of R and R is (9Z,12Z)-octadeca-9,12-diene.
[0009] Also disclosed herein are pharmaceutical compositions comprising a compound of Formula I, wherein R is selected from the group consisting of imidazole, guanidium, amino, imine, enamine, optionally substituted alkylamino (e.g., alkylamino such as dimethylamino), and pyridyl; R is Formula II; and n is 0 or any positive integer. Also disclosed herein are pharmaceutical compositions comprising a compound of Formula I, wherein R is selected from the group consisting of imidazole, guanidium, amino, imine, enamine, optionally substituted alkylamino (e.g., alkylamino such as dimethylamino), and pyridyl; R is Formula III; and wherein R and R are each independently an optionally substituted variably saturated or unsaturated C-C alkyl group. 20 Alkyl and optionally substituted variably saturated or unsaturated C-C20 In one embodiment, R3 and R4 are each an optionally substituted polyunsaturated C 18 alkyl, while in other embodiments, R and R are each a substituted polyunsaturated C 18 alkyl (e.g., octadeca-9,12-diene).
[0010] In certain embodiments, the R1 group or head group is a polar or hydrophilic group (e.g., one or more of an imidazole group, a guanidinium group, and an amino group) and is attached to the R2 lipid group by a disulfide (SS) cleavable linker group, for example, as shown in Formula I. Other contemplated cleavable linker groups are, for example, alkyl groups (e.g., C1-C 10 In certain embodiments, the R group can be a C-C alkyl group. 20 It may be covalently attached to the cleavable linker group by an alkyl group (e.g., when n is 1-20) or alternatively, it may be directly attached to the cleavable linker group (e.g., when n is 0). In some embodiments, the disulfide linker group is cleavable in vitro and / or in vivo (eg, enzymatically cleavable or cleavable when exposed to acidic or reducing conditions).
[0011] In certain embodiments, the present invention relates to the compound 5-(((10,13-dimethyl-17-(6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl)disulfanyl)methyl)-1H-imidazole, having the structure of formula IV (referred to herein as "HGT4001"). [ka]
[0012] In certain embodiments, the present invention relates to the compound -(2-(((3S,10R,13R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl)disulfanyl)ethyl)guanidine, having the structure of Formula V (herein referred to as "HGT4002"). [ka]
[0013] In certain embodiments, the present invention relates to the compound 2-((2,3-bis((9Z,12Z)-octadeca-9,12-dien-1-yloxy)propyl)disulfanyl)-N,N-dimethylethanamine, having the structure of formula VI (referred to herein as “HGT4003”). [ka]
[0014] In another embodiment, the present invention relates to the compound 5-(((2,3-bis((9Z,12Z)-octadeca-9,12-dien-1-yloxy)propyl)disulfanyl)methyl)-1H-imidazole, having the structure of formula VII (referred to herein as "HGT4004"). [ka]
[0015] In yet another embodiment, the present invention relates to the compound 1-(((2,3-bis((9Z,12Z)-octadeca-9,12-dien-1-yloxy)propyl)disulfanyl)methyl)guanidine, having the structure of formula VIII (referred to herein as "HGT4005"). [ka]
[0016] In some embodiments, the compounds disclosed herein are cationic and / or ionizable lipids that can be used as liposome compositions or alternatively as components of liposome compositions (e.g., lipid nanoparticles). In some embodiments, the compounds disclosed herein are used to enrich liposome compositions (e.g., lipid nanoparticles), thereby imparting improved properties to such enriched liposome compositions (e.g., improved delivery of encapsulated polynucleotides to one or more target cells and / or reduced toxicity of the liposome composition in vivo). Thus, pharmaceutical compositions, particularly liposome compositions, that include one or more of the compounds disclosed herein are also contemplated. In some embodiments, such pharmaceutical and liposome compositions include one or more of a PEG-modified lipid, a non-cationic lipid, and a helper lipid such as cholesterol. For example, pharmaceutical and liposomal compositions (e.g., lipid nanoparticles) are contemplated that include one or more of the compounds disclosed herein (e.g., HGT4001, HGT4002, HGT4003, HGT4004, and / or HGT4005) and one or more cationic lipids, non-cationic lipids, helper lipids / cholesterol, and PEG-modified lipid components. Pharmaceutical and liposomal compositions that include one or more of the compounds disclosed herein and further include one or more additional cationic lipids are also contemplated. Also contemplated are liposomal and pharmaceutical compositions (e.g., lipid nanoparticles) comprising one or more of the HGT4001, HGT4002, HGT4003, HGT4004, and / or HGT4005 compounds and one or more of C12-200, DLinDMA, DLinKC2-DMA, CHOL, DOPE, DMG-PEG-2000, ICE, DSPC, DODAP, DOTAP, and C8-PEG-2000. In certain embodiments, such pharmaceutical and liposomal compositions are loaded or otherwise encapsulated with a material, such as, for example, one or more biologically active polynucleotides.
[0017] In some embodiments, one or more of the pharmaceutical and liposomal compositions (e.g., lipid nanoparticles) described herein comprise one or more of the compounds disclosed herein and one or more additional lipids. For example, lipid nanoparticles comprising or otherwise enriched with one or more of the compounds disclosed herein may further comprise one or more of DOTAP (1,2-dioleyl-3-trimethylammonium propane), DODAP (1,2-dioleyl-3-dimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA, DLin-KC2-DMA, C12-200, and ICE. In one embodiment, the pharmaceutical composition comprises lipid nanoparticles comprising HGT4001, DOPE, and DMG-PEG2000. In another embodiment, the pharmaceutical composition comprises lipid nanoparticles comprising HGT4003, DOPE, cholesterol, and DMG-PEG2000.
[0018] In some embodiments, one or more of the pharmaceutical compositions described herein may contain one or more PEG-modified lipids. For example, lipid nanoparticles containing or otherwise enriched with one or more of the compounds disclosed herein may contain one or more C6- C 20 It may further comprise one or more PEG-modified lipids comprising a poly(ethylene) glycol chain up to 5 kDa in length covalently attached to the alkyl-containing lipid.
[0019] Similarly, the pharmaceutical compositions (e.g., lipid nanoparticles) disclosed herein can comprise or otherwise be enriched with one or more of the compounds disclosed herein, including DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), and the like. The composition may further comprise one or more helper lipids selected from the group consisting of: 1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)), DOPG (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DSPE (1,2-distearoyl-sn-glycero-3-phosphoethanolamine), DLPE (1,2-dilauroyl-sn-glycero-3-phosphoethanolamine), DPPS (1,2-dipalmitoyl-sn-glycero-3-phospho-L-serine), ceramide, sphingomyelin, and cholesterol.
[0020] In some embodiments, compounds and pharmaceutical and liposomal compositions (e.g., lipid nanoparticles) comprising such compounds comprise one or more polynucleotides (e.g., encapsulated DNA or RNA). In other embodiments, the one or more polynucleotides comprise at least one locked nucleic acid (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 16, 18, 20 or more locked nucleic acid residues or monomers). When the one or more encapsulated polynucleotides comprise RNA, such RNA can include, for example, mRNA, siRNA, snoRNA, microRNA, and combinations thereof.
[0021] In some embodiments, the polynucleotides encapsulated in the pharmaceutical and liposomal compositions include, for example, mRNA encoding a functional polypeptide, protein, or enzyme, which, when expressed (i.e., translated) by one or more target cells, produces a functional polypeptide product (e.g., a protein or enzyme) that, in some cases, is secreted by the target cells into the peripheral circulation of the subject. In some embodiments, one or more of the polynucleotides comprising (or otherwise loaded or encapsulated within) the compounds and pharmaceutical and liposomal compositions described herein encode a nucleic acid (e.g., a polypeptide) that is abnormally expressed by the subject. In some embodiments, one or more of the encapsulated polynucleotides comprising such compounds and liposomes or pharmaceutical compositions (e.g., lipid nanoparticles) encode a functional enzyme, such as a urea cycle enzyme (e.g., ornithine transcarbamylase (OTC), carbamoyl-phosphate synthetase 1 (CPS1), argininosuccinate synthetase (ASS1), argininosuccinate lyase (ASL), or arginase 1 (ARG1)). In certain embodiments, one or more of the encapsulated polynucleotides comprises an mRNA encoding an enzyme associated with a lysosomal storage disorder (e.g., the encapsulated polynucleotide is an mRNA encoding one or more of the enzymes alpha-galactosidase, iduronate-2-sulfatase, N-acetylglucosamine-1-phosphate transferase, beta-glucosidase, galactocerebrosidase, and glucosidase alpha acid). In other embodiments, the nucleic acid comprises mRNA, such mRNA encodes one or more proteins or enzymes, e.g., proteins or enzymes that may be deficient in a subject (e.g., cystic fibrosis transmembrane conductance regulator (CFTR), α-L-iduronidase, N-acetylglucosaminidase, α-glucosaminide acetyltransferase, N-acetylglucosamine 6-sulfatase, N-acetylgalactosamine-4-sulfatase, galactose-6-sulfate sulfatase, β-galactosidase, β-glucuronidase, glucose The enzyme or protein may encode an enzyme selected from the group of enzymes consisting of levulosidase, heparan sulfamidase, and hyaluronidase.
[0022] Also contemplated herein are pharmaceutical and liposomal compositions (e.g., lipid nanoparticles) comprising one or more of the compounds disclosed herein and one or more polynucleotides (e.g., antisense oligonucleotides), particularly polynucleotides containing one or more chemical modifications. For example, in some embodiments where the polynucleotide is mRNA, such chemical modifications may confer greater stability to the mRNA, and may include, for example, end-blocking modifications of the 5' or 3' untranslated region of the mRNA. In some embodiments, the chemical modifications may be, for example, modifications of the 5' or 3' untranslated region of the mRNA, such as SEQ ID NO: 1: XCAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG (wherein X is GGA) (SEQ ID NO: 1), or by including a partial sequence of the CMV immediate early 1 (IE1) gene, such as a sequence that is at least 90% or at least 95% identical to SEQ ID NO: 1, in the 5' untranslated region of the mRNA.
[0023] In other embodiments, the chemical modification comprises the inclusion of a polyA tail in the 3' untranslated region of the mRNA. Chemical modifications comprising the inclusion of a Cap1 structure in the 5' untranslated region of the mRNA are also contemplated. In yet other embodiments, the chemical modification comprises the inclusion of a sequence from the human growth hormone (hGH) gene in either 3' untranslated region of the mRNA. The hGH sequence can be, for example, SEQ ID NO:2. CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUC (SEQ ID NO: 2) or may comprise a sequence that is at least 90% or at least 95% identical to SEQ ID NO:2.
[0024] The compounds and pharmaceutical compositions described herein can be formulated to specifically target and / or transfect one or more target cells, tissues, and organs.In some embodiments, such compounds and pharmaceutical compositions facilitate transfection into such target cells by one or more mechanisms (e.g., membrane fusion-based release and / or proton-sponsored disruption of the lipid bilayer membrane of target cells).Contemplated target cells include, for example, one or more cells selected from the group consisting of hepatocytes, epithelial cells, hematopoietic cells, epithelial cells, endothelial cells, lung cells, bone cells, stem cells, mesenchymal cells, nerve cells, cardiac cells, adipocytes, vascular smooth muscle cells, cardiac muscle cells, skeletal muscle cells, beta cells, pituitary cells, synovial lineage cells, ovarian cells, testicular cells, fibroblasts, B cells, T cells, reticulocytes, leukocytes, granulocytes, and tumor cells.
[0025] The present invention further provides pharmaceutical compositions (e.g., lipid nanoparticles) comprising lyophilized liposome delivery vehicles and liposome formulations that are useful for achieving delivery of encapsulated contents (e.g., polynucleotides) to one or more target cells, tissues, or organs. The present invention further provides related methods and processes for preparing such pharmaceutical compositions, as well as methods of treating one or more diseases or conditions by administering such pharmaceutical compositions to a subject in need thereof. The lyophilized compositions (e.g., lipid nanoparticles) described herein are also expected to have improved long-term stability when stored either frozen or at ambient temperature (e.g., room temperature).
[0026] In certain embodiments, pharmaceutical compositions comprising lyophilized nanoparticles or liposome delivery vehicles are characterized as being stable (e.g., as stable as pharmaceutical compositions comprising an equivalent non-lyophilized vehicle). The stability of a lyophilized delivery vehicle can be determined, for example, with respect to the particle size of the lipid nanoparticles comprising such a composition. In certain embodiments, lyophilization of lipid nanoparticles does not appreciably change or alter the particle size of the lipid nanoparticles after lyophilization and / or reconstitution. For example, disclosed herein are pharmaceutical compositions comprising lyophilized lipid delivery vehicles in which, upon reconstitution (e.g., with purified water), the lipid nanoparticles do not aggregate or clump, or alternatively, exhibit limited or negligible aggregation or clumping (e.g., as determined by the particle size of the reconstituted lipid nanoparticles). Thus, in certain embodiments, upon reconstitution of the lyophilized lipid nanoparticles, the lipid nanoparticles have a Dv of less than about 500 nm (e.g., less than about 300 nm, 200 nm, 150 nm, 125 nm, 120 nm, 100 nm, 75 nm, 50 nm, 25 nm, or less). 50 Similarly, in certain embodiments, upon reconstitution of the lyophilized lipid nanoparticles, the lipid nanoparticles have a Dv of less than about 750 nm (e.g., less than about 700 nm, 500 nm, 300 nm, 200 nm, 150 nm, 125 nm, 100 nm, 75 nm, 50 nm, 25 nm, or smaller). 90 It has.
[0027] In other embodiments, pharmaceutical compositions comprising lyophilized lipid delivery vehicles are characterized by a polydispersity index of less than about 1 (e.g., less than 0.95, 0.9, 0.8, 0.75, 0.7, 0.6, 0.5, 0.4, 0.3, 0.25, 0.2, 0.1, 0.05, or less). In still other embodiments, pharmaceutical compositions comprising lyophilized lipid delivery vehicles exhibit a tendency to aggregate or otherwise flocculate (e.g., during lyophilization or upon reconstitution). For example, upon reconstitution, the lipid delivery vehicles have an average particle size (Z) of less than 500 nm (e.g., less than about 400 nm, 300 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, 50 nm, 25 nm, or less in PBS solution). 平均 ).
[0028] The stable lyophilized lipid delivery vehicles (e.g., lipid nanoparticles) provided herein are also characterized by their improved storage properties. For example, in certain embodiments, the lyophilized lipid delivery vehicles can be stored frozen and remain stable for extended periods of time (e.g., stable for at least about 1, 2, 3, 4, 5, 6, 9, 12, 18, 24, 36, or more months when stored at about 4°C) (e.g., as indicated by minimal or no loss in the intended pharmaceutical or biological activity). In other embodiments, the lyophilized lipid delivery vehicles can be stored without freezing and remain stable for extended periods of time (e.g., stable for at least about 1, 2, 3, 4, 5, 6, 9, 12, 18, 24, 36, or more months when stored at about 25°C). In certain embodiments, when reconstituted with an appropriate rehydration medium (e.g., purified water, deionized water, 5% dextrose, and / or normal saline), the reconstituted composition exhibits pharmacological or biological activity equivalent to that observed before lyophilization. For example, in certain embodiments, the pharmacological or biological activity of the encapsulated polynucleotide is equivalent to that observed before lyophilization of the composition or exhibits a negligible decrease in pharmacological or biological activity (e.g., less than about 1%, 2%, 2.5%, 4%, 5%, 7.5%, 10%, 12.5%, 15%, 18.5%, 20%, 25%, 30%, 35%, 40%, or 50% decrease in the pharmacological or biological activity of the encapsulated polynucleotide).
[0029] Also disclosed herein are pharmaceutical compositions (e.g., lyophilized lipid nanoparticles) comprising lyophilized lipid delivery vehicles that further comprise, or are otherwise prepared with, one or more lyoprotectants (e.g., sugars and / or carbohydrates). In some embodiments, the inclusion of one or more lyoprotectants in the lipid nanoparticles allows the lyophilized lipid delivery vehicles (e.g., under normal storage conditions) to remain stable. This can improve or otherwise enhance the stability of the lipid delivery vehicle and / or facilitate reconstitution of the lyophilized lipid delivery vehicle with a rehydration medium, thereby preparing an aqueous formulation. For example, in certain embodiments, lipid nanoparticles are prepared, and prior to lyophilization, the buffer present in the liposomal formulation can be replaced (e.g., via centrifugation) with a lyoprotectant, such as a sucrose solution or suspension (e.g., an aqueous solution containing 1-50% or 10-25% sucrose). Other suitable lyoprotectants that can be used to prepare the lyophilized compositions described herein include, for example, trehalose, dextran (e.g., 1.5 kDa, 5 kDa, and / or 40 kDa), and inulin (e.g., 1.8 kDa and / or 4 kDa).
[0030] In some embodiments, the lyophilized compositions disclosed herein can also facilitate sustained release of contents (e.g., polynucleotides) encapsulated within one or more lipid nanoparticles contained in such compositions. For example, pharmaceutical compositions comprising lyophilized lipid delivery vehicles are contemplated, in which the compositions can be implanted into a subject (e.g., subcutaneously, such as in a membrane or disk) without reconstitution. Such implanted lyophilized compositions can erode or otherwise degrade at a predetermined rate, for example, when exposed to one or more biological fluids (e.g., serum, blood, cerebrospinal fluid, mucus, sweat, gastric secretions, urine, and / or saliva). In certain embodiments, such implanted pharmaceutical compositions comprising lyophilized lipid delivery vehicles release the encapsulated polynucleotides for, for example, at least 1, 2, 7, 10, 14, 21, 30, 45, 60, 90, 120, or more days. Alternatively, such implanted compositions comprising lyophilized lipid delivery vehicles release the encapsulated polynucleotide over, for example, at least 1, 2, 3, 6, 12, 16, 24, 36, or more months.
[0031] In some embodiments, the pharmaceutical compositions provided herein containing lyophilized lipid delivery vehicles can be reconstituted (e.g., using purified water or 5% dextrose as a rehydration medium) prior to administration to a subject (e.g., a mammal). The reconstituted aqueous composition may be administered to a subject by one or more of the following routes of administration: intravenous, oral, rectal, vaginal, transmucosal, sublingual, subdural, nasal, intramuscular, subcutaneous, intramedullary injection, intrathecal, intraventricular, intraperitoneal, intranasal, opthalmically, and / or intraocular.
[0032] The present invention also provides a method for treating a disease in a subject (e.g., a disease associated with the abnormal expression of a gene or nucleic acid), the method comprising administering to the subject one or more of the compounds and / or pharmaceutical compositions of the present invention. Also contemplated is a method for transfecting one or more target cells with one or more polynucleotides, the method comprising contacting one or more target cells with a compound or pharmaceutical composition described herein, such that the one or more target cells are transfected with one or more encapsulated polynucleotides.
[0033] In certain embodiments, methods of treatment provided herein employ compositions comprising lyophilized or reconstituted lipid delivery vehicles of the present invention that can modulate the expression of aberrantly expressed nucleic acids and polynucleotides in one or more target cells and tissues. Accordingly, also provided herein are methods of treating a disease in a subject by administering to the subject an effective amount of a pharmaceutical composition comprising a lyophilized lipid delivery vehicle provided herein (e.g., upon reconstitution with a rehydration medium, such as sterile water, for injection). In certain embodiments, such methods can enhance (e.g., increase) the expression of a polynucleotide and / or increase the production and secretion of a functional polypeptide product in one or more target cells and tissues (e.g., hepatocytes). In some embodiments, the target cells or tissues aberrantly express a polynucleotide encapsulated by one or more of the lyophilized lipid delivery vehicles (e.g., lipid nanoparticles) of the present invention.
[0034] The present invention also provides methods for increasing expression of one or more polynucleotides (e.g., mRNA) in one or more target cells, tissues, and organs. Generally, such methods involve contacting target cells with one or more compounds and / or pharmaceutical or liposomal compositions that contain or otherwise encapsulate one or more polynucleotides. In some embodiments, the present invention also relates to methods for transfecting one or more cells with a polynucleotide (e.g., comprising rehydrating a lyophilized composition and contacting such one or more cells with the rehydrated composition).
[0035] The above-discussed and many other features and attendant advantages of the present invention will be better understood by reference to the following detailed description of the invention when taken in conjunction with the accompanying examples. The various embodiments described herein are complementary and can be combined or used together in a manner understood by those skilled in the art in light of the teachings contained herein. [Brief explanation of the drawings]
[0036] [Figure 1] Figure 1 illustrates the luminescence output of firefly luciferase protein in the liver and spleen of mice after intravenous administration of HGT4003-based firefly luciferase (FFL) mRNA-loaded lipid nanoparticles. Administered HGT4003-based lipid nanoparticles result in enrichment of encapsulated mRNA in the liver compared with the spleen. Values are shown as the average relative light units (RLU) / mg of total protein 4 hours after administration. [Figure 2]Figure 1 illustrates the luminescence output of firefly luciferase protein in mouse brain and spinal cord tissue after intracerebrovascular (ICV) and intrathecal (IT) administration of HGT4003-based firefly luciferase (FFL) mRNA-loaded lipid nanoparticles. Administered HGT4003-based lipid nanoparticles result in enrichment of encapsulated mRNA in the brain using the ICV administration route compared to the IT administration route. Values are shown as the average relative light units (RLU) / mg of total protein 4 hours after administration. DETAILED DESCRIPTION OF THE INVENTION
[0037] Description of exemplary embodiments The compounds of the present invention are useful, for example, as liposome delivery vehicles or as components of liposome delivery vehicles. In some embodiments, the compounds disclosed herein can be used in liposome compositions, or alternatively as components of liposome compositions (e.g., lipid nanoparticles). The compounds of the present invention can also be employed in pharmaceutical compositions (e.g., lipid nanoparticles) and methods of administering such pharmaceutical compositions to treat or prevent diseases, disorders, or conditions, or to deliver therapeutic molecules. In some embodiments, such compounds and compositions facilitate the delivery of, for example, encapsulated materials (e.g., polynucleotides) to one or more target cells, tissues, and organs.
