Compositions and methods for treating RAS mutant cancers

By targeting TXNRD1 with inhibitors or nucleic acids, RAS mutant pancreatic cancer is treated effectively, addressing the challenge of KRAS mutations and improving treatment outcomes.

JP7770924B2Active Publication Date: 2025-11-17MEMORIAL SLOAN KETTERING CANCER CENT +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2021562908
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-04-24
Filing Date
2020-04-23
Publication Date
2025-11-17
Estimated Expiration
2040-04-23

AI Technical Summary

Technical Problem

Pancreatic ductal adenocarcinoma (PDAC) has a low survival rate due to KRAS mutations that render the KRAS protein constitutively active, making it a challenging therapeutic target, and existing treatments are inadequate for effectively inhibiting RAS mutant cancers.

Method used

Administering therapeutically effective amounts of TXNRD1 inhibitors, such as auranofin or inhibitory nucleic acids targeting TXNRD1, to reduce TXNRD1 expression and inhibit RAS mutant cancer cell proliferation, potentially combined with other agents like gemcitabine or AMG 510.

Benefits of technology

The approach effectively reduces TXNRD1 protein levels, inhibits RAS mutant cancer cell growth, and shows synergistic effects when combined with other therapies, offering a promising treatment for RAS mutant pancreatic cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007770924000001
    Figure 0007770924000001
  • Figure 0007770924000002
    Figure 0007770924000002
  • Figure 0007770924000003
    Figure 0007770924000003
Patent Text Reader

Abstract

The present disclosure generally relates to compositions and methods for treating RAS mutant cancers. In particular, the present technology relates to administering a therapeutically effective amount of one or more TXNRD1 inhibitors to a subject diagnosed with or at risk for a RAS mutant cancer (e.g., RAS mutant pancreatic cancer).
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of and priority to U.S. Provisional Patent Application No. 62 / 838,065, filed April 24, 2019, the entire contents of which are incorporated herein by reference. The present technology generally relates to compositions and methods for treating, preventing, and / or ameliorating RAS mutant cancer in a subject in need thereof. In particular, the present technology relates to methods for treating, preventing, and / or ameliorating RAS mutant pancreatic cancer by administering a therapeutically effective amount of a TXNRD1 inhibitor. [Background technology]

[0002] The following description of the background of the present technology is provided merely as an aid in understanding the present technology and is not admitted to describe or constitute prior art to the present technology. Approximately 90% of all pancreatic cancers are pancreatic ductal adenocarcinoma (PDAC), which is one of the most lethal cancers. PDAC has a 5-year survival rate of only 7%. Detailed genetic profiling suggests significant variability among cancers. For example, genome sequencing has revealed that genes frequently mutated in PDAC include KRAS, TP53, CDKN2A, SMAD4, MLL3, TGFBR2, ARID1A and SF3B1, EPC1 and ARID2, ATM, ZIM2, MAP2K4, NALCN, SLC16A4, MAGEA6, ROBO2, KDM6A, PREX2, ERBB2, MET, FGFR1, CDK6, PIK3R3, PIK3CA, BRCA1, BRCA2, and PALB2. Despite this variability, it is clear that KRAS is mutated in 95% of PDAC cases. See, for example, Biankin et al., Nature 491(7424): 399-405 (2012); Waddell et al., Nature 518(7540): 495-501 (2015); and Jones et al., Science 321(5897): 1801-1806 (2008).

[0003] The KRAS protein is a GTPase that plays a key role in cell signaling pathways. It is thought to function as a binary on-off switch, cycling between an active guanosine triphosphate (GTP)-bound state and an inactive guanosine diphosphate (GDP)-bound state. In normal quiescent cells, KRAS is mostly found in a GDP-bound, inactive state. Cell surface receptors transiently promote the formation of active KRAS-GTP in response to extracellular stimuli. KRAS mutations in PDAC and other cancers are typically missense mutations that render KRAS constitutively GTP-bound, resulting in overstimulation of signaling pathways that drive cancer growth. Oncogenic mutant KRAS proteins drive tumor progression in many cancer types. For example, in PDAC, mutant KRAS proteins control the reprogramming of pancreatic acinar cells into ductal intraepithelial neoplasia. KRAS is also required for the growth and maintenance of PDAC and other cancers. See, e.g., Ying et al., Cell 149(3):656-70 (2012). Indeed, PDAC is considered to be one of the most "KRAS-addicted" types of cancer. Therefore, KRAS is considered an important therapeutic target for PDAC and other KRAS mutant cancers. See, e.g., Waters and Der, Cold Spring Harb Perspect Med. 8(9): a031435 (2018). Summary of the Invention

[0004] In one aspect, the present disclosure provides a method for treating RAS mutant cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a TXNRD1 inhibitor selected from the group consisting of auranofin, piperlongumine, D9, TRi-1, TRi-2, myricetin, PMX464, PX12, brevetoxin-2, manumicin A, ethaselen, aurothioglucose, protoporphyrin IX, anti-TXNRD1 antibodies, and any derivatives thereof. Also disclosed herein is a method for treating RAS mutant cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an inhibitory nucleic acid that inhibits TXNRD1 expression. In some embodiments, the inhibitory nucleic acid is TCTAATATCATTAACACCATGG (SEQ ID NO: 1; human shTXNRD1), TAAATAAAACTGAATATGGTCA (SEQ ID NO: 2; human shTXNRD1), TTAATAATAACTTATGATATTA (SEQ ID NO: 3; human shTXNRD1), TTTGTAACAAAAATACATGGAA (SEQ ID NO: 4; human shTXNRD1), TTTAAATGAAAATCCTTCACAT (SEQ ID NO: 5; human shTXNRD1), TTTTAAATGAAAATCCTTCACA (SEQ ID NO: 6; human shTXNRD1), TAAGAAAAGAGAATCACAACAT (SEQ ID NO: 7; human shTXNRD1), TTTTCATTTATCTTCACCCCTA (SEQ ID NO: 8; human shTXNRD1), TTAGAAAGAAATAGATACCCAA (SEQ ID NO: 9; human shTXNRD1), TAATAATAACTTATGATATTAA (SEQ ID NO: 10; human shTXNRD1), TTTAGTCACAGGGTAATTCGTC (SEQ ID NO: 11; mouse shTxnrd1), and The RAS mutant cancer comprises a sequence selected from the group consisting of TTCGTCACTGACAACGTTGTGA (SEQ ID NO: 12; mouse shTxnrd1), or any complement thereof. The RAS mutant cancer can be lung cancer (e.g., lung adenocarcinoma), mucinous adenoma, pancreatic cancer (e.g., PDAC), colorectal cancer, skin cancer (e.g., melanoma), endometrial cancer, testicular germ cell carcinoma, or adrenal cancer. In certain embodiments, the RAS mutant cancer comprises a KRAS, NRAS, or HRAS mutation selected from the group consisting of G12C, G12D, G12V, G12A, G12S, G12R, G13D, G13C, G13S, G13R, G13A, G13V, Q61H, Q61L, Q61R, Q61K, Q61P, and Q61E. Additionally or alternatively, in some embodiments, KRAS, NRAS, or HRAS mutations are detected by DNA sequencing.

[0005] Additionally or alternatively, in some embodiments of the methods disclosed herein, the subject exhibits elevated expression levels of RAS proteins (e.g., KRAS, HRAS, NRAS) in cancer cells prior to treatment. In any of the embodiments of the methods disclosed herein, the subject exhibits one or more signs or symptoms selected from pain in the upper abdomen radiating to the back, loss of appetite or unintentional weight loss, depression, new-onset diabetes, blood clots, fatigue, yellowing of the skin and whites of the eyes (jaundice), abdominal distension, nausea, and vomiting.

[0006] Additionally or alternatively, in some embodiments of the methods disclosed herein, the subject comprises one or more point mutations in TP53, CDKN2A, SMAD4, MLL3, TGFBR2, ARID1A, SF3B1, EPC1, ARID2, ATM, ZIM2, MAP2K4, NALCN, SLC16A4, MAGEA6, ROBO2, KDM6A, PREX2, ERBB2, MET, FGFR1, CDK6, PIK3R3, PIK3CA, BRCA1, BRCA2, or PALB2. In some embodiments, the subject is human.

[0007] In any of the embodiments of the method disclosed herein, the TXNRD1 inhibitor or inhibitory nucleic acid that inhibits TXNRD1 expression can be administered orally, topically, intranasally, systemically, intravenously, subcutaneously, intraperitoneally, intradermally, intraocularly, iontophoretically, transmucosally, or intramuscularly.In some embodiments, the TXNRD1 inhibitor or inhibitory nucleic acid is administered daily for 6 weeks or more.In other embodiments, the TXNRD1 inhibitor or inhibitory nucleic acid is administered daily for 12 weeks or more.

[0008] Additionally or alternatively, in some embodiments, the method further comprises separately, sequentially, or simultaneously administering to the subject one or more additional therapeutic agents. Examples of additional therapeutic agents include, but are not limited to, paclitaxel, gemcitabine, AMG 510, 5-FU (fluorouracil), and irinotecan.

[0009] In another aspect, the present disclosure provides a method for monitoring the therapeutic efficacy of a TXNRD1 inhibitor in a subject diagnosed with RAS mutant cancer, comprising the steps of: (a) detecting the TXNRD1 protein level in a test sample obtained from the subject after the subject has been administered the TXNRD1 inhibitor; and (b) determining that the TXNRD1 inhibitor is effective if the TXNRD1 protein level in the test sample is reduced compared to the level observed in a control sample obtained from the subject before the administration of the TXNRD1 inhibitor. Examples of TXNRD1 inhibitors include auranofin, piperlongumine, D9, TRi-1, TRi-2, myricetin, PMX464, PX12, brevetoxin-2, manumicin A, ethaselen, aurothioglucose, protoporphyrin IX, anti-TXNRD1 antibodies, inhibitory nucleic acids that inhibit TXNRD1 expression, or any derivatives thereof. In some embodiments, the inhibitory RNA is an shRNA, an antisense oligonucleotide, or an sgRNA.

[0010] In one aspect, the disclosure provides a method for inhibiting RAS mutant cell proliferation in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one TXNRD1 inhibitor, wherein the at least one TXNRD1 inhibitor is selected from the group consisting of auranofin, piperlongumine, D9, TRi-1, TRi-2, myricetin, PMX464, PX12, brevetoxin-2, manumicin A, ethaselen, aurothioglucose, protoporphyrin IX, anti-TXNRD1 antibodies, inhibitory nucleic acids that inhibit TXNRD1 expression, and any derivatives thereof, and wherein the subject is suffering from a disease or condition characterized by increased expression levels and / or activity of RAS (e.g., KRAS, HRAS, NRAS) and / or TXNRD1. In some embodiments, the inhibitory nucleic acid is TCTAATATCATTAACACCATGG (SEQ ID NO: 1; human shTXNRD1), TAAATAAAAACTGAATATGGTCA (SEQ ID NO: 2; human shTXNRD1), TTAATAATAACTTATGATATTA (SEQ ID NO: 3; human shTXNRD1), TTTGTAACAAAAATACATGGAA (SEQ ID NO: 4; human shTXNRD1), TTTAAATGAAAATCCTTCACAT (SEQ ID NO: 5; human shTXNRD1), TTTTAAATGAAAATCCTTCACA (SEQ ID NO: 6; human shTXNRD1), TAAGAAAAGAGAATCACAACAT (SEQ ID NO: 7; human shTXNRD1), TTTTCATTTATCTTCACCCCTA (SEQ ID NO: 8; human shTXNRD1), TTAGAAAGAAATAGATACCCAA (SEQ ID NO: 9; human shTXNRD1), TAATAATAACTTATGATATTAA (SEQ ID NO: 10; human shTXNRD1), TTTAGTCACAGGGTAATTCGTC (SEQ ID NO: 11; mouse shTxnrd1), and TTCGTCACTGACAACGTTGTGA (SEQ ID NO: 12; mouse shTxnrd1).

[0011] In any and all embodiments of the methods disclosed herein, TXNRD1 and / or RAS (e.g., KRAS, HRAS, NRAS) expression levels are detected by RNA-seq, Northern blotting, microarray, dot or slot blot, fluorescent in situ hybridization, reverse transcription polymerase chain reaction (RT-PCR), ribonuclease protection assay (RPA), real-time quantitative RT-PCR, high performance liquid chromatography (HPLC), liquid chromatography-mass spectrometry (LC / MS), enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, immunoelectrophoresis, immunostaining, immunohistochemistry, or Western blotting.

[0012] Additionally or alternatively, in some embodiments of the methods disclosed herein, the method further comprises administering to the subject a therapeutically effective amount of gemcitabine. In any of the foregoing embodiments of the methods disclosed herein, the method comprises administering to the subject a therapeutically effective amount of KRAS G12C The method further comprises administering to a subject an inhibitor of said KRAS G12C The inhibitor may be AMG 510. [Brief explanation of the drawings]

[0013] [Figure 1A]1 is a schematic diagram showing the pipeline used in the present disclosure for the discovery of therapeutic targets in KRAS mutant pancreatic cancer. The pipeline included low multiplicity of infection (MOI) transduction of KRAS mutant pancreatic cancer cells with a clustered regularly interspaced short palindromic repeats-based interference (CRISPRi) library (see, e.g., Gilbert et al., Cell 154: 442-451 (2013)), single-cell RNA sequencing (scRNA-seq), genome alignment and count matrix generation (see, e.g., Tang et al., Nature Methods 6: 377-382 (2009)), supervised dimensionality reduction, and machine learning algorithms to identify novel targets whose inhibition maximally and selectively targets cancer cells. [Figure 1B] Scatter plot of z-transformed therapeutic scores for several CRISPR target candidates. Therapeutic indices were scored across two negative guide RNAs based on a machine learning algorithm that collectively established a negative control benchmark for identifying therapeutic targets. [Figure 2A] Figure 1 shows the distribution of cell type populations along one dimension after supervised dimensionality reduction using a machine learning algorithm. The following populations are shown: 1) cancer cells: cancer cells targeted with a non-targeting guide RNA gene (N=120), 2) invalid target: cancer cells targeted with a negative control gene (N=122), 3) TXNRD1: cancer cells targeted with TXNRD1 (N=87), and 4) healthy cells: healthy duct cells (N=600). [Figure 2B] 1 is a heatmap showing the z-transformed therapeutic scores for the top 20 candidate targets. The candidate targets are listed in descending order based on their average rank across the four indicated decision functions from the machine learning algorithm. As shown, TXNRD1 had the highest average rank. [Figure 2C]Figure 1 is a graph depicting the weighted average decision function score for therapeutic index across a panel of candidate targets. TXNRD1 emerged as the highest ranked target. [Figure 3A] Figure 1 shows the results of crossover analysis of shRNA-mediated pooled negative selection screening. shRNA-mediated pooled negative selection screening was performed in (1) KrasG12D; Myc; shp53 mouse pancreatic ductal adenocarcinoma (mPDAC) cells and (2) Myc; p53- / - mouse hepatocellular carcinoma (mHCC) cells. The results of shRNA-mediated pooled negative selection screening from the two cell types were crossover analyzed for comparison. [Figure 3B] This bar graph shows validation of candidate genes derived from Figure 3A. Competitive proliferation assays were performed in mPDAC cells, mHCC cells, and non-transformed immortalized mouse embryonic fibroblasts (iMEFs). These cells were transduced with Venus+ virus carrying an inducible shRNA. The following control shRNAs were used: Ren.713 (a non-targeting shRNA serving as a negative control), Rpa3.561 (a positive control for growth inhibition in all proliferating cells), and Kras.247 (a positive control for mPDAC-specific growth inhibition). G418-selected Venus+ cells were mixed with non-transduced cells and cultured in the presence of doxycycline to induce the shRNA. The percentages of Venus+ and dsRed+ (shRNA-expressing) cells were determined at different time points (T0: day 0; T12: day 12). The changes served as a readout for the growth inhibitory effect of the expressed shRNA. [Figure 3C] FIG. 1 shows immunoblots showing TXNRD1 knockdown in mPDAC, mHCC, and iMEF cells. [Figure 3D]Figure 1 shows the effect of pharmacological inhibition of TXNRD1 in pancreatic cancer cells. mPDAC cells were treated with increasing doses of auranofin for 72 hours. The viable cell count was measured and normalized to the viable cell count of DMSO-treated cells (set to 1) to calculate relative proliferation. Relative proliferation was then plotted as a function of auranofin concentration and fitted to an exponential curve. [Figure 3E] This figure shows the effect of pharmacological inhibition of TXNRD1 in human pancreatic cancer cells, as measured by the change in viable cell count after 72 hours of culture with increasing doses of auranofin. Relative proliferation was calculated by measuring viable cell count and normalizing it to the viable cell count of DMSO-treated cells (set at 1). Relative proliferation was then plotted as a function of auranofin concentration and fitted to an exponential curve. L3.3, Colo357, and BXPC3 have wild-type KRAS, while the rest of these cell lines contain KRAS mutations. [Figure 4A] 1 is a bar graph showing the correlation between IC50 values ​​of the TXNRD1 inhibitor auranofin and KRAS status in human pancreatic cancer cell lines (n=12). [Figure 4B] 1 is a bar graph showing the correlation between IC50 values ​​of auranofin and p53 status in human pancreatic cancer cell lines (n=9). [Figure 4C] FIG. 1 is a scatter plot showing the correlation between the IC50 value of auranofin and Myc expression levels in human pancreatic cancer cell lines (n=9). [Figure 4D] This figure shows the effect of pharmacological inhibition of TXNRD1, as measured by treating pancreatic cancer cells with piperlongumine (another TXNRD1 inhibitor) for 72 hours. Cancer cells containing different KRAS mutations (G12C, G12D, G12V) or the wild-type allele were assayed. Relative proliferation was calculated by measuring viable cell counts and normalizing them to the viable cell count of DMSO-treated cells (set at 1). Relative proliferation was then plotted as a function of auranofin concentration and fitted to an exponential curve. [Figure 4E]FIG. 1 is a scatter plot showing the correlation between TXNRD1 and KRAS expression levels in TCGA human pancreatic cancer tumors (n=149). [Figure 4F] Figure 4: Evaluation of gene signature changes upon TXNRD1 knockdown in mPDAC cells. Gene set enrichment analysis (GSEA) was used to evaluate changes in KRAS-dependent gene signatures (Figure 4F), pancreatic cancer (Figure 4G), and amino acid transporter / ferroptosis (Figure 4H) upon TXNRD1 knockdown in mPDAC cells compared to cells containing shRen (a non-targeting shRNA that served as a negative control). [Figure 4G] Figure 4: Evaluation of gene signature changes upon TXNRD1 knockdown in mPDAC cells. Gene set enrichment analysis (GSEA) was used to evaluate changes in KRAS-dependent gene signatures (Figure 4F), pancreatic cancer (Figure 4G), and amino acid transporter / ferroptosis (Figure 4H) upon TXNRD1 knockdown in mPDAC cells compared to cells containing shRen (a non-targeting shRNA that served as a negative control). [Figure 4H] Figure 4: Evaluation of gene signature changes upon TXNRD1 knockdown in mPDAC cells. Gene set enrichment analysis (GSEA) was used to evaluate changes in KRAS-dependent gene signatures (Figure 4F), pancreatic cancer (Figure 4G), and amino acid transporter / ferroptosis (Figure 4H) upon TXNRD1 knockdown in mPDAC cells compared to cells containing shRen (a non-targeting shRNA that served as a negative control). [Figure 5A]Schematic diagram of conditional RNAi experiments. Tet-On competent mouse PDAC cells were transduced with TRMPV-Neo-miR-E shRNA and luciferase-hygro vector. Transduced cells were selected for G418 and hygromycin resistance and transplanted into the pancreas of recipient mice. At the time of disease onset, determined using bioluminescence imaging (typically occurring after 7 days), shRNA expression was induced in a subset of mice by adding doxycycline (dox) to drinking water and chow. [Figure 5B] Scatter plot showing tumor mass in animals (n=4-5) treated with or without doxycycline to induce the corresponding shRNA. [Figure 5C] Bioluminescence imaging of representative mice orthotopically implanted with mPDAC cells containing the indicated TRMPV-Neo-miR-E shRNAs with and without 7 days of dox treatment. Dox was administered at the time of disease onset. Bioluminescence images at day 0 (D0) and day 7 (D7) are shown. [Figure 5D]

[0023] Figure 1 is a bar graph showing in vivo tumor mass reduction caused by auranofin treatment. KRasG12D;p53- / - organoids were transplanted into recipient mice, and the mice were treated with vehicle alone or auranofin for 1 week (n=3-4). Tumor mass was measured and plotted. [Figure 5E]

[0023] Figure 1 is a bar graph showing the in vivo effect of auranofin treatment on human pancreatic cancer cell line tumor mass. MIAPaCa-2 (KRAS mutant) or Colo357 (KRAS wild-type) organoids were transplanted into the pancreas of recipient mice. Mice were treated with vehicle alone or auranofin for 2 weeks (n=5). Tumor mass was measured and plotted. [Figure 6A]Figure 6A shows a heatmap illustrating the survival dependency of the indicated cell lines on the listed genes. Each column represents the cell line with the highest average rank, and each row represents a gene. Gene dependency scores were calculated by averaging the log2FC (fold change in abundance relative to non-diseased tissue) of all corresponding sgRNAs (Figure 6A). Zero represents no change in the indicated cell line, negative numbers represent depletion, and positive numbers represent enrichment. Unsupervised clustering was used to cluster genes with similar phenotypes. As shown, knocking out or knocking down the duplicated genes RAP1 or PCNA resulted in general lethality in almost all cell lines. In contrast, TXNRD1 is conditionally required for certain cell lines that exhibit similar dependency on KRAS, HRAS, and NRAS. [Figure 6B] Figure 6B shows a heatmap depicting the survival dependency of the indicated cell lines on the listed genes. Each column represents the cell line with the highest average rank, and each row represents a gene. Gene dependency scores were calculated by averaging the log2FC (fold change in abundance relative to non-diseased tissue) of all corresponding shRNAs (Figure 6B). Zero represents no change, negative numbers represent depletion, and positive numbers represent enrichment in the indicated cell lines. Unsupervised clustering was used to cluster genes with similar phenotypes. As shown, knocking out or knocking down the duplicated genes RAP1 or PCNA resulted in general lethality in almost all cell lines. In contrast, TXNRD1 is conditionally required for certain cell lines that exhibit similar dependency on KRAS, HRAS, and NRAS. [Figure 7A] Figure 7A shows the antiproliferative effect of the TXNRD1 inhibitor auranofin in KRAS mutant pancreatic cancer cells, and the potential synergistic inhibitory effect when combined with gemcitabine. Figure 7B shows the dose-dependent effects of auranofin, gemcitabine, and their combination on MIAPaCa-2 (KRASG12C) and PSN1 (KRASG12R) pancreatic cancer cell lines. [Figure 7B]Figure 7B shows the antiproliferative effect of the TXNRD1 inhibitor auranofin in KRAS mutant pancreatic cancer cells and its potential synergistic inhibitory effect when combined with gemcitabine. Figure 7B shows the percent growth inhibition at each concentration of auranofin and gemcitabine in MIAPaCa-2 (KRASG12C) and PSN1 (KRASG12R) cells from Figure 7A. Data are presented as the average of three independent experiments (n = 3). Figure 7C shows the combination index (CI) plot of MIAPaCa-2 (KRASG12C) and PSN1 (KRASG12R) cells treated with auranofin in combination with gemcitabine. [Figure 7C] Figure 7C shows the antiproliferative effect of the TXNRD1 inhibitor auranofin in KRAS mutant pancreatic cancer cells, and the potential synergistic inhibitory effect when combined with gemcitabine. Figure 7C shows the combination index (CI) plot of MIAPaCa-2 (KRASG12C) and PSN1 (KRASG12R) cells treated with auranofin in combination with gemcitabine. Figure 7C shows a CI value of less than 1 indicating synergism between auranofin and gemcitabine. [Figure 7D] 7A and 7B show the antiproliferative effect of the TXNRD1 inhibitor auranofin in KRAS mutant pancreatic cancer cells, and the potential synergistic inhibitory effect when combined with gemcitabine. Figure 7D shows the combination index (CI) scores for MIAPaCa-2 (KRASG12C) and PSN1 (KRASG12R) cells treated with auranofin in combination with gemcitabine at the indicated concentrations. Each CI score represents data from at least three independent experiments. [Figure 8A] Figure 8 shows the antiproliferative effect of the TXNRD1 inhibitor auranofin in KRAS mutant pancreatic cancer cells and the potential synergistic inhibitory effect when combined with the KRASG12C inhibitor AMG 510. Figure 8A shows the dose-dependent effects of auranofin, AMG 510, and their combination on MIAPaCa-2 (KRASG12C) and PSN1 (KRASG12R) pancreatic cancer cell lines. [Figure 8B]Figure 8B shows the antiproliferative effect of the TXNRD1 inhibitor auranofin in KRAS mutant pancreatic cancer cells, and the potential synergistic inhibitory effect when combined with the KRASG12C inhibitor AMG 510. Figure 8B shows the percent growth inhibition at each concentration of auranofin and AMG 510 in MIAPaCa-2 (KRASG12C) and PSN1 (KRASG12R) cells from Figure 8A. Data are presented as the average of three independent experiments (n=3). [Figure 8C] 8C shows the antiproliferative effect of the TXNRD1 inhibitor auranofin in KRAS mutant pancreatic cancer cells and the potential synergistic inhibitory effect when combined with the KRASG12C inhibitor AMG 510. Figure 8C shows that CI plots presenting CI values ​​less than 1 indicate synergy between auranofin and AMG 510. [Figure 8D] Figure 8D shows the antiproliferative effect of the TXNRD1 inhibitor auranofin in KRAS mutant pancreatic cancer cells and the potential synergistic inhibitory effect when combined with the KRASG12C inhibitor AMG 510. Figure 8D shows the combination index (CI) scores for MIAPaCa-2 (KRASG12C) and PSN1 (KRASG12R) cells treated with auranofin in combination with AMG 510 at the indicated concentrations. Each CI score represents data from at least three independent experiments. [Figure 9] Overall survival in patients with pancreatic adenocarcinoma with TXNRD1 mRNA upregulation. 178 patients were divided into two groups: TXNRD1 low and TXNRD1 high / intermediate. The ratio cutoffs (0-100%) for high / intermediate and low were >15.87% (Z score >-1, n=145) and ≤15.87% (Z score ≤-1, n=33), respectively. Data analysis was based on available TCGA data. [Figure 10] Figure 1 shows plasma and pancreatic gold concentrations in NCR nu / nu mice after a single intraperitoneal injection dose of 10 mg / kg auranofin suspension, with three consecutive samples collected over 24 hours (2 hours, 4 hours, 24 hours) (n=3). DETAILED DESCRIPTION OF THE INVENTION

[0014] It should be appreciated that certain aspects, modes, embodiments, variations, and features of the present methods are described below at varying levels of detail to provide a substantial understanding of the present technology.

