Archaeal pyrrolysyl-tRNA synthetase for use in orthogonal methods

Abstract

The present invention relates to an efficient orthogonal translation system for eukaryotic cells. Specifically, the present invention relates to a eukaryotic cell comprising a polynucleotide encoding a prokaryotic tRNA synthetase (pRS) and an RNA molecule comprising a prokaryotic tRNA (ptRNA) and one or more ribozymes (herein referred to as a "ptRNA-ribozyme"). The present invention also relates to a method for expressing a polypeptide of interest (POI) containing one or more non-canonical amino acid (ncAA) residues by the eukaryotic cell, as well as a kit useful for the method. The present invention further relates to a polynucleotide encoding the ptRNA-ribozyme.

Description

[Technical Field]

[0001] The present invention relates to an efficient orthogonal translation system for eukaryotic cells. Specifically, the present invention relates to a eukaryotic cell containing a polynucleotide encoding a prokaryotic tRNA synthetase (pRS) and an RNA molecule comprising a prokaryotic tRNA (ptRNA) and one or more ribozymes (herein referred to as a "ptRNA-ribozyme"); a method for expressing a polypeptide of interest (POI) containing one or more non-canonical amino acid (ncAA) residues by the eukaryotic cell; and a kit useful for the method. The present invention further relates to a polynucleotide encoding the ptRNA-ribozyme. [Background technology]

[0002] Genetic code expansion (GCE) is one of the most powerful tools for protein engineering, involving the site-specific introduction of post-translational modifications or the labeling of proteins with specialized dyes to study their structure or dynamics. Specifically, GCE enables the translational modification of polypeptides by direct genetic encoding of ncAA residues, specifically stop codon suppression, using tRNA / aminoacyl-tRNA synthetase (tRNA / RS) pairs that are orthogonal to the host cell's translational machinery.

[0003] An ideal orthogonal tRNA / RS pair would not cross-react with the host translational machinery, thereby minimizing the impact on cellular housekeeping translation activity and normal physiological functions. Various prokaryotic (bacterial and archaeal) tRNA / RS pairs have been used to genetically encode various ncAA residues in polypeptides (e.g., artificial Methanococcus jannaschii tRNA / tyrosyl-RS, Escherichia coli tRNA / leucyl-RS, and Methanosarcina mazei and M. barkeri tRNA / pyrrolysyl-RS pairs). (See, e.g., Non-Patent Documents 1, 2, 3, 4, 5, 6, and 7).

[0004] Over the years, various developments have been made to improve the efficiency of GCE. These include the use of archaeal RSs that lack a nuclear localization signal (NLS) and / or contain a nuclear export signal (NES) to enable the RS to be primarily localized in the cytoplasm (rather than in the nucleus), as described, for example, in Patent Document 1. Further approaches to increasing GCE efficiency that have been explored include promoter engineering, better evolution of orthogonal RSs, release factor engineering, and multi-stranded tRNAs, to name a few (for a review, see Non-Patent Document 8).

[0005] However, strategies to improve the efficiency of GCE in eukaryotic cells remain in high demand. A more efficient GCE allows cells to express larger amounts of POIs containing one or more ncAA residues. A larger amount of POI available for labeling and imaging purposes is advantageous, for example, when low-abundance polypeptides are labeled. Therefore, the objective of the present invention was to (further) improve the efficiency of GCE. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] International Publication No. 2018 / 069481 [Non-patent literature]

[0007] [Non-Patent Document 1] Chin et al., J Am Chem Soc 124:9026,2002 [Non-patent document 2] Chin et al.,Science 301:964,2003 [Non-patent document 3] Nguyen et al., J Am Chem Soc 131:8720,2009 [Non-patent document 4] Yanagisawa et al.,Chem Biol 15:1187,2008 [Non-patent document 5] Liu et al.,Annu Rev Biochem 83:379-408,2010 [Non-patent document 6] Lemke,ChemBioChem 15:1691-1694,2014 [Non-Patent Document 7] Wan et al., Biochim Biophys Acta 1844:1059-170 [Non-patent document 8] Chin et al.,Annu Rev Biochem 83:379-408,2014 Summary of the Invention

[0008] The present inventors have surprisingly found that expressing an orthogonal tRNA as an RNA molecule containing a tRNA together with a ribozyme and coexpressing a double-stranded RNA (dsRNA-) binding polypeptide can increase the amount of POI expressed by a GCE in eukaryotic cells. Without wishing to be bound by theory, it is hypothesized that the dsRNA binding polypeptide inhibits the phosphorylation of the α subunit of eukaryotic initiation factor 2α (eIF-2α) by protein kinase R (PKR), thus alleviating the impairment of eIF-2α activity and protein synthesis associated with PKR activity.

[0009] Without wishing to be bound by theory, it is further postulated that ribozymes improve the processing of difficult tRNAs in eukaryotic cells, thus increasing the amount of processed, functional orthogonal tRNAs available for GCE. A sufficient supply of processed, functional orthogonal tRNAs is essential for GCE (e.g., amber suppression), especially given the potential for orthogonal tRNAs to also interact with untranslated elements in the cell, such as the tRNA processing machinery and elongation factors.

[0010] Thus, in a first aspect, the present invention relates to a eukaryotic cell comprising: (a) a polynucleotide encoding a prokaryotic aminoacyl-tRNA synthetase (pRS), and (b) a polynucleotide encoding a prokaryotic tRNA (ptRNA) and one or more ribozymes.

[0011] In a further aspect, the present invention relates to a eukaryotic cell comprising: (a) a polynucleotide encoding a prokaryotic aminoacyl-tRNA synthetase (pRS); (b) a polynucleotide encoding a prokaryotic tRNA (ptRNA), and (c) A polynucleotide encoding a polypeptide capable of binding to a dsRNA described herein (a dsRNA-binding polypeptide).

[0012] In the eukaryotic cells of the present invention, the pRS encoded by the polynucleotide of item (a) is capable of acylating ptRNA, particularly acylating ptRNA with a non-canonical amino acid (ncAA), and the sequences encoding ptRNA and a ribozyme contained in the polynucleotide of item (b) are linked such that transcription produces an RNA molecule containing both ptRNA and ribozyme (ptRNA-ribozyme).

[0013] A dsRNA-binding polypeptide used in the context of the present invention (e.g., encoded or expressed by a polynucleotide used) comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the sequence set forth in any one of SEQ ID NOs: 37 and 57-59.

[0014] In a further aspect, the present invention relates to a polynucleotide encoding an RNA molecule comprising a ptRNA and a ribozyme (ptRNA-ribozyme) as described herein.

[0015] In a further aspect, the present invention relates to a polynucleotide, or a combination of two or more polynucleotides, comprising a nucleotide sequence encoding an RNA molecule comprising a ptRNA and a ribozyme (ptRNA-ribozyme) as described herein, (i) a nucleotide sequence encoding a tetO-binding protein described herein, or (ii) a nucleotide sequence encoding a pRS described herein; or (iii) Both (i) and (ii).

[0016] The two or three nucleotide sequences can be located on the same polynucleotide. Alternatively, each of the two or three nucleotide sequences can be located on a separate polynucleotide (thus resulting in a combination of two or three polynucleotides, respectively). Alternatively, two of the three nucleotide sequences can be located on the same polynucleotide and the third nucleotide sequence (i.e., the ptRNA-ribozyme-encoding sequence, or the pRS-encoding sequence, or the tetO-binding protein-encoding sequence) can be located on a separate polynucleotide (thus resulting in a combination of two polynucleotides).

[0017] In a further aspect, the present invention relates to a method for preparing a polypeptide of interest (POI) having one or more non-canonical amino acid (ncAA) residues in its amino acid sequence, the method comprising the steps of: (a) expressing in a eukaryotic cell: - pRS, and - an RNA molecule comprising ptRNA and a ribozyme as described herein (ptRNA-ribozyme); (b) expressing the POI in a eukaryotic cell in the presence of one or more ncAAs or salts thereof corresponding to one or more ncAA residues of the POI; and (c) optionally recovering the expressed POI.

[0018] In a further aspect, the present invention relates to a method for preparing a polypeptide of interest (POI) having one or more non-canonical amino acid (ncAA) residues in its amino acid sequence, the method comprising the steps of: (a) expressing in a eukaryotic cell: - pRS, - prokaryotic tRNA (ptRNA), and - a polypeptide capable of binding to a dsRNA as described herein (dsRNA-binding polypeptide); and (b) expressing the POI in a eukaryotic cell in the presence of one or more ncAAs or salts thereof corresponding to one or more ncAA residues of the POI; and (c) optionally recovering the expressed POI.

[0019] In a method for preparing a polypeptide of interest (POI) according to the present invention, a pRS is capable of acylating a ptRNA with an ncAA or a salt thereof, and the POI is encoded by a nucleotide sequence containing one or more selector codons encoding one or more ncAA residues, the selector codons being the reverse complement of the anticodon of the ptRNA.

[0020] Steps (a) and (b) of the method can be performed simultaneously or sequentially. For example, expression step (a) can be performed first, followed by expression step (b). If expression of pRS and RNA molecules (ptRNA-ribozyme or ptRNA, respectively) is initiated according to step (a), said expression can be continued when expression of POI is initiated according to step (b).

[0021] In a further aspect, the present invention relates to a kit for preparing a POI having one or more ncAA residues in its amino acid sequence, the kit comprising one or more ncAAs, or salts thereof, corresponding to one or more ncAA residues of the POI, and: (a) a polynucleotide of the invention described herein, or a combination of two or more polynucleotides; or (b) a polynucleotide encoding a dsRN-binding polypeptide described herein, or (c) a eukaryotic cell of the invention as described herein.

[0022] In GCE, uncontrolled expression of an orthogonal tRNA / RS pair can result in undesirable side effects. For example, an excess of unused RS and / or unused tRNA can impair cell viability. The present invention solves this problem by further providing eukaryotic cells, polynucleotides, methods, and kits for GCE, in which (i) transcription of a nucleotide sequence encoding a tRNA (ptRNA or ptRNA-ribozyme), a pRS, or both, is controlled by a tetracycline-responsive promoter element (TRE); or (ii) transcription of the nucleotide sequence is catalyzed by an RNA polymerase (e.g., T7 RNA polymerase), and expression of the RNA polymerase is controlled by a TRE. Thus, expression of the tRNA and / or pRS is made inducible by co-expression of a protein that binds to the TRE (within the tetracycline operator (tetO) sequence), such as, for example, tetracycline repressor (tetR), tetracycline-controlled transcription activator (tTA) or reverse tTA (rtTA), and the presence (or absence) of a tetracycline derivative, such as tetracycline or doxycycline. [Brief explanation of the drawings]

[0023] [Figure 1] FIG. 1 shows a schematic diagram (5′ to 3′) of a tRNA expression cassette for T7RNAP-controlled expression of tRNA with and without a (HDV) ribozyme (“HDV-Rib.”). [Figure 2]Figure 2 shows the results of flow cytometry analysis of HEK293T cells harboring an NLS-iRFP-Flag-GFPY39->TAG-6His amber suppression reporter, T7RNAP, and expression cassettes for amber suppression versus tRNAPyl / PylRSAF. tRNAPyl was expressed either with ("tRNAPyl-HDV rib.") or without ("tRNAPyl") the HDV ribozyme. HEK293T cells also harbored an expression cassette for HA-tagged human PKR(2-174). Samples include a control in which cells were not supplied with the ncAA SCO ("-SCO" in the bottom row). The numbers in the quadrants indicate the percentage of cells in each population calculated based on the total number of cells measured: cells not expressing the reporter gene (lower left; "DN" = double negative); cells showing only GFP fluorescence (lower right; "GFP only"); cells expressing only iRFP without amber suppression (upper left; "iRFP only"); and cells expressing the full reporter with amber suppression (upper right; "DP" = double positive). See Example 1. Experiments using the plasmid pcDNA3.1 (containing the CMV promoter). [Figure 3]Figure 3 shows the results of flow cytometry analysis of HEK293T cells harboring an NLS-iRFP-Flag-GFPY39->TAG-6His amber suppression reporter, T7RNAP, and expression cassettes for amber suppression versus tRNAPyl / PylRSAF. tRNAPyl was expressed either with ("tRNAPyl-HDV rib.") or without ("tRNAPyl") the HDV ribozyme. HEK293T cells also harbored an expression cassette for HA-tagged human PKR(2-174). Samples include a control in which cells were not supplied with the ncAA SCO ("-SCO" in the bottom panel). The numbers in the quadrants indicate the percentage of cells in each population calculated based on the total number of cells measured: cells not expressing the reporter gene (lower left; "DN" = double negative); cells showing only GFP fluorescence (lower right; "GFP only"); cells expressing only iRFP without amber suppression (upper left; "iRFP only"); and cells expressing the full reporter with amber suppression (upper right; "DP" = double positive). See Example 1. Experiments using the plasmid pCAGGS (containing the chicken actin promoter and CMV enhancer with an intron). [Figure 4a]Figure 4a shows the results of flow cytometry analysis of HEK Flp-In T-REx 293 cells harboring expression cassettes for the NLS-iRFP-Flag-GFPY39->TAG-6His amber suppression reporter, NES-T7RNAP, and the amber suppression pair tRNAPyl / NES-PylRSAF. tRNAPyl was expressed either with ("tRNAPyl-HDV rib.") or without ("tRNAPyl") the HDV ribozyme, and NES-PylRSAF and NES-T7RNAP were inducibly expressed using the T-REx system (ThermoFisher Scientific). Cells were supplied with the ncAA Boc ("+Boc"), and expression of NES-PylRSAF and NES-T7RNAP was either induced with tetracycline (left panel; "+Tet") or not (control; right panel). The numbers in the quadrants indicate the percentage of cells in each population calculated based on the total number of cells measured: cells not expressing the reporter gene (bottom left; "DN" = double negative); cells showing only GFP fluorescence (bottom right; "GFP only"); cells expressing only iRFP without amber suppression (top left; "iRFP only"); and cells with full reporter expression with amber suppression (top right; "DP" = double positive). See Example 2. [Figure 4b]Figure 4b shows the results of flow cytometry analysis of HEK293T cells harboring the NLS-iRFP-Flag-GFPY39->TAG-6His amber suppression reporter, NES-T7RNAP, and expression cassettes for amber suppression pair tRNAPyl / NES-PylRSAF. tRNAPyl was expressed with ("tRNAPyl-HDV rib.") or without ("tRNAPyl") the HDV ribozyme, and NES-PylRSAF and NES-T7RNAP were inducibly expressed using the Tet-On system. Cells were supplied with the ncAA Boc ("+Boc"), and expression of NES-PylRSAF and NES-T7RNAP was either induced with doxycycline (left panel; "+Dox") or not (control; right panel). The numbers in the quadrants indicate the percentage of cells in each population calculated based on the total number of cells measured: cells not expressing the reporter gene (bottom left; "DN" = double negative); cells showing only GFP fluorescence (bottom right; "GFP only"); cells expressing only iRFP without amber suppression (top left; "iRFP only"); and cells expressing full reporter with amber suppression (top right; "DP" = double positive). See Example 2. [Figure 5a] Figure 5a shows the results of flow cytometry analysis of HEK293T cells harboring expression cassettes for the following: NLS-iRFP-Flag-GFPY39->TAG-6His amber suppression reporter, tetR, and amber suppression pair tRNAPyl / NES-PylRSAF (expression of tRNAPyl was controlled by a tetracycline-inducible mutant of the human U6 promoter containing eight tetO sequences before and two tetO sequences after the U6 promoter, and expression of NES-PylRSAF was controlled by a (constitutive) CMV promoter). [Figure 5b]Figure 5b shows the results of flow cytometry analysis of HEK293T cells harboring expression cassettes for the following: NLS-iRFP-Flag-GFPY39->TAG-6His amber suppressor reporter, tetR, and amber suppressor pair tRNAPyl / NES-PylRSAF (expression of tRNAPyl was controlled by a tetracycline-inducible mutant of the human H1 promoter containing two tetO sequences, and expression of NES-PylRSAF was controlled by a (constitutive) CMV promoter). [Figure 5c] Figure 5c shows the results of flow cytometry analysis of HEK293T cells carrying expression cassettes for the NLS-iRFP-Flag-GFPY39->TAG-6His amber suppression reporter, tetR, and amber suppression pair tRNAPyl / NES-PylRSAF (expression of tRNAPyl was controlled by a tetracycline-inducible mutant of the human U6 promoter containing eight tetO sequences before and two tetO sequences after the U6 promoter, and expression of NES-PylRSAF was controlled by a tetracycline-inducible mutant of the CMV promoter containing two tetO sequences). [Figure 5d] Figure 5d shows the results of flow cytometry analysis of HEK293T cells carrying expression cassettes for the following: NLS-iRFP-Flag-GFPY39->TAG-6His amber suppression reporter, tetR, NES-T7RNAP expressed under the control of a tetracycline-inducible mutant of the CMV promoter containing two tetO sequences, and the amber suppression pair tRNAPyl / NES-PylRSAF (tRNAPyl was expressed together with the HDV ribozyme under the control of the T7 promoter, and expression of NES-PylRSAF was controlled by a tetracycline-inducible mutant of the CMV promoter containing two tetO sequences). [Figure 5e]Figure 5e shows the results of flow cytometry analysis of HEK293T cells harboring expression cassettes for the following: NLS-iRFP-Flag-GFPY39->TAG-6His amber suppression reporter, tetR, NES-T7RNAP expressed under the control of a tetracycline-inducible mutant of the CMV promoter containing two tetO sequences, and the amber suppression pair tRNAPyl / NES-PylRSAF (tRNAPyl was expressed together with the HDV ribozyme under the control of the T7 promoter, and expression of NES-PylRSAF was controlled by the (constitutive) CMV promoter). [Figure 5f]Figure 5f shows the results of flow cytometry analysis of HEK293T cells harboring expression cassettes for the following: NLS-iRFP-Flag-GFPY39->TAG-6His amber suppressor reporter, tetR, NES-T7RNAP expressed under the control of the CMV promoter, and amber suppressor pair tRNAPyl / NES-PylRSAF (tRNAPyl was expressed together with the HDV ribozyme under the control of the T7 promoter, and expression of NES-PylRSAF was controlled by a tetracycline-inducible mutant of the CMV promoter containing two tetO sequences). Additionally, HEK293T cells harbored an expression cassette for HA-tagged human PKR(2-174) ("+PKR(2-174)"; lower histograms in Figures 5a-f) or lacked the expression cassette (=control; upper histograms in Figures 5a-f). The cells were either supplied with the ncAA BOC ("Boc"; histograms in the left and right columns of Figures 5a-f) or not (middle column histogram), and expression of the inducible elements (tRNAPyl, NES-PylRSAF, and / or NES-T7RNAP) was either induced with tetracycline ("Tet"; histograms in the left and middle columns of Figures 5a-f) or not (right column histogram). The numbers in the quadrants indicate the percentage of cells in each population calculated based on the total number of cells measured: cells not expressing the reporter gene (bottom left; "DN" = double negative); cells showing only GFP fluorescence (bottom right; "GFP only"); cells expressing only iRFP without amber suppression (top left; "iRFP only"); and cells expressing the full reporter with amber suppression (top right; "DP" = double positive). See Example 3. DETAILED DESCRIPTION OF THE INVENTION

[0024] [Detailed Description of the Invention] Unless otherwise specified or required by context, singular terms include plurals and plural terms include the singular. Thus, for example, a eukaryotic cell defined as containing a "polynucleotide encoding a pRS" includes eukaryotic cells that contain one or more such polynucleotides, as well as eukaryotic cells in which the polynucleotide or polynucleotides encode one or more pRSs.