[0038] The compounds disclosed herein generally contain one or more cleavable groups, such as, for example, one or more disulfide (SS) functional groups shown in Formula I below. The terms "cleavage" and "cleavable" are generally used herein to mean that one or more chemical bonds (e.g., one or more of a covalent bond, a hydrogen bond, a van der Waals force, and / or an ionic interaction) between atoms of or adjacent to the functional group of interest are broken (e.g., hydrolyzed) or are breakable upon exposure to selected conditions (e.g., upon exposure to enzymatic conditions). In certain embodiments, the cleavable group is a disulfide functional group, and in certain embodiments, a disulfide group that is cleavable upon exposure to selected biological conditions (e.g., intracellular conditions). In certain embodiments, the cleavable group is an ester functional group that is cleavable upon exposure to selected biological conditions. For example, the disulfide group can be cleaved enzymatically or by hydrolysis, oxidation, or reduction reactions. Upon cleavage of such a disulfide functional group, one or more attached functional moieties or A functional group (e.g., one or more of the head group and / or tail group) can be released. Exemplary cleavable groups include, but are not limited to, disulfide groups, ester groups, ether groups, and derivatives thereof (e.g., alkyl and aryl esters). In certain embodiments, the cleavable group is not an ester group or an ether group.
[0039] The cleavable groups described herein are generally attached (e.g., attached by one or more of hydrogen bonds, van der Waals forces, ionic interactions, and covalent bonds) to one or more functional moieties or groups (e.g., at least one head group and at least one tail group). In certain embodiments, at least one of the functional moieties or groups is hydrophilic (e.g., a hydrophilic head group comprising one or more of imidazole, guanidinium, amino, imine, enamine, optionally substituted alkylamino, and pyridyl). As used herein, the term "hydrophilic" is used in qualitative terms to indicate that the functional group prefers water, and typically, such groups are water-soluble. For example, compounds are disclosed herein that include a cleavable disulfide (SS) functional group attached to one or more hydrophilic groups (e.g., hydrophilic head groups), where such hydrophilic groups include or are selected from the group consisting of imidazole, guanidinium, amino, imine, enamine, optionally substituted alkylamino (e.g., alkylamino such as dimethylamino), and pyridyl.
[0040] In certain embodiments, selected hydrophilic functional groups or moieties can modify or otherwise impart properties to compounds, or compounds or liposomal compositions of which such compounds are components (e.g., by improving the transfection efficiency of lipid nanoparticles of which the compounds are components). For example, incorporation of guanidinium as a hydrophilic head group into the compounds disclosed herein can promote membrane fusion of such compounds (or liposomal compositions of which such compounds are components) with the cellular membrane of one or more target cells, thereby enhancing, for example, the transfection efficiency of such compounds. It is hypothesized that the nitrogen from the hydrophilic guanidinium moiety provides stability to the interaction, thereby forming a six-membered ring transition state that allows cellular uptake of the encapsulated material (Wender, et al., Adv. Drug Del. Rev. (2008) 60:452-472). Similarly, incorporation of one or more amino groups or amino moieties into the disclosed compounds (e.g., as head groups) can exploit the membrane fusogenic properties of such amino groups to further promote disruption of the endosomal / lysosomal membranes of target cells. This is based not only on the pKa of the amino group of the composition, but also on the ability of the amino group to undergo a hexagonal phase transition and fuse with the target cell surface, i.e., the vesicle membrane (Koltover, et al. Science (1998) 281:78-81). As a result, it is believed that this promotes the disruption of the vesicle membrane, releasing the lipid nanoparticle contents into the target cell.
[0041] Similarly, in some embodiments, the incorporation of, for example, imidazole as a hydrophilic head group into the compounds disclosed herein may serve to facilitate endosomal or lysosomal release of contents encapsulated in, for example, liposome compositions (e.g., lipid nanoparticles) of the present invention. Such enhanced release may be achieved by one or both of the following: a proton-spongiform membrane-mediated disruption mechanism and / or enhanced membrane fusion mechanism. The proton-spongiform membrane mechanism is based on the ability of a compound, particularly a functional moiety or group of a compound, to buffer endosomal acidification. This can be manipulated or otherwise controlled by the pKa of the compound or one or more of the functional groups (e.g., imidazole) that comprise such compounds. Thus, in some embodiments, the membrane fusion properties of, for example, imidazole-based compounds disclosed herein (e.g., HGT4001 and HGT4004) are related to the endosomal disruption properties facilitated by such imidazole groups, which have a lower pKa relative to other conventional cationic lipids. Such endosome-disrupting properties simultaneously promote osmotic swelling and rupture of the liposome membrane, followed by delivery of the loaded or encapsulated polynucleotide material to the target cell. This is followed by transfection or intracellular release of the imidazole moiety. This phenomenon can be applied to a variety of compounds with desirable pKa profiles in addition to imidazole moieties. Such embodiments also include multi-nitrogen-based functional groups such as polyamines, poly-peptides (histidine), and nitrogen-based dendritic structures.
[0042] The compounds described herein, particularly imidazole-based compounds (e.g., HGT4001 and HGT4004), are also characterized by their reduced toxicity, particularly to conventional lipids and cationic lipids. In some embodiments, the pharmaceutical and liposomal compositions described herein contain one or more imidazole-based cationic lipid compounds, so that the relative concentration of other, more toxic cationic lipids in such pharmaceutical or liposomal compositions can be reduced or otherwise eliminated. Imidazole-based compounds or lipids (e.g., HGT4001 and / or HGT4004) can be used as the only cationic lipid in one or more of the pharmaceutical and liposomal compositions (e.g., lipid nanoparticles) described herein, or can be combined with conventional cationic lipids (e.g., lipofectin or lipofectamine), non-cationic lipids, helper lipids / cholesterol, and / or PEG-modified lipids. In certain embodiments, the compounds described herein, or alternatively the total cationic lipid component of pharmaceutical and liposomal compositions, may comprise a molar ratio of about 1% to about 90%, about 2% to about 70%, about 5% to about 50%, about 10% to about 40%, or preferably about 20% to about 70% of the total lipid present in such pharmaceutical or liposomal compositions (e.g., lipid nanoparticles).
[0043] In some embodiments, at least one of the functional groups of the moiety comprising the compounds disclosed herein is hydrophobic in nature (e.g., a hydrophobic tail group comprising a naturally occurring lipid such as cholesterol). As used herein, the term "hydrophobic" is used in qualitative terms to indicate that the functional group is water-repellent, typically such that the group is not water-soluble. For example, compounds are disclosed herein that include a cleavable functional group (e.g., a disulfide (SS) group) attached to one or more hydrophobic groups, such that the hydrophobic group is attached to one or more naturally occurring lipids such as cholesterol, and / or an optionally substituted, variably saturated or unsaturated C6-C 20Alkyl, and / or optionally substituted variable saturated or unsaturated C-C 20 Contains acyl.
[0044] In certain embodiments, compounds disclosed herein include, for example, at least one hydrophilic head group and at least one hydrophobic tail group, each attached to at least one cleavable group, thereby conferring amphiphilic properties to such compounds. As used herein to describe a compound or composition, the term "amphiphilic" refers to the ability to dissolve in both polar (e.g., water) and non-polar (e.g., lipid) environments. For example, in certain embodiments, compounds disclosed herein include at least one lipophilic tail group (e.g., cholesterol or C6-C 20 alkyl), and at least one hydrophilic head group (e.g., imidazole), each attached to a cleavable group (e.g., disulfide).
[0045] It should be noted that the terms "head group" and "tail group," when used to describe the compounds of the invention, and particularly the functional groups that comprise such compounds, are used for ease of reference to describe the orientation of one or more functional groups relative to other functional groups. For example, in certain embodiments, a hydrophilic head group (e.g., guanidinium) is attached (e.g., by one or more of hydrogen bonding, van der Waals forces, ionic interactions, and covalent bonding) to a cleavable functional group (e.g., a disulfide group) that is simultaneously attached to a hydrophobic tail group (e.g., cholesterol).
[0046] As used herein, Formula I [ka] Also disclosed is a compound having the structure: wherein R1 is selected from the group consisting of imidazole, guanidium, amino, imine, enamine, optionally substituted alkylamino (e.g., alkylamino such as dimethylamino), and pyridyl; and R2 is a group selected from the group consisting of Formula II and Formula III. [ka] is selected from the group consisting of
[0047] wherein R3 and R4 are each independently an optionally substituted variably saturated or unsaturated C6-C 20 Alkyl and optionally substituted variably saturated or unsaturated C-C 20 acyl, wherein n is 0 or any positive integer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more). In certain embodiments, each of R3 and R4 is an optionally substituted polyunsaturated C 18 alkyl, while in other embodiments, R and R each comprise an unsubstituted polyunsaturated C 18 In certain embodiments, each of R3 and R4 is (9Z,12Z)-octadeca-9,12-diene. In certain embodiments, n is 1 (such as when the alkyl is ethyl), 2 (such as when the alkyl is methyl), 3 (such as when the alkyl is propyl or isopropyl), 4 (such as when the alkyl is butyl, isobutyl, sec-butyl, or tert-butyl), 5 (such as when the alkyl is pentane), 6 (such as when the alkyl is hexane), 7 (such as when the alkyl is heptane), 8 (such as when the alkyl is octane), 9 (such as when the n alkyl is nonane), or 10. (where alkyl is, for example, decane).
[0048] As used herein, the term "alkyl" refers to both straight and branched chain C 1- C 40 Hydrocarbons (e.g., C6-C 20"Alkyl" refers to a hydrocarbon, including both saturated and unsaturated hydrocarbons. In certain embodiments, alkyl may contain one or more cyclic alkyls and / or one or more heteroatoms such as oxygen, nitrogen, or sulfur, and may optionally be substituted with substituents (e.g., one or more of alkyl, halo, alkoxyl, hydroxy, amino, aryl, ether, ester, or amide). In certain embodiments, contemplated alkyls include (9Z,12Z)-octadeca-9,12-diene. For example, "C6-C 20 " is intended to refer to an alkyl (including, for example, straight or branched chain and alkenes and alkyls) having the recited range of carbon atoms.
[0049] As used herein, the term "aryl" refers to aromatic groups containing 6 to 10 carbons in the ring portion (e.g., monocyclic, bicyclic, and tricyclic structures). Aryl groups can be optionally substituted through available carbon atoms and, in some embodiments, can contain one or more heteroatoms such as oxygen, nitrogen, or sulfur.
[0050] Also disclosed herein are pharmaceutical compositions comprising a compound of Formula I, wherein R is selected from the group consisting of imidazole, guanidium, amino, imine, enamine, optionally substituted alkylamino (e.g., dimethylamino), and pyridyl; R is Formula II; and n is 0 or any positive integer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more). Also disclosed herein are pharmaceutical compositions comprising a compound of Formula I, wherein R is selected from the group consisting of imidazole, guanidium, imine, enamine, amino, optionally substituted alkylamino (e.g., dimethylamino), and pyridyl; R is Formula III; and R and R are each independently an optionally substituted variably saturated or unsaturated C-C alkyl group. 20 Alkyl and optionally substituted variably saturated or unsaturated C-C 20 In one embodiment, R3 and R4 are each an optionally substituted polyunsaturated C 18alkyl, while in other embodiments, R and R are each an unsubstituted polyunsaturated C 18 In some embodiments, contemplated alkyl includes (9Z,12Z)-octadeca-9,12-diene.
[0051] In some embodiments, the R1 group or head group is a polar or hydrophilic group (e.g., one or more of an imidazole group, a guanidinium group, and an amino group) and is attached to the R2 lipid group by a disulfide (SS) cleavable linker group, e.g., as depicted in Formula I. The R1 group or head group is an alkyl group (e.g., a C1-C6 alkyl group, where n is 1-20). 20 The cleavable linker group may be covalently attached to a cleavable linker group via a cleavable linker group (e.g., n is 0) or alternatively may be directly attached to a cleavable linker group (e.g., n is 0). The compounds and pharmaceutical compositions disclosed herein can be prepared such that, upon exposure to selected conditions (e.g., appropriate biological or enzymatic conditions), the cleavable linker group (e.g., a disulfide group) is cleaved, thereby releasing one or more of the attached functional groups or moieties (e.g., head and / or tail groups). Dissociation of the functional group or moiety (e.g., an R1 hydrophilic group such as imidazole) results in a phase transition in a liposome composition in which one or more of the compounds disclosed herein are components, thereby destabilizing the liposome and facilitating fusion with the membrane of one or more target cells. Other contemplated cleavable linker groups include, for example, alkyl groups (e.g., C1-C2). 10 The composition may include compositions comprising one or more disulfide (SS) linker groups bonded (e.g., covalently bonded) to a hydroxyl group (e.g., alkyl).
[0052] In one embodiment, the present invention provides the compound 5-(((10,13-dimethyl-17-(6-methylheptyl)-2-methylheptyl)-1,2-dione, having the structure of Formula IV (referred to herein as "HGT4001"). (tan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl)disulfanyl)methyl)-1H-imidazole is provided. [ka]
[0053] In certain embodiments, the present invention provides the compound 1-(2-(((3S,10R,13R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl)disulfanyl)ethyl)guanidine, having the structure of Formula V (referred to herein as "HGT4002"). [ka]
[0054] In certain embodiments, the present invention provides the compound 2-((2,3-bis((9Z,12Z)-octadeca-9,12-dien-1-yloxy)propyl)disulfanyl)-N,N-dimethylethanamine, having the structure of formula VI (referred to herein as “HGT4003”). [ka]
[0055] In other embodiments, the present invention provides the compound 5-(((2,3-bis((9Z,12Z)-octadeca-9,12-dien-1-yloxy)propyl)disulfanyl)methyl)-1H-imidazole, having the structure of formula VII (referred to herein as "HGT4004"). [ka]
[0056] In yet another embodiment, the present invention provides the compound 1-(((2,3-bis((9Z,12Z)-octadeca-9,12-dien-1-yloxy)propyl)disulfanyl)methyl)guanidine, having the structure of formula VIII (referred to herein as "HGT4005"). [ka]
[0057] The compounds described herein can be used to construct liposome compositions that facilitate or enhance the delivery and release of encapsulated materials (e.g., one or more therapeutic polynucleotides) into one or more target cells (e.g., by penetrating or fusing with the lipid membranes of such target cells). In certain embodiments, such compounds comprise one or more cleavable functional groups, e.g., causing a hydrophilic functional head group to dissociate from a lipophilic functional tail group of the compound (e.g., upon exposure to reducing or acidic conditions), thereby facilitating a phase transition in the lipid bilayer of one or more target cells. For example, when a liposome composition (e.g., lipid nanoparticle) comprises or is otherwise enriched with one or more of the compounds disclosed herein, a phase transition in the lipid bilayer of one or more target cells facilitates the delivery of encapsulated materials (e.g., one or more therapeutic polynucleotides encapsulated in lipid nanoparticles) to one or more target cells.
[0058] In certain embodiments, the compounds described herein are characterized by one or more properties that provide such compounds with advantages over other similarly classified lipids. For example, in certain embodiments, the compounds disclosed herein allow for control and tailoring of the properties of liposome compositions (e.g., lipid nanoparticles) of which they are components. In particular, the compounds disclosed herein may be characterized by enhanced transfection efficiency and their ability to induce specific biological outcomes. Such outcomes may include, for example, enhanced cellular uptake, endosomal / lysosomal disruption, and / or enhanced release of encapsulated material (e.g., polynucleotides) within cells.
[0059] In certain embodiments, the compounds described herein (as well as pharmaceutical and liposomal compositions comprising such compounds) employ a multifunctional strategy to facilitate the delivery of encapsulated material (e.g., one or more polynucleotides) to, and subsequent transfection into, one or more target cells. For example, in certain embodiments, the compounds described herein (as well as pharmaceutical and liposomal compositions comprising such compounds) are characterized by one or more of the following release properties that confer on such compounds advantages over receptor-mediated endocytosis, clathrin- and caveolae-mediated endocytosis, phagocytosis and macroendocytosis, membrane fusion, endosomal or lysosomal disruption, and / or other similarly classified lipids.
[0060] In some embodiments, compounds as well as components (e.g., lipid nanoparticles) of such compounds are used. Certain pharmaceutical and liposomal compositions exhibit enhanced (e.g., increased) ability to transfect one or more target cells. Accordingly, methods of transfecting one or more target cells are also provided herein. Such methods generally involve contacting one or more target cells with a compound and / or pharmaceutical composition disclosed herein (e.g., HGT4003-based lipid nanoparticles encapsulating one or more polynucleotides), such that the one or more target cells are transfected with the encapsulated material (e.g., one or more polynucleotides). As used herein, the term "transfect" or "transfection" refers to the intracellular introduction of one or more encapsulated materials (e.g., nucleic acids and / or polynucleotides) into cells, preferably target cells. The introduced polynucleotides may be stable or may be transiently maintained within the target cells. The term "transfection efficiency" refers to the relative amount of such encapsulated material (e.g., polynucleotides) taken up by, introduced into, and / or expressed by the target cells undergoing transfection. In practice, transfection efficiency is estimated by the amount of reporter polynucleotide product produced by the target cells after transfection. In certain embodiments, the compounds and pharmaceutical compositions disclosed herein exhibit high transfection efficiency, thereby improving the likelihood that an appropriate dosage of encapsulated material (e.g., one or more polynucleotides) will be delivered to the site of the lesion and subsequently expressed, while at the same time minimizing the possibility of systemic adverse effects.
[0061] A wide variety of materials capable of providing pharmaceutical or therapeutic effects can be delivered to target cells using the compounds, compositions, and methods of the present invention. Accordingly, the compounds and pharmaceutical and liposomal compositions described herein can be used to encapsulate any material suitable for intracellular delivery. In certain embodiments, such encapsulated materials can confer therapeutic or diagnostic benefit to the cells to which they are delivered and can include any drug, biologic, and / or diagnostic agent. Materials can be organic or inorganic. Organic molecules can be peptides, proteins, carbohydrates, lipids, sterols, nucleic acids (including peptide nucleic acids), or any combination thereof. In certain embodiments, the pharmaceutical and liposomal compositions disclosed herein can contain or otherwise encapsulate two or more types of materials, e.g., two or more different polynucleotide sequences encoding proteins, enzymes, and / or steroids. In certain embodiments, the encapsulated material is one or more polynucleotides and nucleic acids.
[0062] As used herein, the terms "polynucleotide" and "nucleic acid" are used interchangeably to refer to genetic material (e.g., DNA or RNA), and when used in reference to the compounds and compositions (e.g., lipid nanoparticles) described herein, generally refer to the genetic material encapsulated by such compounds and compositions (e.g., lipid nanoparticles). In some embodiments, the polynucleotide is RNA. Suitable RNAs include mRNA, siRNA, miRNA, snRNA, and snoRNA. Contemplated polynucleotides also include large intergenic non-coding RNAs (lincRNAs), which generally do not encode proteins but rather function, for example, in immune signaling, stem cell biology, and disease development. (See, e.g., Guttman, et al., 458:223-227 (2009) and Ng, et al., Nature Genetics 42:1035-1036 (2010), the contents of which are incorporated herein by reference.) In a preferred embodiment, the polynucleotide is mRNA. In some embodiments, the polynucleotide encapsulated by the compounds or pharmaceutical and liposomal compositions of the invention comprises RNA or stabilized RNA encoding a protein or enzyme (e.g., mRNA encoding alpha-galactosidase). The invention provides therapeutic agents that are capable of expression by target cells, thereby facilitating the production (and in some cases, secretion) of functional enzymes or proteins by such target cells, such as those disclosed in International Application No. PCT / US2010 / 058457 and U.S. Provisional Application No. 61 / 494,881 (filed June 8, 2011), the teachings of both of which are incorporated herein by reference in their entireties. The use of such polynucleotides (and particularly RNA or stabilized RNA) as therapeutic agents is contemplated. For example, in certain embodiments, when one or more polynucleotides are expressed by a target cell, production of a functional enzyme or protein in which the subject is deficient (e.g., a urea cycle enzyme or an enzyme associated with a lysosomal storage disorder) can be observed. As used herein to qualify a protein or enzyme, the term "functional" means that the protein or enzyme has biological activity or, alternatively, is capable of performing the same or similar function as a native or normally functioning protein or enzyme.
