Recombinant foot-and-mouth disease type A virus that induces a potent adaptive immune response and overcomes interference from maternal antibodies, and foot-and-mouth disease vaccine composition containing the same
The recombinant FMD virus with the C3d gene insertion addresses maternal antibody interference, enhancing immune responses and providing effective cross-protection across serotypes.
Patent Information
- Application Number
- JP2024529412
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-11-17
- Filing Date
- 2022-11-11
- Publication Date
- 2025-10-22
- Estimated Expiration
- 2042-11-11
AI Technical Summary
Current FMD vaccines face limitations due to interference from maternal antibodies, which inhibit the formation of active immunity in young animals, and lack cross-protection across different serotypes.
A recombinant FMD virus is developed by inserting the C3d gene as a B cell epitope into the FMD vaccine strain to directly stimulate B cell receptors, overcoming maternal antibody interference and inducing both cellular and humoral immune responses.
The recombinant FMD vaccine composition induces a strong immune response despite maternal antibodies, enabling active immunity and cross-protection against multiple serotypes.
Smart Images

Figure 0007757599000002 
Figure 0007757599000003 
Figure 0007757599000004
Abstract
Description
[Technical Field]
[0001] The present invention relates to an immune-enhancing recombinant FMD virus in which the C3d gene (B cell epitope) has been inserted into the FMD type A vaccine strain in order to overcome interference from maternal antibodies by inducing a strong adaptive (cellular and humoral) immune response, a method for isolating and purifying an inactivated FMD virus antigen with increased immunogenicity, and its use as a FMD vaccine composition for overcoming interference from maternally derived antibodies (MDA). [Background technology]
[0002] Foot-and-mouth disease (FMD) vaccines require regular, repeated vaccination of both cattle and pigs. Such vaccination transfers maternal antibodies to calves or piglets via the placenta or colostrum, forming passive immunity. Maternal antibodies provide host protection during initial FMD virus infection in calves and piglets. However, their duration is short, and early administration of FMD vaccines to young animals can cause passive interference (interference by inhibiting antigen-specific antibody production from plasma cells and memory B cells, leading to immunological tolerance mechanisms), thereby inhibiting vaccine efficacy and inhibiting active immunity. Currently, FMD vaccination programs recommend vaccinating calves and piglets after the age of two months, at which point maternal antibody levels begin to decline.
[0003] Since the level, titer, and half-life of maternal antibodies vary among individuals, it is difficult to determine the appropriate timing for FMD vaccination in the field. Furthermore, current commercially available FMD vaccines generally have a limitation in that they are difficult to overcome interference from maternal antibodies, which inhibits the formation of active immunity through vaccination.
[0004] Meanwhile, foot-and-mouth disease virus (FMDV) belongs to the genus Aphthovirus (family Picornaviridae) and is classified into seven serotypes: O, A, C, Asia1, SAT1, SAT2, and SAT3. Viruses sharing at least 85% nucleotide identity in the FMDV genome region corresponding to the VP1 protein form a single serotype. These serotypes are generally geographically restricted and classified into topotypes. FMDV exhibits high genetic and antigenic variation, so antibodies induced by one serotype cannot neutralize other serotypes, resulting in no cross-protection during vaccination. Despite this, vaccination is widely used to prevent and control the disease in countries where FMD is endemic.
[0005] B cell activation pathways can be broadly divided into three: 1) T cell-dependent pathway, 2) T cell-independent type I pathway, and 3) T cell-independent type II pathway. Among these, the T cell-dependent pathway is a typical pathway in which B cells are activated via TCR / MHC, CD40L / CD40, etc., while the T cell-independent type I pathway is known to occur rarely in the host, in which PAMPs (pathogen-associated molecular patterns) stimulate pattern-recognition receptors (PRRs) to directly activate B cells. Finally, the T cell-independent type II pathway is a pathway in which B cells are activated by antigens or B cell epitopes such as C3d stimulating B cell receptors such as CD21, CD19, and CD81. When maternal maternal antibodies are present in the host, In such cases, immune tolerance and tolerance mechanisms make it difficult to present antigens to T cells, induce cellular immune responses, and activate B cells via T cell-dependent pathways. Therefore, B cells must be directly activated via a T cell-independent pathway, or T cells must be continuously stimulated by inducing a strong cellular immune response.
[0006] Therefore, in the present invention, in order to overcome the interference of maternal antibodies, which has been pointed out as a major limitation of currently available FMD vaccines, we selected the active site of C3d as a candidate substance to overcome the interference of maternal antibodies by stimulating receptors on the surface of B cells via the B cell epitope C3d. We then inserted this into the O PA2 P1 backbone (VP1 region) to develop a FMDV type O FMD vaccine strain for overcoming maternal antibody interference, an immune-enhancing antigen isolated and purified from it, and a FMD vaccine composition for overcoming maternal antibody interference containing the same. [Prior art documents] [Patent documents]
[0007] [Patent Document 1] Korean Patent Registration No. 10-2234754 [Non-patent literature]
[0008] [Non-Patent Document 1] Lee, SY et al. Rapid engineering of foot-and-mouth disease vaccine and challenge viruses. J. Virol. 91, e00155-00117 (2017) [Non-patent document 2] Lee, MJ et al. Advanced foot-and-mouth disease vaccine platform for stimulation of simultaneous cellular and humoral immune responses. Vaccines (Basel) 8, 254 (2020) Summary of the Invention [Problem to be solved by the invention]
[0009] Against the background described above, the present invention aims to overcome the interference of maternal antibodies, which is a limitation of currently available FMD vaccines, by directly stimulating receptors on the surface of B cells via the B cell epitope C3d.
[0010] Therefore, the object of the present invention is to provide an immune-enhancing recombinant FMD virus in which the C3d gene (B cell epitope) has been inserted into the FMD type A vaccine strain in order to overcome the difficulty in inducing FMD vaccine-mediated immune responses due to interference from maternal antibodies, which has been identified as a limitation of currently commercially available FMD vaccines, a FMD vaccine composition containing antigens isolated and purified from the virus, and a method for producing the recombinant FMD virus. [Means for solving the problem]
[0011] To achieve the above object, the present invention provides a FMD vaccine composition comprising a recombinant FMD virus and an antigen isolated and purified from the recombinant FMD virus.
[0012] The present invention also provides a method for producing the recombinant foot-and-mouth disease virus, and a method for separating and purifying an antigen from the recombinant foot-and-mouth disease virus.
[0013] The recombinant FMD virus according to the present invention can be produced using a recombinant plasmid into which a gene of FMD virus is inserted, and the recombinant FMD virus can be, but is not limited to, FMD virus type O or type A.
[0014] The FMD type O recombinant virus can be produced via the recombinant plasmid of SEQ ID NO:8, and the FMD type A recombinant virus can be produced via the recombinant plasmid of SEQ ID NO:11.
[0015] To prepare the recombinant foot-and-mouth disease virus, the active site of C3d (13a.a) was selected as a candidate substance to be inserted into the backbone, and the active site of C3d has sequence number 4 (the base sequence encoding this is sequence number 5).
[0016] This was inserted into the PA2 or A22 P1 backbone (VP1 site) of FMDV We provide a composition for a foot-and-mouth disease vaccine that overcomes interference from maternal antibodies such as O PA2-C3d (O type) and A22-C3d (FMDV type A).
[0017] Also provided are an immune enhancing antigen isolated and purified from the antigen, and a foot-and-mouth disease vaccine composition containing the antigen for overcoming maternal antibody interference.
[0018] The present invention also provides a method for preventing or treating foot-and-mouth disease using a vaccine composition containing the recombinant foot-and-mouth disease virus or an antigen isolated and purified from the recombinant foot-and-mouth disease virus.
[0019] The present invention also provides a diagnostic kit for FMD or a diagnostic kit composition for FMD, which contains the recombinant FMD virus or the recombinant FMD virus antigen.
[0020] The present invention also provides a method for diagnosing foot-and-mouth disease using the foot-and-mouth disease diagnostic kit or the foot-and-mouth disease diagnostic kit composition.
[0021] The recombinant foot-and-mouth disease virus of the present invention is based on type O or type A.
[0022] The O type can be, but is not limited to, O1-Manisa in one embodiment of the present invention.
[0023] In one embodiment of the present invention, type A may be, but is not limited to, subtype A22, preferably A22 / Iraq / 24 / 64.
[0024] In the present invention, the term "plasmid" refers to a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in a suitable host. Once transformed into a suitable host, the plasmid can replicate and function independently of the host genome, or in some cases, can be integrated into the genome itself. Because the plasmid is currently the most commonly used form of vector, in the present specification, the terms "plasmid" and "vector" are sometimes used interchangeably.
[0025] For the purposes of the present invention, it is preferable to use a plasmid vector. Typical plasmid vectors that can be used for this purpose have a structure that includes (a) an origin of replication that allows efficient replication to occur so that hundreds of plasmid vectors are contained per host cell, (b) a selection marker that allows host cells transformed with the plasmid vector to be selected, and (c) a restriction enzyme cleavage site into which a foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site is not available, the vector and foreign DNA can be easily ligated using synthetic oligonucleotide adaptors or linkers, etc., as conventionally used.
