Antisense sequences for treating amyotrophic lateral sclerosis
Antisense sequences targeting the C9orf72 transcript effectively reduce RNA aggregates and dipeptide repeat proteins, offering a promising treatment for ALS and FTD by blocking transcription and translation, using AAV vectors for delivery.
Patent Information
- Application Number
- JP2022561570
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-04-09
- Filing Date
- 2021-04-09
- Publication Date
- 2025-12-16
- Estimated Expiration
- 2041-04-09
AI Technical Summary
Current treatments for amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) are ineffective, as these diseases are considered contiguous with overlapping clinical manifestations and genetic determinants, and no effective therapies are currently available.
Development of antisense sequences targeting the C9orf72 transcript to block its transcription and translation, thereby preventing the formation of RNA aggregates and reducing the levels of sense and antisense C9orf72 RNA aggregates, using nucleic acid molecules such as AAV vectors for delivery.
The antisense sequences significantly reduce the formation of RNA aggregates and dipeptide repeat proteins, providing a potential therapeutic approach for ALS and FTD.
Smart Images

Figure 0007787094000006 
Figure 0007787094000007 
Figure 0007787094000008
Abstract
Description
[Technical Field]
[0001] The present invention relates to nucleic acids, compositions and methods for treating disease, particularly amyotrophic lateral sclerosis or frontotemporal dementia. [Background technology]
[0002] Amyotrophic lateral sclerosis (ALS) is the most common motor neuron disorder in adults, with an incidence rate of 1–2 per 100,000 and an annual prevalence rate of 4–6 per 100,000. Progressive degeneration of both upper and lower motor neurons typically leads to death from respiratory failure 3–5 years after diagnosis. Approximately 15% of ALS patients also develop symptoms of frontotemporal dementia (FTD). FTD is the second most common cause of dementia after Alzheimer's disease and results in personality and behavioral changes as well as language impairment. FTD is characterized by progressive neuronal loss in the frontal and anterior temporal lobes of the brain.
[0003] The most common genetic cause of ALS, FTD, and ALS / FTD has been identified as mutations in the open reading frame 72 (C9orf72) gene on human chromosome 9 (Renton et al., 2011). A hexanucleotide repeat expansion (HRE) G4C2 within intron 1 (between noncoding exons 1a and 1b) of the C9orf72 gene has been shown to be involved in hereditary and sporadic ALS / FTD as well as other neurological disorders (Souza et al., 2015). Three pathogenic mechanisms have been proposed to explain HRE-associated neurotoxicity. First, the presence of the repeat expansion causes downregulation of C9 gene expression, leading to loss of function. Second, HREs are bidirectionally transcribed into RNAs containing G4C2 repeats (sense) and C4G2 repeats (antisense), which aggregate in the cell nucleus and trap RNA-binding proteins (RBPs) within the nuclear RNA aggregates. Another suggested pathogenic mechanism is the direct toxicity of dipeptide repeat proteins (DPRs) that are translated from either sense or antisense RNA transcripts by a non-canonical translation mechanism known as repeat-associated non-AUG-dependent (RAN) translation. [Prior art documents] [Patent documents]
[0004] [Patent Document 1] WO2013 / 053928 [Patent Document 2] WO11113889 [Patent Document 3] WO06021724 [Patent Document 4] WO2013 / 190059 Summary of the Invention [Problem to be solved by the invention]
[0005] Today, ALS and FTD are considered to be contiguous diseases with overlapping clinical manifestations and genetic determinants. Despite the extensive preclinical and clinical trials conducted over the past few decades, no effective treatments are currently available for these fatal diseases. Therefore, effective treatments are urgently needed. [Means for solving the problem]
[0006] The present inventors have developed an effective antisense sequence (AS) to block the transcription and translation of repeats in the C9orf72 gene, thereby preventing the formation of RNA aggregates (RNA foci), with the aim of treating ALS.
[0007] A first aspect of the present invention relates to an antisense nucleic acid molecule targeting a C9orf72 transcript, which can reduce the levels of sense and antisense C9orf72 RNA aggregates. In certain embodiments, the antisense nucleic acid molecule comprises or consists of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6.
[0008] The present invention relates to an antisense nucleic acid molecule targeting the C9orf72 transcript, comprising or consisting of the sequence shown in SEQ ID NO:3 or SEQ ID NO:5.
[0009] The present invention also relates to an antisense nucleic acid molecule targeting the C9orf72 transcript, comprising or consisting of the sequence shown in SEQ ID NO:21 or SEQ ID NO:22.
[0010] In a specific embodiment, an antisense nucleic acid molecule of the invention is fused to a small nuclear RNA, such as a U7 small nuclear RNA.
[0011] The present invention also relates to a nucleic acid construct comprising at least two antisense nucleic acid molecules of the present invention. In a specific embodiment, the nucleic acid construct comprises a first antisense nucleic acid molecule targeting a sense C9orf72 transcript and a second antisense nucleic acid molecule targeting an antisense C9orf72 transcript. In a preferred embodiment, the first antisense nucleic acid molecule comprises or consists of the sequence set forth in SEQ ID NO:6, and the second antisense nucleic acid molecule comprises or consists of the sequence set forth in SEQ ID NO:3.
[0012] The present invention further relates to a vector for delivering the antisense nucleic acid molecule or nucleic acid construct of the present invention. In a specific embodiment, the vector is a viral vector encoding the antisense sequence or the nucleic acid construct. In particular, the viral vector may be an AAV vector, in particular an AAV10 vector such as an AAV9 vector or an AAVrh10 vector. In particular, the viral vector may be an AAV vector, in particular an AAV9 or AAV10 vector.
[0013] The present invention also relates to an antisense nucleic acid molecule, nucleic acid construct, or vector for use in treating a C9orf72-associated disease, particularly a C9orf72 hexanucleotide repeat expansion-associated disease. In certain embodiments, the disease is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD), particularly amyotrophic lateral sclerosis (ALS). In certain embodiments, the antisense nucleic acid molecule, nucleic acid construct, or vector is for administration by intravenous and / or intraventricular routes. [Brief explanation of the drawings]
[0014] [Figure 1] Schematic diagram of the C9orf72 gene and antisense sequences directed against specific regions. Exons are represented as boxes, and the position of the GGGGCC repeat expansion is indicated within intron 1. Antisense sequences (AS) were designed to target putative splicing silencer regions (SSRs) in the region of the C9orf72 gene containing the HRE. AS-1 is designed to target an SSR in exon 1a of the antisense transcript precursor of C9orf72. AS-2, AS-3, AS-5, and AS-7 are designed to target an SSR in intron 1 of the antisense transcript precursor. AS-4, AS-6, and AS-8 are designed to target intron 1 of the sense transcript precursor of C9orf72. [Figure 2] Schematic diagrams of lentiviral vector genomes (A) and AAV vector genomes (B) delivering one or two antisense HREs (top and bottom designs, respectively). Antisense sequences directed against the sense or antisense HREs are integrated into an optimized mouse U7 small nuclear RNA (U7 promoter) and co-cloned with enhanced green fluorescent protein (eGFP) under the control of the phosphoglycerate kinase promoter (PGK) between two self-inactivating (SIN) long terminal repeats (LTRs) (A) or two AAV inverted terminal repeats (ITRs) (B). [Figure 3]RNA-FISH analysis of immortalized skin fibroblasts from two healthy donors (control, CTRL-1, and CTRL-2) and two ALS patients carrying the C9 mutation (ALS-1 and ALS-2) for sense and antisense aggregates using TYE-563-LNA (CCCCGG)3CC (detects sense aggregates) and (GGGGCC)3GG (detects antisense aggregates) probes. Nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI). Scale bar: 10 μm. Images were acquired using a Nikon Ti2 spinning disk confocal microscope. [Figure 4] This figure shows the quantification of the number of nuclei expressing sense (upper graph) or antisense (lower graph) RNA aggregates after lentiviral transduction of ALS-2 fibroblasts. ALS-2 fibroblasts were transduced with lentiviral vectors carrying antisense sequences (Lenti-AS) (AS-1, AS-2, AS-3, AS-4, AS-5, AS-6, AS-7, and AS-8) targeting regions near the HRE portion of the C9orf72 transcript and a random sequence (CTRL). Data are presented as the mean + / - SEM of ≥3 independent transduction experiments. The percentage (%) of RNA aggregates was calculated as the ratio of nuclei containing one or more aggregates to the total number of nuclei, given as 100%, and at least 300 nuclei were counted for each plate. The % aggregate reduction for each AS-C9 compared to AS-CTRL is reported in the table. Differences between groups were analyzed by Student's t-test. Statistical significance is reported comparing each AS to the control condition within the same set of transduction experiments (*p<0.05; **p<0.01; ***p<0.001; and ****p<0.0001). [Figure 5]Figure 1 shows C9 protein revealed by Western blotting in immortalized fibroblasts. (A) Western blot analysis of C9orf72 expression (C9orf72, clone 2E1) in skin-immortalized fibroblasts obtained from two healthy controls (CTRL-1 and CTRL-2) or two C9 ALS patients (ALS-1 and ALS-2). Vinculin was used as a loading control. 20 micrograms of protein lysate from cells was loaded (n=1). (B) ALS-2 fibroblasts were transduced with lentiviral vectors (Lenti-AS) expressing random sequences (CTRL) or different AS-C9s (AS-1, AS-2, AS-3, AS-4, AS-5, AS-6), and C9orf72 levels were analyzed by Western blotting. Images from three independent experiments (exp1, exp2, and exp3) are shown. (C) Densitometry analysis of Western blotting results showing the ratio between C9orf72 protein and vinculin. Data are presented as the mean + / - SEM of three independent transfection experiments. Differences between groups were analyzed by one-way ANOVA followed by Tukey's multiple comparison test. No significant differences were observed between groups. [Figure 6]This figure shows the mRNA expression levels of C9orf72 variants 1, 2, and 3 in cervical spinal cord lysates from 3-month-old C9 carrier mice (females only) injected with no injection (NI, n = 4) and AAV-U7-AS control (U7-CTRL, n = 5), AAV-U7-AS-6 (U7-AS-6, n = 5), or AAV-U7-AS-9 (U7-AS-9, n = 4). Data are presented as relative fold changes, and C9orf72 mRNA levels are normalized to mouse HPRT. Differences between groups were analyzed by one-way ANOVA followed by Tukey's multiple comparison test. Statistical significance is reported for each U7-AS compared with the NI and U7-CTRL conditions. Error bars correspond to the standard error of the mean (s.e.m.). (p-value < 0.05: *; p-value < 0.01: **; p-value < 0.0001: ****, n = number of mice). The % reduction of the two HRE-containing transcripts (V1 and V3) in AS-C9 compared to NI or AS-CTRL is reported in the table. DETAILED DESCRIPTION OF THE INVENTION
[0015] Antisense sequence A first aspect of the present invention relates to antisense sequences targeting the C9orf72 transcript.