[0025] Unless otherwise specified, nucleotide sequences are presented herein in a 5' to 3' orientation. Unless otherwise specified, amino acid sequences are presented herein in an N-terminal to C-terminal orientation.

[0026] 1. Prokaryotic aminoacyl-tRNA synthetase / prokaryotic tRNA (pRS / ptRNA) The eukaryotic cells of the invention comprise a polynucleotide encoding a prokaryotic RS / tRNA (pRS / ptRNA) pair (wherein the pRS is capable of acylating the ptRNA). In particular, the pRS is capable of acylating the tRNA with an amino acid or amino acid analog (e.g., a compound that differs from an amino acid by replacing the α-amino group with a hydroxyl group and / or forming an ester with a carboxylic acid functional group), preferably a non-canonical amino acid (ncAA).

[0027] As used in the context of the present invention, ptRNA and pRS are orthogonal to the translation machinery of a eukaryotic (host) cell (recombinant) expressing said ptRNA and pRS. As used herein, the term "orthogonal" indicates that this particular molecule (e.g., an orthogonal tRNA (O-tRNA) and / or an orthogonal RS (O-RS)) is used with reduced efficiency by the translation system (e.g., a host cell) of interest.

[0028] The term "translation system" generally refers to the set of components necessary to incorporate naturally occurring amino acids into a growing polypeptide chain (protein). Components of a translation system include, for example, ribosomes, tRNA, aminoacyl-tRNA synthetases, mRNA, etc. The translation system used in the context of the present invention is preferably a eukaryotic cell.

[0029] Specifically, "orthogonal" refers to an O-tRNA or O-RS that is unable to or functions with reduced efficiency (e.g., less than 20% efficiency, less than 10% efficiency, less than 5% efficiency, or less than 1% efficiency, etc.) with an endogenous RS or endogenous tRNA, respectively, of the translation system of interest in which the orthogonal RS or orthogonal tRNA is used. For example, the O-tRNA in the translation system of interest is (amino)acylated with reduced or even zero efficiency by any endogenous RS of the translation system when compared to the (amino)acylation of the endogenous tRNA by the endogenous RS. For example, the O-RS (amino)acylates any endogenous tRNA in the translation system of interest with reduced or even zero efficiency when compared to the (amino)acylation of the endogenous tRNA by the endogenous RS. As used herein, an "orthogonal translation system" refers to an RS / O-tRNA that is capable of introducing an ncAA residue into a growing polypeptide chain. ncAA This refers to a translation system that uses pairs.

[0030] Unless otherwise indicated, the terms "endogenous tRNA" and "endogenous aminoacyl-tRNA synthetase" ("endogenous RS") as used herein refer to the tRNA and RS, respectively, present in the cell that is ultimately used as the translation system prior to the introduction of the pRS and ptRNA, respectively, used in the context of the present invention.

[0031] The ptRNA and pRS used in the methods and / or fusion proteins of the invention can be naturally occurring (i.e., ptRNA and pRS found in prokaryotes in nature) or can be derived by mutation of a naturally occurring ptRNA or pRS, respectively. In various embodiments, the ptRNA and pRS are derived from prokaryotes, e.g., eubacteria or archaea (e.g., Escherichia coli; Methanococcus species such as M. jannaschii; Methanosarcina species such as M. mazei, M. barkeri, M. acetivorans, M. thermophile; Methanococcoides species such as M. burtonii; Desulfitobacterium species such as D. hafniense). In another embodiment, the ptRNA is a naturally occurring ptRNA or a variant of a naturally occurring ptRNA from a first prokaryote, and the RS is derived from a naturally occurring pRS or a variant of a naturally occurring pRS from a second prokaryote.

[0032] Suitable (orthogonal) tRNA / pRS pairs can be selected from libraries of mutant tRNAs and pRSs, for example, based on the results of library screening. Methods for evolving tRNA / RS pairs are described, for example, in WO 02 / 085923 and WO 02 / 06075.

[0033] Several prokaryotic RSs, including Methanococcus jannaschii tyrosyl-tRNA synthetase, E. coli tyrosyl-tRNA synthetase, E. coli leucyl-tRNA synthetase, and pyrrolysyl-tRNA synthetases from certain Methanosarcina species (e.g., M. mazei, M. barkeri, M. acetivorans, M. thermophila), Methanococcoides species (e.g., M. burtonii), Desulfitobacterium species (e.g., D. hafniense), or Methanomethylophilus species (e.g., M. alvus), have been used to expand the genetic code.

[0034] Corresponding orthogonal pRS / ptRNA pairs have been used to genetically encode various functionalities of polypeptides (Chin, Annu Rev Biochem 2014, 83:379-408; Chin et al., J Am Chem Soc 2001, 124:9026; Chin et al., Science 2003, 301:964; Nguyen et al., J Am Chem Soc 2009, 131:8720; Willis and Chin, Nat Chem 2018, 10:831-837; Yanagisawa et al., Chem Biol 2008, 15:1187). Such pRS and ptRNA pairs can be used in the present invention.

[0035] The pyrrolysyl-tRNA synthetase (PylRS) that can be used as pRS in the context of the present invention can be a wild-type PylRS or a genetically engineered PylRS. Examples of wild-type PylRS include, but are not limited to, PylRSs from archaea and eubacteria, such as Methanosarcina maize, Methanosarcina barkeri, Methanococcoides burtonii, Methanosarcina acetivorans, Methanosarcina thermophila, Methanomethylophilus alvus, and Desulfitobacterium hafniense. Genetically engineered PylRSs are described, for example, in Neumann et al. (Nat Chem Biol 2008, 4:232), Yanagisawa et al. (Chem Biol 2008, 15:1187), and EP 2192185 A1.

[0036] The efficiency of genetic code expansion using PylRS can be improved by modifying the amino acid sequence of PylRS so that it is not targeted to the nucleus. To this end, the nuclear localization signal (NLS) can be removed from PylRS or can be disabled by introducing an appropriate nuclear export signal (NES). Thus, in certain embodiments of the present invention, the pRS is a PylRS described herein, or a functional fragment or mutant thereof, lacking an NLS and / or comprising an NES (e.g., as described in WO2018 / 069481). For example, the PylRS can have an NES, preferably inserted between amino acid position 1 (the methionine residue) of pRS and amino acid position 2 of pRS.

[0037] The term "nuclear export signal" (abbreviated as "NES") refers to an amino acid sequence capable of directing the export of a polypeptide containing it (such as an NES-containing pRS of the invention or an NES-T7RNAP as used herein) from the nucleus of a eukaryotic cell. Said export is thought to be mediated in large part by Crm1 (chromosomal region maintenance 1; also known as karyopherin exportin 1). NESs are known in the art.

[0038] For example, the database ValidNES (http: / / validness.ym.edu.tw / ) provides sequence information of experimentally validated NES-containing proteins. Furthermore, NES databases, such as NESbase 1.0 (see www.cbs.dtu.dk / databased / NESbase-1.0 / ; Le Cour et al., Nucl Acids Res 31(1), 2003), and tools for NES prediction, such as NetNES (see www.cbs.dtu.dk / services / NetNES / ; Le Cour et al., Protein Eng Des Sel 17(6):527-536, 2004), NESpredictor (NetNES, http: / / www.cbs.dtu.dk / ; Fu et al., Nucl Acids Res 41:D338-D343, 2013; La Cour et al., Protein Eng Des Sel 17(6):527-536, 2004), and NESsential (a web interface combined with ValidNES), are publicly available.

[0039] Hydrophobic leucine-rich NESs are the most common and represent the best-characterized group of NESs to date. Hydrophobic leucine-rich NESs are non-conserved motifs with three or four hydrophobic residues. Many of these NESs contain the conserved amino acid sequence pattern LxxLxL (SEQ ID NO: 28) or LxxxLxL (SEQ ID NO: 29), where each L is independently selected from the amino acid residues leucine, isoleucine, valine, phenylalanine, and methionine, and each x is independently selected from any amino acid (see La Cour et al., Protein Eng Des Sel 17(6):527-536, 2004).

[0040] Specific NESs suitable as signal peptides for pRS (particularly PylRS) used in the present invention are known in the art (e.g., from NES databases) and are described in, for example, WO2018 / 069481.

[0041] In certain embodiments, the pRS used in the present invention comprises a hydrophobic leucine-rich NES, particularly an NES comprising the amino acid sequence LxxLxL (SEQ ID NO: 28) or LxxxLxL (SEQ ID NO: 29), where each L is independently selected from leucine, isoleucine, valine, phenylalanine, and methionine, and each x is independently selected from any amino acid. More specifically, the NES comprises an NES comprising L 1 xxL 2 xxL 1 xL 3 (SEQ ID NO: 30), L 1 xxxL 2 xxL 1 xL 3 (SEQ ID NO: 31), L 1 xxL 2 xxxL 1 xL 3 (SEQ ID NO: 32) and L 1 xxxL 2 xxxL 1 xL 3 (SEQ ID NO: 33). 1 is leucine, and L 2 is selected from leucine, isoleucine, valine, phenylalanine and methionine, L 3 is selected from leucine and isoleucine, and each x is independently selected from any amino acid. Preferably, the NES comprises the amino acid sequence LPPLERLTL (SEQ ID NO: 34) found in the HIV-1 Rev protein, or more preferably, the amino acid sequence ACPVPLQLPPLERLTLD (SEQ ID NO: 35).

[0042] A "nuclear localization signal" (abbreviated as "NLS" and also referred to in the art as a "nuclear localization sequence") is a polypeptide containing it (e.g., NLS-iRFP-Flag-GFP). Y39->TAG -6His) is an amino acid sequence that "tags" (i.e., directs) the protein to be imported into the nucleus of a eukaryotic cell.

[0043] The transport is thought to be mediated by the binding of NLS-containing polypeptides to importins (also known as karyopherins) to form complexes that translocate through the nuclear pore. NLSs are known in the art.

[0044] Numerous NLS databases and tools for NLS prediction are publicly available, such as NLSdb (see Nair et al., Nucl Acids Res 31(1), 2003), cNLS Mapper (see www.nls-mapper.aib.keio.ac.jp; see Kosugi et al., Proc Natl Acad Sci USA. 106(25):10171-10176, 2009; see Kosugi et al., J Biol Chem 284(1):478-485, 2009), SeqNLS (see Lin et al., PLoS One 8(10):e76864, 2013), and NucPred (see www.sbc.su.se / ~maccallr / nucpred / ; see Branmeier et al., Bioinformatics 23(9):1159-60, 2007).

[0045] Classical NLSs can be monopartite or bipartite. Bipartite NLSs consist of two basic amino acid clusters connected by a spacer of approximately 10 amino acids. A typical core sequence contained in a monopartite NLS is KX. 1 X 2 X 3 (SEQ ID NO: 20). 1 and X 3 are independently selected from K and R; X 2 is any amino acid. Exemplary NLSs include those containing the amino acid sequence PKKKRKV (SEQ ID NO: 21).

[0046] Examples of specific pRS that can be used in the context of the present invention include, but are not limited to: - Methanococcus jannaschii tyrosyl-tRNA synthetase; - Escherichia coli tyrosyl-tRNA synthetase; - Escherichia coli leucyl-tRNA synthetase; - Methanosarcina mazei pyrrolysyl-tRNA synthetase; - Methanosarcina barkeri pyrrolysyl-tRNA synthetase; - Methanosarcina acetivorans pyrrolysyl-tRNA synthetase; - Methanosarcina thermophila pyrrolysyl-tRNA synthetase; - Methanococcoides burtonii pyrrolysyl-tRNA synthetase; - Desulfitobacterium hafniense pyrrolysyl-tRNA synthetase; - Methanomethylophilus alvus pyrrolysyl-tRNA synthetase; and functional (ie, enzymatically active) fragments and variants of these polypeptides.

[0047] The functional fragments and variants can comprise at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity to the aminoacyl-tRNA synthetase from which they are derived.

[0048] Specific examples of pRSs useful in the present invention that are M. mazei PylRS include, but are not limited to: - PylRS AF (Methanosarcina mazei pyrrolysyl-tRNA synthetase double mutant: Y306A, Y384F; Uniprot: Q8PWY1; SEQ ID NO: 22); - PylRS AA(Methanosarcina mazei pyrrolysyl-tRNA synthetase double mutant: N346A, C348A; Uniprot: Q8PWY1; SEQ ID NO: 23); - PylRS AAAF (Methanosarcina mazei pyrrolysyl-tRNA synthetase quadruple mutant: Y306A, N346A, C348A, Y384F; Uniprot: Q8PWY1; SEQ ID NO: 24); and functional (ie, enzymatically active) fragments and variants of these polypeptide fragments.

[0049] The functional fragments and variants may comprise at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% amino acid sequence identity to the PylRS from which they are derived.

[0050] According to certain embodiments, the wild-type and mutant M. mazei PylRS described herein are used for aminoacylation of tRNA with ncAAs described in WO2012 / 104422 or WO2015 / 107064. Exemplary ncAAs for this purpose include, but are not limited to, 2-amino-6-(tert-butoxycarbonylamino)hexanoic acid (BOC); 2-amino-6-(cyclooct-2-yn-1-yloxycarbonylamino)hexanoic acid (SCO); 2-amino-6-(cyclooct-2-yn-1-yloxyethoxycarbonylamino)hexanoic acid; 2-amino-6[(4E-cyclooct-4-en-1-yl)oxycarbonylamino]hexanoic acid (TCO); 2-amino-6[(2E-cyclooct-2-en-1-yl)oxycarbonylamino]hexanoic acid (TCO). * );2-amino-6-(prop-2-ynoxycarbonylamino)hexanoic acid (PrK); 2-amino-6-(9-biocyclo[6.1.0]non-4-ynylmethoxycarbonylamino)hexanoic acids (BCN); and, in particular, the 2S-(L-) enantiomers of these amino acids.

[0051] The functional fragments and variants of pRS described herein are functional in that they possess the acylation enzymatic activity of the parent pRS, and the degree of said enzymatic activity of the fragment or variant may be greater than, less than, or approximately the same as that of the parent pRS. Such fragments and variants may be characterized by a minimum degree of sequence identity, as described herein.

[0052] As used herein, amino acid or nucleotide sequence identity refers to identity over the entire length of the amino acid or nucleotide sequence so characterized, respectively. Percentage identity values ​​can be determined based on BLAST alignments, the blastp algorithm (protein-protein BLAST), or using the Clustal method, as known in the art (Higgins et al., Comput Appl. Biosci. 1989, 5(2):151-1).

[0053] Specific pRS functional fragments and variants useful in the present invention can be obtained, for example, by conservative amino acid substitutions, i.e., replacing an amino acid residue with a different amino acid residue having similar biochemical properties (e.g., charge, hydrophobicity, and size) known in the art. Typical examples include substitution of Leu with Ile or vice versa, Asp with Glu or vice versa, Asn with Gln or vice versa, etc.

[0054] ptRNAs that can be used in the context of the present invention include, but are not limited to, pyrrolidinyl tRNAs of M. mazei and functional variants thereof. Preferably, the anticodon of the ptRNA is an anticodon for a selector codon, such as, for example, a CUA anticodon for the amber stop codon TAG, a UCA anticodon for the opal stop codon TGA, or a UUA anticodon for the ochre stop codon TAA. Examples of such pyrrolidinyl tRNAs include, but are not limited to, those represented by SEQ ID NO: 25 (tRNA Pyl,CUA ), SEQ ID NO: 26 (tRNAPyl,UCA ) or SEQ ID NO: 27 (tRNA Pyl,UUA ) is encoded by the nucleotide sequence

[0055] As used in the context of the present invention, ptRNAs can act as suppressor tRNAs that alter the reading of messenger RNA (mRNA) in a given translation system (e.g., a eukaryotic cell of the present invention). The suppressor tRNA can, for example, read through a stop codon, a four-base codon, or a rare codon.

[0056] The O-RS / O-tRNA (pRS / ptRNA) pair used in the present invention preferably has the following property: the O-tRNA is preferentially acylated (with an ncAA) by the O-RS. Furthermore, the orthogonal pair functions in a translation system of interest (e.g., a eukaryotic cell of the present invention) such that the (ncAA-acylated) O-tRNA is used to incorporate said amino acid or ncAA residue into a growing polypeptide chain of the POI. Incorporation is site-specific. Specifically, the O-tRNA recognizes (specifically binds via its anticodon) a selector codon (e.g., an Amber, Ochre, or Opal stop codon) in the mRNA encoding the POI.

[0057] The term "preferentially acylates" refers to the efficiency with which the O-RS acylates the O-tRNA with an ncAA, e.g., about 50% efficiency, about 70% efficiency, about 75% efficiency, about 85% efficiency, about 90% efficiency, about 95% efficiency, or about 99% or greater, relative to the endogenous tRNA or amino acid of the translation system of interest. The ncAA residue is then incorporated into the growing polypeptide chain with high fidelity, e.g., greater than about 75% efficiency for a given selector codon, greater than about 80% efficiency for a given selector codon, greater than about 90% efficiency for a given selector codon, greater than about 95% efficiency for a given selector codon, or greater than about 99% efficiency for a given selector codon.