[0026] The recombinant vector and recombinant FMD virus of the present invention can be produced by conventional genetic engineering and transformation methods, and an appropriate amount of virus can be obtained by serial passage through cell culture of the virus produced in small amounts.
[0027] The cells may be derived from one or more cells selected from the group consisting of cells from Canidae, Feline, Suidae, Bovidae, Cervidae, Giraffidae, Peccaryidae, Camelidae, Hippopotamus, Equine, Tapiridae, Rhinoceros, Mustelidae, Leporidae, Rodents, and Primates, and preferably, one or more cells selected from the group consisting of goat tongue cells (ZZ-R), hamster kidney cells (BHK-21), black goat kidney cells (BGK), porcine kidney cells (IBRS-2), and bovine kidney cells (LFBK) can be used.
[0028] The foot-and-mouth disease vaccine composition of the present invention contains, as an active ingredient, the recombinant foot-and-mouth disease virus of the present invention or an antigen isolated and purified from the recombinant virus.
[0029] The recombinant FMD virus contained in the FMD vaccine composition, FMD diagnostic kit, and FMD diagnostic kit composition of the present invention may be recombinant FMD virus type O, type A, or a combination thereof.
[0030] Furthermore, the antigens isolated and purified from the recombinant FMD virus contained in the FMD vaccine composition, FMD diagnostic kit, and FMD diagnostic kit composition of the present invention may include those derived from recombinant FMD virus type O, type A, or a combination thereof.
[0031] The vaccine comprising the vaccine composition can be a live vaccine, an attenuated vaccine, or an inactivated vaccine.
[0032] The vaccine composition containing the recombinant foot-and-mouth disease virus or an antigen isolated and purified from the recombinant virus can be administered at a dose of 1 / 640 to 1 / 10, preferably 1 / 40 to 1 / 10.
[0033] The vaccine composition can be administered to ungulates, such as pigs, sheep, goats, deer and wild ruminants, excluding humans.
[0034] In addition, the vaccine composition may further comprise a diluent or excipient such as a carrier, a filler, an extender, a binder, a wetting agent, a disintegrant, a surfactant, or the like that is generally accepted in the art.
[0035] The vaccine composition can be administered (or injected) to an individual in various ways, including subcutaneous injection, intramuscular injection, intraperitoneal injection, nasal administration, oral administration, transdermal administration, and oral administration. [Effects of the Invention]
[0036] The present invention relates to a FMD vaccine composition containing a recombinant FMD virus and an antigen isolated and purified from the virus, and provides a vaccine composition that induces a strong cellular immune response at the early stage of vaccination, while simultaneously inducing a humoral immune response, and that overcomes MDA interference and enables active immunity by stimulating B cell receptors in the presence of MDA. [Brief explanation of the drawings]
[0037] [Figure 1a] Schematic diagram of the gene of the recombinant immune-enhanced foot-and-mouth disease type O virus according to the present invention. [Figure 1b] Schematic diagram of the gene of the recombinant immune-enhanced foot-and-mouth disease type A virus according to the present invention. [Figure 2a] O. Diagram showing the immunogenicity evaluation strategy and results of antigens isolated and purified from PA2 and A22. [Figure 2b] O. Diagram showing the immunogenicity evaluation strategy and results of antigens isolated and purified from PA2 and A22. [Figure 3] FIG. 8 shows the immunogenicity evaluation strategy and results when antigens isolated and purified from PA2 and A22 were administered in combination. [Figure 4a] FIG. 1 shows the experimental strategy (A), survival rate (B) and weight change (C) of the recombinant foot-and-mouth disease type O virus according to the present invention. [Figure 4b] FIG. 1 shows the experimental strategy (D), survival rate (E), and weight change (F) of the recombinant foot-and-mouth disease type A virus according to the present invention. [Figure 5] FIG. 1 shows the results of inoculating mice with a vaccine containing antigens isolated and purified from the recombinant immune-enhancing foot-and-mouth disease type O and type A viruses according to the present invention, and evaluating the induction of immune responses. [Figure 6a] FIG. 1 shows a vaccination strategy for pigs containing antigens isolated and purified from recombinant immune-enhanced foot-and-mouth disease type O and type A viruses according to the present invention. [Figure 6b] This figure shows the results of evaluating early, mid-term, and long-term immunity (induction of antibodies by SP O, A ELISA) following vaccination of pigs with a vaccine containing antigens isolated and purified from recombinant immune-enhanced foot-and-mouth disease type O and type A viruses according to the present invention. [Figure 7] FIG. 1 shows the results of evaluating early, mid and long-term immunity (induction of neutralizing antibodies) in pigs after inoculation with a vaccine containing antigens isolated and purified from the recombinant immune-enhanced foot-and-mouth disease type O and type A viruses according to the present invention. [Figure 8a] FIG. 1 shows the results of evaluating the expression of cellular immune response genes (cytokines, costimulatory molecules, etc.) following vaccination of pigs with a vaccine containing antigens isolated and purified from the recombinant immune-enhancing foot-and-mouth disease type O and type A viruses according to the present invention. [Figure 8b] FIG. 1 shows the results of evaluating the expression of cellular immune response genes (cytokines, costimulatory molecules, etc.) following vaccination of pigs with a vaccine containing antigens isolated and purified from the recombinant immune-enhancing foot-and-mouth disease type O and type A viruses according to the present invention. [Figure 8c] FIG. 1 shows the results of evaluating the expression of cellular immune response genes (cytokines, costimulatory molecules, etc.) following vaccination of pigs with a vaccine containing antigens isolated and purified from the recombinant immune-enhancing foot-and-mouth disease type O and type A viruses according to the present invention. [Figure 8d] This figure shows the results of evaluating the induction of humoral immune responses (immunoglobulin subtypes such as IgG, IgM, and IgA) in pigs mediated by inoculation with a vaccine containing antigens isolated and purified from the recombinant immune-enhancing recombinant foot-and-mouth disease type O and type A viruses of the present invention. [Figure 8e]FIG. 1 shows the results of cellular immune responses induced in murine peritoneal exudate cells (PECs) and porcine peripheral blood mononuclear cells (PBMCs) by treatment with antigens isolated and purified from the immune-enhancing recombinant foot-and-mouth disease type O and type A viruses according to the present invention. [Figure 9] FIG. 1 shows the results of measuring the amount of antigen using a simple kit containing an antigen isolated and purified from a recombinant foot-and-mouth disease virus according to the present invention and of differentiating it from a field strain. [Figure 10] FIG. 1 shows the results of electron microscope (TEM) observation of the antigen (146s particle) purified using the recombinant foot-and-mouth disease virus according to the present invention. [Figure 11] Figure 1 shows the VP1 sequences of O PA2-C3d and A22-C3d of the present invention. The VP1 sequences of O PA2-C3d and A22-C3d at the first (Sus. 1) and fourth (Sus. 4) suspension cell (BHK) passages were aligned using SnapGene; (a) O PA-C3d nucleotide sequence, (b) A22-C3d nucleotide sequence, (c) O PA2-C3d amino acid sequence, (d) A22-C3d amino acid sequence. DETAILED DESCRIPTION OF THE INVENTION
[0038] The present invention will be described in detail below with reference to examples and experimental examples.
[0039] However, the following examples and experimental examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples and experimental examples.
[0040] Materials and Methods 1. Recombinant Plasmid Production The recombinant plasmid was prepared as described by Lee et al. (Lee, SY et al. Rapid engineering of foot-and-mouth disease vaccine and challenge viruses. J. Virol. 91, e00155-00117 (2017).) The entire FMD-O1-Manisa virus genome (GenBank Accession No. AY593823.1) was amplified by PCR.
[0041] (1) Construction of recombinant plasmid for producing recombinant FMD type O virus The amplified O1-Manisa genome (SEQ ID NO: 1) was inserted into a plasmid (pBluescript SK II) to prepare the pO1-Manisa (pO1 M) plasmid. The gene encoding the P1 structural protein in the prepared pO1 M was replaced with the gene encoding the structural protein of O-serotype FMDV O PA2 (SEQ ID NO: 2) (GenBank Accession No. GU384682.1) to prepare pO1 MO. The PA2 P1 (SEQ ID NO: 3) plasmid was prepared.
