Partial peptides of Tcf21 protein for deactivating myofibroblasts

A Tcf21-derived peptide forms a complex with Tcf3 protein to deactivate myofibroblasts, addressing the inadequacies of current treatments for organ fibrosis by regulating gene function and reducing collagen production, thereby treating conditions like liver and pancreatic fibrosis.

JP7723955B2Active Publication Date: 2025-08-15TOKAI UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
JP2021078161
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-04-30
Publication Date
2025-08-15
Estimated Expiration
2041-04-30

AI Technical Summary

Technical Problem

Current treatments for organ fibrosis, such as liver fibrosis, are inadequate in deactivating myofibroblasts, which are key collagen-producing cells contributing to tissue dysfunction, and there is a lack of understanding of the molecular mechanisms for inducing stellate cell deactivation under sustained fibrotic conditions.

Method used

A peptide consisting of a specific amino acid sequence from the Tcf21 protein, along with its encoding polynucleotide, is used to form a complex with Tcf3 protein, binding to target genes and forming a three-dimensional structure to deactivate myofibroblasts, thereby preventing or treating associated diseases.

Benefits of technology

The peptide effectively deactivates myofibroblasts, preventing or treating conditions like liver fibrosis, pancreatic fibrosis, renal fibrosis, pulmonary fibrosis, heart failure, and coronary artery diseases by regulating gene function and reducing collagen production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007723955000001
    Figure 0007723955000001
  • Figure 0007723955000002
    Figure 0007723955000002
  • Figure 0007723955000003
    Figure 0007723955000003
Patent Text Reader

Abstract

To provide a technique for deactivating a myofibroblast.SOLUTION: A peptide consists of an amino acid sequence of 25 residues or more and 30 residues or less in Tcf21 protein, which is necessary for the Tcf21 protein and Tcf3 protein to form a three-dimensional structure that can form and maintain a composite which binds to DNAs of target genes of the proteins and is capable of controlling the functions of the genes, and the peptide has a function of deactivating a myofibroblast expressing Tcf3 protein.SELECTED DRAWING: Figure 2
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a partial peptide of Tcf21 protein for deactivating myofibroblasts. do. [Background technology]

[0002] Organ fibrosis, as exemplified by liver cirrhosis, is a pathological condition in which excessive deposition of matrix components, including collagen, in organs and tissues leads to organ and tissue dysfunction. In the liver, stellate cells are the main collagen-producing cells, and when liver inflammation occurs, stellate cells are transformed (activated) from quiescent vitamin A-storing cells into collagen-producing myofibroblasts. Many attempts have been made to treat liver fibrosis to date, including suppressing inflammation, inhibiting stellate cell activation, and suppressing collagen production by activated stellate cells (e.g., Patent Documents 1 to 3), but none of these have yet been put to clinical use.

[0003] On the other hand, recent basic research using mice with liver fibrosis has reported that when fibrotic stimuli are discontinued, approximately half of the activated stellate cells are "deactivated" and return to a state close to quiescence (Non-Patent Documents 1-2). However, whether stellate cell deactivation can be artificially induced under conditions where liver fibrotic stimuli are sustained and elucidating the molecular mechanism that induces deactivation remain major challenges in aiming for therapeutic applications.

[0004] Tcf21 (transcription factor 21) is a known transcription factor. It has been reported that it forms a dimer with Tcf3, a member of the basic helix-loop-helix (bHLH) transcription factor family, and regulates the expression of target genes by binding to DNA (Non-patent Document 3). The present inventors have found that Tcf21 expression gradually increases during the functional maturation of immature fetal hepatic stellate cells, while its expression significantly decreases in activated hepatic stellate cells that have transformed into myofibroblast-like cells. Focusing on this, we have developed and reported a method for deactivating activated hepatic stellate cells, which includes the step of introducing the Tcf21 gene and / or Tcf21 protein into activated hepatic stellate cells (Patent Documents 4 and 5). We have also reported that inducing deactivation of activated hepatic stellate cells can prevent or treat hepatitis, liver fibrosis, cirrhosis, or liver cancer, or liver failure caused by any of these diseases (Patent Documents 4 and 5, Non-Patent Document 6).

[0005] Stellate cells are present not only in the liver but also in the pancreas and are known to play an important role in the onset and progression of pancreatic fibrosis (Non-Patent Document 7). It has also been reported that myofibroblasts are the origin of collagen-producing cells present in the kidney (Non-Patent Document 8), lung (Non-Patent Document 9), heart (Non-Patent Document 10), and coronary artery (Non-Patent Document 11). Among these, for example, abnormal expression (decreased expression level) of Tcf21 in activated myofibroblasts has been confirmed in cardiac fibrosis (Non-Patent Document 12) and coronary atherosclerosis (Non-Patent Document 13). It has been recognized that Tcf21 expression in coronary artery smooth muscle cells suppresses the progression of atherosclerosis. It has been reported that it may work. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] Japanese Patent Application Publication No. 2019-150075 [Patent Document 2] Japanese Patent Application Publication No. 2019-108291 [Patent Document 3] Japanese Patent Publication No. 2020-070250 [Patent Document 4] International Publication No. 2020 / 121546 [Patent Document 5] International Publication No. 2020 / 121366 [Non-patent literature]

[0007] [Non-licensed document 1] Proc. Natl. Acad. Sci. USA., 2012 Jun 12;109(24):9448-53. [Non-licensed document 2] Gastroenterology., 2012 Oct;143(4):1073-1083. [Non-licensed document 3] Mech. Dev., 1998 Apr; 73(1):23-32.

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

Non-licensed Document 7

Non-licensed literature 9

Non-licensed literature 10

Non-licensed Document 11

Non-licensed Document 12

Non-licensed Document 13

[0008] An objective of the present invention is to provide a technique for deactivating myofibroblasts. [Means for solving the problem]

[0009] As a result of extensive research to achieve the above object, the present inventors have discovered that a specific The present inventors have found that the above-mentioned problems can be solved by using a peptide consisting of a specific amino acid sequence and / or a polynucleotide encoding the same, and have thus completed the present invention.

[0010] The present invention provides a peptide consisting of an amino acid sequence of 25 to 30 residues in the Tcf21 protein, which is necessary for the Tcf21 protein and the Tcf3 protein to bind to the DNA of their target genes and form and maintain a three-dimensional structure that can form and maintain a complex that can control the function of the gene. and has the function of deactivating myofibroblasts that express Tcf3 protein. In a preferred embodiment, the peptide comprises the amino acid sequence shown in SEQ ID NO:2. In a preferred embodiment, the peptide is a peptide consisting of the amino acid sequence shown in SEQ ID NO:1.

[0011] The present invention can provide a polynucleotide encoding the peptide.

[0012] The present invention provides a peptide consisting of an amino acid sequence of 25 to 30 residues in the Tcf21 protein, which is necessary for the Tcf21 protein and the Tcf3 protein to bind to the DNA of their target genes and form and maintain a three-dimensional structure that can form and maintain a complex that can control the function of the gene. and / or a polynucleotide encoding the same, for the prevention or treatment of a disease that can be prevented or treated by deactivating myofibroblasts that express Tcf3 protein. In a preferred embodiment, the pharmaceutical composition is used in combination with a composition containing a Tcf3 protein and / or a polynucleotide encoding the same. The pharmaceutical composition is characterized in that the Tcf21 protein and the Tcf3 protein bind to their target genes. It has a three-dimensional structure that can bind to the DNA of a gene and form and maintain a complex that can control the function of the gene. An amino acid sequence of 25 to 30 residues in the Tcf21 protein necessary for the formation of In a preferred embodiment, the peptide comprises the amino acid sequence represented by SEQ ID NO: 2. There are. The pharmaceutical composition is characterized in that the Tcf21 protein and the Tcf3 protein bind to their target genes. It has a three-dimensional structure that can bind to the DNA of a gene and form and maintain a complex that can control the function of the gene. An amino acid sequence of 25 to 30 residues in the Tcf21 protein necessary for the formation of In a preferred embodiment, the peptide comprising the amino acid sequence shown in SEQ ID NO:1. In a preferred embodiment, the pharmaceutical composition is directed to a disease that can be prevented or treated by deactivating myofibroblasts that express the Tcf3 protein, wherein the disease is selected from the group consisting of the following (a) to (f): (a) Hepatitis, liver fibrosis, cirrhosis, or liver cancer, or liver failure due to any of these diseases; (b) pancreatitis, pancreatic fibrosis, or pancreatic secretory insufficiency due to any of these diseases; (c) nephritis, renal fibrosis, or glomerulosclerosis, or renal failure due to any of these diseases; (d) Interstitial pneumonia, pulmonary fibrosis, or respiratory failure due to any of these diseases; (e) fibrosis after myocardial infarction; myocarditis; or cardiomyopathy, or heart failure due to any of these diseases; (f) Coronary artery stenosis due to arterial atherosclerosis, restenosis of the coronary artery after balloon dilatation, or restenosis of the coronary artery after stent placement, or ischemic heart disease due to any of these diseases.

[0013] The present invention provides a peptide consisting of an amino acid sequence of 25 to 30 residues in the Tcf21 protein, which is necessary for the Tcf21 protein and the Tcf3 protein to bind to the DNA of their target genes and form and maintain a three-dimensional structure that can form and maintain a complex that can control the function of the gene. and / or a polynucleotide encoding the same into myofibroblasts that express Tcf3 protein. In a preferred embodiment, the method further comprises the step of introducing Tcf3 protein and / or a polynucleotide encoding it into myofibroblasts that express the Tcf3 protein. The method involves isolating a peptide consisting of an amino acid sequence of 25 to 30 residues in the Tcf21 protein, which is necessary for the Tcf21 protein and the Tcf3 protein to bind to the DNA of their target genes and form and maintain a three-dimensional structure that allows the Tcf21 protein and the Tcf3 protein to form and maintain a complex that can regulate the function of the gene. In a preferred embodiment, the peptide comprises the amino acid sequence shown in SEQ ID NO:2. The method involves isolating a peptide consisting of an amino acid sequence of 25 to 30 residues in the Tcf21 protein, which is necessary for the Tcf21 protein and the Tcf3 protein to bind to the DNA of their target genes and form and maintain a three-dimensional structure that allows the Tcf21 protein and the Tcf3 protein to form and maintain a complex that can regulate the function of the gene. In a preferred embodiment, the peptide is a peptide consisting of the amino acid sequence shown in SEQ ID NO:1. In a preferred embodiment of the method, the Tcf3 protein-expressing myofibroblasts are Tcf3 protein-expressing myofibroblasts in one or more organs or tissues selected from the group consisting of the liver, pancreas, kidney, lung, heart, and coronary artery.

[0014] The present invention provides a peptide consisting of an amino acid sequence of 25 to 30 residues in the Tcf21 protein, which is necessary for the Tcf21 protein and the Tcf3 protein to bind to the DNA of their target genes and form and maintain a three-dimensional structure that can form and maintain a complex that can control the function of the gene. and / or a method for producing deactivated myofibroblasts, which comprises the step of introducing a polynucleotide encoding the same into myofibroblasts that express Tcf3 protein. In a preferred embodiment, the production method further comprises the step of introducing Tcf3 protein and / or a polynucleotide encoding it into myofibroblasts that express the Tcf3 protein. The production method includes a method for producing a Tcf21 protein comprising an amino acid sequence of 25 to 30 residues in the Tcf21 protein, which is necessary for the Tcf21 protein and the Tcf3 protein to bind to the DNA of their target genes and form and maintain a three-dimensional structure that can form and maintain a complex that can control the function of the gene. In a preferred embodiment, the peptide contains the amino acid sequence shown in SEQ ID NO:2. The production method includes a method for producing a Tcf21 protein comprising an amino acid sequence of 25 to 30 residues in the Tcf21 protein, which is necessary for the Tcf21 protein and the Tcf3 protein to bind to the DNA of their target genes and form and maintain a three-dimensional structure that can form and maintain a complex that can control the function of the gene. In a preferred embodiment, the peptide is a peptide consisting of the amino acid sequence shown in SEQ ID NO:1. In a preferred embodiment of the production method, the Tcf3 protein-expressing myofibroblasts are Tcf3 protein-expressing myofibroblasts in one or more organs or tissues selected from the group consisting of the liver, pancreas, kidney, lung, heart, and coronary artery. [Effects of the Invention]

[0015] According to the present invention, a technique for deactivating myofibroblasts can be provided. Furthermore, according to the present invention, by deactivating myofibroblasts in fibrotic organs or tissues, it becomes possible to prevent or treat various myofibroblast-associated diseases. [Brief explanation of the drawings]

[0016] [Figure 1] A graph showing the promoter activity of the wild-type (WT) COL1A2 gene and the promoter activity of the mutant (dE) COL1A2 gene when Tcf21 protein and Tcf3 protein are overexpressed, either alone or together, in one embodiment of the present invention. [Figure 2] A graph showing the promoter activity of the wild-type (WT) COL1A2 gene when a peptide consisting of the amino acid sequence represented by SEQ ID NO: 1 and Tcf3 protein are overexpressed, either alone or together, in one embodiment of the present invention. [Figure 3] A graph showing the promoter activity of the wild-type (WT) COL1A2 gene when three mutants in which the amino acid sequence represented by SEQ ID NO: 2 in a peptide consisting of the amino acid sequence represented by SEQ ID NO: 1 in one embodiment of the present invention has been mutated, and Tcf3 protein are overexpressed, either alone or together. DETAILED DESCRIPTION OF THE INVENTION

[0017] In this specification, different SEQ ID NOs are assigned when the amino acid sequences are different, but even if the amino acid sequences are the same, when the objects from which they are derived are different, the same or different SEQ ID NOs may be assigned. This also applies to nucleotide sequences.

[0018] <Method for deactivating myofibroblasts> One aspect of the present invention is a method for identifying a target gene for Tcf21 protein and a target gene for Tcf3 protein, comprising an amino acid sequence of 25 to 30 residues in the Tcf21 protein, which is necessary for the Tcf21 protein to bind to the DNA of the target gene and form and maintain a three-dimensional structure that can regulate the function of the gene. A method for deactivating myofibroblasts, comprising the step of introducing a peptide and / or a polynucleotide encoding the same into myofibroblasts that express Tcf3 protein.