[0063] In the context of the present invention, the term "expression" is used in its broad sense to refer to either the transcription of a particular gene or polynucleotide into at least one mRNA transcript, or the translation of at least one mRNA or polynucleotide into a protein or enzyme. For example, in certain embodiments, the compounds and pharmaceutical or liposomal compositions described herein comprise a polynucleotide (e.g., mRNA) that encodes a functional protein or enzyme. In the context of such an mRNA polynucleotide, the term "expression" refers to the translation of such mRNA (e.g., by a target cell) to produce the polypeptide or protein encoded thereby.
[0064] In certain embodiments, the compounds and pharmaceutical compositions provided herein can modulate aberrantly expressed nucleic acids and polynucleotides in one or more target cells and tissues. Accordingly, also provided herein are methods for treating a disease in a subject by administering to the subject an effective amount of a compound and / or pharmaceutical or liposomal composition described herein. In certain embodiments, such methods can enhance (e.g., increase) expression of a polynucleotide and / or increase production and secretion of a functional polypeptide product in one or more target cells and tissues (e.g., liver cells). In some embodiments, the target cells or tissues aberrantly express a polynucleotide encapsulated by one or more of the compounds or pharmaceutical and liposomal compositions (e.g., lipid nanoparticles) described herein. Also provided herein are methods for increasing expression of one or more polynucleotides (e.g., mRNA) in one or more target cells, tissues, and organs. Generally, such methods include contacting target cells with one or more compounds and / or pharmaceutical or liposomal compositions that contain or otherwise encapsulate one or more polynucleotides.
[0065] In certain embodiments, the compounds disclosed herein can be used as liposomes or as components of liposomes. Specifically, in certain embodiments, the compounds disclosed herein can be used as lipid (e.g., cationic lipid) components of liposome compositions (e.g., lipid nanoparticles). Such liposomes can be used to encapsulate materials and facilitate delivery of such materials to one or more target cells, tissues, and organs. As used herein, the term "liposome" generally refers to a vesicle composed of lipids (e.g., amphiphilic lipids) arranged in one or more spherical bilayers or bilayers. In certain embodiments, the liposome is a lipid nanoparticle (e.g., a lipid nanoparticle comprising one or more of the cationic lipid compounds disclosed herein). Such liposomes can be unilamellar or multilamellar vesicles having a membrane formed from a lipophilic material and an aqueous interior containing the encapsulated material (e.g., a polynucleotide) to be delivered to one or more target cells, tissues, and organs. In certain embodiments, the pharmaceutical and liposome compositions described herein comprise one or more lipid nanoparticles. Contemplated liposomes include lipid nanoparticles. Examples of suitable lipids (e.g., cationic lipids) that can be used to form the liposomes and lipid nanoparticles contemplated herein include one or more of the compounds disclosed herein (e.g., HGT4001, HGT4002, HGT4003, HGT4004, and / or HGT4005). Such liposomes and lipid nanoparticles may be prepared using C12-200, DLin-KC2-DMA, and / or HGT5001, non-cationic lipids. The lipids may also include additional cationic lipids such as carboxylic acid lipids, helper / cholesterol-based lipids, PEG-modified lipids, and phosphatidyl compounds (e.g., phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides), and combinations or mixtures of the foregoing.
[0066] Several cationic lipids have been described in the literature, many of which are commercially available. In some embodiments, such cationic lipids are included in the pharmaceutical or liposomal compositions described herein in addition to one or more of the compounds or lipids disclosed herein (e.g., HGT4003). In some embodiments, the cationic lipid N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride or "DOTMA" is used (Felgner et al. (Proc. Nat'l Acad.Sci.84,7413(1987), U.S. Patent No. 4,897,355).DOTMA can be formulated alone or combined into lipid nanoparticles with neutral lipids, dioleoylphosphatidylethanolamine or "DOPE", or other cationic or non-cationic lipids.Other suitable cationic lipids include, for example, (15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-15,18-dien-1-amine (HGT5000), (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-tri ... Ionizable cationic lipids, such as those described in U.S. Provisional Patent Application No. 61 / 617,468 (filed March 29, 2012), which is incorporated herein by reference, such as (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine (HGT5001), and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine (HGT5002), C12-200 (WO2010 / 053572), 2-(2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamine (DLinKC2-DMA)) (WO2010 / 042877, Semple et al., nature Biotech.28:172-176 (2010)), 2-(2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamine ("DLin-KC2-DMA"), (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)- (15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)-octadeca-9,12-dien-1-yl)tetraco[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoate ("ICE"); tetracosa-15,18-dien-1-amine ("HGT5000"), (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-trien-1-amine ("HGT5001"), and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine ("HGT5002"), 5-carboxyspermylglycine-dioctadecylamide or "DOGS", 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanaminium or "DOSPA" (Behr et al. Proc. Nat. Acad. Sci. 86, 6982 (1989), U.S. Patent No. 5,171,678, U.S. Patent No. 5,334,761), 1,2-dioleoyl-3-dimethylammonium-propane or "DODAP," 1,2-dioleoyl-3-trimethylammonium-propane or "DOTAP." Contemplated cationic lipids include 1,2-distearyloxy-N,N-dimethyl-3-aminopropane or "DSDMA," 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane. N-Dioleyl-N,N-dimethylammonium chloride or "DODAC", N,N-Distearyl-N,N-dimethylammonium bromide or "DDAB", N-(1,2-Dimyristyloxypropane) 2-[5'-(cholest-5-ene-3-β-oxy)-3'-oxapentoxy)-3-dimethyl-1-(cis,cis-9',12-octadecadienooxy)propane or "CLinDMA"; 2-[5'-(cholest-5-ene-3-β-oxy)-3'-oxapentoxy)-3-dimethyl-1-(cis,cis-9',12-octadecadienooxy)propane or "CLinDMA"; N,N-dimethyl-3,4-dioleoyloxybenzylamine or "DMOBA", 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane or "DOcarbDAP", 2,3-dilinoleoyloxy-N,N-dimethylpropylamine or "DLinDAP", 1,2-N,N'-dilinoleoylcarbamyl-3-dimethylaminopropane or Also included are "DLincarbDAP," 1,2-dilinoleoylcarbamyl-3-dimethylaminopropane or "DLinCDAP," 2,2-dilinoleoyl-4-dimethylaminomethyl-[1,3]-dioxolane or "DLin-K-DMA," 2,2-dilinoleoyl-4-dimethylaminoethyl-[1,3]-dioxolane or "DLin-K-XTC2-DMA," or combinations thereof (Heyes, J., et al., J Controlled Release 107:276-287 (2005); Morrissey, DV., et al., Nat. Biotechnol. 23(8):1003-1007 (2005); PCT Publication No. WO2005 / 121348A1). The use of cholesterol-based cationic lipids to formulate compositions (e.g., lipid nanoparticles) is also contemplated by the present invention. Such cholesterol-based cationic lipids can be used either alone or in combination with other cationic or non-cationic lipids. Suitable cholesterol-based cationic lipids include, for example, DC-Chol (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine (Gao, et al., Biochem. Biophys. Res. Comm. 179, 280 (1991); Wolf et al. al. BioTechniques 23, 139 (1997), U.S. Patent No. 5,744,335).
[0067] Cationic lipids such as the lipids based on dialkylamino, imidazole and guanidinium can also be envisaged.For example, cationic lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoic acid or "ICE" can also be envisaged, as disclosed in International Application No. PCT / US2010 / 058457 (incorporated herein by reference).
[0068] Also contemplated is the use and inclusion of polyethylene glycol (PEG)-modified phospholipids and derivatized lipids, such as derivatized ceramides (PEG-CER), including N-octanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)-2000] (C8 PEG-2000 ceramide), in the liposomes and pharmaceutical compositions described herein, preferably in combination with one or more of the compounds and lipids disclosed herein. Contemplated PEG-modified lipids include those ranging in length from C6-C 20 In some embodiments, the PEG-modified lipid employed in the compositions and methods of the present invention includes, but is not limited to, 1,2-dimyristoyl-sn-glycerol, methacrylate, methacrylate copolymer ... A typical example is dimethylpolyethylene glycol (2000MW PEG) ("DMG-PEG2000"). The addition of PEG-modified lipids to lipid delivery vehicles can prevent complex aggregation, increase circulation lifetime, and provide a means for increasing delivery of lipid-polynucleotide compositions to target tissues (Klibanov et al. (1990) FEBS Letters, 268(1):235-237), or they can be selected to rapidly exchange out of the formulation in vivo (see U.S. Pat. No. 5,885,613). Particularly useful exchangeable lipids are PEG-ceramides with short acyl chains (e.g., C14 or C18). PEG-modified phospholipids and derivatized lipids of the present invention can comprise a molar ratio of about 0% to about 20%, about 0.5% to about 20%, about 1% to about 15%, about 4% to about 10%, or about 2% of the total lipids present in the liposomal lipid nanoparticles.
[0069] The present invention also contemplates the use of non-cationic lipids in one or more pharmaceutical or liposome compositions (e.g., lipid nanoparticles).Such non-cationic lipids are preferably used in combination with one or more of the compounds and lipids disclosed herein.As used herein, the phrase "non-cationic lipid" refers to any neutral, zwitterionic, or anionic lipid.As used herein, the phrase "anionic lipid" refers to any of many lipid species that have a net negative charge at a selected pH, such as physiological pH. Non-cationic lipids include distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), and dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal). Examples of suitable non-cationic lipids include, but are not limited to, dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), DLPE (1,2-dilauroyl-sn-glycero-3-phosphoethanolamine), DPPS (1,2-dipalmitoyl-sn-glycero-3-phospho-L-serine), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidiethanolamine (SOPE), ceramide, sphingomyelin, cholesterol, or mixtures thereof. While such non-cationic lipids can be used alone, they are preferably used in combination with other excipients, such as one of the cationic lipid compounds disclosed herein (e.g., HGT4001, HGT4002, HGT4003, HGT4004, and / or HGT4005).When used in combination with cationic lipids, non-cationic lipids may comprise a molar ratio of 5% to about 90%, or preferably about 10% to about 70%, of the total lipids present in the lipid nanoparticles.
[0070] It is also envisioned that the lipid nanoparticles comprising pharmaceutical or liposome compositions described herein can contain polymer.Suitable polymers can include, for example, polyacrylate, polyalkoxyanacrylate, polylactide, polylactide-polyglycoside copolymer, polycaprolactone, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrin and polyethyleneimine.Such polymers can be used alone, but are preferably used in combination with other excipients, for example, one of the cationic lipid compounds disclosed herein (for example, HGT4001, HGT4002, HGT4003, HGT4004 and / or HGT4005).
[0071] In certain embodiments, pharmaceutical and liposomal compositions (e.g., lipid nanoparticles) are formulated, in part, based on their ability to facilitate transfection (e.g., of polynucleotides) into target cells. In other embodiments, pharmaceutical and liposomal compositions (e.g., lipid nanoparticles) are , may be selected and / or prepared to optimize delivery of the polynucleotide to the target cell, tissue, or organ. For example, if the target cell is a liver cell, the properties of the pharmaceutical and / or liposomal composition (e.g., size, charge, and / or pH) may be optimized to efficiently deliver such composition (e.g., lipid nanoparticles) to the target cell or organ, reduce immune clearance, and / or promote retention in the target organ. Alternatively, if the target tissue is the central nervous system, the selection and preparation of the pharmaceutical and liposomal composition must take into account penetration of and retention within the blood-brain barrier and / or the use of alternative means of directly delivering such composition (e.g., lipid nanoparticles) to such target tissue (e.g., via intracerebrovascular administration). In certain embodiments, the pharmaceutical or liposomal composition, or its component lipid nanoparticles, may be combined with an agent that facilitates movement of the encapsulated material (e.g., an agent that disrupts or improves penetration of the blood-brain barrier, thereby enhancing movement of such encapsulated polynucleotides to the target cell). The pharmaceutical and liposome compositions (e.g., lipid nanoparticles) described herein can facilitate the introduction of encapsulated materials, such as one or more polynucleotides, into target cells, also by adding polycations (e.g., poly-L-lysine and protamine), e.g., as copolymers, to one or more of the lipid nanoparticles containing the pharmaceutical composition, which in some cases significantly enhances the transfection efficiency of some types of cationic liposomes by 2-28 fold in many cell systems in vitro and in vivo. (See N.J. Caplen, et al., Gene Ther. 1995;2:603; S. Li, et al., Gene Ther. 1997;4,891.)
[0072] In some embodiments of the present invention, pharmaceutical and liposomal compositions (e.g., lipid nanoparticles) are prepared to encapsulate one or more materials or therapeutic agents (e.g., polynucleotides). The process of incorporating a desired therapeutic agent (e.g., mRNA) into a liposome or lipid nanoparticle is referred to herein as "loading" or "encapsulation" (Lasic, et al., FEBS Lett., 312:255-258, 1992). The lipid nanoparticle-loaded or encapsulated material (e.g., polynucleotide) may be located entirely or partially within the interior space of the lipid nanoparticle, within the bilayer membrane of the lipid nanoparticle, or associated with the outer surface of the lipid nanoparticle.
[0073] For example, loading or encapsulating a polynucleotide in a lipid nanoparticle may serve to protect the polynucleotide from environments that may contain enzymes or chemicals (e.g., serum) that degrade the polynucleotide and / or systems or receptors, causing the polynucleotide to be rapidly excreted. Thus, in some embodiments, the compositions described herein can enhance the stability of the polynucleotide(s) encapsulated therein, particularly with respect to the environment to which such polynucleotides are exposed. Encapsulating materials such as polynucleotides in one or more of the pharmaceutical and liposomal compositions (e.g., lipid nanoparticles) described herein also facilitates the delivery of such polynucleotides into target cells and tissues. For example, lipid nanoparticles containing one or more of the lipid compounds described herein can allow the encapsulated polynucleotide to reach target cells or can cause the encapsulated polynucleotide to preferentially reach target cells or organs (e.g., lipid nanoparticles can be concentrated in the liver or spleen of a subject to which such lipid nanoparticles are administered). Alternatively, lipid nanoparticles can limit the delivery of the encapsulated polynucleotide to other non-target cells or organs where the presence of the encapsulated polynucleotide is undesirable or may limit its utility.
[0074] In certain embodiments, the pharmaceutical and liposomal compositions (e.g., lipid nanoparticles) described herein contain multiple lipid components (e.g., one or more of the compounds disclosed herein). ) with one or more polymer components. For example, lipid nanoparticles can be prepared using HGT4003, DOPE, CHOL, and DMG-PEG2000. Lipid nanoparticles can also be composed of various ratios of additional lipid combinations, including, for example, HGT4001, DOPE, and DMG-PEG2000. The selection of cationic lipids, non-cationic lipids, and / or PEG-modified lipids comprising the lipid nanoparticles, as well as the relative molar ratios of such lipids to each other, is based on the properties of the selected lipid(s), the nature of the intended target cells or tissues, and the properties of the material or polynucleotide to be delivered by the lipid nanoparticle. Additional considerations include, for example, the saturation of the alkyl chain, as well as the size, charge, pH, pKa, membrane fusogenicity, and toxicity of the selected lipid(s).
[0075] Pharmaceutical and liposome compositions (such as lipid nanoparticles) for use herein can be prepared by various techniques currently known in the art.Multilamellar vesicles (MLVs) can be prepared by conventional techniques, for example, by dissolving lipids in a suitable solvent, then evaporating the solvent, leaving a thin film on the inside of the vessel, or by spray-drying, by depositing selected lipids on the inner wall of a suitable container or vessel.Then, aqueous phase can be added to the vessel with vortex motion, which will result in the formation of MLVs.Unilamellar vesicles (ULVs) can then be formed by homogenization, sonication, or extrusion of multilamellar vesicles.In addition, unilamellar vesicles can be formed by detergent removal method.
[0076] In some embodiments, the pharmaceutical and liposomal compositions of the present invention comprise lipid nanoparticles in which encapsulated polynucleotides (e.g., mRNA) are associated on both surfaces of the lipid nanoparticles and encapsulated within the same lipid nanoparticles. For example, during the preparation of the compositions of the present invention, one or more of the cationic lipid compounds described herein, including lipid nanoparticles, can associate with polynucleotides (e.g., mRNA) through electrostatic interactions with such polynucleotides.
[0077] In certain embodiments, the pharmaceutical and liposomal compositions of the present invention may be loaded with diagnostic radionuclides, fluorescent materials, or other materials that are detectable for both in vitro and in vivo applications. For example, suitable diagnostic materials for use in the present invention may include rhodamine-dioleoylphosphatidylethanolamine (Rh-PE), green fluorescent protein mRNA (GFP mRNA), Renilla luciferase mRNA, and firefly luciferase mRNA (SEQ ID NO: 1).
[0078] During the preparation of the liposome compositions described herein, water-soluble carrier agents can also be encapsulated in the aqueous interior by including them in the hydration solution, and lipophilic molecules can be incorporated into the lipid bilayer by including them in the lipid formulation. In the case of certain molecules (e.g., cationic or anionic lipophilic polynucleotides), loading of the polynucleotide into preformed lipid nanoparticles or liposomes can be achieved, for example, by the method described in U.S. Pat. No. 4,946,683, the disclosure of which is incorporated herein by reference. After encapsulation of the polynucleotide, the lipid nanoparticles can be treated to remove unencapsulated mRNA through processes such as gel chromatography, diafiltration, or ultrafiltration. For example, if it is desired to remove externally bound polynucleotides from the surface of the liposome compositions (e.g., lipid nanoparticles) described herein, such lipid nanoparticles can be subjected to a diethylaminoethyl SEPHACEL column.
[0079] In addition to the encapsulated material (e.g., a polynucleotide or one or more therapeutic or diagnostic agents), additional therapeutic agents may be included in or encapsulated in the lipid nanoparticle. For example, such additional therapeutic agents may be associated with the surface of the lipid nanoparticle, incorporated into the lipid bilayer of the lipid nanoparticle by inclusion in the lipid formulation, or loading within a preformed lipid nanoparticle (see U.S. Pat. No. 6,449,523). See, for example, US Pat. Nos. 5,194,654 and 5,223,263, which are incorporated herein by reference.
[0080] There are several methods for reducing or "sizing" the size of the liposome compositions (e.g., lipid nanoparticles) disclosed herein, and generally, any of these methods can be employed when sizing is used as part of the present invention. The extrusion method is one method for liposome sizing. (Hope, MJ et al., "Reduction of Liposome Size and Preparation of Unilamellar Vesicles by Extrusion Techniques." In: Liposome Technology (G. Gregoriadis, Ed.) Vol. 1, p. 123 (1993)). This method involves extruding liposomes through a small-pore polycarbonate membrane or an asymmetric ceramic membrane to reduce the liposome size to a relatively well-defined size distribution. Typically, the suspension is cycled through the membrane one or more times until the desired liposome size distribution is achieved. Liposomes can be extruded through successively smaller-pore membranes to achieve a gradual reduction in liposome size.
[0081] Various alternative methods known in the art are available for sizing lipid nanoparticle populations. One such sizing method is described in U.S. Pat. No. 4,737,323, incorporated herein by reference. Sonication of liposome or lipid nanoparticle suspensions, either by bath or probe sonication, results in a progressive size reduction to small ULVs with diameters of less than about 0.05 microns. Homogenization is another method that relies on shear energy to fragment large liposomes into smaller ones. In a typical homogenization procedure, MLVs are recirculated through a standard emulsion homogenizer until selected liposome sizes, typically about 0.1 to 0.5 microns, are observed. Lipid nanoparticle size can be determined by pseudo-electric light scattering (QELS) as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421-450 (1981) (incorporated herein by reference). The average lipid nanoparticle diameter can be reduced by sonication of the formed lipid nanoparticles. Intermittent sonication cycles may be alternated with QELS assessment to induce sufficient liposome synthesis.
[0082] Selection of the appropriate size of the liposomal compositions (e.g., lipid nanoparticles) described herein must take into account the site of the target cell or tissue and, to some extent, the application for which the lipid nanoparticles are being produced. As used herein, the phrase "target cell" refers to a cell to which one or more of the pharmaceutical and liposomal compositions described herein are directed or targeted. In some embodiments, the target cell comprises a specific tissue or organ. In some embodiments, the target cell is deficient in a protein or enzyme of interest. For example, if it is desired to deliver a polynucleotide to hepatocytes, hepatocytes represent the target cell. In some embodiments, the pharmaceutical or liposomal compositions of the present invention (and, e.g., polynucleotide material encapsulated therein) are non-discriminatory transfected into target cells (i.e., are not transfected into non-target cells). The compositions and methods of the invention can be prepared to preferentially target a variety of target cells, including, but not limited to, hepatocytes, epithelial cells, hematopoietic cells, epithelial cells, endothelial cells, lung cells, bone cells, stem cells, mesenchymal cells, neural cells (e.g., meningeal, astrocyte, motor neurons, cells of the dorsal root ganglion and anterior horn motor neurons), photoreceptor cells (e.g., rods and cones), retinal pigment epithelial cells, secretory cells, cardiac cells, adipocytes, vascular smooth muscle cells, cardiac myocytes, skeletal muscle cells, beta cells, pituitary cells, synovial lineage cells, ovarian cells, testicular cells, fibroblasts, B cells, T cells, reticulocytes, leukocytes, granulocytes, and tumor cells.