[0042] Using the plasmid (pO1 MO PA2 P1) constructed as described above, a B cell epitope sequence (C3d sequence (GGTAAGCAGCTCTACAACGTGGAGGCCACATCCTATGCC, SEQ ID NO: 4) corresponding to the amino acid residue sequence (GKQLYNVEATSYA, SEQ ID NO: 5)) was inserted between the 456th and 457th base pair positions (152nd and 153rd amino acid positions, i.e., 2025th and 2026th bases of the pO1 MO PA2 P1 sequence) of the VP1 sequence [PA2-C3d: 300 ng / μL pO1 M-A22 P1 as a PCR template, 1 μL of 10 pmole / μL primer C3d F (5'-GGAGGCCACATCCTATGCCCGCGAGAGGCCCTAGGTCGC-3', SEQ ID NO: 6), 1 μL of 10 pmole / μL primer C3d R(5')1µL-ACGTTGTAGAGCTGCTTACCGCGAGGGTCGCCGCTCAGCT-3' (SEQ ID NO: 7) was used to prepare the target plasmid using the same self-ligating method as used in previous studies. The final recombinant plasmid is shown in SEQ ID NO: 8.
[0043] (2) Construction of recombinant plasmids for producing recombinant FMD type A viruses The amplified O1-Manisa genome (SEQ ID NO: 1) was inserted into a plasmid (pBluescript SK II) to prepare the pO-Manisa (pO1 M) plasmid. The genes encoding the structural proteins in the prepared pO1 M were replaced with the genes encoding the structural proteins of serotype A FMDV A22 / Iraq / 24 / 64 (GenBank Accession No. AY593764.1) (SEQ ID NO: 9). The M-A22 P1 plasmid (SEQ ID NO: 10) was prepared.
[0044] Using the plasmid (O1 M-A22 P1) constructed as described above, the B cell epitope sequence (C3d sequence (GGTAAGCAGCTCTACAACGTGGAGGCCACATCCTATGCC, SEQ ID NO: 4) corresponding to the amino acid residue sequence (GKQLYNVEATSYA, SEQ ID NO: 5)) was inserted between the 453 and 454 base pair positions (151 and 152 amino acid positions, i.e., 2025 and 2026 bases of the pO1 MO PA2 P1 sequence) of the VP1 sequence [PA2-C3d: 153 and 154 base pair positions (151 and 152 amino acid positions, i.e., 2025 and 2026 bases of the pO1 MO PA2 P1 sequence)]. Then, O1 was used as a PCR template. M-A22 P1 300 ng / μL, primer Cd3 F (5'-GGAGGCCACATCCTATGCCCGCGAGAGGCCCTAGGTCGC-3', SEQ ID NO: 6) 1 μL at 10 pmole / μL, and primer C3d R (5'-ACGTTGTAGAGCTGCTTACCGCGAGGGTCGCCGCTCAGCT-3', SEQ ID NO: 7) 1 μL at 10 pmole / μL were used to prepare the target plasmid by the same self-ligating method used in previous studies. The final recombinant plasmid produced is shown in SEQ ID NO:11.
[0045] Figures 1a and 1b show schematic diagrams of the final plasmids for OPA2-C3d and A22-C3d, respectively.
[0046] PCR conditions were as follows: 10 μL of 5x Phusion HF buffer (Thermo Scientific, Waltham, MA, USA), 1 μL of 10 mM dNTPs (Invitrogen, Carlsbad, CA, USA), 1 μL of 2 U / μL Phusion DNA polymerase (Thermo Scientific), and 35 μL of sterile distilled water were used for amplification at 98°C for 30 seconds, 98°C for 10 seconds, 65°C for 20 seconds, and 72°C for 2 minutes and 30 seconds, with a final cycle of 72°C for 10 minutes. Next, 1 μL of DpnI (Enzynomics, Daejeon, Korea) was added to the 25 μL PCR product, and the reaction was incubated at 37°C for 1 hour. Then, 35 μL of sterile distilled water, 5 μL of Ligation High (Toyobo, Osaka, Japan), and 1 μL of 5 U / μL T4 polynucleotide kinase (Toyobo, Osaka, Japan) were added to 4 μL of the DpnI-treated product, and the mixture was allowed to ligate in a water bath at 16°C for 1 hour.
[0047] After ligation, the plasmid was transformed into 100 μL of DH5α cells (Yeast Biotech, Taipei, Taiwan) according to the manufacturer's protocol. The transformed cells were spread onto ampicillin-containing agar plates and grown overnight at 37°C.
[0048] Colonies were selected from the plate with a pipette tip and mixed with 18 μL of sterile distilled water, 1 μL of 10 pmol of forward universal primer VP1 (5'-AGNGCNGGNAARTTTGA-3') (SEQ ID NO: 12), and 1 μL of 10 pmol / μL reverse universal primer. Primer VP1 (5'-CATGTCNTCCATCTGGTT-3') (SEQ ID NO: 13) was added to a colony PCR tube, and PCR amplification was performed for a total of 25 cycles: 94°C for 5 minutes, 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 1 minute, and a final cycle of 72°C for 5 minutes. In the universal primer, N can represent any nucleotide. Five μL of the PCR sample was mixed with 1 μL of 6x loading buffer (DYNE BIO, Gyeonggi-do, Korea) and loaded onto an agarose gel. 5 μL of a 100 bp marker (DYNE BIO) was also loaded onto the gel. After electrophoresis at 100V for 30 minutes, the bands were evaluated using GelDoc. After band evaluation, 5 μL of the PCR product was mixed with 2 μL of ExoSAP (Thermo Scientific) and amplified by PCR at 37°C for 15 minutes and 85°C for 15 minutes. The insertion of the epitope into VP1 was confirmed by total DNA sequencing. After confirming the base sequence, colonies were placed in 200 mL of LB medium containing ampicillin and cultured overnight at 37°C with shaking. Plasmids were prepared using Midi prep (MACHEREYNAGEL, Düren, Germany).
[0049] 2. Preparation of Immuno-enhancing Recombinant Foot-and-mouth Disease Virus The recombinant FMD virus was prepared by transfecting BHKT7-9 (a cell line expressing T7 RNA polymerase) with the recombinant plasmid prepared above using Lipofectamine 3000 Reagent (Invitrogen, Carlsbad, CA, USA) and culturing the cells for 2–3 days before harvesting. The prepared virus was then passaged in fetal goat tongue (ZZ-R) cells or baby hamster kidney-21 (BHK-21) cells for viral propagation.
[0050] 3. Purification of antigens (inactivated viruses) from recombinant foot-and-mouth disease type O and type A viruses displaying C3d epitopes on their surface Purified antigens were produced from BHK-21 cells infected with recombinant immunostimulatory FMDV O PA2-C3d and A22-C3d, which were engineered by reverse genetics to counter the rapid phenotype of P1 (referenced sequences), according to a modified method described by Lee et al. (2003).
[0051] For viral infection, the culture medium was replaced with serum-free Dulbecco's Modified Eagle's Medium (DMEM; HyClone, Logan, UT, USA), and the cells were incubated at 37°C with 5% CO2 for 1 hour to inoculate the virus. Extracellular virus was then removed. 24 hours after infection, the virus was inactivated by two treatments with 0.003 N binary ethyleneimine for 24 hours in a shaking incubator, followed by concentration with polyethylene glycol (PEG) 6000 (Sigma-Aldrich, St. Louis, MO, USA). The virus concentrate was layered on a 15%-45% sucrose density gradient and centrifuged. After ultracentrifugation, 1 mL fractions were collected by puncturing the bottom of the centrifuge tube. The presence of FMDV particles in each fraction sample was confirmed by optical density analysis using a lateral flow device (BioSign FMDV Ag; Princeton BioMeditech, Princeton, NJ, USA). Before use in field experiments, the supernatants were confirmed to be free of viable virus by passing the pre-PEG-treated supernatants through ZZ-R and BHK-21 cells at least twice and checking for the occurrence of cytopathic effect (CPE).
[0052] 4. Confirmation of structural and nonstructural proteins using purified antigens and examination of 146S particles using TEM The structural proteins (SPs) of purified antigens expressed in cells infected with the immunopotentiated recombinant FMDV O PA2-C3d and A22-C3d were confirmed using a Rapid Antigen Kit (PBM Kit, PBM Co., Ltd., Princeton, NJ, USA), which showed banding for the SPs. No banding for the FMDV nonstructural proteins (NSPs) was observed. The viral particles (146S) were characterized by transmission electron microscopy (TEM). Furthermore, because sequence changes frequently occur during recombinant virus passage, we confirmed that the sequence did not change during the first and fourth passages by confirming whether the FMDV containing specific epitopes from C3d maintained its genetic stability after passage in cells. Finally, we confirmed that no sequence changes were observed up to the fourth passage (Figure 11).
[0053] 5. Evaluation of immunogenicity in experimental animals (mice) of immune-boosting FMD vaccine strains, O PA2-C3d and A22-C3d, to overcome maternal antibody interference (1) Mice Mouse experiments were performed according to the method described by Lee et al. (Non-Patent Document 2). Age- and sex-matched wild-type C57BL / 6 mice (6-7 week-old females) were purchased from KOSA BIO Inc. (Gyeonggi, Korea). All mice were housed in microisolator cages with free access to food and water in the specific pathogen-free (SPF) biosafety level 3 (ABSL3) animal facility of the Animal and Plant Quarantine Agency. All animals were allowed to acclimate for at least 1 week before use in experiments. The animal room was set to a 12-hour light / dark cycle, a temperature of approximately 22°C, and a relative humidity of approximately 50%. The study was performed in accordance with institutional guidelines and approved by the Animal Experiment Ethics Committee of the Animal and Plant Quarantine Agency (Certification No. IACUC-2021-584).