[0015] In carrying out the present methods, many conventional techniques in molecular biology, protein biochemistry, cell biology, microbiology, and recombinant DNA are used. For example, Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; the series Ausubel et al., eds. al., (1995) PCR 2: A Practical Approach;Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual;Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition;Gait ed. (1984) Oligonucleotide Synthesis;US Patent No. 4,683,195;Hames and Higgins eds. (1984) Nucleic Acid Hybridization;Anderson (1999) Nucleic Acid Hybridization; Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds.(1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al., eds (1996) Weir's Handbook of Experimental See Immunology. .

[0016] The present disclosure is based in part on the discovery that TXNRD1 is a therapeutic target for treating RAS mutant pancreatic cancer, and that pharmacological inhibition of TXNRD1 in pancreatic cancer cells is effective in treating RAS mutant pancreatic cancer.

[0017] definition Unless otherwise defined, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art. As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise. For example, a reference to "a cell" includes a combination of two or more cells, and the like. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, analytical and nucleic acid chemistry, and hybridization described below are those well known and commonly used in the art. As used herein, the term "about" in reference to a number is generally interpreted as including numbers within 1%, 5%, or 10% (greater or lesser) of that number in either direction (except where such number is less than 0% or greater than 100% of a possible value), unless otherwise stated or otherwise clear from the context.

[0018] As used herein, "administration" of an agent or drug to a subject includes any route of introducing or delivering the compound to a subject to perform its intended function. Administration can be by any suitable route, such as orally, intranasally, parenterally (intravenously, intramuscularly, intraperitoneally, or subcutaneously), or topically. Administration includes self-administration and administration by another.

[0019] As used herein, the term "antibody" refers collectively to immunoglobulin or immunoglobulin-like molecules, including, by way of example and not limitation, IgA, IgD, IgE, IgG, and IgM, combinations thereof, and similar molecules produced during the immune response in any vertebrate, e.g., mammal, e.g., human, goat, rabbit, and mouse, as well as in non-mammalian species, e.g., shark immunoglobulins. As used herein, "antibody" (including intact immunoglobulins) and "antibody-binding fragment" specifically bind to a molecule of interest (or a group of highly similar molecules of interest) to the substantial exclusion of binding to other molecules (e.g., with a binding constant at least 10 times higher than the binding constant for other molecules in a biological sample). 3 M -1 Large, at least 10 4 M -1 Large, or at least 10 5 M -1(Antibodies and antibody fragments with large binding constants for the molecule of interest). The term "antibody" also includes genetically engineered forms such as chimeric antibodies (e.g., humanized murine antibodies), heteroconjugate antibodies (e.g., bispecific antibodies), etc. See also Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, Ill.); Kuby, J., Immunology, 3rd Ed., W.H. Freeman & Co., New York, 1997.

[0020] More specifically, an antibody refers to a polypeptide ligand containing at least a light or heavy immunoglobulin chain variable region that specifically recognizes and binds to an epitope of an antigen. Antibodies are composed of heavy and light chains, each of which contains a heavy chain variable region (V H ) region and the light chain variable (V L ) region. H Area and V LThese regions together are responsible for binding the antigen recognized by the antibody. Typically, immunoglobulins have heavy (H) and light (L) chains interconnected by disulfide bonds. There are two types of light chains, lambda (λ) and kappa (κ). There are five major heavy chain classes (or isotypes) that determine the functional activity of antibody molecules: IgM, IgD, IgG, IgA, and IgE. Each heavy and light chain contains a constant region and a variable region (the regions are also known as "domains"). The heavy and light chain variable regions cooperate to specifically bind to antigens. The light and heavy chain variable regions contain a "framework" region interrupted by three hypervariable regions, also called "complementarity-determining regions" or "CDRs." The extent of the framework regions and CDRs has been defined (see Kabat et al., Sequences of Proteins of Immunological Interest, US Department of Health and Human Services, 1991, incorporated herein by reference). The Kabat database is currently maintained online. The sequences of the framework regions of different light or heavy chains are relatively conserved within a species. The combined framework regions of the constituent light and heavy chains, that is, the framework region of an antibody, generally adopt a β-sheet conformation, with the CDRs forming loops that connect the β-sheet structure, and in some cases forming part of the β-sheet structure. Thus, the framework regions act as a scaffold that provides the CDRs with the correct orientation through non-covalent interactions between the chains.

[0021] CDRs are primarily responsible for binding to an epitope of an antigen. The CDRs of each chain are typically referred to as CDR1, CDR2, and CDR3, numbered consecutively starting from the N-terminus, and are also typically identified by the chain in which the particular CDR is located. Thus, V H CDR3 is located within the variable domain of the heavy chain of the antibody in which it is found, while V LCDR1 is the CDR1 from the variable domain of the light chain of the antibody in which it is found. Antibodies that bind the TXNRD1 protein have a specific V H Area and V L Each CDR has a specific CDR sequence and therefore a specific CDR sequence. Antibodies with different specificities (i.e., different binding sites for different antigens) have different CDRs. Although the CDRs differ depending on the antibody, only a limited number of amino acid positions within the CDR are directly involved in antigen binding. These positions within the CDR are called specificity-determining residues (SDRs). As used herein, "immunoglobulin-related compositions" refers to antibodies (including monoclonal antibodies, polyclonal antibodies, humanized antibodies, chimeric antibodies, recombinant antibodies, multispecific antibodies, bispecific antibodies, etc.), as well as antibody fragments. An antibody or its antigen-binding fragment specifically binds to an antigen.

[0022] As used herein, the term "antibody-related polypeptide" refers to antigen-binding antibody fragments, including single-chain antibodies, which may contain a variable region alone or in combination with all or a portion of the following polypeptide elements: hinge region, CH1, CH2, and CH3 domains of an antibody molecule. Any combination of a variable region and hinge region, CH1, CH2, and CH3 domains is also encompassed by the present technology. Antibody-related molecules useful in the present methods include, but are not limited to, Fab, Fab' and F(ab')2, Fd, single-chain Fv (scFv), single-chain antibodies, disulfide-linked Fv (sdFv), and V L or V H Fragments comprising any of the domains. Examples include: (i) Fab fragments, V L , V H , C L (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a V H and a Fd fragment consisting of the CH1 domain; (iv) a V of a single arm of an antibody L and V H Fv fragment consisting of domains, (v) V H(vi) dAb fragments consisting of domains (Ward et al., Nature 341: 544-546, 1989); and (vi) isolated complementarity-determining regions (CDRs). As such, an "antibody fragment" or "antigen-binding fragment" can include a portion of a full-length antibody, generally the antigen-binding or variable region thereof. Examples of antibody fragments or antigen-binding fragments include Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.

[0023] The term "antigen-binding fragment" refers to a fragment of the entire immunoglobulin structure that contains the portion of the polypeptide that is involved in binding to the antigen. Examples of antibody-binding fragments useful in the present technology include, but are not limited to, scFv, (scFv)2, scFvFc, Fab, Fab', and F(ab')2.

[0024] As used herein, the term "diabody" refers to a group of proteins that are composed of the same polypeptide chain (V H V L ) in the light chain variable domain (V L ) and the heavy chain variable domain (V H Diabodies refer to small antibody fragments having two antigen-binding sites, each containing a linker that is too short to allow pairing between the two domains on the same chain, forcing the domains to pair with complementary domains on another chain and creating two antigen-binding sites. Diabodies are more fully described in, for example, EP 404,097; WO 93 / 11161; and Hollinger et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993).

[0025] As used herein, the term "single chain antibody" or "single chain Fv (scFv)" refers to an antibody comprising two domains of an Fv fragment, V L and V HThe term "antibody fusion molecule" refers to an antibody fusion molecule of a single chain antibody. A single chain antibody molecule may comprise a polymer having several individual molecules, such as a dimer, trimer, or other polymer. Furthermore, the two domains of the Fv fragment, V, L and V H are encoded by separate genes, but V L and V H Using recombinant methods, the regions can be linked by a synthetic linker that allows them to be produced as a single protein chain that pairs to form a monovalent molecule, known as a single-chain Fv (scFv). Bird et al. (1988) Science 242:423-426 and Huston et al. (1988) Proc. Natl. Acad Sci. USA 85:5879-5883. Such single-chain antibodies can be prepared by recombinant techniques or by enzymatic or chemical cleavage of intact antibodies.

[0026] Any of the above-mentioned antibody fragments are obtained using conventional techniques known to those skilled in the art, and the fragments are screened for binding specificity and neutralizing activity in the same manner as are intact antibodies. As used herein with respect to polynucleotides (i.e., sequences of nucleotides such as oligonucleotides or target nucleic acids), the terms "complementary" or "complementarity" refer to base-pairing rules. As used herein, the complement of a nucleic acid sequence refers to an oligonucleotide in "antiparallel association" when aligned with respect to the nucleic acid sequence so that the 5' end of one sequence pairs with the 3' end of the other. For example, the sequence "5'-AGT-3'" is complementary to the sequence "3'-TCA-5." Certain bases not commonly found in naturally occurring nucleic acids may be included in the nucleic acids described herein. These include, for example, inosine, 7-deazaguanosine, locked nucleic acids (LNA), and peptide nucleic acids (PNA). Complementarity need not be perfect; stable duplexes may contain mismatched base pairs, degenerate bases, or mismatched bases. Those skilled in the art of nucleic acid technology can empirically determine duplex stability by considering several variables, including, for example, the length of the oligonucleotide, the base composition and sequence of the oligonucleotide, ionic strength, and the incidence of mismatches. The complementary sequence can also be an RNA sequence complementary to a DNA sequence or its complementary sequence, or it can be cDNA.

[0027] As used herein, the term "consensus FR" refers to the framework (FR) antibody region in the consensus immunoglobulin sequence. The FR region of an antibody does not contact the antigen. As used herein, "control" refers to an alternative sample used in an experiment for comparison purposes. A control can be "positive" or "negative". For example, when the purpose of an experiment is to determine the correlation between the efficacy of a therapeutic agent for a specific type of disease or condition treatment, a positive control (a compound or composition known to exhibit the desired therapeutic effect) and a negative control (a subject or sample that does not receive the treatment or receives a placebo) are typically used.

[0028] As used herein, the term "effective amount" refers to an amount sufficient to achieve the desired therapeutic and / or prophylactic effect, e.g., an amount that results in the prevention or reduction of a disease or condition described herein or one or more signs or symptoms associated with a disease or condition described herein. In the context of therapeutic or prophylactic applications, the amount of a composition administered to a subject will vary depending on the composition, the extent, type, and severity of the disease, as well as individual characteristics such as general health, age, sex, weight, and tolerance to drugs. Those skilled in the art will be able to determine the appropriate dosage depending on these and other factors. The composition can also be administered in combination with one or more additional therapeutic compounds. In the methods described herein, a therapeutic composition can be administered to a subject with one or more signs or symptoms of RAS mutant cancer. As used herein, a "therapeutically effective amount" of a composition refers to a level of the composition that ameliorates or eliminates the physiological effects of a disease or condition. A therapeutically effective amount can be administered in one or more administrations. As used herein, "expression" includes one or more of the following: transcription of a gene into precursor mRNA; splicing and other processing of precursor mRNA to produce mature mRNA; mRNA stability; translation of mature mRNA into protein (including codon usage and tRNA availability); and glycosylation and / or other modifications of the translation product, if required for proper expression and function.

[0029] As used herein, the term "gene" means a segment of DNA that contains all the information for the regulated biosynthesis of an RNA product, including promoters, exons, introns, and other untranslated regions that regulate expression.

[0030] "Homology" or "identity" or "similarity" refers to the sequence similarity between two peptides or two nucleic acid molecules. Homology can be determined by comparing positions in each sequence that can be aligned for comparison purposes. If a position in the compared sequences is occupied by the same nucleic acid base or amino acid, the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. A polynucleotide or polynucleotide region (or polypeptide or polypeptide region) having a certain percentage (e.g., at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%) of "sequence identity" with another sequence means that, when aligned, that percentage of bases (or amino acids) are the same in comparing the two sequences. This alignment and percent homology or sequence identity can be determined using software programs known in the art. In some embodiments, default parameters are used for alignment. One alignment program is BLAST using default parameters. Particularly, the programs are BLASTN and BLASTP using the following default parameters: Genetic Code = Standard; Filter = None; Strand = Both; Cutoff = 60; Expectation = 10; Matrix = BLOSUM62; Display = 50 sequences; Sort = HIGH SCORE; Database = Non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS Translation + SwissProtein + SPupdate + PIR. Details of these programs can be found at the National Center for Biotechnology Information. Biologically equivalent polynucleotides are polynucleotides that share a specified percent identity and encode polypeptides with the same or similar biological activity. Two sequences are considered "unrelated" or "non-homologous" if they share less than 40% or 25% identity with each other, respectively.

[0031] As used herein, the term "hypervariable region" refers to the amino acid residues of an antibody which are responsible for antigen binding. Hypervariable regions generally consist of amino acid residues from the "complementarity determining regions" or "CDRs" (e.g., V L Around residues 24–34 (L1), 50–56 (L2), and 89–97 (L3) in V H The residues around about 31-35B (H1), 50-65B (H2), and 95-102B (H3) in the H1 sequence (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. (1991)), and / or those residues from the "hypervariable loops" (e.g., V L Residues 26–32 (L1), 50–52 (L2), and 91–96 (L3) in V H These include 26-32 (H1), 52A-55 (H2), and 96-101 (H3) in Chothia and Lesk J. Mol. Biol. 196:901-917 (1987)).

[0032] As used herein, the term "hybridize" refers to the process by which two substantially complementary nucleic acid strands (at least about 65% complementary, at least about 75%, or at least about 90% complementary over a stretch of at least 14-25 nucleotides) anneal to each other under appropriately stringent conditions to form a duplex or heteroduplex through the formation of hydrogen bonds between complementary base pairs. Nucleic acid hybridization techniques are well known in the art. See, e.g., Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, NY. Hybridization and the strength of hybridization (i.e., the strength of the association between nucleic acids) depend on the degree of complementarity between the nucleic acids, the stringency of the conditions involved, and the thermal melting temperature (T m The stringency of hybridization conditions is influenced by factors such as the degree of complementarity and the degree of complementarity. Those skilled in the art understand how to estimate and adjust the stringency of hybridization conditions so that sequences with at least the desired level of complementarity will stably hybridize, while those with lower complementarity will not hybridize. For examples of hybridization conditions and parameters, see, for example, Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, NY; Ausubel, FM et al., 1994, Current Protocols in Molecular Biology, John Wiley & Sons, Secaucus, NJ. In some embodiments, specific hybridization occurs under stringent hybridization conditions. An oligonucleotide or polynucleotide (e.g., a probe or primer) specific to a target nucleic acid "hybridizes" to the target nucleic acid under appropriate conditions.

[0033] As used herein, "oligonucleotide" refers to a molecule having a sequence of nucleobases on a backbone composed primarily of identical monomers at defined intervals. The bases are arranged on the backbone in a manner that allows binding to nucleic acids having a sequence of bases complementary to the bases of the oligonucleotide. Most common oligonucleotides have a backbone of sugar phosphate units. Oligodeoxyribonucleotides without a hydroxyl group at the 2' position and oligoribonucleotides with a hydroxyl group at the 2' position can be distinguished. Oligonucleotides may also include derivatives in which the hydrogen of the hydroxyl group is replaced with an organic group, such as an allyl group. One or more bases of an oligonucleotide may also be modified to contain a phosphorothioate linkage (e.g., one of the two oxygen atoms in the phosphate backbone not involved in the internucleotide bridge is replaced with a sulfur atom) to increase resistance to nuclease degradation. The exact size of an oligonucleotide depends on many factors, many of which depend on the ultimate function or use of the oligonucleotide. Oligonucleotides can be produced by any method, including, for example, chemical synthesis, DNA replication, restriction endonuclease digestion of plasmid or phage DNA, reverse transcription, PCR, or a combination thereof. Oligonucleotides can be modified, for example, by adding methyl groups, biotin or digoxigenin moieties, fluorescent tags, or by using radioactive nucleotides.

[0034] As used herein, the term "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal compounds, isotonic and absorption delaying compounds, and the like, that are compatible with pharmaceutical administration. Pharmaceutically acceptable carriers and their formulations are known to those skilled in the art and are described, for example, in Remington's Pharmaceutical Sciences (20th edition, ed. A. Gennaro, 2000, Lippincott, Williams & Wilkins, Philadelphia, Pa.).

[0035] As used herein, the term "polynucleotide" or "nucleic acid" refers to any RNA or DNA, which may be unmodified or modified. Polynucleotides include, but are not limited to, single-stranded and double-stranded DNA, DNA that is a mixture of single-stranded and double-stranded regions, single-stranded and double-stranded RNA, RNA that is a mixture of single-stranded and double-stranded regions, and hybrid molecules containing DNA and RNA that may be single-stranded or, more typically, double-stranded, or a mixture of single-stranded and double-stranded regions. In addition, polynucleotide refers to triple-stranded regions containing RNA or DNA or both RNA and DNA. The term polynucleotide also includes DNA or RNA containing one or more modified bases and DNA or RNA with backbones modified for stability or other reasons.

[0036] As used herein, "prevention," "preventing," or "preventing" of a disorder or condition refers to one or more compounds that, in a statistical sample, reduce the incidence of the disorder or condition in treated samples compared to untreated control samples, or delay the onset of one or more symptoms of the disorder or condition compared to untreated control samples.As used herein, preventing RAS mutant cancer includes preventing or delaying the onset of symptoms of RAS mutant cancer.As used herein, preventing RAS mutant cancer also includes preventing the recurrence of one or more signs or symptoms of RAS mutant cancer.

[0037] As used herein, the term " sample " refers to the clinical sample obtained from subject.Biological sample can include tissue, cell, cell protein or membrane extract, mucus, sputum, bone marrow, bronchoalveolar lavage fluid (BAL), bronchial lavage fluid (BW) and biological fluid (for example, ascites or cerebrospinal fluid (CSF)) that is separated from subject, and also the tissue, cell and body fluid (blood, plasma, saliva, urine, serum, etc.) that exists in subject.

[0038] As used herein, the term "separate" therapeutic use refers to the administration of at least two active ingredients by different routes at the same or substantially the same time. As used herein, the term "sequential" therapeutic use refers to the administration of at least two active ingredients at different times, and the administration route is the same or different.More specifically, sequential use refers to the complete administration of one active ingredient before the administration of the other active ingredient begins.Therefore, one active ingredient can be administered for several minutes, several hours, or several days before the administration of the other active ingredient.In this case, there is no simultaneous treatment. As used herein, the term "concurrent" therapeutic use refers to the administration of at least two active ingredients by the same route and at the same or substantially the same time. As used herein, the terms "subject," "individual," or "patient" are used interchangeably and refer to an individual organism, vertebrate, mammal, or human. In certain embodiments, the individual, patient, or subject is a human. As used herein, the terms "target sequence" and "target nucleic acid sequence" refer to a specific nucleic acid sequence that is to be modulated (eg, inhibited or downregulated). The term "TXNRD1 inhibitor" as used herein refers to an agent that inhibits the gene expression or biological activity of TXNRD1. Examples of TXNRD1 biological activities include, but are not limited to, enzymatic activity, substrate binding activity, homo- or heterodimerization activity, and binding to cellular structures. There are several different isoforms of thioredoxin reductase 1. The TXNRD1 inhibitor of the present disclosure inhibits at least one biological activity of at least one isoform. Examples of TXNRD1 inhibitors include, but are not limited to, auranofin, piperlongumine, D9, TRi-1, TRi-2, myricetin, PMX464, PX12, brevetoxin-2, manumicin A, ethaselen, aurothioglucose, protoporphyrin IX, shRNA or siRNA against TXNRD1, antisense oligonucleotides against TXNRD1, anti-TXNRD1 antibodies, or any derivatives thereof.

[0039] As used herein, "treating," "treat," or "treatment" encompasses the treatment of a disease or disorder described herein in a subject, such as a human, and includes: (i) inhibiting the disease or disorder, i.e., arresting its occurrence; (ii) alleviating the disease or disorder, i.e., causing regression of the disorder; (iii) slowing the progression of the disorder; and / or (iv) inhibiting, alleviating, or slowing the progression of one or more symptoms of the disease or disorder. In some embodiments, treatment means that the symptoms associated with the disease are, for example, alleviated, reduced, cured, or placed in remission.

[0040] It should be recognized that various modes of treatment or prevention of medical diseases and conditions as described are intended to mean "substantial," which includes not only total, but also less than total treatment or prevention, and cases where some biologically or medically relevant result is achieved. Treatment may be continuous, long-term treatment for chronic diseases, or a single or few doses for treatment of acute conditions.

[0041] TXNRD1 inhibitor of this technology The TXNRD1 protein (also known as thioredoxin reductase 1, GRIM-12, TR, TR1, TRXR1, or TXNR) is a member of the pyridine nucleotide oxidoreductase family and a component of the thioredoxin (Trx) system. TXNRD1 is a flavoenzyme that reduces thioredoxin as well as other substrates, playing an important role in redox homeostasis and selenium metabolism. TXNRD1 functions as a homodimer containing FAD and a selenocysteine ​​(Sec) at the active site. In one aspect, the present disclosure provides a composition for treating RAS mutant cancer.In some embodiments, TXNRD1 inhibitor reduces the gene expression and / or activity level of TXNRD1.In some embodiments, TXNRD1 inhibitor reduces the TXNRD1 activity selected from the group consisting of enzymatic activity, substrate binding activity, homo- or heterodimerization activity, and binding to cellular structure. In one aspect, the present disclosure provides pharmacological inhibitors, including, but not limited to, auranofin, piperlongumine, D9, TRi-1, TRi-2, myricetin, PMX464, PX12, brevetoxin-2, manumicin A, ethaselen, aurothioglucose, and protoporphyrin IX. Anti-TXNRD1 antibodies, or any derivatives thereof, may also be used in the methods disclosed herein.

[0042] In another embodiment, the present disclosure provides inhibitory RNAs (e.g., sgRNAs, antisense RNAs, or shRNAs) that inhibit TXNRD1 expression and / or activity levels. Examples of such inhibitory RNAs include: TCTAATATCATTAACACCATGG (SEQ ID NO: 1; human shTXNRD1), TAAATAAAACTGAATATGGTCA (SEQ ID NO: 2; human shTXNRD1), TTAATAATAACTTATGATATTA (SEQ ID NO: 3; human shTXNRD1), TTTGTAACAAAAATACATGGAA (SEQ ID NO: 4; human shTXNRD1), TTTAAATGAAAATCCTTCACAT (SEQ ID NO: 5; human shTXNRD1), TTTTAAATGAAAATCCTTCACA (SEQ ID NO: 6; human shTXNRD1), TAAGAAAAGAGAATCACAACAT (SEQ ID NO: 7; human shTXNRD1), TTTTCATTTATCTTCACCCCTA (SEQ ID NO: 8; human shTXNRD1), TTAGAAAGAAATAGATACCCAA (SEQ ID NO: 9; human shTXNRD1), TAATAATAACTTATGATATTAA (SEQ ID NO: 10; human shTXNRD1), TTTAGTCACAGGGTAATTCGTC (SEQ ID NO: 11; mouse shTxnrd1), and Examples include RNA having a sequence comprising TTCGTCACTGACAACGTTGTGA (SEQ ID NO: 12; mouse shTxnrd1), or any complement thereof.