[0019] In this embodiment, a peptide consisting of an amino acid sequence of 25 to 30 residues in the Tcf21 protein is required for the Tcf21 protein and Tcf3 protein to bind to the DNA of their target genes and form and maintain a three-dimensional structure that can form and maintain a complex that can control the function of the gene. The peptide (hereinafter sometimes referred to as the peptide according to this embodiment) is a peptide that, when introduced into myofibroblasts expressing the Tcf3 protein, induces the Tcf21 protein and the Tcf3 protein. They bind to the DNA of these target genes, forming and maintaining complexes that can regulate the function of those genes. There are no particular limitations as long as the myofibroblasts are deactivated while forming a three-dimensional structure that can be obtained by the method.

[0020] The N-terminal amino acid and the C-terminal amino acid of the peptide according to this embodiment are not particularly limited, but they are selected from the group consisting of those that bind to the DNA of the target gene, form and maintain a complex that can regulate the function of the gene, and From the viewpoint of facilitating the formation of a three-dimensional structure, the N-terminal amino acid is preferably leucine, and the C-terminal amino acid is preferably glutamine.

[0021] The amino acid sequence of the peptide according to this embodiment is the same as that of the Tcf21 protein derived from the subject to be administered. It is preferable that the amino acid sequence is a partial peptide of the above.

[0022] For example, the amino acid sequence of mouse Tcf21 protein (full length) can be used as a reference. The amino acid sequence of mouse Tcf21 protein (full length) is, for example, SEQ ID NO: 3. An example of an amino acid sequence that can be used as a reference is the amino acid sequence (NCBI accession no. NP_035675.1) of the peptide of this embodiment. Therefore, the amino acid sequence of the peptide according to this embodiment may be a peptide consisting of 25 to 30 amino acid residues of the amino acid sequence corresponding to the amino acid sequence shown in SEQ ID NO:3. If the amino acid sequence of the target Tcf21 protein (full length) has been identified, This can be determined by comparing the amino acid sequence of the Tcf21 protein (full length) of the subject with the amino acid sequence of the Tcf21 protein (full length) of the subject. The amino acid sequence represented by SEQ ID NO: 3 includes the amino acid sequence from the 114th to the 118th positions (the amino acid sequence represented by SEQ ID NO: 2 (KLSKL)), and also includes the amino acid sequence from the 106th to the 133rd positions. The amino acid sequence (LPWVPPDTKLSKLDTLRLASSYIAHLRQ) represented by SEQ ID NO: 1) is included. Therefore, it is preferably a peptide consisting of an amino acid sequence of 25 to 30 residues, which contains an amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of an amino acid sequence of 25 to 30 residues in an amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 3, which contains an amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of an amino acid sequence corresponding to the amino acid sequence shown in SEQ ID NO:1. Furthermore, when the subject is a mouse, the "amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 2" may be the "amino acid sequence represented by SEQ ID NO: 2," the "amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 3" may be the "amino acid sequence represented by SEQ ID NO: 3," and the "amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 1" may be the "amino acid sequence represented by SEQ ID NO: 1."

[0023] Furthermore, in this specification, the term "xth amino acid" refers to the "xth amino acid" when the N-terminal amino acid in an amino acid sequence is counted as the "first amino acid," as defined in the art.

[0024] When the subject is a mouse, the amino acid sequence of the mouse Tcf21 protein (full length) is An example is the amino acid sequence represented by SEQ ID NO: 3 (NCBI accession No. NP_035675.1), and therefore the peptide may be a peptide consisting of an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 3. The amino acid sequence represented by SEQ ID NO: 3 includes the amino acid sequence from positions 114 to 118 (the amino acid sequence represented by SEQ ID NO: 2) and also includes the amino acid sequence from positions 106 to 133 (the amino acid sequence represented by SEQ ID NO: 1). Therefore, it is preferably a peptide consisting of an amino acid sequence of 25 to 30 residues, including the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 3, which includes the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of the amino acid sequence shown in SEQ ID NO:1.

[0025] When the subject is a human, the amino acid sequence of the human Tcf21 protein (full length) is: An example is the amino acid sequence represented by SEQ ID NO: 4 (NCBI accession No. NP_938206.1 and NCBI accession No. NP_003197.2), and therefore the peptide may consist of an amino acid sequence of 25 to 30 residues of the amino acid sequence represented by SEQ ID NO: 4. The amino acid sequence represented by SEQ ID NO: 4 includes the amino acid sequence from positions 114 to 118 (the amino acid sequence represented by SEQ ID NO: 2) and also includes the amino acid sequence from positions 106 to 133 (the amino acid sequence represented by SEQ ID NO: 1). Therefore, it is preferably a peptide consisting of an amino acid sequence of 25 to 30 residues, including the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 4, which includes the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of the amino acid sequence shown in SEQ ID NO:1.

[0026] When the subject is a rat, the amino acid sequence of rat Tcf21 protein (full length) is The amino acid sequence shown in SEQ ID NO: 5 (NCBI accession No. NP_001027569.1) is an example. Therefore, the peptide may be a peptide consisting of an amino acid sequence of 25 to 30 residues of the amino acid sequence shown in SEQ ID NO:5. The amino acid sequence represented by SEQ ID NO: 5 includes the amino acid sequence from positions 114 to 118 (the amino acid sequence represented by SEQ ID NO: 2) and also includes the amino acid sequence from positions 106 to 133 (the amino acid sequence represented by SEQ ID NO: 1). Therefore, it is preferably a peptide consisting of an amino acid sequence of 25 to 30 residues, including the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 5, including the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of the amino acid sequence shown in SEQ ID NO:1.

[0027] When the subject is a dog, the amino acid sequence of the canine Tcf21 protein (full length) is: An example is the amino acid sequence represented by SEQ ID NO: 6 (NCBI accession No. XP_541110.3), and therefore the peptide may be one consisting of an amino acid sequence of 25 to 30 residues of the amino acid sequence represented by SEQ ID NO: 6. The amino acid sequence represented by SEQ ID NO: 6 includes the amino acid sequence from positions 114 to 118 (the amino acid sequence represented by SEQ ID NO: 2) and also includes the amino acid sequence from positions 106 to 133 (the amino acid sequence represented by SEQ ID NO: 1). Therefore, it is preferably a peptide consisting of an amino acid sequence of 25 to 30 residues, including the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 6, which includes the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of the amino acid sequence shown in SEQ ID NO:1.

[0028] When the subject is a cat, the amino acid sequence of the feline Tcf21 protein (full length) is: The amino acid sequence shown in SEQ ID NO: 7 (NCBI accession No. XP_006932094.1) is an example. Therefore, it may be a peptide consisting of an amino acid sequence of 25 to 30 residues of the amino acid sequence shown in SEQ ID NO:7. Furthermore, the amino acid sequence represented by SEQ ID NO: 7 includes the amino acid sequence from positions 114 to 118 (the amino acid sequence represented by SEQ ID NO: 2), and also includes the amino acid sequence from positions 106 to 133 (the amino acid sequence represented by SEQ ID NO: 1). Therefore, it is preferably a peptide consisting of an amino acid sequence of 25 to 30 residues, including the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 7, including the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of the amino acid sequence shown in SEQ ID NO:1.

[0029] When the subject is a rabbit, the amino acid sequence of the rabbit Tcf21 protein (full length) is The amino acid sequence shown in SEQ ID NO: 8 (NCBI accession No. XP_008261760.1) is an example. Therefore, the peptide may be a peptide consisting of an amino acid sequence of 25 to 30 residues of the amino acid sequence shown in SEQ ID NO:8. The amino acid sequence represented by SEQ ID NO: 8 includes the amino acid sequence from positions 114 to 118 (the amino acid sequence represented by SEQ ID NO: 2) and also includes the amino acid sequence from positions 106 to 133 (the amino acid sequence represented by SEQ ID NO: 1). Therefore, it is preferably a peptide consisting of an amino acid sequence of 25 to 30 residues, including the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 8, which includes the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of the amino acid sequence shown in SEQ ID NO:1.

[0030] When the subject is a cow, the amino acid sequence of the bovine Tcf21 protein (full length) is: The amino acid sequence shown in SEQ ID NO: 9 (NCBI accession No. NP_001014899.1) is an example. Therefore, it may be a peptide consisting of an amino acid sequence of 25 to 30 residues of the amino acid sequence shown in SEQ ID NO:9. The amino acid sequence represented by SEQ ID NO: 9 includes the amino acid sequence from positions 114 to 118 (the amino acid sequence represented by SEQ ID NO: 2) and also includes the amino acid sequence from positions 106 to 133 (the amino acid sequence represented by SEQ ID NO: 1). Therefore, it is preferably a peptide consisting of an amino acid sequence of 25 to 30 residues, including the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 9, which includes the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of the amino acid sequence shown in SEQ ID NO:1.

[0031] When the subject is a horse, the amino acid sequence of the horse Tcf21 protein (full length) is: The amino acid sequence shown in SEQ ID NO: 10 (NCBI accession No. XP_001504420.1) is an example. Therefore, it may be a peptide consisting of an amino acid sequence of 25 to 30 residues inclusive of the amino acid sequence shown in SEQ ID NO:10. The amino acid sequence represented by SEQ ID NO: 10 includes the amino acid sequence from positions 114 to 118 (the amino acid sequence represented by SEQ ID NO: 2) and also includes the amino acid sequence from positions 106 to 133 (the amino acid sequence represented by SEQ ID NO: 1). Therefore, it is preferably a peptide consisting of an amino acid sequence of 25 to 30 residues, including the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 10, which includes the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of the amino acid sequence shown in SEQ ID NO:1.

[0032] When the subject is a goat, the amino acid sequence of the goat Tcf21 protein (full length) is: The amino acid sequence shown in SEQ ID NO: 11 (NCBI accession No. XP_005684836.1) is an example. Therefore, it may be a peptide consisting of an amino acid sequence of 25 to 30 residues of the amino acid sequence shown in SEQ ID NO:11. The amino acid sequence represented by SEQ ID NO: 11 includes the 114th to 118th amino acid sequence (sequence The amino acid sequence of the 106th to 133rd amino acids (the amino acid sequence of SEQ ID NO: 1) is also included. Therefore, it is preferably a peptide consisting of an amino acid sequence of 25 to 30 residues, including the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 11, which includes the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of the amino acid sequence shown in SEQ ID NO:1.

[0033] When the subject is a sheep, the amino acid sequence of the sheep Tcf21 protein (full length) is The amino acid sequence shown in SEQ ID NO: 12 (NCBI accession No. XP_027828288.1) was Therefore, the peptide may be a peptide consisting of an amino acid sequence of 25 to 30 residues inclusive of the amino acid sequence shown in SEQ ID NO:12. The amino acid sequence represented by SEQ ID NO: 12 includes the amino acid sequence from positions 114 to 118 (the amino acid sequence represented by SEQ ID NO: 2), and also includes the amino acid sequence from positions 106 to 133 (the amino acid sequence represented by SEQ ID NO: 1). Therefore, it is preferably a peptide consisting of an amino acid sequence of 25 to 30 residues, including the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 12, which includes the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of the amino acid sequence shown in SEQ ID NO:1.

[0034] When the subject is a pig, the amino acid sequence of the pig Tcf21 protein (full length) is: The amino acid sequence shown in SEQ ID NO: 13 (NCBI accession No. XP_020943327.1) is an example. Therefore, it may be a peptide consisting of an amino acid sequence of 25 to 30 residues of the amino acid sequence shown in SEQ ID NO:13. The amino acid sequence represented by SEQ ID NO: 13 includes the amino acid sequence from positions 114 to 118 (the amino acid sequence represented by SEQ ID NO: 2) and also includes the amino acid sequence from positions 106 to 133 (the amino acid sequence represented by SEQ ID NO: 1). Therefore, it is preferably a peptide consisting of an amino acid sequence of 25 to 30 residues, including the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 13, which includes the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of the amino acid sequence shown in SEQ ID NO:1.

[0035] When the subject is a chicken, the amino acid sequence of chicken Tcf21 protein (full length) and the amino acid sequence represented by SEQ ID NO: 14 (NCBI accession No. NP_001264640.1). Therefore, the peptide may be a peptide consisting of an amino acid sequence of 25 to 30 residues inclusive of the amino acid sequence shown in SEQ ID NO:14. The amino acid sequence represented by SEQ ID NO: 14 includes the amino acid sequence from positions 114 to 118 (the amino acid sequence represented by SEQ ID NO: 2) and also includes the amino acid sequence from positions 106 to 133 (the amino acid sequence represented by SEQ ID NO: 1). Therefore, it is preferably a peptide consisting of an amino acid sequence of 25 to 30 residues, including the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 14, which includes the amino acid sequence represented by SEQ ID NO: 2, More preferably, it is a peptide consisting of the amino acid sequence shown in SEQ ID NO:1.

[0036] In addition, when introduced into myofibroblasts expressing Tcf3 protein, Tcf21 protein and Tcf3 proteins bind to the DNA of their target genes and regulate the function of those genes. The myofibroblasts are deactivated by forming a three-dimensional structure that can form and maintain a complex that can be deactivated. The amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 1 is not limited to the same sequence, as long as it is synthesized, but may be a peptide consisting of an amino acid sequence that has 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more identity to the amino acid sequence represented by SEQ ID NO: 1. Alternatively, the peptide may be an amino acid sequence in which one or more amino acids have been substituted or deleted, or one or more amino acids have been inserted or added, from the amino acid sequence corresponding to the amino acid sequence shown in SEQ ID NO: 1. Here, "one or more" preferably means one to three, more preferably one to two, and even more preferably one. The same applies when an amino acid is added to the N-terminus and / or C-terminus.

[0037] The peptide of this embodiment is not particularly limited as long as, when introduced into myofibroblasts expressing Tcf3 protein, it forms a three-dimensional structure that allows the Tcf21 protein and Tcf3 protein to bind to the DNA of their target genes and form and maintain a complex that can control the function of the gene, and the myofibroblasts are deactivated. However, when the subject is a mouse, human, rat, dog, cat, rabbit, cow, horse, goat, sheep, pig, or chicken, the amino acid sequence represented by SEQ ID NO: 1 is not limited to the same sequence, and the peptide may be a peptide consisting of an amino acid sequence that is 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more identical to the amino acid sequence represented by SEQ ID NO: 1. Alternatively, the peptide may be an amino acid sequence in which one or more amino acids have been substituted or deleted, or one or more amino acids have been inserted or added, from the amino acid sequence represented by SEQ ID NO: 1. Here, "one or more" refers to, in order of increasing preference, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2, and 1. The same applies when amino acids are added to the N-terminus and / or C-terminus.