[0058] 2. Ribozymes and ptRNA-ribozymes In one embodiment of the present invention, ptRNA is expressed in the form of an RNA molecule comprising the ptRNA sequence and one or more ribozymes (ptRNA-ribozymes).

[0059] As used herein, the term "ribozyme" refers to an RNA molecule, or a portion thereof, capable of site-specific self-cleavage. Specifically, a ribozyme can catalyze the site-specific cleavage of a phosphodiester bond between two ribonucleotides within the ribonucleotide sequence of the (same) ribozyme.

[0060] Ribozymes are well known in the art. Examples of ribozymes that can be used in the ptRNA-ribozyme of the present invention include, but are not limited to, hammerhead ribozymes (e.g., hammerhead ribozyme of SEQ ID NO: 4), hairpin ribozymes (e.g., hairpin ribozyme of SEQ ID NO: 5), Varkud satellite (VS) ribozyme (e.g., VS ribozyme of SEQ ID NO: 6), glucosamine-6-phosphate synthase (glmS) riboswitch (e.g., glmS riboswitch of SEQ ID NO: 7), and hepatitis delta virus (HDV) ribozyme (e.g., HDV ribozyme of SEQ ID NO: 1, 2, or 3).

[0061] Information about these ribozymes can be found, for example, in Ferre-D'Amare et al. (Cold Spring Harb Perspect Biol 2010, 2:a003574), Cochrane et al. (Chem Biol 2007, 14(1):97-105) and Schuerer et al. (Nucl Acids Res 2002, 30(12):e56). In a preferred embodiment of the invention, the ribozyme is the HDV ribozyme of SEQ ID NO: 1.

[0062] The RNA containing ptRNA and a ribozyme used in the present invention contains one or more ribozymes positioned relative to the ptRNA so that the 5'-end and / or 3'-end of the ptRNA are released by site-specific (self-)cleavage of the RNA by the ribozyme catalyst. Thus, an RNA molecule containing the ptRNA sequence is obtained by the ribozyme-catalyzed (self-)cleavage. The 5'-end and / or 3'-end of the ptRNA sequence correspond to the 5'-end and / or 3'-end of the RNA molecule, respectively.

[0063] In certain embodiments, ribozyme-catalyzed (self-)cleavage of ptRNA and a ribozyme-containing RNA results in an RNA molecule consisting of ptRNA. In a preferred embodiment, the ribozyme is an HDV ribozyme, particularly the HDV ribozyme of SEQ ID NO: 1, which is covalently linked (fused) directly (i.e., with no intervening ribonucleotides) to the 3' end of ptRNA to form a contiguous ptRNA-ribozyme fusion.

[0064] 3. Inducible and Constitutive Expression of ptRNA and / or pRS In a further aspect, the present invention provides eukaryotic cells, methods of preparing POIs, and related subject matter described herein, in which expression of ptRNA (or ptRNA-ribozyme) or pRS, or both, is inducible (as opposed to constitutive). Specifically, said inducibility is achieved in that transcription of the nucleotide sequence encoding pRS or ptRNA / ptRNA-ribozyme, or both, is controlled (directly) by a tetracycline-responsive promoter element, or its transcription is catalyzed by an RNA polymerase, the expression of which is controlled by a tetracycline-responsive promoter element.

[0065] Systems suitable for TRE-controlled transcription are well known in the art and have become standard tools for inducible gene expression. See, e.g., Gossen and Bujard, Proc Natl Acad Sci USA. 1992, 89(12):5547-5551; Yao et al., Hum Gene Ther. 1998, 9(13):1939-1950; Das et al., Curr Gene Ther, 2016, 16(3):156-167.

[0066] The term "tetracycline responsive promoter element" (abbreviated "tetracycline responsive element" or "TRE") refers to a promoter sequence that includes one or more (e.g., 2, 3, 4, 5, 6, 7 or more, e.g., 2 or 7) tetracycline operator (tetO) sequences. A tetO is a polynucleotide segment having the sequence of SEQ ID NO: 8 or a functional variant thereof that can bind to a tetO-binding protein, such as a tetracycline repressor (tetR), a tetracycline-controlled transcription activator (tTA), or a reverse tTA (rtTA) protein. A TRE can further include at least a portion of the minimal CMV promoter sequence set forth in SEQ ID NO: 9.

[0067] In the context of the present invention, transcription of the TRE regulatory sequence is in particular the transcriptional synthesis of an RNA molecule (ptRNA or ptRNA-ribozyme) described herein, the transcription of a pRS coding sequence, or the transcriptional synthesis of an RNA polymerase (e.g., T7RNA polymerase) that catalyzes the transcriptional synthesis of a ptRNA or ptRNA-ribozyme described herein.

[0068] The eukaryotic cells of the present invention, in which expression of one or more of pRS, ptRNA / ptRNA-ribozyme and T7RNAP is controlled by a TRE as described herein, preferably further comprise a polynucleotide encoding a tetO-binding protein (tetR, rtTA or tTA) as described herein, such that expression of the TRE-controlled coding sequence can be induced in the presence or absence of tetracycline, doxycycline or a functional analogue thereof, respectively, as described herein.

[0069] Specific examples of TREs that can be used in the context of the present invention include TREs that comprise (or have) the sequence of any one of SEQ ID NOs: 10-12. TREs that comprise (or have) the sequence of SEQ ID NO: 10 or SEQ ID NO: 11 are useful in combination with rtTA, as are tTA. TREs that comprise (or have) the sequence of SEQ ID NO: 12 are particularly useful in combination with tetR.

[0070] The tetO-binding protein and the TRE selected to control the transcriptional synthesis of the RNA molecules (ptRNA or ptRNA-ribozyme), pRS-mRNA, and / or RNA polymerase mRNA described herein are therefore preferably selected to match (bind to) each other so as to allow inducible transcriptional control.

[0071] rtTA and tTA are generally known in the art, for example, from Das et al. (Curr Gene Therapy 2016, 16:156-167) and references cited therein. Exemplary rtTA proteins can be selected from those described in Figure 2B of Das et al. (supra).

[0072] rtTA is a fusion protein comprising a first polypeptide that binds to a tetO sequence in the presence of tetracycline or a tetracycline analog, particularly doxycycline, operably linked to a second polypeptide that activates transcription in eukaryotic cells.

[0073] The first polypeptide is preferably a 207aa TetR variant, e.g., selected from the list of rtTAs shown in Figure 2 of Das et al. (supra). The second polypeptide is preferably the 127aa transcription activation domain of the herpes simplex virus VP16 protein. The first and second polypeptides are preferably covalently linked to form a fusion protein, such as a fusion protein comprising the sequence of SEQ ID NO: 14 and functional equivalents thereof.

[0074] rtTA binds to the TRE (tetO sequence) in the presence of doxycycline or a functional analogue thereof. Said binding of rtTA facilitates or enhances the binding of RNA polymerase, thereby promoting the transcription of the TRE regulatory sequence. In this so-called "Tet-On" system, transcription of the TRE regulatory sequence is thus induced in the presence of rtTA by adding doxycycline or a functional analogue thereof. Thus, the method of the present invention, in which the transcription (and therefore expression) of one or more of pRS, ptRNA / ptRNA-ribozyme and T7RNAP is controlled by this Tet-On system, preferably further comprises the following steps: - expressing rtTA in a eukaryotic cell; and - contacting said cells with doxycycline or a functional analogue thereof (thereby inducing transcription of the TRE regulatory sequence). The rtTA is expressed in the cell at least simultaneously with the expression of the TRE regulatory sequence (ie, before and / or simultaneously with the expression of the TRE regulatory sequence).

[0075] tTA is a fusion protein comprising a first polypeptide that binds to a tetO sequence in the absence of tetracycline, doxycycline, or functional analogs thereof. The first polypeptide is (operably) linked to a second polypeptide that activates transcription in eukaryotic cells. The first polypeptide is preferably the 207aa TetR or a functional derivative thereof. The second polypeptide is preferably the 127aa transcription activation domain of the herpes simplex virus VP16 protein. The first and second polypeptides are preferably covalently linked to form a fusion protein.

[0076] tTA binds to the TRE (tetO sequence) in the absence (or at low concentrations) of tetracycline, doxycycline, or functional analogs thereof. The binding of tTA promotes or enhances the binding of RNA polymerase, thereby promoting transcription of the TRE regulatory sequence. In this so-called "Tet-Off" system, transcription of the TRE regulatory sequence is thus induced in the presence of tTA by removing (or reducing the concentration of) previously present tetracycline, doxycycline, or functional analogs thereof. Therefore, the method of the present invention, in which the transcription (and therefore expression) of one or more of pRS, ptRNA / ptRNA-ribozyme, and T7RNAP is controlled by this Tet-Off system, preferably further comprises the following steps:

[0077] - expressing tTA in a eukaryotic cell; and - maintaining contact of the cells prior to expression of the TRE regulatory sequence with tetracycline, doxycycline, or a functional analogue thereof (thereby inhibiting binding of tTA to the TRE and thus inhibiting (trans)activation of transcription synthesis of the TRE regulatory sequence), and then reducing or preferably removing the concentration of the tetracycline, doxycycline, or analogue thereof so as to induce transcription of the TRE regulatory sequence.

[0078] The tTA is expressed in the cell at least simultaneously with the expression of the TRE regulatory sequence (ie, before and / or simultaneously with the expression of the TRE regulatory sequence).

[0079] Tetracycline repressor (tetR) proteins are generally known in the art. See, e.g., Hillen and Berens, Annu Rev Microbiol 1994, 48:345-369. Exemplary tetR proteins that may be suitably used in the context of the present invention include polypeptides that comprise (or have) the amino acid sequence set forth in SEQ ID NO: 13 and functional equivalents thereof.

[0080] TetR binds to the TRE (tetO sequence) in the absence (or at low concentrations) of doxycycline or a functional analog thereof. This binding of tetR inhibits or blocks the binding of RNA polymerase, thereby inhibiting transcription of the TRE-controlled sequence.

[0081] In this so-called "T-REx" system, transcription of the TRE regulatory sequence is thus induced in the presence of tetR by adding tetracycline, doxycycline, or a functional analogue thereof. Thus, the method of the present invention, in which the transcription (and thus expression) of one or more of pRS, ptRNA / ptRNA-ribozyme and T7RNAP is controlled by this T-REx system, preferably further comprises the following steps:

[0082] - expressing tetR in a eukaryotic cell; and - contacting said cells with tetracycline, doxycycline or a functional analogue thereof (thereby inducing transcription of the TRE regulatory sequence). The tetR is expressed in the cell at least prior to (ie, before, or both before and simultaneously with) expression of the TRE regulatory sequence.

[0083] Transcription of the RNA molecules (ptRNA or ptRNA-ribozyme) described herein and / or transcription of the pRS coding sequence can be controlled by a constitutive promoter. Constitutive promoters and RNA polymerases that bind to them are well known in the art and include, for example, eukaryotic promoters such as the CMV promoter (derived from human cytomegalovirus), the SV40 promoter (derived from simian vacuolating virus 40), the U6 promoter (derived from the human U6 micronuclear promoter), and the H1 promoter (derived from the human polymerase III RNA promoter), as well as prokaryotic promoters such as the T7 promoter (derived from T7 bacteriophage) and the Sp6 promoter (derived from Sp6 bacteriophage).

[0084] Transcription of the RNA molecules (ptRNA or ptRNA-ribozyme) described herein and / or transcription of the pRS coding sequence controlled by a constitutive promoter can be constitutive or inducible. Constitutive transcription can be achieved, in particular, when the RNA polymerase catalyzing transcription via the promoter is constitutively expressed in the eukaryotic cell.

[0085] Alternatively, transcription can be inducible if the RNA polymerase catalyzing transcription via said promoter is inducibly expressed in eukaryotic cells, for example under (direct) control of a TRE. In certain embodiments, when expression of an RNA molecule (ptRNA or ptRNA-ribozyme) described herein and / or transcription of a pRS coding sequence is controlled by a constitutive promoter and is inducible by inducible expression of an RNA polymerase catalyzing transcription via said promoter, the constitutive promoter is a prokaryotic promoter, in particular a promoter that requires an RNA polymerase that is not naturally present in eukaryotic cells. In particular, the Sp6 promoter and preferably the T7 promoter are mentioned.

[0086] The term "T7 promoter" refers to a region of DNA that initiates transcription of a specific gene by T7 RNA polymerase (T7RNAP). According to certain embodiments, a T7 promoter used in the context of the present invention comprises (or consists of) a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the sequence set forth in any one of SEQ ID NOs: 15-17. In a preferred embodiment of the present invention, the T7 promoter comprises the amino acid sequence of SEQ ID NO: 15 or 16.

[0087] In a preferred embodiment of the present invention, when transcription (and thereby expression) of one or both of pRS and ptRNA, or ptRNA-ribozyme, respectively, is controlled by a constitutive promoter, the constitutive promoter is a T7 promoter, preferably comprising (or consisting of) the nucleotide sequence of any one of SEQ ID NOs: 15 to 17. In an embodiment in which a T7 promoter is used, the eukaryotic cell preferably further expresses T7RNAP. The T7RNAP may be expressed constitutively or inducibly, for example, under the (direct) control of a TRE.

[0088] "T7 RNA polymerase" (T7RNAP) is a protein that binds to a T7 promoter and catalyzes the transcription of sequences downstream of the T7 promoter. The amino acid sequence of naturally occurring T7RNAP is known in the art. See, for example, UniProtKB / Swiss-Prot Accession No. P00573.2. According to certain embodiments, a T7RNAP used in the context of the present invention comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the sequence set forth in SEQ ID NO: 18 or the sequence set forth in SEQ ID NO: 19 (including the NES covering amino acid positions 2-17).

[0089] To direct its localization within a eukaryotic cell, T7RNAP (or another RNA polymerase recombinantly expressed in a eukaryotic cell) can have a signal peptide inserted, particularly at its N-terminus, for example, between amino acid positions 1 and 2 of the RNA polymerase. In one embodiment, T7RNAP can have a nuclear localization signal (NLS) or a nuclear export signal (NES), respectively, as defined herein above (see section 1). The amino acid sequence of this NES-T7RNAP is set forth in SEQ ID NO: 19. In another embodiment, T7RNAP may not have this nuclear localization or export tag / signal.

[0090] 4. dsRNA-binding polypeptides One aspect of the present invention provides eukaryotic cells and methods for preparing the POI described herein, wherein the eukaryotic cell comprises a polynucleotide encoding a ptRNA / pRS pair (wherein the ptRNA can be expressed as a ptRNA-ribozyme) and further comprises a polynucleotide encoding a dsRNA-binding polypeptide, and the method for preparing the POI comprises expressing the ptRNA / pRS pair in the eukaryotic cell and expressing the dsRNA-binding polypeptide.

[0091] The dsRNA-binding polypeptide used in the present invention is a polypeptide capable of binding to double-stranded RNA molecules (dsRNA) having 30 or more base pairs, preferably 80 or more base pairs, and its binding is independent of the specific nucleotide sequence of the dsRNA. The binding is mediated by the dsRNA-binding domain of protein kinase R (PKR), which contains two dsRNA-binding motifs (each containing an α-β-β-α fold) adjacent to the linker region. A preferred dsRNA-binding polypeptide used in the present invention is a polypeptide comprising the amino acid sequence of SEQ ID NO: 36.

[0092] Thus, the dsRNA-binding polypeptide used in the present invention comprises or consists of an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity to the sequence set forth in any one of SEQ ID NOs: 37, and 57-59. More preferably, the dsRNA-binding polypeptide used in the present invention comprises or consists of an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity to the sequence set forth in any one of SEQ ID NOs: 38, and 57-59.

[0093] Suitably, the dsRNA-binding polypeptide lacks a functional PKR kinase domain and is preferably unable to phosphorylate eukaryotic initiation factor 2α (eIF-2α).

[0094] In the methods of the invention for preparing a POI, the dsRNA-binding polypeptide is expressed simultaneously with (ie, simultaneously with, or both before and simultaneously with) expression of at least the ptRNA / pRS pair.

[0095] 5. Polynucleotides The present invention also relates to a polynucleotide, or a combination of two or more polynucleotides, comprising: - a nucleotide sequence encoding an RNA molecule as described herein, said RNA comprising a ptRNA and a ribozyme (ptRNA-ribozyme); and, optionally, (i) a nucleotide sequence encoding a tetO-binding protein described herein, or (ii) a nucleotide sequence encoding a pRS as described herein, or (iii) both (i) and (ii); and / or (a) a nucleotide sequence complementary to the encoding nucleotide sequence.

[0096] The present invention further relates to a polynucleotide, or a combination of two or more polynucleotides, comprising: - a nucleotide sequence encoding a dsRNA-binding polypeptide described herein; and (i) a nucleotide sequence encoding a ptRNA or ptRNA-ribozyme described herein, or (ii) a nucleotide sequence encoding a pRS as described herein, or (iii) both (i) and (ii); and, optionally, - a nucleotide sequence encoding a tetO-binding protein described herein; and / or (a) a nucleotide sequence complementary to the encoding nucleotide sequence.

[0097] Unless otherwise indicated or required by context, the terms "polynucleotide," "polynucleotide molecule," or "nucleic acid molecule," as used herein, refer to polymers of nucleotides and ribonucleotides, i.e., both nucleic acids and ribonucleic acids, such as single- or double-stranded DNA molecules and RNA molecules, including cDNA and mRNA.

[0098] Unless otherwise specified or required by context, the expression "nucleotide sequence encoding [expression product]" is intended to refer to the sequence directly encoding said expression product and / or the nucleotide sequence complementary thereto.

[0099] The coding nucleotide sequences defined to be comprised in a polynucleotide or combination of two or more polynucleotides of the present invention can be located on the same polypeptide or distributed on two or more different polynucleotides, thus resulting in a combination of said different polypeptides (e.g., each coding nucleotide sequence can be located on a different combination of polypeptides).