[0016] In the present application, the expressions "antisense sequence," "AS," "AS sequence," or "antisense nucleic acid molecule" refer to a single-stranded nucleic acid molecule complementary to a portion of the pre-mRNA or mRNA encoded by the C9orf72 gene. Thus, the AS of the present invention is a single-stranded oligomeric sequence capable of hybridizing to the target C9orf72 transcript by hydrogen bonding.
[0017] The AS of the present invention may be at least 13, 20, 25, or 30 nucleotides in length, preferably at least 35 nucleotides, and more preferably at least 39 or 40 nucleotides in length. In certain embodiments, the AS of the present invention is 13 to 50 nucleotides in length. The AS may be, for example, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, or 45 nucleotides in length or longer. In certain embodiments of the present invention, the AS is 13, 15, 20, 25, 30, 35, 39, 40, or 45 nucleotides in length. Preferably, the AS is 35 to 50 nucleotides, more preferably 39 to 50 nucleotides or 40 to 50 nucleotides in length.
[0018] In certain embodiments, the antisense sequence is an isolated antisense sequence. In certain embodiments, the isolated sequence is chemically synthesized. The isolated sequence may be chemically modified, as further described below, to prevent degradation by serum ribonucleases, thereby increasing in vivo efficacy. In particular, the isolated antisense sequence may be 13 to 25 nucleotides in length. In particular, the isolated antisense sequence may be 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.
[0019] In another specific embodiment, the antisense sequence is encoded by a vector comprising elements enabling intracellular expression. In a specific embodiment, the antisense sequence encoded by the vector is 13 to 50 nucleotides in length. The AS may be, for example, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, or 45 nucleotides in length, or longer. In a specific embodiment of the present invention, the AS is 13, 15, 20, 25, 30, 35, 39, 40, or 45 nucleotides in length. Preferably, the AS is 35 to 50 nucleotides, more preferably 39 to 50 nucleotides or 40 to 50 nucleotides.
[0020] In a specific embodiment, the AS of the present invention targets the human C9orf72 gene or the human C9orf72 transcript.
[0021] In a specific embodiment of the present invention, the AS of the present invention targets the human C9orf72 transcript.
[0022] The AS of the present invention can be designed to target any coding or non-coding portion of the C9orf72 transcript.
[0023] In the context of the present invention, the term "C9orf72 transcript" includes C9orf72 pre-mRNA and C9orf72 mRNA.
[0024] C9orf72 (chromosome 9 open reading frame 72) is a protein encoded by the gene C9orf72 (C9). The human C9orf72 gene is located in open reading frame 72, base pair 27,573,863 to base pair 27,546,542, on the short arm (p) of chromosome 9. The human C9orf72 gene has been well characterized. Its sequence is reported in SEQ ID NO: 18 (NCBI ref seq: NG_031977.1). The C9orf72 gene consists of 11 exons and can be transcribed into three mRNAs: variant 1 (V1) (NM_145005), variant 2 (V2) (NM_018325), and variant 3 (V3) (NM_001256054). Transcripts V2 and V3 encode the long form of the C9orf72 protein, while transcript V1 encodes the short form. C9orf72 is transcribed bidirectionally (Zu et al., 2013), so antisense transcripts are also produced.
[0025] The AS of the present invention can be used to target C9orf72 transcripts containing pathogenic repeat expansions. In certain embodiments, the targeted C9orf72 transcript contains a pathogenic hexanucleotide repeat expansion (HRE). "Hexanucleotide repeat expansion" refers to a series of six bases repeated at least twice, particularly GGGGCC (G4C2) or CCCCGG (C4G2). The hexanucleotide repeat expansion is particularly located in intron 1 of the C9orf72 nucleic acid. In the context of the present invention, a pathogenic hexanucleotide repeat expansion comprises at least 30 repeats of hexanucleotides, such as G4C2 or C4G2, in the C9orf72 nucleic acid and is associated with a disease. In certain embodiments, the repeats are consecutive. In certain embodiments, the repeats are interrupted by one or more nucleobases. Indeed, ALS or FTD patients are characterized by longer G4C2 or C4G2 HREs (HREs>70) in the first intron of the C9orf72 gene than healthy subjects (HREs less than 30). In further particular embodiments, the pathogenic HRE comprises at least 70 hexanucleotide repeats, such as at least 70 G4C2 or C4G2 repeats.
[0026] In certain embodiments, the AS may target a sequence located within or immediately adjacent to the HRE of the C9orf72 transcript.
[0027] In particular, the AS may be complementary to a sequence located within intron 1 or exon 1A of the C9orf72 transcript.
[0028] In certain embodiments, the AS can target a sequence located in the HRE of the C9orf72 transcript, in other words, the AS is complementary to the sequence consisting of the HRE.
[0029] The AS of the present invention may target other regions adjacent to the HRE of the C9orf72 transcript. In a specific embodiment, the AS of the present invention targets a sequence located in the region from 319 nucleotides upstream of the HRE to 18 nucleotides downstream of the HRE.
[0030] In certain embodiments, the AS targets the region upstream of the HRE, ie, the 5' region of the HRE.
[0031] In another specific embodiment, the AS can target a sequence that overlaps with the HRE and a region of the C9orf72 transcript adjacent to the HRE. In a specific embodiment, the AS can target a sequence that includes the 5'-flanking region of the HRE and a portion of the HRE (i.e., the AS overlaps the HRE and the 5' region of the HRE). In another specific embodiment, the AS can target a sequence that includes the 3'-flanking region of the HRE and a portion of the HRE (i.e., the AS overlaps the HRE and the 3' region of the HRE).
[0032] In another specific embodiment, the AS targets a putative splicing silencer region (SSR). In a specific embodiment, the AS of the present invention targets an SSR contained in the region of positions 5002 to 5041, 5128 to 5167, 5200 to 5239, or 5299 to 5338 of the C9orf72 genomic sequence of SEQ ID NO: 18. In a specific embodiment, the AS targets an SSR located in exon 1a. In another specific embodiment, the AS targets an SSR located in intron 1, preferably upstream of the HRE in intron 1.
[0033] The AS of the present invention may target sense or antisense C9orf72 transcripts. In fact, it has been described that HREs exert their pathological effects from both the sense and antisense strands (Haeusler et al., 2016). In other words, HREs are bidirectionally transcribed into RNAs that aggregate and form intranuclear aggregates that capture RNA-binding proteins (RBPs). In particular, HREs containing G4C2 and C4G2 repeats can be bidirectionally transcribed into RNAs containing G4C2 and C4G2 repeats. The AS of the present invention can be designed to target such sense or antisense RNAs.
[0034] In certain embodiments, the AS of the present invention is designed to reduce the levels of sense C9orf72-RNA aggregates and / or antisense C9orf72-RNA aggregates. By "sense C9orf72-RNA aggregates" is meant intranuclear aggregates resulting from the aggregation of sense hexanucleotide repeat-containing C9orf72 RNA, such as G4C2 repeat-containing C9orf72 RNA. By "antisense C9orf72-RNA aggregates" is meant intranuclear aggregates resulting from the aggregation of antisense hexanucleotide repeat-containing C9orf72 RNA, such as C4G2 repeat-containing C9orf72 RNA. In certain embodiments, the AS of the present invention can reduce both sense and antisense aggregates.
[0035] "Reducing the level of sense or antisense RNA aggregates" means reducing or lowering the number of aggregates by at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, the AS of the present invention can reduce the number of aggregates by at least 30%, preferably at least 40%, more preferably at least 50%, and even more preferably at least 60%.
[0036] Any method known to those skilled in the art can be used to determine the level of sense or antisense RNA aggregates.In particular, fluorescence in situ hybridization (FISH) can be used.For example, the level of sense or antisense RNA aggregates can be determined by FISH using a TYE563-(C4G2)3 locked nucleic acid (LNA) probe to detect sense aggregates and a TYE563-(G4C2)3 LNA probe to detect antisense aggregates.
[0037] Repeat-containing RNAs can be translocated to the cytoplasm, where they can be translated into toxic dipeptide repeat proteins (DPRs) by a non-canonical translation mechanism known as repeat-associated non-AUG-dependent (RAN) translation. Thus, in certain embodiments, the AS of the present invention can reduce the levels of dipeptide repeat proteins translated from sense HRE-containing RNAs and / or antisense HRE-containing RNAs. Dipeptide repeat proteins translated from sense RNAs include poly[GA], poly[GR], and poly[GP] peptides. Dipeptide repeat proteins translated from antisense RNAs include poly[PR], poly[PA], and poly[GP] peptides. "Reducing the level of DPRs" means reducing or lowering the number of DPRs by at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
[0038] In another specific embodiment, the AS of the present invention can reduce the level of sense and / or antisense HRE-containing C9orf72 transcripts. "Reducing the level of sense and / or antisense HRE-containing C9orf72 transcripts" means reducing or lowering the level of sense and / or antisense pathogenic transcripts by at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
[0039] In a specific embodiment, the AS of the present invention may reduce the level of pathogenic HRE-containing transcripts while maintaining the level of total C9orf72 transcripts. In other words, the AS of the present invention may be able to reduce the level of pathogenic transcripts while maintaining the total C9orf72 protein level.
[0040] Representative AS for practicing the present invention are listed in Table 1:
[0041] [Table 1]
[0042] AS-1, AS-2, AS-3, and AS-5 are designed to target the antisense C9orf72 transcript, while AS-4 and AS-6 are designed to target the sense C9orf72 transcript.