[0043] The present disclosure provides antisense nucleic acids comprising a nucleic acid sequence that is complementary to and specifically hybridizes to a portion of any one of the following (i.e., TXNRD1 mRNA isoforms), thereby reducing or inhibiting TXNRD1 expression; NM_182729.2 Human (Homo sapiens) thioredoxin reductase 1 (TXNRD1), transcript variant 1, mRNA (SEQ ID NO: 13) 1 agaccctcac gtgatgacaa cagctagcaa agttctgtag ctactgcctt agggcatagt 61 ctaatttctt cagtaaaaac acacttattc caaatttggt tccagaattg ccttaaattg 121 tttttgctct gttcttaggt tgggggcggc tatgagcagg cagaggatgt ggtgtcaccc 181 aattaggagc tctcagctta cgaggcaatt agcataggtt gccagggctg cacgaggagt 241 ggatttctgc tttgtcattc tgactctggc agttagcccg cccgctcggc gcagggcgtg 301 gcttctcgta gccattagga aacagcaacc ctttcacctc agttttcttc actccggcat 361 ttgcagcaga gcgaaaggtg gtcgagtcct gaaggagggc ctgatgtctt catcattctc 421 aaattcttag gacggtcggg ccctggaagg aacgctctcg gaattggccg cggaaaccga 481 tctgcccgtt gtgtttgtga aacagagaaa gataggcggc catggtccaa ccttgaaggc 541 ttatcaggag ggcagacttc aaaagctact aaaaatgaac ggccctgaag atcttcccaa 601 gtcctatgac tatgacctta tcatcattgg aggtggctca ggaggtctgg cagctgctaa 661 ggaggcagcc caatatggca agaaggtgat ggtcctggac tttgtcactc ccacccctct 721 tggaactaga tggggtctcg gaggaacatg tgtgaatgtg ggttgcatac ctaaaaaact 781 gatgcatcaa gcagctttgt taggacaagc cctgcaagac tctcgaaatt atggatggaa 841 agtcgaggag acagttaagc atgattggga cagaatgata gaagctgtac agaatcacat 901 tggctctttg aattggggct accgagtagc tctgcgggag aaaaaagtcg tctatgagaa 961 tgcttatggg caatttattg gtcctcacag gattaaggca acaaataata aaggcaaaga 1021 aaaaatttat tcagcagaga gatttctcat tgccactggt gaaagaccac gttacttggg 1081 catccctggt gacaaagaat actgcatcag cagtgatgat cttttctcct tgccttactg 1141 cccgggtaag accctggttg ttggagcatc ctatgtcgct ttggagtgcg ctggatttct 1201 tgctggtatt ggtttagacg tcactgttat ggttaggtcc attcttctta gaggatttga 1261 ccaggacatg gccaacaaaa ttggtgaaca catggaagaa catggcatca agtttataag 1321 acagttcgta ccaattaaag ttgaacaaat tgaagcaggg acaccaggcc gactcagagt 1381 agtagctcag tccaccaata gtgaggaaat cattgaagga gaatataata cggtgatgct 1441 ggcaatagga agagatgctt gcacaagaaa aattggctta gaaaccgtag gggtgaagat 1501 aaatgaaaag actggaaaaa tacctgtcac agatgaagaa cagaccaatg tgccttacat 1561 ctatgccatt ggcgatatat tggaggataa ggtggagctc accccagttg caatccaggc 1621 aggaagattg ctggctcaga ggctctatgc aggttccact gtcaagtgtg actatgaaaa 1681 tgttccaacc actgtattta ctcctttgga atatggtgct tgtggccttt ctgaggagaa 1741 agctgtggag aagtttgggg aagaaaatat tgaggtttac catagttact tttggccatt 1801 ggaatggacg attccgtcaa gagataacaa caaatgttat gcaaaaataa tctgtaatac 1861 taaagacaat gaacgtgttg tgggctttca cgtactgggt ccaaatgctg gagaagttac 1921 acaaggcttt gcagctgcgc tcaaatgtgg actgaccaaa aagcagctgg acagcacaat 1981 tggaatccac cctgtctgtg cagaggtatt cacaacattg tctgtgacca agcgctctgg 2041 ggcaagcatc ctccaggctg gctgctgagg ttaagcccca gtgtggatgc tgttgccaag 2101 actgcaaacc actggctcgt ttccgtgccc aaatccaagg cgaagttttc tagagggttc 2161 ttgggctctt ggcacctgcg tgtcctgtgc ttaccaccgc ccaaggcccc cttggatctc 2221 ttggatagga gttggtgaat agaaggcagg cagcatcaca ctggggtcac tgacagactt 2281 gaagctgaca tttggcaggg catcgaaggg atgcatccat gaagtcacca gtctcaagcc 2341 catgtggtag gcggtgatgg aacaactgtc aaatcagttt tagcatgacc tttccttgtg 2401 gattttcttta ttctcgttgt caagttttct agggttgaat ttttttcttt tttctccatg 2461 gtgttaatga tattagagat gaaaaacgtt agcagttgat ttttgtccaa aagcaagtca 2521 tggctagagt atccatgcaa ggtgtctttgt tgcatggaag ggatagttttg gctcccttgg 2581 aggctatgta ggcttgtccc gggaaagaga actgtcctgc agctgaaatg gactgttctt 2641 tactgacctg ctcagcagtt tcttctca tatattccca aaacaagtac atctgcgatc 2701 aactctagcc aaatttgccc ctgtgtgcta catgatggat gattattatt ttaaggtctg 2761 tttaggaagg gaaatggcta cttggccagc cattgcctgg catttggtag tatagtatga 2821 ttctcaccat tatttgtcat ggaggcagac atacaccaga aatgggggag aaacagtaca 2881 tatctttctg tctttagttt attgtgtgct ggtctaagca agctgagatc atttgcaatg 2941 gaaaacacgt aacttgttta aaagtttttc tggtagcttt agctttatgc taaaaaaaat 3001 aatgacattg ggtatctatt tctttctaag actacattag taggaaaata agtcttttca 3061 tgcttatgat ttagctgttt tgtggtaatt gctttttaaa ggaagttatt aatatcataa 3121 gttattatta atattttgaa cacaggtgga tgtgaaggat tttcatttaa aaaccaagtg 3181 gttttgactt tttctgttga atgaacaact gtgccttgtg gaatttttgc agaagtgttt 3241 atgctttgtt agcatttcaa cttgcattat tataaagagg tattaatgcc tcagttatgt 3301 gtttgtcaat gtactggctg aggattctat ctcagctgtc ttttctaact gtgtaggttg 3361 agttttgaac acgtgcttgt ggacatcagg cctcctgcca gcagttcttg aagcttcttt 3421 ttcattcctg ctactctacc tgtatttctc agttgcagca ctgagtggtc aaaatacatt 3481 tctgggccac ctcagggaac ccatgcatct gcctggcatt taggcagcag agcccctgac 3541 cgtcccccac agggctctgc ctcacgtcct catctcattt ggctgtgtaa agaaatggga 3601 aaagggaaaa ggagagagca attgaggcag ttgaccatat tcagttttat ttatttattt 3661 ttaatttgtt tttttctcca agtccaccag tctctgaaat tagaacagta ggcggtatga 3721 gataatcagg cctaatcatg ttgtgattct cttttcttag tggagtggaa tgttctatcc 3781 ccacaagaag gattatatct tatagacttg tcttgttcag attctgtatt tacccatttt 3841 attgaaacat atactaagtt ccatgtattt ttgttacaaa tcttctgaaa aaaaacaaaa 3901 caatgtgaaa cattaaaatt aaaaggcatt aataatatcc acgtgtgcct tcttactgaa 3961 aaaaaaaaa

[0044] NM_182742.2 Human thioredoxin reductase 1 (TXNRD1), transcript variant 2, mRNA (SEQ ID NO: 14) 1 agaccctcac gtgatgacaa cagctagcaa agttctgtag ctactgcctt agggcatagt 61 ctaatttctt cagtaaaaac acacttattc caaatttggt tccagaattg ccttaaattg 121 tttttgctct gttcttaggt tgggggcggc tatgagcagg cagaggatgt ggtgtcaccc 181 aattaggagc tctcagctta cgaggcaatt agcataggtt gccagggctg cacgaggagt 241 ggatttctgc tttgtcattc tgactctggc agttagcccg cccgctcggc gcagggcgtg 301 gcttctcgta gccattagga aacagcaacc ctttcacctc agttttcttc actccggcat 361 ttgcagcaga gcgaaaggtg gtcgagtcct gaaggagggc ctgatgtctt catcattctc 421 aaattcttgt aagctctgcg tcgggtgaaa ccagacaaag ccgcgagccc agggatggga 481 gcacgcgggg gacggcctgc cggcggggac gacagcattg cgcctgggtg cagcagtgtg 541 cgtctcgggg aagggaagat attttaaggc gtgtctgagc agacggggag gcttttccaa 601 acccaggcag cttcgtggcg tgtgcggttt cgacccggtc acacaaagct tcagcatgtc 661 atgtggctta tcaggagggc agacttcaaa agctactaaa aatgaacggc cctgaagatc 721 ttcccaagtc ctatgactat gaccttatca tcattggagg tggctcagga ggtctggcag 781 ctgctaagga ggcagcccaa tatggcaaga aggtgatggt cctggacttt gtcactccca 841 cccctcttgg aactagatgg ggtctcggag gaacatgtgt gaatgtgggt tgcataccta 901 aaaaactgat gcatcaagca gctttgttag gacaagccct gcaagactct cgaaattatg 961 gatggaaagt cgaggagaca gttaagcatg attgggacag aatgatagaa gctgtacaga 1021 atcacattgg ctcttgaat tggggtacc gagtagctct gcgggagaa aaagtcgtct 1081 atgagaatgc ttgggcaa tttattggtc ctcacaggat taaggcaca ataataag 1141 gcaagaaaa atttattca gcagagagat ttctcattgc cactggtgaa agaccacgtt 1201 acttgggcat ccctgtgac aagaatact gcatcagcag tgatgat tctccttgc 1261 cttactgccc gggtaagacc ctggttgttg gagcatccta tgtcgcttg gagtgcgctg 1321 gatttcttgc tgttattggt ttagacgtca ctgttatggt taggtccatt cttcttagag 1381 gatttgacca ggacatggcc aaaaaattg gtgacacat ggagacat ggcatcaagt 1441 ttataagaca gttcgtacca attaaagttg aacaattga agcagggaca ccaggccgac 1501 tcagagtagt agctcagtcc accatagtg aggaatcat tgaggagaa tataatacgg 1561 tgatgctggc ataggaaga gatgcttgca caaaaaat tggcttagaa accgtagggg 1621 tgaagaaa tgaaagact ggaaaaatac ctgtcacaga tgaagacag accaatgtgc 1681 cttacatcta tgccattggc gatatattgg aggataggt ggagctcacc ccagttgcaa 1741 tccaggcagg aagattgctg gctcagaggc tctatgcagg ttccactgtc aagtgtgact 1801 atgaaaatgt tccaaccact gtatttactc ctttggaata tggtgcttgt ggcctttctg 1861 aggagaaagc tgtggagaag tttggggaag aaaatattga ggtttaccat agttactttt 1921 ggccattgga atggacgatt ccgtcaagag ataacaacaa atgttatgca aaataatct 1981 gtaatactaa agacaatgaa cgtgttgtgg gctttcacgt actgggtcca aatgctggag 2041 aagttacaca aggctttgca gctgcgctca aatgtggact gaccaaaaag cagctggaca 2101 gcacaattgg aatccaccct gtctgtgcag aggtattcac aacattgtct gtgaccaagc 2161 gctctggggc aagcatcctc caggctggct gctgaggtta agccccagtg tggatgctgt 2221 tgccaagact gcaaaccact ggctcgtttc cgtgcccaaa tccaaggcga agttttctag 2281 agggttcttg ggctcttggc acctgcgtgt cctgtgctta ccaccgccca aggccccctt 2341 ggatctcttg gataggagtt ggtgaataga aggcaggcag catcacactg gggtcactga 2401 cagacttgaa gctgacattt ggcagggcat cgaagggatg catccatgaa gtcaccagtc 2461 tcaagcccat gtggtaggcg gtgatggaac aactgtcaaa tcagttttag catgaccttt 2521 ccttgtggat tttcttattc tcgttgtcaa gttttctagg gttgaattttt tttcttttt 2581 ctccatggtg ttaatgatat tagagatgaa aaacgttagc agttgatttt tgtccaaaag 2641 caagtcatgg ctagagtatc catgcaaggt gtcttgttgc atggaaggga tagtttggct 2701 cccttggagg ctatgtaggc ttgtcccggg aaagagaact gtcctgcagc tgaaatggac 2761 tgttctttac tgacctgctc agcagtttct tctctcatat attcccaaaa caagtacatc 2821 tgcgatcaac tctagccaaa tttgcccctg tgtgctacat gatggatgat tattatttta 2881 aggtctgttt aggaagggaa atggctactt ggccagccat tgcctggcat ttggtagtat 2941 agtatgattc tcaccattat ttgtcatgga ggcagacata caccagaaat gggggagaaa 3001 cagtacatat ctttctgtct ttagtttatt gtgtgctggt ctaagcaagc tgagatcatt 3061 tgcaatggaa aacacgtaac ttgtttaaaa gttttctgg tagctttagc tttatgctaa 3121 aaaaaataat gacattgggt atctatttct ttctaagact acattagtag gaaaataagt 3181 cttttcatgc ttatgatta gctgttttgt ggtaattgct ttttaaagga agttattaat 3241 atcataagtt attattaata ttttgaacac aggtggatgt gaaggatttt catttaaaaa 3301 ccaagtggtt ttgacttttt ctgttgaatg aacaactgtg ccttgtggaa tttttgcaga 3361 agtgttatg ctttgttagc atttcaactt gcattattat aaagaggtat taatgcctca 3421 gttatgtgtt tgtcaatgta ctggctgagg attctatctc agctgtcttt tctaactgtg 3481 taggttgagt ttgaacacg tgcttgtgga catcaggcct cctgccagca gttcttgaag 3541 cttctttttc attcctgcta ctctacctgt attctcagt tgcagcactg agtggtcaaa 3601 atacatttct gggccacctc agggaaccca tgcatctgcc tggcatttag gcagcagagc 3661 ccctgaccgt cccccacagg gctctgcctc acgtcctcat ctcatttggc tgtgtaaaga 3721 aatgggaaaa gggaaaagga gagagcaatt gaggcagttg accatattca gttttattta 3781 tttattttta atttgttttt ttctccaagt ccaccagtct ctgaaattag aacagtaggc 3841 ggtatgagat aatcaggcct aatcatgttg tgattctctt ttcttagtgg agtggaatgt 3901 tctatcccca caagaaggat tatatcttat agacttgtct tgttcagatt ctgtatttac 3961 ccattttatt gaaacatata ctaagttcca tgtatttttg ttacaaatct tctgaaaaaa 4021 aacaaaacaa tgtgaaacat taaaattaaa aggcattaat aatatccacg tgtgccttct 4081 tactgaaaaa aaaaaa

[0045] Human thioredoxin reductase 1 (TXNRD1), transcript variant 3, mRNA NCBI reference sequence: NM_182743.2 (SEQ ID NO: 15) 1 agaccctcac gtgatgacaa cagctagcaa agttctgtag ctactgcctt agggcatagt 61 ctaatttctt cagtaaaaac acacttattc caaatttggt tccagaattg ccttaaattg 121 tttttgctct gttcttaggt tgggggcggc tatgagcagg cagaggatgt ggtgtcaccc 181 aattaggagc tctcagctta cgaggcaatt agcataggtt gccagggctg cacgaggagt 241 ggatttctgc tttgtcattc tgactctggc agttagcccg cccgctcggc gcagggcgtg 301 gcttctcgta gccattagga aacagcaacc ctttcacctc agttttcttc actccggcat 361 ttgcagcaga gcgaaaggtg gtcgagtcct gaaggagggc ctgatgtctt catcattctc 421 aaattcttgc ttcaggag ggcagacttc aaagctact aaaatgaac ggccctgaag 481 atctccca gtcctatgac tatgacctta tcatcattgg aggtggctca ggaggtgg 541 cagctgctaa ggaggcagcc caatgcca agaggtgat ggtcctggac ttgtcactc 601 caccacctct tggaactaga tggtctcg gaggaacatg tgtgaatg tggttgcatac 661 ctaaaaaact gatgcatca gcagctttgt taggacaagc cctgcagac tctcgaatt 721 atgatggaa agtcgaggag acagttaagc atgattggga cagaatgata gaagctgtac 781 agaatcacat tggctttg aattggggct accgagtagc tctcgggag aaaaagtcg 841 tctatgagaa tgcttatggg caatttattg gtcctcacag gattaggca acaatata 901 aaggcaaga aaaaatttat tcagcagaga gatttctcat tgccactggt gaagaccac 961 gttacttggg catccctggt gataagaat acctcatcag cagtgat cttttctcct 1021 tgccttactg cccgggtaag accctgttg tggagcatc ctagtcgct tggagtgcg 1081 ctggattct tgctgtatt gtttagacg tcacttt ggttaggtcc attctctta 1141 gaggatttga ccaggacatg gccaacaaaa ttggtgaaca catggaagaa catggcatca 1201 agtttataag acagttcgta ccaattaaag ttgaacaaat tgaagcaggg acaccaggcc 1261 gactcagagt agtagctcag tccaccaata gtgaggaaat cattgaagga gaatataata 1321 cggtgatgct ggcaatagga agagatgctt gcacaagaaa aattggctta gaaaccgtag 1381 gggtgaagat aaatgaaaag actggaaaaa tacctgtcac agatgaagaa cagaccaatg 1441 tgccttacat ctatgccatt ggcgatatat tggaggataa ggtggagctc accccagttg 1501 caatccaggc aggaagattg ctggctcaga ggctctatgc aggttccact gtcaagtgtg 1561 actatgaaaa tgttccaacc actgtattta ctcctttgga atatggtgct tgtggccttt 1621 ctgaggagaa agctgtggag aagtttgggg aagaaaatat tgaggtttac catagttact 1681 tttggccatt ggaatggacg attccgtcaa gagataacaa caaatgttat gcaaaaataa 1741 tctgtaatac taaagacaat gaacgtgttg tgggctttca cgtactgggt ccaaatgctg 1801 gagaagttac acaaggcttt gcagctgcgc tcaaatgtgg actgaccaaa aagcagctgg 1861 acagcacaat tggaatccac cctgtctgtg cagaggtatt cacaacattg tctgtgacca 1921 agcgctctgg ggcaagcatc ctccaggctg gctgctgagg ttaagcccca gtgtggatgc 1981 tgttgccaag actgcaaacc actggctcgt ttccgtgccc aaatccaagg cgaagttttc 2041 tagaggttc ttgggctctt ggcacctgcg tgtcctgtgc ttaccaccgc ccaaggcccc 2101 cttggatctc ttggatagga gttggtgaat agaaggcagg cagcatcaca ctggggtcac 2161 tgacagactt gaagctgaca tttggcaggg catcgaaggg atgcatccat gaagtcacca 2221 gtctcaagcc catgtggtag gcggtgatgg aacaactgtc aaatcagttt tagcatgacc 2281 tttccttgtg gattttctta ttctcgttgt caagttttct agggttgaat ttttttcttt 2341 tttctccatg gtgttaatga tattagagat gaaaaacgtt agcagttgat ttttgtccaa 2401 aagcaagtca tggctagagt atccatgcaa ggtgtctttgt tgcatggaag ggatagtttg 2461 gctcccttgg aggctatgta ggcttgtccc gggaaagaga actgtcctgc agctgaaatg 2521 gactgttctt tactgacctg ctcagcagtt tcttcttca tatattccca aaacaagtac 2581 atctgcgatc aactctagcc aaatttgccc ctgtgtgcta catgatggat gattattatt 2641 ttaaggtctg tttaggaagg gaaatggcta cttggccagc cattgcctgg catttggtag 2701 tatagtatga ttctcaccat tatttgtcat ggaggcagac atacaccaga aatgggggag 2761 aaacagtaca tatctttctg tctttagttt attgtgtgct ggtctaagca agctgagatc 2821 atttgcaatg gaaaacacgt aacttgttta aaagtttttc tggtagcttt agctttatgc 2881 taaaaaaaat aatgacattg ggtatctatt tctttctaag actacattag taggaaaata 2941 agtcttttca tgcttatgat ttagctgttt tgtggtaatt gctttttaaa ggaagttatt 3001 aatatcataa gttattatta atattttgaa cacaggtgga tgtgaaggat tttcatttaa 3061 aaaccaagtg gttttgactt tttctgttga atgaacaact gtgccttgtg gaatttttgc 3121 agaagtgttt atgctttgtt agcatttcaa cttgcattat tataaagagg tattaatgcc 3181 tcagttatgt gtttgtcaat gtactggctg aggattctat ctcagctgtc ttttctaact 3241 gtgtaggttg agttttgaac acgtgcttgt ggacatcagg cctcctgcca gcagttcttg 3301 aagcttcttt ttcattcctg ctactctacc tgtatttctc agttgcagca ctgagtggtc 3361 aaaatacatt tctgggccac ctcagggaac ccatgcatct gcctggcatt taggcagcag 3421 agcccctgac cgtccccac agggctctgc ctcacgtcct catctcattt ggctgtgtaa 3481 agaaatggga aaagggaaaa ggagagagca attgaggcag ttgaccatat tcagttttat 3541 ttattattt ttaatttgtt tttttctcca agtccaccag tctctgaaat tagaacagta 3601 ggcggtatga gataatcagg cctaatcatg ttgtgattct cttttcttag tggagtggaa 3661 tgttctatcc ccacaagaag gattatatct tatagacttg tcttgttcag attctgtatt 3721 tacccatttt attgaaacat atactaagtt ccatgtattt ttgttacaaa tcttctgaaa 3781 aaaaacaaaa caatgtgaaa cattaaaatt aaaaggcatt aataatatcc acgtgtgcct 3841 tcttactgaa aaaaaaaaa

[0046] Human thioredoxin reductase 1 (TXNRD1), transcript variant 4, mRNA NCBI reference sequence: NM_003330.3 (SEQ ID NO: 16) 1 agaccctcac gtgatgacaa cagctagcaa agttctgtag ctactgcctt agggcatagt 61 ctaatttctt cattaaaac acacttattc caaatttggt tccagaattg ccttaaattg 121 tttttgctct gttcttaggt tggggcggc tatgagcagg cagaggatgt ggtgtcaccc 181 aattaggagc tctcagctta cgaggcaatt agcataggtt gccagggctg cacgagggt 241 ggatttctgc tttgtcattc tgactctggc agttagcccg cccgctcggc gcagggcgtg 301 gcttctcgta gccattagga aacagcaacc ctttcacctc agttttcttc actccggcat 361 ttgcagcaga gcgaaaggtg gtcgagtcct gaaggaggc ctgatgtctt catcattctc 421 aaattcttgt aagctctgcg tcgggtgaaa ccagacaaag ccgcgagccc agggatggga 481 gcagcggggg gacggcctgc cggcggggac gacagcattg cgcctgggtg cagcagtgtg 541 cgtctcgggg aagggagaat attttaaggc gtgtctgagc agacggggag gcttttccaa 601 acccaggcag cttcgtggcg tgtgcggttt cgacccggtc acaaaagct tcagcatgtc 661 atgtgaggac ggtcgggccc tggaggaac gctctcggaa ttggccgcgg aaaccgatct 721 gcccgttgtg tttgtgaaac agaaagat aggcggccat ggtccaacct tgaaggctta 781 tcaggagggc agacttcaaa agctactaaa aatgaacggc cctgaagatc ttcccaagtc 841 ctatgactat gaccttatca tcattggagg tggctcagga ggtctggcag ctgctaagga 901 ggcagcccaa tatggcaaga aggtgatggt cctggacttt gtcactccca cccctcttgg 961 aactagatgg ggtctcggag gaacatgtgt gaatgtgggt tgcataccta aaaaactgat 1021 gcatcaagca gctttgttag gacaagccct gcaagactct cgaaattatg gatggaaagt 1081 cgaggagaca gttaagcatg attgggacag aatgatagaa gctgtacaga atcacattgg 1141 ctctttgaat tggggctacc gagtagctct gcgggagaaa aaagtcgtct atgagaatgc 1201 ttatgggcaa tttattggtc ctcacaggat taaggcaaca aataataaag gcaaagaaaa 1261 aatttattca gcagagagat ttctcattgc cactggtgaa agaccacgtt acttgggcat 1321 ccctggtgac aaagaatact gcatcagcag tgatgatctt ttctccttgc cttactgccc 1381 gggtaagacc ctggttgttg gagcatccta tgtcgctttg gagtgcgctg gatttcttgc 1441 tggtattggt ttagacgtca ctgttatggt taggtccatt cttcttagag gatttgacca 1501 ggacatggcc aacaaaattg gtgaacacat ggaagacat ggcatcaagt ttataagaca 1561 gttcgtacca attaaagttg aacaaattga agcaggaca ccaggccgac tcagagtagt 1621 agctcagtcc accaatagtg aggaatcat tgaaggaga fathercgg tgatgctggc 1681 aataggaaga gatgcttgca caagaaaaat tggcttagaa accgtagggg tgaagataaa 1741 tgaaagact ggaaaaatac ctgtcacaga tgaagaacag accaatgtgc cttacatcta 1801 tgccattggc gatatattgg aggataaggt ggagctcacc ccagttgcaa tccaggcagg 1861 aagattgctg gctcagaggc tctatgcagg ttccactgtc aagtgtgact atgaaaatgt 1921 tccaaccact gtatttactc ctttggaata tggtgcttgt ggcctttctg aggagaaagc 1981 tgtggagag tttggggag aaaatattga ggttttaccat agttactttt ggccattgga 2041 atggacgatt ccgtcaagag father atgttatgca aaaatatct gtaatactaa 2101 cgtgttgtgg gctttcacgt actgggtcca aatgctggag aagttacaca 2161 aggctttgca gctgcgctca aatgtggact gaccaaaaag cagctggaca gcacaattgg 2221 aatccaccct gtctgtgcag aggtattcac aacattgtct gtgaccaagc gctctggggc 2281 aagcatcctc caggctggct gctgaggtta agccccagtg tggatgctgt tgccaagact 2341 gcaaaccact ggctcgtttc cgtgcccaaa tccaaggcga agttttctag agggttcttg 2401 ggctcttggc acctgcgtgt cctgtgctta ccaccgccca aggccccctt ggatctcttg 2461 gataggagtt ggtgaataga aggcaggcag catcacactg gggtcactga cagacttgaa 2521 gctgacattt ggcagggcat cgaagggatg catccatgaa gtcaccagtc tcaagcccat 2581 gtggtaggcg gtgatggaac aactgtcaaa tcagttttag catgaccttt ccttgtggat 2641 tttcttattc tcgttgtcaa gttttctagg gttgaatttt tttctttttt ctccatggtg 2701 ttaatgatat tagagatgaa aaacgttagc agttgatttt tgtccaaaag caagtcatgg 2761 ctagagtatc catgcaaggt gtcttgttgc atggaaggga tagtttggct cccttggagg 2821 ctatgtaggc ttgtcccggg aaagagaact gtcctgcagc tgaaatggac tgttctttac 2881 tgacctgctc agcagtttct tctctcatat attcccaaaa caagtacatc tgcgatcaac 2941 tctagccaaa tttgcccctg tgtgctacat gatggatgat tattatttta aggtctgttt 3001 aggaagggaa atggctactt ggccagccat tgcctggcat ttggtagtat agtatgattc 3061 tcaccattat ttgtcatgga ggcagacata caccagaaat gggggagaaa cagtacatat 3121 ctttctgtct ttagtttatt gtgtgctggt ctaagcaagc tgagatcatt tgcaatggaa 3181 aacacgtaac ttgtttaaaa gttttctgg tagctttagc tttatgctaa aaaaaataat 3241 gacattgggt atctatttct ttctaagact acattagtag gaaaataagt cttttcatgc 3301 ttatgatta gctgttttgt ggtaattgct ttttaaagga agttattaat atcataagtt 3361 attattaata ttttgaacac aggtggatgt gaaggatttt catttaaaaa ccaagtggtt 3421 ttgacttttt ctgttgaatg aacaactgtg ccttgtggaa tttttgcaga agtgttatg 3481 ctttgttagc atttcaactt gcattattat aaagaggtat taatgcctca gttatgtgtt 3541 tgtcaatgta ctggctgagg attctatctc agctgtcttt tctaactgtg taggttgagt 3601 tttgaacacg tgcttgtgga catcaggcct cctgccagca gttcttgaag cttctttttc 3661 attcctgcta ctctacctgt atttctcagt tgcagcactg agtggtcaaa atacatttct 3721 gggccacctc agggaaccca tgcatctgcc tggcatttag gcagcagagc ccctgaccgt 3781 cccccacagg gctctgcctc acgtcctcat ctcatttggc tgtgtaaaga aatgggaaaa 3841 gggaaaagga gagagcaatt gaggcagttg accatattca gttttattta tttattttta 3901 atttgttttt ttctccaagt ccaccagtct ctgaaattag aacagtaggc ggtatgagat 3961 aatcaggcct aatcatgttg tgattctctt ttcttagtgg agtggaatgt tctatcccca 4021 caagaaggat tatatcttat agacttgtct tgttcagatt ctgtatttac ccattttatt 4081 gaaacatata ctaagttcca tgtatttttg ttacaaatct tctgaaaaaa aacaaaacaa 4141 tgtgaaacat taaaattaaa aggcattaat aatatccacg tgtgccttct tactgaaaaa 4201 aaaaaa