[0100] The present invention further relates to, inter alia, recombinant, expression constructs or expression cassettes comprising the (particularly encoding) nucleotide sequence of a polynucleotide of the invention, or combination of polynucleotides, described herein, under the genetic control of regulatory nucleotide sequences.

[0101] In one embodiment of the present invention, the expression cassette of the present invention comprises a nucleotide sequence encoding a ptRNA-ribozyme as described herein. In this embodiment of the present invention, the expression cassette may optionally further comprise, or optionally combine, one or more additional expression cassettes comprising: (i) a nucleotide sequence encoding a tetO-binding protein described herein, or (ii) a nucleotide sequence encoding a pRS described herein, or (iii) Both (i) and (ii).

[0102] In a further embodiment of the present invention, the expression cassette of the present invention may comprise a nucleotide sequence encoding a dsRNA-binding polypeptide as described herein. In said embodiment of the present invention, said expression cassette may further comprise, or in any combination of, one or more additional expression cassettes comprising: (i) a nucleotide sequence encoding a ptRNA or ptRNA-ribozyme described herein, or (ii) a nucleotide sequence encoding a pRS as described herein, or (iii) Both (i) and (ii).

[0103] The present invention also relates to vectors (expression vectors), in particular recombinant vectors, which contain one or more of these expression cassettes or a combination of expression cassettes.

[0104] An expression cassette comprises a nucleotide sequence encoding an expression product operably linked to a promoter sequence located 5' (upstream) of the nucleotide sequence, a terminator sequence (e.g., a T7 terminator sequence) typically located 3' (downstream) of the coding sequence, and optionally additional regulatory elements, including, but not limited to, targeting sequences, enhancers, polyadenylation signals, selectable markers, amplification signals, and origins of replication.

[0105] Suitable regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).

[0106] "Operable" linkage of elements of a polynucleotide (e.g., an expression cassette), such as a promoter, coding sequence, terminator, regulator, etc., means that these elements are positioned so that the coding sequence is transcribed and any regulatory elements are capable of effecting their regulation of said transcription. This can be achieved by direct linkage of the elements on one and the same nucleic acid molecule; however, such direct linkage is not required.

[0107] Gene control sequences, such as enhancer sequences, can exert their function on a target sequence from more distant locations or even from separate DNA molecules. A preferred arrangement is one in which the nucleic acid sequence to be transcribed is located downstream (i.e., at the 3' end) of the promoter sequence, with the two sequences covalently linked. The distance between the promoter sequence and the nucleic acid sequence to be expressed can be less than 200 base pairs, less than 100 base pairs, or less than 50 base pairs.

[0108] For expression in cells, the expression cassette is advantageously inserted into an expression vector. The expression vector is selected depending on the cell to be used for expression, allowing optimal expression of the coding nucleotide sequence in the cell. Vectors are well known to those skilled in the art and are described, for example, in "Cloning vectors" (Pouwels PH et al., Ed., Elsevier, Amsterdam-New York-Oxford, 1985).

[0109] Examples of expression vectors include, but are not limited to, plasmids, viral vectors (phages), such as SV40, CMV, baculovirus and adenovirus, transposons, IS elements, phasmids, cosmids, and linear or circular DNA. See, for example, the book "Cloning Vectors" (Eds. Pouwels PH et al. Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018). These vectors can replicate autonomously within (host) cells or can replicate chromosomally. Expression vectors comprising one or more expression cassettes of the invention represent a further aspect of the invention.

[0110] For expression of a POI in a eukaryotic cell according to the present invention, for example, a polynucleotide (e.g., an expression vector) encoding the POI can be introduced into the cell. Alternatively, an existing gene of the cell can be modified to include a selector codon at those amino acid positions where the POI is intended to have an ncAA residue. Methods for introducing nucleic acid molecules encoding (recombinant) polypeptides into cells or modifying existing genes of cells are known in the art.

[0111] The term "expression" in the context of the present invention describes the production of a polypeptide encoded by the corresponding nucleotide sequence in a eukaryotic cell. The term "expression" is also used for the production of an RNA molecule (ptRNA or ptRNA-ribozyme as described herein) encoded by a nucleotide sequence in a eukaryotic cell.

[0112] The polynucleotides of the present invention, including the expression cassettes and expression vectors of the present invention, can be prepared using standard cloning techniques known in the art. Standard recombinant and cloning techniques are used, for example, as described in the following references: T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989); T. J. Silhavy, M. L. Berman and L. W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984); and Ausubel, F. M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).

[0113] Polynucleotides of the invention, including expression cassettes and expression vectors of the invention, or combinations of polynucleotides, can be isolated, for example, by methods known in the art.

[0114] An "isolated" polynucleotide or "isolated" combination of polynucleotides is separated from other polynucleotides present in the natural source of the polynucleotide (e.g., a cell), and further, if produced by recombinant techniques, can be essentially free of other cellular material or culture medium, and if chemically synthesized, can be free of chemical precursors or other chemicals.

[0115] Polynucleotides according to the invention can be isolated using standard techniques of molecular biology and the sequence information provided according to the invention. For example, cDNA can be isolated from an appropriate cDNA bank using the specifically disclosed complete sequence or one of its segments as a hybridization probe and standard hybridization techniques (e.g., as described in Sambrook, J., Fritsch, EF and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).

[0116] Furthermore, polynucleotides comprising one of the disclosed sequences or a segment thereof can be isolated by polymerase chain reaction using oligonucleotide primers constructed based on this sequence. The polynucleotides thus amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.

[0117] 6. POIs with one or more ncAA residues The present invention provides a method for preparing a POI having one or more ncAA residues, wherein the ncAA residues of the POI are encoded by a selector codon.

[0118] As used herein, the term "selector codon" refers to a codon that is recognized (i.e., bound) to a ptRNA during the translation process, but is not recognized by endogenous tRNAs of a eukaryotic cell.

[0119] The term is also used to refer to the corresponding codon in a polypeptide-encoding sequence of a polynucleotide that is not messenger RNA (mRNA), such as a DNA plasmid. Preferably, the selector codon is a naturally occurring, eukaryotic, minority codon. Suitably, the anticodon of the ptRNA used in the present invention specifically binds (hybridizes) to the selector codon in the mRNA, thereby site-specifically incorporating an ncAA residue into the growing chain of the polypeptide encoded by the mRNA. The 64 known genetic codons (triplets) encode 20 standard amino acid residues and three stop codons.

[0120] Because only one stop codon is required for translation termination, the other two can, in principle, be used to encode nonproteinogenic amino acids. For example, the amber codon, UAG, has been successfully used as a selector codon in in vitro and in vivo translation systems to direct the incorporation of ncAAs. The selector codons utilized in the methods of the present invention expand the genetic codon framework of the protein biosynthetic machinery of the translation system used.

[0121] Specifically, selector codons include, but are not limited to, nonsense codons such as stop codons (e.g., amber (UAG), ochre (UAA), and opal (UGA) codons); codons consisting of more than three bases (e.g., four-base codons); and codons derived from natural or unnatural base pairs. For a given system, the selector codon can also comprise one of the natural three-base codons (i.e., natural triplets), where the endogenous translation system (e.g., a system lacking a tRNA that recognizes the natural triplet or a system in which the natural triplet is a rare codon) does not use (or rarely uses) the natural triplet.

[0122] In a given translation system, a recombinant tRNA that alters the reading of mRNA so that it reads through a stop codon, a four-base codon, or a rare codon (such as ptRNA in the eukaryotic cells of the present invention) is called a suppressor tRNA. The efficiency of suppression of a stop codon (e.g., an amber codon) functioning as a selector codon depends on competition between the (aminoacylated) recombinant tRNA (ptRNA) functioning as the suppressor tRNA and a release factor (e.g., RF1) that binds to the stop codon and initiates release of the growing polypeptide chain from the ribosome. Therefore, the efficiency of such suppression of a stop codon can be increased by using a release factor- (e.g., RF1-) deficient strain.

[0123] A nucleotide sequence encoding a target polypeptide (also referred to herein as a polypeptide of interest or POI) can include one or more codons (e.g., selector codons), e.g., two or more, three or more, etc., that are the reverse complement of the anticodon contained in the ptRNA. To generate a nucleotide sequence encoding a POI, the selector codon can be introduced into the nucleotide sequence at a desired site using conventional site-directed mutagenesis techniques.

[0124] The abbreviation "ncAA" generally refers to a non-standard or unnatural amino acid (or amino acid residue) that is not one of the 20 naturally occurring "standard" proteinogenic amino acids (R, H, K, D, E, S, T, N, Q, C, G, P, A, V, I, L, M, F, Y, W) and is not selenocysteine ​​or pyrrolysine. Many ncAAs are known in the art. ncAAs useful in the methods and kits of the present invention have been described in the prior art (see, e.g., Liu et al., Annu Rev Biochem 83:379-408, 2010; Lemke, ChemBioChem 15:1691-1694, 2014).

[0125] As used herein, the term "ncAA" also refers to amino acid analogs, e.g., compounds that, unlike amino acids, have their α-amino group replaced with a hydroxyl group (α-hydroxyl acid) and / or a carboxylic acid functional group to form an ester. When translationally incorporated into a polypeptide, an α-hydroxyl acid (residue) is linked via its α-hydroxyl group to the carboxylic acid functional group of an adjacent amino acid (analog) residue in an ester bond.

[0126] When an amino acid analog ncAA (in which the carboxylic acid functional group forms an ester of the formula -C(O)-OR) is used to prepare a polypeptide in a translation system (e.g., a eukaryotic cell), R is likely to be removed in situ, e.g., enzymatically, in the translation system before incorporation into the POI. Therefore, R is appropriately selected to match the ability of the translation system to convert the ncAA or its salt into a form that can be recognized and processed by the PylRS of the present invention.

[0127] In the context of the present invention, particularly preferred ncAAs can be further modified after translation.For example, the ncAA can have a group (herein referred to as a "labeling group") that facilitates reaction with an appropriate group (herein referred to as a "docking group") of another molecule (herein referred to as a "binding partner molecule"), thereby covalently binding the binding partner molecule to the ncAA.When a UAA with a labeling group is translationally incorporated into a POI, the labeling group becomes part of the POI.

[0128] Thus, a POI prepared according to the methods of the present invention can be reacted with one or more binding partner molecules, whereby the binding partner molecules are covalently attached to (labeling groups of) non-canonical amino acid (ncAA) residues of the POI. This conjugation reaction can be used for in situ coupling of the POI within cells or tissues expressing the POI, or for site-specific conjugation of isolated or partially isolated POI.

[0129] Particularly useful options for combinations of labeling groups and docking groups (of binding partners) are those that can react via metal-free click reactions, such as strain-promoted inverse electron demand Diels-Alder cycloaddition (SPIEDAC; see, e.g., Devaraj et al., Angew Chem Int Ed Engl 2009, 48:7013) and cycloaddition reactions of strained cycloalkynyl groups or strained cycloalkynyl analogs having one or more triple-bond-free ring atoms substituted with amino groups with azides, nitrile oxides, nitrones, and diazocarbonyl reagents (see, e.g., Sanders et al., J Am Chem Soc 2010, 133:949; Agard et al., J Am Chem Soc 2004, 126:15046), such as strain-promoted alkyne-azide cycloaddition (SPAAC). Such click reactions allow for ultrafast, bi-orthogonal, covalent, site-specific coupling of the ncAA labeling group of the POI with the appropriate group on the coupling partner molecule.

[0130] Pairs of docking groups and labeling groups that can react via the above-mentioned click reaction are known in the art. Examples of suitable ncAAs containing docking groups include, but are not limited to, those described in WO2012 / 104422 and WO2015 / 107064.

[0131] Examples of specific suitable pairs of docking groups (contained in the binding partner molecule) and labeling groups (contained in the ncAA residue of the POI) include, but are not limited to, the following: (a) a docking group comprising (or consisting essentially of) a group selected from an azide group, a nitrile oxide functional group (i.e., a group represented by the formula: , a nitrone functional group, or a diazocarbonyl group) in combination with a labeling group comprising (or consisting essentially of) an optionally substituted strained alkynyl group, which groups can react covalently in a copper-free strain-promoted alkyne-azide cycloaddition reaction (SPAAC); (b) a combination of a docking group comprising (or consisting essentially of) an optionally substituted strained alkynyl group and a labeling group comprising (or consisting essentially of) a group selected from an azide group, a nitrile oxide functional group (these groups can react covalently in a copper-free strain-promoted alkyne-azide cycloaddition reaction (SPAAC)); (c) a combination of a docking group comprising (or consisting essentially of) a group selected from an optionally substituted strained alkynyl group, an optionally substituted strained alkenyl group, and a norbornenyl group, and a labeling group comprising (or consisting essentially of) an optionally substituted tetraalkynyl group, which groups can react covalently in a copper-free strain-promoted inverse electron demand Diels-Alder cycloaddition reaction (SPIEDAC); (d) A combination of a docking group comprising (or consisting essentially of) an optionally substituted tetrazinyl group and a labeling group comprising (or consisting essentially of) a group selected from an optionally substituted strained alkynyl group, an optionally substituted strained alkenyl group, and a norbornenyl group, which groups can react covalently in a copper-free strain-promoted inverse electron demand Diels-Alder cycloaddition reaction (SPIEDAC).

[0132] Optionally substituted strained alkynyl groups include, but are not limited to, optionally substituted trans-cyclooctenyl groups (e.g., those described in WO2012 / 104422 and WO2015 / 107064). Optionally substituted strained alkenyl groups include, but are not limited to, optionally substituted cyclooctynyl groups (e.g., those described in WO2012 / 104422 and WO2015 / 107064). Optionally substituted tetrazinyl groups include, but are not limited to, those described in WO2012 / 104422 and WO2015 / 107064.

[0133] An azido group is a group of formula -N3. The nitrone functional group has the formula -C(R x )=N + (Ry )-O - where R x and R y are independently selected from organic residues, such as C1-C6-alkyl as described herein.

[0134] A diazocarbonyl group is a group of formula -C(O)-CH=N2. The nitrile oxide functional group has the formula -C≡N + -O - or preferably of the formula -C=N + (R x )-O - where R x is an organic residue, for example a residue selected from C1-C6-alkyl as described herein.

[0135] "Cyclooctynyl" is an unsaturated alicyclic group having 8 carbon atoms and one triple bond in the ring structure. "Trans-cyclooctenyl" is an unsaturated alicyclic group having 8 carbon atoms in the ring structure and one double bond in the trans configuration. "Tetradinyl" is a six-membered monocyclic aromatic group having four nitrogen ring atoms and two carbon ring atoms.

[0136] Unless otherwise indicated, the term "substituted" means that the group is substituted with 1, 2 or 3, in particular 1 or 2, substituents. In certain embodiments, these substituents are hydrogen, halogen, C1-C4-alkyl, (R a O)2P(O)O-C1-C4-alkyl,(R b O)2P(O)—C1-C4-alkyl, CF3, CN, hydroxyl, C1-C4-alkoxy, —O—CF3, C2-C5-alkenoxy, C2-C5-alkanoyloxy, C1-C4-alkylaminocarbonyloxy or C1-C4-alkylthio, C1-C4-alkylamino, di-(C1-C4-alkyl)amino, C2-C5-alkenylamino, N—C2-C5-alkenyl-N—C1-C4-alkyl-amino and di-(C2-C5-alkenyl)amino, where R a and Rb are independently hydrogen or C2-C5-alkanoyloxymethyl).

[0137] The term halogen in each case denotes a fluorine, bromine, chlorine or iodine radical, in particular a fluorine radical. C1-C4-Alkyl is a straight-chain or branched alkyl radical having 1 to 4, in particular 1 to 3, carbon atoms. Examples include C2-C4-alkyl, such as methyl and ethyl, n-propyl, isopropyl, n-butyl, 2-butyl, isobutyl and tert-butyl.

[0138] C2-C5-Alkenyl is a monounsaturated hydrocarbon group having 2, 3, 4 or 5 carbon atoms. Examples include vinyl, allyl (2-propen-1-yl), 1-propen-1-yl, 2-propen-2-yl, methallyl (2-methylprop-2-en-1-yl), 1-methylprop-2-en-1-yl, 2-buten-1-yl, 3-buten-1-yl, 2-penten-1-yl, 3-penten-1-yl, 4-penten-1-yl, 1-methylbut-2-en-1-yl and 2-ethylprop-2-en-1-yl. C1-C4-alkoxy is a group of the formula RO-, wherein R is a C1-C4-alkyl group as defined herein. C2-C5-alkenoxy is a radical of the formula RO-, wherein R is C2-C5-alkenyl as defined herein.

[0139] C2-C5-Alkanoyloxy is a radical of the formula RC(O)-O-, wherein R is C1-C4-alkyl as defined herein. C1-C4-Alkylaminocarbonyloxy is a group of the formula R-NH-C(O)-O-, wherein R is C1-C4-alkyl as defined herein. C1-C4-Alkylthio is a group of the formula RS-, wherein R is C1-C4-alkyl as defined herein.

[0140] C1-C4-Alkylamino is a group of the formula R-NH-, wherein R is C1-C4-alkyl as defined herein. Di-(C1-C4-alkyl)amino is a compound of the formula R x -N(R y )- group, where R x and R y are independently C1-C4-alkyl as defined herein. C2-C5-Alkenylamino is a group of the formula R-NH-, wherein R is C2-C5-alkenyl as defined herein.

[0141] N-C2-C5-alkenyl-N-C1-C4-alkylamino is a compound of the formula R x -N(R y )- group, where R x is C-C-alkenyl as defined herein, and R y is C1-C4-alkyl. Di-(C2-C5-alkenyl)amino is a compound of the formula R x -N(R y )- group, where R x and R y are independently C2-C5-alkenyl as defined herein. C2-C5-alkanoyloxymethyl is a compound of the formula R x -C(O)-O-CH2- group. x is C1-C4-alkyl as defined herein.

[0142] The ncAAs used in the context of the present invention can be used in the form of their salts. The salts of ncAAs described herein refer to acid or base addition salts, particularly addition salts with physiologically acceptable acids or bases. Physiologically acceptable acid addition salts can be formed by treating the base form of ncAAs with an appropriate organic or inorganic acid. ncAAs containing acidic protons can be converted into their non-toxic metal or amine addition salt forms by treatment with appropriate organic and inorganic bases. The ncAAs and their salts described in the context of the present invention also include their hydrates and solvent addition forms, such as hydrates, alcoholates, etc.