[0054] (2) Vaccination and FMDV administration to mice To verify the immunogenicity and short-term immune induction effect of antigens isolated and purified from highly immunogenic FMDV O PA2-C3d and A22-C3d, and to confirm their potential as master seed viruses (MSVs) for the development of foot-and-mouth disease vaccines, To this end, animal experiments were carried out as follows.
[0055] The composition of the vaccine used in the experiment was as follows: O PA2-C3d and A22-C3d (15 μg / dose / mL, 1 / 10 to 1 / 640 dose for pigs), ISA 206 (Seppic, Paris, France, 50%, w / w), 10% Al(OH)3, and 15 μg / mouse Quil-A (InvivoGen, San Diego, CA, USA). Mice were intramuscularly (IM) injected (day 0 post-vaccination (dpv)) into the thigh muscle with 100 LD of FMDV (O / VET / 2013). 50 ME-SA topotype or 100 LD 50 Mice were administered intraperitoneally (IP) at 7 days post-injection (dpc) with the IgG antibody (A / Malay / 97, SEA topotype). Mice in the negative control group received an equal volume of phosphate-buffered saline (PBS, pH 7.0) via the same route. To assess short-term immunogenicity, survival and weight change were monitored for up to 7 days post-injection (dpc).
[0056] As a preliminary experiment for experiments in target animals (pigs), PD was conducted to confirm the immunogenicity of a bivalent test vaccine containing O PA2-C3d antigen + A22-C3d antigen. 50 O was tested and used as the backbone of an immune-boosting vaccine strain. Test vaccine groups containing PA2 and A22 antigens were compared together. The vaccine compositions used in the experiment were as follows: PA2-C3d and A22-C3d antigens (15 μg + 15 μg / dose / ml, 1 / 10 to 1 / 640 dose) or PA2 and A22 antigens (15 μg + 15 μg / dose / ml, 1 / 10 to 1 / 640 dose), ISA 206 (50%, w / w), 10% Al(OH)3, and 15 μg Quil-A per mouse. The negative control group received the same volume of PBS via the same route.
[0057] Mice were vaccinated IM at 0 dpv and then vaccinated with FMDV (100 LD 50 , O / VET / 2013, ME-SA topotype or 100 LD 50 Mice were intraperitoneally administered with the IgG antibody (A / Malay / 97, SEA topotype), and survival rates and changes in body weight were monitored up to 7 days post-challenge (dpc).
[0058] 6. Evaluation of immunogenicity in target animals (pigs) of the immune-boosting FMD vaccine strains O PA2-C3d and A22-C3d to overcome maternal antibody interference (1) Pig Pigs (8-9 weeks old, total n = 32) were tested for antibody titers (PI value: 50% standard) and VN titers (1.6 Log) via SP O ELISA and SP A ELISA. 10 Patients were screened according to the criteria and divided into MDA(+) and MDA(-) groups (n=16 per group).
[0059] The pigs in each group, corresponding to the MDA(+) and MDA(-) groups, were randomly divided into three groups (n = 4 or 6 / group): NC (negative control group), O PA2 + A22 (positive control group, PC) treatment, and O PA2-C3d + A22-C3d treatment group.
[0060] Animals were isolated in a closed isolation room (ABSL3) during the experimental period. After arriving at the ABSL, all animals were kept in cages with free access to food and water (ad libitum) and allowed at least one week of adaptation before being used in experiments. The animal room was set to a 12-hour light-dark cycle, a temperature of approximately 22°C, and a relative humidity of approximately 50%. This study was conducted in accordance with the institutional guidelines approved by the Animal Experiment Ethics Committee of the Agriculture, Forestry and Fisheries Quarantine Agency (certification number IACUC-2021-584).
[0061] (2) Induction of immune responses by vaccination and sampling Immuno-enhanced FMD antibody produced to overcome maternal antibody interference in pigs as target animals To evaluate the immunogenicity of antigens isolated and purified from the vaccine strains O PA2-C3d and A22-C3d and to observe their effects on inducing adaptive immune responses and overcoming maternal antibody interference, experiments were conducted using maternal antibody-positive (MDA(+), FMD-seropositive) and -negative (MDA(-), FMD-seronegative) field pigs. The vaccine composition was as follows: 1 ml of vaccine was prepared as one dose, containing 15 μg of O PA2 antigen + 15 μg of A22 antigen (positive control group, PC group) or 15 μg of O PA2-C3d antigen + 15 μg of A22-C3d antigen (experimental group), ISA 206 (50%, w / w), 10% Al(OH)3, and 150 μg of Quil-A. The negative control group (NC group) received the same volume of PBS via the same route.
[0062] Eight- to nine-week-old pigs, maternal antibody-positive and -negative, were screened and divided into two groups: the MDA(+) group (n = 16) and the MDA(-) group (n = 16). The MDA(+) and MDA(-) groups were each divided into three groups: the NC group (PBS-treated group, n = 4 / group), the PC group (O PA2 + A22-treated group, n = 6 / group), and the experimental group (O PA2-C3d + A22-C3d-treated group, n = 6 / group). Vaccinated pigs were administered 1 mL of vaccine via the intramuscular route twice, 28 days apart (0 dpv and 28 dpv). Blood samples from the vaccinated pigs were collected at 0, 7, 14, 28, 42, 56, 70, and 84 dpv for serological analyses, including SP O, A ELISA, and VN titer confirmation. In the case of SP O, A ELISA, taking into consideration the antibody positivity rate due to the characteristics of the antigen, PrioCHECK for FMDV O type and A type was used. TM The VDPro® kit and the VDPro® kit were used for comparison. Additionally, peripheral blood mononuclear cells (PBMCs) were isolated from blood samples collected during all sampling schedules, and changes in the expression of genes related to the test vaccine-mediated cellular and humoral immune responses were analyzed.
[0063] (3) Serological analysis PrioCHECK to detect SP antibodies in serum TM FMDV type O or FMDV type A (Prionics AG, Switzerland) and VDPro® FMDV type O or FMDV type A (Median Diagnostics, Gangwon-do, Korea) were used. The absorbance of the ELISA plate was converted into a percent inhibition (PI) value. The PI value was calculated using PrioCHECK TM Animals were considered seropositive if they were 50% or more for the FMDV kit or 40% or more for the VDPro® FMDV kit.
[0064] The virus neutralization test (VNT) was performed according to the World Organization for Animal Health (OIE) manual. Serum was heat-inactivated in a water bath at 56°C for 30 minutes. Cell density was adjusted to form a 70% monolayer, and two-fold serial dilutions (1:8 to 1:1024) of serum samples were prepared. The diluted serum samples were then transferred to a 100-TCID tissue culture infective dose (TCID) of 1000 cells / mL. 50 The wells were incubated with 0.5 mL of homologous virus at 37°C for 1 hour. After 1 hour, LF-BK (bovine kidney) cell suspension was added to all wells. After 2–3 days, CPE was assessed to determine the titer. This was determined by infecting 100 TCID of virus. 50 Log of the reciprocal antibody dilution required to neutralize 10 FMDV O / PA2 and FMDV A22 / IRAQ were used for VNT.
[0065] (4)PECs isolation and cell culture Naive mice were anesthetized with CO2 and sacrificed. 2+ / Mg 2+ The peritoneal cavity was lavaged with 5 mL of chilled phenol-free Hank's Balanced Salt Solution (HBSS, Gibco, Waltham, MA, USA) buffer. The peritoneal lavage fluid was centrifuged at 300 × g for 10 min at 4 °C. The pelleted PECs were resuspended and stored in Bio-Ray. d Counting was performed using a TC20 automated cell counter (Bio-Rad). All cells were freshly isolated before use. Cryopreserved cells were not used in any experiments. Purified PECs were then cultured in complete medium composed of Roswell Park Memorial Institute (RPMI) 1640 (Gibco, Carlsbad, CA, USA) supplemented with 10% fetal calf serum (HyClone), 3 mM L-glutamine (Sigma-Aldrich), 10 mM HEPES (Sigma-Aldrich), 100 U / mL penicillin / streptomycin (Sigma-Aldrich), and 0.05 mM 2-β-mercaptoethanol (Sigma-Aldrich). Culture was performed at 37°C and 5% CO2.