[0038] Conservative substitution is preferred. Conservative substitution means substitution between Phe, Trp, and Tyr when the substitution site is an aromatic amino acid, between Leu, Ile, and Val when the substitution site is a hydrophobic amino acid, between Gln and Asn when the substitution site is a polar amino acid, and between Lys when the substitution site is a basic amino acid. It refers to the substitution between Arg and His, between Asp and Glu in the case of acidic amino acids, and between Ser and Thr in the case of amino acids having a hydroxyl group. Conservative substitutions include, for example, substitution of Ala with Ser or Thr, substitution of Arg with Gln, His or Lys, substitution of Asn with Glu, Gln, Lys, His or Asp, substitution of Asp with Asn, Glu or Gln, and the like. substitution of Cys with Ser or Ala; substitution of Gln with Asn, Glu, Lys, His, Asp or Arg; substitution of Glu with Gly, Asn, Gln, Lys or Asp; substitution of Gly with Pro; substitution of His with Asn, Lys , substitution of Gln, Arg, or Tyr, substitution of Ile with Leu, Met, Val, or Phe, substitution of Leu with Ile, Met , substitution of Val or Phe, substitution of Lys with Asn, Glu, Gln, His or Arg, substitution of Met with Ile, Leu Substitutions of Ser with Thr or Ala, substitution of Thr with Ser or Ala, substitution of Trp with Phe or Tyr, substitution of Tyr with His, Phe or Trp, and substitution of Val with Met, Ile or Leu are included, but are not limited to these. I can't.

[0039] As will be described later, when the method further includes a step of introducing Tcf3 protein and / or a polynucleotide encoding the same into myofibroblasts that express the Tcf3 protein, the amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 2 can be used in combination with Tcf21 protein (full length) and / or a polynucleotide encoding the same, whether or not the amino acid sequence is identical to the amino acid sequence represented by SEQ ID NO: 2. When the vector is introduced into myofibroblasts expressing the Tcf3 protein, the myofibroblasts can be more effectively deactivated. The same applies to the amino acid sequence represented by SEQ ID NO: 2. In this case, the amino acid sequence represented by SEQ ID NO: 2 (KLSKL) is not limited to this sequence, and may be, for example, ALSKL (SEQ ID NO: 15) or KLSAL (SEQ ID NO: 16). It is desirable that at least one of the first and fourth residues is K, but it is also desirable that ALSAL (SEQ ID NO: 16) is K. 17) may also be used.

[0040] The peptide according to this embodiment may be modified, including, but not limited to, amidation, addition of a lipid chain (aliphatic acylation (palmitoylation, myristoylation, etc.), prenylation (farnesylation, geranylgeranylation, etc.)), phosphorylation (phosphorylation of serine residues, threonine residues, tyrosine residues, etc.), acetylation, addition of a sugar chain (N-glycosylation, O-glycosylation), etc.

[0041] The peptide according to this embodiment may have an amino acid sequence added thereto that allows it to be selectively delivered to organs or tissues containing myofibroblasts that express the Tcf3 protein. For example, such an amino acid sequence includes the amino acid sequence described in Nature Communications 3:951 doi: 10.1038 / ncomms1952.2012 Kondo Examples include the amino acid sequences described in E.

[0042] The peptide according to this embodiment can be produced, for example, by constructing a recombinant expression vector using the polynucleotide according to this embodiment described below, introducing it into a host, expressing it, and purifying it. Alternatively, the peptide can be artificially synthesized. In either case, known techniques can be used.

[0043] The peptide according to this embodiment can be introduced into myofibroblasts expressing Tcf3 protein using known introduction techniques that utilize, for example, liposomes or exosomes.

[0044] In this embodiment, a peptide consisting of an amino acid sequence of 25 to 30 residues in the Tcf21 protein is required for the Tcf21 protein and Tcf3 protein to bind to the DNA of their target genes and form and maintain a three-dimensional structure that can form and maintain a complex that can control the function of the gene. The polynucleotide encoding the peptide according to this embodiment (hereinafter sometimes referred to as the polynucleotide according to this embodiment) is not particularly limited, as long as it produces the peptide according to this embodiment and exerts an action similar to that of the peptide according to this embodiment when introduced into myofibroblasts that express the Tcf3 protein. Furthermore, the base sequence of the polynucleotide according to this embodiment may be a base sequence that includes an untranslated region, or may be a base sequence that does not include an untranslated region (e.g., a cDNA sequence that encodes the peptide according to this embodiment), as long as the peptide according to this embodiment is produced when introduced into myofibroblasts that express Tcf3 protein. It would be readily apparent to a person skilled in the art at the time of filing of this application that the base sequence of the polynucleotide according to this embodiment can be designed based on the amino acid sequence of the peptide according to this embodiment described above.

[0045] The polynucleotide according to this embodiment is a portion of a Tcf21 protein derived from a subject to be administered. Preferably, it is a polynucleotide that encodes the amino acid sequence of the peptide.

[0046] For example, a base sequence encoding the amino acid sequence of the mouse Tcf21 protein (full length) is used. For example, mouse Tcf21 protein (full length) (represented by SEQ ID NO: 3) can be used as a reference. For example, a polynucleotide encoding the amino acid sequence represented by SEQ ID NO: 18 (NCBI accession No. NP_035675.1) is a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 18 (NCBI accession No. NM_011545.2), and therefore this sequence can be used as a reference. This may also be a polynucleotide consisting of a nucleotide sequence encoding an amino acid sequence of 25 to 30 residues inclusive of the amino acid sequence represented by SEQ ID NO: 3. If the amino acid sequence of the target Tcf21 protein (full length) has been identified, The base sequence can be one that encodes an amino acid sequence determined by comparing the amino acid sequence of the Tcf21 protein (full length) of interest with the Tcf21 protein (full length) of the target. Therefore, it is preferable that the polynucleotide is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues including an amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 2," More preferably, it is a polynucleotide consisting of a nucleotide sequence encoding "an amino acid sequence of 25 to 30 residues in an amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 3, including an amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 2," More preferably, it is a polynucleotide consisting of a base sequence that encodes "an amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 1." Furthermore, when the subject is a mouse, the "amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 2" may be the "amino acid sequence represented by SEQ ID NO: 2," the "amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 3" may be the "amino acid sequence represented by SEQ ID NO: 3," and the "amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 1" may be the "amino acid sequence represented by SEQ ID NO: 1."

[0047] When the subject is a mouse, the mouse Tcf21 protein (full length) (represented by SEQ ID NO: 3) For example, the polynucleotide encoding the amino acid sequence represented by SEQ ID NO: 18 (NCBI accession No. NP_035675.1) may be a polynucleotide consisting of a base sequence encoding an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 3. Preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues including the amino acid sequence represented by SEQ ID NO: 2", More preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 3, including the amino acid sequence represented by SEQ ID NO: 2," More preferably, it is a polynucleotide consisting of a base sequence that encodes the "amino acid sequence represented by SEQ ID NO: 1."

[0048] When the subject is a human, human Tcf21 protein (full length) (represented by SEQ ID NO: 4) For example, a polynucleotide encoding the amino acid sequence (NCBI accession No. NP_938206.1 or NCBI accession No. NP_003197.2) may be a polynucleotide consisting of the base sequence represented by SEQ ID NO: 19 (NCBI accession No. NM_198392.3), and the polynucleotide may be a polynucleotide consisting of a base sequence encoding an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 19. Preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues including the amino acid sequence represented by SEQ ID NO: 2", More preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 4, including the amino acid sequence represented by SEQ ID NO: 2," More preferably, it is a polynucleotide consisting of a base sequence that encodes the "amino acid sequence represented by SEQ ID NO: 1."

[0049] When the subject is a rat, rat Tcf21 protein (full length) (represented by SEQ ID NO: 5) The polynucleotide encoding the amino acid sequence (NCBI accession No. NP_001027569.1) For example, the polynucleotide is a polynucleotide consisting of the base sequence represented by SEQ ID NO: 20 (NCBI accession No. NM_001032397.1), and the amino acid sequence represented by SEQ ID NO: 20 is It may be a polynucleotide consisting of a base sequence encoding an amino acid sequence of 25 to 30 residues. Preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues including the amino acid sequence represented by SEQ ID NO: 2", More preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 5, including the amino acid sequence represented by SEQ ID NO: 2," More preferably, it is a polynucleotide consisting of a base sequence that encodes the "amino acid sequence represented by SEQ ID NO: 1."

[0050] When the subject is a dog, canine Tcf21 protein (full length) (represented by SEQ ID NO: 6) For example, a polynucleotide encoding the amino acid sequence (NCBI accession No. XP_541110.3) may be a polynucleotide consisting of the base sequence represented by SEQ ID NO: 21 (NCBI accession No. XM_541110.7), and the polynucleotide may be a polynucleotide consisting of a base sequence encoding an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 21. Preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues including the amino acid sequence represented by SEQ ID NO: 2", More preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 6, including the amino acid sequence represented by SEQ ID NO: 2," More preferably, it is a polynucleotide consisting of a base sequence that encodes the "amino acid sequence represented by SEQ ID NO: 1."

[0051] When the subject is a cat, feline Tcf21 protein (full length) (represented by SEQ ID NO: 7) A polynucleotide encoding the amino acid sequence (NCBI accession no. XP_006932094.1) As an example, the base sequence represented by SEQ ID NO: 22 (NCBI accession No. XM_006932032.4 ), and may be a polynucleotide consisting of a base sequence encoding an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO:22. Preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues including the amino acid sequence represented by SEQ ID NO: 2", More preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 7, including the amino acid sequence represented by SEQ ID NO: 2," More preferably, it is a polynucleotide consisting of a base sequence that encodes the "amino acid sequence represented by SEQ ID NO: 1."

[0052] When the subject is a rabbit, rabbit Tcf21 protein (full length) (represented by SEQ ID NO: 8) The polynucleotide encoding the amino acid sequence (NCBI accession No. XP_008261760.1) For example, the polynucleotide is a polynucleotide consisting of the base sequence represented by SEQ ID NO: 23 (NCBI accession No. XM_008263538.2), and the amino acid sequence represented by SEQ ID NO: 23 is It may be a polynucleotide consisting of a base sequence encoding an amino acid sequence of 25 to 30 residues. Preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues including the amino acid sequence represented by SEQ ID NO: 2", More preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 8, including the amino acid sequence represented by SEQ ID NO: 2," More preferably, it is a polynucleotide consisting of a base sequence that encodes the "amino acid sequence represented by SEQ ID NO: 1."

[0053] When the subject is a cow, bovine Tcf21 protein (full length) (represented by SEQ ID NO: 9) The polynucleotide encoding the amino acid sequence (NCBI accession no. NP_001014899.1) As an example, the base sequence represented by SEQ ID NO: 24 (NCBI accession No. NM_001014899.1 ), and may be a polynucleotide consisting of a base sequence encoding an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO:24. Preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues including the amino acid sequence represented by SEQ ID NO: 2", More preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 9, including the amino acid sequence represented by SEQ ID NO: 2," More preferably, it is a polynucleotide consisting of a base sequence that encodes the "amino acid sequence represented by SEQ ID NO: 1."

[0054] When the subject is a horse, horse Tcf21 protein (full length) (represented by SEQ ID NO: 10) A polynucleotide encoding the amino acid sequence (NCBI accession no. XP_001504420.1) For example, the polynucleotide is a polynucleotide consisting of the base sequence represented by SEQ ID NO: 25 (NCBI accession No. XM_001504370.6), and the polynucleotide is a polynucleotide consisting of a base sequence encoding an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 25. It's okay. Preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues including the amino acid sequence represented by SEQ ID NO: 2", More preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 10, including the amino acid sequence represented by SEQ ID NO: 2," More preferably, it is a polynucleotide consisting of a base sequence that encodes the "amino acid sequence represented by SEQ ID NO: 1."

[0055] When the subject is a goat, the Tcf21 protein (full length) of the goat (represented by SEQ ID NO: 11) is used. A polynucleotide encoding the amino acid sequence (NCBI accession no. XP_005684836.1) For example, the polynucleotide may be a polynucleotide consisting of a base sequence represented by SEQ ID NO: 26 (NCBI accession No. XM_005684779.3), and may be a polynucleotide consisting of a base sequence encoding an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 26. Preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues including the amino acid sequence represented by SEQ ID NO: 2", More preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 11, including the amino acid sequence represented by SEQ ID NO: 2," More preferably, it is a polynucleotide consisting of a base sequence that encodes the "amino acid sequence represented by SEQ ID NO: 1."

[0056] When the subject is a sheep, the sheep Tcf21 protein (full length) (represented by SEQ ID NO: 12) is used. The polynucleotide encoding the amino acid sequence (NCBI accession no. XP_027828288.1) For example, the peptide is a polynucleotide consisting of the base sequence represented by SEQ ID NO: 27 (NCBI accession No. XM_027972487.1), and the amino acid sequence represented by SEQ ID NO: 27 It may be a polynucleotide consisting of a base sequence encoding an amino acid sequence of 25 to 30 residues in length. Preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues including the amino acid sequence represented by SEQ ID NO: 2", More preferably, it is a nucleic acid sequence that encodes "an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 12, including the amino acid sequence represented by SEQ ID NO: 2." is a polynucleotide comprising More preferably, it is a polynucleotide consisting of a base sequence that encodes the "amino acid sequence represented by SEQ ID NO: 1."

[0057] When the subject is a pig, the pig Tcf21 protein (full length) (represented by SEQ ID NO: 13) A polynucleotide encoding the amino acid sequence (NCBI accession no. XP_020943327.1) For example, the polynucleotide is a polynucleotide consisting of the base sequence represented by SEQ ID NO: 28 (NCBI accession No. XM_021087668.1), and the polynucleotide is a polynucleotide consisting of a base sequence encoding an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 28. It's okay. Preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues including the amino acid sequence represented by SEQ ID NO: 2", More preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 13, including the amino acid sequence represented by SEQ ID NO: 2," More preferably, it is a polynucleotide consisting of a base sequence that encodes the "amino acid sequence represented by SEQ ID NO: 1."