[0043] The reverse complements of SEQ ID NO: 1 and SEQ ID NO: 2 may also be used. Thus, an AS comprising or consisting of a sequence that is the reverse complement of SEQ ID NO: 1 or SEQ ID NO: 2 may also be used in the context of the present invention. Thus, an AS may be: SEQ ID NO: 21: 5' TGACGCACCTCTCTTTCCTAGCGGGACACCGTAGGTTACG 3' (reverse complement of SEQ ID NO: 1); or SEQ ID NO: 22: 5' AACACACACCTCCTAAACCCACACCTGCTCTTGCTAGACC 3' (reverse complement of SEQ ID NO: 2) It may comprise or consist of:
[0044] In certain embodiments, the AS comprises the sequence shown in SEQ ID NO: 1 to SEQ ID NO: 6. Preferably, the AS comprises the sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 6, more preferably SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6.
[0045] In another specific embodiment, the AS consists of the sequences shown in SEQ ID NOs: 1 to 6. Preferably, the AS consists of the sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 6, more preferably SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6.
[0046] In a specific embodiment, the AS comprises a sequence having 13 to 25 contiguous nucleotides of any one of the sequences shown in SEQ ID NO: 1 to 6. Preferably, the AS comprises a sequence having 13 to 25 contiguous nucleotides of any one of the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 6, more preferably SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6.
[0047] In a specific embodiment, the AS consists of a sequence having 13 to 25 contiguous nucleotides of any one of the sequences shown in SEQ ID NO: 1 to 6. Preferably, the AS consists of a sequence having 13 to 25 contiguous nucleotides of any one of the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 6, more preferably, a sequence having 13 to 25 contiguous nucleotides of any one of the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6.
[0048] In certain embodiments, the AS comprises or consists of a sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any one of the sequences set forth in SEQ ID NO: 1 to SEQ ID NO: 6. Preferably, the AS comprises or consists of a sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 6, more preferably to the sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6.
[0049] In certain embodiments, the AS comprises the sequence shown in SEQ ID NO:21 or SEQ ID NO:22.
[0050] In another specific embodiment, the AS consists of the sequence shown in SEQ ID NO:21 or SEQ ID NO:22.
[0051] In a specific embodiment, the AS comprises a sequence having 13 to 25 contiguous nucleotides of the sequence shown in SEQ ID NO:21 or SEQ ID NO:22.
[0052] In a specific embodiment, the AS consists of a sequence having 13 to 25 contiguous nucleotides of the sequence shown in SEQ ID NO:21 or SEQ ID NO:22.
[0053] In certain embodiments, the AS comprises or consists of a sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to the sequence set forth in SEQ ID NO:21 or SEQ ID NO:22.
[0054] The AS of the present invention may be of any suitable chemical nature. In certain embodiments, the AS of the present invention may be a DNA or RNA nucleic acid molecule. For in vivo use, the isolated AS may be stabilized by several chemical modifications, such as phosphate backbone modifications. For example, the stabilized isolated AS of the present invention may have a modified backbone, such as phosphorothioate linkages. Other possible stabilizing modifications include phosphodiester modifications, combinations of phosphodiester and phosphorothioate modifications, methylphosphonate, methylphosphorothioate, phosphorodithioate, p-ethoxy, and combinations thereof. Chemically stabilized modified versions of the isolated AS include chemical modifications at the 2'-position of the sugar moiety, such as 2'-O-methyl (2'OME), 2'-O-methoxyethyl (2'MOE), 2'-fluorinated (2'F), and 2'-O-aminopropyl analogs. Chemical modifications have evolved and new generation molecules such as morpholinos (phosphorodiamidate morpholino oligomers, PMOs), locked nucleic acids (LNAs), 2',4 constrained ethyl (cEt), peptide nucleic acids (PNAs), tricycloDNA, tricycloDNA phosphorothioate AON molecules (WO2013 / 053928) or U small nuclear (sn) RNA have been designed.
[0055] Non-viral gene delivery methods such as microinjection, gene guns, electroporation, and / or chemical methods using various carriers such as N-acetylgalactosamine, octaguanidine dendrimers, cell-penetrating peptides, liposomes, or nanoparticles can be used to deliver isolated AS to a specific site of action.
[0056] In certain embodiments, the antisense sequence is modified with a small nuclear RNA, such as U7 small nuclear RNA. In certain embodiments, the AS described above is linked to a small nuclear RNA molecule, such as U1, U2, U6, or U7, or any other small nuclear RNA or chimeric small nuclear RNA (Donadon et al., 2019; Imbert et al., 2017). snRNA is involved in pre-mRNA processing and associates with specific proteins called Sm cores to form small nuclear ribonucleoprotein (snRNP) complexes. Information regarding U7 modifications can be found, inter alia, in Goyenvalle et al., 2004; WO11113889; and WO06021724.
[0057] The U7 small nuclear RNA (U7 snRNA), a component of the small ribonucleoprotein complex (U7 snRNP), can be used as a tool for pre-mRNA splicing modulation by modifying the binding sites of Sm / Lsm (Sm-like) proteins (Imbert et al., 2017). In a specific embodiment, the U7 cassette described by D. Schumperli is used (Schumperli and Pillai, 2004). It contains the native U7 promoter (positions -267 to +1), the U7smOpt snRNA, and downstream sequences up to position 116. The 18-nt native sequence complementary to histone pre-mRNA in U7smOpt is replaced by one or two (either the same sequence used twice or two different sequences) or more repeats of AS sequences selected using, for example, a previously described PCR-mediated mutagenesis method (Goyenvalle et al., 2004).
[0058] In certain embodiments, the AS of the present invention comprises or consists of the sequence shown in SEQ ID NO: 9 to SEQ ID NO: 14 or SEQ ID NO: 17. Preferably, the AS of the present invention comprises or consists of the sequence shown in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14 or SEQ ID NO: 17. In certain embodiments, the AS of the present invention comprises or consists of the sequence shown in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12 or SEQ ID NO: 14.
[0059] In certain embodiments, the AS comprises or consists of a sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any one of the sequences set forth in SEQ ID NOs: 9 to 14 and 17. Preferably, the AS of the present invention comprises or consists of a sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any one of the sequences set forth in SEQ ID NOs: 9, 10, 11, 12, 14, or 17. In certain embodiments, the AS of the present invention comprises or consists of a sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any one of the sequences set forth in SEQ ID NOs: 9, 10, 12, or 14.
[0060] [Table 2A]
[0061] [Table 2B]
[0062] In a particular embodiment, the AS of the invention comprises or consists of the sequence shown in SEQ ID NO:23 or SEQ ID NO:24.
[0063] In certain embodiments, the AS comprises or consists of a sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to the sequence set forth in SEQ ID NO:23 or SEQ ID NO:24.
[0064] [Table 3]
[0065] For stable and efficient in vivo delivery, especially across the blood-brain barrier, isolated AS may be fused to or co-administered with any cell-penetrating peptide and signal peptide mediating protein secretion. The cell-penetrating peptide may be RVG peptide (Kumar et al., 2007), PiP (Betts et al., 2012), P28 (Yamada et al., 2013), or protein transduction domain-like TAT (Malhotra et al., 2013), or VP22 (Lundberg et al., 2003).
[0066] nucleic acid construct A second aspect of the present invention relates to a nucleic acid construct comprising at least two of the above-described antisense nucleic acid molecules. In certain embodiments, the nucleic acid construct may comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more of the above-described AS. In certain embodiments, the nucleic acid construct comprises repeats of the same AS nucleic acid molecule described above. In certain embodiments, the nucleic acid construct comprises repeats of the same AS sequence, wherein the AS sequence is selected from SEQ ID NO:1 to SEQ ID NO:6. In certain embodiments, the nucleic acid construct comprises repeats of the same AS sequence, wherein the AS sequence is SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:6, preferably SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:6.
[0067] In certain embodiments, as described above, each of the AS of the nucleic acid construct is fused to a U7 small nuclear RNA.
[0068] In certain embodiments, the nucleic acid construct comprises two different ASs as described above. In certain embodiments, the nucleic acid construct comprises two different ASs, wherein the ASs comprise or consist of a sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any one of the sequences set forth in SEQ ID NO:1 to SEQ ID NO:6. In certain embodiments, the nucleic acid construct comprises two different ASs, wherein the ASs consist of any one of the sequences set forth in SEQ ID NO:1 to SEQ ID NO:6.
[0069] In certain embodiments, the nucleic acid construct comprises a first AS that targets a sense C9orf72 transcript and a second AS that targets an antisense C9orf72 transcript. In certain embodiments, the first AS and the second AS are each fused to a U7 small nuclear RNA, as described above. In certain embodiments, the nucleic acid construct comprises: (i) a first AS comprising or consisting of a sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any one of the sequences set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 5, in particular SEQ ID NO: 3; and (ii) a second AS comprising or consisting of any one of the sequences set forth in SEQ ID NO: 4 or SEQ ID NO: 6, in particular a sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to SEQ ID NO: 6.
[0070] In certain embodiments, the nucleic acid construct comprises: (i) a first AS comprising or consisting of the sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 5; and (ii) a second AS comprising or consisting of the sequence shown in SEQ ID NO: 4 or SEQ ID NO: 6. In certain embodiments, the first antisense sequence comprises or consists of the sequence set forth in SEQ ID NO: 3, and the second antisense sequence comprises or consists of the sequence set forth in SEQ ID NO: 6. In certain embodiments, the first antisense sequence comprises or consists of the sequence set forth in SEQ ID NO: 3 fused to U7 small nuclear RNA, and the second antisense sequence comprises or consists of the sequence set forth in SEQ ID NO: 6 fused to U7 small nuclear RNA.
[0071] In certain embodiments, the nucleic acid construct comprises or consists of the sequence set forth in SEQ ID NO: 17. In certain embodiments, the nucleic acid construct comprises or consists of a sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 17.
[0072] AS delivery The antisense sequences or nucleic acid constructs of the present invention may be delivered in vivo alone or in association with a vector. In the broadest sense, a "vector" is any vehicle capable of facilitating the transfer of antisense sequences into cells. Vectors useful in the present invention include, but are not limited to, plasmids, phagemids, viruses, and other vehicles derived from viral or bacterial sources that have been engineered with the insertion or incorporation of an AS sequence.