[0066] (5)PBMCs isolation and cell culture Porcine PBMCs were isolated from whole blood of pigs vaccinated at the specific time points (n=4 or 6 / group) described above according to the method described by Lee et al. (Non-Patent Document 2). Whole blood (20 mL / animal) was collected independently from BD Vaccutainer heparin tubes (BD, Becton, Dickinson and Company, Franklin Lakes, NJ, USA). PBMCs were isolated using Ficoll-Paque TM PBMCs were isolated using PLUS (GE Healthcare Bio-Sciences Corp., Piscataway, NJ, USA) gradient centrifugation. Residual red blood cells were lysed by treatment with ammonium chloride-potassium (ACK) lysis buffer (Gibco, Carlsbad, CA, USA). PBMCs were then lysed using Ca 2+ and Mg 2+ The cells were suspended in Dulbecco's PBS (Gibco) without PBS and supplemented with 2% fetal bovine serum (FBS) (Gibco), and counted using a volumetric flow cytometer (Miltenyi Biotec, Bergisch Gladbach, Germany). All cells were freshly isolated before use. Cryopreserved cells were not used in any experiments. Purified PBMCs were then resuspended in RPMI 1640 (Gibco) medium supplemented with 10% FBS (HyClone, Logan, UT, USA), 3 mM L-glutamine (Sigma-Aldrich, St. Louis, MO, USA), and 100 U / mL penicillin-streptomycin (Sigma-Aldrich).
[0067] PBMCs 2+ / Mg 2+The cells were suspended in DPBS (Gibco) without PBS and counted using a Bio-Rad TC20 automated cell counter (Bio-Rad). All cells were freshly isolated before use; cryopreserved cells were not used in any experiments. Purified PBMCs were then resuspended in RPMI-1640 (Gibco) medium supplemented with 10% FBS (Gibco), 3 mM L-glutamine (Sigma-Aldrich), 10 mM HEPES (Sigma-Aldrich), and 100 U / mL penicillin-streptomycin (Sigma-Aldrich). Incubation was carried out at 37°C and 5% CO2.
[0068] (6) Analysis of antigen-induced IFNγ ELISpot in vitro against PECs and PBMCs PA2-C3d and A22-C3d antigen-mediated IFNγ secretion was analyzed using commercial ELISpot assay kits (catalog numbers EL485 and EL985 for mice and pigs, R&D Systems, Minneapolis, MN, USA) according to the manufacturer's guidelines. Isolated murine PECs or pig PBMCs (5 × 10 5 Cells (100 cells / well) were cultured in 96-well PVDF-supported microplates containing a monoclonal capture antibody specific for mouse or porcine IFNγ and stimulated with inactivated FMDV antigens (0 PA2, 0 PA2-C3d, A22, A22-C3d) at a final concentration of 4 μg / mL for 18 hours in a humidified incubator at 37°C and 5% CO2. PBS and 5 μg / mL phorbol miltiazole were used as negative and positive controls, respectively. Protease inhibitors (PMA, Sigma-Aldrich) were used. Plates were washed with wash buffer and incubated overnight at 4°C with biotinylated anti-mouse IFNγ antibody (1:119) or anti-pig antibody (1:119), followed by 2 hours of incubation at RT with AP-conjugated streptavidin (1:119). Plates were washed, developed with 5-bromo-4-chloro-3'indolylphosphate p-toluidine salt (BCIP) / nitroblue tetrazolium chloride (NBT), and counted using an ImmunoSpot ELISpot reader (AID iSpot reader system; Autoimmune Diagnostika GmbH, Strassberg, Germany). Results were expressed in spot-forming units (SFU).
[0069] (7) RNA isolation, cDNA synthesis, and quantitative real-time PCR Total RNA was extracted from purified porcine PBMCs using TRIzol Reagent (Invitrogen) and RNeasy Mini Kits (QIAGEN, Valencia, CA, USA). cDNA was prepared by reverse transcription using the GoScript Reverse Transcription System (Promega, Madison, WI, USA) according to the manufacturer's guidelines. The synthesized cDNA was amplified by quantitative real-time PCR (qRT-PCR) on a Bio-Rad iCycler using iQ SYBR Green Supermix (BioRad, Hercules, CA, USA).
[0070] Gene expression levels were normalized to hprt levels and presented as relative ratios compared to the control group. The primers used in this study are listed in Table 1.
[0071] qRT-PCR primer sequence table [Table 1]
[0072] 7. Statistics All quantitative data were expressed as mean ± standard error of the mean (SEM) unless otherwise specified. Statistical significance between groups was assessed using two-way ANOVA followed by Tukey's post-hoc test or one-way ANOVA followed by Tukey's post-hoc test. *p<0.05; **p<0.01; ***p<0.001; and ****p<0.0001. Parametric tests were used to compare different groups. Survival curves were generated using the Kaplan-Meier method, and differences were analyzed using the log-rank sum test. GraphPad Prism 9.1.2 (GraphPad, San Diego, CA, USA) software and IBM SPSS software (IBM Corp., Armonk, NY, USA) were used for all statistical analyses.
[0073] <Example> Construction of an immune-enhancing foot-and-mouth disease vaccine strain to overcome maternal antibody interference, production and purification of inactivated antigens using O PA2-C3d and A22-C3d To develop a FMD vaccine strain that overcomes maternal antibody interference, reverse genetics The P1 backbones of the O1 Manisa-O PA2 (O1 MO PA2) and O1 Manisa-A22 / Iraq / 24 / 64 (O1 M-A22) strains, which had already been developed using a genetics program, were used. For type O, O PA2 was determined to be the most potent candidate vaccine strain based on the vaccine matching rate in the surrounding outbreak conditions, the virus's growth in suspension cells, and, in particular, the antigen-mediated immunogenicity in experimental animals (mice) and target animals (pigs). For type A, A22 was also classified as a suitable vaccine strain, despite its generally low matching rate based on the global outbreak conditions.
[0074] In the present invention, the active site of C3d, a B cell epitope, was inserted into the O PA2 and A22 P1 backbones to construct foot-and-mouth disease vaccine strains for overcoming maternal antibody interference in FMDV types O and A, as shown in Figures 1a and 1b. The detailed method is described in the Materials and Methods section.
[0075] <Experimental Example 1> Evaluation of immunogenicity in mice of FMD vaccine containing immune-enhancing foot-and-mouth disease vaccine strains, O PA2-C3d and A22-C3d antigens, to overcome maternal antibody interference To evaluate the immunogenicity of O PA2-C3d and A22-C3d, which contain the B cell epitope C3d for B cell activation, and the potential of isolated and purified antigens from O PA2 and A22 as master seed viruses (MSVs) for foot-and-mouth disease vaccines, and their protective effects against FMDV infection, O PA2-C3d and A22-C3d were tested using the strategies shown in Figure 4a(A) and Figure 4b(D), respectively. O PA2 and A22 were tested using the strategies shown in Figure 2a(A) and Figure 2b(D). The vaccine composition used in the experiment was as follows: 0 PA2-C3d or A22-C3d antigen, 0 PA2 or A22 antigen (15 μg / dose / mL, 1 / 10 to 1 / 640 dose), ISA206 (50%, w / w), 10% Al(OH)3, and 15 μg Quil-A / mouse.
[0076] Mice were vaccinated 0 days post vaccination (dpv) by intramuscular (IM) injection and then 7 days post vaccination (dpv) with FMDV type O (100 LD 50 , O / VET / 2013, ME-SA topotype) or FMDV type A (100LD 50 , A / Malay / 97, SEA topotype) was intraperitoneally administered to mice, and survival rates ((B) and (C) in Figure 4a) and body weight changes ((E) and (F) in Figure 4b) were monitored up to 7 days after administration (dpc).
[0077] The results of the experiment showed that the test vaccine containing the O PA2-C3d antigen caused 97.01 PD when inoculated into mice. 50 (Log4), and the survival rate was 100% at 1 / 10, 1 / 40, and 1 / 160 doses, and 80% at 1 / 640 dose. The weight loss was also 1 / 10, 1 / 40, and 1 / 640 doses. The vaccine using the antigen isolated and purified from A22-C3d showed a 73.52 PD 50 The survival rate was 100% at 1 / 10, 1 / 40, and 1 / 160 doses, and 60% at 1 / 640 doses (Log4). Almost no weight loss was observed at 1 / 10, 1 / 40, and 1 / 160 doses (Figure 4b (E) and (F)).
[0078] However, the vaccine containing the O PA2 antigen showed a 55.72 PD 50 The change in body weight of O PA2 was reduced to a lower level than that of O PA2-C3d (FIG. 2a (C)).
[0079] The vaccine containing the A22-C3d antigen showed 100% survival rate for the 1 / 10, 1 / 40 and 1 / 160 doses, with a PD of 73.52. 50 (Log4), showing a 60% survival rate for the 1 / 640 dose. There was no change in body weight for the 1 / 10, 1 / 40 and 1 / 160 doses.
[0080] However, the vaccine containing the A22 antigen had a PD of 6.06. 50 The change in body weight of A22 was reduced to a lower level than that of A22-C3d (FIG. 2B(F)).
[0081] A PD50 study was conducted in pigs to confirm the immunogenicity of the bivalent investigational vaccine (containing O PA2-C3d + A22-C3d antigens, a combination of O PA2-C3d and A22-C3d). The results were compared with those of a group administered the investigational vaccine (containing O PA2 + A22 antigens, a combination of O PA2 and A22) used as the backbone for the immune-boosting vaccine strain (Figures 5 and 3).