[0047] Human thioredoxin reductase 1 (TXNRD1), transcript variant 5, mRNA NCBI Reference Sequence: NM_001261445.1 (SEQ ID NO: 17) 1 agaccctcac gtgatgacaa cagctagcaa agttctgtag ctactgcctt agggcatagt 61 ctaatttctt cattaaaac acacttattc caaatttggt tccagaattg ccttaaattg 121 tttttgctct gttcttaggt tggggcggc tatgagcagg cagaggatgt ggtgtcaccc 181 aattaggagc tctcagctta cgaggcaatt agcataggtt gccagggctg cacgagggt 241 ggatttctgc tttgtcattc tgactctggc agttagcccg cccgctcggc gcagggcgtg 301 gcttctcgta gccattagga aacagcaacc ctttcacctc agttttcttc actccggcat 361 ttgcagcaga gcgaaaggtg gtcgagtcct gaaggaggc ctgatgtctt catcattctc 421 aaattcttgt aagctctgcg tcgggtgaaa ccagacaaag ccgcgagccc agggatggga 481 gcagcggggg gacggcctgc cggcggggac gacagcattg cgcctgggtg cagcagtgtg 541 cgtctcgggg aagggagaat attttaaggc gtgtctgagc agacggggag gcttttccaa 601 acccaggcag cttcgtggcg tgtgcggttt cgacccggtc acaaaagct tcagcatgtc 661 atgtggtagg tgaggccggc gcctgtaggc tggcggtttc cttctctcttg gtctttgtag 721 781 cggaattggc cgcggaacc gatctgcccg tgtgttgt gaacagaga aagataggcg 841 gccatggtcc aaccttgaag gcttatcagg agggcagact tcaaagcta ctaaaaatga 901 acggccctga agatctccc aagtcctatg actatgacct tatcatt ggaggtggct 961 caggaggtct gcagctgct aaggaggcag cccaatatgg caggaggtg atggtcctgg 1021 acttgtcac tcccacct cttggaacta gatggggtct cggaggaca tgtgtgaatg 1081 tgggttgcat acctaaaaa ctgatgcatc aagcagcttt gttaggacaa gccctgcaag 1141 actctcgaaa ttatggatgg aaagtcgagg agacagttaa gcatgatgg gacagaatga 1201 tagagctgt acagaatcac attggctctt tgaattgggg ctaccgagta gctctgcggg 1261 agaaaaagt cgtctatgag aatgcttag ggcaatttat tggtcctcac aggattaagg 1321 c'aaaata taaggcaaaaaaaattt attcagcaga gagatttc attgccactg 1381 gtgaaagacc acgttacttg gcatccctg gtgacaaga attackacccatc agcagtgatg 1441 atctttctc cttgccttac tgccggta agaccctgt tgttggagca tcctatgtcg 1501 ctttggagtg cgctggattt cttgctggta ttggtttaga cgtcactgtt atggttaggt 1561 cattcttct tagaggattt gaccaggaca tggccaacaa aattggtgaa cacatggaag 1621 aacatggcat caagtttata agacagttcg taccaattaa agttgaacaa attgaagcag 1681 ggacaccagg ccgactcaga gtagtagctc agtccaccaa tagtgaggaa atcattgaag 1741 gagaatataa tacggtgatg ctggcaatag gaagagatgc ttgcacaaga aaaattggct 1801 tagaaccgt aggggtgaag ataaatgaaa agactggaaa aatacctgtc acagatgaag 1861 aacagaccaa tgtgccttac atctatgcca ttggcgatat attggaggat aaggtggagc 1921 tcaccccagt tgcaatccag gcaggaagat tgctggctca gaggctctat gcaggttcca 1981 ctgtcaagtg tgactatgaa aatgttccaa ccactgtatt tactcctttg gaatatggtg 2041 cttgtggcct ttctgaggag aaagctgtgg agaagttttgg ggaagaaaat attgaggtttt 2101 accatagtta cttttggcca ttggaatgga cgattccgtc aagagataac aacaaatgtt 2161 atgcaaaaat aatctgtaat actaaagaca atgaacgtgt tgtgggcttt cacgtactgg 2221 gtccaaatgc tggagaagtt acacaaggct ttgcagctgc gctcaaatgt ggactgacca 2281 aaaagcagct ggacagcaca attggaatcc accctgtctg tgcagaggta ttcacaacat 2341 tgtctgtgac caagcgctct ggggcaagca tcctccaggc tggctgctga ggttaagccc 2401 cagtgtggat gctgttgcca agactgcaaa ccactggctc gtttccgtgc ccaaatccaa 2461 ggcgaagttt tctagagggt tcttgggctc ttggcacctg cgtgtcctgt gcttaccacc 2521 gcccaaggcc cccttggatc tcttggatag gagttggtga atagaaggca ggcagcatca 2581 cactggggtc actgacagac ttgaagctga catttggcag ggcatcgaag ggatgcatcc 2641 atgaagtcac cagtctcaag cccatgtggt aggcggtgat ggaacaactg tcaaatcagt 2701 tttagcatga cctttccttg tggattttct tattctcgtt gtcaagtttt ctagggttga 2761 atttttttct tttttctcca tggtgttaat gatattagag atgaaaaacg ttagcagttg 2821 atttttgtcc aaaagcaagt catggctaga gtatccatgc aaggtgtctt gttgcatgga 2881 agggatagtt tggctccctt ggaggctatg taggcttgtc ccgggaaaga gaactgtcct 2941 gcagctgaaa tggactgttc tttactgacc tgctcagcag ttctctct catatattcc 3001 caaacaagt acatctgcga tcaatctag cccaatttgc acctgtgtgc tacatgatgg 3061 atgattatta tttaaggtc tgtttaggaa gggaatgc tacttggcca gccattgcct 3121 ggcattgt agtatagtat gattctcacc attatttgtc atggaggcag acatacacca 3181 gaatggggg agaacagta catatctttc tgtctttagt ttattgtg ctggtctaag 3241 caagctgaga tcattgcaa tggaaacac gtaactgtt taaagtttt tctgtagct 3301 tttagttat gctaaaaaaa atatgacat tggtatcta tttcttcta agactacatt 3361 agtaggaaaa taagtctttt catgcttatg atttagctgtttgtgtaa ttgcttttta 3421 aaggagtta tattatcat aagttatt taatattg aacacaggtg gatgtgagg 3481 atttcattt aaaaaccaag tggtttgac ttttctgtt gatgaacaa ctgtgccttg 3541 tggaatttt gcagaagtgt ttatgctttg ttagcattc aacttgcatt attataaaga 3601 gttattaatg cctcagttat gtgtttgtca atgtactggc tgaggattct atctcagctg 3661 tcttttctaa ctgtgtaggt tgagttttga acacgtgctt gtggacatca ggcctcctgc 3721 cagcagttct tgaagcttct tttcattc tgctactcta cctgtatttc tcagttgcag 3781 cactgagtgg tcaaaataca tttctgggcc acctcaggga acccatgcat ctgcctggca 3841 tttaggcagc agagcccctg accgtccccc acagggctct gcctcacgtc ctcatctcat 3901 ttggctgtgt aaagaaatgg gaaaagggaa aaggagagag caattgaggc agttgaccat 3961 attcagtttt atttatttat ttttaatttg ttttttctc caagtccacc agtctctgaa 4021 attagaacag taggcggtat gagataatca ggcctaatca tgttgtgatt ctctttctt 4081 agtggagtgg aatgttctat ccccacaaga aggattatat cttatagact tgtcttgttc 4141 agattctgta tttacccatt ttattgaaac atatactaag ttccatgtat tttgttaca 4201 aatcttctga aaaaaaacaa aacaatgtga aacattaaaa ttaaaaggca ttaataatat 4261 ccacgtgtgc cttcttactg aaaaaaaaa a

[0048] TXNRD1 (TXNRD1) mRNA NCBI dataset:NM_001261446.1(dataset 18) 1 agaccctcac gtgatgacaa cagctagcaa agttctgtag ctactgcctt agggcatagt 61 ctaatttctt cattaaaac acacttattc caaatttggt tccagaattg ccttaaattg 121 tttttgctct gttcttaggt tggggcggc tatgagcagg cagaggatgt ggtgtcaccc 181 aattaggagc tctcagctta cgaggcaatt agcataggtt gccagggctg cacgagggt 241 ggatttctgc tttgtcattc tgactctggc agttagcccg cccgctcggc gcagggcgtg 301 gcttctcgta gccattagga aacagcaacc ctttcacctc agttttcttc actccggcat 361 ttgcagcaga gcgaaaggtg gtcgagtcct gaaggaggc ctgatgtctt catcattctc 421 aaattcttag gacggtcggg ccctggaagg aacgctctcg gaattggccg cggaaaccga 481 541 ggcagcccaa tatggcaaga aggtgatggt cctggacttt gtcactccca cccctcttgg 601 aactagatgg ggtctcggag gaacatgtgt gaatgtgggt tgcataccta aaaaactgat 661 gcatcaagca gctttgttag gacaagccct gcaagactct cgaaattatg gatggaaagt 721 cgaggagaca gttaagcatg attgggacag aatgatagaa gctgtacaga atcacattgg 781 ctctttgaat tggggctacc gagtagctct gcgggagaaa aaagtcgtct atgagaatgc 841 tttgggcaa tttattggtc ctcacaggat taaggcaaca aataataaag gcaaagaaaa 901 aatttattca gcagagagat ttctcattgc cactggtgaa agaccacgtt acttgggcat 961 ccctggtgac aaagaatact gcatcagcag tgatgatctt ttctccttgc cttactgccc 1021 gggtaagacc ctggttgttg gagcatccta tgtcgctttg gagtgcgctg gatttcttgc 1081 tggtattggt ttagacgtca ctgttatggt taggtccatt cttcttagag gatttgacca 1141 ggacatggcc aacaaaattg gtgaacacat ggaagaacat ggcatcaagt ttataagaca 1201 gttcgtacca attaaagttg aacaaattga agcagggaca ccaggccgac tcagagtagt 1261 agctcagtcc accaatagtg aggaaatcat tgaaggagaa tataatacgg tgatgctggc 1321 aataggaaga gatgcttgca caagaaaaat tggcttagaa accgtagggg tgaagataaa 1381 tgaaaagact ggaaaatac ctgtcacaga tgaagaacag accaatgtgc cttacatcta 1441 tgccattggc gatatattgg aggataaggt ggagctcacc ccagttgcaa tccaggcagg 1501 aagattgctg gctcagaggc tctatgcagg ttccactgtc aagtgtgact atgaaaatgt 1561 tccaaccact gtatttactc ctttggaata tggtgcttgt ggcctttctg aggagaaagc 1621 tgtggagaag tttggggaag aaaatattga ggtttaccat agttactttt ggccattgga 1681 atggacgatt ccgtcaagag ataacaacaa atgttatgca aaaataatct gtaatactaa 1741 agacaatgaa cgtgttgtgg gctttcacgt actgggtcca aatgctggag aagttacaca 1801 aggctttgca gctgcgctca aatgtggact gaccaaaaag cagctggaca gcacaattgg 1861 aatccaccct gtctgtgcag aggtattcac aacattgtct gtgaccaagc gctctggggc 1921 aagcatcctc caggctggct gctgaggtta agccccagtg tggatgctgt tgccaagact 1981 gcaaaccact ggctcgtttc cgtgcccaaa tccaaggcga agttttctag agggttcttg 2041 ggctcttggc acctgcgtgt cctgtgctta ccaccgccca aggccccctt ggatctcttg 2101 gataggagtt ggtgaataga aggcaggcag catcacactg gggtcactga cagacttgaa 2161 gctgacattt ggcagggcat cgaagggatg catccatgaa gtcaccagtc tcaagcccat 2221 gtggtaggcg gtgatggaac aactgtcaaa tcagttttag catgaccttt ccttgtggat 2281 tttctttattc tcgttgtcaa gttttctagg gttgaattttt tttcttttt ctccatggtg 2341 ttaatgatat tagagatgaa aaacgttagc agttgatttt tgtccaaaag caagtcatgg 2401 ctagagtatc catgcaaggt gtcttgttgc atggaaggga tagtttggct cccttggagg 2461 ctatgtaggc ttgtcccggg aaagagaact gtcctgcagc tgaaatggac tgttctttac 2521 tgacctgctc agcagttt tctctcatat attcccaaaa caagtacatc tgcgatcaac 2581 tctagccaaa tttgcccctg tgtgctacat gatggatgat tattatttta aggtctgttt 2641 aggaagggaa atggctactt ggccagccat tgcctggcat ttggtagtat agtatgattc 2701 tcaccattat ttgtcatgga ggcagacata caccagaaat gggggagaaa cagtacatat 2761 ctttctgtct ttagtttatt gtgtgctggt ctaagcaagc tgagatcatt tgcaatggaa 2821 aacacgtaac ttgtttaaaa gttttctgg tagctttagc tttatgctaa aaaaaataat 2881 gacattgggt atctatttct ttctaagact acattagtag gaaaataagt cttttcatgc 2941 ttatgattta gctgttttgt ggtaattgct ttttaaagga agttattaat atcataagtt 3001 attattaata ttttgaacac aggtggatgt gaaggatttt catttaaaaa ccaagtggtt 3061 ttgacttttt ctgttgaatg aacaactgtg ccttgtggaa tttttgcaga agtgttatg 3121 ctttgttagc atttcaactt gcattattat aaagaggtat taatgcctca gttatgtgtt 3181 tgtcaatgta ctggctgagg attctatctc agctgtcttt tctaactgtg taggttgagt 3241 ttgaacacg tgcttgtgga catcaggcct cctgccagca gttcttgaag cttctttttc 3301 attcctgcta ctctacctgt atttctcagt tgcagcactg agtggtcaaa atacatttct 3361 gggccacctc agggaaccca tgcatctgcc tggcatttag gcagcagagc ccctgaccgt 3421 cccccacagg gctctgcctc acgtcctcat ctcatttggc tgtgtaaaga aatgggaaaa 3481 gggaaaagga gagagcaatt gaggcagttg accatattca gttttattta tttattttta 3541 atttgttttt ttctccaagt ccaccagtct ctgaaattag aacagtaggc ggtatgagat 3601 aatcaggcct aatcatgttg tgattctctt ttcttagtgg agtggaatgt tctatcccca 3661 caagaaggat tatatcttat agacttgtct tgttcagatt ctgtatttac ccattttatt 3721 gaaacatata ctaagttcca tgtatttttg ttacaaatct tctgaaaaaa aacaaaacaa 3781 tgtgaaacat taaaattaaa aggcattaat aatatccacg tgtgccttct tactgaaaaa 3841 aaaaaa

[0049] Human thioredoxin reductase 1 (TXNRD1), transcript variant 7, mRNA NCBI Reference Sequence: NM_001093771.3 (SEQ ID NO: 19) 1 agttcccaca gggccttgtg cgacatgggc tgcgccgagg gcaaggcagt ggcggcggcc 61 gccccaacgg agctgcagac gaaaggcaag aacggcgatg gccgccgtag gtcagctaaa 121 gatcatcacc ctggtaaaac tttgccagag aacccagcag gattcaccag cacggccact 181 gcagactcca gagccctgct tcaggcctat atagatggtc actctgtggt catcttcagt 241 aggtccacat gcacacgctg tactgaggta aagaagttat ttaaatctct gtgtgttcct 301 tattttgtgc ttgaacttga tcaaacagag gacggtcggg ccctggaagg aacgctctcg 361 gattggccg cggaaaccga tctgccgtt gtgttgtga aacagagaaa gataggcggc 421 catggtccaa ccttgaggc ttcaggag ggcagacttc aaaagctact aaaaatgaac 481 gccctgaag atctcccaa gtcctatgac tatgaccta tcatcattgg aggtggctca 541 ggaggtctgg cagctgctaa ggaggcagcc caatggca agaggtgat ggtcctggac 601 ttgtcactc caccacctct tggaactaga tggtctcg gaggaacatg tgtgaatgtg 661 gttgcatac ctaaaaaact gatgcatca gcagctttgt taggacaagc cctgcaagc 721 tctcgaatt atgaatggaa agtcgaggag acagttaagc atgattggga cagaatgata 781 gaagctgtac agaatcacat tggctttg aattggggct accgagtagc tctcgggag 841 aaaaagtcg tctatgagaa tgcttatggg caatttattg gtcctcacag gatttaggca 901 aaataata aaggcaaga aaaaatttat tcagcagaga gatttctcat tgccactggt 961 gaaagaccac gttacttggg catccctggt gaaagaat actgcatcag cagtgatgat 1021 cttttctcct tgccttactg cccgggtaag accctggttg tggagcatc ctatgtcgct 1081 ttggagtgcg ctggatttct tgctggtatt ggtttagacg tcactgttat ggttaggtcc 1141 attcttctta gaggatttga ccaggacatg gccaacaaaa ttggtgaaca catggaagaa 1201 catggcatca agtttataag acagttcgta ccaattaaag ttgaacaaat tgaagcaggg 1261 acaccaggcc gactcagagt agtagctcag tccaccaata gtgaggaaat cattgaagga 1321 gaatataata cggtgatgct ggcaatagga agagatgctt gcacaagaaa aattggctta 1381 gaaaccgtag gggtgaagat aaatgaaaag actggaaaaa tacctgtcac agatgaagaa 1441 cagaccaatg tgccttacat ctatgccatt ggcgatatat tggaggataa ggtggagctc 1501 accccagttg caatccaggc aggaagattg ctggctcaga ggctctatgc aggttccact 1561 gtcaagtgtg actatgaaaa tgttccaacc actgtattta ctcctttgga atatggtgct 1621 tgtggccttt ctgaggagaa agctgtggag aagtttgggg aagaaaatat tgaggtttac 1681 catagttact tttggccatt ggaatggacg attccgtcaa gagataacaa caaatgttat 1741 gcaaaaataa tctgtaatac taaagacaat gaacgtgttg tgggctttca cgtactgggt 1801 ccaaatgctg gagaagttac acaaggcttt gcagctgcgc tcaaatgtgg actgaccaaa 1861 aagcagctgg acagcacaat tggaatccac cctgtctgtg cagaggtatt cacaacattg 1921 tctgtgacca agcgctctgg ggcaagcatc ctccaggctg gctgctgagg ttaagcccca 1981 gtgtggatgc tgttgccaag actgcaaacc actggctcgt ttccgtgccc aaatccaagg 2041 cgaagttttc tagagggttc ttgggctctt ggcacctgcg tgtcctgtgc ttaccaccgc 2101 ccaaggcccc cttggatctc ttggatagga gttggtgaat agaaggcagg cagcatcaca 2161 ctggggtcac tgacagactt gaagctgaca tttggcaggg catcgaaggg atgcatccat 2221 gaagtcacca gtctcaagcc catgtggtag gcggtgatgg aacaactgtc aaatcagttt 2281 tagcatgacc tttccttgtg gattttctta ttctcgttgt caagttttct agggttgaat 2341 ttttttcttt tttctccatg gtgttaatga tattagagat gaaaacgtt agcagttgat 2401 ttttgtccaa aagcaagtca tggctagagt atccatgcaa ggtgtcttgt tgcatggaag 2461 ggatagtttg gctcccttgg aggctatgta ggcttgtccc gggaaagaga actgtcctgc 2521 agctgaatg gactgttctt tactgactg ctcagcagtt tctctctca tatattccca 2581 aacaagtac atctgcgatc aacttagcc aaatttgccc ctgtgtgcta catgatggat 2641 gattattatt tttaggtctg tttaggagg gaatggcta cttggccagc cattgctgg 2701 catttggtag tatagtatga ttctcaccat tattgtcat ggaggcagac atacaccaga 2761 atggggg aacagtaca tatctttctg tcttagttt attgtgtgct gtctaagca 2821 agctgagatc atttgcaatg gaaacacgt aacttgttta aaagttttc tggtagcttt 2881 agctttatgc taaaaaaaat atgacattg ggtatctatt tctttctag actacattag 2941 taggaaata agtctttca tgcttatgat ttagcttt tgtggtatt gctttttaaa 3001 ggagttatt atatcataa gttattatta attttgaa cacaggtgga tgtgaaggat 3061 ttcatttaa aaaccaagtg gttttgactt tttctgttga atgacaact gtgccttgtg 3121 gatttttgc agaagtgttt atgctttgtt agcatttca cttgcattat tataaagagg 3181 tattaatgcc tcagttatgt gtttgtcaat gtactggctg aggattctat ctcagctgtc 3241 ttttctaact gtgtaggttg agttttgaac acgtgcttgt ggacatcagg cctcctgcca 3301 gcagttcttg aagcttcttt ttcattcctg ctactctacc tgtatttctc agttgcagca 3361 ctgagtggtc aaaatacatt tctgggccac ctcagggaac ccatgcatct gcctggcatt 3421 taggcagcag agcccctgac cgtcccccac agggctctgc ctcacgtcct catctcattt 3481 ggctgtgtaa agaaatggga aaagggaaaa ggagagagca attgaggcag ttgaccatat 3541 tcagttttat ttattattt ttaatttgtt tttttctcca agtccaccag tctctgaaat 3601 tagaacagta ggcggtatga gataatcagg cctaatcatg ttgtgattct cttttcttag 3661 tggagtggaa tgttctatcc ccacaagaag gattatatct tatagacttg tcttgttcag 3721 attctgtatt tacccatttt attgaaacat atactaagtt ccatgtattt ttgttacaaa 3781 tcttctgaaa aaaaacaaaa caatgtgaaa cattaaaatt aaaaggcatt aataatatcc 3841 acgtgtgcct tcttactgaa