[0143] A physiologically acceptable acid or base is one that is tolerated by the translation system used to prepare the POI having the ncAA residue, e.g., is substantially non-toxic to living eukaryotic cells.

[0144] The ncAAs and salts thereof useful in the context of the present invention are well known in the art and can be prepared, for example, similarly to the methods described in the various publications cited herein.

[0145] The nature of the coupling partner molecule depends on the intended use. For example, the POI may be conjugated to a molecule suitable for imaging methods or may be functionalized by conjugating to a biologically active molecule. For example, in addition to the docking group, the coupling partner molecule may have a group selected from, but not limited to: a dye (e.g., a fluorescent, luminescent, or phosphorescent dye, such as dansyl, coumarin, fluorescein, acridine, rhodamine, silicon rhodamine, BODIPY, or cyanine dye); a molecule that can fluoresce upon contact with a reagent; a chromophore (e.g., phytochrome, phycobilin, bilirubin, etc.); a radiolabel (e.g., a radioactive form of hydrogen, fluorine, carbon, phosphorus, sulfur, or iodine, e.g., tritium, 18 F, 11 C, 14 C, 32 P, 33 P, 33 S, 35 S, 11 In, 125 I, 123 I, 131 I, 212 B, 90 Y or 186Rh, etc.); MRI-sensitive spin labels; affinity tags (e.g., biotin, His tags, Flag tags, Strep tags, sugars, lipids, sterols, PEG linkers, benzylguanine, benzylcytosine, or cofactors); polyethylene glycol groups (e.g., branched PEG, linear PEG, PEG of various molecular weights, etc.); photocrosslinkers (e.g., p-azidoiodoacetanilide, etc.); NMR probes; X-ray probes; pH probes; IR probes; resins; solid supports, and biologically active compounds (e.g., synthetic drugs). Suitable biologically active compounds include, but are not limited to, cytotoxic compounds (e.g., cancer chemotherapy compounds), antiviral compounds, biological response modifiers (e.g., hormones, chemokines, cytokines, interleukins, etc.), microtubule-active agents, hormone-modulating agents, and steroid compounds. Examples of useful coupling partner molecules include, but are not limited to, members of receptor / ligand pairs, members of antibody / antigen pairs, members of lectin / carbohydrate pairs, members of enzyme / substrate pairs, biotin / avidin, biotin / streptavidin, and digoxin / antidigoxin.

[0146] In particular, the ability of specific ncAA residues (labeling groups) to be covalently attached in situ to binding partner molecules (docking groups) via the click reaction described herein can be used to detect POIs bearing those ncAA residues within eukaryotic cells or tissues expressing the POI and to study the distribution and fate of the POI. Thus, for example, the methods of the present invention for preparing POIs by expression in eukaryotic cells can be combined with super-resolution microscopy (SRM) to detect POIs within cells or tissues of those cells. Several SRM methods are known in the art and can be adapted to utilize click chemistry to detect POIs expressed by eukaryotic cells of the present invention. Specific examples of SRM methods include DNA-PAINT (DNA point accumulation for imaging in nanoscale topography; e.g., Jungmann et al., Nat Methods 11:313-318, 2014), dSTORM (direct stochastic optical reconstruction microscopy), and STED (stimulated emission depletion) microscopy.

[0147] 7. Eukaryotic cells of the present invention The eukaryotic cells of the present invention can be produced by introducing a polynucleotide described herein, particularly a polynucleotide encoding a pRS described herein and comprising a nucleotide sequence encoding a ptRNA or a ptRNA-ribozyme, and in one embodiment, the polynucleotide introduced into the eukaryotic cell further comprises a nucleotide sequence encoding a dsRNA-binding polypeptide.

[0148] Optionally, the introduced polynucleotide further comprises a nucleotide sequence encoding a tetO-binding protein and / or a constitutive RNA polymerase (e.g., T7RNAP) as described herein, which nucleotide sequences can be located on the same polynucleotide or distributed on two or more different polynucleotides.

[0149] The eukaryotic cells of the present invention may be selected from, but are not limited to, mammalian cells (e.g., human, mouse, rat, or cynomolgus monkey cells), avian cells (e.g., chicken cells), insect cells, yeast cells, and plant cells. The eukaryotic cells of the present invention may exist as individual cells or may be part of a tissue (e.g., cells within a (cultured) tissue, organ, or whole organism).

[0150] A POI containing one or more non-canonical amino acid (ncAA) residues in its amino acid sequence can be prepared according to the present invention using a eukaryotic cell, particularly the eukaryotic cell of the present invention. The eukaryotic cell expresses a pair of pRS and ptRNA, in which pRS can acylate ptRNA. In certain embodiments, the ptRNA is expressed in the form of a ptRNA-ribozyme as described herein.

[0151] The eukaryotic cell further expresses the POI in the presence of one or more ncAAs or salts thereof corresponding to one or more ncAA residues of the POI. To this end, the eukaryotic cell includes a polynucleotide encoding the pRS, ptRNA, and POI to be expressed, and further includes (e.g., by supplying) the ncAA or salt thereof. When expression of one of the pRS, ptRNA, and / or POI is under the control of a TRE, the eukaryotic cell preferably further expresses a tetO-binding protein selected to match the respective TRE used as described herein. The eukaryotic cell is then contacted with (e.g., by culturing in a medium containing) tetracycline, doxycycline, or a functional analog thereof as described herein.

[0152] Recombinant expression in eukaryotic cells, including induction of TRE-controlled expression, is a standard procedure in the art. Therefore, those skilled in the art are fully capable of selecting conditions for culturing eukaryotic cells that allow (recombinant) expression of the desired expression product (here, at least ptRNA, pRS, and POI). Depending on the cell type, the cells can be cultured in liquid media. Culture can be performed in batch, semi-batch, or continuous mode. Nutrients can be supplied at the beginning of the culture or later in a semi-continuous or continuous manner.

[0153] To produce a POI (target polypeptide) according to the methods of the present invention, eukaryotic cells are cultured under suitable conditions, preferably in the presence of (e.g., in a medium containing) an ncAA or a salt thereof, for a period of time suitable to allow translation in the ribosomes of the cells.

[0154] Depending on the polynucleotide encoding the POI (and optionally other elements, such as pRS, ptRNA, etc.), it may be necessary to induce expression by adding a compound that induces transcription, such as arabinose, isopropyl β-D-thiogalactoside (IPTG), or in the case of TRE-regulated expression, tetracycline, doxycycline, or a functional analog thereof. The mRNA encoding the POI (and which contains one or more codons that are the reverse complement of the anticodons contained in the ptRNA) binds to ribosomes.

[0155] Next, the POI is formed by the stepwise binding of amino acids and ncAAs to the positions encoded by the codons recognized by each aminoacyl-tRNA. As a result, the ncAA is incorporated into the POI at the position encoded by the (selector) codon, which is the reverse complement of the anticodon contained in the ptRNA.

[0156] Eukaryotic cells used to prepare a POI comprising one or more non-canonical amino acid (ncAA) residues described herein can be produced by introducing polynucleotides encoding pRS, ptRNA, the POI, and / or additional elements, such as the dsRNA-binding polypeptide and / or tetO-binding polypeptide described herein, into a eukaryotic (host) cell. The nucleotide sequences can be located on separate nucleic acid molecules (vectors) or on the same nucleic acid molecule (e.g., vector), in any combination, and can be introduced into the cell in combination or sequentially.

[0157] Preferably, the nucleic acid molecules described are introduced into the respective cells using common cloning and transfection techniques known to those skilled in the art (e.g., co-precipitation, protoplast fusion, electroporation, virus-mediated gene delivery, lipofection, microinjection, etc.). Suitable techniques are described, for example, in Current Protocols in Molecular Biology, F. Ausubel et al., Ed., Wiley Interscience, New York 1997; or Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

[0158] After translation, the POI prepared according to the present invention can optionally be recovered from the eukaryotic cells, or from the culture medium if secreted, and purified to homogeneity, partially or substantially, according to procedures commonly known in the art. To this end, the POI can be recovered and purified to homogeneity, partially or substantially, according to procedures known and used by those skilled in the art.

[0159] Unless the target polypeptide is secreted into the culture medium, recovery usually requires cell disruption. Methods for cell disruption are well known in the art and include physical disruption by ultrasound treatment, liquid shear disruption (e.g., using a French press), mechanical methods (e.g., using a blender or grinder), freeze-thaw cycles, and chemical lysis using agents that disrupt lipid-lipid, protein-protein, and / or protein-lipid interactions (e.g., detergents), as well as combinations of physical disruption and chemical lysis. Standard procedures for purifying polypeptides from cell lysates or culture medium are also well known in the art. Examples include ammonium sulfate or ethanol precipitation, acid or base extraction, column chromatography, affinity column chromatography, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, hydroxyapatite chromatography, lectin chromatography, gel electrophoresis, and the like. Protein refolding steps can be used, if necessary, to produce correctly folded mature proteins. High-performance liquid chromatography (HPLC), affinity chromatography, or other suitable methods can be used in final purification steps where high purity is desired. Antibodies generated against the polypeptides of the present invention can be used as purification reagents, i.e., for affinity-based purification of the polypeptides. Various purification / protein refolding methods are well known in the art, such as those described in Scopes, Protein Purification, Springer, Berlin (1993); Deutscher, Methods in Enzymology Vol. 182: Guide to Protein Purification, Academic Press (1990); and references cited therein.

[0160] As previously mentioned, one of skill in the art will recognize that after synthesis, expression, and / or purification, a polypeptide may have a conformation that differs from the desired conformation of the related polypeptide. For example, overexpressed polypeptides and polypeptides produced in prokaryotic systems are often optimized by exposure to chaotropic agents to achieve proper folding.

[0161] For example, during purification from E. coli lysate, expressed polypeptides are optionally denatured and then renatured. This can be achieved, for example, by solubilizing the protein in a chaotropic agent such as guanidine HCl. In general, it is sometimes desirable to denature and disrupt an expressed polypeptide and then refold the polypeptide into a preferred conformation. For example, guanidine, urea, DTT, DTE, and / or chaperonins can be added to the translation product of interest. Methods for reducing, denaturing, and renaturing proteins are well known to those skilled in the art. For example, polypeptides can be refolded in a redox buffer containing oxidized glutathione and L-arginine.

[0162] The POI expressed by the method of the invention can be purified by known techniques, such as molecular sieve chromatography (gel filtration), such as Q-Sepharose™ chromatography, ion exchange chromatography, and hydrophobic chromatography, as well as other common protein purification techniques such as ultrafiltration, crystallization, salting out, dialysis, and native gel electrophoresis. Suitable methods are described, for example, in Cooper, T.G., Biochemische Arbeitsmethoden [Biochemical processes], Verlag Walter de Gruyter, Berlin, New York; or Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.

[0163] To isolate a POI, it may be advantageous to link the POI to a tag that may facilitate easier purification. This can be achieved by introducing a sequence encoding the corresponding tag into the nucleotide sequence encoding the POI. Suitable tags for protein purification are well known in the art and include, for example, histidine tags (e.g., His6 tags) and epitopes that can be recognized as antigens by antibodies (e.g., as described in Harlow, E. and Lane, D., 1988, Antibodies: A Laboratory Manual. Cold Spring Harbor (NY) Press). These tags may be useful for attaching proteins to solid supports, such as polymer matrices (which can be used, for example, as packing for chromatography columns or can be used on microtiter plates or other supports).

[0164] A tag linked to a POI can also function to detect the POI. Tags for protein detection are well known in the art and include, for example, fluorescent dyes, enzyme markers that form detectable reaction products after reaction with a substrate, etc.

[0165] Also described are POIs produced by the methods of the invention, which POIs can be prepared by the methods of the invention utilizing the eukaryotic cells described herein.

[0166] 8. Kit The present invention also provides kits for preparing a POI having one or more non-canonical amino acid (ncAA) residues in its amino acid sequence. The kits of the present invention include one or more ncAAs, or salts thereof, corresponding to one or more ncAA residues of the POI. Furthermore, the kits of the present invention can include a polynucleotide or a combination of polynucleotides of the present invention, and / or a polynucleotide encoding a dsRNA-binding polypeptide described herein, and / or a eukaryotic cell of the present invention.

[0167] The kit can further include one or more reporter constructs encoding a readily detectable (e.g., fluorescent) reporter polypeptide. The reporter construct includes at least one selector codon located in the coding sequence of the reporter polypeptide. The successful incorporation of an amino acid or ncAA at the position encoded by the selector codon allows for translational synthesis of the reporter polypeptide.

[0168] The kits of the present invention can be used in the methods of the present invention for preparing the ncAA residue-containing POIs described herein.

[0169] 9. Specific Embodiments The present invention provides the following specific embodiments: 1) According to a first embodiment, the present invention relates to a eukaryotic cell comprising: (a) a polynucleotide encoding a prokaryotic aminoacyl-tRNA synthetase (pRS); (b) a polynucleotide encoding a prokaryotic tRNA (ptRNA) and one or more ribozymes. In the eukaryotic cell, pRS can acylate ptRNA, The sequences encoding the ptRNA and the ribozyme are linked such that transcription produces an RNA molecule containing both the ptRNA and the ribozyme (ptRNA-ribozyme).

[0170] A second embodiment relates to the eukaryotic cell of embodiment 1, wherein the ribozyme is selected from a hammerhead ribozyme, a hairpin ribozyme, a Varkud satellite ribozyme, a glucosamine-6-phosphate synthase riboswitch, and a hepatitis delta virus (HDV) ribozyme.

[0171] A third embodiment relates to a eukaryotic cell of embodiment 1 or embodiment 2, wherein the ribozyme is a HDV ribozyme directly linked to the 3' end of ptRNA in the ptRNA-ribozyme.

[0172] A fourth embodiment relates to the eukaryotic cell of any one of embodiments 1 to 3: In the eukaryotic cell, (i) the transcriptional synthesis of the ptRNA-ribozyme is controlled by a tetracycline-responsive promoter element (TRE), or (ii) The ptRNA-ribozyme is transcribed and synthesized by RNA polymerase, and the expression of the RNA polymerase is controlled by the TRE.

[0173] A fifth embodiment relates to the eukaryotic cell of any one of embodiments 1 to 4, wherein transcription of the pRS coding sequence is controlled by a tetracycline-responsive promoter element (TRE).

[0174] A sixth embodiment relates to the eukaryotic cell of embodiment 4 or embodiment 5, further comprising a polynucleotide encoding a protein that binds to a tetracycline operator (tetO) sequence (tetO-binding protein), wherein the tetO-binding protein is selected from the group consisting of: (i) tetracycline repressor (tetR); (ii) tetracycline-controlled transcription activator (tTA); and (iii) reverse tTA (rtTA).

[0175] A seventh embodiment relates to the eukaryotic cell of any one of embodiments 1 to 6: In the eukaryotic cell, (i) the transcriptional synthesis of the ptRNA-ribozyme is controlled by a T7 promoter, and / or (ii) transcription of the pRS coding sequence is controlled by the T7 promoter; The eukaryotic cell further comprises: (c) A polynucleotide encoding T7 RNA polymerase (T7RNAP).

[0176] An eighth embodiment relates to the eukaryotic cell of embodiment 7, wherein expression of T7RNAP is controlled by a TRE.

[0177] A ninth embodiment relates to the eukaryotic cell of embodiment 7 or embodiment 8, wherein the T7RNAP comprises: (i) a nuclear localization signal (NLS); or (ii) a nuclear export signal (NES); or (iii) No NES or NLS.

[0178] A tenth embodiment relates to a eukaryotic cell of any one of embodiments 1 to 9, further comprising a polynucleotide encoding a dsRNA-binding polypeptide as defined in any one of embodiments 11 to 13 below.

[0179] An eleventh embodiment relates to a eukaryotic cell comprising: (a) a polynucleotide encoding a prokaryotic aminoacyl-tRNA synthetase (pRS); (b) a polynucleotide encoding a prokaryotic tRNA (ptRNA); and (c) A polynucleotide encoding a polypeptide capable of binding to double-stranded RNA (dsRNA-binding polypeptide), comprising an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to any one of the sequences set forth in SEQ ID NOs: 37 and 57 to 59.

[0180] A twelfth embodiment relates to the eukaryotic cell of embodiment 11, wherein the amino acid sequence comprised in the dsRNA-binding polypeptide has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the sequence set forth in SEQ ID NO:38.

[0181] A thirteenth embodiment relates to the eukaryotic cell of embodiment 11 or embodiment 12, wherein the dsRNA-binding polypeptide is not capable of phosphorylating eukaryotic initiation factor 2α (eIF-2α).

[0182] A fourteenth embodiment relates to the eukaryotic cell of any one of embodiments 11 to 13: In the eukaryotic cell, (i) transcriptional synthesis of ptRNA is controlled by a tetracycline-responsive promoter element (TRE), or (ii) ptRNA is transcribed and synthesized by RNA polymerase, and the expression of the RNA polymerase is controlled by TRE.

[0183] A fifteenth embodiment relates to the eukaryotic cell of any one of embodiments 11 to 14: In the eukaryotic cell, (i) transcription of the pRS coding sequence is controlled by a tetracycline-responsive promoter element (TRE), or (ii) Transcription of the pRS coding sequence is catalyzed by an RNA polymerase, the expression of which is controlled by the TRE.

[0184] A sixteenth embodiment relates to the eukaryotic cell of embodiment 14 or embodiment 15, further comprising a polynucleotide encoding a protein that binds to a tetracycline operator (tetO) sequence (tetO-binding protein), wherein the tetO-binding protein is selected from the group consisting of: (i) tetracycline repressor (tetR); (ii) tetracycline-controlled transcription activator (tTA); and (iii) reverse tTA (rtTA).

[0185] A seventeenth embodiment relates to the eukaryotic cell of any one of embodiments 11 to 16: In the eukaryotic cell, (i) transcriptional synthesis of ptRNA is controlled by a T7 promoter, or (ii) transcription of the pRS coding sequence is controlled by a T7 promoter, or (iii) both (i) and (ii); The eukaryotic cell further comprises: (c) A polynucleotide encoding T7 RNA polymerase (T7RNAP).