[0083] For example, one or more lipid nanoparticles comprising the pharmaceutical or liposomal compositions disclosed herein. After transfection of one or more target cells with polynucleotides encapsulated in nanoparticles, production of the product (e.g., polypeptide or protein) encoded by such polynucleotides can be preferably stimulated, enhancing the ability of such target cells to express the polynucleotides and, e.g., produce the polypeptide or protein of interest. For example, transfection of target cells with one or more compounds or pharmaceutical compositions that encapsulate mRNA enhances (i.e., increases) production of the protein or enzyme encoded by such mRNA.
[0084] In some embodiments, it may be desirable to restrict transfection of polynucleotides to certain cells or tissues. For example, the liver represents an important target organ for the compositions of the present invention, in part due to its central role in metabolism and protein production; therefore, diseases resulting from abnormalities in liver-specific gene products (e.g., urea cycle disorders) may benefit from specific targeting of cells (e.g., hepatocytes). Accordingly, in certain embodiments of the present invention, the structural properties of target tissues can be exploited to direct the distribution of pharmaceutical and liposomal compositions of the present invention (e.g., lipid nanoparticles based on HGT4001) directly into such target tissues. For example, to target hepatocytes, one or more of the lipid nanoparticles comprising the pharmaceutical or liposomal compositions described herein can be sized such that their dimensions are smaller than the fenestrations of the hepatic sinusoids in the endothelial layer of the liver; thus, such lipid nanoparticles can easily penetrate such endothelial fenestrations and reach the target hepatocytes. Alternatively, the lipid nanoparticles can be sized such that the liposomes are of a diameter sufficient to limit or specifically avoid distribution within certain cells or tissues. For example, lipid nanoparticles containing the pharmaceutical and liposomal compositions described herein can be sized so that their diameter is larger than the fenestrations of the hepatic sinusoids lining the endothelial layer, thereby limiting the distribution of the liposomal lipid nanoparticles to stem cells. In such embodiments, the larger liposomal compositions (e.g., lipid nanoparticles) will not readily penetrate the endothelial fenestrations and instead will be removed by macrophage Kupffer cells lining the hepatic sinusoids. Thus, sizing lipid nanoparticles containing, for example, pharmaceutical compositions can provide an opportunity to further manipulate and precisely control the extent to which expression of the encapsulated polynucleotide can be enhanced in one or more target cells. Generally, the size of at least one of the lipid nanoparticles containing the pharmaceutical and liposomal compositions of the present invention is within the range of about 25-250 nm, preferably less than about 250 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, 50 nm, 25 nm, or 10 nm.
[0085] Similarly, the compositions of the present invention can be prepared to be preferentially distributed to other target tissues, cells or organs, such as heart, lung, kidney, spleen, etc. For example, lipid nanoparticles of the present invention can be prepared to achieve enhanced delivery to target cells and tissues.Therefore, the compositions of the present invention can be enriched with additional cationic, non-cationic and PEG-modified lipids to further target tissue or cell.
[0086] In some embodiments, the compounds and pharmaceutical and liposomal compositions (e.g., lipid nanoparticles based on HGT4002) described herein are distributed to liver cells and tissues to enhance delivery, transfection, and subsequent expression by liver cells and tissues of polynucleotides (e.g., mRNA) encapsulated therein, and the corresponding production of polypeptides or proteins encoded by such polynucleotides. While such compositions are preferentially distributed within liver cells and tissues, the therapeutic effect of the expressed polynucleotides and subsequent production of the proteins encoded thereby need not be restricted to the targeted cells and tissues. For example, targeted stem cells may express or produce functional proteins or enzymes, such as those disclosed in International Application No. PCT / US2010 / 058457 and U.S. Provisional Application No. 61 / 494,881 (the teachings of which are both incorporated herein by reference in their entireties), and serve as "reservoirs" capable of being excreted systemically or peripherally. " or "depot." Thus, in certain embodiments of the present invention, one or more of the lipid nanoparticles (e.g., lipid nanoparticles based on HGT4005) comprising the pharmaceutical and liposomal compositions described herein can be targeted to hepatocytes and / or preferentially distributed to liver cells and tissues upon delivery. Following transfection of target stem cells with a polynucleotide encapsulated in one or more of such lipid nanoparticles, such polynucleotides are expressed (e.g., translated), and functional products (e.g., polypeptides or proteins) are secreted and distributed systemically where such functional products can exert a desired therapeutic effect.
[0087] Polynucleotides encapsulated in one or more of the compounds or pharmaceutical and liposomal compositions described herein can be delivered to and / or transfected into target cells or tissues. In some embodiments, the encapsulated polynucleotide can be expressed, and a functional polypeptide product produced (and in some cases secreted) by the target cell, thereby conferring beneficial properties to the target cell or tissue, for example. Such encapsulated polynucleotides can encode, for example, hormones, enzymes, receptors, polypeptides, peptides, or other proteins of interest. In certain embodiments, such encapsulated polynucleotides can also encode small interfering RNA (siRNA) or antisense RNA for the purpose of regulating or otherwise reducing or eliminating the expression of endogenous nucleic acids or genes. In certain embodiments, such encapsulated polynucleotides can be natural or recombinant in nature and can exert therapeutic activity using either sense or antisense mechanisms of action (e.g., by modulating the expression of a target gene or nucleic acid).
[0088] In some embodiments, the encapsulated polynucleotide (e.g., an mRNA encoding a deficiency protein) optionally includes chemical or biological modifications that, for example, improve the stability and / or half-life of such polynucleotide, or that improve or otherwise facilitate translation of such polynucleotide.
[0089] It is also contemplated herein that the compounds or pharmaceutical and liposomal compositions described herein can co-deliver one or more unique polynucleotides to target cells, for example, by combining two unique therapeutic agents or polynucleotides in a single lipid nanoparticle. It is also contemplated that one or more encapsulated polynucleotides can be delivered to one or more target cells to treat a single disorder or deficiency, with each such polynucleotide functioning by a different mechanism. For example, a pharmaceutical or liposomal composition of the present invention can contain, for example, a first polynucleotide encapsulated in a lipid nanoparticle and intended to correct an endogenous protein or enzyme deficiency, and a second polynucleotide intended to inactivate or "knockdown" the dysfunctional endogenous polynucleotide and its protein or enzyme product. Such encapsulated polynucleotides can encode, for example, mRNA and siRNA.
[0090] Although ex vivo transcribed polynucleotides (e.g., mRNA) can be transfected into target cells, such polynucleotides can be readily and efficiently degraded by cells in vivo, thereby rendering such polynucleotides ineffective. Furthermore, some polynucleotides are unstable in body fluids (particularly human serum) and may be degraded or digested before reaching the target cells. Additionally, within cells, naturally occurring mRNA may decay with a half-life of 30 minutes to several days. Thus, in certain embodiments, the encapsulated polynucleotides provided herein, particularly the mRNA polynucleotides provided herein, preferably retain at least some ability to be expressed or translated within one or more target cells, thereby producing a functional protein or enzyme.
[0091] In certain embodiments, pharmaceutical and liposomal compositions comprise one or more lipid compounds disclosed herein and one or more lipid nanoparticles containing or encapsulating one or more stable polynucleotides (e.g., mRNA stabilized against in vivo nuclease digestion or degradation) that regulate gene expression or can be expressed or translated to produce a functional polypeptide or protein in one or more target cells. In certain embodiments, the activity of such encapsulated polynucleotides (e.g., mRNA encoding a functional protein or enzyme) is extended over an extended period of time. For example, the activity of the polynucleotide is extended so that the pharmaceutical composition can be administered to a subject semiweekly or biweekly, or more preferably monthly, bimonthly, quarterly, or yearly. The extended or prolonged activity of pharmaceutical compositions of the present invention, particularly encapsulated mRNA, is directly related to the amount of functional protein or enzyme translated from such mRNA. Similarly, the activity of compositions of the present invention can be further extended or prolonged by chemical modifications to further improve or enhance translation of the mRNA polynucleotide. For example, Kozak consensus sequences are involved in the initiation of protein translation, and including such Kozak consensus sequences in encapsulated mRNA polynucleotides can further extend or prolong the activity of the mRNA polynucleotide. Furthermore, the amount of functional protein or enzyme produced by a target cell is a function of the amount of polynucleotide (e.g., mRNA) delivered to the target cell and the stability of such polynucleotide. To the extent that the stability of polynucleotides encapsulated by the compounds or compositions of the present invention can be improved or enhanced, the half-life, activity of the translated protein or enzyme, and administration frequency of the compound can be further extended.
[0092] In certain embodiments, a polynucleotide may be chemically modified to confer stability (e.g., relative to a wild-type or naturally occurring form of mRNA and / or relative to a form of mRNA naturally endogenous to a target cell). Thus, in some embodiments, the encapsulated polynucleotides provided herein comprise at least one chemical modification that confers increased or enhanced stability to the polynucleotide, including, for example, improved resistance to nuclease digestion in vivo. As used herein, the phrases "chemically modified" and "chemically modified," when such terms refer to a polynucleotide provided herein, preferably enhance stability and include at least one alteration that confers stability (e.g., resistance to nuclease digestion) relative to a wild-type or naturally occurring form of that polynucleotide. The terms "stable" and "stability," when such terms refer to polynucleotides encapsulated by the compounds or pharmaceutical and liposomal compositions of the invention, particularly when referring to mRNA, refer to increased or enhanced resistance to degradation by nucleases (i.e., endonucleases or exonucleases) that are normally capable of degrading such RNA. Increased stability can include, for example, reduced susceptibility to hydrolysis or other destruction by endogenous enzymes (e.g., endonucleases or exonucleases) or conditions within the target cell or tissue, thereby increasing or enhancing the resistance of such polynucleotides in the target cell, tissue, subject, and / or cytoplasm. The stabilized polynucleotide molecules provided herein exhibit a longer half-life than their naturally occurring, unmodified counterparts (e.g., wild-type forms of the polynucleotide).
[0093] Alterations that improve or enhance translation of mRNA polynucleotides, including, for example, the inclusion of sequences that function in protein translation initiation (e.g., Kozak consensus sequences), are also contemplated by the phrases "chemical modification" and "chemically modified" when such terms refer to polynucleotides encapsulated by the compounds or pharmaceutical and liposomal compositions of the present invention. (Kozak, M., Nucleic Acids Res 15(20):8125-48(1987)). As used herein, the phrase "chemical modification" refers to a modification that introduces chemicals that differ from those found in naturally occurring polynucleotides, such as the introduction of modified nucleotides (e.g., nucleotide analogs, or the like) to modify such polynucleotides. Covalent modifications, such as the inclusion of pendant groups not naturally found in the molecule, are also included. In some embodiments, polynucleotides are chemically or biologically modified to render them more stable prior to encapsulation in one or more lipid nanoparticles. Exemplary chemical modifications to polynucleotides include base deletion (e.g., by deleting a nucleotide or by substituting one nucleotide for another) or chemical modification of a base.
[0094] Additionally, suitable modifications include altering one or more nucleotides of a codon so that the codon encodes the same amino acid but is more stable than the codon found in the wild-type form of the polynucleotide. For example, an inverse relationship between RNA stability and a high number of cytidine (C) and / or uridine (U) residues has been demonstrated, and RNA lacking C and U residues has been found to be stable against most RNases (Heidenreich, et al. J Biol Chem 269, 2131-8 (1994)). In some embodiments, the number of C and / or U residues in an mRNA sequence is reduced. In another embodiment, the number of C and / or U residues is reduced by substituting one codon encoding a specific amino acid with another codon encoding the same or a related amino acid. Modifications contemplated for mRNA polynucleotides encapsulated by the compounds or pharmaceutical and liposomal compositions of the present invention also include the incorporation of pseudouridine. Incorporation of pseudouridine into the mRNA polynucleotide encapsulated by the compounds or pharmaceutical and liposomal compositions of the present invention can enhance stability and translation ability, as well as reduce immunogenicity in vivo. (See, for example, Kariko', K., et al., Molecular Therapy 16(11):1833-1840(2008)). Substitutions and modifications to the polynucleotide encapsulated by the compounds or pharmaceutical and liposomal compositions of the present invention can be easily performed by methods known to those skilled in the art.
[0095] The limitations on reducing the number of C and U residues in a sequence may be greater in the coding region of an mRNA compared to the untranslated region (i.e., it may be impossible to eliminate all of the C and U residues present in a message while still maintaining the message's ability to encode the desired amino acid sequence). However, the degeneracy of the genetic code presents opportunities to reduce the number of C and / or U residues present in a sequence while retaining the same coding capacity (i.e., depending on which amino acids are encoded by the codons, several different possibilities for modifying the RNA sequence may be possible). For example, the codon for Gly can be changed to GGA or GGG instead of GGU or GGC.
[0096] The term "chemical modification" also includes, for example, the incorporation of non-nucleotide linkages or modified nucleotides into the polynucleotide sequences of the invention (e.g., end-blocking modifications to one or both of the 3' and 5' ends of an mRNA molecule encoding a functional protein or enzyme). Such modifications can include the addition of bases to the polynucleotide sequence (e.g., inclusion of polyA tails or longer polyA tails), alteration of the 3' or 5' UTR, conjugation of the polynucleotide with an agent (e.g., a protein or complementary polynucleotide molecule), and the inclusion of elements that alter the structure of the polynucleotide molecule (e.g., to form secondary structures).
[0097] Poly A tails are thought to stabilize natural messenger and synthetic sense RNA. Thus, in one embodiment, a long poly A tail can be added to an mRNA molecule, thereby conferring greater stability to the RNA. Poly A tails can be added using a variety of art-recognized techniques. For example, long poly A tails can be added to synthetic or in vitro transcribed RNA using poly A polymerase (Yokoe, et al., Nature Biotechnology. 1996;14:1252-1256). Transcription vectors can also encode long poly A tails. In addition, poly A polymerases can be added to synthetic or in vitro transcribed RNA (Yokoe, et al., Nature Biotechnology. 1996;14:1252-1256). A polyA tail can be added by direct transcription from a PCR product. PolyA can also be ligated to the 3' end of a sense RNA using RNA ligase (see, e.g., Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch, and Maniatis (Cold Spring Harbor Laboratory Press: 1991 edition)). In certain embodiments, the length of the polyA tail is at least about 90, 200, 300, 400, or at least 500 nucleotides. In certain embodiments, the length of the polyA tail is adjusted to control the stability of the modified sense mRNA molecules of the present invention and thus protein transcription. For example, because the length of the polyA tail can affect the half-life of the sense mRNA molecule, the length of the polyA tail can be adjusted to alter the level of resistance of the mRNA to nucleases, thereby controlling the elapsed time of polynucleotide expression and protein production in target cells. In certain embodiments, the stabilized polynucleotide molecules are sufficiently resistant to degradation in vivo (e.g., by nucleases) that they can be delivered to target cells without lipid nanoparticles.
[0098] In some embodiments, the chemical modification is a terminal blocking modification of one or more polynucleotides comprising the pharmaceutical composition of the present invention. For example, such polynucleotides can be modified by incorporating 3' and / or 5' untranslated (UTR) sequences that are not naturally found in wild-type polynucleotides. In some embodiments, 3' and / or 5' adjacent sequences that naturally flank mRNA and encode a second, unrelated protein can be incorporated into the nucleotide sequence of an mRNA molecule encoding a protein or functional protein to modify it. For example, 3' or 5' sequences from a stable mRNA molecule (e.g., globin, actin, GAPDH, tubulin, histone, or citric acid cycle enzyme) can be incorporated into the 3' and / or 5' region of a sense mRNA polynucleotide molecule to increase the stability of the sense mRNA molecule.
[0099] Modifications to polynucleotide sequences made to one or both of the 3' and 5' ends of the polynucleotide are also contemplated by the present invention. For example, the present invention contemplates modifications to the 3' and / or 5' ends of a polynucleotide (e.g., mRNA) that include a subsequence of the CMV immediate early 1 (IE1) gene or a fragment thereof to improve nuclease resistance and / or improve the half-life of the polynucleotide (e.g., SEQ ID NO: 1). In addition to increasing the stability of the mRNA polynucleotide sequence, it has surprisingly been found that including a subsequence of the CMV immediate early 1 (IE1) gene (e.g., in one or more of the 5' and 3' untranslated regions of the mRNA) further enhances translation of the mRNA. It is also contemplated that a sequence from the human growth hormone (hGH) gene or a fragment thereof may be included in one or both of the 3' and 5' ends of a polynucleotide (e.g., mRNA) to further stabilize the polynucleotide (e.g., SEQ ID NO: 2). Generally, contemplated chemical modifications include modifications made to improve the stability and / or pharmacokinetic properties (e.g., half-life) of a polynucleotide relative to its unmodified counterpart, e.g., to improve the resistance of such polynucleotides to nuclease digestion in vivo.
[0100] In some embodiments, the pharmaceutical composition, the two or more lipid nanoparticles contained therein, or the polynucleotide encapsulated by such lipid nanoparticles may contain a stabilizing reagent. The composition may contain one or more formulation reagents that directly or indirectly bind to the polynucleotide and stabilize the polynucleotide, thereby enhancing its residence time in the cytoplasm of the target cell. Such reagents preferably result in improved half-life of the polynucleotide in the target cell. For example, mRNA stability and translation efficiency can be increased by incorporating a "stabilizing reagent" that forms a complex with naturally occurring polynucleotides (e.g., mRNA) in the cell (see, e.g., U.S. Patent No. 5,677,124). Incorporation of a stabilizing reagent can be achieved, for example, by incorporating an mRNA into one or more lipid nanoparticles comprising the pharmaceutical composition. This can be achieved by combining polyA and proteins with the mRNA to be stabilized in vitro before loading or encapsulating the NA. Exemplary stabilization reagents include one or more proteins, peptides, aptamers, translational accessory proteins, mRNA-binding proteins, and / or translation initiation factors.
[0101] Stabilization of the pharmaceutical and liposomal compositions (e.g., lipid nanoparticles) described herein can also be improved by the use of opsonization-inhibiting moieties, typically large hydrophilic polymers, that are chemically or physically bound or otherwise incorporated into the lipid nanoparticles (e.g., by inserting a lipid-soluble anchor into the membrane itself or by directly binding to active groups on membrane lipids). These opsonization-inhibiting hydrophilic polymers form a protective surface layer that significantly reduces liposome uptake by the macrophage-monocyte system and the reticuloendothelial system (e.g., as described in U.S. Pat. No. 4,920,016, the disclosure of which is incorporated herein by reference). For example, delay in lipid nanoparticle uptake by the reticuloendothelial system can be facilitated by adding a hydrophilic polymer surface coating onto or within the lipid nanoparticles to shield the recognition and uptake of liposome-based lipid nanoparticles by the reticuloendothelial system. For example, in certain embodiments, one or more of the lipid nanoparticles comprising the pharmaceutical compositions disclosed herein comprise a polyethylene glycol (PEG) polymer or a PEG-modified lipid to further enhance delivery of such lipid nanoparticles to target cells and tissues.
[0102] When RNA hybridizes to a complementary polynucleotide molecule (e.g., DNA or RNA), it can be protected from nucleases. (Krieg, et al. Melton. Methods in Enzymology. 1987; 155, 397-415). The stability of hybridized mRNA is likely due to the inherent single-strand specificity of most RNases. In some embodiments, the stabilizing reagent selected to complex the polynucleotide is a eukaryotic protein (e.g., a mammalian protein). In yet another embodiment, a polynucleotide (e.g., mRNA) used in sense therapy can be modified by hybridizing it to a second polynucleotide molecule. When the entire mRNA molecule hybridizes to a complementary polynucleotide molecule, translation initiation can be reduced. In some embodiments, the 5' untranslated region and AUG initiation region of the mRNA molecule can optionally remain unhybridized. After translation initiation, the unwinding activity of the ribosome complex can function on the high-affinity duplex to allow translation to proceed. (Liebhaber. J. Mol. Biol. 1992;226:2-13; Monia, et al. J Biol Chem. 1993;268:14514-22.) It is understood that any of the above-described methods for enhancing polynucleotide stability can be used alone or in combination with one or more of any of the other above-described methods and / or compositions.
[0103] In certain embodiments, the pharmaceutical compositions of the present invention enhance delivery of lipid nanoparticle-encapsulated polynucleotides to one or more target cells, tissues, or organs. In some embodiments, enhancing delivery to one or more target cells comprises increasing the amount of polynucleotide contacting or otherwise delivered to the target cells. In some embodiments, enhancing delivery to target cells comprises decreasing the amount of polynucleotide contacting non-target cells. In some embodiments, enhancing delivery to target cells comprises transfecting at least some of the target cells with the encapsulated polynucleotide. In some embodiments, the expression level of polynucleotides encapsulated by lipid nanoparticles comprising the pharmaceutical compositions and the corresponding products of functional proteins or enzymes encoded thereby is increased in the target cells.