[0050] Mouse (Mus musculus) thioredoxin reductase 1 (Txnrd1), transcript variant 1, mRNA NCBI reference sequence: NM_001042513.1 (SEQ ID NO: 20) 1 agtttgcttc cgtcaggcct cgcgtccacg cgggaggtgc gggacgccga caccgcgggg 61 cgagaagagc tggtggtttc accttccttg ttcatagggc ggcggggcct tgcagcggcg 121 cgggcgagcg gaaaggccgc gggaggcggc gagccagcgg aaggtgcgac cggcggaggg 181 cggccatggt ccagccctga agccgaacaa aaaaggccaa cttcaaaagc tgccaacaat 241 gaatggctcc aaagatcccc ctgggtccta tgacttcgac ctgatcatca ttggaggagg 301 ctcaggagga ctggcagcag ctaaggaggc agccaaattt gacaagaaag tgctggtctt 361 ggattttgtc acaccgactc ctcttgggac cagatggggt ctcggaggaa cgtgtgtgaa 421 tgtgggttgc atacctaaga agctgatgca ccaggcagct ttgctcggac aagctctgaa 481 agactcgcgc aactatggct ggaaagtcga agacacagtg aagcatgact gggagaaaat 541 gacggaatct gtgcagagtc acatcggctc gctgaactgg ggctaccgcg tagctctccg 601 ggagaaaaag gtcgtctatg agaatgctta cgggaggttc attggtcctc acaggattgt 661 ggcgacaaat aacaaaggta aagaaaaaat ctattcagca gagcggttcc tcatcgccac 721 aggtgagagg ccccgctacc tgggcatccc tggagacaaa gagtactgca tcagcagtga 781 tgatcttttc tccttgcctt actgcccggg gaagacccta gtagttggtg catcctatgt 841 cgccttggaa tgtgcaggat ttctggctgg tatcggctta gacgtcactg taatggtgcg 901 gtccattctc cttagaggat ttgaccaaga catggccaac aaaatcggtg aacacatgga 961 agaacatggt atcaagttta taaggcagtt cgtcccaacg aaaattgaac agatcgaagc 1021 aggaacacca ggccgactca gggtgactgc tcaatccaca aacagcgagg agaccataga 1081 gggcgaattt aacacagtgt tgctggcggt aggaagagat tcttgtacga gaactattgg 1141 cttagagacc gtgggcgtga agataaacga aaaaaccgga aagatacccg tcacggatga 1201 agagcagacc aatgtgcctt acatctacgc catcggtgac atcctggagg ggaagctaga 1261 gctgactccc gtagccatcc aggcggggag attgctggct cagaggctgt atggaggctc 1321 caatgtcaaa tgtgactatg acaatgtccc aacgactgta tttactcctt tggaatatgg 1381 ctgttgtggc ctctctgaag aaaaagccgt agaagaaattt ggggaagaaa atattgaagt 1441 ttaccatagt ttcttttggc cattggaatg gacagtccca tcccgggata acaacaaatg 1501 ttatgcaaaa ataatctgca accttaaaga cgatgaacgt gtcgtgggct tccacgtgct 1561 gggtccaaac gctggagagg tgacgcaggg ctttgcggct gcgctcaagt gtgggctgac 1621 taagcagcag ctggacagca ccatcggcat ccacccggtc tgtgcagaga tattcacaac 1681 gttgtcagtg acgaagcgct ctgggggaga catcctccag tctggctgct gaggttaagc 1741 cccagtgtgg atgctgttgc caagactaca gaccattgcc ttgcttcctt gcccacgccc 1801 aggtgaagtt caggaaggct cttgggtcct aggcgccaat tcaaggtgct gtcctaaggc 1861 caccgggtcc ctgggatctt gtgggtagga ggtggcaggt cgaaggaggc tgcagcatcg 1921 cactggggtc accatgacag actcagactg acatctggca gagcatcaca ggcatgcgtc 1981 catgaagtca ctggcctcaa gcccaagtgg tgggcagtga cagaagagct gccgggtctg 2041 ttgagctcaa ccttttcctg tagattgtct tagtctcact ttcaagctgt ctaatgtcaa 2101 ttctgttttt cttttttcct ccatggggtt aatgatacta gagataggga atattagcaa 2161 tcagttttg tcatggctgg tccatctgca acagtcttta ctgtgtggaa gtgggtgaga 2221 tggcttatga gagccaaacc aattatccc cagaaagacg aattaccctg tgactaaaat 2281 acactgtctg cttttactaa ctggtgtagc attgtctcct ttaataagtc ttgtgtccaa 2341 aacgagaaaa accattggcc acttttgcaa gtttcctgca gtgtgcttag caagggaggt 2401 ggcgacttgg ctaatctact tgaactgcat cgcatggctc ttgggtagct tagagcatcg 2461 caggtagtag gcagaccagc agtgagtgtc tctcctggta caattattgt ctggttctca 2521 gtggaaaacg cttaatttgc tttaaacttg gtgtttttgt gaggtggatt tagtcttaag 2581 ctgtgtccca taagaactac attcacaggc aagtggctct tcctccacac agcctataca 2641 tcttctgagg taattacttt cataaggaag ctgttcataa cgtaagttat tattattatt 2701 gaacacaggt ggatgtgaag gatttttcat tgaaaaacca aatggtttttt cttttttct 2761 gttcagtgag cccacaggaa ctctgtcagg acagccagta ctctgccggc atggctgctg 2821 gggcgtttac ggtgtagttt agctcctagg ttacatgacc gtgaacatgc tggctgagga 2881 ctacacaaac caggtttccc accatacacg gcctggccct gcagcttctt ttcttgccct 2941 cccctttgcc tgtccccacc tgcagtactg agtggcgttt cacagtaccc ttctgggcca 3001 cctcagggaa gggatttgcc tggtgtccag ccagcagcac ccaccctgcc ccacgaggct 3061 ccctcacacc tgcccccccg tccttgtgtt gaagacagtg ggaagaggag aaaggaccag 3121 ggaaaccaag ggagttgact gttcagtttt atttatttat tttttaagtt tttttttcct 3181 ttcaagtctg ccagtctctg agatcagaac aacagacagt gtagggtaac taatcatgtg 3241 attctcttag tggaatgaaa tgttctaccc ccacaagaag gagtatacgt cattgttcat 3301 attctgtaat cgcacaatgt attgtaatgc aaattccaat tccatgtatt tttattacaa 3361 tttttctgga aaaaaatgtg aaccaataaa agatgttgat gcacacgcgt gccttct

[0051] Mouse thioredoxin reductase 1 (Txnrd1), transcript variant 3, mRNA NCBI Reference Sequence: NM_001042514.1 (SEQ ID NO: 21) 1 gtggctacga ggctggtgtt tttagccgcc atgcagagct tttctgagtt ctgggggtcc 61 tggagtcttg ctggcccggc tgcttaaggg tcggagtcca ctggcgagag tgacccaggg 121 cgcgtggcgt cccggaagcc ccgccccggag gaaggctcac tgccgctctg ctttgtgcca 181 241 gccagcggaa ggtgcgaccg gcggagggcg gccatggtcc agccctgaag ccgaacaaaa 301 aaggccaact tcaaaagctg ccaacaatga atggctccaa agatccccct gggtcctatg 361 acttcgacct gatcatcatt ggaggaggct caggaggact ggcagcagct areaggcag 421 ccaaatttga caagaaagtg ctggtcttgg attttgtcac accgactcct cttgggacca 481 gatggggtct cggaggaacg tgtgtgaatg tgggttgcat acctaagaag ctgatgcacc 541 aggcagcttt gctcggacaa gctctgaaag actcgcgcaa ctatggctgg aaagtcgaag 601 661 tgaactgggg ctaccgcgta gctctccggg agaaaaaggt cgtctatgag aatgcttacg 721 ggaggttcat tggtcctcac aggattgtgg cgacaataa caaaggtaaa gaaaaaatct 781 attcagcaga gcggttcctc atcgccacag gtgagaggcc ccgctacctg ggcatccctg 841 gagacaaaga gtactgcatc agcagtgatg atcttttctc cttgccttac tgcccgggga 901 agaccctagt agttggtgca tcctatgtcg ccttggaatg tgcaggattt ctggctggta 961 tcggcttaga cgtcactgta atggtgcggt ccattctcct tagaggattt gaccaagaca 1021 tggccaacaa aatcggtgaa cacatggaag aacatggtat caagtttata aggcagttcg 1081 tcccaacgaa aattgaacag atcgaagcag gaacaccagg ccgactcagg gtgactgctc 1141 aatccacaaa cagcgaggag accatagagg gcgaatttaa cacagtgttg ctggcggtag 1201 gaagagattc ttgtacgaga actattggct tagagaccgt gggcgtgaag ataaacgaaa 1261 aaaccggaaa gatacccgtc acggatgaag agcagaccaa tgtgccttac atctacgcca 1321 tcggtgacat cctggagggg aagctagagc tgactcccgt agccatccag gcggggagat 1381 tgctggctca gaggctgtat ggaggctcca atgtcaaatg tgactatgac aatgtcccaa 1441 cgactgtatt tactcctttg gaatatggct gttgtggcct ctctgaagaa aaagccgtag 1501 1561 cagtcccatc ccgggataac aacaaatgtt atgcaaaaat aatctgcaac cttaaagacg 1621 atgaacgtgt cgtgggcttc cacgtgctgg gtccaaacgc tggagaggtg acgcagggct 1681 ttgcggctgc gctcaagtgt gggctgacta agcagcagct ggacagcacc atcggcatcc 1741 1801 tcctccagtc tggctgctga ggttaagccc cagtgtggat gctgttgcca agactacaga 1861 ccattgcctt gcttccttgc ccacgcccag gtgaagttca ggaaggctct tgggtcctag 1921 gcgccaattc aaggtgctgt cctaaggcca ccgggtccct gggatcttgt gggtaggagg 1981 tggcaggtcg aaagggctg cagcatcgca ctggggtcac catgacagac tcagactgac 2041 atctggcaga gcatcacagg catgcgtcca tgaagtcact ggcctcaagc ccaagtggtg 2101 ggcagtgaca gaagagctgc cgggtctgtt gagctcaacc ttttcctgta gattgtctta 2161 gtctcacttt caagctgtct aatgtcaatt ctgtttttct tttttcctcc atggggttaa 2221 tgatactaga gatagggaat attagcaatc agttttgtc atggctggtc catctgcaac 2281 agtctttact gtgtggaagt gggtgagatg gcttatgaga gccaaaccaa tttatcccca 2341 gaaagacgaa ttaccctgtg actaaaatac actgtctgct tttactaact ggtgtagcat 2401 tgtctccttt aataagtctt gtgtccaaaa cgagaaaaac cattggccac ttttgcaagt 2461 ttcctgcagt gtgcttagca agggaggtgg cgacttggct aatctacttg aactgcatcg 2521 catggctctt gggtagctta gagcatcgca gggtagaggc agaccagcag tgagtgtctc 2581 tcctggtaca attattgtct ggttctcagt ggaaaacgct taatttgctt taaacttggt 2641 gttttgtga ggtggattta gtcttaagct gtgtcccata agaactacat tcacaggcaa 2701 gtggctcttc ctccacacag cctatacatc ttctgaggta attactttca taaggaagct 2761 gttcataacg taagttatta ttattattga acacaggtgg atgtgaagga ttttcattg 2821 aaaaaccaaa tggttttct ttttttctgt tcagtgagcc cacaggaact ctgtcaggac 2881 agccagtact ctgccggcat ggctgctggg gcgtttacgg tgtagtttag ctcctaggtt 2941 acatgaccgt gaacatgctg gctgaggact acacaaacca ggtttcccac catacacggc 3001 ctggccctgc agcttctttt cttgccctcc cctttgcctg tccccacctg cagtactgag 3061 tggcgtttca cagtaccctt ctgggccacc tcagggaagg gatttgcctg gtgtccagcc 3121 agcagcaccc accctgcccc acgaggctcc ctcacacctg cccccccgtc cttgtgttga 3181 agacagtggg aagaggagaa aggaccaggg aaaccaaggg agttgactgt tcagttttat 3241 ttatttattt tttaagtttt tttttccttt caagtctgcc agtctctgag atcagaacaa 3301 cagacagtgt agggtaacta atcatgtgat tctcttagtg gaatgaaatg ttctaccccc 3361 acaagaagga gtatacgtca ttgttcatat tctgtaatcg cacaatgtat tgtaatgcaa 3421 attccaattc catgtatttt tattacaatt tttctggaaa aaaatgtgaa ccaataaaag 3481 atgttgatgc acacgcgtgc cttct

[0052] Mouse thioredoxin reductase 1 (Txnrd1), transcript variant 2, mRNA NCBI Reference Sequence: NM_015762.2 (SEQ ID NO: 22) 1 agtttgcttc cgtcaggcct cgcgtccacg cgggaggtgc gggacgccga caccgcgggg 61 cgagaagagc tggtggtttc accttccttg ttcatccgaa caaaaaaggc caacttcaaa 121 agctgccaac aatgaatggc tccaaagatc cccctgggtc ctatgacttc gacctgatca 181 tcattggagg aggctcagga ggactggcag cagctaagga ggcagccaaa tttgacaaga 241 aagtgctggt cttggatttt gtcacaccga ctcctcttgg gaccagatgg ggtctcggag 301 gaacgtgtgt gaatgtgggt tgcataccta agaagctgat gcaccaggca gctttgctcg 361 gacaagctct gaaagactcg cgcaactatg gctggaaagt cgaagacaca gtgaagcatg 421 actgggagaa aatgacggaa tctgtgcaga gtcacatcgg ctcgctgaac tggggctacc 481 gcgtagctct ccgggagaaa aaggtcgtct atgagaatgc ttacgggagg ttcattggtc 541 ctcacaggat tgtggcgaca aataacaaag gtaaagaaaa aatctattca gcagagcggt 601 tcctcatcgc cacaggtgag aggccccgct acctgggcat ccctggagac aaagagtact 661 gcatcagcag tgatgatctt ttctccttgc cttactgccc ggggaagacc ctagtagttg 721 gtgcatccta tgtcgccttg gaatgtgcag gatttctggc tggtatcggc ttagacgtca 781 ctgtaatggt gcggtccatt ctccttagag gatttgacca agacatggcc aacaaaatcg 841 gtgaacacat ggaagaacat ggtatcaagt ttataaggca gttcgtccca acgaaaattg 901 aacagatcga agcaggaca ccaggccgac tcagggtgac tgctcaatcc acaaacagcg 961 aggagaccat aggggcga tttaacacag tgttgctggc ggtaggaaga gattcttgta 1021 cgagaactat tggcttagag accgtgggcg tgaagataaa cgaaaaaacc ggaaagatac 1081 ccgtcacgga tgaagagcag accaatgtgc cttacatcta cgccatcggt gacatcctgg 1141 aggggagct agagctgact cccgtagcca tccaggcggg gagattgctg gctcagaggc 1201 tgtatggagg ctccaatgtc aaatgtgact atgacaatgt cccaacgact gtatttactc 1261 ctttggaata tggctgttgt ggcctctctg aagaaaaagc cgtagagaaa tttggggaag 1321 aaaatattga agtttaccat agtttctttt ggccattgga atggacagtc ccatcccggg 1381 father atgttatgca aaataatct gcaacctta agacgatgcgtgtcgtgg 1441 gcttccacgt gctgggtcca aacgctggag aggtgacgca gggctttgcg gctgcgctca 1501 agtgtgggct gactaagcag cagctggaca gcaccatcgg catccacccg gtctgtgcag 1561 agatattcac aacgttgtca gtgacgaagc gctctggggg agacatcctc cagtctggct 1621 gctgaggtta agccccagtg tggatgctgt tgccaagact acagaccatt gccttgcttc 1681 cttgcccacg cccaggtgaa gttcaggaag gctcttgggt cctaggcgcc aattcaaggt 1741 gctgtcctaa ggccaccggg tccctgggat cttgtgggta ggaggtggca ggtcgaagga 1801 ggctgcagca tcgcactggg gtcaccatga cagactcaga ctgacatctg gcagagcatc 1861 acaggcatgc gtccatgaag tcactggcct caagcccaag tggtgggcag tgacagaaga 1921 gctgccgggt ctgttgagct caaccttttc ctgtagattg tcttagtctc actttcaagc 1981 tgtctaatgt caattctgtt tttctttttt cctccatggg gttaatgata ctagagatag 2041 ggaatattag caatcagttt ttgtcatggc tggtccatct gcaacagtct ttactgtgtg 2101 gaagtgggtg agatggctta tgagagccaa accaatttat ccccagaaag acgaattacc 2161 ctgtgactaa aatacactgt ctgcttttac taactggtgt agcattgtct cctttaataa 2221 gtcttgtgtc caaaacgaga aaaaccattg gccacttttg caagtttcct gcagtgtgct 2281 tagcaaggga ggtggcgact tggctaatct acttgaactg catcgcatgg ctcttgggta 2341 gcttagagca tcgcagggta gaggcagacc agcagtgagt gtctctcctg gtacaattat 2401 tgtctggttc tcagtggaaa acgcttaatt tgctttaaac ttggtgtttt tgtgaggtgg 2461 atttagtctt aagctgtgtc ccataagaac tacattcaca ggcaagtggc tcttcctcca 2521 cacagcctat acatcttctg aggtaattac tttcataagg aagctgttca taacgtaagt 2581 tattattatt attgaacaca ggtggatgtg aaggattttt cattgaaaaa ccaaatggtt 2641 tttctttttt tctgttcagt gagcccacag gaactctgtc aggacagcca gtactctgcc 2701 ggcatggctg ctggggcgtt tacggtgtag tttagctcct aggttacatg accgtgaaca 2761 tgctggctga ggactacaca aaccaggttt cccaccatac acggcctggc cctgcagctt 2821 cttttcttgc cctccccttt gcctgtcccc acctgcagta ctgagtggcg tttcacagta 2881 cccttctggg ccacctcagg gaagggattt gcctggtgtc cagccagcag cacccaccct 2941 gccccacgag gctccctcac acctgccccc ccgtccttgt gttgaagaca gtgggaagag 3001 gagaaaggac cagggaaacc aagggagttg actgttcagt tttatttatt tattttttaa 3061 gttttttttt cctttcaagt ctgccagtct ctgagatcag aacaacagac agtgtagggt 3121 aactaatcat gtgattctct tagtggaatg aaatgttcta cccccacaag aaggatata 3181 cgtcattgtt catattctgt aatcgcacaa tgtattgtaa tgcaaattcc aattccatgt 3241 atttttatta caatttttct ggaaaaaaat gtgaaccaat aaaagatgtt gatgcacacg 3301 cgtgccttct

[0053] Mouse thioredoxin reductase 1 (Txnrd1), transcript variant 4, mRNA NCBI reference sequence: NM_001042523.1 (SEQ ID NO: 23) 1 caggctccac cagtgcttct gcagacctca gagcctggcg gctggcctca taaacagccg 61 tgcggtggac actctactaa gtgccctgca ttgaaggaga agccctggtc accatgccag 121 ttgatgactg ctggctgtac ttcccagctt ctcgaggtag aacctttgtg cagactgtct 181 gggtggcacc cacttgcccc aactgttgct ggtttccagg ttttctccct ccagtccccc 241 ggccaccaca tgtgccccgt gtgctgctga ggggccctcg tggggctgtg cttcctgctt 301 cacgtccctc caagacactc ccctcctcat cccagacgcc ctgtcctact gacccctgta 361 tctgccctcc accctccaca cctgatagta ggcaggaaaa aatacgcaa tctgagctgc 421 cgaacaaaaa aggccaactt caaaagctgc cacaatgaa tggctccaaa gatccccctg 481 ggtcctatga cttcgacctg atcatcattg gaggaggctc aggaggactg gcagcagcta 541 aggaggcagc caaatttgac aagaaagtgc tggtcttgga ttttgtcaca ccgactcctc 601 ttgggaccag atggggtctc ggaggacgt gtgtgaatgt gggttgcata cctaagaagc 661 tgatgcacca ggcagctttg ctcggacaag ctctgaaaga ctcgcgcaac tatggctgga 721 aagtcgaaga cacagtgaag catgactggg agaaaatgac ggaatctgtg cagagtcaca 781 tcggctcgct gaactggggc taccgcgtag ctctccgggga gaaaaaggtc gtctatgaga 841 atgcttacgg gaggttcatt ggtcctcaca ggattgtggc gacaaatac aaaggtaaag 901 aaaaaatcta ttcagcagag cggttcctca tcgccacagg tgagaggccc cgctacctgg 961 gcatccctgg agaaagag tactgcatca gcagtgatga tcttttctcc ttgccttact 1021 gcccgggggaa gaccctagta gttggtgcat cctatgtcgc cttggaatgt gcaggatttc 1081 tggctggtat cggcttagac gtcactgtaa tggtgcggtc cattctcctt agaggatttg 1141 accaagacat ggccaacaaa atcggtgaac acatgggaaga acatggtatc aagtttaa 1201 ggcagttcgt cccaacgaaa attgaacaga tcgaagcagg aacaccaggc cgactcaggg 1261 tgactgctca atccacaaac agcgaggaga ccatagagg cgaatttaac acagtgttgc 1321 tggcggtagg aagagattct tgtacgagaa ctattggctt agagaccgtg ggcgtgaaga 1381 taaacgaaaa aaccggaaag atacccgtca cggatgaaga gcagaccaat gtgccttaca 1441 tctacgccat cggtgacatc ctggagggga agctagagct gactcccgta gccatccagg 1501 cggggagatt gctggctcag aggctgtatg gaggctccaa tgtcaaatgt gactatgaca 1561 atgtcccaac gactgtattt actcctttgg aatatggctg ttgtggcctc tctgaagaaa 1621 aagccgtaga gaaatttggg gaaaaata ttgaagttta ccatagtttc tttggccat 1681 tggaatggac agtcccatcc cgggataaca acaaatgtta tgcaaaata atctgcaacc 1741 ttaaagacga tgaacgtgtc gtgggcttcc acgtgctggg tccaaacgct ggagaggtga 1801 cgcagggctt tgcggctgcg ctcaagtgtg ggctgactaa gcagcagctg gacagcacca 1861 tcggcatcca cccggtctgt gcagagatat tcacaacgtt gtcagtgacg aagcgctctg 1921 ggggagacat cctccagtct ggctgctgag gttaagcccc agtgtggatg ctgttgccaa 1981 gactacagac cattgccttg cttccttgcc cacgcccagg tgaagttcag gaaggctctt 2041 gggtcctagg cgccaattca aggtgctgtc ctaaggccac cgggtccctg ggatcttgtg 2101 ggtaggaggt ggcaggtcga aggaggctgc agcatcgcac tggggtcacc atgacagact 2161 cagactgaca tctggcagag catcacaggc atgcgtccat gaagtcactg gcctcaagcc 2221 caagtggtgg gcagtgacag aagagctgcc gggtctgttg agctcaacct tttcctgtag 2281 attgtcttag tctcactttc aagctgtcta atgtcaattc tgttttctt ttttcctcca 2341 tggggttaat gatactagag atagggaata ttagcaatca gtttttgtca tggctggtcc 2401 atctgcaaca gtctttactg tgtggaagtg ggtgagatgg cttatgagag ccaaaccaat 2461 ttatccccag aaagacgaat taccctgtga ctaaaataca ctgtctgctt ttactaactg 2521 gtgtagcatt gtctccttta ataagtcttg tgtccaaaac gagaaaaacc attggccact 2581 tttgcaagtt tcctgcagtg tgcttagcaa gggaggtggc gacttggcta atctacttga 2641 actgcatcgc atggctcttg ggtagcttag agcatcgcag ggtagaggca gaccagcagt 2701 gagtgtctct cctggtacaa ttattgtctg gttctcagtg gaaaacgctt aatttgcttt 2761 aaacttggtg ttttgtgag gtggatttag tcttaagctg tgtcccataa gaactacatt 2821 cacaggcaag tggctcttcc tccacacagc ctatacatct tctgaggtaa ttactttcat 2881 aaggaagctg ttcataacgt aagttattat tattattgaa cacaggtgga tgtgaaggat 2941 ttttcattga aaaaccaaat ggtttttcttt ttttctgtt cagtgagccc acaggaactc 3001 tgtcaggaca gccagtactc tgccggcatg gctgctgggg cgtttacggt gtagtttagc 3061 tcctaggtta catgaccgtg aacatgctgg ctgaggacta cacaaaccag gtttcccacc 3121 atacacggcc tggccctgca gcttcttttc ttgccctccc ctttgcctgt ccccacctgc 3181 agtactgagt ggcgtttcac agtacccttc tgggccacct cagggaaggg atttgcctgg 3241 tgtccagcca gcagcaccca ccctgcccca cgaggctccc tcacacctgc ccccccgtcc 3301 ttgtgttgaa gacagtggga agaggagaaa ggaccaggga aaccaaggga gttgactgtt 3361 cagttttatt tatttatttt ttaagttttt ttttcctttc aagtctgcca gtctctgaga 3421 tcagaacaac agacagtgta gggtaactaa tcatgtgatt ctcttagtgg aatgaaatgt 3481 tctaccccca caagaaggag tatacgtcat tgttcatatt ctgtaatcgc acaatgtatt 3541 gtaatgcaaa ttccaattcc atgtattttt attacaattt ttctggaaaa aaatgtgaac 3601 caataaaaga tgttgatgca cacgcgtgcc ttct

[0054] The antisense nucleic acid can be antisense RNA or antisense DNA. Antisense nucleic acids based on the known TXNRD1 gene sequence can be easily designed and engineered using methods known in the art. In some embodiments, the antisense nucleic acid comprises the nucleic acid sequence of any one of SEQ ID NOs: 1-12 or its complement.

[0055] An antisense nucleic acid is a molecule complementary to a sense nucleic acid strand, for example, a molecule complementary to the coding strand of a double-stranded DNA (or cDNA) molecule or a molecule complementary to an mRNA sequence. Thus, an antisense nucleic acid can form hydrogen bonds with a sense nucleic acid. An antisense nucleic acid can be complementary to the entire TXNRD1 coding strand or a portion thereof, for example, all or part of the protein coding region (or open reading frame). In some embodiments, an antisense nucleic acid is an oligonucleotide complementary to only a portion of the coding region of TXNRD1 mRNA. In certain embodiments, an antisense nucleic acid molecule can be complementary to a non-coding region of the TXNRD1 coding strand. In some embodiments, the non-coding region refers to the 5' and 3' untranslated regions adjacent to the coding region and not translated into amino acids. For example, an antisense oligonucleotide can be complementary to the region surrounding the translation start site of TXNRD1. Antisense oligonucleotides can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides in length.