[0073] Viral vectors are a preferred type of vector, including, but not limited to, nucleic acid sequences derived from the following viruses: lentiviruses such as HIV-1, retroviruses such as Moloney murine leukemia virus, adenoviruses, parvoviruses such as adeno-associated viruses (AAV), SV40-type viruses, herpesviruses such as HSV-1, and vaccinia viruses. Other vectors not named but known to those skilled in the art can also be readily utilized. Among vectors that have been validated for clinical application and can be used to deliver antisense sequences, lentiviruses, retroviruses, and AAV show greater potential.
[0074] Replication-deficient (i.e., capable of directing the synthesis of the desired AS but incapable of producing infectious particles) retroviral- and lentiviral-based vectors have been approved for human gene therapy clinical trials. They have the property of integrating into the target cell genome, thus allowing sustained expression of the transgene in the target cell and its progeny.
[0075] In certain embodiments, AS is delivered using an AAV vector. The human parvovirus adeno-associated virus (AAV) is a dependent virus that is naturally replication-deficient and can integrate into the genome of infected cells to establish latent infection. Integration occurs at a specific site (19q13.3-qter) in the human genome, called AAVS1, located on chromosome 19; this property appears to be unique among mammalian viruses. AAV-based recombinant vectors lack Rep proteins, exhibit low integration efficiency, exist primarily as stable, circular episomes, and can persist in target cells for months, or even years. Therefore, AAV has attracted considerable interest as a potential vector for human gene therapy. Among its favorable characteristics, the virus is not associated with any human disease and can be infected using a wide variety of cell lines derived from different tissues. Indeed, 12 AAV serotypes (AAV1-12) and hundreds of variants have been described, many of which have been shown to enhance targeting to specific tissues (Hester et al., 2009). Furthermore, there are concerted efforts in the field of AAV vectors to design and characterize new capsids with improved efficacy, such as AAV-PHP.eB and AAV-F. Different serotypes are defined by the capsid protein amino acid structure, which is responsible for tissue tropism, distribution, and susceptibility to circulating antibodies (Deverman et al., 2018). Thus, the present invention relates to an AAV vector encoding the above-described AS, which is configured to target the human C9orf72 transcript and target a pathological repeat expansion within the human C9orf72 transcript. According to specific embodiments, the AAV genome is derived from serotype AAV1, 2, 3, 4, 5, 6, 7, 8, 9, 10 (e.g., cynomolgus AAV10 or rhesus AAVrhlO), 11, or 12. In preferred embodiments, the AAV capsid is derived from serotype AAV1, 2, 3, 4, 5, 6, 7, 8, 9, 10 (e.g., cynomolgus AAV10 or AAVrhlO), 11, 12, or an AAV variant. In further specific embodiments, the AAV vector is a pseudotyped vector, i.e., its genome and capsid are derived from AAV of different serotypes.For example, a pseudotyped AAV vector can be a vector whose genome is derived from the AAV2 serotype and whose capsid is derived from AAV1, 3, 4, 5, 6, 7, 8, 9, 10 (e.g., cynomolgus monkey AAV10 or AAVrh10), 11, 12 serotypes, or an AAV variant. In addition, the genome of an AAV vector can be either a single-stranded or self-complementary double-stranded genome (McCarty et al., 2001). Self-complementary double-stranded AAV vectors are generated by deleting the terminal separation site (trs) from one of the AAV terminal repeats. These modified vectors, whose replicating genome is half the length of the wild-type AAV genome, tend to package DNA dimers.
[0076] Preferably, the AAV vectors implemented in the practice of the present invention are vectors that target CNS neurons (including motor neurons and glial cells in the brain, brainstem, and spinal cord) and muscle cells (Ilieva et al., 2009). Because serotype 2 was the first to be modified into a recombinant vector for gene delivery, it is the most well-known and studied AAV, and indeed, the capsids of these natural serotypes can be engineered to generate novel AAV capsids with enhanced properties. Other serotypes, such as rAAV1, AAV5, AAV9, and AAVrh.10, exhibit high transduction efficiency and spread more widely in the CNS than AAV2 (Deverman et al., 2018; Tanguy et al., 2015). These serotypes, along with rAAV6, 7, and 8, have also demonstrated efficient muscle transduction (Wang et al., 2014; Zincarelli et al., 2008). Interestingly, in 2017, Ai J et al. demonstrated excellent muscle transduction of rAAVrh.10 after intraperitoneal administration (Ai et al., 2017). Recently, newly re-engineered AAV capsids, AAV-AS, AAV-PHP.B, AAV-PHP.eB, and AAV-F, have been shown to transduce the CNS with high efficiency via intravenous administration (Chan et al., 2017; Choudhury et al., 2016; Deverman et al., 2016; Hanlon et al., 2019). In a preferred embodiment, the AAV vector has an AAV1, AAV6, AAV6.2, AAV7, AAVrh39, AAVrh43, AAV2, AAV5, AAV8, AAV9, or AAV10 capsid, and the vector is optionally pseudotyped. In certain embodiments, the AAV vector has an AAV9 or AAV10 (e.g., cynomolgus AAV10 or AAVrh10) capsid, optionally pseudotyped. In certain embodiments, the AAV vector has a capsid described in Nonnenmacher et al., 2020, such as capsid variants 9P03, 9P08, 9P09, 9P13, 9P16, 9P31, 9P32, 9P33, 9P36, or 9P39 described in Nonnenmacher et al., 2020.
[0077] In certain embodiments, the AS is encoded in a vector in combination with a small nuclear RNA molecule such as U1, U2, U6, or U7, or any other small nuclear RNA or chimeric small nuclear RNA (Cazzella et al., 2012; De Angelis et al., 2002; Donadon et al., 2019; Imbert et al., 2017). Information on U7 modifications can be found, inter alia, in Goyenvalle et al. (Goyenvalle et al., 2004); WO11113889; and WO06021724. In certain embodiments, the U7 cassette described by D. Schumperli is used (Schumperli and Pillai, 2004). It contains the native U7 promoter (positions -267 to +1), the U7smOpt snRNA, and downstream sequences up to position 116. The 18-nt natural sequence complementary to the histone pre-mRNA in U7smOpt is replaced by one or two (either the same sequence used twice or two different sequences) or more repeats of AS sequences selected using, for example, a PCR-mediated mutagenesis method previously described ( Goyenvalle et al., 2004 ).
[0078] In certain embodiments, the small nuclear RNA-modified AS, particularly the U7-modified AS, is vectorized into a viral vector, particularly an AAV vector.
[0079] Generally, vectors may contain regulatory sequences that enable expression of the encoded AS, such as promoters, enhancers, internal ribosome entry sites (IRES), and sequences encoding protein transduction domains (PTDs). In this regard, vectors most preferably contain a promoter region operably linked to the coding sequence to induce or improve expression of the AS. Such promoters may be ubiquitous, tissue-specific, strong, weak, regulated, chimeric, etc., and allow for efficient and appropriate production of the AS. The promoter may be a cellular, viral, fungal, plant, or synthetic promoter. The most preferred promoters for use in the present invention are functional in nerve and muscle cells, more preferably motor neurons and glial cells. The promoter may be selected from small nuclear RNA promoters, such as U1, U2, U6, U7, or other small nuclear RNA promoters, or chimeric small nuclear RNA promoters. Other representative promoters include RNA polymerase III-dependent promoters, such as the H1 promoter, or RNA polymerase II-dependent promoters. Examples of regulated promoters include, but are not limited to, promoters containing Tet on / off elements, rapamycin-inducible promoters, and metallothionein promoters. Examples of motor neuron-specific promoters include the calcitonin gene-related peptide (CGRP), choline acetyltransferase (ChAT), or homeobox 9 (HB9) promoters. Other promoters functional in motor neurons include neuron-specific promoters, such as the neuron-specific enolase (NSE) and synapsin promoters, or ubiquitous promoters containing neuron-specific silencer elements (NRSEs). Glial cell-specific promoters, such as the glial fibrillary acidic protein (GFAP) promoter, can also be used. Examples of ubiquitous promoters include viral promoters, particularly the CMV promoter, RSV promoter, SV40 promoter, hybrid CBA (chicken beta-actin / CMV) promoter, and cellular promoters, such as the PGK (phosphoglycerate kinase) or EF1 alpha (elongation factor 1 alpha) promoters.
[0080] composition The present invention also relates to compositions comprising AS, nucleic acid constructs, or vectors containing the same in a pharmaceutically acceptable carrier. In addition to AS, nucleic acid constructs, or vectors, pharmaceutical compositions of the present invention may also contain pharmaceutically or physiologically acceptable carriers, such as saline, sodium phosphate, etc. The compositions are generally, but not necessarily, in liquid form. Suitable carriers, excipients, and diluents include lactose, glucose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginic acid, tragacanth, gelatin, calcium silicate, crystalline cellulose, polyvinylpyrrolidone, cellulose, water syrup, methylcellulose, methyl and propylhydroxybenzoates, mineral oil, and the like. Formulations may also include lubricants, wetting agents, emulsifiers, preservatives, buffers, and the like. In particular, the present invention involves the administration of AS, thus somewhat similar to gene therapy. Those skilled in the art will recognize that nucleic acids are frequently delivered in the form of liposomes, together with lipids (e.g., cationic or neutral lipids, or mixtures thereof), or other suitable micro- or nanostructured materials (e.g., micelles, lipid complexes, dendrimers, emulsions, cubic phases, etc.).
[0081] The compositions of the present invention are generally administered by enteral or parenteral routes, such as intravenous (iv), intraarterial, subcutaneous, intramuscular (im), intracerebral, intracerebroventricular (icv), intrathecal (it), intraperitoneal (ip), subpial, intralingual, intrathoracic, intrapleural, and combinations of these with other delivery routes. Other types of administration, such as by inhalation, intranasal, topical, oral, rectal, intraosseous, ophthalmic, ear drop administration, etc., are not excluded.