[0058] When the subject is a chicken, chicken Tcf21 protein (full length) (SEQ ID NO: 14 The polynucleotide encoding the amino acid sequence represented by the formula (NCBI accession number NP_001264640.1) For example, the nucleic acid sequence of SEQ ID NO: 29 (NCBI accession No. NM_001277711.1) is a polynucleotide having the amino acid sequence of SEQ ID NO: 29. It may be a polynucleotide consisting of a base sequence that encodes an amino acid sequence of 25 to 30 residues in the sequence. Preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues including the amino acid sequence represented by SEQ ID NO: 2", More preferably, it is a polynucleotide consisting of a base sequence encoding "an amino acid sequence of 25 to 30 residues in the amino acid sequence represented by SEQ ID NO: 14, including the amino acid sequence represented by SEQ ID NO: 2," More preferably, it is a polynucleotide consisting of a base sequence that encodes the "amino acid sequence represented by SEQ ID NO: 1."

[0059] Furthermore, as mentioned above, the amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 1 is not limited to the same sequence, but may be a peptide consisting of an amino acid sequence that has 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more identity to the amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 1, and the base sequence of the polynucleotide may be designed accordingly. Furthermore, as described above, the amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 1 is not limited to the same sequence, but may be a peptide consisting of an amino acid sequence in which one or more amino acids have been substituted or deleted, or one or more amino acids have been inserted or added, from the amino acid sequence represented by SEQ ID NO: 1. Accordingly, the base sequence of the polynucleotide may be designed in accordance with this.

[0060] Furthermore, as mentioned above, when the subject is a mouse, human, rat, dog, cat, rabbit, cow, horse, goat, sheep, pig, or chicken, the amino acid sequence represented by SEQ ID NO: 1 is not limited to the same sequence, but may be a peptide consisting of an amino acid sequence having 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more identity to the amino acid sequence represented by SEQ ID NO: 1, and the base sequence of the polynucleotide may be designed accordingly. As mentioned above, the subjects are mice, humans, rats, dogs, cats, rabbits, cows, horses, In the case of goat, sheep, pig, or chicken, the amino acid sequence represented by SEQ ID NO: 1 is not limited to the same sequence, but may be a peptide consisting of an amino acid sequence in which one or more amino acids of the amino acid sequence represented by SEQ ID NO: 1 have been substituted or deleted, or one or more amino acids have been inserted or added, and the base sequence of the polynucleotide may be designed accordingly.

[0061] Furthermore, as mentioned above, when the method further comprises the step of introducing Tcf3 protein and / or a polynucleotide encoding the same into myofibroblasts that express the Tcf3 protein, the amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 2 can be used to express Tcf21 protein (full length) and / or a polynucleotide encoding the same, whether or not the amino acid sequence is the same as that represented by SEQ ID NO: 2. When the Tcf3 protein is introduced into myofibroblasts expressing the Tcf3 protein, the myofibroblasts can be more effectively deactivated. As mentioned above, a person skilled in the art at the time of filing the present application could easily design a nucleotide sequence encoding an amino acid sequence corresponding to the amino acid sequence represented by SEQ ID NO: 2. This also applies to the amino acid sequence represented by SEQ ID NO: 2.

[0062] A method for introducing the polynucleotide according to this embodiment into myofibroblasts expressing Tcf3 protein can be, for example, a known method, such as preparing an expression vector or adeno-associated virus containing the polynucleotide according to this embodiment, introducing it into myofibroblasts expressing Tcf3 protein, and forcibly expressing the peptide according to this embodiment.

[0063] The myofibroblasts in this embodiment are not particularly limited in terms of the subject, organ, tissue, etc. from which they are present or derived, as long as they express Tcf3 protein and are deactivated when the peptide and / or polynucleotide of this embodiment is introduced. For example, they may be myofibroblasts in a target organ or tissue that have not yet been harvested, myofibroblasts immediately after harvesting from a target organ or tissue, or primary cultured myofibroblast cells or a cultured cell line. That is, any system may be used, for example, an in vivo system, an in vitro system, or an ex vivo system.

[0064] In this embodiment, subjects in which myofibroblasts expressing Tcf3 protein exist or are derived include, for example, mammals such as humans, mice, rats, dogs, cats, rabbits, cows, horses, goats, sheep, and pigs, and birds such as chickens. Mammals such as humans, mice, dogs, cats, cows, horses, and pigs are preferred, humans, mice, dogs, or cats are more preferred, humans or mice are even more preferred, and humans are most preferred. The subject may also be any subject (excluding humans). The age and sex of the subject are not important. Furthermore, when the peptide according to this embodiment and / or the polynucleotide according to this embodiment is introduced into myofibroblasts expressing Tcf3 protein, and the myofibroblasts are myofibroblasts that are present in a target organ or tissue but have not yet been collected, the myofibroblasts may be myofibroblasts present in one organ and / or one tissue, or may be myofibroblasts present in multiple organs and / or multiple tissues. Furthermore, when the peptide according to this embodiment and / or the polynucleotide according to this embodiment is introduced into myofibroblasts expressing Tcf3 protein, and the myofibroblasts are myofibroblasts immediately after collection from a target organ or tissue, or primary cultured myofibroblast cells or a cultured cell line, the myofibroblasts may be derived from a single subject or multiple subjects, or may be derived from a single organ and / or a single tissue, or may be derived from multiple organs and / or multiple tissues.

[0065] In this embodiment, an organ in which myofibroblasts expressing Tcf3 protein are present or derived As described in the Background Art, the deactivation is achieved by increasing the abundance of Tcf21. These are organs in which myofibroblasts expressing Tcf3 protein are present or derived, and examples thereof include the liver, pancreas, kidney, lung, and heart. Myofibroblasts present in or derived from the liver are sometimes called activated hepatic stellate cells, and myofibroblasts present in or derived from the pancreas are sometimes called activated pancreatic stellate cells.

[0066] In this embodiment, the tissues in which myofibroblasts expressing Tcf3 protein exist or are derived include those in which myofibroblasts are deactivated by increasing the abundance of Tcf21, as described in the Background Art. These tissues are tissues in which myofibroblasts expressing Tcf3 protein are present or derived, such as coronary arteries.

[0067] Furthermore, primary cultured myofibroblast cells or cultured cell lines expressing Tcf3 protein also include cells obtained by activating quiescent cells for testing or other purposes. Examples include primary cultured myofibroblasts activated by culturing quiescent cells on a culture dish, and cultured myofibroblast cell lines obtained by forcibly expressing a myofibroblast marker gene in the above-mentioned quiescent cells. Examples of methods for producing the latter include cells obtained by incorporating a myofibroblast marker gene into a plasmid or viral vector for introducing into mammalian cells and transfecting the cells using a conventional method such as lipofection. Transfection may be transient or stable.

[0068] The peptide according to this embodiment binds to the DNA of the target genes of the Tcf21 protein and the Tcf3 protein, and forms a three-dimensional structure that can form and maintain a complex that can regulate the function of the gene. Target genes of the Tcf21 protein and Tcf3 protein include Examples of such target genes include genes involved in fibrosis, marker genes for quiescent cells, etc. Furthermore, controlling the function of such target genes may mean either enhancing or decreasing the expression of the target genes.

[0069] In this embodiment, it is preferable to reduce the expression of target genes involved in organ or tissue fibrosis, such as Col1a1 gene, Col1a2 gene, and Acta2 gene. For example, in myofibroblasts expressing Tcf3 protein, the expression level of the Col1a1 gene after introduction of the peptide according to this embodiment and / or the polynucleotide according to this embodiment is preferably 0.8 or less, more preferably 0.7 or less, even more preferably 0.6 or less, and even more preferably 0.5 or less, assuming that the expression level before introduction of the peptide according to this embodiment and / or the polynucleotide according to this embodiment is 1. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more. For example, in myofibroblasts expressing Tcf3 protein, the expression level of the col1a2 gene after introduction of the peptide according to this embodiment and / or the polynucleotide according to this embodiment is, in order of increasing preference, 0.8 or less, 0.7 or less, 0.6 or less, 0.55 or less, 0.5 or less, 0.425 or less, and 0.41 or less, where the expression level before introduction of the peptide according to this embodiment and / or the polynucleotide according to this embodiment is set to 1. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more. do. For example, in myofibroblasts expressing Tcf3 protein, the expression level of Acta2 gene after introduction of the peptide according to this embodiment and / or the polynucleotide according to this embodiment is, for example, The expression level before introduction of the peptide according to this embodiment and / or the polynucleotide according to this embodiment is preferably 0.8 or less, more preferably 0.7 or less, even more preferably 0.6 or less, and even more preferably 0.5 or less, assuming that this is 1. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more.

[0070] It is also preferable to enhance the expression of quiescent cell marker genes in organs and tissues, such as the Gfap gene and Ngfr gene. For example, in myofibroblasts expressing Tcf3 protein, the expression level of the Gfap gene after introduction of the peptide according to this embodiment and / or the polynucleotide according to this embodiment is, for example, 1 / 2 of the expression level before introduction of the peptide according to this embodiment and / or the polynucleotide according to this embodiment. is preferably 1.2 or more, more preferably 1.5 or more, even more preferably 2.0 or more, More preferably, it is 3.0 or more. On the other hand, the upper limit is not particularly limited, but it is, for example, 20 or less. is. For example, in myofibroblasts expressing Tcf3 protein, the expression level of the Ngfr gene after introduction of the peptide according to this embodiment and / or the polynucleotide according to this embodiment is, for example, 1 / 2 of the expression level before introduction of the peptide according to this embodiment and / or the polynucleotide according to this embodiment. is preferably 1.2 or more, more preferably 1.5 or more, even more preferably 2.0 or more, More preferably, it is 3.0 or more. On the other hand, the upper limit is not particularly limited, but it is, for example, 20 or less. is.

[0071] The control of target gene expression can be confirmed by conventional methods, including known methods for measuring the expression levels of mRNA and proteins, which are gene products. The expression level of mRNA can be confirmed by, for example, RT-PCR, quantitative PCR, microarray, or Northern blotting. Alternatively, it can be confirmed by evaluating the promoter activity of the target gene, for example, by incorporating a promoter fragment of the target gene into a luciferase reporter vector containing a luciferase gene and evaluating the luciferase activity, as described in the Examples below. The expression level of the protein, which is the gene product, can be confirmed by, for example, Western blotting or ELISA.

[0072] Therefore, this embodiment may include a step of measuring the expression level of the target gene after the step of introducing the peptide of this embodiment and / or a polynucleotide encoding it into myofibroblasts that express Tcf3 protein.

[0073] In the step of introducing the peptide according to this embodiment and / or the polynucleotide encoding it into myofibroblasts expressing Tcf3 protein, the amount of the peptide according to this embodiment and / or the polynucleotide encoding it introduced may be the amount typically used for gene or protein introduction into cells, whether the target is myofibroblasts immediately after collection from the target organ or tissue, or whether the target is primary cultured myofibroblasts or a cultured myofibroblast cell line. In addition, when the peptide of this embodiment and / or a polynucleotide encoding the same is introduced into myofibroblasts that are in a state where they are in a target organ or tissue and have not been collected, this is considered to be equivalent to administering the pharmaceutical composition described below to the subject, and the explanation of the pharmaceutical composition described below is hereby incorporated by reference.

[0074] In this embodiment, it is preferable to further include the step of introducing Tcf3 protein and / or a polynucleotide encoding it into myofibroblasts that express the Tcf3 protein. As described in the background art, Tcf21 is a transcription factor that binds to the same basic helix-loop-helix (bHLH) transcription factor family. It forms a dimer with Tcf3, a member of the TCF family, and regulates target gene expression by binding to DNA. This is because, by further expressing Tcf3 protein in myofibroblasts that express Tcf3 protein, the myofibroblasts are further deactivated.

[0075] Preferably, the Tcf3 protein is derived from the subject to be administered.

[0076] For example, the amino acid sequence of mouse Tcf3 protein can be used as a reference, and if the amino acid sequence of the target Tcf3 protein has been identified, the amino acid sequence of mouse Tcf3 protein can be compared with the target Tcf3 protein to determine the target Tcf3 protein. For example, the mouse Tcf3 protein identified by NCBI accession number NP_001157619.1 Examples of such proteins include proteins consisting of an amino acid sequence corresponding to the amino acid sequence of the mouse Tcf3 protein. In addition, the proteins may also include proteins consisting of an amino acid sequence corresponding to the amino acid sequence of any of the mouse Tcf3 proteins identified by NCBI accession numbers, as described below. In addition, when the subject is a mouse, the above-mentioned "NCBI accession number NP_001157619.1" is used. The "amino acid sequence corresponding to the amino acid sequence of the mouse Tcf3 protein identified by NCBI accession No. NP_001157619.1" was the "amino acid sequence of the mouse Tcf3 protein identified by NCBI accession No. NP_001157619.1." The "amino acid sequence corresponding to any of the amino acid sequences of mouse Tcf3 proteins identified by NCBI accession numbers, as described below" may be "any of the amino acid sequences of mouse Tcf3 proteins identified by NCBI accession numbers, as described below."

[0077] When the subject is a mouse, for example, the mouse strain identified by NCBI accession No. NP_001157619.1 can be used. Mouse Tcf3 protein identified by NCBI accession No. NP_001157620.1, mouse Tcf3 protein identified by NCBI accession No. NP_001157621.1, mouse Tcf3 protein identified by NCBI accession No. NP_001157622.1, mouse Tcf3 protein identified by NCBI accession No. NP_001157623.1, mouse Tcf3 protein identified by NCBI accession No. NP_001157624.1, mouse Tcf3 protein identified by NCBI accession No. NP_001157625.1, mouse Tcf3 protein identified by NCBI accession No. NP_035678.3, mouse Tcf3 protein identified by NCBI accession No. NP_001365832.1, NCBI accession No. Mouse Tcf3 protein identified by NP_001365833.1, NCBI accession Mouse Tcf3 protein identified by NCBI accession number NP_001365834.1, mouse Tcf3 protein identified by NCBI accession number NP_001365837.1, and mouse Tcf3 protein identified by NCBI accession number NP_001365839.1 Examples of such Tcf3 proteins include the mouse Tcf3 protein identified by NCBI accession No. NP_001365841.1, the mouse Tcf3 protein identified by NCBI accession No. NP_001365842.1, and the mouse Tcf3 protein identified by NCBI accession No. NP_001365843.1.