[0056] Antisense nucleic acid can be constructed by chemical synthesis and enzyme ligation reaction using procedures known in the art.For example, antisense nucleic acid (such as antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotide or modified nucleotide designed to increase the biological stability of the molecule or to increase the physical stability of the duplex formed between antisense nucleic acid and sense nucleic acid, for example, phosphorothioate derivative and acridine-substituted nucleotide.Examples of modified nucleotides that can be used to generate antisense nucleic acids include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-hodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thouridine, 5-carboxymethylaminomethyl-uracil, dihydrouracil, β-D-galactosylqueosine, inosine, N6-isopentenyladenosine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine ), N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyl-adenine, uracil-5-oxyacetic acid(v), wybutosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil (thlouracil), 4-thiouracil (thiouracil), 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid(v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, antisense nucleic acids can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., the RNA transcribed from the inserted nucleic acid is in an antisense orientation relative to the target nucleic acid of interest).

[0057] Antisense nucleic acid molecules can be administered to a subject or generated in situ and hybridize or bind to cellular mRNA and / or genomic DNA encoding a protein of interest, thereby inhibiting expression of that protein, e.g., by inhibiting transcription and / or translation. Hybridization can occur via Watson-Crick base pairing, which can form a stable duplex, or, in the case of antisense nucleic acid molecules that bind to DNA duplexes, through specific interactions in the major groove of the double helix.

[0058] In some embodiments, antisense nucleic acid molecules are modified to specifically bind to a selected cell surface-expressed receptor or antigen, for example, by linking the antisense nucleic acid molecule to a peptide or antibody that binds to the cell surface receptor or antigen. In some embodiments, the antisense nucleic acid molecule is an α-anomeric nucleic acid molecule. α-anomeric nucleic acid molecules form specific double-stranded hybrids with complementary RNA in which, unlike the usual β-units, the strands run parallel to each other (Gaultier et al., Nucleic Acids. Res. 15:6625-6641(1987)). Antisense nucleic acid molecules can also contain 2'-O-methylribonucleotides (Inoue et al., Nucleic Acids Res. 15:6131-6148(1987)) or chimeric RNA-DNA analogs (Inoue et al., FEBS Lett. 215:327-330(1987)).

[0059] The present disclosure also provides short hairpin RNAs (shRNAs) or small interfering RNAs (siRNAs) comprising a nucleic acid sequence that is complementary to and specifically hybridizes with a portion of any one of SEQ ID NOS: 13-23 (TXNRD1 mRNA isoforms), thereby reducing or inhibiting TXNRD1 expression. In some embodiments, the shRNA or siRNA is approximately 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 base pairs in length. Double-stranded RNA (dsRNA) can induce sequence-specific post-transcriptional gene silencing (e.g., RNA interference (RNAi)) in many organisms, including C. elegans, Drosophila, plants, mammals, oocytes, and early embryos. RNAi is a process that interferes with mRNA or significantly reduces the number of protein copies produced by mRNA. For example, double-stranded siRNA or shRNA molecules are engineered to complement and hybridize with the mRNA of a target gene. After intracellular delivery, the siRNA or shRNA molecule associates with an RNA-induced silencing complex (RISC), which then binds and degrades the complementary target mRNA (e.g., TXNRD1 mRNA). In some embodiments, the shRNA or siRNA comprises any one of the nucleic acid sequences of SEQ ID NOs: 1-12.

[0060] The present disclosure also provides a ribozyme comprising a nucleic acid sequence complementary to and specifically hybridizing to a portion of any one of SEQ ID NOS: 13-23 (TXNRD1 mRNA isoforms), thereby reducing or inhibiting TXNRD1 expression. Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving complementary single-stranded nucleic acids, such as mRNA. Thus, ribozymes (hammerhead ribozymes, as described in Haselhoff and Gerlach, Nature 334:585-591 (1988)) can be used to catalytically cleave TXNRD1 transcripts, thereby inhibiting TXNRD1 translation.

[0061] Ribozymes with specificity for TXNRD1-encoding nucleic acids can be designed based on the TXNRD1 nucleic acid sequence disclosed herein.For example, a derivative of Tetrahymena L-19 IVS RNA can be constructed, whose active site nucleotide sequence is complementary to the nucleotide sequence to be cleaved in TXNRD1-encoding mRNA.See, for example, U.S. Patent No. 4,987,071 and U.S. Patent No. 5,116,742.Alternatively, TXNRD1 mRNA can be used to select catalytic RNAs with specific ribonuclease activity from a pool of RNA molecules.See, for example, Bartel and Szostak (1993) Science 261:1411-1418, which is incorporated herein by reference.

[0062] The present disclosure also provides a synthetic guide RNA (sgRNA) comprising a nucleic acid sequence complementary to and specifically hybridizing to a portion of any one of SEQ ID NOS: 13-23 (TXNRD1 mRNA isoforms). Guide RNAs used in CRISPR-Cas systems are typically generated as a single guide RNA comprising a crRNA segment and a tracrRNA segment. The crRNA segment and tracrRNA segment can also be generated as separate RNA molecules. The crRNA segment comprises a targeting sequence that binds to a portion of any one of SEQ ID NOS: 13-23 (TXNRD1 mRNA isoforms) and a stem portion that hybridizes to the tracrRNA. The tracrRNA segment comprises a nucleotide sequence that is partially or fully complementary to the stem sequence of the crRNA and a nucleotide sequence that binds to the CRISPR enzyme. In some embodiments, the crRNA segment and tracrRNA segment are provided as a single guide RNA. In some embodiments, the crRNA segment and tracrRNA segment are provided as separate RNAs. The combination of the CRISPR enzyme with the crRNA and tracrRNA creates a functional CRISPR-Cas system. Exemplary CRISPR-Cas systems for targeting nucleic acids are described, for example, in WO2015 / 089465.

[0063] In some embodiments, the synthetic guide RNA is a single RNA that is represented as comprising the following elements: 5'-X1-X2-YZ-3' wherein X1 and X2 represent crRNA segments, where X1 is a targeting sequence that binds to a portion of any one of SEQ ID NOS: 13-23, X2 is a stem sequence that hybridizes to the tracrRNA, Z represents a tracrRNA segment containing a nucleotide sequence that is partially or completely complementary to X2, and Y represents a linker sequence. In some embodiments, the linker sequence comprises two or more nucleotides and connects the crRNA segment to the tracrRNA segment. In some embodiments, the linker sequence comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides. In some embodiments, the linker is a loop of a hairpin structure formed when the stem sequence hybridizes to the tracrRNA.

[0064] In some embodiments, the synthetic guide RNA is provided as two separate RNAs, where one RNA represents the crRNA segment: 5'-X1-X2-3' (wherein X1 is a targeting sequence that binds to a portion of any one of SEQ ID NOs: 13-23 and X2 is a stem sequence that hybridizes to the tracrRNA), and one RNA represents a tracrRNA segment, Z, that is a separate RNA from the crRNA segment and includes a nucleotide sequence that is partially or fully complementary to X2 of the crRNA.

[0065] Exemplary crRNA stem sequences and tracrRNA sequences are provided, for example, in WO / 2015 / 089465, which is incorporated herein by reference. Generally, the stem sequence includes any sequence that has sufficient complementarity with the complementary sequence in the tracrRNA to promote the formation of a CRISPR complex at the target sequence, and the CRISPR complex includes the stem sequence hybridized with the tracrRNA. Generally, the degree of complementarity is relative to the optimal alignment of the stem sequence and the complementary sequence in the tracrRNA along the length of the shorter of the two sequences. Optimal alignment can be determined by any suitable alignment algorithm and can further account for secondary structure, such as self-complementarity, within either the stem sequence or the complementary sequence in the tracrRNA. In some embodiments, the degree of complementarity between the stem sequence and the complementary sequence in the tracrRNA along the length of the shorter of the two sequences when optimally aligned is greater than about 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or more. In some embodiments, the stem sequence is greater than about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, or more nucleotides in length. In some embodiments, the stem sequence and the complementary sequence in the tracrRNA are contained within a single RNA, such that hybridization between the two sequences produces a transcript with a secondary structure, such as a hairpin. In some embodiments, the tracrRNA has an additional complementary sequence that forms a hairpin. In some embodiments, the tracrRNA has at least two or more hairpins. In some embodiments, the tracrRNA has two, three, four, or five hairpins. In some embodiments, the tracrRNA has up to five hairpins.

[0066] In the hairpin structure, the portion of the sequence 5' to the final "N" and upstream of the loop corresponds to the crRNA stem sequence, and the portion of the sequence 3' to the loop corresponds to the tracrRNA sequence. Further non-limiting examples of single polynucleotides comprising a guide sequence, stem sequence, and tracr sequence are as follows (listed from 5' to 3'), where "N" represents bases of the guide sequence (e.g., a modified oligonucleotide provided herein), the first block of lowercase letters represents the stem sequence, the second block of lowercase letters represents the tracrRNA sequence, and the final poly-T sequence represents a transcription termination sequence: (a)NNNNNNNNNNNNNNNNNNNNgtttttgtactctcaagatttaGAAAtaaatcttgcagaagctacaaagataa ggcttcatgccgaaatcaacaccctgtcattttatggcagggtgttttcgttatttaaTTTTTT (SEQ ID NO: 24); (b) NNNNNNNNNNNNNNNNNNNNgtttttgtactctcaGAAAtgcagaagctacaaagataaggcttcatgccg aaatcaacaccctgtcattttatggcagggtgttttcgttatttaaTTTTTT (SEQ ID NO: 25); (c)NNNNNNNNNNNNNNNNNNNNgtttttgtactctcaGAAAtgcagaagctacaaagataaggcttcatgccg aaatcaacaccctgtcattttatggcagggtgtTTTTTT (SEQ ID NO: 26); (d) NNNNNNNNNNNNNNNNNNNNgttttagagctaGAAAtagcaagttaaaataaggctagtccgttatcaactt gaaaaagtggcaccgagtcggtgcTTTTTT (SEQ ID NO: 27); (e) NNNNNNNNNNNNNNNNNNNNNNgttttagagctaGAAATAGcaagttaaaataaggctagtccgttatcaac ttgaaaaagtgTTTTTTT (SEQ ID NO: 28); and (f) NNNNNNNNNNNNNNNNNNNNgttttagagctagAAATAGcaagttaaaataaggctagtccgttatcaTT TTTTTT (SEQ ID NO: 29)

[0067] The selection of an appropriate oligonucleotide for use as a targeting sequence in a CRISPR-Cas system depends on several factors, including the specific CRISPR enzyme used and the presence of a corresponding protospacer adjacent motif (PAM) downstream of the target sequence in the target nucleic acid. The PAM sequence directs cleavage of the target nucleic acid by the CRISPR enzyme. In some embodiments, a suitable PAM is 5'-NRG or 5'-NNGRR (where N is any nucleotide) for SpCas9 or SaCas9 enzymes (or derivative enzymes), respectively. Generally, the PAM sequence should be located between about 1 and about 10 nucleotides from the target sequence to generate efficient cleavage of the target nucleic acid. Thus, when the guide RNA forms a complex with the CRISPR enzyme, the complex locates the target and PAM sequence, unwinds the DNA duplex, and the guide RNA anneals to a complementary sequence on the opposite strand. This allows the Cas9 nuclease to generate a double-stranded break. In some embodiments, the sgRNA comprises the nucleic acid sequence of any one of SEQ ID NOS: 1-12.

[0068] Various CRISPR enzymes are available for use with the disclosed guide RNAs of the present disclosure. In some embodiments, the CRISPR enzyme is a type II CRISPR enzyme. In some embodiments, the CRISPR enzyme catalyzes DNA cleavage. In some embodiments, the CRISPR enzyme catalyzes RNA cleavage. In some embodiments, the CRISPR enzyme is any Cas9 protein, such as any naturally occurring bacterial Cas9, as well as any chimera, mutant, homolog, or ortholog. Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, and Csm3. , Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, or modified variants thereof. In some embodiments, the CRISPR enzyme cleaves both strands of the target nucleic acid at the protospacer adjacent motif (PAM) site. In some embodiments, the CRISPR enzyme is a nickase and cleaves only one strand of the target nucleic acid. In some embodiments, the CRISPR enzyme is dCas9 with additional enzymatic activity to silence or activate expression of a gene of interest.

[0069] Pharmaceutical Composition In one aspect, the present disclosure provides a pharmaceutical composition comprising a TXNRD1 inhibitor. The pharmaceutical compositions of the present disclosure can be prepared by any method known in the pharmaceutical arts. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will vary depending on the host being treated and the particular mode of administration. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will generally be the amount of compound that produces a therapeutic effect. Generally, the amount of active compound ranges from about 0.1 to 99 percent, more typically from about 5 to 70 percent, and more typically from about 10 to 30 percent.

[0070] In some embodiments, the pharmaceutical compositions of the present technology contain one or more pharmaceutically acceptable carriers, which as used herein generally refers to pharmaceutically acceptable carriers such as liquid or solid fillers, diluents, excipients, manufacturing aids (e.g., lubricants, talc, magnesium stearate, calcium stearate, or zinc stearate, or steric acid), or solvent encapsulating materials, useful for introducing an active agent into the body. Examples of suitable aqueous and non-aqueous carriers that can be used in the pharmaceutical compositions of the present technology include, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, polyethylene glycol, and the like), vegetable oils (e.g., olive oil), and injectable organic esters (e.g., ethyl oleate), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants.

[0071] In some embodiments, the formulation may include one or more of sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; alginic acid; buffers such as magnesium hydroxide and aluminum hydroxide; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffer solutions; polyesters, polycarbonates, and / or polyanhydrides; preservatives; glidants; fillers; and other non-toxic, compatible substances used in pharmaceutical formulations.

[0072] Various auxiliary agents, such as wetting agents, emulsifiers, lubricants (e.g., sodium lauryl sulfate and magnesium stearate), colorants, releasing agents, coating agents, sweeteners, flavoring agents, preservatives, and antioxidants, can also be included in the pharmaceutical compositions of the present technology. Some examples of pharmaceutically acceptable antioxidants include water-soluble antioxidants such as ascorbic acid, cysteine ​​hydrochloride, sodium bisulfite, sodium metabisulfite, sodium sulfate, and the like; oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, α-tocopherol, and the like; and metal chelating agents such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like. In some embodiments, pharmaceutical formulations contain excipients selected from, for example, cellulose, liposomes, lipid nanoparticles, micelle-forming agents (e.g., bile acids), and polymeric carriers, such as polyesters and polyanhydrides. In addition to the active compound, suspensions may contain suspending agents, such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, and tragacanth, and mixtures thereof. Prevention of microbial attack on the active compound can be ensured by the inclusion of various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like, in the composition. In addition, prolonged absorption of injectable pharmaceutical forms can be achieved by the inclusion of agents that delay absorption, such as aluminum monostearate and gelatin.

[0073] Treatment method The following discussion is offered by way of example only and is not intended to be limiting.

[0074] One aspect of the present technology includes a method for treating a disease or condition characterized by elevated expression levels and / or increased activity of TXNRD1. Additionally or alternatively, in some embodiments, the present technology includes a method for treating RAS mutant cancer. The three major isoforms of RAS (KRAS, NRAS, and HRAS) are mutated in approximately 20% of human cancers, primarily at active site residues G12, G13, and Q61 near the g-phosphate of the guanosine triphosphate (GTP) substrate (see Marcus & Mattos, Clin Cancer Res 21(8): 1810-1818 (2015)). In certain embodiments, the RAS mutant cancer comprises a KRAS, NRAS, or HRAS mutation selected from the group consisting of G12C, G12D, G12V, G12A, G12S, G12R, G13D, G13C, G13S, G13R, G13A, G13V, Q61H, Q61L, Q61R, Q61K, Q61P, and Q61E.

[0075] In some embodiments, the present technology includes methods for treating RAS mutant pancreatic cancer. In one aspect, the present disclosure provides a method for inhibiting the growth of RAS mutant cancer in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of at least one TXNRD1 inhibitor disclosed herein, wherein the subject is suffering from a RAS mutant cancer characterized by elevated expression levels and / or increased activity of TXNRD1.

[0076] In some embodiments, the subject has been diagnosed with, is suspected of, or is at risk for a disease or condition characterized by elevated expression levels and / or activity of TXNRD1. Additionally or alternatively, in some embodiments, the subject has been diagnosed with a RAS mutant cancer. In certain embodiments, the RAS mutant cancer comprises a KRAS, NRAS, or HRAS mutation selected from the group consisting of G12C, G12D, G12V, G12A, G12S, G12R, G13D, G13C, G13S, G13R, G13A, G13V, Q61H, Q61L, Q61R, Q61K, Q61P, and Q61E. In some embodiments, the subject has been diagnosed with lung cancer (e.g., lung adenocarcinoma), mucinous adenoma, pancreatic cancer (e.g., PDAC), colorectal cancer, skin cancer (e.g., melanoma), endometrial cancer, testicular germ cell carcinoma, or adrenal cancer.In some embodiments, the subject has been diagnosed with pancreatic cancer.In some embodiments, the subject has been diagnosed with RAS mutant pancreatic cancer.

[0077] In therapeutic applications, compositions or drugs comprising the TXNRD1 inhibitors disclosed herein are administered to subjects suspected of suffering from or already suffering from such a disease or condition (e.g., subjects diagnosed with a disease or condition characterized by elevated expression levels and / or increased activity of TXNRD1, and / or subjects diagnosed with RAS mutant cancer, and / or subjects diagnosed with pancreatic cancer) in an amount sufficient to cure or at least partially arrest the symptoms of the disease, including its complications and intermediate pathological phenotypes in the development of the disease.

[0078] Subjects suffering from a disease or condition characterized by elevated expression levels and / or increased activity of TXNRD1 and / or subjects diagnosed with RAS mutant cancer can be identified by any or a combination of diagnostic or prognostic assays known in the art. In some embodiments, the subject may show one or more mutations in KRAS.In addition, the subject may show one or more mutations in at least one of TP53, CDKN2A, SMAD4, MLL3, TGFBR2, ARID1A and SF3B1, EPC1 and ARID2, ATM, ZIM2, MAP2K4, NALCN, SLC16A4, MAGEA6, ROBO2, KDM6A, PREX2, ERBB2, MET, FGFR1, CDK6, PIK3R3, PIK3CA, BRCA1, BRCA2, PALB2, etc.Biankin et al., Nature 491(7424): 399-405 (2012); and Waddell et al., Nature 518(7540): 495-501 (2015). Additionally or alternatively, the subject may exhibit at least one mutation in one or more of a core set of 12 cell signaling pathways and processes. Jones et al., Science 321(5897): 1801-1806 (2008).

[0079] In some embodiments, subjects with a disease or condition characterized by elevated expression levels and / or increased activity of TXNRD1 and / or subjects suffering from RAS mutant pancreatic cancer who are treated with a TXNRD1 inhibitor will show remission or disappearance of one or more of the following symptoms: pain in the upper abdomen radiating to the back, loss of appetite or unintentional weight loss, depression, new-onset diabetes, blood clots, fatigue, yellowing of the skin and whites of the eyes (jaundice), abdominal bloating, nausea, and vomiting. In certain embodiments, subjects with a disease or condition characterized by elevated TXNRD1 expression levels and / or increased TXNRD1 activity levels, and / or subjects suffering from RAS mutant cancer and / or subjects suffering from pancreatic cancer who are treated with a TXNRD1 inhibitor, will exhibit reduced RAS mutant cell proliferation and / or increased survival compared to untreated subjects with RAS mutant cancer. In certain embodiments, subjects with a disease or condition characterized by elevated TXNRD1 expression levels and / or increased TXNRD1 activity levels, and / or subjects suffering from RAS mutant cancer and / or subjects suffering from pancreatic cancer who are treated with a TXNRD1 inhibitor, will exhibit reduced TXNRD1 and / or RAS expression levels and / or reduced TXNRD1 and / or RAS activity levels compared to untreated subjects with RAS mutant cancer.

[0080] In one aspect, the present disclosure provides a method for monitoring the therapeutic efficacy of a TXNRD1 inhibitor in a subject diagnosed with RAS mutant cancer, comprising the steps of: (a) detecting TXNRD1 protein levels in a test sample obtained from the subject after the subject has been administered the TXNRD1 inhibitor; and (b) determining that the TXNRD1 inhibitor is effective if the TXNRD1 protein level in the test sample is reduced compared to the level observed in a control sample obtained from the subject before administration of the TXNRD1 inhibitor. The TXNRD1 inhibitor may be auranofin, piperlongumine, D9, TRi-1, TRi-2, myricetin, PMX464, PX12, brevetoxin-2, manumicin A, ethaselen, aurothioglucose, protoporphyrin IX, an inhibitory RNA against TXNRD1, an anti-TXNRD1 antibody, or any derivative thereof. The test sample may be tissue, cells, or bodily fluids (such as blood, plasma, saliva, urine, or serum) present in the subject. Alternatively, RAS (e.g., KRAS, HRAS, NRAS) and / or TXNRD1 expression levels can be used to determine the efficacy of a TXNRD1 inhibitor in a subject (see Example 6 described herein). Thus, in certain embodiments, the method further comprises detecting RAS (e.g., KRAS, HRAS, NRAS) and / or TXNRD1 expression levels in a subject, wherein a decrease in RAS (e.g., KRAS, HRAS, NRAS) and / or TXNRD1 expression levels compared to those observed in the subject before treatment indicates the therapeutic efficacy of the TXNRD1 inhibitor. Additionally or alternatively, in certain embodiments, the method further comprises detecting RAS (e.g., KRAS, HRAS, NRAS) and / or TXNRD1 protein activity in a subject, wherein a decrease in RAS (e.g., KRAS, HRAS, NRAS) and / or TXNRD1 activity compared to those observed in the subject before treatment indicates the therapeutic efficacy of the TXNRD1 inhibitor.In certain embodiments, RAS mutant cancer comprises KRAS, NRAS or HRAS mutation selected from the group consisting of G12C, G12D, G12V, G12A, G12S, G12R, G13D, G13C, G13S, G13R, G13A, G13V, Q61H, Q61L, Q61R, Q61K, Q61P and Q61E.In certain embodiments, KRAS, NRAS or HRAS mutation is detected by DNA sequencing.

[0081] In any and all embodiments of the methods disclosed herein, TXNRD1 and / or RAS (e.g., KRAS, HRAS, NRAS) expression levels are detected by RNA-seq, Northern blotting, microarray, dot or slot blot, fluorescent in situ hybridization, reverse transcription polymerase chain reaction (RT-PCR), ribonuclease protection assay (RPA), real-time quantitative RT-PCR, high performance liquid chromatography (HPLC), liquid chromatography-mass spectrometry (LC / MS), enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, immunoelectrophoresis, immunostaining, immunohistochemistry, or Western blotting.

[0082] Prevention methods In one aspect, the technology provides a method for preventing or delaying the onset of a disease or condition characterized by elevated expression levels and / or activity of TXNRD1. Additionally or alternatively, in some aspects, the technology provides a method for preventing or delaying the onset of a RAS mutant cancer. In certain embodiments, the RAS mutant cancer comprises a KRAS, NRAS, or HRAS mutation selected from the group consisting of G12C, G12D, G12V, G12A, G12S, G12R, G13D, G13C, G13S, G13R, G13A, G13V, Q61H, Q61L, Q61R, Q61K, Q61P, and Q61E. The RAS mutant cancer can be lung cancer (eg, lung adenocarcinoma), mucinous adenoma, pancreatic cancer (eg, PDAC), colorectal cancer, skin cancer (eg, melanoma), endometrial cancer, testicular germ cell carcinoma, or adrenal cancer.

[0083] Subjects at risk of or prone to diseases or conditions characterized by increased expression level and / or increased activity of TXNRD1, and / or subjects at risk of or prone to RAS mutant cancer, and / or subjects at risk of or prone to pancreatic cancer include subjects that show one or more mutations in RAS (e.g., KRAS, HRAS, NRAS).In addition, subjects may show one or more point mutations in one or more of TP53, CDKN2A, SMAD4, MLL3, TGFBR2, ARID1A and SF3B1, EPC1 and ARID2, ATM, ZIM2, MAP2K4, NALCN, SLC16A4, MAGEA6, ROBO2, KDM6A, PREX2, ERBB2, MET, FGFR1, CDK6, PIK3R3, PIK3CA, BRCA1, BRCA2, PALB2, etc. Biankin et al., Nature 491(7424): 399-405 (2012); and Waddell et al., Nature 518(7540): 495-501 (2015). Additionally or alternatively, the subject may exhibit at least one mutation in one or more of a core set of 12 cell signaling pathways and processes. Jones et al., Science 321(5897): 1801-1806 (2008). Such subjects can be identified, for example, by any or a combination of diagnostic or prognostic assays known in the art. In certain embodiments, the RAS mutant cancer comprises a KRAS, NRAS, or HRAS mutation selected from the group consisting of G12C, G12D, G12V, G12A, G12S, G12R, G13D, G13C, G13S, G13R, G13A, G13V, Q61H, Q61L, Q61R, Q61K, Q61P, and Q61E.

[0084] In prophylactic applications, pharmaceutical compositions or drugs comprising the TXNRD1 inhibitors disclosed herein are administered to (a) subjects susceptible to or otherwise at risk for diseases or conditions characterized by elevated expression levels and / or increased activity of TXNRD1, and / or (b) subjects susceptible to or otherwise at risk for RAS mutant cancer, and / or subjects susceptible to or otherwise at risk for pancreatic cancer, in an amount sufficient to eliminate or reduce the risk of, or delay the onset of, the disease, including its biochemical, histological, and / or behavioral symptoms, its complications, and intermediate pathological phenotypes exhibited during the development of the disease. Administration of a prophylactic TXNRD1 inhibitor can occur before the manifestation of symptoms characteristic of the disease or disorder, so that the disease or disorder is prevented, or alternatively, its progression is delayed.