[0104] Polynucleotides encapsulated by the compounds or pharmaceutical and liposome compositions of the present invention The polynucleotide may optionally be combined with a reporter gene (e.g., upstream or downstream of the coding region of the polynucleotide) to facilitate determination of delivery of the polynucleotide to target cells or tissues. Suitable reporter genes may include, for example, green fluorescent protein mRNA (GFP mRNA), Renilla luciferase mRNA (luciferase mRNA), firefly luciferase mRNA (SEQ ID NO: 1), or any combination thereof. For example, GFP mRNA may be fused with a polynucleotide encoding OTC mRNA to facilitate confirmation of mRNA localization in target cells, tissues, or organs.
[0105] In some embodiments, the pharmaceutical compositions of the present invention comprise one or more additional molecules (e.g., proteins, peptides, aptamers, or oligonucleotides) that facilitate the transfer of polynucleotides (e.g., mRNA, miRNA, snRNA, and snoRNA) from lipid nanoparticles to intracellular compartments of target cells. In some embodiments, the additional molecules facilitate delivery of the polynucleotides, for example, into the cytosol, lysosomes, mitochondria, nucleus, nucleolus, or proteasomes of the target cells. Also included are agents that facilitate the transport of a translated protein of interest from the cytoplasm to its normal intracellular location (e.g., in mitochondria) to treat a deficiency in that organelle. In some embodiments, the agent is selected from the group consisting of proteins, peptides, aptamers, and oligonucleotides.
[0106] In some embodiments, the compositions of the present invention facilitate the endogenous production of one or more functional proteins and / or enzymes in a subject, particularly proteins and / or enzymes that exhibit reduced immunogenicity relative to their recombinantly prepared counterparts. In certain embodiments of the present invention, lipid nanoparticles contain a polynucleotide encoding an mRNA for a deficient protein or enzyme. When such compositions are distributed to a target tissue and subsequently transfected into such target cells, the exogenous mRNA loaded or encapsulated within the lipid nanoparticles containing the composition can be translated in vivo to produce the functional protein or enzyme encoded by the encapsulated mRNA (e.g., the protein or enzyme for which the subject is deficient). Thus, in certain embodiments, the compositions of the present invention utilize the subject's ability to use exogenously or recombinantly prepared mRNA to produce the exogenously translated protein or enzyme, thereby producing (and, if applicable, excreting) the functional protein or enzyme. The translated protein or enzyme may also be characterized as containing native post-translational modifications that are often absent in recombinantly prepared proteins or enzymes, thereby further reducing the immunogenicity of the translated protein or enzyme.
[0107] Encapsulation of mRNA within lipid nanoparticles and administration of pharmaceutical compositions containing such lipid nanoparticles avoids the need to deliver mRNA to specific organelles (e.g., mitochondria) within target cells. Rather, upon transfection of the target cell and delivery of the encapsulated mRNA to the cytoplasm of the target cell, the mRNA content of the lipid nanoparticles can be translated to produce a functional protein or enzyme.
[0108] The present invention also contemplates the differential targeting of one or more target cells and tissues by both passive and active targeting means.The phenomenon of passive targeting utilizes the natural distribution pattern of lipid nanoparticles in vivo, without relying on the use of additional excipients to enhance the recognition of lipid nanoparticles by one or more target cells.For example, lipid nanoparticles that are phagocytosed by cells of the reticuloendothelial system are likely to accumulate in the liver or spleen, thus providing a means for passively inducing the delivery of compositions to such target cells.
[0109] Alternatively, the present invention provides a method for binding (covalently or non-covalently) lipid nanoparticles to facilitate the localization of such lipid nanoparticles in certain target cells or tissues. Active targeting is contemplated, involving the use of additional excipients, referred to herein as "targeting ligands," that can enhance the affinity of the composition to one or more target cells. For example, targeting can be mediated by including one or more endogenous targeting ligands (e.g., apolipoprotein E) on or in the lipid nanoparticle to facilitate distribution to target cells or tissues. Recognition of the targeting ligand by the target tissue actively facilitates tissue distribution and cellular uptake of the lipid nanoparticle and / or its contents by the target cells and tissues. For example, in certain embodiments, one or more of the lipid nanoparticles comprising a pharmaceutical formulation can include an apolipoprotein E targeting ligand on or in the lipid nanoparticle that facilitates or promotes recognition of the lipid nanoparticle and binding to an endogenous low-density lipoprotein receptor, for example, expressed by hepatocytes. The compositions provided herein can include a ligand capable of enhancing the affinity of the composition to one or more target cells. The targeting ligand can be linked to the outer bilayer of the lipid nanoparticle during or after formulation. These methods are known in the art. In addition, some lipid nanoparticles may contain membrane-fusogenic polymers such as PEAA, hemagglutinin, other lipopeptides (see U.S. Patent Application Nos. 08 / 835,281 and 60 / 083,294, incorporated herein by reference), and other features useful for in vivo and / or intracellular delivery. In other embodiments, the compositions of the present invention exhibit improved transfection efficiency and / or enhanced selectivity for target cells or tissues of interest. Thus, compositions or lipid nanoparticles containing one or more ligands (e.g., peptides, aptamers, oligonucleotides, vitamins, or other molecules) capable of enhancing the affinity of the composition or its component lipid nanoparticles and their polynucleotide content for one or more target cells or tissues are contemplated. Suitable ligands may optionally be bound or linked to the surface of the lipid nanoparticle. In some embodiments, the targeting ligand may extend to the surface of the lipid nanoparticle or be encapsulated within the lipid nanoparticle. Suitable ligands are selected based on their physical, chemical, or biological properties (e.g., selective affinity and / or recognition of target cell surface markers or features).The cell-specific targeting moiety and its corresponding targeting ligand can vary widely. Suitable targeting ligands are selected so that the unique properties of the target cells are utilized, thereby enabling the composition to distinguish target cells from non-target cells. For example, the compositions of the present invention may have a surface marker (e.g., apolipoprotein-B or apolipoprotein-E) that selectively enhances recognition of or affinity for hepatocytes (e.g., by receptor-mediated recognition of and binding to such surface markers). In addition, the use of galactose as a targeting ligand is expected to target the compositions of the present invention to parenchymal hepatocytes, or alternatively, the use of mannose containing sugar residues as a targeting ligand (e.g., mannose containing sugar residues that can preferentially bind to the asialoglycoprotein receptor present on hepatocytes) is expected to target the compositions of the present invention to liver endothelial cells. (Hillery, 1999). (See AM, et al. "Drug Delivery and Targeting: For Pharmacists and Pharmaceutical Scientists" (2002) Taylor & Francis, Inc.). Thus, the presence of such targeting ligands conjugated to moieties present on lipid nanoparticles facilitates recognition or uptake of the liposome compositions of the present invention by one or more target cells and tissues. Examples of suitable targeting ligands include one or more peptides, proteins, aptamers, vitamins, and oligonucleotides.
[0110] As used herein, the term "subject" refers to any animal (e.g., mammal) to which the compounds, pharmaceutical or liposomal compositions and methods of the invention can be administered, including, but not limited to, humans, non-human primates, rodents, etc. Typically, the terms "subject" and "patient" are used interchangeably herein in reference to a human subject.
[0111] Expression of polynucleotides and production of polypeptides or proteins encapsulated in the compounds and pharmaceutical or liposomal compositions (e.g., lipid nanoparticles) described herein The ability to regulate or enhance the expression of HGT4004 provides a new, more efficient means of generating endogenous polypeptides and proteins for the treatment of a host of diseases or pathological conditions. Such lipid nanoparticle compositions are particularly suitable for treating diseases or pathological conditions associated with the abnormal expression of nucleic acids encoding proteins or enzymes. For example, successful delivery of polynucleotides, such as mRNA, to target organs, such as the liver, particularly stem cells, can be used to treat and correct liver-localized inborn errors of metabolism. Thus, the compounds, pharmaceutical compositions, and related methods described herein can be employed to treat a wide range of diseases and pathological conditions, particularly those caused by protein or enzyme deficiency. Polynucleotides encapsulated by the compounds or pharmaceutical and liposomal compositions described herein (e.g., lipid nanoparticles based on HGT4004) can encode functional products (e.g., proteins, enzymes, polypeptides, peptides, functional RNA, and / or antisense molecules), preferably products whose endogenous production is desired.
[0112] The compounds, pharmaceutical compositions, and related methods of the present invention are broadly applicable to the delivery of therapeutic agents such as polynucleotides, particularly mRNA, to treat numerous disorders. In particular, such compounds, compositions, and related methods of the present invention are suitable for the treatment of diseases or disorders associated with protein and / or enzyme deficiencies. In certain embodiments, the lipid nanoparticle-encapsulated polynucleotide encodes a functional protein or enzyme that is excreted or secreted by one or more target cells into the surrounding extracellular fluid (e.g., mRNA encoding hormones and neurotransmitters). Alternatively, in other embodiments, the polynucleotide encapsulated by the compounds or pharmaceutical and liposomal compositions of the present invention encodes a functional protein or enzyme that remains in the cytosol of one or more target cells (e.g., mRNA encoding an enzyme associated with the urea cycle or lysosomal storage metabolic disorders).Other disorders for which the compounds, pharmaceutical compositions, and related methods of the invention are useful include disorders such as SMN1-associated spinal muscular atrophy (SMA), amyotrophic lateral sclerosis (ALS), GALT-associated galactosemia, cystic fibrosis (CF), SLC3A1-associated disorders (including cystinuria), COL4A5-associated disorders (including Alport syndrome), galactocerebrosidase deficiency, X-linked adrenoleukodystrophy and adrenomyeloneuropathy, Huntington's disease, Parkinson's disease, muscular dystrophies (e.g., Duchenne and Becker), hemophilic disorders (e.g., hemophilia B (FIX) and hemophilia A (FVIII)), Friedreich's ataxia, Pelizaeus-Merzbacher disease, TSC1- and TSC2-associated tuberous sclerosis, Sanfilippo B syndrome (MPS), and others. IIIB), CTNS-associated cystinosis, FMR1-associated disorders (including Fragile X syndrome, Fragile X-associated tremor / ataxia syndrome, and Fragile X premature ovarian failure syndrome), Prader-Willi syndrome, Fabry disease, hereditary hemorrhagic peripheral telangiectasia (AT), Niemann-Pick disease type C1, neuronal ceroid lipofuscinosis-associated disorders (including juvenile neuronal ceroid lipofuscinosis (JNCL), juvenile Batten disease, Santavuori-Haltia disease, Jansky-Bielschowsky disorder, and PTT-1 and TPP1 deficiency), EIF2B1-, EIF2B2-, EIF2B3-, EIF2B4-, and EIF2B5-associated childhood ataxia with central nervous system hypomyelinogenesis / white matter annihilation, CACNA1A and and CACNB4-associated paroxysmal ataxia type 2, MECP2-associated disorders (including classic Rett syndrome), MECP2-associated severe neonatal encephalopathy and PPM-X syndrome, CDKL5-associated variant Rett syndrome, Kennedy disease (SBMA), autosomal dominant cerebral arteriopathy with Notch3-associated subcortical infarcts and leukoencephalopathy (CADASIL), SCN1A- and SCN1B-associated seizure disorders, polymerase G-associated disorders (including Alpers-Huttenlocher syndrome, POLG-associated sensory ataxic neuropathy, dysarthria, and ophthalmoplegia), and autosomal dominant and recessive progressive external ophthalmoplegia with mitochondrial DNA deletions, X-linked adrenal dysgenesis, X-linked agammaglobulinemia, Wilson's disease, and Fabry disease.In certain embodiments, the polynucleotides, particularly mRNAs, of the present invention can encode functional proteins or enzymes. For example, the compositions of the present invention can encode agalsidase alpha, erythropoietin, alpha 1-antitrypsin, carboxypeptidase N, etc. The mRNA may include mRNA encoding α-L-iduronidase, iduronate-2-sulfatase, N-acetylglucosamine-1-phosphate transferase, N-acetylglucosaminidase, α-glucosaminide acetyltransferase, N-acetylglucosamine 6-sulfatase, N-acetylgalactosamine-4-sulfatase, β-glucosidase, galactose-6-sulfatase, β-galactosidase, β-glucuronidase, glucocerebrosidase, heparan sulfamidase, hyaluronidase, galactocerebrosidase, or human growth hormone.
[0113] The compounds and pharmaceutical compositions described herein can be administered to a subject. In some embodiments, the compositions are formulated in combination with one or more additional polynucleotides, carriers, targeting ligands, or stabilizing reagents, or other suitable excipients. Techniques for drug formulation and administration can be found in the latest edition of "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa.
[0114] The compounds and pharmaceutical and liposomal compositions (e.g., lipid nanoparticles) of the present invention may be administered and dosed in accordance with current medical practice, taking into account the subject's clinical condition, the nature of the encapsulated material, the site and method of administration, the administration schedule, the subject's age, sex, and weight, and other factors relevant to a clinician skilled in the art. For purposes herein, an "effective amount" may be determined by experimental clinical studies, pharmacology, and such relevant considerations known to those skilled in the medical field. In some embodiments, the amount administered is sufficient to achieve at least some stabilization, improvement, or elimination of symptoms and other indicators selected by those skilled in the art as appropriate treatment of disease progression, regression, or improvement. For example, a suitable amount and administration regimen is one that results in at least transient expression of one or more polynucleotides in target cells.
[0115] Suitable routes of administration of the compounds and pharmaceutical compositions disclosed herein include, for example, oral, rectal, vaginal, transmucosal, or intestinal administration, parenteral delivery (including intramuscular, subcutaneous, intramedullary injection, as well as intrathecal, intraventricular, direct intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injection or infusion). In some embodiments, administering a compound or composition described herein (e.g., lipid nanoparticles) to a subject facilitates contact of such compound or composition with one or more target cells, tissues, or organs.
[0116] Alternatively, the compounds and compositions of the present invention can be administered in a local rather than systemic manner, for example, via direct injection or infusion of the pharmaceutical composition into the target tissue, preferably in a depot or sustained-release formulation, to further facilitate access to the lipid nanoparticles that comprise the target cells. Local delivery can be influenced in various ways depending on the tissue being targeted. For example, aerosols containing the compositions of the present invention can be inhaled (for nasal, tracheal, or bronchial delivery), compositions of the present invention can be injected, for example, into the site of a wound, disease symptom, or pain, compositions can be provided in a lozenge for oral, tracheal, or esophageal administration, can be provided in the form of a liquid, tablet, or capsule for administration to the stomach or intestine, can be provided in suppository form for rectal or vaginal administration, or can be delivered to the eye using a cream, drops, or even injection. Formulations containing compounds of the present invention conjugated to therapeutic molecules or ligands can also be administered surgically, for example, in association with polymers or other structures or substances that allow the composition to diffuse from the site of implantation to surrounding cells. Alternatively, such compositions can be applied surgically without the use of a polymer or support.
[0117] In certain embodiments, the compositions of the present invention are formulated so that they are suitable for sustained release of, for example, polynucleotides or nucleic acids encapsulated therein. Such sustained release compositions are , or at extended intervals. For example, in some embodiments, the compositions of the present invention are administered to a subject twice a day, once a day, or every two days. In some embodiments, the compositions of the present invention are administered to a subject twice a week, once a week, once every 10 days, once every two weeks, once every three weeks, or preferably once every four weeks, once a month, once every six weeks, once every eight weeks, once every two months, once every three months, once every four months, once every six months, once every eight months, once every nine months, or once a year. Compositions and lipid nanoparticles formulated for depot administration (e.g., intramuscular, subcutaneous, intravitreal) are also contemplated for delivering or releasing polynucleotides (e.g., mRNA) over an extended period of time. Preferably, the sustained release means employed is combined with modifications (e.g., chemical modifications) introduced into the polynucleotide to enhance stability.
[0118] While certain compounds, compositions, and methods of the present invention have been specifically described in accordance with certain embodiments, the following examples merely serve to illustrate the compounds of the present invention and are not intended to limit it. Each of the publications, references, etc. referred to in describing the background of the invention and providing additional details regarding its practice is incorporated herein by reference in its entirety. Lyophilized lipid delivery vehicles
[0119] The present invention provides pharmaceutical compositions comprising lyophilized liposome delivery vehicles and liposome formulations capable of delivering encapsulated contents (e.g., polynucleotides) to one or more target cells, tissues, or organs. For example, upon delivery of encapsulated polynucleotides to one or more target cells, such polynucleotides can modulate (e.g., increase) expression of polynucleotides or nucleic acids in the target cells. Also disclosed herein are related methods and processes for preparing such pharmaceutical compositions, as well as methods for treating one or more diseases or conditions by administering such pharmaceutical compositions to a subject in need thereof. The lyophilized compositions (e.g., lipid nanoparticles) described herein are also expected to have improved long-term stability (e.g., at least 1, 2, 3, 6, 9, 12, 18, 24, 30 months or more) when stored either refrigerated or at ambient temperature (e.g., room temperature).
[0120] The terms "lyophilization" and "lyophilized," as used herein to refer to liposome compositions (e.g., lipid nanoparticles), refer to a process by which such liposome compositions are prepared in a dry form by rapid freezing, and in some cases by one or more drying steps (e.g., by exposure to vacuum conditions), thereby reducing the concentration of water in such liposome compositions in order to eliminate or otherwise limit further biological or chemical reaction.
[0121] Lyophilization of liposome compositions (e.g., lipid nanoparticles) can be carried out by any suitable method, for example, according to the lyophilization cycle provided in the Examples. After quick-freezing of the liposome compositions (e.g., lipid nanoparticles), the liposome compositions can be dried by one or more suitable methods, such as exposure to primary or secondary vacuum drying conditions. In some embodiments, the liposome compositions (e.g., lipid nanoparticles) are dried at the temperature and vacuum conditions provided in the embodiments. After exposure to the lyophilization conditions described herein, the lyophilized lipid nanoparticle compositions can be rehydrated, for example, using a suitable aqueous rehydration medium (e.g., sterile water, normal saline, and / or 5% dextrose), and administered to a subject.
[0122] In certain embodiments, the lyophilized pharmaceutical compositions described herein are characterized as being stable (e.g., relative to non-lyophilized pharmaceutical compositions). The term "stable," as used to describe the lyophilized liposomal compositions described herein, refers to the ability of such liposomal compositions (e.g., lipid nanoparticles) to aggregate or flocculate ( The stability of such lyophilized pharmaceutical compositions is determined with reference to a number of physical properties. For example, stability can be determined with reference to the particle size of lipid nanoparticles comprising such compositions. Preferably, after rehydration of a lyophilized composition disclosed herein, the size distribution and physical properties of the reconstituted composition are the same as or otherwise comparable to those of the composition before lyophilization. Thus, in certain embodiments, lyophilization of lipid nanoparticles does not appreciably change or alter the particle size of the lipid nanoparticles after lyophilization and / or reconstitution. For example, upon reconstitution (with purified water), the lipid nanoparticles comprising the lyophilized pharmaceutical composition do not aggregate or agglomerate, or alternatively, exhibit limited or negligible aggregation or agglomeration (e.g., as determined by the particle size of the reconstituted lipid nanoparticles).
[0123] In certain embodiments, the reconstituted liposome compositions (e.g., lipid nanoparticles) of the present invention exhibit an enhanced (e.g., increased) ability to transfect one or more target cells. Accordingly, methods of transfecting one or more target cells are also provided herein. Such methods generally include contacting one or more target cells with, for example, a reconstituted lyophilized pharmaceutical composition of the present invention (e.g., lyophilized HGT4003-based lipid nanoparticles encapsulating one or more polynucleotides), such that the one or more target cells are transfected with the encapsulated material (e.g., one or more polynucleotides).
[0124] In certain embodiments, one or more lipids (e.g., cationic lipids) may be used as liposomes or alternatively as components of lipid delivery vehicles (e.g., lipid nanoparticles) used in the compositions of the present invention. As mentioned above, suitable lipid delivery vehicles are lipid nanoparticles comprising a nucleic acid, a cationic lipid, such as, for example, a cleavable cationic lipid, such as, for example, HGT4001, HGT4002, HGT4003, HGT4004, and HGT4005 described above, or selected from the group consisting of C12-200, ICE, DOTMA, DOGS, DOSPA, DODAP, DOTAP, DSDMA, DODMA, DLinDMA, DLenDMA, DDAB, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, DLin-K-DMA, DLin-K-XTC2-DMA, DLinKC2-DMA, HGT5000, HGT5001, HGT5002, or a mixture thereof.
[0125] Other suitable components of lipid delivery vehicles include non-cationic lipids, helper lipids, such as cholesterol and PEG-modified lipids described above. For example, lipid nanoparticles can be prepared using HGT4003, DOPE, CHOL, and DMG-PEG2000. Lipid nanoparticles can be composed of various ratios of additional lipid combinations, including, for example, HGT4001, DOPE, and DMG-PEG2000. The selection of cationic lipids, non-cationic lipids, and / or PEG-modified lipids comprising lipid nanoparticles, and the relative molar ratios of such lipids to each other, are based on the properties of the selected lipid(s), the properties of the intended target cells or tissues, and the properties of the material or polynucleotide delivered by the lipid nanoparticle. Additional considerations include, for example, the saturation of alkyl chains, and the size, charge, pH, pKa, membrane fusogenicity, and toxicity of the selected lipid(s).