[0186] An eighteenth embodiment relates to the eukaryotic cell of embodiment 17, wherein expression of T7RNAP is controlled by a TRE.

[0187] A 19th embodiment relates to the eukaryotic cell of embodiment 17 or embodiment 18, wherein the T7RNAP has: (i) a nuclear localization signal (NLS); or (ii) a nuclear export signal (NES); or (iii) No NES or NLS.

[0188] A twentieth embodiment relates to the eukaryotic cell of any one of embodiments 11 to 13, wherein the eukaryotic cell is a cell of any one of embodiments 1 to 9.

[0189] A 21st embodiment relates to a polynucleotide encoding an RNA molecule comprising ptRNA and one or more ribozymes (ptRNA-ribozyme), as defined in any one of embodiments 1 to 4 and 7: In more detail, a) the ribozyme is a HDV ribozyme directly linked to the 3' end of the ptRNA in a ptRNA-ribozyme; or b) the ptRNA is derived from a pyrrolysyl tRNA of Methanosarcina species, in particular M. mazei; or c) the ptRNA molecule is encoded lacking the 3'-terminal aminoacyl acceptor stem motif CCA; or d) ptRNA has the following nucleotide sequence (SEQ ID NO: 60): ggaaacctgatcatgtagatcgaatggact xxx It is encoded by aatccgttcagccgggttagattcccggggtttccg (xxx codes for the anticodon).

[0190] A 22nd embodiment relates to a nucleotide sequence encoding an RNA molecule comprising ptRNA and one or more ribozymes (ptRNA-ribozyme), as defined in any one of embodiments 1 to 4 and 7; and (i) a nucleotide sequence encoding a tetO-binding protein as defined in embodiment 6, or (ii) a nucleotide sequence encoding pRS as defined in any one of embodiments 1, 5 and 7; or (iii) both (i) and (ii); or a combination of two or more polynucleotides comprising:

[0191] A twenty-third embodiment relates to a method of preparing a polypeptide of interest (POI) having one or more non-canonical amino acid (ncAA) residues in its amino acid sequence: The method comprises the steps of: (a) In eukaryotic cells, - a prokaryotic aminoacyl-tRNA synthetase (pRS); and - an RNA molecule comprising a prokaryotic tRNA (ptRNA) and one or more ribozymes (ptRNA-ribozymes), expressing the and, simultaneously or sequentially, (b) expressing the POI in a eukaryotic cell in the presence of one or more ncAAs or salts thereof corresponding to one or more ncAA residues of the POI; and (c) optionally recovering the expressed POI; pRS is capable of acylating ptRNA with ncAA or a salt thereof, The POI is encoded by a nucleotide sequence that includes one or more selector codons that encode one or more ncAA residues, and The selector codon is the reverse complement of the anticodon of the ptRNA.

[0192] A 24th embodiment relates to the method of embodiment 23, wherein the ribozyme is selected from a hammerhead ribozyme, a hairpin ribozyme, a Varkud satellite ribozyme, a glucosamine-6-phosphate synthase riboswitch, and a hepatitis delta virus (HDV) ribozyme.

[0193] A 25th embodiment relates to the method of embodiment 23 or embodiment 24, wherein the ribozyme is a HDV ribozyme directly linked to the 3' end of ptRNA in the ptRNA-ribozyme.

[0194] T7 control in general A 26th embodiment relates to the method of any one of embodiments 23 to 25, wherein the transcriptional synthesis of the ptRNA-ribozyme is controlled by a T7 promoter: The method further comprises expressing T7 RNA polymerase (T7RNAP) in the eukaryotic cell prior to or simultaneously with the controlled expression of (i) the ptRNA-ribozyme or (ii) pRS or (iii) both, respectively.

[0195] T-RE X System (tetR, +tet / dox) A 27th embodiment relates to the method of any one of embodiments 23 to 25: In the method, (i) the transcriptional synthesis of the ptRNA-ribozyme is controlled by a tetracycline-responsive promoter element (TRE), or (ii) the ptRNA-ribozyme is transcribed and synthesized by an RNA polymerase, and the expression of the RNA polymerase is controlled by a TRE; The method further comprises expressing a tetracycline repressor (tetR) in the eukaryotic cell prior to expression of at least the ptRNA ribozyme; Expression of the ptRNA-ribozyme involves contacting a eukaryotic cell with tetracycline, doxycycline, or a functional analog thereof, thereby inducing transcriptional synthesis of the ptRNA-ribozyme.

[0196] A 28th embodiment relates to the method of any one of embodiments 23 to 25 and 27: In the method, (i) transcription of the pRS coding sequence is controlled by a tetracycline-responsive promoter element (TRE); or (ii) transcription of the pRS coding sequence is catalyzed by an RNA polymerase, the expression of which is controlled by a TRE; The method further comprises expressing a tetracycline repressor (tetR) in the eukaryotic cell prior to expression of at least pRS; Expression of pRS involves contacting a eukaryotic cell with tetracycline, doxycycline, or a functional analog thereof, thereby inducing transcription of the pRS coding sequence.

[0197] A 29th embodiment relates to the method of embodiment 27 or embodiment 28: The method comprises: (i) the transcriptional synthesis of the ptRNA-ribozyme is controlled by a T7 promoter; or (ii) transcription of the pRS coding sequence is controlled by a T7 promoter; or (iii) both (i) and (ii); The method further comprises the steps of: - expressing T7 RNA polymerase (T7RNAP) in a eukaryotic cell, prior to or simultaneously with the controlled expression of (i) ptRNA-ribozyme or (ii) pRS or (iii) both, respectively, wherein the expression of T7RNAP is controlled by a TRE; - expressing tetR in the eukaryotic cell at least simultaneously with the expression of T7RNAP; Expression of T7RNAP involves contacting a eukaryotic cell with tetracycline, doxycycline, or a functional analogue thereof, thereby inducing transcription of the T7RNAP coding sequence.

[0198] Tet-Off system (tTA, -tet / dox) A 30th embodiment relates to the method of any one of embodiments 23 to 25: In the method, (i) the transcriptional synthesis of the ptRNA-ribozyme is controlled by a tetracycline-responsive promoter element (TRE), or (ii) the ptRNA-ribozyme is transcribed and synthesized by an RNA polymerase, and the expression of the RNA polymerase is controlled by a TRE; The method further comprises the steps of: (1) expressing a tetracycline-controlled transcription activator (tTA) in a eukaryotic cell prior to and simultaneously with the expression of the ptRNA-ribozyme; and (2) Maintaining contact between eukaryotic cells and tetracycline, doxycycline or a functional analogue thereof prior to expression of ptRNA-ribozyme, thereby suppressing transcriptional synthesis of ptRNA-ribozyme, and then reducing or preferably removing the concentration of said tetracycline, doxycycline or a functional analogue thereof to induce transcriptional synthesis of ptRNA-ribozyme.

[0199] A 31st embodiment relates to the method of any one of embodiments 23 to 25 and 30: In the method, (i) transcription of the pRS coding sequence is controlled by a TRE; or (ii) transcription of the pRS coding sequence is catalyzed by an RNA polymerase, and expression of said RNA polymerase is controlled by a TRE; The method further comprises the steps of: (1) expressing a tetracycline-controlled transcription activator (tTA) in a eukaryotic cell prior to and simultaneously with the expression of pRS; and (2) maintaining contact of the eukaryotic cell with tetracycline, doxycycline, or a functional analog thereof prior to expression of pRS, thereby repressing transcription of the pRS coding sequence, and then reducing or preferably removing the concentration of said tetracycline, doxycycline, or a functional analog thereof to induce transcription of the pRS coding sequence.

[0200] A 32nd embodiment relates to the method of embodiment 30 or embodiment 31: In the method, (i) the transcriptional synthesis of the ptRNA-ribozyme is controlled by a T7 promoter, or (ii) transcription of the pRS coding sequence is controlled by a T7 promoter; or (iii) both (i) and (ii); The method further comprises the steps of: (3) expressing T7 RNA polymerase (T7RNAP) in a eukaryotic cell prior to or simultaneously with the controlled expression of (i) ptRNA-ribozyme or (ii) pRS or (iii) both, respectively, wherein the expression of T7RNAP is controlled by a TRE; (4) expressing tTA in the eukaryotic cell prior to and simultaneously with the expression of T7RNAP; and (5) maintaining contact of the eukaryotic cell with tetracycline, doxycycline, or a functional analogue thereof prior to expression of T7RNAP, thereby suppressing transcription of the T7RNAP coding sequence, and then reducing or preferably removing the concentration of the tetracycline, doxycycline, or a functional analogue thereof to induce transcription of the T7RNAP coding sequence.

[0201] Tet-On system (rtTA, +dox) A 33rd embodiment relates to the method of any one of embodiments 23 to 25: In the method, (i) the transcriptional synthesis of the ptRNA-ribozyme is controlled by a tetracycline-responsive promoter element (TRE), or (ii) the ptRNA-ribozyme is transcribed and synthesized by an RNA polymerase, and the expression of the RNA polymerase is controlled by a TRE; The method further comprises expressing reverse tTA (rtTA) in the eukaryotic cell simultaneously with the expression of at least the ptRNA; Expression of the ptRNA-ribozyme involves contacting a eukaryotic cell with doxycycline or a functional analog thereof, thereby inducing transcriptional synthesis of the ptRNA-ribozyme.

[0202] A 34th embodiment relates to the method of any one of embodiments 23 to 25 and 33: In the method, (i) transcription of the pRS coding sequence is controlled by a tetracycline-responsive promoter element (TRE), or (ii) transcription of the pRS coding sequence is catalyzed by an RNA polymerase, the expression of which is controlled by a TRE; The method further comprises expressing reverse tTA (rtTA) in the eukaryotic cell simultaneously with the expression of at least pRS; Expression of pRS involves contacting a eukaryotic cell with doxycycline or a functional analog thereof, thereby inducing transcription of the pRS coding sequence.

[0203] A 35th embodiment relates to the method of embodiment 33 or embodiment 34: The method comprises: (i) the transcriptional synthesis of the ptRNA-ribozyme is controlled by a T7 promoter; or (ii) transcription of the pRS coding sequence is controlled by a T7 promoter; or (iii) both (i) and (ii); The method further comprises the steps of: - expressing T7 RNA polymerase (T7RNAP) in a eukaryotic cell, prior to or simultaneously with the controlled expression of (i) ptRNA-ribozyme or (ii) pRS or (iii) both, respectively, wherein the expression of T7RNAP is controlled by a TRE; - expressing rtTA in the eukaryotic cell at least simultaneously with the expression of T7RNAP; Expression of T7RNAP involves contacting a eukaryotic cell with doxycycline or a functional analog thereof, thereby inducing transcription of the T7RNAP coding sequence.

[0204] A 36th embodiment relates to the method of any one of embodiments 23 to 25, further comprising the steps of: Expressing in a eukaryotic cell a dsRNA-binding polypeptide as defined in any one of embodiments 11 to 13.

[0205] A thirty-seventh embodiment relates to a method of preparing a polypeptide of interest (POI) having one or more non-canonical amino acid (ncAA) residues in its amino acid sequence: The method comprises the steps of: (a) In eukaryotic cells, - Prokaryotic aminoacyl-tRNA synthetases (pRS); - prokaryotic tRNA (ptRNA); and - a polypeptide capable of binding to double-stranded RNA (dsRNA-binding polypeptide), expressing the and, simultaneously or sequentially, (b) expressing the POI in a eukaryotic cell in the presence of one or more ncAAs or salts thereof corresponding to one or more ncAA residues of the POI; and (c) optionally recovering the expressed POI; pRS is capable of acylating ptRNA with ncAA or a salt thereof, The dsRNA-binding polypeptide comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any one of the sequences set forth in SEQ ID NOs: 37, and 57 to 59; The POI is encoded by a nucleotide sequence that includes one or more selector codons that encode one or more ncAA residues, and The selector codon is the reverse complement of the anticodon of the ptRNA.

[0206] A 38th embodiment relates to the method of embodiment 37, wherein the amino acid sequence comprised in the dsRNA-binding polypeptide has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the sequence set forth in SEQ ID NO:38.

[0207] A thirty-ninth embodiment relates to the method of embodiment 37 or embodiment 38, wherein the dsRNA-binding polypeptide is not capable of phosphorylating eukaryotic initiation factor 2α (eIF-2α).

[0208] T7 control in general A 40th embodiment relates to the method of any one of embodiments 37 to 39: The method comprises: (i) transcriptional synthesis of ptRNA is controlled by a T7 promoter, or (ii) transcription of the pRS coding sequence is controlled by a T7 promoter; or (iii) both (i) and (ii); The method further includes expressing T7 RNA polymerase (T7RNAP) in the eukaryotic cell prior to or simultaneously with the controlled expression of (i) ptRNA or (ii) pRS or (iii) both, respectively.

[0209] T-RE X System (tetR, +tet / dox) A 41st embodiment relates to the method of any one of embodiments 37 to 39: In the method, (i) transcriptional synthesis of ptRNA is controlled by a tetracycline-responsive promoter element (TRE), or (ii) ptRNA is transcribed and synthesized by RNA polymerase, and the expression of the RNA polymerase is controlled by the TRE; The method further comprises expressing a tetracycline repressor (tetR) in the eukaryotic cell prior to expression of at least the ptRNA; Expression of ptRNA involves contacting a eukaryotic cell with tetracycline, doxycycline, or a functional analog thereof, thereby inducing transcriptional synthesis of ptRNA.

[0210] A 42nd embodiment relates to the method of any one of embodiments 37 to 39 and 41: In the method, (i) transcription of the pRS coding sequence is controlled by a tetracycline-responsive promoter element (TRE), or (ii) transcription of the pRS coding sequence is catalyzed by an RNA polymerase, the expression of which is controlled by a TRE; The method further comprises expressing a tetracycline repressor (tetR) in the eukaryotic cell prior to expression of at least pRS; and Expression of pRS involves contacting a eukaryotic cell with tetracycline, doxycycline, or a functional analog thereof, thereby inducing transcription of the pRS coding sequence.

[0211] A 43rd embodiment relates to the method of embodiment 41 or embodiment 42: The method comprises: (i) transcriptional synthesis of ptRNA is controlled by a T7 promoter; or (ii) transcription of the pRS coding sequence is controlled by a T7 promoter; or (iii) both (i) and (ii); The method further comprises the steps of: - expressing T7 RNA polymerase (T7RNAP) in a eukaryotic cell prior to or simultaneously with the controlled expression of (i) ptRNA or (ii) pRS or (iii) both, respectively, wherein the expression of T7RNAP is controlled by a TRE; - expressing tetR in the eukaryotic cell at least simultaneously with the expression of T7RNAP; Expression of T7RNAP involves contacting a eukaryotic cell with tetracycline, doxycycline, or a functional analogue thereof, thereby inducing transcription of the T7RNAP coding sequence.

[0212] Tet-Off system (tTA, -tet / dox) A 44th embodiment relates to the method of any one of embodiments 37 to 39: In the method, (i) transcriptional synthesis of ptRNA is controlled by a tetracycline-responsive promoter element (TRE), or (ii) ptRNA is transcribed and synthesized by RNA polymerase, and the expression of the RNA polymerase is controlled by TRE; The method further comprises the steps of: (1) expressing a tetracycline-controlled transcription activator (tTA) in a eukaryotic cell prior to and simultaneously with the expression of ptRNA; and (2) maintaining contact between eukaryotic cells prior to expression of ptRNA and tetracycline, doxycycline, or a functional analog thereof, thereby suppressing transcriptional synthesis of ptRNA, and then reducing or preferably removing the concentration of the tetracycline, doxycycline, or a functional analog thereof to induce transcriptional synthesis of ptRNA.

[0213] A 45th embodiment relates to the method of any one of embodiments 37 to 39 and 44: In the method, (i) transcription of the pRS coding sequence is controlled by a TRE; or (ii) transcription of the pRS coding sequence is catalyzed by an RNA polymerase, and expression of said RNA polymerase is controlled by a TRE; The method further comprises the steps of: (1) expressing a tetracycline-controlled transcription activator (tTA) in a eukaryotic cell prior to and simultaneously with the expression of pRS; and (2) maintaining contact of the eukaryotic cell with tetracycline, doxycycline, or a functional analog thereof prior to expression of pRS, thereby repressing transcription of the pRS coding sequence, and then reducing or preferably removing the concentration of said tetracycline, doxycycline, or a functional analog thereof to induce transcription of the pRS coding sequence.

[0214] A 46th embodiment relates to the method of embodiment 44 or embodiment 45: In the method, (i) transcriptional synthesis of ptRNA is controlled by a T7 promoter, or (ii) transcription of the pRS coding sequence is controlled by a T7 promoter; or (iii) both (i) and (ii); The method further comprises the steps of: (3) expressing T7 RNA polymerase (T7RNAP) in a eukaryotic cell prior to or simultaneously with the controlled expression of (i) ptRNA or (ii) pRS or (iii) both, respectively, wherein the expression of T7RNAP is controlled by a TRE; (4) expressing tTA in the eukaryotic cell prior to and simultaneously with the expression of T7RNAP; and (5) maintaining contact of the eukaryotic cell with tetracycline, doxycycline, or a functional analogue thereof prior to expression of T7RNAP, thereby suppressing transcription of the T7RNAP coding sequence, and then reducing or preferably removing the concentration of the tetracycline, doxycycline, or a functional analogue thereof to induce transcription of the T7RNAP coding sequence.

[0215] Tet-On system (rtTA, +dox) A 47th embodiment relates to the method of any one of embodiments 37 to 39: In the method, (i) transcriptional synthesis of ptRNA is controlled by a tetracycline-responsive promoter element (TRE), or (ii) ptRNA is transcribed and synthesized by RNA polymerase, and the expression of the RNA polymerase is controlled by the TRE; The method further comprises expressing reverse tTA (rtTA) in the eukaryotic cell simultaneously with the expression of at least the ptRNA; Expression of ptRNA involves contacting a eukaryotic cell with doxycycline or a functional analog thereof, thereby inducing transcriptional synthesis of ptRNA.