[0085] In some embodiments, treatment with a TXNRD1 inhibitor will prevent or delay the onset of one or more of the following symptoms: pain in the upper abdomen radiating to the back, loss of appetite or unintentional weight loss, depression, new-onset diabetes, blood clots, fatigue, yellowing of the skin and whites of the eyes (jaundice), abdominal distension, nausea, and vomiting. In certain embodiments, (a) subjects with a disease or condition characterized by elevated expression levels and / or increased activity of TXNRD1, and / or (b) subjects with RAS mutant cancers and / or subjects with pancreatic cancer, who are treated with a TXNRD1 inhibitor, will exhibit TXNRD1 and / or RAS expression levels similar to those observed in healthy control subjects.

[0086] For therapeutic and / or prophylactic applications, a composition comprising a TXNRD1 inhibitor disclosed herein is administered to a subject. In some embodiments, the TXNRD1 inhibitor is administered once, twice, three times, four times, or five times daily. In some embodiments, the TXNRD1 inhibitor is administered more than five times daily. Additionally or alternatively, in some embodiments, the TXNRD1 inhibitor is administered daily, every other day, every second day, every third day, every fourth day, or every fifth day. In some embodiments, the TXNRD1 inhibitor is administered weekly, every other week, every three weeks, or monthly. In some embodiments, the TXNRD1 inhibitor is administered for one week, two weeks, three weeks, four weeks, or five weeks. In some embodiments, the TXNRD1 inhibitor is administered for six weeks or more. In some embodiments, the TXNRD1 inhibitor is administered for twelve weeks or more. In some embodiments, the TXNRD1 inhibitor is administered for less than one year. In some embodiments, the TXNRD1 inhibitor is administered for more than one year. In some embodiments, the TXNRD1 inhibitor is administered throughout the subject's life.

[0087] In some embodiments of the methods of the present technology, the TXNRD1 inhibitor is administered daily for one week or more. In some embodiments of the methods of the present technology, the TXNRD1 inhibitor is administered daily for two weeks or more. In some embodiments of the methods of the present technology, the TXNRD1 inhibitor is administered daily for three weeks or more. In some embodiments of the methods of the present technology, the TXNRD1 inhibitor is administered daily for four weeks or more. In some embodiments of the methods of the present technology, the TXNRD1 inhibitor is administered daily for six weeks or more. In some embodiments of the methods of the present technology, the TXNRD1 inhibitor is administered daily for twelve weeks or more. In some embodiments, the TXNRD1 inhibitor is administered daily for the subject's lifetime.

[0088] Determining the biological effects of TXNRD1 inhibitors In various embodiments, suitable in vitro or in vivo assays are carried out to determine the effect of a particular TXNRD1 inhibitor and whether its administration is suitable for treatment.In various embodiments, in vitro assays can be carried out using representative animal models to determine whether a given TXNRD1 inhibitor exerts the desired effect of reducing or eliminating the signs and / or symptoms of RAS mutant cancer.Compounds for use in treatment can be tested in suitable animal model systems before testing in human subjects, including but not limited to rats, mice, chickens, cows, monkeys, rabbits, and the like.Similarly, for in vivo testing, any animal model system known in the art can be used before administration to human subjects.In some embodiments, in vitro or in vivo testing is directed to the biological function of one or more TXNRD1 inhibitors of the present technology. Animal models of RAS mutant cancer and / or pancreatic cancer can be generated using techniques known in the art (see Example 7 described herein). Such models can be used to demonstrate the biological effects of TXNRD1 inhibitors in preventing and treating conditions resulting from the disruption of specific genes and / or the inhibition of the activity of specific proteins, and to determine what, under given circumstances, comprises a therapeutically effective amount of one or more TXNRD1 inhibitors disclosed herein.

[0089] Mode of Administration and Effective Dosage Any method known in the art can be used to contact cells, organs, or tissues with one or more TXNRD1 inhibitors disclosed herein.Suitable methods include in vitro, ex vivo, or in vivo methods.In vivo methods typically include administering one or more TXNRD1 inhibitors to mammals, suitably humans.When used in vivo for treatment, one or more TXNRD1 inhibitors described herein are administered to subjects in effective amounts (i.e., the amount that produces the desired therapeutic effect).Dosage and administration schedule depend on the degree of the subject's disease state, the characteristics of the specific TXNRD1 inhibitor used, such as its therapeutic index, and the subject's medical history.

[0090] Effective amount can be determined in preclinical and clinical trials by methods well known to physicians and clinicians.The effective amount of one or more TXNRD1 inhibitors useful in the present method can be administered to a mammal in need thereof by any of several well-known methods for administering pharmaceutical compounds.TXNRD1 inhibitors can be administered systemically or locally. One or more TXNRD1 inhibitors described herein can be incorporated into pharmaceutical compositions for administration alone or in combination to subjects for the treatment or prevention of RAS mutant cancer and / or pancreatic cancer.Such compositions typically comprise an active substance and a pharmaceutically acceptable carrier.As used herein, the term "pharmaceutically acceptable carrier" includes physiological saline, solvent, dispersion medium, coating, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration.Additional active compounds can also be incorporated into the composition.

[0091] Pharmaceutical compositions are typically formulated to be compatible with their intended route of administration. Examples of routes of administration include parenteral (intravenous, intradermal, intraperitoneal, or subcutaneous), oral, inhalation, transdermal (topical), ocular, iontophoretic, and transmucosal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application may contain the following components: a sterile diluent such as water for injection, saline, fixed oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; an antibacterial agent such as benzyl alcohol or methylparaben; an antioxidant such as ascorbic acid or sodium bisulfite; a chelating agent such as ethylenediaminetetraacetic acid; a buffer such as acetate, citrate, or phosphate, and an agent for adjusting tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases such as hydrochloric acid or sodium hydroxide. Parenteral preparations can be enclosed in ampoules, disposable syringes, or multiple-dose vials made of glass or plastic. For the convenience of the patient or treating physician, the dosage formulations can be provided in a kit containing all the necessary equipment (e.g., vials of drug, vials of diluent, syringes, and needles) for a course of treatment (e.g., a 7-day treatment).

[0092] Pharmaceutical compositions suitable for injection may include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, CREMOPHOR EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). In all cases, compositions for parenteral administration must be sterile and fluid to the extent that they can be easily syred. They must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.

[0093] Pharmaceutical compositions containing one or more TXNRD1 inhibitors disclosed herein may contain a carrier, which may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thiomersal, and the like. Glutathione and other antioxidants may be included to prevent oxidation. It is often advantageous to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of injectable compositions can be achieved by including an agent that delays absorption, for example, aluminum monostearate or gelatin in the composition.

[0094] Sterile injectable solution can be prepared by incorporating active compound in the required amount in suitable solvent with one or combination of the above-listed components, and then optionally sterilize by filtration.Generally, dispersion is prepared by incorporating active compound into sterile vehicle, and this sterile vehicle contains basic dispersion medium and other components required from above-listed.For the sterile powder that is used to prepare sterile injectable solution, the typical method of preparation includes vacuum drying and freeze-drying, which can produce the powder of active ingredient plus any additional desired components from the solution that has been previously sterilized and filtered.

[0095] Oral compositions generally contain an inert diluent or an edible carrier. For oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, such as gelatin capsules. Oral compositions can also be prepared using a flowable carrier for use as a mouthwash. Pharmaceutically compatible binders and / or adjuvant materials can be included as part of the composition. Tablets, pills, capsules, troches, and the like can contain any of the following ingredients, or compounds of a similar nature: binders such as microcrystalline cellulose, tragacanth gum, or gelatin; excipients such as starch or lactose, disintegrating agents such as alginic acid, Primogel, or cornstarch; lubricants such as magnesium stearate or SteroTe; glidants such as colloidal silicon dioxide; sweeteners such as sucrose or saccharin; or flavoring agents such as peppermint, methyl salicylate, or orange flavor.

[0096] For administration by inhalation, the compounds can be delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer. Such methods include those described in U.S. Patent No. 6,468,798. Systemic administration of therapeutic compounds as described herein can also be via transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be achieved through the use of nasal sprays. For transdermal administration, the active compound is formulated into an ointment, salve, gel, or cream as generally known in the art. In one embodiment, transdermal administration can be performed by iontophoresis.

[0097] The therapeutic agent can be formulated in a carrier system. The carrier can be a colloidal system. The colloidal system can be a liposome, a phospholipid bilayer vehicle, or a lipid nanoparticle. In one embodiment, the therapeutic agent is encapsulated in a liposome while maintaining the structural integrity of the agent. Those skilled in the art will recognize that there are various methods for preparing liposomes (see Lichtenberg, et al., Methods Biochem. Anal., 33:337-462 (1988); Anselem, et al., Liposome Technology, CRC Press (1993)). Liposomal formulations can delay clearance and increase cellular uptake (see Reddy, Ann. Pharmacother., 34(7-8):915-923 (2000)). Active agents can also be loaded into particles prepared from pharmaceutically acceptable components, including, but not limited to, soluble, insoluble, permeable, impermeable, biodegradable, or gastroretentive polymers or liposomes. Such particles include, but are not limited to, nanoparticles, biodegradable nanoparticles, microparticles, biodegradable microparticles, nanospheres, biodegradable nanospheres, microspheres, biodegradable microspheres, capsules, emulsions, liposomes, micelles, and viral vector systems.

[0098] The carrier can also be a polymer, e.g., a biodegradable, biocompatible polymer matrix. In one embodiment, the therapeutic agent can be embedded within the polymer matrix while maintaining the structural integrity of the agent. The polymer can be natural, such as a polypeptide, protein, or polysaccharide, or synthetic, such as a poly-α-hydroxy acid. Examples include carriers made of collagen, fibronectin, elastin, cellulose acetate, cellulose nitrate, polysaccharides, fibrin, gelatin, and combinations thereof. In one embodiment, the polymer is polylactic acid (PLA) or lactic / glycolic acid copolymer (PGLA). Polymer matrices can be prepared and isolated in various shapes and sizes, including microspheres and nanospheres. Polymer formulations can provide long-lasting therapeutic effects (see Reddy, Ann. Pharmacother., 34(7-8):915-923 (2000)). Polymer formulations of human growth hormone (hGH) are in clinical trials (see Kozarich and Rich, Chemical Biology, 2:548-552 (1998)).

[0099] Examples of polymeric microsphere sustained-release formulations are described in WO 99 / 15154 (Tracy et al.), U.S. Patent Nos. 5,674,534 and 5,716,644 (both Zale et al.), WO 96 / 40073 (Zale et al.), and WO 00 / 38651 (Shah et al.). U.S. Patent Nos. 5,674,534 and 5,716,644, and WO 96 / 40073, describe polymer matrices containing particles of erythropoietin that are stabilized against aggregation by salt.

[0100] In some embodiments, therapeutic compounds are prepared with carriers that protect the therapeutic compounds from rapid elimination from the body, such as controlled-release formulations, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Such formulations can be prepared using known techniques. Materials can also be commercially obtained, for example, from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to specific cells with monoclonal antibodies against cell-specific antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811. Therapeutic compounds can also be formulated to enhance intracellular delivery. For example, liposome delivery systems are known in the art, see, for example, Chonn and Cullis, "Recent Advances in Liposome Drug Delivery Systems," Current Opinion in Biotechnology 6:698-708 (1995); Weiner, "Liposomes for Protein Delivery: Selecting Manufacturing and Development Processes," Immunomethods, 4(3):201-9 (1994); and Gregoriadis, "Engineering Liposomes for Drug Delivery: Progress and Problems," Trends Biotechnol., 13(12):527-37 (1995). Mizguchi, et al., Cancer Lett., 100:63-69 (1996) describes the use of fusogenic liposomes to deliver proteins to cells both in vivo and in vitro.

[0101] The dosage, toxicity, and therapeutic efficacy of any therapeutic agent can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, to determine the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index, which can be expressed as the ratio LD50 / ED50. Compounds that exhibit high therapeutic indices are advantageous. Compounds that exhibit toxic side effects may be used, but care should be taken to design delivery systems that target such compounds to the site of affected tissues in order to minimize potential damage to uninfected cells and reduce side effects.

[0102] Data obtained from cell culture assays and animal studies can be used to formulate a dosage range for use in humans. The dosage of such compounds can be within a range of circulating concentrations that includes the ED50 without significant toxicity. Dosages can vary within this range depending on the dosage form used and the route of administration utilized. For any compound used in the present methods, a therapeutically effective dose can be initially estimated from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound that achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to accurately determine useful doses in humans. Plasma levels can be measured, for example, by high-performance liquid chromatography.

[0103] Typically, an effective amount of one or more TXNRD1 inhibitors disclosed herein sufficient to achieve a therapeutic or prophylactic effect ranges from about 0.000001 mg per kilogram of body weight per day to about 10,000 mg per kilogram of body weight per day. Suitably, the dosage ranges from about 0.0001 mg per kilogram of body weight per day to about 100 mg per kilogram of body weight per day. For example, dosages can be 1 mg / kg or 10 mg / kg of body weight daily, every other day, or every third day, or within the range of 1 to 10 mg / kg weekly, every other week, or every two weeks. In one embodiment, a single dosage of therapeutic compound ranges from 0.001 to 10,000 micrograms per kilogram of body weight. In one embodiment, the concentration of one or more TXNRD1 inhibitors in the carrier ranges from 0.2 to 2000 micrograms per milliliter delivered. Exemplary treatment regimens entail once-daily or once-weekly administration. In therapeutic applications, relatively high dosages at relatively short intervals may be required until the progression of the disease slows or stops, or until the subject shows partial or complete remission of disease symptoms, after which the patient can be placed on a prophylactic regimen.

[0104] In some embodiments, the therapeutically effective amount of one or more TXNRD1 inhibitors is 10 -32 ~10 -6 Molar concentration, e.g., approximately 10 -7 The dose can be defined as the molar concentration of the inhibitor in the target tissue. This concentration can be delivered by a systemic dose of 0.001 to 100 mg / kg, or the equivalent dose by body surface area. The administration schedule can be optimized to maintain therapeutic concentrations in the target tissue, including, for example, single daily or weekly administration, as well as continuous administration (e.g., parenteral infusion or transdermal application). Those skilled in the art will recognize that certain factors can affect the dosage and timing required to effectively treat a subject, including, but not limited to, the severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a therapeutic composition described herein can include a single treatment or a series of treatments.

[0105] The mammal treated according to the present method can be any mammal, including, for example, livestock such as sheep, pigs, cattle, and horses; pet animals such as dogs and cats; and laboratory animals such as rats, mice, and rabbits. In some embodiments, the mammal is a human.

[0106] Combination treatment In some embodiments, one or more of the TXNRD1 inhibitors disclosed herein can be used in combination with one or more additional therapies to prevent or treat RAS mutant cancer or pancreatic cancer. Additional therapeutic agents include, but are not limited to, ABRAXANE® (albumin-bound paclitaxel), GEMZAR® (gemcitabine), 5-FU (fluorouracil), ONIVYDE® (irinotecan liposome injection), surgery, radiation, or a combination thereof. In some embodiments, one or more TXNRD1 inhibitors disclosed herein may be administered separately, sequentially, or simultaneously with at least one additional therapeutic agent selected from the group consisting of immunotherapeutic agents, alkylating agents, topoisomerase inhibitors, endoplasmic reticulum stress inducers, antimetabolites, mitotic inhibitors, nitrogen mustards, nitrosoureas, alkyl sulfonates, platinum agents, taxanes, vinca agents, antiestrogens, aromatase inhibitors, ovarian suppressants, VEGF / VEGFR inhibitors, EGF / EGFR inhibitors, RAS inhibitors, PARP inhibitors, cytostatic alkaloids, cytotoxic antibiotics, endocrine / hormonal agents, bisphosphonate therapeutic agents, phenformin, and targeted biological therapeutic agents (e.g., therapeutic peptides described in U.S. Pat. No. 6,306,832, WO2012007137, WO2005000889, WO2010096603, etc.). In some embodiments, the at least one additional therapeutic agent is a chemotherapeutic agent.

[0107] Specific chemotherapy agents include cyclophosphamide, fluorouracil (or 5-fluorouracil or 5-FU), methotrexate, edatrexate (10-ethyl-10-deaza-aminopterin), thiotepa, carboplatin, cisplatin, taxanes, paclitaxel, protein-bound paclitaxel, docetaxel, vinorelbine, tamoxifen, raloxifene, toremifene, fulvestrant, gemcitabine, irinotecan, ixabepilone, temozolmide, topotecan, vincristine, vinblastine eribulin, mutamycin, capecitabine, anastrozole, exemestane, letrozole, leuprolide, abarelix, buserlin, goserelin, megestrol acetate, risedronate, pamidronate, ibandronate, alendronate, denosumab, zoledronate, trastuzumab, tykerb, anthracyclines (e.g., daunorubicin and doxorubicin), cladribine, midostaurin, bevacizumab, oxaliplatin, melphalan, etoposide, mechlorethamine acetogenins, chlorambucil, ifosfamide, streptozocin, carmustine, lomustine, busulfan, dacarbazine, temozolumide, altretamine, 6-mercaptopurine (6-MP), cytarabine, floxuridine, fludarabine, hydroxyurea, pemetrexed, epirubicin, idarubicin, SN-38, ARC, NPC, camptothecin, 9-nitrocamptothecin, 9-aminocamptothecin, rubifen, gimatecan, diflomotecan, BN80927, DX-8951 f, MAG-CPT, amasacrilene (amsacnne), etoposide phosphate, teniposide, azacitidine (Vidaza), decitabine, baccatin III, 10-deacetyltaxol, 7-xylosyl-10-deacetyltaxol, cephalomannine, 10-deacetyl-7-epitaxol, 7-epitaxol, 10-deacetylbaccatin III, 10-deacetylcephalomannine, streptozotocin, nimustine, ranimustine, bendamustine, uramustine, estramustine, mannosulfan, camptothecin, exatecan,These include, but are not limited to, lurtotecan, lamellarin D9-aminocamptothecin, amsacrine, ellipticine, aurintricarboxylic acid, HU-331, or a combination thereof.

[0108] Examples of antimetabolites include 5-fluorouracil (5-FU), 6-mercaptopurine (6-MP), capecitabine, cytarabine, floxuridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, pemetrexed, and mixtures thereof.

[0109] Examples of taxanes include baccatin III, 10-deacetyltaxol, 7-xylosyl-10-deacetyltaxol, cephalomannine, 10-deacetyl-7-epitaxol, 7-epitaxol, 10-deacetylbaccatin III, 10-deacetylcephalomannine, and mixtures thereof.

[0110] Examples of DNA alkylating agents include cyclophosphamide, chlorambucil, melphalan, bendamustine, uramustine, estramustine, carmustine, lomustine, nimustine, ranimustine, streptozotocin; busulfan, mannosulfan, and mixtures thereof.

[0111] Examples of topoisomerase I inhibitors include SN-38, ARC, NPC, camptothecin, topotecan, 9-nitrocamptothecin, exatecan, lurtotecan, lamellarin D9-aminocamptothecin, rubifen, gimatecan, diflomotecan, BN80927, DX-8951f, MAG-CPT, and mixtures thereof. Examples of topoisomerase II inhibitors include amsacrine, etoposide, etoposide sulfate, teniposide, daunorubicin, mitoxantrone, amsacrine, ellipticine, aurintricarboxylic acid, doxorubicin, and HU-331, and combinations thereof.

[0112] Examples of immunotherapeutic agents include immune checkpoint inhibitors (e.g., antibodies targeting CTLA-4, PD-1, PD-L1), ipilimumab, 90Y-clivatuzumab tetraxetan, pembrolizumab, nivolumab, trastuzumab, cixutumumab, ganitumab, demcizumab, cetuximab, nimotuzumab, dalotuzumab, sipuleucel-T, CRS-207, and GVAX. Examples of RAS inhibitors include AMG 510, MRTX849, ARS-3248, BI 1701963, ARS-1620, ARS-853, thiol-reactive GDP analogs, BBP-454, mRNA-5671, KRAS G12D inhibitors, and the like. In any case, the multiple therapeutic agents can be administered in any order, or even simultaneously.If administered simultaneously, the multiple therapeutic agents can be provided in a single, integrated form or in multiple forms (for example, either as a single pill or as two separate pills).One of the therapeutic agents can be given in multiple doses, or both can be given in multiple doses.If not administered simultaneously, the timing between multiple doses can vary from more than 0 weeks to less than 4 weeks.In addition, the combination methods, compositions, and preparations should not be limited to the use of only two active substances.

[0113] kit The present disclosure also provides a kit for preventing and / or treating RAS mutant cancer (e.g., RAS mutant pancreatic cancer), comprising one or more TXNRD1 inhibitors. Optionally, the above-described components of the kit of the present technology are packaged in a suitable container and labeled for preventing and / or treating RAS mutant cancer (e.g., RAS mutant pancreatic cancer).

[0114] The above-mentioned components may be stored in unit-dose or multi-dose containers, such as sealed ampoules, vials, bottles, syringes, and test tubes, as aqueous, preferably sterile, solutions, or as lyophilized, preferably sterile, formulations for reconstitution. The kit may further include a second container holding a diluent suitable for diluting the pharmaceutical composition to a larger volume. Suitable diluents include, but are not limited to, pharmaceutically acceptable excipients of the pharmaceutical composition and saline. The kit may further include instructions for diluting the pharmaceutical composition and / or instructions for administering the pharmaceutical composition, whether diluted or not. The container may be formed from a variety of materials, such as glass or plastic, and may have a sterile access port (e.g., the container may be an intravenous solution bag or vial with a stopper pierceable by a hypodermic injection needle). The kit may further include an additional container containing a pharmaceutically acceptable buffer, such as phosphate-buffered saline, Ringer's solution, and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, media for one or more of the appropriate hosts. Kits may optionally include instructions for use that are typically included in commercial packaging of therapeutic or diagnostic products, containing, for example, information about the indications, usage, dosage, manufacture, administration, contraindications, and / or warnings regarding the use of such therapeutic or diagnostic products.

[0115] The kit may also include, for example, a buffer, a preservative, or a stabilizer. The kit may also contain a control sample or a series of control samples that can be assayed and compared to the test sample. Each component of the kit may be enclosed in an individual container, and all of the various containers may be in a single package along with instructions for interpreting the results of an assay performed using the kit. The kits of the present technology may contain written material on or in the kit container. The written material describes how to use the reagents contained in the kit. In certain embodiments, use of the reagents may follow the methods of the present technology. [Example]

[0116] The present technology is further illustrated by the following examples, which should not be construed as limiting the invention in any way. The examples herein are provided to illustrate the advantages of the present technology and to further assist those skilled in the art in preparing or using the compositions and systems of the present technology. The examples should not be construed as limiting the scope of the present technology as defined by the appended claims. The examples may include or incorporate any of the variations, aspects, or embodiments of the present technology described above. The variations, aspects, or embodiments may also include or incorporate variations of any or all other variations, aspects, or embodiments of the present technology, respectively. The following examples demonstrate the preparation, characterization, and use of illustrative compositions of the present technology that inhibit TXNRD1 expression and / or activity.

[0117] Example 1 Experimental Materials and Methods Preprocessing of scRNA-seq count data. The raw HGNC-aligned UMI count matrix generated by 10x sequencing was preprocessed and scaled before analysis in the downstream analysis pipeline. Low-abundance genes (e.g., average counts <0.25) and genes with reads in fewer than 10% of cells, as well as cells with non-zero reads for fewer than 10% of all genes, were removed from the count matrix. To adjust for discrepancies in sequencing depth between individual cells, the count matrix was optionally normalized and scaled before proceeding in subsequent analyses. Normalization methods included, but were not limited to, 1) globally scaling cell-level counts to match the median depth across all cells (scalar adjustment), and 2) solving simultaneous linear equations to obtain unique scaling factors for individual cells. In some cases, sample batch effects were corrected using a reciprocal nearest neighbor algorithm.

[0118] Supervised dimensionality reduction. To computationally identify therapeutic targets, high-dimensional count data were mapped into a lower-dimensional latent space. The latent space was constructed by supervised dimensionality reduction on a collection of pure cell types (e.g., pancreatic adenocarcinoma, ductal cells, and acinar cells), with cell types serving as supervised labels for reduction. In this way, the latent space maximized the separability between cancer cells and primary cells. In some cases, cells targeted with essential genes (e.g., PCNA or MCM6 by RNAi or CRISPR) were also included in the construction of the latent space to define regions of "toxicity." For example, toxicity manifested when genes were knocked down induced apoptosis in primary cells. After model training, cells queried for CRISPR target candidates were mapped into the same latent space constructed from the pure cell types to quantify their shift toward a wild-type expression profile (therapeutic index).

[0119] Several algorithms were used for supervised dimensionality reduction, and in some cases the Elbow method (Richards et al., J Shoulder Elbow Surg 8(4): 351-354 (1999)) was used to determine the optimal number of dimensions for the latent space.

[0120] Therapeutic index scoring. Target genes queried by the pooled CRISPRi library were quantified for their ability to shift the transcriptional profile of cancer cells back to a wild-type-like expression state (therapeutic index). Genes were scored using machine learning algorithms. Briefly, separate one-class machine learning algorithms were trained on the potential expression profiles of different cell types, including, but not limited to: 1) pancreatic ductal cells; 2) pancreatic acinar cells; 3) pancreatic adenocarcinoma; and 4) pancreatic adenocarcinoma with essential genes (e.g., PCNA or MCM6) targeted (by CRISPR / RNAi) as a model for toxicity. Each trained machine learning model was then used to score candidate genes based on the output of a decision function applied to the potential expression profiles of single cells targeted by the CRISPRi library. In some cases, cells were sampled with repeated replacement to construct bootstrap confidence intervals for the decision function estimates.