[0082] In the experimental strategy shown in Figure 5(A) and Figure 3(A), vaccination in mice was administered IM at 0 dpv with 100 LD of FMDV (O / VET / 2013). 50 , ME-SA topotype or A / Malay / 97 100 LD 50 Mice (SEA topotype) were challenged IP on 7 days post-challenge. Survival and weight change were monitored from 0 days post-challenge (0 days post-challenge) to 7 days post-challenge.
[0083] The bivalent vaccine containing O PA2+A22 antigens was effective in preventing PD when mice were challenged with O / VET / 2013 and A / Malay / 97, respectively. 50 The (Log4) values were 5.66 and 4 (Figures 3(B) and 3(D)).
[0084] The bivalent vaccine containing O PA2-C3d + A22-C3d antigens showed PD when administered with O / VET / 2013 and A / Malay / 97, respectively. 50 (Log4) value 90.5 and >128 PD 50 (Log4) and showed high immunogenicity (Fig. 5(B) and Fig. 5(D)).
[0085] <Experimental Example 2> Evaluation of the immune effects (early, mid-term, and long-term) in target animals (pigs) of an FMD vaccine containing immune-enhancing foot-and-mouth disease vaccine strains, OPA2-C3d and A22-C3d antigens, to overcome maternal maternal antibody interference To evaluate the immunogenicity of antigens isolated and purified from the immune-enhancing FMD vaccine strains O PA2-C3d and A22-C3d, which were developed to overcome maternal antibody interference in pigs as the target animals, and to observe their effect on inducing adaptive immune responses and overcoming maternal antibody interference, experiments were conducted using maternally antibody-positive (MDA(+), FMD-seropositive) and -negative (MDA(-), FMD-seronegative) field pigs (Figure 6a).
[0086] As a result, when the test vaccine containing O PA2-C3d + A22-C3d antigens was administered to pigs in the MDA(+) group to confirm the effect of overcoming maternal antibody interference, antibody titers measured by SP O ELISA were significantly increased from 14 days after administration compared to the PC group vaccinated with the test vaccine containing O PA2 + A22 antigens (p<0.001, PrioCheck TM Kit, VDPro® Kit), p<0.05 at 28 dpv (PrioCheck TM kit) and p<0.01 (VDPro (registered trademark) kit) (Figure 6b (A) and (B)). In particular, after boosting with the second test vaccine at 28 dpv, the antibody titer was very high in the experimental group, whereas the NC group showed a tendency for maternal antibodies to continuously decrease. The antibody titers between the two groups at 56, 70, and 84 dpv showed differences at the p<0.0001 or p<0.001 level. Furthermore, in the MDA(+) group, SP A ELISA showed that the antibody titer of the experimental group at 42 dpv was higher than that of the PC group (p<0.001, PrioCheck TM Significant differences between the experimental and NC groups at 56, 70, and 84 dpv were observed at the levels of p<0.5, p<0.0001, p<0.001 (PrioCheck® kit), and p<0.0001 (VDPro® kit), respectively (Figure 6b (C) and (D)).
[0087] On the other hand, to confirm the immunogenicity of the test vaccine containing the O PA2-C3d + A22-C3d antigen in the target animals (pigs) and the induction of early, mid, and long-term immunity, antibody titers by SP O ELISA were measured at 7 dpv (PrioCheck) when the vaccine was administered to the MDA(-) group. TM The antibody titers in the MDA(-) group measured by SP A ELISA for each group were significantly higher than those in the NC group at 7 dpv (PrioCheck kit) and 14 dpv (VDPro® kit) at a level of p<0.05, and remained significant compared to the NC group from 28 dpv to 84 dpv (p<0.0001) (Fig. 6b (E) and (F)). Similar to the results of SP O ELISA, the antibody titers in the MDA(-) group measured by SP A ELISA for each group were significantly higher than those in the NC group at 7 dpv (PrioCheck kit). TMThe experimental group showed significantly higher antibody titers than the NC group at 28-84 dpv (p<0.0001, p<0.001, p<0.01, p<0.05). Furthermore, antibody titers in the experimental group were consistently higher than those in the PC group. Significance between the two groups was observed at 14 and 84 dpv (p<0.01, p<0.05 for the VDPro® kit) (Figure 6b (G) and (H)).
[0088] Before vaccination (0 days after vaccination), the neutralizing antibody titers against O1 Campos, A2001 Argentina, and A24 Cruzeiro in the MDA(+) / MDA(-) groups are shown in Figure 7A. In the MDA(+) group, all were >1.6 Log 10 The MDA(-) group showed levels of <1.2 Log 10 The neutralizing antibody titers were confirmed using homologous viruses to O PA2 and A22, the backbone viruses used as antigens in the PC group (Figures 7(B) and (C)). In the MDA(+) group, antibody titers by SP O and A ELISA were high at 0 dpv, but the neutralizing antibody titers against O PA2 and A22 were low and below the protective level (Figure 7(B)). This is thought to be because the sows of piglets with high maternal antibodies (MDA(+)) were vaccinated with Company B's vaccine, resulting in low antibody titers against heterologous viruses such as O PA2 and A22.
[0089] In the MDA(-) group, neutralizing antibody titers against O PA2 (Figure 7(C)) were significantly higher in the experimental group administered the test vaccine containing the O PA2-C3d + A22-C3d antigen from 7 dpv than in the NC and PC groups (p<0.05), and continued to increase until 14 and 28 dpv (p<0.01, p<0.05). After boosting at 28 dpv, the neutralizing antibody titers increased significantly from 42 to 84 dpv compared to the NC group (p<0.0001, p<0.001, p<0.01, p<0.05). Even after boosting, the experimental group showed higher neutralizing antibody titers than the PC group, but significance between the two groups was not observed until 42 and 84 dpv. (p<0.001, p<0.01).
[0090] The neutralizing antibody titers against A22 in the MDA(+) and MDA(-) groups (Figure 7(D) and (E)) were higher in the experimental group than in the NC and PC groups at 28 dpv (p<0.01), and after boosting, increased to higher levels than in the NC group from 42 to 84 dpv (p<0.0001, p<0.001). The difference between the experimental group and the PC group was significant from 42 to 84 dpv (p<0.0001, p<0.001).
[0091] <Experimental Example 3> Evaluation of induction of cellular immune response in pigs by FMD vaccine containing immune-enhancing foot-and-mouth disease vaccine strains, O PA2-C3d and A22-C3d antigens, to overcome maternal antibody interference As shown in Figure 6a, pigs were vaccinated with the test vaccine containing the O PA2-C3d and A22-C3d antigens. PBMCs were isolated from whole blood at each sampling time point, and changes in the expression of genes related to the induction of cellular immune responses, such as cytokines (IFNα, IFNβ, IFNγ, IL-1β, IL-17A, IL-23p19, IL-23R, IL-2, IL-10, TGFβ, IL-4, and IL-6) and costimulatory molecules (CD40, CD80, CD86, MHC class I, MHC class II, CD21, CD28, CTLA4, ICOS, and AHNAK), were observed via qRT-PCR (Figures 8a-c).
[0092] The results showed that the expression of proinflammatory cytokine genes was significantly elevated overall. In particular, the expression of type I IFNs, IFNα and IFNβ, was significantly elevated in the experimental group compared to the NC group in MDA(+) / MDA(-) mice at 7 dpv (p<0.0001, p<0.001). Meanwhile, the difference between the PC and NC groups was such that IFNα was elevated in the PC group compared to the NC group in both MDA(+) and MDA(-) mice (p<0.01), whereas IFNβ was significantly elevated in the PC group compared to the NC group only in the MDA(+) mice (p<0.01). The expression level of IFNγ was somewhat lower than that of IFNα and IFNβ, but was significantly higher in the experimental group compared to the NC group in both MDA(+) and MDA(-) mice (p<0.05).
[0093] IL-1β expression was significantly higher in the experimental group than in the NC group under MDA(+) / MDA(-) conditions (p<0.0001, p<0.001), with a significant difference (p<0.0001) between the experimental group and the PC group. IL-17A expression was significantly higher in the experimental group than in the NC group under MDA(+) / MDA(-) conditions (p<0.0001, p<0.01), with a significant difference between the PC and NC groups under the MDA(+) condition (p<0.01). IL-23p19 expression was also significantly higher in the experimental group than in the NC group under MDA(+) / MDA(-) conditions (p<0.01, p<0.001), with a significant difference (p<0.05) between the experimental and PC groups under the MDA(-) condition. IL-23R expression, like that of other cytokines, was also very high, with significant differences between the experimental and NC groups in both the MDA(+) and MDA(-) conditions (p<0.05). For IL-4 and IL-6, expression levels were higher in the MDA(+) condition than in the MDA(-) condition, with significance between the experimental and NC groups (p<0.01) and between the PC and NC groups for IL-4 and IL-6 (p<0.01, p<0.01, respectively). In the MDA(-) condition, a significant difference in IL-4 expression was observed between the experimental and NC groups (p<0.05). Meanwhile, expression of the anti-inflammatory cytokine IL-10 was higher in the experimental group than in the NC group in the MDA(+) / MDA(-) conditions (p<0.05). In the case of IL-2 and TGFβ, the expression levels were higher in the experimental group > PC group > NC group, but no significance was observed between the groups.