[0078] When the subject is a human, for example, the human Tcf3 protein identified by NCBI accession No. NP_003191.1, the human Tcf3 protein identified by NCBI accession No. NP_001129611.1, Examples of such proteins include the human Tcf3 protein identified by NCBI accession number NP_001338707.1 and the human Tcf3 protein identified by NCBI accession number NP_001338708.1.

[0079] When the subject is a rat, for example, rat Tcf3 protein identified by NCBI accession No. NP_598208.2, rat Tcf3 protein identified by NCBI accession No. NP_001030314.1, etc. Examples include proteins.

[0080] When the subject is a dog, for example, the gene estimated in NCBI accession No. XP_038285196.1 is used. The canine Tcf3 protein, which is the putative canine Tcf3 protein in NCBI accession No. XP_038285199.1, Protein, canine Tcf3 protein deduced by NCBI accession No. XP_038285200.1, canine Tcf3 protein deduced by NCBI accession No. XP_038285201.1, canine Tcf3 protein deduced by NCBI accession No. XP_038285202.1, canine Tcf3 protein deduced by NCBI accession No. XP_038285203.1, canine Tcf3 protein deduced by NCBI accession No. XP_038285204.1, canine Tcf3 protein deduced by NCBI accession No. XP_038285205.1, canine Tcf3 protein deduced by NCBI accession No. XP_038285206.1, canine Tcf3 protein deduced by NCBI accession No. XP_038285207.1, canine Tcf3 protein deduced by NCBI accession No. Examples include the canine Tcf3 protein predicted by XP_038285211.1.

[0081] When the subject is a cat, for example, the gene estimated by NCBI accession No. XP_023098869.1 is used. feline Tcf3 protein, the putative feline Tcf3 protein in NCBI accession No. XP_023098878.1 Protein, deduced feline Tcf3 protein in NCBI accession No. XP_023098880.1, deduced feline Tcf3 protein in NCBI accession No. XP_023098881.1, deduced feline Tcf3 protein in NCBI accession No. XP_023098887.1, deduced feline Tcf3 protein in NCBI accession No. XP_023098895.1, deduced feline Tcf3 protein in NCBI accession No. XP_023098902.1, deduced feline Tcf3 protein in NCBI accession No. XP_023098911.1, deduced feline Tcf3 protein in NCBI accession No. XP_023098919.1, deduced feline Tcf3 protein in NCBI accession No. XP_023098928.1, NCBI accession No. Examples include the feline Tcf3 protein predicted by XP_023098955.1.

[0082] If the subject is a cow, see, for example, the reference identified by NCBI accession number NP_001179627.1. Examples include bovine Tcf3 protein.

[0083] When the subject is a horse, for example, the gene estimated in NCBI accession No. XP_023502072.1 is used. The equine Tcf3 protein, deduced from NCBI accession No. XP_023502073.1, Examples of the equine Tcf3 protein include the equine Tcf3 protein deduced by NCBI accession No. XP_023502074.1, the equine Tcf3 protein deduced by NCBI accession No. XP_023502075.1, the equine Tcf3 protein deduced by NCBI accession No. XP_023502076.1, the equine Tcf3 protein deduced by NCBI accession No. XP_023502077.1, the equine Tcf3 protein deduced by NCBI accession No. XP_023502079.1, and the equine Tcf3 protein deduced by NCBI accession No. XP_023502080.1.

[0084] When the subject is a goat, for example, the gene estimated by NCBI accession No. XP_017905900.1 is used. The goat Tcf3 protein, which is the putative goat Tcf3 protein in NCBI accession No. XP_017905901.1, Examples of such proteins include the caprine Tcf3 protein deduced by NCBI accession No. XP_017905902.1, the caprine Tcf3 protein deduced by NCBI accession No. XP_017905903.1, and the caprine Tcf3 protein deduced by NCBI accession No. XP_017905904.1.

[0085] When the subject is a sheep, for example, the gene estimated by NCBI accession No. XP_027826020.1 is used. Examples of the ovine Tcf3 protein include the ovine Tcf3 protein deduced by NCBI accession No. XP_027826021.1, the ovine Tcf3 protein deduced by NCBI accession No. XP_027826022.1, the ovine Tcf3 protein deduced by NCBI accession No. XP_027826023.1, the ovine Tcf3 protein deduced by NCBI accession No. XP_027826024.1, the ovine Tcf3 protein deduced by NCBI accession No. XP_027826025.1, and the ovine Tcf3 protein deduced by NCBI accession No. XP_027826026.1.

[0086] When the subject is a pig, for example, the strain identified by NCBI accession number ALS88204.1 can be used. porcine Tcf3 protein, porcine Tcf3 protein identified by NCBI accession No. ALS88207.1, etc. Examples include:

[0087] When the subject is a chicken, examples include chicken Tcf3 protein identified by NCBI accession No. NP_989817.2.

[0088] As mentioned above, the Tcf3 protein is identified by NCBI accession number NP_001157619.1. When an amino acid sequence corresponding to the amino acid sequence of mouse Tcf3 protein is used as a standard, the following aspects can be considered. When introduced into myofibroblasts expressing the Tcf3 protein, the Tcf21 protein and the Tcf3 protein bind to the DNA of their target genes, forming a three-dimensional structure that allows them to form and maintain a complex that can regulate the function of the genes, and the myofibroblasts are further deactivated. The amino acid sequence corresponding to the amino acid sequence of the mouse Tcf3 protein identified by NCBI accession No. NP_001157619.1 is not particularly limited as long as it is compatible with the sequence, but may also be a protein consisting of an amino acid sequence that has 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more identity to the amino acid sequence corresponding to the amino acid sequence of the mouse Tcf3 protein identified by NCBI accession No. NP_001157619.1. In addition, the amino acid sequence of mouse Tcf3 protein identified by NCBI accession No. NP_001157619.1 was The protein may be an amino acid sequence in which one or more amino acids have been substituted or deleted, or one or more amino acids have been inserted or added, from the amino acid sequence corresponding to the amino acid sequence. Here, "one or more" preferably means 1 to 65, more preferably 1 to 30, and even more preferably 10. The same applies when amino acids are added to the N-terminus and / or C-terminus. This is also true when other mouse Tcf3 proteins mentioned above are used as a reference.

[0089] When the subject is a mouse, the subject is identified by NCBI accession number NP_001157619.1. Taking mouse Tcf3 protein as an example, the following aspects can be considered. When introduced into myofibroblasts expressing Tcf3 protein, the Tcf21 protein and Tcf3 protein bind to the DNA of their target genes, form a three-dimensional structure that can form and maintain a complex that can control the function of the gene, and further deactivate the myofibroblasts. However, the amino acid sequence of the mouse Tcf3 protein identified by NCBI accession No. NP_001157619.1 is not limited to this sequence, and the protein may be one consisting of an amino acid sequence that is 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more identical to the amino acid sequence of the mouse Tcf3 protein identified by NCBI accession No. NP_001157619.1. In addition, the amino acid sequence of mouse Tcf3 protein identified by NCBI accession No. NP_001157619.1 was The protein may be an amino acid sequence in which one or more amino acids have been substituted or deleted, or one or more amino acids have been inserted or added. Here, "one or more" preferably means 1 to 65, more preferably 1 to 30, and even more preferably 10. The same applies when amino acids are added to the N-terminus and / or C-terminus. This is also true for the other mouse Tcf3 proteins mentioned above.

[0090] For human subjects, the human Tcf3 protein identified by NCBI accession number NP_003191.1 can be used as an example, and the same applies to the mouse subject as described above, as well as to the other human Tcf3 proteins previously mentioned. When the subject is a rat, the rat Tcf3 protein identified by NCBI accession number NP_598208.2 can be used as an example, and the same applies to the other rat Tcf3 proteins described above when the subject is a mouse. When the subject is a dog, the canine Tcf3 protein deduced by NCBI accession No. XP_038285196.1 can be used as an example, and the same explanation applies as when the subject is a mouse. This is also true for the other canine Tcf3 proteins mentioned above. When the subject is a cat, the feline Tcf3 protein deduced by NCBI accession No. XP_023098869.1 can be used as an example, and the same explanation applies as when the subject is a mouse. This is also true for the other feline Tcf3 proteins mentioned above. When the subject is a cow, the bovine Tcf3 protein identified by NCBI accession No. NP_001179627.1 can be used as an example, and the same explanation applies as when the subject is a mouse. This is also true for the other bovine Tcf3 proteins mentioned above. When the subject is a horse, the equine Tcf3 protein deduced by NCBI accession No. XP_023502072.1 can be used as an example, and the same explanation applies as when the subject is a mouse. This is also true for the other horse Tcf3 proteins mentioned above. When the subject is a goat, the putative goat Tcf 3 protein can be mentioned as an example, and the explanation is the same as above when the subject is a mouse. This is also true for the other goat Tcf3 proteins mentioned above. If the subject is a sheep, the sheep gene estimated by NCBI accession No. XP_027826020.1 is used. The diTcf3 protein can be taken as an example, and the same applies as described above when the subject is a mouse. The same applies to the other sheep Tcf3 proteins mentioned above. When the subject is a pig, the pig Tcf3 gene identified by NCBI accession number ALS88204.1 is used. The same applies to the other porcine Tcf3 proteins mentioned above, with the same explanation being given for mice. When the subject is a chicken, the chicken Tcf3 protein identified by NCBI accession number NP_989817.2 can be used as an example, and the same applies to the other chicken Tcf3 proteins described above when the subject is a mouse.

[0091] The above-mentioned explanations for the peptide of this embodiment are incorporated herein by reference with regard to the Tcf3 protein, including conservative substitutions, protein modifications, the amino acid sequence for selective delivery to organs and tissues containing myofibroblasts that express Tcf3 protein, the production method, the method for introducing the protein into myofibroblasts that express Tcf3 protein, and the amount introduced into myofibroblasts.

[0092] The polynucleotide encoding the Tcf3 protein is not particularly limited, as long as it produces the Tcf3 protein and exerts an action similar to that of the Tcf3 protein when introduced into myofibroblasts that express the Tcf3 protein. Furthermore, the base sequence of a polynucleotide encoding Tcf3 protein may be a base sequence that includes or does not include an untranslated region (e.g., a cDNA sequence encoding Tcf3 protein), as long as Tcf3 protein is produced when the polynucleotide is introduced into myofibroblasts that express Tcf3 protein. It would be readily apparent to those skilled in the art at the time of filing this application that the base sequence of a polynucleotide encoding Tcf3 protein could be designed based on the amino acid sequence of Tcf3 protein described above.

[0093] The polynucleotide encoding the Tcf3 protein is preferably a polynucleotide encoding the amino acid sequence of a Tcf3 protein derived from the subject to be administered.

[0094] For example, the Tcf3 protein is identified by NCBI accession number NP_001157619.1. The amino acid sequence corresponding to the amino acid sequence of mouse Tcf3 protein can be used as a reference. In this case, the amino acid sequence of mouse Tcf3 protein identified by NCBI accession No. NP_001157619.1 can be used as a reference. Examples of suitable polynucleotides include polynucleotides that encode the amino acid sequence corresponding to the amino acid sequence. In addition, when the subject is a mouse, the above-mentioned "NCBI accession number NP_001157619.1" is used. The "amino acid sequence corresponding to the amino acid sequence of the mouse Tcf3 protein identified by NCBI accession No. NP_001157619.1" was the "amino acid sequence of the mouse Tcf3 protein identified by NCBI accession No. NP_001157619.1." That's fine.

[0095] For mice, the Tcf3 protein is identified under NCBI accession number NP_001157619.1. For example, in the case of a mouse Tcf3 protein identified by NCBI accession No. NM_001164147.2, a polynucleotide encoding the protein is, for example, a polynucleotide identified by NCBI accession No. NM_001164147.2. Examples include leotide.

[0096] For example, if the subject is a human, and the Tcf3 protein is the human Tcf3 protein identified by NCBI accession No. NP_003191.1, an example of a polynucleotide encoding it is the polynucleotide identified by NCBI accession No. NM_003200.5.

[0097] For example, if the subject is a rat, and the Tcf3 protein is the rat Tcf3 protein identified by NCBI accession No. NP_598208.2, an example of a polynucleotide encoding it is the polynucleotide identified by NCBI accession No. NM_133524.2.

[0098] When the subject is a dog, the Tcf3 protein is identified as NCBI accession number XP_038285196.1. For example, in the case of a putative canine Tcf3 protein, the polynucleotide encoding it is, for example, the polynucleotide putatively identified by NCBI accession No. XM_038429268.1. Chido is one example.

[0099] If the subject is a cat, the Tcf3 protein is identified as NCBI accession number XP_023098869.1. For example, in the case of a putative feline Tcf3 protein, the polynucleotide encoding it is, for example, the polynucleotide putatively identified by NCBI accession No. XM_023243101.1. Chido is one example.

[0100] When the subject is a cow, the Tcf3 protein is available under NCBI accession number NP_001179627.1. For example, in the case of the identified bovine Tcf3 protein, the polynucleotide encoding it can be, for example, the polynucleotide identified by NCBI accession No. NM_001192698.1. Chido is one example.

[0101] When the subject is a horse, the Tcf3 protein is identified under NCBI accession number XP_023502072.1. For example, in the case of a putative equine Tcf3 protein, the polynucleotide encoding it is, for example, the polynucleotide putatively identified by NCBI accession number XM_023646304.1. Chido is one example.

[0102] When the subject is a goat, the Tcf3 protein is identified as NCBI accession number XP_017905900.1. For example, in the case of a putative goat Tcf3 protein, the polynucleotide encoding it is, for example, the putative polynucleotide sequence identified by NCBI accession number XM_018050411.1. Chido is one example.

[0103] When the subject is a sheep, the Tcf3 protein is identified as NCBI accession no. XP_027826020.1 For example, in the case of the sheep Tcf3 protein deduced by NCBI accession No. XM_027970219.1, the polynucleotide encoding it is, for example, the polynucleotide deduced by NCBI accession No. XM_027970219.1. Examples include leotide.

[0104] If the subject is a pig, the Tcf3 protein is identified under NCBI accession number ALS88204.1. For example, in the case of the porcine Tcf3 protein, an example of a polynucleotide encoding the protein is the polynucleotide identified by NCBI accession No. KR818872.1. It can be obtained.