[0121] 2-D pooled negative selection RNAi screening. As previously described (Huang et al., Genes Dev. 28(16): 1800-1814 (2014)), we designed and constructed a custom shRNA library (2245 shRNAs, 5-6 per gene) focused on 442 drug target genes. The library was cloned into the TRMPV-Neo vector and transfected into Tet-On mouse pancreatic ductal adenocarcinoma (mPDAC) cells (Kras G12D; Myc; shp53). Lito et al., Cancer Cell 25(5):697-710 (2014). The conditions used for library transduction resulted in primarily single retroviral integrations, with each shRNA expressed in a calculated number of at least 1,000 cells. Transduced cells were selected for 5 days with 1 mg / mL G418 (Invitrogen). At each passage, more than 20 million cells were maintained to preserve library expression throughout the experiment. After drug selection, a TO sample was obtained (20 million cells per replicate) and transduced into Venus. + After 12 days (passage 6, T12), cells were sorted and 20 million shRNA-expressing (dsRed + Venus + ) Cells were sorted for each replicate using a FACSAria II (BD Biosciences). Genomic DNA from T0 and T12 samples was isolated by two rounds of phenol extraction using PhaseLock tubes (5 Prime) followed by isopropanol precipitation.

[0122] We then compared the results from the mPDAC screen with Myc;p53 - / - We compared the results with those obtained from mouse hepatocellular carcinoma (mHCC) cells (Huang et al., Genes Dev. 28(16): 1800-1814 (2014)), and constructed a two-dimensional RNAi screening plot (see, for example, Figure 3A). Plasmids. For conditional RNAi experiments, shRNAs were expressed from TRMPV-Neo vectors derived from either the miR-E or miR-30 backbone as previously described (Zuber et al., Nat Biotechnol. 29(1):79-83 (2011); Fellmann et al., Cell Rep 5(6): 1704-1713 (2013)). Knockdown efficiency or overexpression was assessed by immunoblotting.

[0123] Immunoblotting. Cell pellets were dissolved in Laemmli buffer (100 mM Tris-HCl pH 6.8, 5% glycerol, 2% SDS, 5% 2-mercaptoethanol). Equal amounts of protein were separated on a 12% SDS-polyacrylamide gel and transferred to a PVDF membrane at 90 V for 120 min. β-actin abundance was monitored to ensure equal loading. Images were analyzed using AlphaView software (ProteinSimple). Immunoblotting was performed using antibodies against TXNRD1 (TrxR1) (1:1000, sc-28321, Santa Cruz Biotechnology), KRAS (1:200, WH0003845M1, Sigma-Aldrich), or β-actin-HRP (1:10000, A3854, Sigma).

[0124] Proliferation assay. Competitive proliferation assays using shRNA in the TRMPV-Neo vector (with miR-30 or miR-E backbone) were performed as previously described (Huang et al., Genes Dev. 28(16): 1800-1814 (2014)). In vitro growth inhibition assays by auranofin or piperlongumine were performed by counting viable cells using a CellTiter-Glo luminescent cell viability assay (Promega) after 72 hours of cell incubation in the presence of increasing concentrations of auranofin or piperlongumine. Proliferation rates were calculated by dividing the number of viable cells at 72 hours by the number at 0 hours. Relative proliferation rates were calculated by normalizing to the proliferation rate of vehicle-treated cells.

[0125] Animal studies. All experimental procedures described in this study were approved by the Institutional Animal Care and Use Committee (IACUC) at Memorial Sloan Kettering Cancer Center (NY) under protocol numbers 11-06-016 and 11-06-018. Mice were maintained under specific pathogen-free conditions and provided with food and water ad libitum. In vivo conditional RNAi experiments. Tet-On mouse PDAC cells were transduced with luciferase-hygro and TRMPV-Neo-miR-E shRNA constructs. One million mouse PDAC cells were orthotopically transplanted into female nude recipient mice (NCR nu / nu, purchased from Charles River Laboratories and Harlan Laboratories). For whole-body bioluminescence imaging, mice were intraperitoneally injected with 50 mg / kg D-luciferin (Goldbio) and analyzed 10 minutes later using an IVIS Spectrum system (Caliper LifeSciences). Quantification was performed using Living Image software (Caliper LifeSciences) on standardized circular regions of interest covering the mouse trunk and limbs. For shRNA induction, animals were treated with doxycycline in drinking water (2 mg / ml with 2% sucrose; Sigma-Aldrich) and food (625 mg / kg, Harlan Laboratories).

[0126] In vivo drug treatment experiments. For auranofin treatment studies, 16 mg auranofin was first dissolved in 4 mL ethanol and then diluted with 12 mL PBS to a final concentration of 1 mg / mL. Mice were given auranofin (10 mg / kg) or a similar volume of vehicle via intraperitoneal injection daily. Sick animals were sacrificed, and pancreatic tissues and tumors were used for further analysis.

[0127] RNA Sequencing and Gene Set Enrichment Analysis (GSEA) Analysis. For RNA sequencing, total RNA from mPDAC cells containing control Renilla luciferase or shRNA targeting TXNRD1 was isolated using the RNeasy Mini Kit, QIAshredder Columns, and RNase-Free DNase Set (Qiagen). RNA-seq library construction and sequencing were performed according to the protocol used by the Integrated Genomics Operation (IGO) Core at MSKCC. Five to ten million reads were acquired per replicate sample. After adapter removal with Trimmomatic (Bolger et al., 2014), RNA-seq reads were aligned to GRCh37.75 (hg19) using the STAR alignment tool (Dobin et al., 2013). Genome-wide transcript counting was performed by HTSeq to generate an FPKM matrix (Anders et al., 2015 Bioinformatics). Gene set enrichment analysis (Subramanian et al., 2005) was performed using GSEA v2.07 software.

[0128] Statistics. Data are presented as mean ± standard deviation unless otherwise noted. Statistical significance between groups was calculated by two-tailed Student's t-test. Corrections were calculated by Pearson's test. Prism 7 software was used to calculate IC 50 The significance level was P<0.05 ( * ), P<0.01( ** ), and P<0.001( *** ) In some cases, volcano plots were created.

[0129] Gene dependency analysis. Data from human cancer cell line genome-wide sgRNA screens used for all heatmaps were from http: / / genomecrispr.dkfz.de / . Log2FC (log-transformed abundance fold change) was used to calculate a gene dependency score for each gene in each experiment. Gene dependency scores were calculated by averaging the Log2FC of all sgRNAs targeting the same gene. Genes with similar phenotypes were clustered for visualization using unsupervised clustering using the "Pheatmap" R package. Determination of fold changes in sensitivity to auranofin and quantitative analysis of drug synergy. Drug synergy was analyzed using CompuSyn software (version 1.0) (http: / / www.combosyn.com), which is based on the median-effectiveness principle and the combination index-isobologram theorem. Combination index (CI) values: CI > 1 indicates antagonism; CI = 0.75-1.25 indicates an additive effect; and < 1 indicates synergy. Each GI (growth inhibition) or CI score represents data from at least three independent experiments.

[0130] Auranofin Pharmacokinetics. Plasma and pancreatic pharmacokinetics of gold were analyzed in nine NCR nu / nu mice after administration of a single dose of 10 mg / kg auranofin suspension via intraperitoneal injection. Plasma and pancreatic samples for gold concentration determination were obtained 2, 4, and 24 hours after administration of auranofin. Collected plasma and pancreatic samples were analyzed using inductively coupled plasma mass spectrometry (ICPMS) to quantify gold concentrations.

[0131] Example 2 Computational discovery and validation of novel targets in Kras mutant pancreatic cancer Figures 1A-1B provide a pipeline for computational discovery of therapeutic targets in RAS mutant pancreatic cancer. As shown in Figure 1A, Kras mutant pancreatic cell lines were screened using a CRISPRi library transduced at a low multiplicity of infection (MOI). Single-cell transcriptomes were isolated using a Chromium instrument (10X Genomics) and enzyme kit (10X Genomics), converted to DNA libraries, and sequenced using a Hiseq4000 system (Illumina). Single-cell RNA sequencing (scRNA-seq) profiles of individual cells were matched to their respective CRISPR targets by paired-end sequencing and barcodes. Raw reads in FASTQ format were aligned across the whole genome and mapped to the appropriate genomic coordinates and HGNC genes for each cell, resulting in a count matrix consisting of N cells × M genes (see Figure 1A). This N × M matrix was further reduced to an N × 50 matrix by supervised dimensionality reduction (see Figure 1A). A dimensionality reduction model was trained to identify pure cell types (e.g., cancer cells, ductal cells, acinar cells, or cancer cells expressing a non-targeting guide RNA that served as a negative control), resulting in a lower-dimensional latent space that maximally separated healthy and cancer cells from each other (see Figures 1A-2A). Cells expressing CRISPR targets that maximally shifted mRNA expression patterns away from the negative control and toward healthy cells (ductal or acinar cells) were identified using this algorithm; such CRISPR targets constituted the most promising targets to explore in preclinical development.

[0132] As shown in Figures 1A-1B, we used a machine learning algorithm to quantify the therapeutic index. Briefly, separate machine learning models were trained to identify distinct cell populations: 1) pancreatic ductal cells (positive control for therapeutic index); 2) pancreatic acinar cells (positive control for therapeutic index); 3) Kras mutant PDAC cells expressing a non-targeting guide RNA (negative control for therapeutic index); and 4) Kras mutant PDAC cells expressing the essential gene being targeted (positive control for toxic target). As shown in Figures 1A-1B, we then applied the trained machine learning models to RNA-seq data from Kras mutant PDAC cells expressing CRISPRi targets to detect cells that exhibited RNA-seq profiles similar to pancreatic acinar cells but distinct from Kras mutant PDAC cells expressing the negative control for therapeutic index. The identity of the CRISPRi targets expressed by such cells was identified based on paired-end sequencing and barcoding. The target with the largest therapeutic index was selected for exploration in preclinical development.

[0133] Example 3 Computational identification of TXNRD1 as a therapeutic target in KRAS mutant pancreatic cancer As shown in Figure 1B, scRNA-seq profiles of individual Kras mutant PDAC cells expressing the CRISPRi target were analyzed using the decision function of a machine learning algorithm trained on two non-targeting guide RNAs, a toxic target, and a healthy ductal cell line, as described above. The output of the decision function was further transformed using various methods, including but not limited to, effect sizes relative to the control population, K-S statistics, z-scores, or p-values. Scores across multiple machine learning algorithms and replicates were further integrated using various methods, including but not limited to, mean, weighted mean, rank integration, weighted rank integration, Stouffer's method (z-score), and Fischer's method (p-value).

[0134] As shown in Figure 2A, TXNRD1 was identified as a CRISPRi target that transformed Kras mutant PDAC cells to exhibit an RNA-seq profile similar to pancreatic acinar cells. The distribution of cell type populations was analyzed and plotted along one dimension after supervised dimensionality reduction using a machine learning algorithm. As shown in Figure 2A, Kras mutant PDAC cells (N = 87) expressing a guide RNA targeting TXNRD1 showed a shift toward healthy ductal cells (N = 600). By comparison, Kras mutant PDAC cells (N = 122) expressing an ineffective CRISPRi target (non-targeting guide RNA) largely overlapped with the profile of cancer cells. As shown in Figure 2B, the z-transformed therapeutic index of TXNRD1, averaged across four decision functions from the machine learning algorithm, was the highest among the top 20 candidate targets. Similarly, as shown in Figure 2C, TXNRD1 exhibited the highest weighted average decision function score for therapeutic index among a panel of over 50 candidate targets.

[0135] Example 4 Identification of TXNRD1 as a therapeutic target by a 2-D RNAi screening approach To selectively identify drug targets essential for the maintenance of KRAS mutant PDAC, we administered a custom library of short hairpin RNAs (shRNAs) directed against known drug targets to a genetically defined mouse HCC model (Kras G12D ;Myc;shp53) for negative selection. Results were compared with a mouse HCC model (Myc;p53) - / -We cross-analyzed our previous negative selection results from (Huang et al., Genes Dev. 28(16): 1800-1814 (2014)). As shown in Figure 3A, shRNAs targeting Txnrd1, Acpp, and Amt were found to be selectively depleted in Kras mutant PDAC cells compared with the negative control shRNA, which remained unchanged in both cell lines. In comparison, the positive control shRNA was depleted in both mouse HCC and PDAC cells (see Figure 3A).

[0136] To detect depletion of cells expressing specific siRNAs quantified in mPDAC, mHCC, and iMEF, these cells were transduced with viruses carrying inducible shRNAs against Txnrd1, Acpp, Amt, and controls: Ren.713 (a non-targeting shRNA serving as a negative control), Rpa3.561 (a positive control for growth inhibition in all proliferating cells), and Kras.247 (a positive control for mPDAC-specific growth inhibition). The percentage of cells expressing these shRNAs was determined on days 0 and 12 of shRNA induction. A decrease in the percentage of cells expressing the shRNA indicated the inhibitory effect of the shRNA. As shown in Figure 3B, the non-targeting negative control shRNA Ren.713 (against Renilla luciferase) had no effect in any of the cells, while the positive control shRNA Rpa3.561 depleted all cell types tested. The mPDAC-specific positive control Kras.247 was depleted in mPDAC compared to mHCC and iMEF. As shown in Figure 3B, shRNAs against Txnrd1, Acpp, and Amt significantly increased the expression of Kras mutant PDAC cells (Kras) compared to the negative control. G12D ;Myc;shp53), but showed inhibitory effects in mHCC cells (Myc;p53 - / -) or in non-transformed immortalized mouse embryonic fibroblasts (iMEFs). The effect of Txnrd1 shRNA was more pronounced than that of shRNAs targeting Acpp or Amt. The Western blot shown in Figure 3B shows that shRNAs reduced the amount of their target proteins. Therefore, this assay also identified Txnrd1 as a promising target. Given that RAS gain-of-function mutations (e.g., at codons 12, 13, or 61) occur in regions that share 100% amino acid sequence identity among KRAS, NRAS, and HRAS isoforms (see Prior et al., Cancer Research 72(10) (2012)), inhibition of TXNRD1 is predicted to treat cancers associated with KRAS, NRAS, and HRAS mutations.

[0137] TXNRD1 dependence was further investigated in various cell lines. As shown in Figures 6A-6B, knocking out or knocking down the replication genes RAP1 or PCNA resulted in general lethality in almost all cell lines. In contrast, TXNRD1 is conditionally required in certain cell lines that exhibit similar dependence on KRAS, HRAS, and NRAS.

[0138] These results demonstrate that the TXNRD1 inhibitor compositions of the present technology are useful in methods for treating diseases or conditions characterized by elevated levels of RAS expression and / or elevated levels of TXNRD1 expression in subjects in need thereof.

[0139] Example 5 KRAS mutant PDAC growth is sensitive to pharmacological TXNRD1 inhibition To evaluate the effects of pharmacological inhibition of TXNRD1 in pancreatic cancer using small molecule drugs, we undertook inhibition studies with myricetin, manumicin A, protoporphyrin IX, and auranofin.

[0140] Auranofin is an inhibitor of the enzymatic activity of TXNRD1 (see Gromer et al., J Biol Chem 273(32): 20096-20101). Myricetin, manumicin A, and protoporphyrin IX are also inhibitors of the enzymatic activity of TXNRD1. mPDAC cells were treated with the TXNRD1 inhibitor auranofin or DMSO for 72 hours, and viability was measured. DMSO treatment served as a negative control, causing a lack of growth inhibition. The viable cell count of DMSO-treated cells was set to 1. The viability of auranofin-treated cells, normalized to the viability of DMSO-treated cells, was plotted as a function of auranofin concentration and fitted to an exponential growth curve. Myricetin, manumicin A, and protoporphyrin IX were also subjected to similar treatments. As shown in Figure 3D, auranofin inhibited the growth of mPDAC cells at sub-micromolar concentrations. These results demonstrate that the TXNRD1 inhibitor compositions of the present technology are useful in methods for treating diseases or conditions characterized by RAS mutations, elevated levels of RAS expression, and / or elevated levels of TXNRD1 expression in a subject in need thereof.

[0141] Example 6 KRAS status predicts response to TXNRD1 inhibition Because the screening system discussed above and Figures 1A–3B were driven by mutant Kras, p53 deficiency, and Myc overexpression, we investigated whether alterations in any of these genes determined sensitivity to TXNRD1 inhibition. Twelve pancreatic cancer cell lines were treated with increasing concentrations of auranofin or DMSO. Among the cell lines used in this experiment, L3.3, Colo357, and BXPC3 harbor wild-type Kras. Cell lines PANC0327, MIAPaCa-2, PANC0213, ASPC1, 8898, CFPAC-1, L3.6pl, PANC1, and SU8686 contained KRAS mutations. While there was variability among cell lines, as shown in Figure 3E, KRAS mutant cells were generally more sensitive to auranofin than wild-type Kras cells.

[0142] To understand whether the observed differences between the sensitivity of wild-type KRAS cells and KRAS mutant cells are statistically significant, we evaluated the IC of the relative sensitivity of human PDAC cell lines to TXNRD1 inhibition by auranofin. 50 The data were compared. As shown in Figure 4A, a significant correlation was found between the antiproliferative response to TXNRD1 inhibition and KRAS mutation status. In contrast, as shown in Figures 4B-4C, there was no significant correlation between the response to TXNRD1 inhibition and P53 mutation status or MYC mRNA expression. To understand the effect of KRAS mutations (G12C, G12D, G12V) on auranofin sensitivity, human pancreatic cancer cells containing different KRAS mutations (G12C, G12D, G12V) or wild-type cells were treated with another TXNRD1 inhibitor, piperlongumine. As shown in Figure 4D, KRAS mutant cells were more sensitive to piperlongumine than wild-type KRAS cells, further strengthening the above findings. To understand whether there is a correlation between the expression of KRAS and TXNRD1, the expression of both these genes was quantified in 149 human pancreatic cancer tumors from the Cancer Genome Atlas Research Network (TCGA) and presented as a scatter plot. As shown in Figure 4E, a correlation between TXNRD1 and KRAS expression levels was observed (r=0.36, p<0.0001).

[0143] To understand the molecular mechanism of TXNRD1 suppression in PDAC cells, we performed RNA-seq analysis of mPDAC cells containing control Renilla or shRNA targeting Txnrd1. As shown in Figure 4F-4G, suppression of Cdk9 resulted in reversion of both KRAS-dependent (Figure 4F) and pancreatic cancer signatures (Figure 4G), further confirming the finding that TXNRD1 is required for KRAS oncogenic signaling. Interestingly, as shown in Figure 4H, suppression of TXNRD1 downregulated a gene signature related to amino acid transporters and ferroptosis, including a gene called SLC7A11.

[0144] These results demonstrate that the TXNRD1 inhibitor compositions of the present technology are useful in methods for treating diseases or conditions characterized by elevated levels of RAS expression and / or elevated levels of TXNRD1 expression in subjects in need thereof.

[0145] Example 7 TXNRD1 is required for the maintenance of KRAS mutant pancreatic tumors We also investigated the relevance of TXNRD1 to PDAC progression in vivo. To suppress Txnrd1 in established pancreatic tumors, mPDAC cells were transduced with luciferase and a dox-inducible TRMPV-Neo-miR-E construct (Renilla and Kras) containing Txnrd1 shRNA or a control shRNA and implanted into the pancreas of recipient mice by orthotopic injection (Figure 5A). Upon detection of luminescent signals, animals were treated with or without dox to induce expression of the corresponding shRNA. As shown in Figure 5C, bioluminescence imaging revealed that mice from the untreated group (no dox) exhibited large pancreatic tumors by day 7. In contrast, knockdown of Txnrd1 or Kras resulted in comparable delays in tumor growth. Thus, RNAi-mediated suppression of Txnrd1 mimics the effects of Kras inhibition in eliciting antitumor effects in Kras-mutant PDAC in vivo. Tumor mass was quantified from animals treated with or without doxycycline to induce the corresponding shRNA (n = 4–5). As shown in Figure 5B, tumor mass from mice from the untreated group (no dox) showed larger pancreatic tumors compared to mice with knockdown of Txnrd1 or Kras, which resulted in comparable tumor growth delays. Tumor mass expressing Ren.713E was not affected by doxycycline treatment (compare the two sets of replicates in the Ren.713 column in Figure 5B). Tumor mass expressing Txnrd1 shRNA and KRAS shRNA was inhibited to a similar extent by doxycycline treatment (compare the two sets of inter- and intragroup replicates in the Txnrd1.2057E, Txnrd1.1474E, and KRas.247 columns in Figure 5B).

[0146] These results demonstrate that the TXNRD1 inhibitor compositions of the present technology, e.g., agents that inhibit the expression of TXNRD1, are useful in methods for treating RAS mutant cancers in subjects in need thereof.

[0147] The growth inhibitory effect of pharmacological TXNRD1 inhibition was also confirmed by KRas G12D ;p53 - / - We investigated an additional mouse PDAC model generated by transplanting pancreatic cancer organoid lines into the pancreases of recipient mice. Mice were treated with either vehicle alone, which served as a negative control, or auranofin. As shown in Figure 5D, consistent with the in vivo RNAi results (Figures 5A-5C), treatment with the TXNRD1 inhibitor auranofin (10 mg / kg, once daily, 5 days per week) caused a delay in Kras mutant tumor growth. Additionally, as shown in Figure 5E, the growth inhibitory effect of pharmacological TXNRD1 inhibition was observed in a human xenograft model generated with KRAS mutant PDAC cells (MIAPaCa-2:KRAS mutant) but not KRAS wild-type cells (Colo357:KRAS wild-type). Thus, TXNRD1 is required for the maintenance of KRAS mutant tumors and their dependency in vivo. Figure 10 demonstrates that auranofin is delivered to the pancreas.

[0148] FIG. 9 shows that patients with pancreatic adenocarcinoma (PDAC) that exhibit TXNRD1 mRNA upregulation exhibit decreased overall survival compared to PDAC patients that express low levels of TXNRD1. Figures 7A-7D show the antiproliferative effect of the TXNRD1 inhibitor auranofin in KRAS mutant pancreatic cancer cells, and the potential synergistic inhibitory effect when combined with gemcitabine. Figures 8A-8D show the antiproliferative effect of the TXNRD1 inhibitor auranofin in KRAS mutant pancreatic cancer cells, and the potential synergistic inhibitory effect when combined with gemcitabine. G12C This shows a potential synergistic inhibitory effect when combined with the inhibitor AMG 510. These results demonstrate that the TXNRD1 inhibitor compositions of the present technology are useful in methods for treating RAS mutant cancers in subjects in need thereof.

[0149] equivalent The present technology should not be limited in terms of the specific embodiments described in this application, which embodiments are intended as single illustrations of individual aspects of the present technology. Many modifications and variations of the present technology can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and apparatuses within the scope of the present technology, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing description. Such modifications and variations are intended to be within the scope of the present technology. It is to be understood that the present technology is not limited to particular methods, reagents, compounds, compositions, or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0150] Additionally, when features or aspects of the present disclosure are described in terms of a Markush group, those skilled in the art will recognize that the present disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group. For all purposes, particularly with respect to providing a written description, as will be understood by those skilled in the art, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges. Any recited range can be readily recognized as fully descriptive and allowing that same range to be broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third, upper third, etc. As will also be understood by those skilled in the art, all language such as "up to," "at least," "higher," "less than," and the like, refers to a range that is inclusive of the recited numbers and can subsequently be broken down into subranges as discussed above. Finally, as will be understood by those skilled in the art, a range includes each individual member. Thus, for example, a group having 1 to 3 cells refers to a group having 1, 2, or 3 cells. Similarly, a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so on.

[0151] All patents, patent applications, provisional applications, and publications mentioned or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they do not contradict the explicit teachings of this specification.

Claims

1. 1. A pharmaceutical composition for treating RAS mutant pancreatic cancer in a subject, comprising auranofin and gemcitabine, wherein the gemcitabine is administered at a dose of about 0.004 μM to 0.4 μM.

2. A pharmaceutical composition for treating RAS mutant pancreatic cancer in a subject, comprising auranofin and AMG510, wherein the AMG510 is administered at a dose of about 0.004 μM to 40 μM.

3. the subject exhibits elevated expression levels of RAS protein in cancer cells prior to treatment; or the subject exhibits one or more signs or symptoms selected from pain in the upper abdomen radiating to the back, loss of appetite or unintentional weight loss, depression, new-onset diabetes, blood clots, fatigue, yellowing of the skin and whites of the eyes (jaundice), abdominal distension, nausea, and vomiting; or the subject comprises one or more point mutations in TP53, CDKN2A, SMAD4, MLL3, TGFBR2, ARID1A, SF3B1, EPC1, ARID2, ATM, ZIM2, MAP2K4, NALCN, SLC16A4, MAGEA6, ROBO2, KDM6A, PREX2, ERBB2, MET, FGFR1, CDK6, PIK3R3, PIK3CA, BRCA1, BRCA2, or PALB2; or, The subject is a human, The pharmaceutical composition according to claim 1 or 2.

4. 3. The pharmaceutical composition of claim 1 or 2, wherein the RAS mutant cancer comprises a KRAS, NRAS, or HRAS mutation selected from the group consisting of G12C, G12D, G12V, G12A, G12S, G12R, G13D, G13C, G13S, G13R, G13A, G13V, Q61H, Q61L, Q61R, Q61K, Q61P, and Q61E.

5. 5. The pharmaceutical composition of any one of claims 1 to 4, formulated for oral, topical, intranasal, systemic, intravenous, subcutaneous, intraperitoneal, intradermal, intraocular, iontophoretic, transmucosal, or intramuscular administration.

6. 6. The pharmaceutical composition according to any one of claims 1 to 5, wherein one or more additional therapeutic agents are administered to a subject in combination, separately, sequentially, or simultaneously.

7. The pharmaceutical composition of any one of claims 1 to 6, which is administered daily for 6 weeks, 12 weeks or more.

Citation Information

Patent Citations

  • Piperlongumine and piperlongumine analogs for use in the treatment of cancer

    WO2009114126A1

  • Methods of cancer treatment

    WO2018218087A1