[0082] In certain embodiments, as described in WO2013 / 190059, the AAV vector of the present invention is administered by combining administration into the patient's cerebrospinal fluid (CSF) and / or blood. In certain variants of this embodiment, administration of the viral vector into the mammalian CSF is carried out by intracerebroventricular (icv or ICV) injection, intrathecal (it or IT) injection, or intracisternal injection, and administration into the blood is preferably carried out by parenteral administration, such as intravenous (IV) injection, im injection, intra-arterial injection, ip injection, subcutaneous injection, intradermal injection, intranasal delivery, transdermal delivery (e.g., patch), or enteral delivery (oral or rectal). In certain embodiments, the AAV vector is administered by both the icv (it) and iv (im) routes. In certain embodiments, administration of the viral vector is carried out by intracerebroventricular (icv or ICV) injection.
[0083] Injectable preparations, for example, sterile injectable aqueous or oily suspensions, can be formulated according to known techniques using appropriate dispersing or wetting agents and suspending agents. The sterile injectable preparation can be a sterile injectable solution or suspension in a non-toxic, parenterally acceptable diluent or solvent, such as 1,3-butanediol. Delivery can be local (i.e., in situ, directly into tissue such as muscle tissue) or systemic, but delivery is usually localized to affected muscle tissue, such as skeletal muscle, smooth muscle, cardiac muscle, etc. Depending on the form of AS administered and the tissue or cell type targeted, techniques such as electroporation, sonoporation, "gene gun" (which delivers gold particles coated with nucleic acid), etc., can be used.
[0084] Those skilled in the art will recognize that the amount of AS, nucleic acid construct, or vector containing or expressing AS to be administered will be an amount sufficient to induce amelioration of undesired disease symptoms, particularly ALS symptoms. Such amounts may vary depending on factors such as the patient's sex, age, weight, and overall physical condition, among others, and may be determined on an individual basis. Amounts may also vary depending on other components of the treatment protocol (e.g., administration of other medications, etc.). Generally, appropriate doses range from about 1 mg / kg to about 100 mg / kg, more usually from about 2 mg / kg / day to about 10 mg / kg. When viral delivery of AS is selected, appropriate doses will depend on various factors, such as the virus utilized and the route of delivery (intramuscular, intravenous, intraarterial, etc.), but generally range from about 10 mg / kg to about 100 mg / kg. 9 ~10 15 The dose of AS administered to a patient may be in the range of viral particles / kg. Those skilled in the art will recognize that such parameters are routinely calculated during clinical trials. Furthermore, those skilled in the art will recognize that while the treatments described herein may result in complete alleviation of disease symptoms, this need not be the case. Even partial or intermittent alleviation of disease symptoms may be of great benefit to the recipient. Additionally, treatment of a patient may be a one-time event (with the modified AS or AAV vector), or the patient may be administered AS on multiple occasions, which may be days, weeks, months, or even years apart, depending on the results obtained.
[0085] The methods of the present invention can be carried out in any of several different ways. For example, the AS of the present invention can be administered together with a vector encoding an exogenous wild-type C9orf72 protein, preferably a human C9orf72 protein. The AS can also be administered together with a vector encoding a neurotrophic factor that induces neuroprotection, such as glial cell line-derived neurotrophic factor (GDNF), insulin-like growth factor 1 (IGF-1), vascular endothelial growth factor (VEGF), neuregulin 1, or neurturin. Different studies have shown that AAV-mediated expression of these neurotrophic factors delays disease onset and extends survival in SOD1 mouse models (Azzouz et al., 2004; Dodge et al., 2008, 2010; Kaspar et al., 2003; Lepore et al., 2007; Gross et al., 2020; Lasiene et al., 2016). Furthermore, as a complementary approach to reducing C9orf72 HRE RNA, useful therapeutic strategies may target downstream mechanisms. AS may be administered in combination with antibodies targeting TAR DNA-binding protein 43 (TDP43) and / or dipeptide repeat proteins such as GA or GP RAN proteins, which are present in C9orf72 patients.
[0086] AS may also be administered in combination with small molecules that target the secondary structure of C9orf72 repeat RNA or inhibit the nuclear export of pathological C9orf72 repeat transcripts. Different groups have attempted to develop small molecules that target the G-quadruplex structure of C9orf72, presumably to rescue pathological defects by releasing trapped RNA-binding proteins and / or blocking translation of DPRs (Alniss et al., 2018; Simone et al., 2018; Su et al., 2014; Yang et al., 2015; Zamiri et al., 2014). In 2017, Hautbergue et al. demonstrated how depletion of a serine / arginine-rich splicing factor 1 (SRSF1)-like nuclear export adaptor inhibited the nuclear export of pathological C9orf72 transcripts and the production of dipeptide repeat proteins, thereby reducing neurotoxicity in Drosophila, patient-derived neurons, and neuronal cell models (Hautbergue et al., 2017). The AS of the present invention can be combined with any of these approaches, particularly with exogenous C9 protein, antibodies against DPR or TDP43, small molecules against G-quadruplex C9 structures, and inhibition of nuclear export, to improve therapeutic efficacy and target different hallmarks of C9orf72-ALS.
[0087] In a further aspect, the present invention provides a method for producing a pharmaceutical composition comprising: - an AS of the invention, a nucleic acid construct or a vector encoding said AS or said nucleic acid construct, as described above; and - vectors encoding wild-type C9orf72 proteins (such as wild-type human C9orf72 proteins) for simultaneous, separate or sequential use; The present invention relates to a kit of parts including:
[0088] use The present invention also relates to an antisense sequence, a nucleic acid construct or a vector as described above for use in the treatment of a C9orf72-associated disease, in particular a C9orf72 HRE-associated disease.
[0089] C9orf72-associated diseases include neurodegenerative diseases. In certain embodiments, the neurodegenerative disease may be amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD). In certain embodiments, the disease is amyotrophic lateral sclerosis (ALS). In another specific embodiment, the subject to be treated has ALS and FTD. In certain embodiments, the neurodegenerative disease may be familial or sporadic.
[0090] As used herein, the term "treatment" or "therapy" includes curative and / or prophylactic treatment. More specifically, curative treatment refers to any of the alleviation, amelioration and / or elimination, reduction and / or stabilization (e.g., not progressing to a more advanced stage) of symptoms, as well as delay in the progression of symptoms of a particular disorder. Prophylactic treatment refers to any of the following for a given disorder: arrest of onset, delay in onset, reduction in progression, reduction in risk of progression, reduction in incidence, reduction in severity, and increase in time to onset of symptoms and survival rate.
[0091] Thus, methods for treating a C9orf72-associated disease, such as ALS or FTD, in a subject in need thereof are described, the methods comprising administering to said patient a nucleic acid molecule, nucleic acid construct, or vector of the invention. Within the context of the present invention, a "subject" or "patient" refers to a mammal, particularly a human, suffering from a C9orf72-associated disease, such as ALS or FTD, regardless of age or sex. The term particularly includes domestic animals, such as non-human primates, cats, dogs, horses, pigs, cows, goats, sheep, rabbits, rats, and mice, as well as common laboratory mammals. Preferably, the patient to be treated is a human.
[0092] Further aspects and advantages of the present invention will be disclosed in the following experimental section, which is merely illustrative and is not intended to limit the scope of this application. [Example]
[0093] Materials and Methods Preparation of AAV and lentiviral plasmids expressing U7-AS As previously described (Goyenvalle et al., 2004), the AS sequence was cloned into the self-complementary pAAV-U7-SOD1 plasmid (Biferi et al., 2017) by replacing AS-SOD1 with AS-C9 using PCR-mediated mutagenesis. To generate the lentiviral vector, the U7-AS insert was amplified by PCR from pAAV expressing the U7-AS-C9 sequence using primers specific for the 5' and 3' sequences of U7-AS-C9, which harbor an EcoRV cleavage site (forward: 5'-GGGGATATCTAACAACATAGGAGCTGTGA-3', reverse: 5'-GGGGATATCCACATACGCGTTTCCTAGGA-3'). The U7-AS construct was cloned into the EcoRV site of pRRLSIN.cPPT.PGKGFP.WPRE (Addgene).
[0094] Cell culture and viral infection Primary dermal fibroblasts obtained from C9-ALS patients (ALS-1 and ALS-2) and healthy controls (CTRL-1 and CTRL-2) were provided by Dr. Bohl (Brain and Spine Institute, ICM, Paris, France). CTRL-1 was a 33-year-old male, and CTRL-2 was a 69-year-old female; ALS-1 and ALS-2 cells were obtained from two males expressing more than 60 HREs in the C9 gene. Primary fibroblasts were immortalized using a protocol established by the Myoline facility (Dr. Bigot, Center of Research in Myology, Paris, France) (Chaouch et al., 2009). Immortalized fibroblasts were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% penicillin / streptomycin, and 1% pyruvate containing nonessential amino acids at 37°C in 5% CO2. HEK-293T cells were grown in pyruvate-free DMEM supplemented with 10% FBS and used for lentivirus production. To generate lentivirus carrying U7-AS-C9, 5 × 10 cells were cultured per 100 mm plate. 6The cells were plated and transfected the following day with the lentiviral construct plasmid and packaging mixture plasmids [pMD2.G, pMDLg / RRE, and pRSVRev (Addgene)] using Lipofectamine 2000 reagent. Viral particles were harvested from the supernatant after 48 and 72 hours and used to transduce immortalized fibroblasts.
[0095] Viral transduction Immortalized fibroblasts were plated at 8 × 10 cells per well onto 24-well plates containing 12-mm diameter slides / wells pretreated with type I collagen Rat Tail (A10483-01, Life Technologies) for RNA FISH experiments. 4 1 cell / well or 2.4 x 10 cells in a 10 mm dish for Western blot analysis 6 The cells were plated at a density of 10 cells / well. The cells were transfected the next day with the lentiviral vector and 2 μg / mL polybrene. After 5 hours at 37°C, the transfection was stopped by adding half of the complete medium. The next day, the cells were quiescent in DMEM containing 0.1% FBS, 1% P / S, and 1% NEAA. The following day, cells in 24-well plates were fixed with 2% formaldehyde for RNA FISH analysis. Cell pellets were harvested from 10-mm dishes by centrifuging the cells twice at 3000 rpm for 5 minutes at 4°C and stored at -80°C. Viral expression was monitored by immunofluorescence analysis of GFP.