[0126] In one embodiment, the lyophilized lipid delivery vehicle further comprises at least one lyoprotectant. The term "lyoprotectant" is used herein to refer to one or more compounds that, when combined with or included in one or more preparations of the liposomal compounds described herein, enhance (e.g., increase) the chemical and / or physical stability of the liposomal compound (e.g., lipid nanoparticles) during lyophilization, storage, or reconstitution of such liposomal compound. For example, in some embodiments, the inclusion of one or more lyoprotectants in the lipid nanoparticles improves the stability (e.g., stability) of the lyophilized composition. The lyophilized composition may be reconstituted using a rehydration medium to improve or otherwise enhance its stability (e.g., under normal storage conditions) and / or facilitate reconstitution of the lyophilized composition, thereby preparing an aqueous formulation. In some embodiments, lipid nanoparticles are prepared, and prior to lyophilization, the buffer present in the liposomal formulation may be replaced (e.g., via centrifugation) with a suitable lyoprotectant (e.g., an aqueous sucrose solution containing about 1-50% or 10-25% sucrose). In some embodiments, the lyoprotectant is included as part of the buffer or medium in which the liposomal formulation is prepared or lyophilized (e.g., during hydration, diafiltration, and / or dilution). Examples of suitable lyoprotectants that can be used to prepare the lyophilized compositions described herein include, for example, trehalose, dextran (e.g., 1.5 kDa, 5 kDa, and / or 40 kDa), inulin (e.g., 1.8 kDa and / or 4 kDa), and any combination thereof.
[0127] It is believed that the inclusion of a sugar lyoprotectant during lyophilization may help stabilize the lyophilized composition. (See Anchordoquy, et al., J. Pharm. Sci. (2000) 89:289-296.) One possible explanation for the observed stabilization could be the particle isolation hypothesis, which refers to the formation of a sugar matrix that acts as a physical barrier between liposome particles.
[0128] The lyophilized pharmaceutical and component liposomes (such as lipid nanoparticles) used herein can be prepared by various techniques currently known in the art.Multilamellar vesicles (MLVs) can be prepared by conventional techniques, for example, by dissolving lipids in a suitable solvent, then evaporating the solvent, leaving a thin film on the inside of the vessel, or by spray-drying, by depositing selected lipids on the inner wall of a suitable container or vessel.Then, aqueous phase can be added to the vessel with vortex motion, which will result in the formation of MLVs.Unilamellar vesicles (ULVs) can then be formed by homogenization, sonication, or extrusion of multilamellar vesicles.In addition, unilamellar vesicles can be formed by detergent removal method.
[0129] As used herein and in the claims, the articles "a" and "an" should be understood to include plural referents unless expressly stated to the contrary. A claim or description including "or" between one or more members of a group is considered satisfied when one, more than one, or all group members are present in, employed in, or otherwise relevant to a given product or process, unless the contrary is stated or otherwise apparent from the context. The invention includes embodiments in which exactly one member of a group is present in, employed in, or otherwise relevant to a given product or process. The invention also includes embodiments in which two or more or all group members are present in, employed in, or otherwise relevant to a given product or process. Furthermore, the invention is understood to encompass all variations, combinations, and permutations of one or more limitations, elements, clauses, descriptive language, etc. from one or more of the enumerated claims that are introduced into another claim dependent on (or as any other related claim of) the same basic claim, unless otherwise stated or unless a contradiction or inconsistency would arise. Where elements are presented as a list (e.g., in the form of a Markush group or similar), it is understood that each subgroup of elements is also disclosed, and that any element(s) can be removed from the group. Generally, the invention or aspects of the invention are considered to include certain elements, features, etc., and it should also be understood that certain embodiments of the invention or aspects of the invention consist of, or consist essentially of, such elements, features, etc. For purposes of brevity, these embodiments will not be explicitly and specifically described herein in all instances. It should also be understood that any embodiment or aspect of the invention can be explicitly excluded from the claims, regardless of whether a specific exclusion is recited herein. Publications and other reference materials referenced to describe the background of the invention and to provide additional details regarding its practice are incorporated herein by reference. Example Example 1 - Preparation of HGT4001
[0130] The compound 5-(((10,13-dimethyl-17-(6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthrene-3-yl)disulfanyl)methyl)-1H-imidazole (imidazole-cholesterol disulfide) (referred to herein as "HGT4001") was prepared according to the general synthetic scheme shown below, depicted in Reaction 1. Reaction 1 [ka]
[0131] The intermediate compound 2-(((3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl)disulfanyl)pyridine (pyridylcholesterol disulfide), identified as compound (3), was prepared as follows: A solution containing 3.0 g (7.45 mmol) of compound (1) and 1.8 g (8.17 mmol) of compound (2) in chloroform (35 mL) was prepared and stirred at room temperature for 4 days. The solvent was evaporated, and methanol (50 mL) was added to the residue and evaporated. The resulting solid was suspended in methanol (50 mL) and stirred at room temperature overnight. The pyridyl cholesterol disulfide product (3) was collected by filtration, washed with methanol, and dried under high vacuum. Yield: 3.6 g (95%). 1 H NMR(300 MHz, CDCl3)δ8.43(m,1H), 7.76(m,1H), 7.62(m,1H), 7.05(m,1H), 5.32(bd,J=4Hz,1H), 2.75( m,1H), 2.35(d,J=8Hz,2H), 2.05-1.7(m,5H),1.7-1.2(m,8H), 1.2-0.8(m,25H),0.65(s,3H). MS(APCI,Pos):512(M+1).
[0132] The intermediate compound 4-((benzylthio)methyl)-1H-imidazole, identified as compound (6) in reaction 1, was prepared as follows: 12.15 g (123.9 mmol) of compound (4) and 15.5 ml (132 mmol) of A solution containing (5) was prepared and heated to reflux for 24 hours. The reaction mixture was allowed to cool overnight. The solvent was evaporated, and the residue was dissolved in chloroform (800 ml). The resulting solution was washed with diluted ammonia (4:1 water:concentrated ammonia, 200 ml) and brine (200 ml). The organic phase was dried (Na2SO4), filtered, and the solvent evaporated. Flash chromatography (500 g silica gel, 5-7% methanol in chloroform) afforded 23 g of the desired product, 4-((benzylthio)methyl)-1H-imidazole (compound (6)), representing a 91% yield. NMR indicated the presence of a small impurity (4 wt%), which was identified as the acetate salt and was identified as compound (8) below. The compound (6) material was used to generate HGT4001 without further purification. 1 H NMR (300MHz, CDCl3) δ7.60(d,J=1Hz,1H), 7.35-7.2(m,5H), 6.90(d,J=1Hz,1H), 3.67(s,2H), 3.62(s,2H). MS(APCI,Pos):205(M+1). [ka]
[0133] The intermediate compound (1H-imidazol-4-yl)methanethiol, identified as compound (7) in Scheme 1, was prepared as follows: A solution of liquid ammonia (200 mL) was concentrated through a suspension of 15 g of compound (6) (70.5 mmol) in ether (30 mL). To the resulting yellow solution, 5 g of sodium (217 mmol) was added portionwise until the mixture remained deep blue. This was then stirred for 40 minutes. Approximately 10–15 g of solid NH4Cl was added until the color disappeared, and the solvent was evaporated using a stream of nitrogen to give crude compound (7), which was used without further purification.
[0134] HGT4001 was prepared by adding 3.6 g of compound 3 (7 mmol) and 10 ml of triethylamine (71.8 mmol) to chloroform (200 ml). The resulting solution was degassed using vacuum and nitrogen and immediately added to compound 7. The resulting mixture was stirred at room temperature under nitrogen. After 3 days, 200 ml of water was added, and the mixture was extracted with chloroform (2 x 500 ml). The organic extract was washed with brine (200 ml), dried (NaSO), filtered, and the solvent evaporated. Flash chromatography (200 g of silica gel, neutralized with 1% triethylamine in chloroform, 2-5% ethanol in chloroform) afforded 1.25 g of HGT4001 (35% yield over two steps). 1 H NMR (300MHz, CDCl3) δ7.61(s,1H), 7.00(s,1H), 5.33(d,1H), 3.93(s,2H), 2. 58-2.46(m,1H), 2.29(d,2H), 1.91(m,5H), 1.61-0.84(m,33H), 0.66(s,3H). 13 C NMR (300MHz, CDCl3) δ141.6, 135.3, 134.3, 121.4, 118.1, 56.8, 56.2, 50.3, 50.2, 42.4, 39.8, 39. 6, 39.1, 36.8, 36.2, 35.8, 31.9, 29.1, 28.3, 28.1, 24.4, 23.9, 22.9, 22.6, 21.0, 19.4, 18.8, 11.9. MS(APCI,Pos)515(M+1). Elemental analysis:C 31 H50 N2S2, C (72.32 calculated value), measured value 72.04, H (9.79 calculated value), measured value 9.84, N (5.44, calculated value), measured value Value 5.41. Example 2 - Preparation of HGT4002
[0135] The compound 1-(2-(((3S,10R,13R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl)disulfanyl)ethyl)guanidine (referred to herein as "HGT4002") was prepared according to the general synthetic scheme shown below, which is depicted in Reaction 2. Reaction 2 [ka]
[0136] The intermediate compound tert-butyl ester identified as compound (10) in reaction 2 above 2-(Pyridin-2-yldisulfanyl)ethyl carbamate was prepared by adding 5.0 g of compound (9) (28.2 mmol) and 6.82 g of compound (2) (31 mmol) to 100 ml of chloroform (100 ml) and stirring at room temperature for 4 days to form a solution. The solvent was evaporated, and the resulting yellow solid was purified by flash chromatography (SiO, 50–100% ethyl acetate in hexanes) to give 9.0 g of impure compound (10). NMR indicated the presence of the desired material (56 wt%) along with the starting material compound (2) (24%) and disulfide compound (11) (20%), identified below. The resulting mixture was used in the next step without further purification. 1H NMR(300MHz,DMSO-d6)δ8.55-8.45(m,1H), 7.9-7.8(m,2H), 7.3-7.2(m,1H) , 7.07(bt,J=5Hz,1H), 3:25-3.15(m,2H), 2.87(t,J=7Hz,2H), 1.37(s,9H). MS(APCI,Pos)287(M+1), 231(M+1-C4H8). [ka]
[0137] The intermediate compound bis(N,N'-tert-butyl)-1-(2-(pyridin-2-yldisulfanyl)ethyl)guanidine carbamate (14) was prepared by adding 2.0 g of compound (10) (56% purity, 3.9 mmol) to anhydrous dichloromethane (12 mL), followed by the addition of TFA (6 mL), and stirring the resulting solution at room temperature for 5 hours. The solvent was evaporated, and the residue was dried under high vacuum to obtain crude compound (13) (TFA salt). Compound (13) salt was dissolved in 25 mL of anhydrous dichloromethane, and excess triethylamine (7 mL) was added, followed by the addition of 2.7 g of compound (12) (7.0 mmol). The reaction mixture was stirred at room temperature overnight, then diluted with chloroform (175 mL), washed with water (2 × 50 mL), and brine (50 mL). The organic solution was dried (NaSO), filtered, and the solvent was evaporated. The residue was purified by flash chromatography (SiO, 0–10% methanol in chloroform) to give 1.9 g of impure compound 14. NMR indicated the presence of the desired compound 14 (73 wt%) along with the disulfide compound 15 (27 wt%), identified below. The mixture was used in the next step without further purification. 1H NMR (300 MHz, CDCl) δ 11.48 (bs, 1H), 8.86 (bt, 1H), 8.55-8.5 (m, 1H), 7.65-7.6 (m, 2H), 7.25-7.15 (m, 1H), 3.8-3.65 (m, 2H), 2.99 (t, J = 6 Hz, 2H), 1.51 (s, 9H), 1.49 (s, 9H). MS (APCI, Pos): Complex, (M+1) not detected. [ka]
[0138] The intermediate compound 1-(2-(pyridin-2-yldisulfanyl)ethyl)guanidine trifluoroacetate, identified as compound 16 in Reaction 2 above, was prepared by adding 1.6 g of compound 14 (73% purity, 2.8 mmol) to anhydrous dichloromethane (33 mL), adding TFA (11 mL), and stirring the resulting solution at room temperature overnight. The solvent was evaporated, and the residue was dried under high vacuum to give crude compound 16 (TFA salt), which was used in the next step without further purification.
[0139] HGT4002 was prepared by dissolving the TFA salt of compound (16) in anhydrous dichloromethane (50 mL) followed by the addition of excess triethylamine (5 mL). 1.13 g of thiocholesterol (1) (2.8 mmol) was added, and the reaction mixture was stirred overnight at room temperature. It was then diluted with chloroform (200 mL) and washed with water (2 × 50 mL) and brine (100 mL). The resulting organic solution was dried (NaSO), filtered, and the solvent evaporated. The residue was purified by flash chromatography (SiO, 0–30% ethanol in chloroform) and triturated in acetone to give 80 mg of HGT4002. 1H NMR (300MHz, DMSO-d6) δ7.60-6.90 (broad, 4H), 5.35 (d, 1H), 3.39 (t, 2H), 2.84 (t, 2H), 2.72 (m,1H), 2.28(m,2H), 1.91(m,5H), 1.58-1.28(m,10H), 1.20-0.82(m,23H), 0.65(s,3H).). 13 C NMR(300MHz,DMSO-d6)δ157.5, 141.5, 121.5, 56.7, 56.1, 50.1, 49.6, 42.4, 38.3, 36. 7, 36.2, 35.7, 31.9, 29.0, 28.3, 27.9, 24.4, 23.7, 23.2, 22.9, 21.0, 19.5, 19.1, 12.2. MS(APCI,Pos):520(M+1). Elemental analysis:C 30 H 53 N3S2-SiO2, C (62.13, calculated), found 62.33; H (9.21, calculated), found 9.08; N (7.25, calculated), found 7.07; S (11.06, calculated), found 10.83. Example 3 - Preparation of HGT4003
[0140] The compound 2-((2,3-bis((9Z,12Z)-octadeca-9,12-dien-1-yloxy)propyl)disulfanyl)-N,N-dimethylethanamine (referred to herein as "HGT4003") was prepared according to the following general synthetic scheme shown in Reaction 3. Reaction 3 [ka]
[0141] The intermediate compound 3-(benzylthio)propane-1,2-diol, identified as compound 19 in reaction 3 above, was prepared by adding 11.37 g of compound 18 (90.3 mmol) dropwise to a stirred mixture of 9.73 g of compound 17 (90.3 mmol) and 18.64 g of KCO (135.1 mmol) in 60 mL of ACN. The resulting mixture was heated at reflux for 2 h. After cooling to room temperature, the reaction mixture was filtered and the solid was rinsed with 20 mL of ACN. The filtrate was evaporated, and the pale liquid residue was purified by column chromatography (eluent: 10–100% EtOAc in hexanes) to yield 17.03 g of compound 19 as a clear liquid (95%).
[0142] The intermediate compound benzyl(2,3-bis((9Z,12Z)-octadeca-9,12-dien-1-yloxy)propyl)sulfane, identified as compound 21 in reaction 3 above, was prepared by adding NaH (60% in mineral oil, 0.82 g, 20.5 mmol) to a stirred mixture of 1.56 g of compound 19 (7.88 mmol) and 6.91 g of compound 20 (21.00 mmol) in THF (200 mL) under N. The resulting mixture was heated at reflux for 44 h. After cooling to room temperature, the reaction mixture was diluted with EtO (400 mL) and washed with water (300 mL) and brine (300 mL). The organic layer was dried over anhydrous Na2SO4 and evaporated, and the yellow liquid residue was purified by column chromatography (eluent: 0-20% EtOAc in hexane) to give compound (21) as a pale yellow liquid (2.04 g, 37.3%).
[0143] The intermediate compound 2,3-bis((9Z,12Z)-octadeca-9,12-dien-1-yloxy)propane-1-thiol, identified as compound 22 in reaction 3 above, was prepared by adding a solution of compound 21 (0.7 g, 1.01 mmol) in EtO (30 mL) to liquid NH (30 mL) and concentrating under N into a two-necked RBF at −78 °C, followed by the addition of a small amount of Na (90 mg, 3.91 mmol). TLC showed that When the reaction mixture showed complete disappearance of compound 21, the resulting mixture was stirred at -78 °C for 30 min, and 340 mg of NH₄Cl (6.34 mmol) was added. The deep blue color of the reaction mixture faded to pale yellow within 10 min, and the dry ice acetone bath was removed. The reaction mixture was purged with N₂ while gradually warming to room temperature. After most of the NH₃ was removed with N₂ (the volume of the reaction mixture was reduced to approximately 20 mL), aqueous HCl (3N, 30 mL) was added. The mixture was eluted with DCM (60 mL). The DCM extract was dried over anhydrous Na₂SO₄ and evaporated. The yellow liquid residue was purified by column chromatography (eluent: 0–20% EtOAc in hexane) to give 490 mg of compound 22 as a pale yellow liquid (80%).
[0144] The intermediate compound N,N-dimethyl-2-(pyridin-2-yldisulfanyl)ethanamine, identified as compound 24 in reaction 3 above, 2.8 g of compound 2 (12.7 mmol), and 1.41 g of compound 23 (10 mmol) were mixed in 30 mL of DCM. The mixture was stirred while purging with N for 10 min, and 1.5 mL of EtN (11.2 mmol) was added. The resulting solution was stirred at room temperature for 16 h and then applied to a 230 g silica gel column. The column was eluted with 40-100% EtOAc / hexanes, followed by 8-10% MeOH / DCM, to give 0.72 g of compound 24 as a yellow liquid (34%).
[0145] HGT4003 was prepared by mixing 487 mg of compound 22 (0.81 mmol) and 180 mg of compound 24 (0.84 mmol) in 2 mL of DCM, followed by stirring under N for 16 h at room temperature. The reaction solution was purified three times by column chromatography (eluent: 20-100% EtOAc in hexanes) to yield 252 mg of HGT4003 as a pale yellow liquid (44%). 213 mg of compound 25 (37%), identified in reaction 4 below, was also obtained from the column chromatography purification. 1H NMR(300MHz,CDCl3)δ5.36-5.33(m,8H), 3.65(m,1H), 3.56-3.50(m,4H), 3.43(td,2H), 2.96-2.74( m,8H), 2.60(t,2H), 2.25(s,6H), 2.04(m,8H), 1.62-1.50(m,5H), 1.39-1.22(m,32H), 0.88(t,6H). 13 C NMR (300MHz, CDCl3) δ130.3, 128.0, 71.8, 71.6, 70.6, 58.8, 45.5, 41.4, 36.9, 31.6, 30.1, 29.7, 29.5, 29.4, 27.3, 26.2, 25.7, 22.6, 14.2. MS(APCI,Pos):709(M+1). Elemental analysis:C 43 H 81 NO2S2, C (72.92 calc.), found 72.75; H (11.53 calc.), found 11.50; N (1.98, calc.), found 2.08; S (9.05, calc.), found 8.95. Reaction 4 [ka]
[0146] An alternative synthetic route to HGT4003 employing a pyridyl disulfide bis(alkyl) intermediate is shown above in Reaction 4. The intermediate compound 2-((2,3-bis((9Z,12Z)-octadeca-9,12-dien-1-yloxy)propyl)disulfanyl)pyridine, identified as compound (25) in Reaction 4 above, was dissolved in 10 mL of CHCl3 for 1. A mixture of 35 g of compound 22 (2.24 mmol) and 0.54 g of compound 2 (2.45 mmol) was prepared by stirring at room temperature under N2 for 16 hours. The reaction solution was purified three times by column chromatography (eluent: 0-20% EtOAc in hexane) to give 1.1 g of compound 25 as a pale yellow liquid (67%). Next, 1.09 g of compound 23 (7.71 mmol) was added to a solution of compound 25 (1.1 g, 1.54 mmol) and Et3N (2.6 mL, 18.5 mmol) in CHCl3 (20 mL) and stirred under N2. TLC after 16 hours showed the complete disappearance of compound 25. The reaction solution was then washed with aqueous NaOH (1 N, 20 mL), dried over anhydrous Na2SO4, and evaporated. The yellow liquid residue was purified by column chromatography (eluent: 5-100% EtOAc in hexanes) to give 0.37 g of HGT4003 as a pale yellow liquid (34%). Example 4
[0147] Lipid nanoparticles containing HGT4001, DOPE, and DMG-PEG2000 and encapsulating codon-optimized firefly luciferase (FFL) mRNA (SEQ ID NO: 1) were formed via a standard ethanol injection method (Ponsa, et al., Int. J. Pharm. (1993) 95:51-56). Ethanol stock solutions of lipids were prepared in advance at a concentration of 50 mg / mL and stored at -20°C.