[0216] A 48th embodiment is the method of any one of embodiments 37-39 and 47: In the method, (i) transcription of the pRS coding sequence is controlled by a tetracycline-responsive promoter element (TRE), or (ii) transcription of the pRS coding sequence is catalyzed by an RNA polymerase, the expression of which is controlled by a TRE; The method further comprises expressing reverse tTA (rtTA) in the eukaryotic cell simultaneously with the expression of at least pRS; and Expression of pRS involves contacting a eukaryotic cell with doxycycline or a functional analog thereof, thereby inducing transcription of the pRS coding sequence.

[0217] A 49th embodiment relates to the method of embodiment 47 or embodiment 48: The method comprises: (i) transcriptional synthesis of ptRNA is controlled by a T7 promoter; or (ii) transcription of the pRS coding sequence is controlled by a T7 promoter; or (iii) both (i) and (ii); The method further comprises the steps of: - expressing T7 RNA polymerase (T7RNAP) in a eukaryotic cell prior to or simultaneously with the controlled expression of (i) ptRNA or (ii) pRS or (iii) both, respectively, wherein the expression of T7RNAP is controlled by a TRE; - expressing rtTA in the eukaryotic cell at least simultaneously with the expression of T7RNAP; Expression of T7RNAP involves contacting a eukaryotic cell with doxycycline or a functional analog thereof, thereby inducing transcription of the T7RNAP coding sequence.

[0218] A fiftieth embodiment relates to the method of any one of embodiments 37 to 49, wherein the ptRNA expresses a part of an RNA molecule that further comprises one or more ribozymes (ptRNA-ribozyme).

[0219] The fifty-first embodiment relates to the method of embodiment fifty, which is any one of embodiments twenty-third to thirty-five.

[0220] A fifty-second embodiment relates to a kit for preparing a polypeptide of interest (POI) having one or more non-canonical amino acid (ncAA) residues in its amino acid sequence, comprising: The kit comprises one or more ncAAs, or salts thereof, corresponding to one or more ncAA residues of the POI; and (a) the polynucleotide of embodiment 21; or (b) the polynucleotide of embodiment 22, or a combination of two or more polynucleotides; or (c) a polynucleotide encoding a dsRNA-binding polypeptide as defined in any one of embodiments 11 to 13; or (d) a eukaryotic cell according to any one of embodiments 1 to 20; Includes:

[0221] The invention will now be described in more detail by reference to certain non-limiting embodiments in the experimental section that follows. [Example]

[0222] Materials and Methods Unless otherwise stated, cloning and expression of recombinant polypeptides was performed according to standard methods as described, for example, in Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

[0223] A) Cloning Reporter gene NLS-iRFP-Flag-GFP Y39->TAG NLS-iRFP-Flag-GFP (SEQ ID NO: 39) was cloned into the pCI plasmid (Promega) as described by Nikic et al. (Angew Chem Int Ed Engl 2016, 55:16172-16176). Y39->TAG -6His is iRFP fused to GFP, in which position 39 of GFP is encoded by the amber stop codon TAG (iRFP-GFP Y39TAG ) is included.

[0224] The coding sequence of the T7 RNA polymerase gene with or without the NES signal (NES-T7RNAP or T7RNAP) was inserted into the pcDNA3.1 or pCAGGS plasmid. The pcDNA3.1 and pCAGGS plasmids differ in their promoters. The pcDNA3.1 plasmid contains a CMV promoter. The pCAGGS plasmid contains a chicken actin promoter and a CMV enhancer with an intron (SEQ ID NO: 56).

[0225] For constitutive expression, the T7RNAP or NES-T7RNAP coding sequence was inserted downstream of the CMV promoter (pcDNA3.1 plasmid) or downstream of the chicken actin promoter and intron (pCAGGS plasmid). For inducible expression via the T-REx system, the NES-T7RNAP coding sequence was inserted downstream of the "T-REx" promoter (SEQ ID NO: 12, ThermoFisher Scientific) containing two tetO sequences. For inducible expression via the Tet-On system, the NES-T7RNAP coding sequence was inserted downstream of the "Tet-On" promoter (SEQ ID NO: 10) containing eight tetO sequences. The expression cassettes for constitutive "T-REx" and "Tet-On" expression of NES-T7RNAP are shown in SEQ ID NOs: 40 to 43, respectively.

[0226] PylRS with or without an NES signal for constitutive expression AF (Methanosarcina mazei) coding sequence (NES-PylRS AF or PylRS AF ) was inserted into the pcDNA3.1 plasmid (Invitrogen) downstream of the CMV promoter. For inducible expression via the T-REx system, NES-PylRS AF The coding sequence was inserted into the plasmid pDEST downstream of the "T-REx" promoter (SEQ ID NO: 12, ThermoFisher Scientific) containing two tetO sequences.

[0227] NES-PylRS for inducible expression via the Tet-On system AF The coding sequence was inserted into the pcDNA3.1 plasmid downstream of the "Tet-On" promoter (SEQ ID NO: 10) containing eight tetO sequences. AF The expression cassettes for constitutive "T-REx" and "Tet-On" expression are shown in SEQ ID NOs: 44 to 47, respectively.

[0228] tRNA Pyl The T7 promoter-controlled expression cassette (SEQ ID NO: 48) is Pyl A T7 promoter sequence was cloned upstream of the coding sequence, and tRNA Pyl A T7 termination signal was cloned downstream of the coding sequence and this expression cassette was inserted into the p2RZ plasmid (Avis et al., Methods Mol Biol. 941:83-98, 2012; (see Figure 1)). A variant of this expression cassette carrying the HDV ribozyme (tRNA Pyl -HDV) to tRNA Pyl A combination of restriction cloning, site-directed mutagenesis, and unrestricted cloning was used to generate a sequence that inserted the HDV ribozyme coding sequence directly downstream of (SEQ ID NO:49; see FIG. 1).

[0229] For inducible expression via the T-REx system, tRNA PylTwo different expression cassettes under the control of tet-inducible promoters were generated by inserting the coding sequences downstream of either variants of the human U6 promoter containing eight tetO sequences before and two tetO sequences after the U6 promoter or variants of the human H1 promoter containing two tetO sequences into the plasmids pUC57 (for the U6 promoter) and pPBEX (for the H1 promoter) (SEQ ID NOs: 50 and 51).

[0230] The expression cassette for rtTA or tetR contained the rtTA coding sequence (SEQ ID NO: 14) downstream of the CMV promoter and the tetR coding sequence (SEQ ID NO: 13) downstream of the CMV promoter.

[0231] The N-terminal dsRNA-binding domain of human protein kinase R (residues 2-174) ("PKR(2-174)") was cloned into the pI.18 plasmid (US 6,187,759 B1; a pUC-based plasmid containing the hCMV promoter, intron A, a terminator sequence, and a multiple cloning site) for constitutive expression with an N-terminal HA tag under the control of the cytomegalovirus (hCMV) promoter fused to intron A (the largest intron in the transcribed region of the hCMV major-immediate-early (IE1) gene, which enhances protein expression). See Chapman, BS et al., NAR, 1991, Vol. 19, No. 14, 2979-3986). The amino acid sequence of HA-PKR(2-174) is shown in SEQ ID NO: 36.

[0232] B) Cell culture and transfection HEK293T cells (ATCC CRL-3216) and HEK Flp-In T-REx 293 cells (ThermoFisher Scientific, #R78007) were maintained in Dulbecco's modified Eagle's medium (Life Technologies #41965-039) supplemented with 1% penicillin-streptomycin (Sigma P0781, 10,000 U / ml penicillin, 10 mg / ml streptomycin, 0.9% NaCl), 1% L-glutamine (Sigma #G7513), 1% sodium pyruvate (Life Technologies #11360), and 10% fetal bovine serum (FBS, Sigma #F7524).

[0233] For HEK Flp-In T-REx 293 cells, blasticidin (15 μg / ml) was added to the culture medium according to the manufacturer's instructions. The HEK Flp-In T-REx 293 cell line is derived from HEK293 cells (ATCC CRL-1573) and stably expresses the tet repressor (tetR) gene under the control of a constitutive CMV promoter. The user guide "Growth and Maintenance of the Flp-In" is available. TM T-REx TM See "Catalog Number: R780-07, Document Part Number: 25-0369, Publication Number: MAN0000187, Revision 2.0, 14.09.15, Gibco / Life Technologies."

[0234] The cells were cultured at 37°C in a 5% CO atmosphere and passaged every 2–3 days up to 15–20 passages.

[0235] Cells were seeded 15–20 h prior to transfection (approximately 110,000 cells / well) and grown in 24-well cell culture plates at 37°C and 5% CO2 to 70–80% confluency. For HEK TetOn-3G cells, cell culture plates were pre-coated with polylysine hydrobromide for 4–10 h. For 3 and 4 plasmid transfections, 1.2 μg of total DNA / well was used. For 5 or 6 plasmid transfections, 1.5 μg of total DNA / well was used. Transfections were performed using polyethyleneimine (PEI) at a DNA-to-PEI ratio of 1:3.

[0236] C) Expression induction and ncAA supplementation Four hours after transfection, the medium was replaced with fresh medium containing, depending on the experiment and sample, 1 μg / ml tetracycline (for induction of expression in the T-REx system, tetR co-expression system) or 1 μg / ml doxycycline (for induction of expression in the Tet-On system) and / or 250 μM of the ncAA used (e.g., BOC), or none of these (indicated concentrations = final concentration in cell culture).

[0237] The cells were then cultured at 37°C in a 5% CO 2 atmosphere for 2 days and then analyzed as described herein.

[0238] D) Analysis by flow cytometry spectroscopy (FCS) Cells were washed once with 1x PBS and analyzed by flow cytometry. Data acquisition and analysis were performed using a BD LSRFortessa instrument (BD Bioscience) and FlowJo software (FlowJo). GFP fluorescence was detected at 530 / 30 nm using a 488 nm laser, and iRFP fluorescence was detected at 730 / 45 nm using a 670 nm laser.

[0239] Events were first gated on an FSC-A x SSC-A scattergram for live cells, and then on an FSC-A x SSC-W scattergram for singlets. The singlet-gated events are shown as a plot of GFP signal versus iRFP signal, divided into four regions representing four distinct species: cells with iRFP fluorescence (lacking GFP) in the upper left; cells with both iRFP and GFP fluorescence (expressing the full-length protein iRFP-GFP, termed "double-positive sample" or "DP") in the upper right; cells with GFP fluorescence (lacking iRFP) in the lower right; and cells lacking both iRFP and GFP in the lower left.

[0240] Reporter NLS-iRFP-Flag-GFP Y39->TAG -6His is a fusion of iRFP (infrared fluorescent protein) and GFP (green fluorescent protein), with an amber (TAG) stop codon at amino acid position 39 of GFP. When properly transfected, cells express iRFP (detectable as red fluorescence), and only when the amber codon is suppressed to encode an ncAA (here, BOC or SCO), do they further express GFP (detectable as green fluorescence). Therefore, the ratio of green fluorescence (GFP) to red fluorescence (iRFP) in cells is an indicator of the efficiency of amber suppression.

[0241] Example 1: tRNA expressed as an RNA ribozyme Pyl Amber suppression using In the presence of PKR(2-174), the reporter gene NLS-iRFP-Flag-GFP Y39->TAG -6His, PylRS AF , tRNA Pyl Amber suppression was tested using , and the ncAA SCO. PKR(2-174) was expressed with an N-terminal HA tag (SEQ ID NO: 36) as HA-PKR(2-174). Pyl The HDV ribozyme is synthesized together with the tRNA-ribozyme RNA molecule (tRNA Pyl PylRS was expressed as a vector (-HDV). AFwas expressed under the control of the CMV promoter. The cells also expressed T7 RNA polymerase (T7RNAP).

[0242] PylRS AF and T7RNAP were constitutively expressed in HEK293T cells (ATCC CRL-3216). HEK293T cells were transfected with the reporter gene NLS-iRFP-Flag-GFP Y39->TAG -6His, PylRS under the control of the CMV promoter AF , tRNA under the control of the T7 promoter Pyl -HDV and vectors carrying expression cassettes for T7RNAP under the control of the CMV promoter were transfected using the respective constructs and transfection methods described in sections A) and B) above.

[0243] Controls consisted of cells not receiving SCO ("-ncAA") and / or tRNA without HDV ribozyme. Pyl was prepared in the same manner, except that

[0244] The cells were analyzed by FCS as described above in section D. The results shown in Figure 2 (using the pcDNA3.1 plasmid) and Figure 3 (using the pCAGGS plasmid) demonstrate that tRNA along with the HDV ribozyme Pyl When tRNA is expressed without a ribozyme, Pyl Without being bound by theory, we speculate that this effect is due to improved tRNA processing by the ribozyme.

[0245] Example 2: Amber suppression using various inducible expression systems Reporter gene NLS-iRFP-Flag-GFP Y39->TAG -6His, PylRS AF , tRNA Pyl Amber suppression was tested using tRNA, tRNA ... PylThe HDV ribozyme is combined with a tRNA-ribozyme RNA molecule (tRNA Pyl -HDV) under the control of the T7 promoter. AF was expressed with the NES signal (NES-PylRS AF These cells also expressed T7 RNA polymerase with an NES signal (NES-T7RNAP).

[0246] NES-PylRS AF and NES-T7RNAP were inducibly expressed using the T-REx system or the Tet-On system.

[0247] For the T-REx system, HEK Flp-In T-REx 293 cells were transfected with the reporter gene NLS-iRFP-Flag-GFP. Y39->TAG -6His, NES-PylRS under the control of the "T-REx" promoter AF , tRNA under the control of the T7 promoter Pyl HEK Flp-In T-REx 293 cells were transfected using the respective constructs and transfection methods described in sections A) and B) above. HEK Flp-In T-REx 293 cells stably express the tet repressor (tetR) gene. NES-T7RNAP (and thus tRNA) was expressed in the tetR gene. Pyl -HDV) and NES-PylRS AF Expression of was induced by the addition of tetracycline and cells were fed with the ncAA BOC as described above in section C).

[0248] For the Tet-On system, HEK293T cells (ATCC CRL-3216) were transfected with the reporter gene NLS-iRFP-Flag-GFP. Y39->TAG -6His, NES-PylRS under the control of the "Tet-On" promoter AF , tRNA under the control of the T7 promoter PylA vector carrying an expression cassette for tRNA-HDV, NES-T7RNAP under the control of the "Tet-On" promoter, and rtTA was co-transfected in the presence of PKR(2-174) using the respective constructs and transfection methods described in sections A) and B) above. PKR(2-174) was expressed as HA-PKR(2-174) with an N-terminal HA-tag (SEQ ID NO: 36). NES-T7RNAP (and thus tRNA) Pyl -HDV) and NES-PylRS AF Expression of was induced by the addition of doxycycline and cells were fed with the ncAA BOC as described above in section C).

[0249] Controls were prepared similarly, except that neither tetracycline nor doxycycline was added.

[0250] The cells were analyzed by FCS as described in section D above. The results shown in Figure 4 indicate that the inducibly expressed tRNA Pyl -HDV and NES-PylRS AF Amber suppression using BOC with α-receptor was shown to work effectively in both the T-REx system (FIG. 4a) and the Tet-On system (FIG. 4b).

[0251] Example 3: Amber suppression effect of PKR(2-174) in inducible and non-inducible expression systems The reporter gene NLS-iRFP-Flag-GFP was expressed in the presence or absence of PKR(2-174). Y39->TAG -6His, PylRS AF , tRNA Pyl Amber suppression was tested using tetR, tetR, and the ncAA BOC.

[0252] PKR(2-174) was expressed as HA-PKR(2-174) with an N-terminal TA-tag (SEQ ID NO: 36).

[0253] tRNA PylOne of three different expression cassettes was used: T7-tRNA Pyl -HDV (under the control of the T7 promoter, tRNA Pyl is a tRNA-ribozyme RNA molecule (tRNA Pyl -HDV) as HDV ribozyme (tRNA Pyl 8xtetO-U6-tetO-tRNA Pyl (tRNA Pyl is controlled by a tetracycline-inducible mutant of the human U6 promoter that contains eight tetO sequences before the U6 promoter and two tetO sequences after the U6 promoter (SEQ ID NO: 50); and H1-TetO-tRNA Pyl (tRNA Pyl Expression of is controlled by a tetracycline-inducible variant of the human H1 promoter containing two tetO sequences (SEQ ID NO: 51).

[0254] PylRS AF was expressed together with the NES signal (NES-PylRS AF ). NES-PylRS AF One of two different expression cassettes was used: CMV-tetO-NES-PylRS AF (NES-PylRS AF expression of which is controlled by a tetracycline-inducible variant of the CMV promoter containing two tetO sequences (SEQ ID NO: 46); CMV-NES-PylRS AF (NES-PylRS AF Expression of is controlled by the (constitutive) CMV promoter (SEQ ID NO: 45).

[0255] tRNA Pyl Expression of the T7 promoter (expression cassette T7-tRNA PylCells controlled by CMV-HDV) further contain one of two different expression cassettes for T7 RNA polymerase expressed with an NES signal (NES-T7RNAP): CMV-tetO-T7RNAP (NES-T7RNAP expression is under the control of a tetracycline-inducible mutant of the CMV promoter containing two tetO sequences (SEQ ID NO: 12); CMV-NES-T7RNAP (NES-T7RNAP expression is under the control of the (constitutive) CMV promoter (SEQ ID NO: 43)).

[0256] HEK293T cells were transfected with vectors carrying the following combinations of expression cassettes (x indicates the presence of the respective expression cassette in the combination):

[0257] [Table 1]

[0258] A control was prepared in the same manner but did not contain the expression cassette for HA-PKR(2-174).

[0259] Tetracycline was added for expression of the tet-inducible element, and cells were fed with the ncAA BOC as described above in section C. Control samples were prepared similarly, except that the addition of tetracycline and / or Boc was omitted.

[0260] Cells were analyzed by FCS as described above in section D. The results, shown in Figure 5, demonstrate that coexpression of PKR(2-174) increases the intensity of GFP fluorescence detected in double-positive cells and increases the amount of intact reporter gene expression product per cell (a result of successful amber suppression).