[0096] RNA-FISH Cells were fixed in 2% formaldehyde for 30 min at 4°C and permeabilized with 0.4% TRITON X-100 (Biorad), 2 mM vanadyl ribonucleoside complex solution (Vanadyl, Sigma, 94742-10ML) in 1x PBS for 10 min at RT. Cells were washed twice for 5 min at RT in 1x PBS and twice for 10 min at RT in 2x saline-sodium citrate buffer (SSC, Invitrogen 15557-044). The cells were then incubated with prehybridization buffer [40% formamide (Life Technologies, AM9342), 2x SSC, 0.2% UltraPure bovine serum albumin (BSA, Life Technologies, AM2618), 0.2 mg / µL yeast tRNA (Life Technologies, 15401029), and 2 mM vanadyl in DEPC HO] for 30 min at 55°C. Simultaneously, two LNA probes for sense and antisense RNA hexanucleotide repeats [TYE-563-LNA (CCCCGG)3CC and (GGGGCC)3GG probes, Qiagen] were denatured (100°C for 10 min) and then added to the prehybridization buffer at a final concentration of 40 nM. Hybridization was carried out at 55°C for 2 hours and 30 minutes or overnight, followed by two 30-minute washes with posthybridization buffer (40% formamide in DEPC H2O, 0.5x SSC) at 55°C, two 10-minute washes with 0.5x SSC at RT, and two 5-minute washes with 1x PBS at RT. Nuclei were visualized with DAPI (Sigma-Aldrich). Samples were examined with a Nikon Ti2 spinning-disk confocal microscope. Cell scoring was performed using the publicly available software ImageJ.
[0097] Whole cell extracts and Western blot analysis Cell pellets were lysed in NP40 lysis buffer (FNN0021, Invitrogen, ThermoFicher Scientific) supplemented with 1 mM PMSF and a protease inhibitor cocktail (Complete Mini, Roche Diagnostics). 20 μg was separated on a 12% polyacrylamide gel (Criterion XT 10% Bis-Tris, Biorad). Western blots were performed using the following antibodies: mouse monoclonal antibody (clone 2E1) anti-C9orf72, kindly generated and provided by Dr. Charlet-Berguerand (Institute of Genetics and Molecular and Cellular Biology, IGBMC, Strasbourg, France), and anti-vinculin (V9131, Sigma-Aldrich). Horseradish peroxidase-conjugated sheep anti-mouse to detect vinculin was purchased from Amersham Pharmacia Biotech, and peroxidase AffiniPure goat anti-mouse IgG light chain-specific antibody (115-035-174, Jackson ImmunoResearch) was purchased as the secondary antibody for anti-C9orf72. Western blots were developed using the SuperSignal West Dura kit (Thermoscientific). Band imaging and quantification were performed using the ChemiDoc Western Blot Imaging System with ImageLab 4.0 software.
[0098] AAV production and injection in C9orf72 mice Self-complementary AAVrh10 vectors expressing U7-AS were generated by transient transfection in HEK-293T cells according to the protocol described by Biferi et al. (2017). Each gene was quantified by real-time qPCR, and vector titers were expressed as viral genomes (vg) / mL. C9orf72 mice carrying a human C9 BAC containing 500 repeats were purchased from Jackson Laboratory (JAX stock #029099). Animals were maintained in accordance with the European Regulations for the Care and Use of Laboratory Animals. The experimental protocol was approved by the Charles Darwin N.5 Ethics Committee for Animal Experiments. Mice were housed in enclosed, individually ventilated cages with automated water and constant access to food in an EOPS Health (specific pathogen-free) A1 facility. Hemizygous progeny (C9orf72 carriers) were obtained by breeding carrier males with non-carrier females.
[0099] AAV injection Only C9orf72 carrier females (reported to have a pathological phenotype, Liu et al., 2016) were intracerebroventricularly (ICV) injected with the AAVrh10 vector at birth as previously described (Biferi et al., 2017 and Besse et al., 2020). Four mice were injected with a control AAV (AAV-U7-CTRL) and six with therapeutic constructs (AAV-U7-AS-6 or AAV-U7-AS-9) at a dose of 2.2e14 VG / kg. Mice were sacrificed 3 months after treatment and subsequently analyzed for C9 transcript levels.
[0100] RNA extraction from mouse tissues To analyze C9orf72 mRNA expression levels, mouse cervical spinal cords were snap-frozen in liquid nitrogen at 3 months of age. Samples were stored at -80°C and then individually lysed in a FastPrep device using Trizol reagent (Ambion Life Technologies) in ready-to-use 2 mL tubes containing specialized beads (RNase / FNase-Free Lysing Matrix D tubes, mpbio, USA) at speed 5 for 30 seconds. The lysates were then incubated at room temperature (RT) for 5 minutes, with frequent vortexing to continue the lysis process. 200 μL of chloroform was added per tube, and the samples were then vortexed for 15 seconds and incubated at RT for 1 minute. The lysates were then centrifuged at 15,000 g for 10 minutes at 4°C. The supernatant fraction containing RNA was collected in a new tube, and RNA was purified using the RNeasy Mini Kit (Qiagen) according to the manufacturer's protocol. RNA was eluted in water and quantified using a Nanodrop™.
[0101] Reverse transcription and quantitative PCR cDNA was synthesized from 1000 ng of RNA using the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific, Applied Biosystems) according to the manufacturer's instructions. The cDNA was diluted in RNase-free water. 50 ng of cDNA was mixed with 10 μL of Taqman Universal PCR Master Mix II 2x (Applied Biosystems), a probe, and primers specific for each C9 transcript variant (V1, V2, and V3). Primers and a 6-carboxyfluorescein (FAM) probe for V1 and V3 were purchased from Applied Biosystems (NM_145005.5-Hs00331877 and NM_001256054.1-Hs00948764, respectively), while those for V2 were specially ordered (forward: 5'-CGGTGGCGAGTGGATATCTC-3', reverse: 5'-TGGGCAAAGAGTCGACATCA-3', FAM probe: 5'-TAATGTGACAGTTGGAATGC-3'). A 2'-chloro-7'-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC) probe for mouse hypoxanthine guanine phosphoribosyltransferase (HPRT) (Taqman Gene Expression Assay Mm00446968_m1, Life Technologies) gene was used as an endogenous control. Each sample was loaded in triplicate into a 96-well plate. Thermal cycling conditions were: 55°C for 2 minutes, 95°C for 3 minutes, followed by 40 cycles of 95°C for 30 seconds and 60°C for 30 seconds in a StepOne Plus Real Time PCR System (Applied Biosystems). The relative amount of each transcript variant was calculated using the ΔCt / ΔCt method, taking into account the PCR signal of the target gene transcript in each sample compared to the control sample (normalized to the endogenous control). qPCR analysis was performed using StepOne software v2.3 (Life Technologies).
[0102] result Design and construction of U7-AS viral vector Aiming to address the pathological mechanisms associated with the disease (protein loss, RNA aggregates and / or accumulation of DPRs), eight AS sequences of 40 nucleotides (nt) in length were designed as listed in the table below:
[0103] [Table 4]
[0104] Two AS sequences were designed to target putative splicing silencer regions in exon 1a (AS1) and intron 1 (AS2) of the antisense C9 precursor transcript. Another sequence (containing a potential splicing silencer region) was placed upstream of the HRE within intron 1 and directed against either the antisense (AS3) or sense (AS4) precursor transcript. AS sequences encompassing the 5' region of the HRE and within portions of the HRE were also prepared (to avoid targeting other G4C2-containing genes). This AS was directed against either the antisense (AS5) or sense (AS6) precursor transcript. Another AS was placed in the 3' region of the HRE (AS7 and AS8 for antisense and sense, respectively), as shown schematically in Figure 1. A double construct (designated AS9, SEQ ID NO: 17 in Table 2) was also designed, combining two AS sequences targeting the antisense (AS3) and sense (AS6) precursor transcripts. Additionally, we designed a single AS control sequence and a double AS carrying a previously described control sequence (Biferi, MG et al., 2017).
[0105] The AS sequence was fused to the U7 small nuclear RNA (SEQ ID NOs: 9-17) to protect it for in vivo delivery as well as to incorporate it at the pre-mRNA level prior to processing. These U7-AS sequences were generated by PCR-mediated mutagenesis using specific primers carrying restriction enzyme sites for cloning into the pRRL third-generation lentiviral backbone expressing the green fluorescent protein (GFP) gene and between the ITRs of the AAV plasmid (pAAV) (Figure 2). Lentivirus and AAV particles were generated as described in Dull et al., 1998 and Biferi et al., 2017, respectively.
[0106] Analysis of RNA aggregates in patient-derived fibroblasts We tested the construct in vitro using immortalized primary fibroblasts from two patients with C9 mutations (ALS-1 and ALS-2) and two healthy controls (CTRL-1 and CTRL-2). To characterize the in vitro model of C9-ALS, we performed different analyses to detect key hallmarks of the disease. First, we analyzed the presence of aggregates in the immortalized primary fibroblasts. RNA fluorescence in situ hybridization (FISH) analysis was performed. In fibroblasts from patient 1, 20% of cells contained sense RNA aggregates and 25% of cells contained antisense RNA aggregates (ALS1, n ≥ 3), and in fibroblasts from patient 2, 30% of cells contained sense RNA aggregates and 35% of cells contained antisense RNA aggregates (ALS2, n ≥ 3) (Figure 3). In contrast, no sense or antisense aggregates were detected in either control fibroblasts (CTRL-1 and CTRL-2) (Figure 3). To complete the characterization of these cells, C9 protein expression was assessed in immortalized fibroblasts by Western blot using a monoclonal antibody (clone 2E1). Lower expression of C9 protein was observed in C9-ALS1 or C9-ALS2 fibroblasts compared with cells from two healthy controls (Figure 5A).
[0107] Therapeutic effects on sense and antisense RNA aggregates in patient-derived fibroblasts To test the therapeutic effects of U7-AS sequences in vitro, ALS-2 fibroblasts were transduced with lentiviral vectors expressing different U7-AS sequences. The transduction efficacy of each lentiviral vector was assessed by counting GFP-positive cells. The percentage of transduced cells in each experiment was approximately 80%. RNA-FISH was then performed to detect the effect of these AS sequences on altering the accumulation of sense and antisense aggregates. The number of cells with one or more RNA aggregates was counted and compared with the total number of cells. This analysis was performed at least in triplicate for each condition, and an average of 300 cells per image was counted. The ability of the AS sequences to prevent aggregate formation was determined by comparing the percentage of cells exhibiting aggregates after treatment with Lenti-AS-C9 or Lenti-AS-CTRL.