[0148] Codon-optimized firefly luciferase (FFL) mRNA was synthesized in vitro from a plasmid DNA template encoding the gene, followed by the addition of a 5' cap structure (Cap1) (Fechter, P. et al., J. Gen. Virology (2005) 86:1239-1249) and a 3' poly(A) tail approximately 200 nucleotides in length as determined by gel electrophoresis. The 5' and 3' untranslated regions present in each FFL mRNA product are represented as X and Y, respectively, in SEQ ID NO: 4, shown below. Codon-optimized firefly luciferase mRNA (SEQ ID NO: 3): XAUGGAAGAUGCCAAAAACAUUAAGAAGGGCCCAGCGCCAUUCUACCCACUCGAAGACGGGACCGCCGGCGAGCAGCUGCACAAAGCCAUGAAGCGCUACGCCCUGGUGCCCGGCACCAUCGCCUUUACCGACGCACAUAUCGAGGUGGACAUUACCUACGCCGAGUACUUCGAGAUGAGCGUUCGGCUGGCAGAAGCUAUGAAGCGCUAUGGGCUGAAUACAAACCAUCGGAUCGUGGUGUGCAGCGAGAAUAGCUUGCAGUUCUUCAUGCCCGUGUUGGGUGCCCUGUUCAUCGGUGUGGCUGUGGCCCCAGCUAACGACAUCUACAACGAGCGCGAGCUGCUGAACAGCAUGGGCAUCAGCCAGCCCACCGUCGUAUUCGUGAGCAAGAAAGGGCUGCAAAAGAUCCUCAACGUGCAAAAGAAGCUACCGAUCAUACAAAAGAUCAUCAUCAUGGAUAGCAAGACCGACUACCAGGGCUUCCAAAGCAUGUACACCUUCGUGACUUCCCAUUUGCCACCCGGCUUCAACGAGUACGACUUCGUGCCCGAGAGCUUCGACCGGGACAAAACCAUCGCCCUGAUCAUGAACAGUAGUGGCAGUACCGGAUUGCCCAAGGGCGUAGCCCUACCGCACCGCACCGCUUGUGUCCGAUUCAGUCAUGCCCGCGACCCCAUCUUCGGCAACCAGAUCAUCCCCGACACCGCUAOCCUCAGCGUGGUGCCAUUUCACCACGGCUUCGGCAUGUUCACCACGCUGGGCUACUUGAUCUGCGGCUUUCGGGUCGUGCUCAUGUACCGCUUCGAGGAGGAGCUAUUCUUGCGCAGCUUGCAAGACUAUAAGAUUCAAUCUGCCCUGCUGGUGCCCACACUAUUUAGCUUCUUCGCUAAGAGCACUCUCAUCGACAAGUACGACCUAA GCAACUUGCACGAGAUCGCCAGCGGCGGGGCGCCGCUCAGCAAGGAGGUAGGUGAGGCCGUGGCCAAACGCUUCCACCUACCAGGCAUCCGCCAGGGCUACGGCCUGACAGAAACAACCAGCGCCAUUCUGAUCACCCCCGAAGGGGACGACAAGCCUGGCGCAGUAGGCAAGGUGGUGCCCUUCUUCGAGGCUAAGGUGGUGGACUUGGACACCGGUAAGACACUGGGUGUGAACCAGCGCGGCGAGCUGUGCGUCCGUGGCCCCAUGAUCAUGAGCGGCUACGUUAACAACCCCGAGGCUACAAACGCUCUCAUCGACAAGGACGGCUGGCUGCACAGCGGCGACAUCGCCUACUGGGACGAGGACGAGCACUUCUUCAUCGUGGACCGGCUGAAGAGCCUGAUCAAAUACAAGGGCUACCAGGUAGCCCCAGCCGAACUGGAGAGCAUCCUGCUGCAACACCCCAACAUCUUCGACGCCGGGGUCGCCGGCCUGCCCGACGACGAUGCCGGCGAGCUGCCCGCCGCAGUCGUCGUGCUGGAACACGGUAAAACCAUGACCGAGAAGGAGAUCGUGGACUAUGUGGCCAGCCAGGUUACAACCGCCAAGAAGCUGCGCGGUGGUGUUGUGUUCGUGGACGAGGUGCCUAAAGGACUGACCGGCAAGUUGGACGCCCGCAAGAUCCGCGAGAUUCUCAUUAAGGCCAAGAAGGGCGGCAAGAUCGCCGUGUAAY X = GGGAUCCUACC (SEQ ID NO: 5) Y = UUUGAAUU (SEQ ID NO: 6)
[0149] FFL mRNA was stored in water at -80°C at a final concentration of 1 mg / mL until use. All mRNA concentrations were determined via Ribogreen assay (Invitrogen). mRNA encapsulation was calculated by performing the Ribogreen assay in the presence and absence of 0.1% Triton-X100. Particle size (dynamic light scattering (DLS)) and zeta potential were determined in 1x PBS and 1 mM KCl solutions, respectively, using a Malvern Zetasizer instrument.
[0150] Aliquots of 50 mg / mL ethanolic solutions of the imidazole-based cationic lipid HGT4001, DOPE, and DMG-PEG2000 were mixed and diluted with ethanol to a final volume of 3 mL. Separately, an aqueous buffer solution of FFL mRNA (10 mM citrate / 150 mM NaCl, pH 4.5) was prepared from a 1 mg / mL stock solution. The lipid solution was rapidly injected into the aqueous mRNA solution and shaken to obtain a final suspension in 20% ethanol. The resulting nanoparticle suspension was filtered, diafiltered against 1x PBS (pH 7.4), concentrated, and stored at 2-8°C. Final concentration = 0.69 mg / mL CO-FF mRNA (encapsulated). Z 平均 =70.3nm(Dv (50) = 43.2 nm; Dv (90) =80.3nm). Example 5
[0151] This example illustrates that HGT4003-based lipid nanoparticles provide a highly efficient means of delivering polynucleotide constructs to one or more target cells, tissues, and organs. HGT4003-based lipid nanoparticles were formed via a standard ethanol injection method. (Ponsa, et al., Int. J. Pharm. (1993) 95:51 -56.) Ethanol stock solutions of lipids were prepared in advance at a concentration of 50 mg / mL and stored at -20°C.
[0152] Codon-optimized firefly luciferase (FFL) mRNA encodes the gene The mRNAs were synthesized by in vitro transfection from a plasmid DNA template followed by the addition of a 5' cap structure (Cap1) (Fechter, P. et al., J. Gen. Virology (2005) 86:1239-1249) and a 3' poly(A) tail of approximately 200 nucleotides in length as determined by gel electrophoresis. The 5' and 3' untranslated regions present in each mRNA product are represented as X and Y, respectively, in SEQ ID NO: 4. FFL mRNAs were stored in water at -80°C at a final concentration of 1 mg / mL until use. All mRNA concentrations were determined via Ribogreen assay (Invitrogen). mRNA encapsulation was calculated by performing the Ribogreen assay in the presence and absence of 0.1% Triton-X100. Particle size (dynamic light scattering (DLS)) and zeta potential were determined in 1x PBS and 1 mM KCl solutions, respectively, using a Malvern Zetasizer instrument.
[0153] Aliquots of 50 mg / mL ethanolic solutions of HGT4003, DOPE, cholesterol, and DMG-PEG2000 were mixed and diluted with ethanol to a final volume of 3 mL. Separately, an aqueous buffer solution of FFL mRNA (10 mM citrate / 150 mM NaCl, pH 4.5) was prepared from a 1 mg / mL stock solution. The lipid solution was rapidly injected into the aqueous mRNA solution and shaken to obtain a final suspension in 20% ethanol. The resulting nanoparticle suspension was filtered, diafiltered against 1x PBS (pH 7.4), concentrated, and stored at 2-8°C. Final concentration = 1.27 mg / mL CO-FF mRNA (encapsulated). Z 平均 =60.9nm(Dv (50) = 47.9 nm; Dv (90) =75.3nm).
[0154] To determine whether HGT4003-based lipid nanoparticles can deliver encapsulated polynucleotide constructs to one or more target cells, CD-1 mice were injected with a single dose of HGT4003-based FFL mRNA-encapsulated lipid nanoparticles and sacrificed 4 hours later. As described below, a single dose of HGT4003-based FFL mRNA-encapsulated lipid nanoparticles was administered to the animals via one of the following routes: intravenous (IV), intracerebroventricular (ICV), or intrathecal (IT). The activity of firefly luciferase protein produced in the liver, spleen, brain, and spinal cord of the animals following FFL mRNA expression was determined in a bioluminescence assay.
[0155] Briefly, bioluminescence assays were performed using the Promega Luciferase Assay System (item #E1500 / E4500 Promega). Tissue preparation was performed as follows: a portion of the desired tissue sample (flash-frozen) was thawed, washed with RO / DI water, and placed in a ceramic bead homogenization tube. The tissue was treated with lysis buffer and homogenized. After five freeze / thaw cycles and subsequent centrifugation at 4°C, the supernatant was transferred to a new microcentrifuge tube. After repeating the procedure, the tissue extract was stored at -80°C.
[0156] Luciferase assay reagent was prepared by adding 10 mL of luciferase assay buffer to luciferase assay substrate and mixing via vortexing. 20 μL of homogenate samples were loaded into a 96-well plate, followed by 20 μL of plate controls for each sample. Separately, 120 μL of luciferase assay reagent was loaded into each well of a 96-well flat-bottom plate, and each plate was inserted into the appropriate chamber using a Biotek Synergy2 instrument to measure luminescence in relative light units (RLU).
[0157] The HGT4003-based FFL mRNA-encapsulated lipid nanoparticle formulations described herein were evaluated by administering a single bolus intravenous (IV) injection to test animals. After 4 hours, the animals were sacrificed, and the liver and spleen were harvested from each animal. Luminescence was detected via the FFL protein generated from the delivered exogenous FFL message. Figure 1 illustrates an example of intravenous administration using a lipid nanoparticle system based on HGT4003, showing that FFL protein produced in the liver was enriched by over an order of magnitude when compared to the spleen (2.34 x 10, respectively). 6 RLU / mg protein vs. 1.71 × 10 5 RLU / mg protein), illustrating that the use of HGT4003-based nanoparticles results in enrichment of encapsulated material in the liver relative to the spleen.
[0158] In addition, FFL mRNA expression was assessed using HGT4003-based lipid nanoparticle formulations by administering a single bolus injection into the central nervous system (CNS) of the animals tested via either intracerebroventricular (ICV) or intrathecal (IT) routes. After 4 hours, the animals were sacrificed, and the brain and spinal cord were harvested from each animal. Luminescence generated from the delivered exogenous FFL message via the FFL protein was detected and analyzed. As illustrated in Figure 2, after administration of HGT4003-based lipid nanoparticles, FFL protein product was enriched in the brain following ICV administration compared to IT administration.
[0159] Regardless of the administration route selected, detectable luminescence signals above baseline were observed in all animals administered HGT4003-based FFL-mRNA-encapsulated lipid nanoparticle formulations. The presence of a luminescence signal relative to the background suggests expression of the exogenously administered FFL mRNA and production of firefly luciferase protein from such FFL mRNA. The luminescence observed in the animal's liver was stronger than the similar signal observed in the spleen, suggesting enrichment of lipid nanoparticles in liver cells and tissues. Similarly, when HGT4003-based FFL mRNA-encapsulated nanoparticles were administered via the ICV administration route, FFL protein production was enriched in the brain compared to the subsequent IT administration route. Thus, this example illustrates that HGT4003-based lipid nanoparticles provide a highly efficient means of delivering polynucleotide constructs to one or more target cells, tissues, and organs. Example 6 - Lyophilized liposome formulation
[0160] Lipid nanoparticles were formed via a standard ethanol injection method (Ponsa, et al., Int. J. Pharm. (1993) 95:51-56). Ethanol stock solutions of lipids were prepared in advance at a concentration of 50 mg / mL and stored at -20°C. Codon-optimized firefly luciferase (FFL) mRNA (SEQ ID NO: 3) was stored in water at -80°C at a final concentration of 1 mg / mL until use.
[0161] All FFL mRNA concentrations were determined via the Ribogreen assay (Invitrogen). mRNA encapsulation was calculated by performing the Ribogreen assay in the presence and absence of 0.1% Triton-X100. Particle size (dynamic light scattering (DLS) and particle size) were determined using a Malvern Zetasizer instrument in 1x PBS and 1 mM KCl solutions, respectively. The in vitro activity of encapsulated mRNA formulations was assessed using 293T cells; 10 μg of mRNA equivalent to the selected formulation was incubated with 293T cells for 8 hours at 37°C. Luciferase production was measured using a Perkin-Elmer BriteLite Plus kit.
[0162] Generally, lyophilization of lipid nanoparticles was performed by freezing prepared liposomes in a solution containing a lyoprotectant (sucrose) and then removing any water or moisture by sublimation under vacuum. Specifically, prior to lyophilization, the buffer present in the liposome formulation was replaced with 10% sucrose via centrifugation. The resulting lipid nanoparticle solution then underwent a lyophilization process characterized by specific parameters for the freezing, primary drying, and secondary drying steps, as identified in Table 1 below. The lyophilized cake was reconstituted with an appropriate amount of purified water before undergoing physical characterization and biochemical analysis, as described below. [Table 1] Example 7
[0163] A lipid nanoparticle formulation containing firefly luciferase mRNA (FFL) encapsulated in C12-200:DOPE:CHOL:DMG-PEG2000 (40:30:20:10, N / P2) lipid nanoparticles was prepared. A portion of the prepared lipid nanoparticle formulation batch was then lyophilized according to the protocol described in Table 1.
[0164] The observed physical properties of fresh (unlyophilized) and lyophilized lipid nanoparticle formulations were compared according to the protocol described above and found to be consistent. The mean particle size (Z) of fresh and lyophilized lipid nanoparticles is shown in Table 2 below. 平均 ) were 103.8 nm and 117.0 nm, respectively. The polydispersity index (PDI) of the fresh lipid nanoparticles was 0.236 compared to 0.247 for the freeze-dried lipid nanoparticles. The Dv of the freeze-dried lipid nanoparticles was 49.0 nm and 176 nm, respectively. 50 and Dv 90 Compared with the Dv of fresh lipid nanoparticles 50 and Dv 90 were 60.2 nm and 156 nm, respectively. Therefore, the observed physical properties suggest that both the fresh and freeze-dried lipid nanoparticles were stable and also that the particle sizes remained relatively comparable. [Table 2] Example 8
[0165] A lipid nanoparticle formulation containing firefly luciferase mRNA (FFL) encapsulated in DLinKC2-DMA:DOPE:CHOL:DMG-PEG2000 (50:25:20:5, N / P5) lipid nanoparticles was prepared. One batch of the lipid nanoparticle formulation was then lyophilized according to the protocol described in Table 5 below.
[0166] The lyophilization process was carried out by freezing the prepared liposomes in a solution containing a lyoprotectant (sucrose) and then removing any water or moisture by sublimation under vacuum. Specifically, prior to lyophilization, the buffer in the liposome formulation was replaced with 10% sucrose via centrifugation. The resulting liposome solution then underwent a lyophilization process characterized by specific parameters for the freezing, primary drying, and secondary drying steps, as identified in Table 3 below. The lyophilized cake was reconstituted with an appropriate amount of purified water prior to physical characterization and biochemical analysis, as described below. [Table 3]
[0167] The prepared fresh (unlyophilized) and lyophilized formulations were placed in the encapsulated FFL. mRNA was used to deliver to 293T cells and luminescence was determined according to the protocol described above. 4.21 x 10 6 Luminescence values of 2.65 x 10 were observed after reconstitution of the lyophilized formulation. 6 compared to that observed in fresh lipid nanoparticles before freeze-drying.
[0168] The mean particle size (Z) of fresh and freeze-dried lipid nanoparticles 平均 ) were 89.11 nm and 96.41 nm, respectively. The polydispersity index (PDI) of the fresh lipid nanoparticles was 0.205 compared to 0.204 for the freeze-dried lipid nanoparticles. The Dv of the freeze-dried lipid nanoparticles was 65.1 nm and 135 nm, respectively. 50 and Dv 90 Compared with the Dv of fresh lipid nanoparticles 50 and Dv 90were 63.8 nm and 117 nm, respectively. As shown in Table 6, both particle size and encapsulation efficiency were well maintained during lyophilization. The encapsulation efficiency of FFL mRNA was 93% and 87%, respectively, in the fresh and lyophilized lipid nanoparticles. In addition, the observed physical properties suggest that both the fresh and lyophilized lipid nanoparticles were stable and the particle sizes remained relatively comparable. [Table 4] Example 9
[0169] A lipid nanoparticle formulation was prepared containing erythropoietin (EPO) mRNA (SEQ ID NO: 4) flanked at the 5' and 3' ends by SEQ ID NO: 1 and SEQ ID NO: 2, respectively, encapsulated in DLinKC2-DMA:DOPE:CHOL:DMG-PEG2000 (50:25:20:5, N / P5) lipid nanoparticles. One batch of the prepared lipid nanoparticle formulation was then lyophilized according to the protocol described in Table 3. Human erythropoietin (EPO) mRNA (SEQ ID NO: 4) AUGGGGGUGCACGAAUGUCCUGCCUGGCUGUGGCUUCUCCUGQCCCUGCUGUCGCUCCCUCUGGGCCUCCCAGUCCUGGGCGCCCCACCACGCCUCAUCUGUGACAGCCGAGUCC UGGAGAGGUACCUCUUGGAGGCCAAGGAGGCCGAGAAUAUCACGACGGGCUGUGCUGAACACUGCAGCUUGAAUGAGAAUAUCACUGUCCCAGACACCAAAGUUAAUUUCUAUGCC UGGAAGAGGAUGGAGGUCGGGCAGCAGGCCGUAGAAGUCUGGCAGGGCCUGGCCCUGCUGUCGGAAGCUGUCCUGCGGGGCCAGGCCCUGUUGGUCAACUCUUCCCAGCCGUGGAG CCCCUGCAGCUGCAUGUGGAUAAAGCCGUCAGUGGCCUUCGCAGCCUCACCACUCQGCUUCGGGCUCUGGGAGCCCAGAAGGAAGCCAUCUCCCCUCCAGAUGCGGCCUCAGCUGCU CCACUCCGAACAAUCACUGCUGACACUUUCGGCAAACUCUUCCGAGUCUACUCCAAUUUCCUCCGGGGAAAGCUGAAGCUGUACACAGGGGAGGCCOGCAGGACAGGGGACAGAUGA
[0170] The observed physical properties of the lipid nanoparticle formulations both before and after lyophilization were compared according to the protocol described above and found to be consistent. The mean particle size (Z) of the fresh (unlyophilized) and lyophilized lipid nanoparticles is shown in Table 5 below. 平均 ) were 85.9 nm and 95.4 nm, respectively, suggesting that both the fresh and freeze-dried lipid nanoparticles were stable. The polydispersity index (PDI) of the fresh lipid nanoparticles was 0.188 compared to 0.231 for the freeze-dried lipid nanoparticles. The Dv of the fresh lipid nanoparticles 50 and Dv 90 are the Dv of 67.2 nm and 134 nm for the freeze-dried lipid nanoparticles, respectively. 50 and Dv 90The particle sizes were 61.0 nm and 112 nm, respectively, compared with the fresh and freeze-dried lipid nanoparticles. The encapsulation efficiency of EPO mRNA was 94% and 86%, respectively, in the fresh and freeze-dried lipid nanoparticles. As also shown in Table 7, both particle size and encapsulation efficiency were well maintained during freeze-drying.
[0171] Finally, the erythropoietin protein produced by 293T cells was measured using the R&D Systems Human EPO Quantikine IVD ELISA kit. As shown in Table 5, the erythropoietin protein produced after delivery of EPO mRNA to 293T cells in both the pre- and post-lyophilized formulations was comparable, and there was no significant difference in erythropoietin protein production when compared to both the pre- and post-lyophilized lipid nanoparticle formulations. [Table 5] Example 10
[0172] A 6-month stability study was conducted on lyophilized EPO mRNA-encapsulated lipid nanoparticles. Particle size distribution, mRNA encapsulation efficiency, and EPO expression in CD-1 mice were determined.
[0173] The lipid formulation included EPO mRNA encapsulated in KC2:DOPE:CHOL:DMGPEG2K (50:25:20:5) as described in Example 9. The N / P ratio (defined as the ratio of the number of phosphates in the nucleic acid to the number of nitrogens in the cationic lipid) was 5.
[0174] One vial was stored at 2-8°C. One vial was stored at room temperature. Humidity was not controlled in both storage conditions.
[0175] The lyophilized cake was reconstituted with an appropriate amount of water for injection prior to physical characterization and animal testing.
[0176] Particle size was obtained using a Malvern Zetasizer Nano-ZS. The encapsulation efficiency of mRNA in lipid particles was determined using a RiboGreen assay kit. Unencapsulated mRNA was detected directly. Total mRNA was measured after dissolution of lipid nanoparticles in the presence of 0.45% w / v Triton X-100. The encapsulation efficiency was calculated as (total mRNA - unencapsulated mRNA) / total mRNA × 100%.
[0177] Wild-type CD-1 mice were used to evaluate the relative expression of EPO after a single IV administration of two formulations of hEPO mRNA-encapsulated lipid nanoparticles. Serum EPO levels were measured 6 hours after dose administration. Four 7-week-old CD-1 mice (2 males, 2 females) were used in this study. Upon arrival, animals were randomized into two treatment groups with two animals per group (1 male, 2 females). On day 1, animals were weighed and body weights were recorded. Each mouse received a single IV dose of 99 μg of mRNA / animal in a dose volume of 300 μL / animal. Six hours after dose administration, mice were euthanized by CO2 asphyxiation, followed by thoracotomy, and the maximum obtainable blood volume was collected and processed for serum. All administered treatments were well tolerated in CD-1 mice after a single IV administration. Serum hEPO levels were measured by ELISA. EPO was observed in the serum from all test animals receiving either formulation.