[0105] For example, if the subject is a chicken, and the Tcf3 protein is the chicken Tcf3 protein identified by NCBI accession No. NP_989817.2, an example of a polynucleotide encoding it is the polynucleotide identified by NCBI accession No. NM_204486.2.

[0106] As mentioned above, the Tcf3 protein identified by NCBI accession number NP_001157619.1 The amino acid sequence corresponding to the amino acid sequence of the present invention is not limited to this sequence, and may be 80% identical to the amino acid sequence of the Tcf3 protein identified by NCBI accession No. NP_001157619.1. % or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more The base sequence of the polynucleotide may be designed accordingly, since the protein may be a protein consisting of an amino acid sequence having the above identity. As mentioned above, the Tcf3 protein identified by NCBI accession number NP_001157619.1 The amino acid sequence corresponding to the amino acid sequence of is not limited to this sequence, but may be any amino acid sequence corresponding to the amino acid sequence of the Tcf3 protein identified by NCBI accession No. NP_001157619.1. The polynucleotide may be a protein consisting of an amino acid sequence in which one or more amino acids have been substituted or deleted, or one or more amino acids have been inserted or added, and the base sequence of the polynucleotide may be designed accordingly. This is also true when other mouse Tcf3 proteins mentioned above are used as a reference.

[0107] Furthermore, as mentioned above, when the subject is a mouse, the mouse Tcf3 protein identified by NCBI accession No. NP_001157619.1 is not limited to the same sequence, but may be any amino acid sequence of the protein. The polynucleotide may be a protein consisting of an amino acid sequence that has 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more identity with the sequence, and the base sequence of the polynucleotide may be designed accordingly. Furthermore, as mentioned above, when the subject is a mouse, the mouse Tcf3 protein identified by NCBI accession No. NP_001157619.1 is not limited to the same sequence, but may be any amino acid sequence of the protein. The base sequence of the polynucleotide may be designed accordingly, since the polynucleotide may be a protein consisting of an amino acid sequence in which one or more amino acids are substituted or deleted, or one or more amino acids are inserted or added. This is also true for the other mouse Tcf3 proteins mentioned above.

[0108] When the subject is a human, the human Tcf3 protein identified by NCBI accession number NP_003191.1 can be used as a reference, as described above for a mouse subject, and this also applies when other human Tcf3 proteins are used as references.

[0109] When the subject is a rat, the rat Tcf3 protein identified by NCBI accession No. NP_598208.2 can be used as a reference, as described above for the case of a mouse, and this also applies when other rat Tcf3 proteins mentioned above are used as references.

[0110] When the subject is a dog, the canine Tcf3 protein deduced by NCBI accession No. XP_038285196.1 can be used as a reference. The same procedures as described above for the subject of a mouse can be used. This is also true when other canine Tcf3 proteins mentioned above are used as references.

[0111] When the subject is a cat, the feline Tcf3 protein estimated by NCBI accession No. XP_023098869.1 can be used as a reference. The same as described above when the subject is a mouse, This is also true when other feline Tcf3 proteins mentioned above are used as references.

[0112] When the subject is a cow, the bovine Tcf3 protein identified by NCBI accession No. NP_001179627.1 can be used as a reference, and the same procedures as described above when the subject is a mouse can be used. This is also true when other bovine Tcf3 proteins are used as a reference.

[0113] When the subject is a horse, the equine Tcf3 protein estimated by NCBI accession No. XP_023502072.1 can be used as a reference. The same procedures as described above for the subject of a mouse can be used. This is also true when other horse Tcf3 proteins mentioned above are used as references.

[0114] When the subject is a goat, the goat Tcf3 protein estimated by NCBI accession No. XP_017905900.1 can be used as a reference. The same procedures as described above for the subject when the subject is a mouse can be used. This is also true when other goat Tcf3 proteins mentioned above are used as references.

[0115] If the subject is a sheep, the sheep gene estimated by NCBI accession No. XP_027826020.1 is used. The diTcf3 protein can be used as a reference, and the same applies as described above when the subject is a mouse. This also applies when the other ovine Tcf3 proteins mentioned above are used as a reference.

[0116] When the subject is a pig, the pig Tcf3 gene identified by NCBI accession number ALS88204.1 is used. The same applies to the case where the subject is a mouse, as described above. This also applies to the case where the other porcine Tcf3 proteins mentioned above are used as the reference.

[0117] When the subject is a chicken, the chicken Tcf3 protein identified by NCBI accession No. NP_989817.2 can be used as a reference, as described above for a mouse, and this also applies when other chicken Tcf3 proteins are used as a reference.

[0118] Regarding the polynucleotide encoding the Tcf3 protein, the method for introducing the polynucleotide into myofibroblasts that express the Tcf3 protein, the amount of polynucleotide introduced into myofibroblasts, and so on, the above-mentioned explanations regarding the polynucleotide of this embodiment are incorporated herein by reference.

[0119] <Method for producing deactivated myofibroblasts> The method for deactivating myofibroblasts expressing Tcf3 protein according to the above aspect allows for the production of deactivated myofibroblasts. The Tcf3 protein binds to the DNA of their target genes and inhibits the function of those genes. The Tcf21 protein is required to form a three-dimensional structure that can form and maintain a complex that can control the activity of the Tcf21 protein. This is a method for producing deactivated myofibroblasts, which includes the step of introducing a peptide consisting of an amino acid sequence of 25 to 30 residues in a protein and / or a polynucleotide encoding the peptide into myofibroblasts that express Tcf3 protein.

[0120] Furthermore, when the myofibroblasts expressing Tcf3 protein are myofibroblasts that are present in the target organ or tissue but have not yet been harvested, after the peptide of this embodiment and / or the polynucleotide encoding it has been introduced, some or all of the myofibroblasts may be appropriately harvested ex vivo.

[0121] A peptide consisting of an amino acid sequence of 25 to 30 residues in the Tcf21 protein, which is necessary for the Tcf21 protein and the Tcf3 protein to bind to the DNA of their target genes and form a three-dimensional structure that can form and maintain a complex that can control the function of the gene, and / or A description of the polynucleotide encoding it, a description of myofibroblasts expressing the Tcf3 protein, a peptide consisting of an amino acid sequence of 25 to 30 residues in the Tcf21 protein that is necessary for the Tcf21 protein and the Tcf3 protein to bind to the DNA of their target genes and form and maintain a three-dimensional structure that can control the function of the gene. The description of the above embodiment is incorporated herein by reference for the explanation of the step of introducing a Tcf3 peptide and / or a polynucleotide encoding the same into myofibroblasts that express Tcf3 protein.

[0122] In this embodiment, the Tcf3 protein and / or a polynucleotide encoding the same is administered to the Tc It is preferable to further include the step of introducing the f3 protein into myofibroblasts that express the protein. The contents of the above aspects are incorporated herein by reference for explanations regarding the Tcf3 protein and / or the polynucleotide encoding it, and the step of introducing the Tcf3 protein and / or the polynucleotide encoding it into myofibroblasts that express the Tcf3 protein.

[0123] Furthermore, this embodiment may include a step of measuring the expression level of the target gene after the step of introducing the peptide of this embodiment and / or a polynucleotide encoding it into myofibroblasts that express Tcf3 protein. The contents of the above-described embodiments are incorporated herein by reference for explanations of the target gene and the step of measuring the expression level of the target gene.

[0124] <Screening method for deactivated myofibroblasts> Another aspect of the present invention is a method for screening for deactivated myofibroblasts, comprising the step of introducing a peptide according to this aspect and / or a polynucleotide encoding the peptide into myofibroblasts expressing Tcf3 protein. The deactivated myofibroblasts screened by this method may be cells that are candidates for deactivated myofibroblasts.

[0125] Furthermore, when the myofibroblasts expressing Tcf3 protein are myofibroblasts that are present in the target organ or tissue but have not yet been harvested, after the peptide of this embodiment and / or the polynucleotide encoding it has been introduced, some or all of the myofibroblasts may be appropriately harvested ex vivo.

[0126] The screening method preferably includes a step of measuring the expression level of the target gene in myofibroblasts into which the peptide according to this aspect and / or a polynucleotide encoding it has been introduced. It is also preferable to include a step of measuring the expression activity of a polynucleotide encoding the peptide according to this aspect in myofibroblasts into which the polynucleotide encoding the peptide according to this aspect has been introduced. The screening method may also include a step of measuring the expression level of the peptide according to this aspect in myofibroblasts into which the peptide according to this aspect and / or a polynucleotide encoding it has been introduced. The contents of the above embodiments are incorporated by reference for explanations of the expression level of the target gene and a method for measuring the same in myofibroblasts into which the peptide of this embodiment and / or a polynucleotide encoding it has been introduced, and explanations of the expression level of the peptide of this embodiment and a method for measuring the same.

[0127] The deactivated myofibroblasts can be selected using known cell selection methods. For example, a method in which a reporter gene that expresses a fluorescent protein is linked to a vector containing a polynucleotide encoding the peptide according to this embodiment, and the vector is introduced into cells, and the deactivated myofibroblasts are selected using the resulting fluorescence intensity as an indicator is exemplified. Another method in which a peptide according to this embodiment fused with a fluorescent protein is introduced into cells, and the deactivated myofibroblasts are selected using the resulting fluorescence intensity as an indicator is exemplified. In either case, a specific example of a method for selecting deactivated myofibroblasts using fluorescence intensity as an indicator is FACS technology.

[0128] <Pharmaceutical Composition> Another aspect of the present invention is that the Tcf21 protein and the Tcf3 protein are capable of inhibiting their target genes. It has a three-dimensional structure that can bind to the DNA of a gene and form and maintain a complex that can control the function of the gene. An amino acid sequence of 25 to 30 residues in the Tcf21 protein necessary for the formation of and / or a polynucleotide encoding the same, for use in the prevention or treatment of a disease that can be prevented or treated by deactivating myofibroblasts that express Tcf3 protein.

[0129] A peptide consisting of an amino acid sequence of 25 to 30 residues in the Tcf21 protein, which is necessary for the Tcf21 protein and the Tcf3 protein to bind to the DNA of their target genes and form a three-dimensional structure that can form and maintain a complex that can control the function of the gene, and / or The contents of the above-mentioned aspects are incorporated by reference for explanations of the polynucleotide encoding it, myofibroblasts expressing Tcf3 protein, and deactivation of myofibroblasts expressing Tcf3 protein.

[0130] Examples of diseases that can be prevented or treated by deactivating myofibroblasts that express the Tcf3 protein include the following:

[0131] (a) When myofibroblasts expressing the Tcf3 protein are present in the liver, the condition may be hepatitis, liver fibrosis, cirrhosis, or liver cancer, or liver failure due to any of these diseases. Specific examples of hepatitis include viral hepatitis, drug-induced hepatitis, autoimmune hepatitis, alcoholic hepatitis, and nonalcoholic steatohepatitis (NASH). Specific examples of hepatic fibrosis and cirrhosis include the aforementioned diseases that cause hepatitis, as well as primary biliary cholangitis, primary sclerosing cholangitis, congenital biliary atresia, common bile duct stenosis pancreatitis, hepatic congestion, and metal metabolism disorders.

[0132] (b) When myofibroblasts expressing the Tcf3 protein are present in the pancreas, the condition may be pancreatitis, pancreatic fibrosis, or pancreatic secretory insufficiency due to any of these diseases. Specific examples of pancreatitis include alcoholic pancreatitis, autoimmune pancreatitis, pancreatitis associated with cholelithiasis, and pancreatitis secondary to dyslipidemia. Specific examples of pancreatic fibrosis include the aforementioned diseases that cause pancreatitis, as well as diabetes and pancreatic duct obstruction. Pancreatic secretory insufficiency may be exocrine pancreatic insufficiency, endocrine pancreatic insufficiency, or both.

[0133] (c) When myofibroblasts expressing the Tcf3 protein are present in the kidney, the condition may be nephritis, renal fibrosis, or glomerulosclerosis, or renal failure due to any of these diseases. Specific examples of nephritis include glomerulonephritis and interstitial nephritis. Specific examples of renal fibrosis and glomerulosclerosis include the aforementioned diseases that cause nephritis, as well as diabetic nephropathy and renal fibrosis associated with urinary tract obstruction.

[0134] (d) When myofibroblasts expressing the Tcf3 protein are present in the lungs, the condition may include interstitial pneumonia, pulmonary fibrosis, or respiratory failure due to any of these diseases. Specific examples of interstitial pneumonia and pulmonary fibrosis include idiopathic interstitial pneumonia, interstitial pneumonia associated with collagen disease, bacterial pneumonia, viral pneumonia, drug-induced pneumonia, radiation pneumonia, asbestosis, and interstitial pneumonia caused by environmental hazardous substances.

[0135] (e) When myofibroblasts expressing the Tcf3 protein are present in the heart, the condition may be fibrosis after myocardial infarction, myocarditis, cardiomyopathy, or heart failure due to any of these diseases. Specific examples of myocarditis include viral myocarditis and drug-induced myocarditis. The cardiomyopathy may be idiopathic or secondary cardiomyopathy.

[0136] (f) When myofibroblasts expressing the Tcf3 protein are present in the coronary artery, examples of the condition include coronary artery stenosis due to arterial atherosclerosis, restenosis of the coronary artery after balloon dilatation, or restenosis of the coronary artery after stent placement, or ischemic heart disease caused by any of these diseases.

[0137] (a1) The pharmaceutical composition according to this embodiment has an anti-fibrotic effect on the liver. Therefore, when myofibroblasts expressing the Tcf3 protein are present in the liver, the pharmaceutical composition for anti-fibrotic liver The compound can be used as a pharmaceutical composition for improving liver function. For example, subjects administered with the pharmaceutical composition according to this embodiment have lower serum ALT and AST levels, which are indicators of liver function, compared to subjects not administered with the pharmaceutical composition. In this case, the ALT of the subject to which the pharmaceutical composition of this embodiment was administered was 100% of that of the subject to which the pharmaceutical composition was not administered. When ALT is 1, it is preferably 0.7 or less, more preferably 0.6 or less, and further preferably 0.5 or less. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more. Furthermore, the AST of a subject administered with the pharmaceutical composition according to this embodiment is preferably 0.7 or less, more preferably 0.6 or less, and even more preferably 0.5 or less, with the AST of a subject not administered being taken as 1. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more.