[0108] Compared to controls, patient-derived cells transduced with therapeutic vectors showed a reduction in the number of sense or antisense aggregates by up to 66% or 55%, respectively, depending on the AS contained in the vector (Figure 4). The results showed a significant reduction in sense aggregates in ALS-2 cells, particularly with Lenti-AS-3 (up to 66%). We also analyzed antisense RNA aggregates and found that Lenti-AS-1, Lenti-AS-2, Lenti-AS-4, and Lenti-AS-6 mediated significant reductions in antisense RNA aggregates by 44%, 50%, 42%, and 55%, respectively, compared to control-treated cells (Figure 4). Lenti-AS-7 and Lenti-AS-8 were not effective in reducing RNA aggregates, suggesting that targeting sequences upstream of the repeats may be more promising.
[0109] Therapeutic effects on C9orf72 protein levels in patient-derived fibroblasts ALS-2 fibroblasts transduced with lentiviruses carrying different ASs were further analyzed to assess the effect of AS treatment on C9 protein expression. As shown in Figures 5B and 5C, treatment with AS did not induce any significant changes in C9orf72 protein levels.
[0110] Therapeutic efficacy of C9orf72 transcript variants in the C9 mouse model To test the in vivo therapeutic effects, C9 female mice were injected with a control vector (AAV-U7-CTRL) or two therapeutic constructs via ICV injection at birth. Mice were sacrificed at 3 months of age. The effect of the gene therapy approach on the expression levels of C9 isoforms in the cervical spinal cord was analyzed by RT-qPCR. Compared with non-injected (NI) or control-treated tp mice, a significant decrease in the repeat-carrying transcript variants V1 and V3 was observed in carrier C9 mice after treatment with AAV-U7-AS-6 or AAV-U7-AS-9. Importantly, no significant effect of the AAV-U7-AS construct on V2 mRNA expression levels was observed (Figure 6C). This result indicates that the gene therapy approach can maintain non-pathological V2 mRNA transcription, confirming the effect on protein levels observed in fibroblasts.
[0111] conclusion The overall goal of this study was to develop an efficient gene therapy approach for the most common genetic form of ALS, which is caused by an HRE in the C9orf72 gene. AS sequences were designed to target specific regions on the C9 transcript to reduce RNA aggregate formation, translation in DPRs, and / or maintain C9 transcript levels. This approach represents an advantage over the use of RNAi, which induces the destruction of mature mRNA and potentially exacerbates the haploinsufficiency observed in C9-ALS.
[0112] The therapeutic efficacy of lentiviral vectors expressing AS sequences was tested in immortalized fibroblasts. The AS-1, AS-2, AS-3, AS-4, AS-5, and AS-6 sequences were able to reduce the level of sense RNA aggregates (up to 66% with AS-3), and AS-1, AS-2, AS-4, and AS-6 were able to significantly reduce antisense aggregates (up to 55% with AS-6). No previously published studies have demonstrated the use of AS to reduce both sense and antisense aggregates. Together, these results demonstrate how efficient this approach is in reducing sense and antisense aggregates in patient-derived cells. The fact that AS could prevent both sense and antisense aggregation suggests that this approach may result in enhanced therapeutic efficacy in vivo. This is confirmed by the results obtained in C9 mice, which show a reduction in V1 transcripts (44% and 55% in AS-6 and AS-9, respectively) and V3 transcripts (82% and 87% in AS-6 and AS-9, respectively).
[0113] Furthermore, despite its effect on RNA aggregation, AS sequences do not reduce C9 protein levels, as shown in vitro. Additionally, AS sequences do not reduce the levels of the non-pathological transcript variant (V2) in vivo. This suggests that this approach addresses both gain- and loss-of-function pathological mechanisms underlying disease.
[0114] References - Ai, J., Li, J., Gessler, DJ, Su, Q., Wei, Q., Li, H., and Gao, G. (2017). Adeno-associated virus serotype rh.10 displays strong muscle tropism following intraperitoneal delivery. Sci Rep 7, 1-6. - Alniss, H., Zamiri, B., Khalaj, M., Pearson, C.E., and Macgregor, R.B. (2018). Thermodynamic and spectroscopic investigations of TMPyP4 association with guanine- and cytosine-rich DNA and RNA repeats of C9orf72. Biochemical and Biophysical Research Communications 495, 2410-2417. - Azzouz, M., Ralph, G.S., Storkebaum, E., Walmsley, L.E., Mitrophanous, K.A., Kingsman, S.M., Carmeliet, P., and Mazarakis, N.D. (2004). VEGF delivery with retrogradely transported lentivector prolongs survival in a mouse ALS model. Nature 429, 413. - Besse, A., Astord, S., Marais, T., Roda, M., Giroux, B., Lejeune, F. X., Relaix, F., Smeriglio, P., Barkats, M., & Biferi, M. G. (2020). AAV9-Mediated Expression of SMN Restricted to Neurons Does Not Rescue the Spinal Muscular Atrophy Phenotype in Mice. Molecular therapy : the journal of the American Society of Gene Therapy, 28(8), 1887-1901. - Betts, C., Saleh, A.F., Arzumanov, A.A., Hammond, S.M., Godfrey, C., Coursindel, T., Gait, M.J., and Wood, M.J. (2012). Pip6-PMO, A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Molecular therapy Nucleic acids 1, e38. - Biferi, M. G. et al. A New AAV10-U7-Mediated Gene Therapy Prolongs Survival and Restores Function in an ALS Mouse Model. Mol. Ther. 25, 2038-2052 (2017). - Cazzella, V., Martone, J., Pinnaro, C., Santini, T., Twayana, S.S., Sthandier, O., D'Amico, A., Ricotti, V., Bertini, E., Muntoni, F., et al. (2012). Exon 45 skipping through U1-snRNA antisense molecules recovers the Dys-nNOS pathway and muscle differentiation in human DMD myoblasts. Mol Ther 20, 2134-2142. - Chan, J.H., Lim, S., and Wong, W.S. (2006). Antisense oligonucleotides: from design to therapeutic application. Clinical and experimental pharmacology & physiology 33, 533-540. 15 Crooke, S.T. (2004). Antisense strategies. Current molecular medicine 4, 465-487. - Chan, K.Y., Jang, M.J., Yoo, B.B., Greenbaum, A., Ravi, N., Wu, W.-L., Sanchez-Guardado, L., Lois, C., Mazmanian, S.K., Deverman, B.E., et al. (2017). Engineered AAVs for efficient noninvasive gene delivery to the central and peripheral nervous systems. Nat Neurosci 20, 1172-1179. - Choudhury, S.R., Fitzpatrick, Z., Harris, A.F., Maitland, S.A., Ferreira, J.S., Zhang, Y., Ma, S., Sharma, R.B., Gray-Edwards, H.L., Johnson, J.A., et al. (2016). In Vivo Selection Yields AAV-B1 Capsid for Central Nervous System and Muscle Gene Therapy. Mol Ther 24, 1247-1257. - De Angelis, F.G., Sthandier, O., Berarducci, B., Toso, S., Galluzzi, G., Ricci, E., Cossu, G., and Bozzoni, I. (2002). Chimeric snRNA molecules carrying antisense sequences against the splice junctions of exon 51 of the dystrophin pre-mRNA induce exon skipping and restoration of a dystrophin synthesis in Delta 48-50 DMD cells. Proc Natl Acad Sci U S A 99, 9456-9461. - Deverman, B.E., Pravdo, P.L., Simpson, B.P., Kumar, S.R., Chan, K.Y., Banerjee, A., Wu, W.-L., Yang, B., Huber, N., Pasca, S.P., et al. (2016). Cre-dependent selection yields AAV variants for widespread gene transfer to the adult brain. Nat Biotechnol 34, 204-209. - Deverman, B.E., Ravina, B.M., Bankiewicz, K.S., Paul, S.M., and Sah, D.W.Y. (2018). Gene therapy for neurological disorders: progress and prospects. Nature Reviews Drug Discovery 17, 641-659. - Dodge, J.C., Haidet, A.M., Yang, W., Passini, M.A., Hester, M., Clarke, J., Roskelley, E.M., Treleaven, C.M., Rizo, L., Martin, H., et al. (2008). Delivery of AAV-IGF-1 to the CNS extends survival in ALS mice through modification of aberrant glial cell activity. Mol. Ther. 16, 1056-1064. - Dodge, J.C., Treleaven, C.M., Fidler, J.A., Hester, M., Haidet, A., Handy, C., Rao, M., Eagle, A., Matthews, J.C., Taksir, T.V., et al. (2010). AAV4-mediated expression of IGF-1 and VEGF within cellular components of the ventricular system improves survival outcome in familial ALS mice. Mol. Ther. 18, 2075-2084. - Donadon, I., Bussani, E., Riccardi, F., Licastro, D., Romano, G., Pianigiani, G., Pinotti, M., Konstantinova, P., Evers, M., Lin, S., et al. (2019). Rescue of spinal muscular atrophy mouse models with AAV9-Exon-specific U1 snRNA. Nucleic Acids Research 47, 7618-7632. - Gao, G., Vandenberghe, L.H., Alvira, M.R., Lu, Y., Calcedo, R., Zhou, X., and Wilson, J.M. (2004). Clades of Adeno-associated viruses are widely disseminated in human tissues. J Virol 78, 6381-6388. - Gao, G.P., Alvira, M.R., Wang, L., Calcedo, R., Johnston, J., and Wilson, J.M. (2002). Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy. Proc Natl Acad Sci U S A 99, 11854-11859. - Goyenvalle, A., Vulin, A., Fougerousse, F., Leturcq, F., Kaplan, J.C., Garcia, L., and Danos, O. (2004). Rescue of dystrophic muscle through U7 snRNA-mediated exon skipping. Science 306, 1796-1799. - Haeusler, A.R., Donnelly, C.J., and Rothstein, J.D. (2016). The expanding biology of the C9orf72 nucleotide repeat expansion in neurodegenerative disease. Nat Rev Neurosci 17, 383-395. - Hanlon, K.S., Meltzer, J.C., Buzhdygan, T., Cheng, M.J., Sena-Esteves, M., Bennett, R.E., Sullivan, T.P., Razmpour, R., Gong, Y., Ng, C., et al. (2019). Selection of an Efficient AAV Vector for Robust CNS Transgene Expression. Molecular Therapy - Methods & Clinical Development 15, 320-332.- Hautbergue, G.M., Castelli, L.M., Ferraiuolo, L., Sanchez-Martinez, A., Cooper-Knock, J., Higginbottom, A., Lin, Y.-H., Bauer, C.S., Dodd, J.E., Myszczynska, M.A., et al. (2017). SRSF1-dependent nuclear export inhibition of C9orf72 repeat transcripts prevents neurodegeneration and associated motor deficits. Nat Commun 8. - Hester, M., Foust, K., Kaspar, R., and Kaspar, B. (2009). AAV as a Gene Transfer Vector for the Treatment of Neurological Disorders: Novel Treatment Thoughts for ALS. Current Gene Therapy 9, 428-433.- Ilieva, H., Polymenidou, M., and Cleveland, D.W. (2009). Non-cell autonomous toxicity in neurodegenerative disorders: ALS and beyond. J Cell Biol 187, 761-772. - Imbert, M., Dias-Florencio, G., and Goyenvalle, A. (2017). Viral Vector-Mediated Antisense Therapy for Genetic Diseases. Genes (Basel) 8. - Kaspar, B.K., Llado, J., Sherkat, N., Rothstein, J.D., and Gage, F.H. (2003). Retrograde Viral Delivery of IGF-1 Prolongs Survival in a Mouse ALS Model. Science 301, 839-842. - Kumar, P., Wu, H., McBride, J.L., Jung, K.E., Kim, M.H., Davidson, B.L., Lee, S.K., Shankar, P., and Manjunath, N. (2007). Transvascular delivery of small interfering RNA to the central nervous system. Nature 448, 39-43. - Lepore, A.C., Haenggeli, C., Gasmi, M., Bishop, K.M., Bartus, R.T., Maragakis, N.J., and Rothstein, J.D. (2007). Intraparenchymal spinal cord delivery of adeno-associated virus IGF-1 is protective in the SOD1G93A model of ALS. Brain Res. 1185, 256-265. - Liu, Y., Pattamatta, A., Zu, T., Reid, T., Bardhi, O., Borchelt, D. R., Yachnis, A. T., & Ranum, L. P. (2016). C9orf72 BAC Mouse Model with Motor Deficits and Neurodegenerative Features of ALS / FTD. Neuron, 90(3), 521-534. - Lundberg, M., Wikstrom, S., and Johansson, M. (2003). Cell surface adherence and endocytosis of protein transduction domains. Mol Ther 8, 143-150. - Malhotra, M., Tomaro-Duchesneau, C., Saha, S., Kahouli, I., and Prakash, S. (2013). Development and characterization of chitosan-PEG-TAT nanoparticles for the intracellular delivery of siRNA. International journal of nanomedicine 8, 2041-2052. - McCarty, D.M., Monahan, P.E., and Samulski, R.J. (2001). Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis. Gene Ther 8, 1248-1254. - Nonnenmacher, M., Wang, W., Child, M. A., Ren, X. Q., Huang, C., Ren, A. Z., Tocci, J., Chen, Q., Bittner, K., Tyson, K., Pande, N., Chung, C. H., Paul, S. M., & Hou, J. (2020). Rapid evolution of blood-brain-barrier-penetrating AAV capsids by RNA-driven biopanning. Molecular therapy. Methods & clinical development, 20, 366-378. - Renton, A.E., Majounie, E., Waite, A., Simon-Sanchez, J., Rollinson, S., Gibbs, J.R., Schymick, J.C., Laaksovirta, H., van Swieten, J.C., Myllykangas, L., et al. (2011). A hexanucleotide repeat expansion in C9orf72 is the cause of chromosome 9p21-linked ALS-FTD. Neuron 72, 257-268. - Schumperli, D., and Pillai, R.S. (2004). The special Sm core structure of the U7 snRNP: far-reaching significance of a small nuclear ribonucleoprotein. Cell Mol Life Sci 61, 2560-2570. - Souza, P.V., Pinto, W.B., and Oliveira, A.S. (2015). C9orf72-related disorders: expanding the clinical and genetic spectrum of neurodegenerative diseases. Arq Neuropsiquiatr 73, 246-256. - Simone, R., Balendra, R., Moens, T.G., Preza, E., Wilson, K.M., Heslegrave, A., Woodling, N.S., Niccoli, T., Gilbert-Jaramillo, J., Abdelkarim, S., et al. (2018). G-quadruplex-binding small molecules ameliorate C9orf72 FTD / ALS pathology in vitro and in vivo. EMBO Molecular Medicine 10, 22-31. - Su, Z., Zhang, Y., Gendron, T.F., Bauer, P.O., Chew, J., Yang, W.-Y., Fostvedt, E., Jansen-West, K., Belzil, V.V., Desaro, P., et al. (2014). Discovery of a Biomarker and Lead Small Molecules to Target r(GGGGCC)-Associated Defects in c9FTD / ALS. Neuron 83, 1043-1050. - Tanguy, Y., Biferi, M.G., Besse, A., Astord, S., Cohen-Tannoudji, M., Marais, T., and Barkats, M. (2015). Systemic AAVrh10 provides higher transgene expression than AAV9 in the brain and the spinal cord of neonatal mice. Front Mol Neurosci 8, 36. - Wang, D., Zhong, L., Nahid, M.A., and Gao, G. (2014). The potential of adeno-associated viral vectors for gene delivery to muscle tissue. Expert Opinion on Drug Delivery 11, 345. - Yamada, T., Das Gupta, T.K., and Beattie, C.W. (2013). p28, an anionic cell-penetrating peptide, increases the activity of wild type and mutated p53 without altering its conformation. Molecular pharmaceutics 10, 3375-3383. - Yang, W.-Y., Wilson, H.D., Velagapudi, S.P., and Disney, M.D. (2015). Inhibition of Non-ATG Translational Events in Cells via Covalent Small Molecules Targeting RNA. J. Am. Chem. Soc. 137, 5336-5345. - Zamiri, B., Reddy, K., Macgregor, R.B., and Pearson, C.E. (2014). TMPyP4 Porphyrin Distorts RNA G-quadruplex Structures of the Disease-associated r(GGGGCC)n Repeat of the C9orf72 Gene and Blocks Interaction of RNA-binding Proteins. J. Biol. Chem. 289, 4653-4659. - Zincarelli, C., Soltys, S., Rengo, G., and Rabinowitz, J.E. (2008). Analysis of AAV Serotypes 1-9 Mediated Gene Expression and Tropism in Mice After Systemic Injection. Molecular Therapy 16, 1073-1080 - Zu, T., Liu, Y., Banez-Coronel, M., Reid, T., Pletnikova, O., Lewis, J., Miller, T. M., Harms, M. B., Falchook, A. E., Subramony, S. H., Ostrow, L. W., Rothstein, J. D., Troncoso, J. C., & Ranum, L. P. (2013). RAN proteins and RNA foci from antisense transcripts in C9ORF72 ALS and frontotemporal dementia. Proceedings of the National Academy of Sciences of the United States of America, 110(51), E4968-E4977.
Claims
1. 1. An antisense nucleic acid molecule targeting a C9orf72 transcript, comprising 40 to 50 nucleotides and comprising or consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6, or a sequence having at least 90%, 95%, 96%, 97%, 98% or at least 99% identity to the sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:
6.
2. The antisense nucleic acid molecule of claim 1 fused to a small nuclear RNA.
3. The antisense nucleic acid molecule of claim 2 fused to U7 small nuclear RNA.
4. A nucleic acid construct comprising at least two antisense nucleic acid molecules according to any one of claims 1 to 3.
5. 5. The nucleic acid construct of claim 4, comprising a first antisense nucleic acid molecule that targets a sense C9orf72 transcript and a second antisense nucleic acid molecule that targets an antisense C9orf72 transcript.
6. 6. The nucleic acid construct of claim 5, wherein the first antisense nucleic acid molecule comprises or consists of the sequence shown in SEQ ID NO: 6, and the second antisense nucleic acid molecule comprises or consists of the sequence shown in SEQ ID NO:
3.
7. A vector for delivering the antisense nucleic acid molecule of any one of claims 1 to 3 or the nucleic acid construct of any one of claims 4 to 6.
8. The vector of claim 7, which is a viral vector encoding the antisense nucleic acid molecule or the nucleic acid construct.
9. The vector of claim 8, wherein the viral vector is an AAV vector.
10. The vector described in claim 9, wherein the viral vector is an AAV9 or AAV10 vector.
11. 11. A pharmaceutical composition for use in the treatment of a C9orf72-associated disease, comprising an antisense nucleic acid molecule according to any one of claims 1 to 3, a nucleic acid construct according to any one of claims 4 to 6, or a vector according to any one of claims 7 to 10.
12. The pharmaceutical composition described in claim 11, wherein the disease is a C9orf72 hexanucleotide repeat expansion associated disease.
13. 13. The pharmaceutical composition according to claim 11 or 12, wherein the disease is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD).
14. The pharmaceutical composition of claim 13, wherein the disease is amyotrophic lateral sclerosis (ALS).
15. 11. A pharmaceutical composition for administration by intravenous and / or intraventricular routes, comprising an antisense nucleic acid molecule according to any one of claims 1 to 3, a nucleic acid construct according to any one of claims 4 to 6 or a vector according to any one of claims 7 to 10.
Citation Information
Patent Citations
Compositions for modulating c9orf72 expression
JP2016533717A
Adeno-associated viral vector for exon skipping in a gene encoding a dispensable-domain protein
WO2006021724A2
Modified u7 snrnas for treatment of neuromuscular diseases
WO2011113889A1
Tricyclo-phosphorothioate DNA
WO2013053928A1
Widespread gene delivery of gene therapy vectors
WO2013190059A1