[0094] The expression levels of costimulatory molecules were generally somewhat lower than those of cytokines, but the expression levels were significantly higher in the experimental group compared to the PC and NC groups. The expression of D21, CD28, CTLA4, and ICOS tended to increase after vaccination in the MDA(-) condition compared to the MDA(+) condition. Comparisons between the experimental and NC groups in the MDA(+) / MDA(-) conditions showed significance (p<0.0001, p<0.001, p<0.01, p<0.05). Significance was observed between the PC and NC groups for the expression of all genes except ICOS (p<0.01, p<0.01). Among these, CD80, CD21, and CD28 showed significantly higher gene expression changes after vaccination. For ICOS, the significance between the experimental and PC groups was p<0.01 in the MDA(+) condition and p<0.0001 in the MDA(-) condition, indicating higher gene expression in the C3d-inserted strain compared to the backbone strain.
[0095] For CD86 and AHNAK, significant differences were observed between the experimental and NC groups under the MDA(-) condition (p<0.0001, p<0.001). In particular, significant differences were observed between the experimental and PC groups (p<0.0001) for CD86. Meanwhile, MHC class I gene expression was reduced under the MDA(-) condition compared to the MDA(+) condition, while no significant differences were observed between the groups for CD40 and MHC class II.
[0096] 3-2. The humoral immune responses mediated by the immune-enhanced FMD virus types O and A (O PA2-C3d and A22-C3d) of the present invention measured in pigs by immunoglobulin subtypes such as IgG, IgM, and IgA are as follows:
[0097] FMD antibody-positive (MDA(+), n = 16) or FMD antibody-negative (MDA(-), n = 16) pigs (8-9 weeks old) were divided into three groups: a negative control group (NC, n = 4 / group), a positive control group (PC, n = 6 / group), and an experimental group (Exp., n = 6 / group).
[0098] The experimental group received a test vaccine containing 15 μg (one dose for cattle and pigs) of the O PA2-C3d + A22-C3d antigen, ISA 206 (oil-based emulsion, 50% w / w), 10% Al(OH)3, and 150 μg Quil-A. The positive control group (PC) received a test vaccine containing 15 μg (one dose for cattle and pigs) of the O PA2 + A22 antigen, ISA 206 (oil-based emulsion, 50% w / w), 10% Al(OH)3, and 150 μg Quil-A. The negative control group (NC) received an equal volume of PBS. Vaccinations were administered twice, 28 days apart. Animals were injected with 1 mL of vaccine (one dose) via a deep intramuscular route in the neck. For serological analysis, blood samples were collected on days 0, 7, 14, 28, 42, 56, 70 and 84 after vaccination of pigs. The experimental results are shown in Figure 8d.
[0099] Figure 8d shows (a) IgG concentration, (b) IgM concentration, and (c) IgA concentration. Data represent the mean ± SEM of triplicate determinations (n = 4 or 6 per group). Statistical analysis was performed using two-way ANOVA followed by Tukey's test. *p < 0.05; **p < 0.01; ***p < 0.001; and ****p < 0.0001.
[0100] Experimental results showed that O PA2-C3d and A22-C3d effectively induced not only SP-specific antibody titers (via SP ELISA) but also SP-nonspecific antibody levels, including IgG (an indicator of neutralizing antibodies), IgM (the first natural antibody induced during pathogen infection or vaccination), and IgA (a core element for inducing mucosal immunity) in MDA(+) / MDA(-) animals. Maternal IgG and IgA can weaken mucosal accessory cell responses during early infancy, and maternal IgG regulatory T cell epitopes induce immune tolerance rather than immunogenicity. Based on the above results, the immune-enhancing recombinant FMD vaccine strains O PA2-C3d and A22-C3d can effectively induce active immunity in the host by overcoming MDA interference-mediated immune tolerance in MDA(+) animals, and also enhance MDA immunity. When vaccinated in DA(-) animals or animals aged 2-3 months (a period when MDA titers are even lower according to current vaccine programs), strong cellular and humoral immune responses can be induced. These results suggest that the C3d spike (insertion of C3d onto the antigen surface) persistently stimulates B cell surface receptors, directly activating B cells, and that the highly immunogenic O PA2-C3d and A22-C3d antigens provide a strong T cell-mediated immune response, generating more efficient high-titer and neutralizing antibodies (Figure 8d).
[0101] These results suggest that O PA2-C3d and A22-C3d are immune-enhancing FMD vaccine strains with excellent antigenicity, which play an important role in short-term immune induction and early host defense. Furthermore, a bivalent vaccine containing O PA2-C3d and A22-C3d antigens is expected to be more effective in overcoming maternal antibody interference by simultaneously inducing strong early cellular and humoral immune responses upon vaccination of target animals.
[0102] <Experimental Example 4> Evaluation of the effect of overcoming maternal antibody interference and simultaneously inducing cellular and humoral immune responses in pigs To evaluate the effectiveness of overcoming maternal antibody interference and simultaneously inducing cellular and humoral immune responses in pigs, experiments were performed using MDA(+)- or MDA(-)- pigs (Fig. 6a). In MDA(+)- pigs, O PA2-C3d + A22-C3d demonstrated a strong effect of overcoming maternal antibody interference, particularly in antibody titers measured by SP O ELISA. In antibody titers measured by SP A ELISA, antibody titers themselves decreased slightly early after vaccination and tended to increase after the booster. This is likely due to the characteristics of the FMDV type A antigen, where the SP site differs from the antigen coated on the SP A ELISA plate, resulting in low detection and affecting the percent inhibition (PI) values. For a more accurate evaluation, further investigation into the ability of VN titers to overcome maternal antibody interference is needed.
[0103] In contrast, in MDA(-)- individuals, O PA2-C3d+A22-C3d induced a strong increase in antibody titers as determined by SP O ELISA and SP A ELISA, and its antibody titer-inducing ability was significantly higher than that of O PA2+A22, which was used as the backbone (Figure 8b).
[0104] Additionally, to confirm the actual virus neutralization effect, VN titers against O1 PA2 and A22 were checked. Because the animal in question had been vaccinated with a vaccine from Company B (the source of the vaccine used is not disclosed to protect the company's interests and prevent conflicts), VN titers against O1 Campos, A2001 Argentina, and A24 Cruzeiro were checked using serum at 0 dpv before vaccination to confirm the presence or absence of maternal antibodies. As a result, VN titers for the MDA(+) and MDA(-) groups were accurately classified as positive and negative, respectively, and these animals were used to vaccinate the respective groups.
[0105] The serum samples collected at each blood collection time from 0 to 84 dpv were used to evaluate VN for PA2 and A22. As a result of checking titers, it was found that because the vaccine strain antigen in the vaccine administered to the sows was different from the antigen in the vaccine administered by the present invention, VN titers against OPA2 and A22 were below the protective level at the early stage (0 dpv) of <1.2 Log regardless of the MDA(+) / MDA(-) group. 10 Furthermore, administration of the O PA2-C3d + A22-C3d bivalent test vaccine resulted in significantly higher VN titers in both maternal transfer antibody positive and negative groups than administration of the O PA2 + A22 bivalent test vaccine (Figure 7).
[0106] Based on the above results, the immune-enhancing FMD vaccine strain developed to overcome maternal antibody interference was O PA2-C3d and A22-C3d are believed to be able to effectively induce active immunity in the host by overcoming interference phenomena such as immune tolerance, even in the presence of maternal antibodies. Furthermore, they are believed to be able to induce a strong humoral immune response when inoculated into target animals (pigs) at 8-12 weeks of age, a time when maternal antibodies are declining according to current vaccination programs. This is believed to be because the C3d spiked on the antigen continuously stimulates B cell surface receptors to directly activate B cells, while the highly immunogenic O PA2-C3d and A22-C3d antigens induce a strong T cell-mediated cellular immune response, enabling more efficient production of high-titer antibodies and neutralizing antibodies.
[0107] To demonstrate this, we examined the cellular immune response mediated by a bivalent test vaccine containing the O PA2-C3d+A22-C3d antigen in MDA(+) / MDA(-) pigs. The positive control group (PC) received the bivalent test vaccine containing the O PA2+A22 antigen, a backbone strain, and the negative control group (NC) received PBS. The test vaccine containing the O PA2-C3d+A22-C3d antigen was confirmed to significantly increase the expression of type I IFN, which has antiviral effects, at early stages of vaccination (7 days after vaccination) in both MDA(+) and MDA(-) pigs, suggesting that it could effectively protect hosts against FMDV infection early in the vaccination period. Although the expression level of IFNγ, a T helper (Th)1 cell-associated cytokine, was lower than that of IFNα and IFNβ, it showed significant expression with a fold change of >2 (p<0.05), indicating that it effectively induced T cell-mediated cellular immune responses. The expression of IL-1β, which is involved in inflammasome activity, and Th17 cells, as well as IL-17A derived from non-conventional T cells (γδ T cells), was also significantly higher in the experimental group administered antigen isolated and purified from the C3d-inserted vaccine strain. Previous studies have shown that the expression of IL-23p19 and IL-23R is crucial for the host's early defense, and this study also found that their expression initially exhibits a "cytokine storm" level, which then normalizes.