[0138] (b1) The pharmaceutical composition according to this embodiment has an anti-fibrotic effect on the pancreas, and therefore, when myofibroblasts expressing the Tcf3 protein are present in the pancreas, the pharmaceutical composition can be used as a pharmaceutical composition for anti-fibrotic action on the pancreas or for improving pancreatic function. For example, subjects administered with the pharmaceutical composition according to this embodiment have lower serum amylase, elastase, and lipase levels, which are indicators of pancreatic function, compared to subjects not administered with the pharmaceutical composition. In this case, the amylase activity of the subject to which the pharmaceutical composition of this embodiment is administered is preferably 0.7 or less, more preferably 0.6 or less, and even more preferably 1.0 or less, based on the amylase activity of the subject to which the pharmaceutical composition of this embodiment is not administered. It is preferably 0.5 or less, while the lower limit is not particularly limited, and is, for example, 0.1 or more. Furthermore, the elastase of a subject to which the pharmaceutical composition according to this embodiment is administered is preferably 0.7 or less, more preferably 0.6 or less, and even more preferably 1.0 or less, based on the elastase of a subject to which the pharmaceutical composition is not administered. It is preferably 0.5 or less, while the lower limit is not particularly limited, and is, for example, 0.1 or more. Similarly, the lipase activity of a subject to which the pharmaceutical composition according to this embodiment is administered is preferably 0.7 or less, more preferably 0.6 or less, and even more preferably 1.0 or less, based on the lipase activity of a subject to which the pharmaceutical composition according to this embodiment is not administered. is 0.5 or less. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more.

[0139] (c1) The pharmaceutical composition according to this embodiment has an anti-fibrotic effect on the kidney, and therefore, when myofibroblasts expressing the Tcf3 protein are present in the kidney, the pharmaceutical composition can be used as a pharmaceutical composition for anti-fibrotic treatment of the kidney or for improving renal function. For example, subjects administered with the pharmaceutical composition according to this embodiment have lower values of serum urea nitrogen, creatinine, and glomerular filtration rate, which are indicators of renal function, compared to subjects not administered with the pharmaceutical composition. In this case, the urea nitrogen of the subject to which the pharmaceutical composition according to this embodiment is administered is preferably 0.7 or less, more preferably 0.6 or less, and even more preferably 1.0 or less, based on the urea nitrogen of the subject to which the pharmaceutical composition according to this embodiment is not administered. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more. Furthermore, the creatinine of a subject to which the pharmaceutical composition according to this embodiment is administered is preferably 0.7 or less, more preferably 0.6 or less, and even more preferably 1.0 or less, based on the creatinine of a subject to which the pharmaceutical composition according to this embodiment is not administered. It is preferably 0.5 or less, while the lower limit is not particularly limited, and is, for example, 0.1 or more. Similarly, the glomerular filtration rate of a subject administered with the pharmaceutical composition according to this embodiment is preferably 0.7 or less, more preferably 0.6 or less, based on the glomerular filtration rate of a subject not administered with the pharmaceutical composition being 1. It is preferably 0.5 or less, while the lower limit is not particularly limited, and is, for example, 0.1 or more.

[0140] (d1) The pharmaceutical composition of this embodiment has an anti-fibrotic effect on the lungs, and therefore can be used as a pharmaceutical composition for anti-fibrotic effects on the lungs or for improving pulmonary function when myofibroblasts expressing the Tcf3 protein are present in the lungs. For example, subjects administered with the pharmaceutical composition of this embodiment have higher values for arterial blood oxygen partial pressure, oxygen saturation, and vital capacity, which are indicators of pulmonary function, compared to subjects not administered with the pharmaceutical composition. In this case, the arterial blood oxygen partial pressure of the subject to which the pharmaceutical composition of this embodiment is administered is preferably 1.1 or more, more preferably 1.3 or more, based on the arterial blood oxygen partial pressure of the subject to which the pharmaceutical composition is not administered. On the other hand, the upper limit is not particularly limited, but is, for example, 3.0 or less. Furthermore, the arterial blood oxygen saturation of a subject to which the pharmaceutical composition of this embodiment is administered is preferably 1.1 or more, more preferably 1.3 or more, based on the arterial blood oxygen saturation of a subject to which the pharmaceutical composition of this embodiment is not administered. On the other hand, the upper limit is not particularly limited, but is, for example, 3.0 or less. Similarly, the vital capacity of a subject administered with the pharmaceutical composition according to this embodiment is preferably 1.1 or more, more preferably 1.3 or more, and even more preferably 1.5 or more, assuming that the vital capacity of a subject not administered with the pharmaceutical composition is 1. On the other hand, the upper limit is not particularly limited, but is, for example, 3.0 or less.

[0141] (e1) The pharmaceutical composition according to this embodiment has an anti-fibrotic effect on the heart. Therefore, when myofibroblasts expressing the Tcf3 protein are present in the heart, the pharmaceutical composition can be used as a pharmaceutical composition for anti-fibrotic treatment of the heart or for improving cardiac function. For example, subjects administered with the pharmaceutical composition according to this embodiment have lower serum CPK, troponin, and BNP values, which are indicators of cardiac function, compared to subjects not administered with the pharmaceutical composition. In this case, the CPK of the subject to which the pharmaceutical composition of this embodiment was administered was compared with that of the subject to which the pharmaceutical composition was not administered. The CPK of the hydroxyl group is preferably 0.7 or less, more preferably 0.6 or less, and even more preferably 0.5 or less, where 0.7 is the CPK of the hydroxyl group, and 0.6 is the CPK of the hydroxyl group. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more. Furthermore, the troponin of a subject administered with the pharmaceutical composition according to this embodiment is preferably 0.7 or less, more preferably 0.6 or less, and even more preferably 1.0 or less, based on the troponin of a subject not administered with the pharmaceutical composition. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more. Similarly, the BNP of a subject administered with the pharmaceutical composition according to this embodiment is preferably 0.7 or less, more preferably 0.6 or less, and even more preferably 0.5 or less, assuming that the BNP of a subject not administered with the pharmaceutical composition is 1. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more.

[0142] (f1) The pharmaceutical composition according to this embodiment has an anti-atherosclerotic effect on the coronary artery. Therefore, when myofibroblasts expressing the Tcf3 protein are present in the coronary artery, the pharmaceutical composition can be used as a pharmaceutical composition for anti-atherosclerosis of the coronary artery or a pharmaceutical composition for improving coronary artery blood flow. For example, subjects administered with the pharmaceutical composition according to this embodiment have an increased coronary artery inner diameter, which is an index of coronary artery atherosclerosis and coronary artery blood flow, compared to subjects not administered with the pharmaceutical composition. In this case, the inner diameter of the coronary artery of the subject to which the pharmaceutical composition of this embodiment is administered is preferably 10 or more, more preferably 50 or more, and even more preferably 10 or more, based on the inner diameter of the coronary artery of the subject to which the pharmaceutical composition of this embodiment is not administered. The upper limit is not particularly limited, but may be, for example, 1,000 or less.

[0143] The pharmaceutical composition of this embodiment contains the peptide of this embodiment and / or a polynucleotide encoding it. Specific examples of the peptide of this embodiment include liposomes and exosomes containing the peptide of this embodiment. Specific examples of the polynucleotide encoding the peptide of this embodiment include expression vectors and adeno-associated viruses containing a polynucleotide encoding the peptide of this embodiment.

[0144] The pharmaceutical composition according to this embodiment is usually formulated with a physiologically acceptable liquid or solid pharmaceutical carrier for use. The dosage form of the pharmaceutical composition according to this embodiment is not particularly limited, and specific examples include solutions, suspensions, emulsions, injections, etc. Furthermore, in formulating the pharmaceutical composition, additives such as excipients, binders, disintegrants, lubricants, stabilizers, flavorings, diluents, surfactants, and injection solvents that are commonly used as pharmaceutical carriers, as well as liposomes, exosomes, etc. as a means of delivery to target cells can be used.

[0145] The dosage of the pharmaceutical composition according to this embodiment can be appropriately selected depending on the dosage form, method of use, age, sex, weight, type of disease, severity of disease, symptoms, administration route, administration schedule, formulation, etc. The amount of the peptide according to this embodiment to be administered is, for example, preferably 0.1 times the body weight. mg / kg or more, more preferably 1 mg / kg or more, and even more preferably 10 mg / kg or more, while it is preferably 1,000 mg / kg or less, more preferably 500 mg / kg or less, and even more preferably 100 mg / kg or less. The amount of polynucleotide encoding the peptide according to this embodiment to be administered is, for example, preferably 1 × 10 in terms of the amount of adeno-associated virus genome in terms of body weight ratio. 10 Will genome / kg or more, preferably 1 x 10 11 viral genomes / kg or more, more preferably 1×10 12 viral genomes / kg or more, while preferably 1 x 10 16 Viral genomes / kg or less, preferably 1 x 10 15 viral genome / kg or less, more preferably 1 x 10 14 less than viral genomes / kg.

[0146] Examples of administration routes include oral administration and rectal injection, and in the case of injection, examples include subcutaneous injection, intramuscular injection, peripheral intravenous injection, hepatic arterial injection, and intraperitoneal injection, but are not necessarily limited to these.

[0147] The timing of administration of the pharmaceutical composition according to this embodiment is not particularly limited, and can be appropriately selected according to the method for preventing or treating the target disease. It may be administered prophylactically or for maintenance therapy. The dosage form is preferably determined according to the dosage form, the age, sex, and other conditions of the subject, the severity of the subject's symptoms, and the like. In either case, the pharmaceutical composition according to this embodiment can be administered once a day or in divided doses, or once every few days or weeks. It may also be administered irregularly while evaluating the therapeutic effect.

[0148] The pharmaceutical composition according to this embodiment is preferably used in combination with a composition comprising a Tcf3 protein and / or a polynucleotide encoding it. The composition comprising a Tcf3 protein and / or a polynucleotide encoding it is preferably a pharmaceutical composition. For explanations regarding the Tcf3 protein and / or the polynucleotide encoding it, and explanations regarding the specific forms of the Tcf3 protein and / or the polynucleotide encoding it, please refer to the explanations previously given for the peptide of this embodiment and the explanations previously given for the polynucleotide of this embodiment. Furthermore, the explanations given above regarding the pharmaceutical composition of this embodiment are incorporated herein by reference with regard to the dosage form, additives used in formulation, means of delivery to target cells, dosage, route of administration, timing of administration, and dosage form of the composition containing Tcf3 protein and / or the polynucleotide encoding it.

[0149] The pharmaceutical composition according to this embodiment may be administered alone or in combination with other pharmaceutical compositions or drugs, even when used in combination with a composition containing the Tcf3 protein and / or a polynucleotide encoding it.

[0150] <Peptide> Another aspect of the present invention is that the Tcf21 protein and the Tcf3 protein are capable of inhibiting their target genes. It has a three-dimensional structure that can bind to the DNA of a gene and form and maintain a complex that can control the function of the gene. An amino acid sequence of 25 to 30 residues in the Tcf21 protein necessary for the formation of and has the function of deactivating myofibroblasts that express Tcf3 protein. The peptide according to this embodiment preferably comprises the amino acid sequence shown in SEQ ID NO:2. Furthermore, the peptide according to this embodiment is preferably a peptide consisting of the amino acid sequence shown in SEQ ID NO:1. For details of this embodiment, the above description of the peptide according to this embodiment is incorporated herein by reference.

[0151] <Polynucleotide> Another aspect of the present invention is a method for producing a Tcf21 protein and a Tcf3 protein, comprising the steps of: They bind to the DNA of these target genes, forming and maintaining complexes that can regulate the function of those genes. 25 to 30 residues in the Tcf21 protein necessary for forming a three-dimensional structure that can and having the function of deactivating myofibroblasts that express the Tcf3 protein. For details of this embodiment, the above description of the polynucleotide encoding the peptide according to this embodiment is incorporated herein by reference. [Example]

[0152] The present invention will be described below with reference to specific examples, but the present invention is not limited to the following embodiments.

[0153] Example 1 (Culture of activated hepatic stellate cell clones derived from cirrhotic rat livers) Activated hepatic stellate cell clone CFSC-8B cells were used, which were immortalized by subculturing activated stellate cells isolated from rat cirrhotic livers induced by repeated administration of carbon tetrachloride. The cells were cultured at ℃ under 5% carbon dioxide. The culture medium was prepared by dissolving 4.75 g of Dulbecco's Modified Eagle's Medium (DMEM) powder (Nissui) in 500 mL of purified water, sterilizing it with high-pressure steam, and then mixing it with 10 mL of sodium bicarbonate solution (Gibco), 10 mL of L-glutamine solution (Gibco), 5 mL of non-essential amino acid solution (Gibco), 50 mL of fetal bovine serum (Gibco), and 5 mL of penicillin-streptomycin solution (Gibco).

[0154] (Preparation of reporter plasmids and gene expression plasmids) A promoter fragment spanning from bases -3,000 to +58 upstream of the transcription start site (+1) of the COL1A2 gene encoding the human type I collagen α2 chain was excised and inserted into the pGL3 vector (Promega) to generate a reporter plasmid (COL1A2 / LUC) for evaluating the transcription level of the COL1A2 gene by firefly luciferase activity. A mutant (dE) was also generated, in which the E-box sequence (CAGCTG) located at bases -122 to -117 upstream of the transcription start site of the COL1A2 gene was replaced with TTTAAA. was prepared using the Prime STAR Mutagenesis Basal Kit (TaKaRa).

[0155] Complementary DNAs (cDNAs) encoding mouse Tcf21 and Tcf3 are described below. Using oligo DNA primers, the nucleotide sequences were extracted from adult mouse hepatic stellate cells and cardiac tissue, respectively. The resulting cDNA was then inserted into the pcDNA3 vector (Invitrogen) to create an expression plasmid for each gene.

[0156] Tcf21-Forward primer, ATGTCCACTGGCTCCCTCAGCGATGTAGAA (NCBI accession No. NM_011545.2) (SEQ ID NO: 30) Tcf21-Reverse primer, TCAGGATGCTGTAGTTCCACACAAG (same as above) (SEQ ID NO: 31) Tcf3-Forward primer, ATGATGAACCAGTCTCAGAGAATGGCAC (NCBI accession number NM_001164152.2) (SEQ ID NO: 32) Tcf3-Reverse primer, CTCACAGGTGCCCGGCTGGGTTG (same as above) (SEQ ID NO: 33) As a control plasmid, a pcDNA3 vector without cDNA integration was used, and this was designated as Control.