[0261] Abbreviation: BCN = 2-amino-6-(9-biocyclo[6.1.0]non-4-ynylmethoxycarbonylamino)hexanoic acid BOC = 2-amino-6-(tert-butoxycarbonylamino)hexanoic acid, in the examples "BOC" specifically refers to (2S)-2-amino-6-(tert-butoxycarbonylamino)hexanoic acid = Boc-l-Lys-OH = N-α-tert-butyloxycarbonyl-l-lysine CMV = cytomegalovirus Crm1 = chromosome region maintenance 1 (also known as karyopherin exportin 1) dsRNA = double-stranded RNA dSTORM = Direct Stochastic Optical Reconstruction Microscopy

[0262] E.coli BL21(DE3)AI=E.coli strain BF - ompT gal dcm lon hsdS B (r B - m B - )λ(DE3[lacI lacUV5-T7p07 ind1 sam7 nin5])[malB + ] K-12 (λ S )araB::T7RNAP-tetA eIF-2α = α subunit of eukaryotic initiation factor 2 FBS = fetal bovine serum FISH = Fluorescence in situ hybridization GCE = Genetic Code Extension GFP = green fluorescent protein glmS = glucosamine-6-phosphate synthetase H1 promoter = human RNA polymerase III promoter HDV = Hepatitis delta virus

[0263] IPTG = isopropyl β-D-1-thiogalactopyranoside iRFP = infrared fluorescent protein ncAA = non-standard amino acid NES = nuclear export signal NLS = nuclear localization signal O-tRNA = orthogonal tRNA O-RS = Orthogonal RS

[0264] PAINT = Point Integration for Imaging in Nanoscale Topography PBS = phosphate-buffered saline PKR = protein kinase R; also known as: dsRNA-dependent protein kinase, interferon (IFN)-induced dsRNA-activated serine / threonine-protein kinase, p68 kinase PMSF = phenylmethylsulfonyl fluoride POI = Polypeptide of Interest, Target Polypeptide PrK = 2-amino-6-(prop-2-ynoxycarbonylamino)hexanoic acid pRS=prokaryotic RS ptRNA=prokaryotic tRNA ptRNA-ribozyme = a prokaryotic RNA molecule containing ptRNA and at least one ribozyme PylRS = pyrrolysyl-tRNA synthetase PylRS AF = Mutant M. mazei pyrrolysyl-tRNA synthetase containing the amino acid substitutions Y306A and Y384F

[0265] RP-HPLC = reversed-phase high-performance liquid chromatography RS = aminoacyl-tRNA synthetase RT=room temperature rtTA = reverse tTA SCO = 2-amino-6-(cyclooct-2-yn-1-yloxycarbonylamino)hexanoic acid SPAAC = (Copper-Free) Strain-Promoted Alkyne-Azide Cycloaddition Reaction SPIEDAC = (Copper-Free) Strain-Promoted Inverse Electron Demand Diels-Alder Cycloaddition SRM = Super Resolution Microscopy SV40 = Simian vacuolating virus 40

[0266] T7RNAP = T7 RNA polymerase TCO = 2-amino-6[(2E-cyclooct-2-en-1-yl)oxycarbonylamino]hexanoic acid TCO * 2-Amino-6[(2E-cyclooct-2-en-1-yl)oxycarbonylamino]hexanoic acid tetR = tetracycline repressor tetO = tetracycline operator tTA = tetracycline-controlled transcription activator TRE = tetracycline-responsive promoter element (also called tetracycline-responsive element) tRNA Pyl = tRNA (used in the examples) that is acylated with pyrrolysine by wild-type or modified PylRS and preferably has an anticodon that is the reverse complement of the selector codon for site-specific incorporation of an ncAA into the POI Pyl In this case, the anticodon is CUA. U6 promoter = A promoter that normally controls the expression of U6 RNA (nucleolar RNA) in mammalian cells VS=Varkud satellite

[0267] [Table 2]

[0268] [Table 3]

[0269] [Table 4]

[0270] [Table 5]

[0271] [Table 6]

[0272]

Table 7

[0273]

Table 8

[0274]

Table 9

[0275]

Table 10

[0276]

Table 11

[0277]

Table 12

[0278]

Table 13

[0279]

Table 14

[0280]

Table 15

[0281] Table 16

[0282] Table 17

[0283]

Table 18

[0284] Table 19

[0285] Table 20

[0286] Table 21

[0287] Table 22

[0288] Table 23

[0289] Table 24

Claims

1. 1. A eukaryotic cell comprising: (a) a polynucleotide encoding a prokaryotic aminoacyl-tRNA synthetase (pRS); (b) a polynucleotide encoding a prokaryotic tRNA (ptRNA) and one or more ribozymes; The pRS is capable of acylating the ptRNA, and A eukaryotic cell in which the ptRNA and ribozyme encoding sequences are linked in such a way that transcription produces an RNA molecule containing both the ptRNA and the ribozyme (ptRNA-ribozyme).

2. 2. The eukaryotic cell of claim 1, wherein the ribozyme is selected from a hammerhead ribozyme, a hairpin ribozyme, a Varkud satellite ribozyme, a glucosamine-6-phosphate synthase riboswitch, and a hepatitis delta virus (HDV) ribozyme.

3. 3. The eukaryotic cell according to claim 1, wherein the ribozyme is an HDV ribozyme directly linked to the 3' end of the ptRNA in the ptRNA-ribozyme.

4. (i) the transcriptional synthesis of the ptRNA-ribozyme is controlled by a tetracycline-responsive promoter element (TRE), or (ii) the ptRNA-ribozyme is transcribed and synthesized by an RNA polymerase, and the expression of the RNA polymerase is controlled by a TRE; A eukaryotic cell according to any one of claims 1 to 3.

5. 5. The eukaryotic cell of claim 1, wherein transcription of the pRS coding sequence is controlled by a tetracycline-responsive promoter element (TRE).

6. further comprising a polynucleotide encoding a protein that binds to a tetracycline operator (tetO) sequence (tetO-binding protein); 6. The eukaryotic cell of claim 4 or 5, wherein the tetO binding protein is selected from the group consisting of: (i) tetracycline repressor (tetR); (ii) tetracycline-controlled transcriptional activator (tTA); and (iii) reverse tTA (rtTA).

7. The eukaryotic cell according to any one of claims 1 to 6, (i) the transcriptional synthesis of the ptRNA-ribozyme is controlled by a T7 promoter, and / or (ii) transcription of the pRS coding sequence is controlled by the T7 promoter; moreover, (c) A eukaryotic cell comprising a polynucleotide encoding T7 RNA polymerase (T7RNAP).

8. The eukaryotic cell of claim 7 , wherein expression of T7RNAP is controlled by a TRE.

9. T7RNAP has: (i) a nuclear localization signal (NLS); or (ii) a nuclear export signal (NES); or T7RNAP is (iii) does not have NES and NLS; A eukaryotic cell according to claim 7 or 8.

10. The eukaryotic cell of any one of claims 1 to 9, further comprising a polynucleotide encoding a dsRNA-binding polypeptide.

11. A polynucleotide encoding an RNA molecule comprising a ptRNA and one or more ribozymes (ptRNA-ribozymes) as defined in any one of claims 1 to 4 and 7, a) the ribozyme is an HDV ribozyme directly linked to the 3' end of a ptRNA in a ptRNA-ribozyme, said ptRNA lacking the 3' terminal aminoacyl acceptor stem motif CCA; or b) the ptRNA is derived from a pyrrolysyl-tRNA of the species Methanosarcina; or c) the ptRNA molecule is encoded lacking the 3'-terminal aminoacyl acceptor stem motif CCA; or d) A polynucleotide wherein the ptRNA is encoded by the following nucleotide sequence (SEQ ID NO: 60): ggaaacctgatcatgtagatcgaatggactnnnaatccgttcagccgggttagattcccggggtttccg (nnn encodes the anticodon).

12. The polynucleotide described in claim 11, wherein the Methanosarcina species is Methanosarcina mazei (M. mazei).

13. A nucleotide sequence encoding an RNA molecule comprising a ptRNA and one or more ribozymes (ptRNA-ribozymes) as defined in any one of claims 1 to 4 and 7; and (i) a nucleotide sequence encoding a tetO-binding protein as defined in claim 6, or (ii) A nucleotide sequence encoding a tetO-binding protein as defined in claim 6 and a nucleotide sequence encoding a pRS as defined in any one of claims 1, 5 and 7. or a combination of two or more polynucleotides.

14. 1. A method for preparing a polypeptide of interest (POI) having one or more non-canonical amino acid (ncAA) residues in its amino acid sequence, comprising: It comprises the steps of: (a) in a eukaryotic cell, - a prokaryotic aminoacyl-tRNA synthetase (pRS); and - an RNA molecule comprising a prokaryotic tRNA (ptRNA) and one or more ribozymes (ptRNA-ribozymes), expressing the and, simultaneously or sequentially, (b) expressing the POI in a eukaryotic cell in the presence of one or more ncAAs or salts thereof corresponding to one or more ncAA residues of the POI; and (c) optionally recovering the expressed POI; The pRS is capable of acylating the ptRNA with an ncAA or a salt thereof; The POI is encoded by a nucleotide sequence that includes one or more selector codons that encode one or more ncAA residues, and The method, wherein the selector codon is the reverse complement of the anticodon of the ptRNA.

15. The method according to claim 14, wherein the transcriptional synthesis of the ptRNA-ribozyme is controlled by a T7 promoter, The method further comprises expressing T7 RNA polymerase (T7RNAP) in the eukaryotic cell prior to or simultaneously with the controlled expression of (i) the ptRNA-ribozyme, or (ii) the pRS, or (iii) both, respectively.

16. 15. The method of claim 14, (i) the transcriptional synthesis of the ptRNA-ribozyme is controlled by a tetracycline-responsive promoter element (TRE); or (ii) the ptRNA-ribozyme is transcribed and synthesized by an RNA polymerase, and the expression of the RNA polymerase is controlled by a TRE; The method further comprises the step of expressing a tetracycline repressor (tetR) in the eukaryotic cell prior to expression of at least the ptRNA-ribozyme; and The method, wherein expression of the ptRNA-ribozyme comprises contacting a eukaryotic cell with tetracycline, doxycycline, or a functional analogue thereof, thereby inducing transcriptional synthesis of the ptRNA-ribozyme.

17. The method according to any one of claims 14 to 16, (i) transcription of the pRS coding sequence is controlled by a tetracycline-responsive promoter element (TRE); or (ii) transcription of the pRS coding sequence is catalyzed by an RNA polymerase, the expression of which is controlled by a TRE; The method further comprises expressing a tetracycline repressor (tetR) in the eukaryotic cell prior to expression of at least pRS; and The method, wherein expression of pRS comprises contacting a eukaryotic cell with tetracycline, doxycycline, or a functional analog thereof, thereby inducing transcription of the pRS coding sequence.

18. 18. The method of claim 16 or 17, (i) the transcriptional synthesis of the ptRNA-ribozyme is controlled by a T7 promoter; or (ii) transcription of the pRS coding sequence is controlled by a T7 promoter; or (iii) both (i) and (ii); The method further comprises the steps of: - expressing T7 RNA polymerase (T7RNAP) in a eukaryotic cell prior to or simultaneously with the controlled expression of (i) the ptRNA-ribozyme or (ii) the pRS or (iii) both, respectively, wherein the expression of T7RNAP is controlled by the TRE; and - expressing tetR in the eukaryotic cell at least simultaneously with the expression of T7RNAP; The method, wherein expression of T7RNAP comprises contacting a eukaryotic cell with tetracycline, doxycycline, or a functional analogue thereof, thereby inducing transcription of the T7RNAP coding sequence.

19. 15. The method of claim 14, (i) the transcriptional synthesis of the ptRNA-ribozyme is controlled by a tetracycline-responsive promoter element (TRE); or (ii) the ptRNA-ribozyme is transcribed and synthesized by an RNA polymerase, and the expression of the RNA polymerase is controlled by a TRE; The method further comprising the steps of: (1) expressing a tetracycline-controlled transcription activator (tTA) in a eukaryotic cell prior to and simultaneously with the expression of the ptRNA-ribozyme; and (2) maintaining contact between eukaryotic cells prior to expression of ptRNA-ribozymes and tetracycline, doxycycline or a functional analogue thereof, thereby suppressing transcriptional synthesis of ptRNA-ribozymes, and then reducing the concentration of the tetracycline, doxycycline or a functional analogue thereof to induce transcriptional synthesis of ptRNA-ribozymes.

20. The method of claim 14, (i) the transcriptional synthesis of the ptRNA-ribozyme is controlled by a tetracycline-responsive promoter element (TRE); or (ii) the ptRNA-ribozyme is transcribed and synthesized by an RNA polymerase, and the expression of the RNA polymerase is controlled by a TRE; The method further comprising the steps of: (1) expressing a tetracycline-controlled transcription activator (tTA) in a eukaryotic cell prior to and simultaneously with the expression of the ptRNA-ribozyme; and (2) maintaining contact between the eukaryotic cell and tetracycline, doxycycline, or a functional analogue thereof prior to expression of the ptRNA-ribozyme, thereby suppressing the transcriptional synthesis of the ptRNA-ribozyme, and then removing the tetracycline, doxycycline, or a functional analogue thereof to induce the transcriptional synthesis of the ptRNA-ribozyme.

21. The method according to any one of claims 14 to 20, (i) transcription of the pRS coding sequence is controlled by a TRE; or (ii) transcription of the pRS coding sequence is catalyzed by an RNA polymerase, the expression of which is controlled by a TRE; The method further comprising the steps of: (1) expressing a tetracycline-controlled transcription activator (tTA) in a eukaryotic cell prior to and simultaneously with the expression of pRS; and (2) maintaining contact of the eukaryotic cell with tetracycline, doxycycline, or a functional analog thereof prior to expression of pRS, thereby suppressing transcription of the pRS coding sequence, and then reducing the concentration of the tetracycline, doxycycline, or a functional analog thereof to induce transcription of the pRS coding sequence.

22. The method according to any one of claims 14 to 20, (i) transcription of the pRS coding sequence is controlled by a TRE; or (ii) transcription of the pRS coding sequence is catalyzed by an RNA polymerase, the expression of which is controlled by a TRE; The method further comprising the steps of: (1) expressing a tetracycline-controlled transcription activator (tTA) in a eukaryotic cell prior to and simultaneously with the expression of pRS; and (2) maintaining contact of the eukaryotic cell prior to expression of pRS with tetracycline, doxycycline, or a functional analog thereof, thereby repressing transcription of the pRS coding sequence, and then removing the tetracycline, doxycycline, or a functional analog thereof, to induce transcription of the pRS coding sequence.

23. The method according to any one of claims 19 to 22, (i) the transcriptional synthesis of the ptRNA-ribozyme is controlled by a T7 promoter, or (ii) transcription of the pRS coding sequence is controlled by a T7 promoter; or (iii) both (i) and (ii); The method further comprising the steps of: (3) expressing T7 RNA polymerase (T7RNAP) in a eukaryotic cell prior to or simultaneously with the controlled expression of (i) the ptRNA-ribozyme or (ii) the pRS or (iii) both, respectively, wherein the expression of T7RNAP is controlled by the TRE; (4) expressing tTA in the eukaryotic cell prior to and simultaneously with the expression of T7RNAP; and (5) maintaining contact of the eukaryotic cell with tetracycline, doxycycline, or a functional analog thereof prior to expression of T7RNAP, thereby suppressing transcription of the T7RNAP coding sequence, and then reducing the concentration of the tetracycline, doxycycline, or a functional analog thereof to induce transcription of the T7RNAP coding sequence.

24. The method according to any one of claims 19 to 22, comprising: (i) the transcriptional synthesis of the ptRNA-ribozyme is controlled by a T7 promoter, or (ii) transcription of the pRS coding sequence is controlled by a T7 promoter; or (iii) both (i) and (ii); The method further comprising the steps of: (3) expressing T7 RNA polymerase (T7RNAP) in a eukaryotic cell prior to or simultaneously with the controlled expression of (i) the ptRNA-ribozyme or (ii) the pRS or (iii) both, respectively, wherein the expression of T7RNAP is controlled by the TRE; (4) expressing tTA in the eukaryotic cell prior to and simultaneously with the expression of T7RNAP; and (5) maintaining contact of the eukaryotic cell prior to expression of T7RNAP with tetracycline, doxycycline, or a functional analog thereof, thereby repressing transcription of the T7RNAP coding sequence, and then removing the tetracycline, doxycycline, or a functional analog thereof to induce transcription of the T7RNAP coding sequence.

25. 15. The method of claim 14, (i) the transcriptional synthesis of the ptRNA-ribozyme is controlled by a tetracycline-responsive promoter element (TRE), or (ii) the ptRNA-ribozyme is transcribed and synthesized by an RNA polymerase, and the expression of the RNA polymerase is controlled by a TRE; The method further comprises expressing a reverse tTA (rtTA) in the eukaryotic cell simultaneously with the expression of at least the ptRNA; and The method, wherein expression of the ptRNA-ribozyme comprises contacting a eukaryotic cell with doxycycline or a functional analog thereof, thereby inducing transcriptional synthesis of the ptRNA-ribozyme.

26. The method according to any one of claims 14 to 25, (i) transcription of the pRS coding sequence is controlled by a tetracycline-responsive promoter element (TRE), or (ii) transcription of the pRS coding sequence is catalyzed by an RNA polymerase, the expression of which is controlled by a TRE; The method further comprises expressing a reverse tTA (rtTA) in the eukaryotic cell simultaneously with the expression of at least pRS; and The method, wherein expression of pRS comprises contacting a eukaryotic cell with doxycycline or a functional analog thereof, thereby inducing transcription of the pRS coding sequence.

27. 1. A kit for preparing a polypeptide of interest (POI) having one or more non-canonical amino acid (ncAA) residues in its amino acid sequence, comprising: The kit includes one or more ncAAs or salts thereof corresponding to one or more ncAA residues of a POI; (a) a polynucleotide according to claim 11 or 12, or (b) a polynucleotide according to claim 13, or a combination of two or more polynucleotides; (c) a polynucleotide encoding a dsRNA-binding polypeptide, in combination with each other; or The kit comprises one or more ncAAs or salts thereof corresponding to one or more ncAA residues of a POI; and (d) a eukaryotic cell according to any one of claims 1 to 10.

Images