[0178] The test results are summarized in Table 6. No significant changes were observed in the particle size distribution of the lyophilized lipid nanoparticles after 6 months of storage at both frozen and room temperature. In addition, the encapsulation efficiency of the mRNA in the lipid nanoparticles remained essentially unchanged during storage. These results indicate that the integrity of the lipid particles was well maintained during storage in the lyophilized configuration. The 6-month stability under accelerated room temperature conditions is comparable to the potential 2-year shelf life under frozen conditions. Furthermore, serum hEPO was detected in wild-type CD-1 mice 6 hours after intravenous injection of a reconstituted suspension of lyophilized lipid nanoparticles after storage at either frozen or room temperature. These results indicate that the integrity of the lipid particles was efficiently protected during storage in the lyophilized configuration. [Table 6] Abbreviations: 1) Zave (Z-average) is the mean value from the intensity distribution; 2) PDI (polydispersity index) describes the width of the distribution; 3) Dv50 is the median of the volume distribution; 4) Dv90 means that 90 percent of the volume distribution lies below this value. Example 11
[0179] Freeze-drying studies were performed on mRNA-encapsulated lipid nanoparticles using 2-hydroxypropyl-β-cyclodextrin as a lyoprotectant. For comparison, sucrose cryoprotectant was also evaluated.
[0180] mRNA was encapsulated in C12-200:DOPE:CHOL:DMGPEG2K (40:30:25:5) lipid particles using the ethanol dilution method. The N / P ratio was 20. The buffer in the formulation was replaced with an aqueous solution containing the appropriate amount of sucrose or 2-hydroxypropyl-β-cyclodextrin via centrifugation before lyophilization. The resulting solution underwent a lyophilization process characterized by specific parameters for the freezing, primary drying, and secondary drying steps. Table 7 lists the lyophilization cycle for the sucrose-containing formulation. Table 8 lists the lyophilization cycle for the 2-hydroxypropyl-β-cyclodextrin-containing formulation. The lyophilized cake was reconstituted with an appropriate amount of purified water before physical characterization and biochemical analysis. Particle size was measured using a Malvern Zetasizer Nano-ZS. The encapsulation efficiency of mRNA in lipid particles was determined using a RiboGreen assay kit. Unencapsulated mRNA was directly detected. Total mRNA was measured after dissolution of lipid nanoparticles in the presence of 0.45% w / v Triton X-100. Encapsulation efficiency was calculated as (total mRNA - unencapsulated mRNA) / total mRNA × 100%.
[0181] In mice after a single IV administration of two formulations of EPO mRNA-encapsulated lipid nanoparticles Wild-type CD-1 mice were used to assess the relative expression of EPO in the treatments. Serum EPO levels were measured 6 hours after dose administration. Three 7-week-old male CD-1 mice were used in each group. After arrival, animals were randomized into treatment groups with three animals per group. On day 1, animals were weighed and their weights recorded. Each mouse received a single IV dose of 15 μg of mRNA / animal in a dose volume of 50 μL / animal. Six hours after dose administration, mice were euthanized by CO2 asphyxiation, followed by thoracotomy, and the maximum obtainable blood volume was collected and processed for serum. All administered treatments were well tolerated in CD-1 mice after a single IV administration. Serum EPO levels were measured by ELISA. EPO was observed in the serum from all test animals receiving either formulation. [Table 7] [Table 8]
[0182] All test results are summarized in Table 9. When sucrose was used as the lyoprotectant at a weight ratio of 6:1 to the total lipid, particle size growth was observed during freeze-drying. However, particle size was well maintained even at a relatively low weight ratio of 5:1 when 2-hydroxypropyl-β-cyclodextrin was used instead. N / P was 20. In addition, the encapsulation efficiency of mRNA in lipid nanoparticles was well maintained during freeze-drying. These The results suggest that the integrity of the lipid particles was effectively protected during lyophilization. Furthermore, serum hEPO levels in wild-type CD-1 mice 6 hours after dose administration were comparable before and after lyophilization. In summary, 2-hydroxypropyl-β-cyclodextrin is an effective lyoprotectant for mRNA-encapsulated lipid nanoparticles formulated with C12-200 lipids. [Table 9] Abbreviations: 1) Zave (Z-average) is the mean value from the intensity distribution; 2) PDI (polydispersity index) describes the width of the distribution; 3) Dv50 is the median of the volume distribution; 4) Dv90 means that 90 percent of the volume distribution lies below this value.
[0183] The foregoing examples illustrate that the lyophilized lipid nanoparticle formulations exhibited comparable or equivalent physical properties to prepared lyophilized lipid nanoparticles, including comparable stability, lipid nanoparticle particle size, and encapsulation efficiency. With respect to encapsulated mRNA polynucleotides, the lyophilized lipid nanoparticles also exhibited comparable protein production. For example, several of the evaluated lyophilized lipid nanoparticle compositions exhibited comparable firefly luciferase protein production as determined by the presence of a luminescent signal, thereby inferring the expression and / or production of exogenously administered encapsulated mRNA. The foregoing results suggest that the lyophilized lipid nanoparticle compositions and formulations described herein are stable and capable of minimizing degradation of encapsulated compounds (e.g., polynucleotides). Such lyophilized lipid nanoparticle compositions are predicted to have an increased shelf life upon storage under both refrigerated and ambient temperature conditions, thereby presenting an attractive means of improving the availability and potential costs associated with such pharmaceutical compositions.
[0184] According to a preferred embodiment of the present invention, for example, the following is provided: (Section 1) structure [ka] wherein R1 is selected from the group consisting of imidazole, guanidinium, imine, enamine, amino, optionally substituted alkylamino (e.g., alkylamino such as dimethylamino), and pyridyl; R2, [ka] is selected from the group consisting of wherein R3 and R4 are each independently an optionally substituted variably saturated or unsaturated C6-C 20Alkyl and optionally substituted variably saturated or unsaturated C-C 20 acyl; A compound wherein n is 0 or any positive integer. (Section 2) R2, [ka] Item 1. The compound according to item 1, (Section 3) Item 3. The compound according to item 2, wherein R1 is imidazole. (Section 4) R1 is imidazole, R2, [ka] and The compound according to item 1, wherein n is 1. (Section 5) The compound according to item 2 above, wherein R1 is guanidinium. (Section 6) R1 is guanidinium; R2, [ka] and The compound according to item 1, wherein n is 1. (Section 7) R2, [ka] and wherein R3 and R4 are each independently an optionally substituted variably saturated or unsaturated C6-C 20Alkyl and optionally substituted variably saturated or unsaturated C-C 20 Item 1. The compound according to item 1, wherein the compound is selected from the group consisting of acyls. (Section 8) R3 and R4 are each an optionally substituted variably saturated or unsaturated C6-C 20 8. The compound according to item 7, wherein the aryl group is alkyl. (Section 9) R3 and R4 are each an optionally substituted polyunsaturated C6-C 20 8. The compound according to item 7, wherein the aryl group is alkyl. (Section 10) R3 and R4 are each an optionally substituted polyunsaturated C 18 8. The compound according to item 7, wherein the aryl group is alkyl. (Section 11) R3 and R4 are each an unsubstituted polyunsaturated C 18 8. The compound according to item 7, wherein the aryl group is alkyl. (Section 12) 8. The compound according to item 7, wherein R1 is amino. (Section 13) R3 and R4 are each an unsubstituted polyunsaturated C 18 Item 13. The compound according to item 12, wherein the aryl group is alkyl. (Section 14) Item 14. The compound according to item 13, wherein n is 1. (Section 15) R1 is dimethylamino, R2, [ka] and wherein R3 and R4 are each an unsubstituted polyunsaturated C 18 is alkyl, The compound according to item 1, wherein n is 1. (Section 16) 8. The compound according to item 7, wherein R1 is imidazole. (Section 17) R3 and R4 are each an unsubstituted polyunsaturated C 18 17. The compound according to item 16, wherein the aryl group is alkyl. (Section 18) Item 18. The compound according to item 17, wherein n is 1. (Section 19) R1 is imidazole, R2, [ka] and wherein R3 and R4 are each an unsubstituted polyunsaturated C 18 is alkyl, The compound according to item 1, wherein n is 1. (Section 20) 8. The compound according to item 7, wherein R1 is guanidinium. (Section 21) R3 and R4 are each an unsubstituted polyunsaturated C 18 21. The compound according to item 20, wherein the aryl group is alkyl. (Section 22) 22. The compound according to item 21, wherein n is 1. (Section 23) R1 is guanidinium; R2, [ka] and wherein R3 and R4 are each an unsubstituted polyunsaturated C 18 is alkyl, The compound according to item 1, wherein n is 1. (Section 24) structure [ka] A compound having the formula: (Section 25) structure [ka] A compound having the formula: (Section 26) structure [ka] A compound having the formula: (Section 27) structure [ka] A compound having the formula: (Section 28) structure [ka] A compound having the formula: (Section 29) 29. Nanoparticles comprising the compound according to any one of items 1 to 28. (Section 30) 30. The nanoparticles according to item 29, further comprising one or more compounds selected from the group consisting of cationic lipids, PEG-modified lipids, non-cationic lipids, and helper lipids. (Section 31) 31. The nanoparticle according to item 29 or 30, further comprising one or more polynucleotides. (Section 32) 32. The nanoparticles according to claim 31, wherein one or more of the polynucleotides comprises a chemical modification. (Section 33) Item 32. The nanoparticles according to item 31, wherein the one or more polynucleotides are selected from the group consisting of antisense oligonucleotides, siRNA, miRNA, snRNA, snoRNA, and combinations thereof. (Section 34) 32. The nanoparticle according to claim 31, wherein the one or more polynucleotides comprise one or more LNAs. (Section 35) 32. The nanoparticle according to claim 31, wherein the one or more polynucleotides comprise DNA. (Section 36) 32. The nanoparticle according to claim 31, wherein the one or more polynucleotides comprise RNA. (Section 37) Item 37. The nanoparticles according to item 36, wherein the RNA is selected from the group consisting of mRNA, siRNA, snoRNA, microRNA, and combinations thereof. (Section 38) 37. The nanoparticle according to item 36, wherein the RNA encodes an enzyme. (Section 39) The enzymes include agalsidase alpha, alpha-L-iduronidase, iduronate-2-sulfatase, N-acetylglucosamine-1-phosphate transferase, N-acetylglucosaminidase, alpha-glucosaminide acetyltransferase, N-acetylglucosamine 6-sulfatase, N-acetylgalactosamine-4-sulfatase, β-glucosidase, and galactose-6-sulfate sulfatase. Item 40. The nanoparticles according to item 38, wherein the enzyme is selected from the group consisting of β-galactosidase, β-glucuronidase, glucocerebrosidase, heparan sulfamidase, hyaluronidase, galactocerebrosidase, ornithine transcarbamylase (OTC), carbamoyl-phosphate synthetase 1 (CPS1), argininosuccinate synthetase (ASS1), argininosuccinate lyase (ASL), and arginase 1 (ARG1). A pharmaceutical composition comprising the compound according to any one of items 1 to 28 above, or the nanoparticles according to any one of items 29 to 39 above. (Section 41) A method for treating a disease in a subject, comprising administering to the subject an effective amount of the pharmaceutical composition described in paragraph 40 above. (Section 42) A method for transfecting one or more target cells with a polynucleotide, the method comprising contacting the one or more target cells with the pharmaceutical composition described in paragraph 40 above, such that the polynucleotide is transfected into the one or more target cells. (Section 43) A pharmaceutical composition comprising lyophilized lipid nanoparticles, wherein the lipid nanoparticles contain mRNA. 10. A pharmaceutical composition comprising: (Section 44) Item 45. The pharmaceutical composition according to Item 43, wherein the mRNA is modified to improve stability. 44. The pharmaceutical composition according to claim 43, wherein the lipid nanoparticles do not aggregate upon reconstitution. (Section 46) 44. The pharmaceutical composition of claim 43, wherein the lipid nanoparticles have a Dv50 of less than about 150 nm upon reconstitution. (Section 47) 44. The pharmaceutical composition of claim 43, wherein the lipid nanoparticles have a Dv90 of less than about 200 nm upon reconstitution. (Section 48) 44. The pharmaceutical composition of claim 43, wherein the lipid nanoparticles have a polydispersity index value of less than about 0.25 upon reconstitution. (Section 49) 44. The pharmaceutical composition of claim 43, wherein the lipid nanoparticles have an average particle size of less than 125 nm in PBS solution upon reconstitution. (Section 50) 44. The pharmaceutical composition according to claim 43, wherein the lipid nanoparticles comprise one or more cationic lipids. (Section 51) 51. The pharmaceutical composition of claim 50, wherein the one or more cationic lipids are selected from the group consisting of C12-200, DOTAP (1,2-dioleyl-3-trimethylammonium propane), DODAP (1,2-dioleyl-3-dimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA, DLinKC2-DMA, HGT4003, HGT5001, and ICE. (Section 52) 44. The pharmaceutical composition according to claim 43, wherein the lipid nanoparticles comprise one or more PEG-modified lipids. (Section 53) 53. The pharmaceutical composition of claim 52, wherein the one or more PEG-modified lipids comprise a poly(ethylene)glycol chain up to 5 kDa in length covalently attached to a lipid comprising one or more alkyl chains C6-C20 in length. (Section 54) Item 44. The pharmaceutical composition according to item 43, wherein the lipid nanoparticles comprise C12-200, DOPE, cholesterol, and DMG-PEG-2000. (Section 55) Item 44. The pharmaceutical composition according to item 43, wherein the lipid nanoparticles comprise DLinKC2-DMA, DOPE, cholesterol, and DMG-PEG2000. (Section 56) 44. The pharmaceutical composition according to paragraph 43, wherein the mRNA encodes an enzyme. (Section 57) The enzymes include agalsidase alpha, alpha-L-iduronidase, iduronate-2-sulfatase, N-acetylglucosamine-1-phosphate transferase, N-acetylglucosaminidase, alpha-glucosaminide acetyltransferase, N-acetylglucosamine 6-sulfatase, N-acetylgalactosamine-4-sulfatase, β-glucosidase, galactose-6-sulfatase, β-galactosidase, β-glucuronidase, glucocerebrosidase, heparan sulfamidase, hyaluronidase, and galactocerebrosidase, ornithinetra 57. The pharmaceutical composition of claim 56, wherein the enzyme is selected from the group consisting of argininosuccinate synthetase (ASS1), argininosuccinate lyase (ASL), and arginase 1 (ARG1). (Section 58) 44. The pharmaceutical composition according to claim 43, further comprising one or more lyoprotectants. (Section 59) 59. The pharmaceutical composition of claim 58, wherein the one or more lyoprotectants are selected from the group consisting of sugars and carbohydrates. (Section 60) 59. The pharmaceutical composition of claim 58, wherein the lyoprotectant comprises about 10% sucrose. (Section 61) 59. The pharmaceutical composition of claim 58, wherein the one or more lyoprotectants are selected from the group consisting of sucrose, trehalose, dextran, and inulin. (Section 62) Item 44. The pharmaceutical composition according to item 43, wherein the composition is stable for at least about 1 month when stored at about 4°C. (Section 63) Item 44. The pharmaceutical composition according to item 43, wherein the composition is stable for at least about 6 months when stored at about 4°C. (Section 64) Item 44. The pharmaceutical composition according to item 43, wherein the composition is stable for at least about 6 months when stored at about 25°C. (Section 65) 44. The pharmaceutical composition of claim 43, wherein the biological activity of the mRNA is greater than about 75% of the biological activity observed before lyophilization of the composition. (Section 66) Item 44. The pharmaceutical composition according to item 43, wherein the lipid nanoparticles comprise a cationic lipid, a PEG-modified lipid, a non-cationic lipid, and cholesterol. (Section 67) 44. The pharmaceutical composition according to claim 43, wherein the composition is implanted into a subject. (Section 68) 44. The pharmaceutical composition of claim 43, wherein the composition, upon reconstitution, is administered to a subject by one or more of the following routes of administration: intravenous, oral, rectal, vaginal, transmucosal, sublingual, subdural, nasal, intramuscular, subcutaneous, intramedullary injection, intrathecal, intraventricular, intraperitoneal, intranasal, opthalmically, and intraocular.
Claims
1. 1. A pharmaceutical composition comprising lipid nanoparticles, The pharmaceutical composition, wherein the lipid nanoparticles comprise 1) mRNA, 2) an ionizable cationic lipid, 3) a non-cationic lipid, 4) cholesterol, and 5) a PEG-modified lipid, wherein the mRNA is encapsulated within the aqueous interior of the lipid nanoparticles.
2. 10. The pharmaceutical composition of claim 1, wherein the ionizable cationic lipid comprises one or more cleavable functional groups having one or more functional groups or moieties attached thereto.
3. 10. The pharmaceutical composition of claim 1, wherein the one or more cleavable functional groups are cleavable enzymatically or by reduction, oxidation, or hydrolysis, and optionally the one or more cleavable functional groups comprise disulfide groups, esters, ethers, and / or derivatives thereof (e.g., alkyl esters and aryl esters).
4. 2. The pharmaceutical composition of claim 1, wherein the lipid nanoparticles comprise a cationic lipid selected from the group consisting of ICE ((3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoate), C12-200, and DLinKC2-DMA (2-(2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamine).
5. The pharmaceutical composition according to any one of claims 1 to 4, wherein the lipid nanoparticles comprise a cationic lipid which is ICE ((3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoate).
6. The pharmaceutical composition according to any one of claims 1 to 5, wherein the non-cationic lipid is DS PC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), the pharmaceutical composition is selected from the group consisting of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-dilauroyl-sn-glycero-3-phosphoethanolamine (DLPE), DPPS (1,2-dipalmitoyl-sn-glycero-3-phospho-L-serine), ceramide, and sphingomyelin.
7. 7. The pharmaceutical composition according to any one of claims 1 to 6, wherein the PEG-modified lipid is 1,2-dimyristoyl-sn-glycerol, methoxypolyethylene glycol, 2000 MW PEG (DMG-PEG2000).
8. 7. The pharmaceutical composition according to claim 6, wherein the non-cationic lipid is DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine).
9. 7. The pharmaceutical composition according to claim 6, wherein the non-cationic lipid is DSPE (1,2-distearoyl-sn-glycero-3-phosphoethanolamine).
10. 10. The pharmaceutical composition according to any one of claims 1 to 9, wherein the total cationic lipid is present in an amount of 20 to 70% of the total lipid present in the lipid nanoparticle.
11. 11. The pharmaceutical composition according to any one of claims 1 to 10, wherein the PEG-modified lipid is present in an amount of 1 to 15% of the total lipid present in the lipid nanoparticle.
12. The pharmaceutical composition according to any one of claims 1 to 11, wherein the nucleotide sequence of the mRNA is selected from the group consisting of agalsidase α, α-L-iduronidase, iduronate-2-sulfatase, N-acetylglucosamine-1-phosphate transferase, N-acetylglucosaminidase, α-glucosaminide acetyltransferase, N-acetylglucosamine 6-sulfatase, N-acetylgalactosamine-4-sulfatase, β-glucosidase, galactose-6- The pharmaceutical composition encodes an enzyme selected from the group consisting of sulfate sulfatase, β-galactosidase, β-glucuronidase, glucocerebrosidase, heparan sulfamidase, hyaluronidase and galactocerebrosidase, ornithine transcarbamylase (OTC), carbamoyl-phosphate synthetase 1 (CPS1), argininosuccinate synthetase (ASS1), argininosuccinate lyase (ASL), and arginase 1 (ARG1).
13. 13. The pharmaceutical composition of claim 12, wherein the nucleotide sequence of the mRNA encodes the enzyme ornithine transcarbamylase (OTC).
14. 12. The pharmaceutical composition of any one of claims 1 to 11, wherein the nucleotide sequence of the mRNA encodes cystic fibrosis transmembrane conductance regulator (CFTR) or an enzyme selected from the group consisting of α-L-iduronidase, N-acetylglucosaminidase, α-glucosaminide acetyltransferase, N-acetylglucosamine 6-sulfatase, N-acetylgalactosamine-4-sulfatase, galactose-6-sulfate sulfatase, β-galactosidase, β-glucuronidase, glucocerebrosidase, heparan sulfamidase, and hyaluronidase.
15. 15. The pharmaceutical composition of claim 14, wherein the nucleotide sequence of the mRNA encodes the cystic fibrosis transmembrane conductance regulator (CFTR).
16. 16. The pharmaceutical composition according to any one of claims 1 to 15, which is administered intravenously, orally, rectally, vaginally, transmucosally, sublingually, subdurally, nasally, intramuscularly, subcutaneously, intramedullary, intrathecally, intraventricularly, intraperitoneally, intranasally, ocularly or intraocularly.
Citation Information
Patent Citations
Polyethylene glycol-modified lipid compounds and their uses
JP2007505954A
Improved methods for delivering aminolipids and nucleic acids
JP2012505250A
Amino alcohol lipidoids and their use
JP2012508235A
amphoteric liposomes containing iminolipids
JP2012532839A
Improved amino lipids and methods for the delivery of nucleic acids
WO2010042877A1