[0157] (Gene transfer into activated hepatic stellate cell clones) CFSC-8B cells were seeded at a cell density of 15% in each well of a 24-well plate. After 1 h, 100 ng of COL1A2 / LUC plasmid, 500 ng of expression plasmid, and internal standard were added per well. 60 ng of pRL-TK (Promega) plasmid, which expresses Renilla luciferase under the herpesvirus thymidine kinase promoter, was mixed in 60 μL of Opti-MEM (Gibco). To this mixture, 1.8 μL of PEI Max (Polysciences) solution (1 μg / μL) was added, and the mixture was then incubated at room temperature for 1 It was left to stand for 5 minutes. Next, the cell culture medium in each well was replaced with a medium without penicillin and streptomycin, and the above-mentioned plasmid DNA and PEI mixture was added. After culturing for 5 hours, antibiotics were added. The medium was replaced with the original medium and cultured for another 40 hours.

[0158] (Luciferase assay) The culture supernatant was removed using an aspirator, and after gently washing with PBS, 50 μL / well of the passive lysis buffer from the Dual-Luciferase Reporter Assay System (Promega) was added. 5 μL of the collected cell lysate was added to 25 μL of the luciferase assay buffer from the same system and gently stirred. After stirring gently, measure the luminescence intensity using a luminometer for 30 seconds. Next, add 25 μL of the Stop & Glo reaction buffer from the same system, stir gently, and measure the luminescence intensity again using a luminometer. The light intensity was measured for 30 seconds to assess the luciferase activity of firefly and Renilla luciferase, respectively. The relative promoter activity of each COL1A2 gene was calculated by dividing the firefly luciferase activity in each sample by the Renilla luciferase activity.

[0159] (result) When Tcf21 or Tcf3 was overexpressed alone, the promoter activity of the wild-type (WT) COL1A2 gene was reduced to approximately 55%, and when both were coexpressed, it was reduced to approximately 35%. In contrast, when the E-box sequence (CAGCTG) was replaced with TTTAAA (dE), the promoter activity of the COL1A2 gene was reduced to approximately 80% when either Tcf21 or Tcf3 was overexpressed alone, and to approximately 60% when both were coexpressed. The attenuation of repression of gene promoter activity indicated that the repressive effect of Tcf21 / Tcf3 was at least partly mediated through this region (Fig. 1). In detail, for WT, the relative activity was 100.00% (1.28% SD) for the "Control," compared with 54.80% (7.34% SD) for "Tcf21," 54.48% (14.05% SD) for "Tcf3," and 34.17% (14.87% SD) for "Tcf21 + Tcf3." For dE, the relative activity was 100.00% (6.88% SD) for the "Control," compared with 76.93% (2.29% SD) for "Tcf21," 76.81% (2.50% SD) for "Tcf3," and 58.15% (6.14% SD) for "Tcf21 + Tcf3." The results in Figure 1 are based on the promoter activity of the WT and dE controls, which are set at 100%. It is expressed as a relative value.

[0160] Example 2 (Identification of functional peptide sequences responsible for Tcf21 deactivation) Tcf21 forms a heterodimer with Tcf3, which belongs to the same basic helix-loop-helix (bHLH) transcription factor family, and regulates the transcription of target genes. The X-ray structure of Tcf21 has not yet been analyzed, and its three-dimensional structure is still unknown. Furthermore, the three-dimensional structure of Tcf3 is only known for its DNA-binding domain. Therefore, we investigated the heterodimers of the retinoic receptor RXR / RAR, which is also a bHLH transcription factor, and the T-cell acute lymphoblastoid (T-cell amyloid β-glucan), which is known to form a heterodimer with Tcf3. Using the crystal structure of the lymphocytic leukemia protein-1 (TAL1) complex (Tcf3 / TAL1) as a template, we predicted the three-dimensional structure of the Tcf21 / Tcf3 / DNA complex by homology modeling.

[0161] (result) Both complex structural models strongly predicted that a 28-amino acid peptide consisting of LPWVPPDTKLSKLDTLRLASSYIAHLRQ (SEQ ID NO: 1) in the Tcf21 molecule is important for Tcf21 / Tcf3 / DNA complex formation, and that a five-amino acid sequence consisting of KLSKL (SEQ ID NO: 2) is essential for binding to target DNA.

[0162] Example 3 (Construction of a 28 amino acid residue expression plasmid) Homology modeling revealed that the 28 amino acid residues (LPWVPPDTKLSKLDTLRLASSYIAHLRQ (SEQ ID NO: 1)) in the Tcf21 molecule are important for the formation of the Tcf21 / Tcf3 / DNA complex. A start codon (ATG) is added to the N-terminus of the gene encoding the peptide, and a stop codon (TAA) is added to the C-terminus. The added DNA fragment was amplified using the primers described below in the Tcf21 expression plasmid shown in Example 1. The DNA was amplified using the mid DNA as a template. An expression plasmid for a peptide consisting of the amino acid sequence shown in sequence number 1 was constructed.

[0163] Tcf21 28 residues-Forward primer, ATGCTGCCCTGGGTGCCCCG (NCBI accession No. NM_011545.2) (SEQ ID NO: 34) Tcf21 28 residues-Reverse primer, TTACTGCCTTAAGTGAGCGATGTAGCTGGAC (sequence Number 35)

[0164] (Gene transfection into activated hepatic stellate cell clones and luciferase assay) Plasmid DNA was introduced into CFSC-8B cells in the same manner as in Example 1, and the promoter activity of the COL1A2 gene was evaluated using the Dual Luciferase Reporter Assay System.

[0165] (result) Even a plasmid expressing a peptide consisting of the amino acid sequence represented by SEQ ID NO: 1 showed almost the same inhibitory effect on the promoter activity of the COL1A2 gene as full-length Tcf21, especially when co-expressed with Tcf3. It was demonstrated that a peptide consisting of this sequence forms a Tcf21 / Tcf3 / DNA complex and is therefore responsible for the deactivation of activated hepatic stellate cells (Figure 2). In detail, the relative activity of "Tcf21" was 66.59% (1.84% SD), "SEQ ID No.1" was 76.89% (4.31% SD), "Control + Tcf3" was 63.31% (1.08% SD), "Tcf21 + Tcf3" was 45.84% (1.78% SD), and "SEQ ID No.1 + Tcf3" was 48.58% (1.53% SD), compared to 100.00% (2.13% SD) for "Control." The results in Figure 2 were obtained from a peptide consisting of Tcf21, Tcf3, and the amino acid sequence shown in SEQ ID NO: 1. When an empty expression vector without any of the peptides was introduced, the promoter activity of the control The relative values are expressed with the 100% accuracy. This shows a "peptide consisting of the amino acid sequence represented by SEQ ID NO: 1."

[0166] Example 4 (Construction of mutant plasmids) Among the amino acid sequence shown in SEQ ID NO: 1 examined in Example 3, five amino acids (KLSKL (SEQ ID NO: 2)) predicted to be particularly important for the formation of the Tcf21 / Tcf3 / DNA complex were selected. One or two lysine residues (K) within these five amino acids were replaced with alanine residues (A) using the Prime STAR Mutagenesis Basal Kit (TaKaRa) to generate the following three mutants. M1: ALSKL (SEQ ID NO: 15) M2: KLSAL (SEQ ID NO: 16) M3: ALSAL (SEQ ID NO: 17)

[0167] (Gene transfection into activated hepatic stellate cell clones and luciferase assay) Plasmid DNA was introduced into CFSC-8B cells in the same manner as in Example 1, and the promoter activity of the COL1A2 gene was evaluated using the Dual Luciferase Reporter Assay System.

[0168] (result) The promoter activity of the COL1A2 gene was reduced to approximately 60% by wild-type Tcf21 (WT) and to approximately 70 to 80% by the introduction of the three Tcf21 mutants. Furthermore, under coexpression with Tcf3, the promoter activity was reduced to approximately 40% by the introduction of wild-type, M1, or M2 mutant Tcf21 and to approximately 50% by the introduction of the M3 mutant. Therefore, the role of KLSKL (SEQ ID NO: 1) in the repression of COL1A2 transcription by Tcf21 was confirmed. 2) The importance of sequence became clear (Figure 3). In detail, compared to 100.00% (4.99% SD) for "Control," 59.33% (3.14% SD) for "WT," 72.69% (1.75% SD) for "M1," 75.88% (13.30% SD) for "M2," 81.77% (12.28% SD) for "M3," 62.78% (4.68% SD) for "Control + Tcf3," 42.72% (4.42% SD) for "WT + Tcf3," and 42.72% (4.42% SD) for "M1." The relative activity of "M2 + Tcf3" was 42.10% (7.90% SD), "M2 + Tcf3" was 40.53% (2.38% SD), and "M3 + Tcf3" was 52.41% (9.47% SD). The results in Figure 3 are relative values, with the promoter activity of the control, which was obtained by introducing an empty expression vector containing no wild-type Tcf21 (WT), Tcf21 mutants, or Tcf3, set at 100%. It is expressed as a value.

Claims

1. A peptide consisting of an amino acid sequence of 25 to 30 residues necessary to form a three-dimensional structure that can bind to the DNA of the target gene of Tcf21 protein and Tcf3 protein together with the Tcf3 protein, and form and maintain a complex that can control the function of the gene, and which has the function of deactivating myofibroblasts that express the Tcf3 protein, and which consists of an amino acid sequence that is 90% or more identical to the amino acid sequence represented by any of SEQ ID NOs: 1, 36 to 38.

2. The peptide according to claim 1, which is a peptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 1, 36 to 38.

3. A polynucleotide encoding the peptide of claim 1 or 2.

4. A pharmaceutical composition for the prevention or treatment of a disease that can be prevented or treated by deactivating myofibroblasts expressing Tcf3 protein, comprising a peptide consisting of an amino acid sequence of 25 to 30 residues necessary for binding to the DNA of the target gene of Tcf21 protein and Tcf3 protein together with the Tcf3 protein to form a three-dimensional structure that can form and maintain a complex that can control the function of the gene, and which has the function of deactivating myofibroblasts expressing Tcf3 protein, and which comprises a peptide consisting of an amino acid sequence that has 90% or more identity to the amino acid sequence represented by any of SEQ ID NOs: 1, 36 to 38 and / or a polynucleotide encoding said peptide.

5. The pharmaceutical composition according to claim 4, used in combination with a composition comprising a Tcf3 protein and / or a polynucleotide encoding the same.

6. A pharmaceutical composition described in claim 4 or 5, wherein the peptide is a peptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 1, 36 to 38.

7. The pharmaceutical composition according to any one of claims 4 to 6, wherein the disease that can be prevented or treated by deactivating myofibroblasts that express the Tcf3 protein is a disease selected from the group consisting of the following (a) to (f): (a) hepatitis, liver fibrosis, cirrhosis, or liver cancer, or liver failure due to any of these diseases; (b) pancreatitis, pancreatic fibrosis, or pancreatic secretory insufficiency due to any of these diseases; (c) nephritis, renal fibrosis, or glomerulosclerosis, or renal failure due to any of these diseases; (d) Interstitial pneumonia, pulmonary fibrosis, or respiratory failure due to any of these diseases; (e) fibrosis after myocardial infarction; myocarditis, cardiomyopathy, or heart failure due to any of these diseases; (f) Coronary artery stenosis due to arterial atherosclerosis, restenosis of the coronary artery after balloon dilatation, or restenosis of the coronary artery after stent placement, or ischemic heart disease due to any of these diseases

8. A method for deactivating myofibroblasts, comprising the step of introducing a peptide consisting of an amino acid sequence of 25 to 30 residues necessary for binding to the DNA of the target gene of Tcf3 protein and Tcf21 protein together with the Tcf3 protein, and forming a three-dimensional structure that can form and maintain a complex that can control the function of the gene, and which has the function of deactivating myofibroblasts that express Tcf3 protein, and which comprises introducing a peptide consisting of an amino acid sequence that has 90% or more identity to the amino acid sequence represented by any of SEQ ID NOs: 1, 36 to 38, and / or a polynucleotide encoding said peptide, into myofibroblasts that express Tcf3 protein (excluding myofibroblasts that express Tcf3 protein in vivo in humans).

9. The method of claim 8, further comprising the step of introducing Tcf3 protein and / or a polynucleotide encoding the same into myofibroblasts that express the Tcf3 protein.

10. The method described in claim 8 or 9, wherein the peptide is a peptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 1, 36 to 38.

11. The method of any one of claims 8 to 10, wherein the myofibroblasts expressing Tcf3 protein are myofibroblasts expressing Tcf3 protein in one or more organs or tissues selected from the group consisting of liver, pancreas, kidney, lung, heart, and coronary artery.

12. A method for producing deactivated myofibroblasts, comprising the step of introducing a peptide consisting of an amino acid sequence of 25 to 30 residues necessary for binding, together with Tcf3 protein, to the DNA of the target gene of Tcf21 protein and Tcf3 protein, and forming a three-dimensional structure that can form and maintain a complex that can control the function of the gene, and which has the function of deactivating myofibroblasts that express Tcf3 protein, and which comprises an amino acid sequence that has 90% or more identity to the amino acid sequence represented by any of SEQ ID NOs: 1, 36 to 38, and / or a polynucleotide encoding said peptide, into myofibroblasts that express Tcf3 protein (excluding myofibroblasts that express Tcf3 protein in vivo in humans).

13. The method of claim 12, further comprising the step of introducing Tcf3 protein and / or a polynucleotide encoding the same into myofibroblasts that express the Tcf3 protein.

14. A manufacturing method described in claim 12 or 13, wherein the peptide is a peptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 1, 36 to 38.

15. The production method according to any one of claims 12 to 14, wherein the myofibroblasts expressing Tcf3 protein are myofibroblasts expressing Tcf3 protein in one or more organs or tissues selected from the group consisting of the liver, pancreas, kidney, lung, heart, and coronary artery.

Citation Information

Patent Citations

  • Anti-fibrogenesis agent

    JP2019108291A

  • Compositions for treating liver fibrosis and methods for treating liver fibrosis

    JP2019150075A

  • Pharmaceutical composition for preventing and / or treating hepatic fibrosis, and application of the same

    JP2020070250A

  • Method for deactivating activated hepatic stellate cells

    WO2020121366A1

  • Method for deactivating active hepatic stellate cell

    WO2020121546A1