[0108] Dendritic cells (DCs), macrophages (M Φ IL-23A is secreted by innate immune cells, such as T cells, through the stimulation of pathogen recognition receptors (PRRs). IL-23A binds to IL-23R on the surface of non-traditional T cells, which are innate-like immune cells, and stimulates the cells to produce IL-17A. The produced IL-17A plays a crucial role in the host's initial defense by recruiting neutrophils to the site of pathogen infection, forming neutrophil extracellular traps (NETs), and inducing NETosis of the pathogen.
[0109] Furthermore, the IL-23 / IL-17A axis is known to link innate and adaptive immunity, and it is thought that the test vaccine containing the O PA2-C3d+A22-C3d antigen will simultaneously induce innate and adaptive immune responses through the secretion of such inflammatory cytokines.
[0110] CD4 + Th subsets and CD4 + T regulatory cells (T regs ) differentiation and survival, and is essential for the generation of memory cells. regs TGFβ, which is known to be involved in the development of inflammatory cytokines and the induction of immunological tolerance in DCs, was slightly higher in the experimental group, but no significant difference was observed between the groups. Expression of the anti-inflammatory cytokine IL-10 also increased significantly in the experimental group (p<0.05), which is presumed to be due to host homeostasis to regulate the "cytokine storm" of inflammatory cytokines. Expression of IL-4 and IL-6, cytokines derived from Th2 cells, was significantly higher in the MDA(+) group than in the MDA(-) group. ) group, it was determined that the expression levels of these cytokines increase in the presence of passive immunity due to maternal antibodies.
[0111] CD80 and CD86 costimulatory signaling, which cooperates with T cell receptor (TCR) signals to promote T cell activation, was increased in the O PA2-C3d + A22-C3d administration group, suggesting that these immune-enhancing FMD vaccine strains can effectively present antigens to T cells and stimulate them effectively.
[0112] In the case of MHC class I, gene expression was higher in the MDA(+) group than in the MDA(-) group, and even lower in the vaccinated group than in the NC group. However, because gene expression was low in the presence of passive immunity, cytotoxic CD8 +Antigen recognition by T cells is inhibited. In contrast, MHC class II was expressed at a higher level in the MDA(-) group than in the MDA(+) group, and although there was no significant difference between the groups, it tended to increase in the experimental group. This suggests that the antigen of the C3d-inserted immune-enhancing vaccine strain is expressed by APCs (DCs, M Φ CD4 induces effector cell cooperation and regulation through MHC class II presentation by CD4 receptors (e.g., B cells) + It has been confirmed that it activates T cells, and it is believed that it can induce sustained cell-cell contact and T cell activation through interaction with the MHC complex.
[0113] On the other hand, the expression of CD21, the direct receptor for C3d, was significantly increased in both MDA(+) and MDA(-) conditions by administration of the test vaccine containing the FMD vaccine strain antigen fused with C3d (p<0.01, p<0.0001), suggesting that B cell activation is possible through stimulation of C3d on the FMDV surface and binding to CD21.
[0114] The expression of CD28 and ICOS, which are costimulatory signals that are crucial for T cell activation and the induction of memory T cells, was significantly elevated in the MDA(+) and MDA(-) conditions following administration of the test vaccine containing the O PA2-C3d+A22-C3d antigen (CD28: p<0.0001; p<0.05; ICOS: p<0.01; p<0.00001). In particular, ICOS expression showed a significant difference between the experimental and PC groups (MDA(+): p<0.05; MDA(-): p<0.0001). The C3d-fused FMD vaccine strain antigen increased costimulation of T cells and lymphocytes, leading to significant IFN-γ expression. Furthermore, ICOS, an immunoglobulin domain known to affect intestinal immune responses for IgA production, may be useful in FMD vaccine strains for simultaneous induction of systemic and mucosal immunity. Since CTLA4 expression also shows a similar tendency to ICOS expression, it is thought that the CTLA pathway is induced by ICOS expression, and it is speculated that the induced CTLA4 causes the conversion of regulatory T cells to suppress autoimmunity by expressing inflammatory cytokines at a ``cytokine storm'' level when administered with a FMD vaccine to overcome maternal antibody interference in the cytoplasmic domain.
[0115] In contrast, in the present study, AHNAK expression was significantly increased in the OPA2-C3d + A22-C3d group under MDA(-) conditions (p<0.001), and was also slightly higher in the experimental group under MDA(+) conditions, but no significant difference was observed between the groups. AHNAK is a large 700 kDa protein previously identified as a structural scaffold protein and has been implicated in various cellular processes, including cell structure, intracellular trafficking, cell membrane regeneration, regulated extracellular efflux, and calcium signaling during T cell differentiation and activation.
[0116] Cytolytic CD8 +T cells (CTLs) kill virus-infected cells in a calcium-dependent manner. AHNAK is expressed in mature CTLs but not in nai ve CD8 + It has been reported that ANHAK1 is not expressed in T cells and is crucial for proper functioning in the induction of immune responses. - / - CTLs have been shown to exhibit significantly reduced Granzyme B production, cytolytic activity, and IFNγ secretion after TCR stimulation.
[0117] Therefore, it is believed that the test vaccine containing the O PA2-C3d+A22-C3d antigens can induce T cell activation and CTL responses via the expression of AHNAK.
[0118] Furthermore, the immune-enhancing FMDV antigen according to the present invention induces IFNγ secretion, an indicator of cellular immune responses. To verify the specific cellular immune responses induced by C3d-inserted FMDV antigens, the "C3d"-inserted FMDV (O PA2-C3d, A22-C3d) Ag-mediated IFNγ secretion was confirmed by in vitro ELISpot analysis using peritoneal exudate cells (PECs) isolated from mouse peritoneal lavage fluid and peripheral blood mononuclear cells (PBMCs) isolated from porcine whole blood.
[0119] As a result, inactivated FMDV antigens derived from O PA2-C3d and A22-C3d induced significantly higher levels of IFNγ secretion in mouse PECs and pig PBMCs than in the control groups (Fig. 8e). Collectively, these results demonstrated that O PA2-C3d and A22-C3d can induce Th1-type immune responses.
[0120] <Experimental Example 5> Measurement of antigen quantity in a simple kit and evaluation of differentiation from field strains Inactivated antigens were produced and purified using two recombinant FMD viruses, O PA2-C3d and A22-C3d, produced according to the present invention, and two backbone viruses, O PA2 and A22, as positive controls (PCs). Using these, antigen quantity was measured using a simple kit and differentiation tests from field strains were performed. Even a small amount, 2.34 ng (1 / 640 dose), showed SP-positive bands, and the absence of NSP bands indicated differentiation from field strains (Figure 9). Transmission electron microscopy (TEM) observation of the purified antigen (146s particles) through a sucrose gradient confirmed the formation of 146s particles without any problems, and this was used as a test FMD vaccine antigen (Figure 10).
Claims
1. A recombinant plasmid having the sequence of SEQ ID NO:
11.
2. An immune-enhancing recombinant foot-and-mouth disease type A virus comprising all of the proteins encoded by the recombinant plasmid of claim 1.
3. The immuno-enhanced recombinant foot-and-mouth disease type A virus antigen according to claim 2, which is an inactivated immuno-enhanced recombinant foot-and-mouth disease type A virus.
4. A foot-and-mouth disease vaccine composition comprising the immunopotentiated recombinant foot-and-mouth disease type A virus according to claim 2 or the immunopotentiated recombinant foot-and-mouth disease type A virus antigen according to claim 3.
5. A diagnostic kit for foot-and-mouth disease, comprising the immunopotentiating recombinant foot-and-mouth disease type A virus according to claim 2 or the immunopotentiating recombinant foot-and-mouth disease type A virus antigen according to claim 3.
6. A method for diagnosing foot-and-mouth disease using the foot-and-mouth disease diagnostic kit according to claim 5.
7. A method for preventing or treating foot-and-mouth disease using the foot-and-mouth disease vaccine composition according to claim 4.
Citation Information
Patent Citations
regulation of the immune response
JP1998509723A
Recombinant virus expressing protective antigen of foot-and-mouth o-panasia-2 genotye, and manufacturing method thereof
KR1020150014015A
Recombinant viruses expressing the foot-and-mouth disease type A protective antigen which inserted long term immunity enhancing gene, and a vaccine composition comprising the same
KR1020200134637A
Foot-and-mouth disease recombinant type A virus inserted with T cell epitope and vaccine composition containing inactivated antigen isolated and purified from this virus
KR102234754B1
peptide
US20140219918A1