Mutant cis-prenyltransferase (CPT) family protein, method for producing polyisoprenoid, vector, transformed plant, method for producing pneumatic tire, and method for producing rubber product
By mutating the N- and C-terminal sequences of CPT family proteins to enhance folding and membrane binding, high-molecular-weight polyisoprenoids are produced, enabling efficient production of high-performance pneumatic tires and rubber products from plant resources.
Patent Information
- Application Number
- JP2022031815
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2022-03-02
- Publication Date
- 2026-01-15
- Estimated Expiration
- 2042-03-02
AI Technical Summary
Conventional methods fail to produce high-molecular-weight polyisoprenoids due to issues with cis-prenyltransferase (CPT) family proteins folding correctly and binding to membranes, leading to loss of enzymatic activity.
Mutate the N- and C-terminal regions of CPT family proteins not present on rubber particles to match the sequences of those present on rubber particles, enabling correct folding, membrane binding, and deep incorporation, thereby producing high-molecular-weight polyisoprenoids.
The mutant CPT proteins enable the production of polyisoprenoids with higher molecular weights, facilitating the production of high-performance pneumatic tires and rubber products from plant resources in an environmentally friendly manner.
Smart Images

Figure 0007799274000001 
Figure 0007799274000002
Abstract
Description
[Technical Field]
[0001] The present disclosure relates to mutant cis-prenyltransferase (CPT) family proteins, methods for producing polyisoprenoids, vectors, transformed plants, methods for producing pneumatic tires, and methods for producing rubber products. [Background technology]
[0002] In human cis-prenyltransferase (CPT) family proteins, it is known that the interaction between the N-terminus of the CPT family protein (hereinafter simply referred to as CPT) and the Nogo-B receptor (NgBR) family protein (corresponding to HRBP from rubber trees) is important for the activity of CPT.
[0003] It is known that N-terminal deletions of cis-prenyltransferase (CPT) family proteins (hereinafter simply referred to as rubber synthases) present on rubber particles also result in loss of enzymatic activity. In other words, the N-terminus of rubber synthases is known to be an important site for enzymatic activity. However, conventional techniques leave room for improvement in terms of producing high-molecular-weight polyisoprenoids. Summary of the Invention [Problem to be solved by the invention]
[0004] The present disclosure aims to solve the above-mentioned problems and provide a method for producing mutant cis-prenyltransferase (CPT) family proteins and polyisoprenoids, which enables the production of high-molecular-weight polyisoprenoids.
[0005] Another object of the present disclosure is to solve the above-mentioned problems and to provide a vector that enables the production of high-molecular-weight polyisoprenoids by introducing it into a plant body using genetic recombination technology, and a transformed plant into which the vector has been introduced. [Means for solving the problem]
[0006] The present inventors believe that Nogo-B receptor (NgBR) family proteins play a role in assisting CPT to fold into the correct structure. Therefore, if the interaction with NgBR is lost, CPT is less likely to fold into the correct structure, resulting in the loss of enzymatic activity.
[0007] As a result of investigations by the present inventors, the following was discovered. (Findings 1) Rubber synthesis on rubber particles using wild-type CPT When polyisoprenoids are synthesized by directly binding CPT to rubber particles without introducing mutations, it was found that depending on the type of CPT, high molecular weight polyisoprenoids may not be synthesized on the rubber particles. In particular, when using an enzyme that synthesizes short- and medium-chain isoprenoids, which do not naturally bind to membranes, there was a problem that they did not bind to membranes in the first place. (Finding 2) Polyisoprenoid synthesis on membrane particles using an enzyme in which a peptide (or enzyme) that assists membrane binding is fused to CPT As a way to solve the problem of Insight 1, we tried fusing peptides or enzymes (such as the membrane-binding portion of oil droplet-binding proteins or SRPPs that bind to rubber particles) that assist membrane binding to the N- or C-terminus of CPT. However, although this method solved the problem of membrane binding of the enzyme, there remained the possibility that the enzyme would not be properly embedded in the membrane or that the fusion protein would inhibit the interaction with NgBR, which is considered to be important for enzymatic activity.
[0008] After extensive research, the present inventors have concluded that in order to synthesize high molecular weight polyisoprenoids on rubber particles, it is necessary for (guideline a) CPT to fold correctly, (guideline b) to bind to the membrane, and (guideline c) to be correctly (deeply) incorporated into the membrane.
[0009] As a result of extensive research, the present inventors have found that the method of (Finding 1) described above has issues with (Guideline b) and (Guideline c) when using CPT that is not originally present on the rubber particles, and that the method of (Finding 2) described above can solve (Guideline b) by fusing with a membrane-binding peptide, but has issues with the drawbacks of peptide fusion, such as (Guideline a) (when fused to the N-terminus, the enzyme does not fold properly) and (Guideline c) (when fused to the C-terminus, the enzyme is not properly incorporated into the membrane).
[0010] While investigating the relationship between the terminal structure of CPT and the interaction with NgBR, the present inventors discovered that by changing the N-terminal structure of CPT, it is possible to impart an interaction with NgBR to CPT that does not interact with NgBR. Furthermore, the present inventors discovered that when CPT that does not interact with NgBR becomes able to interact with NgBR, the product chain length increases in polyisoprenoid synthesis on rubber particles. Furthermore, the present inventors discovered that by changing the C-terminal structure of CPT in addition to the N-terminal structure of CPT, the product chain length increases in polyisoprenoid synthesis on rubber particles. Furthermore, the present inventors have discovered that, rather than fusing the N-terminal sequence of CPT present on rubber particles to the N-terminus of CPT, it is possible to produce high molecular weight polyisoprenoids by exchanging (swaping) the N-terminal sequence of CPT not present on rubber particles with the N-terminal sequence of CPT present on rubber particles; similarly, rather than fusing the C-terminal sequence of CPT present on rubber particles to the C-terminus of CPT, it is possible to produce high molecular weight polyisoprenoids by exchanging (swaping) the C-terminal sequence of CPT not present on rubber particles with the C-terminal sequence of CPT present on rubber particles, thereby completing the present disclosure.
[0011] That is, the present disclosure provides a method for producing a rubber particle-specific cis-prenyltransferase (CPT) protein by mutating the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein that is not present on a rubber particle so that the amino acid sequence is identical to or similar to the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein that is present on a rubber particle; The present disclosure relates to a mutant cis-prenyltransferase (CPT) family protein in which the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein not present on rubber particles has been mutated so that it is identical to or similar to the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles. Hereinafter, this disclosure will be referred to as the first disclosure of the present disclosure, and will also be referred to as the first present disclosure. [Effects of the Invention]
[0012] According to the first present disclosure, the mutant cis-prenyltransferase (CPT) family protein is one in which the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein not present on rubber particles is mutated so that it is identical to or similar to the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles, and the amino acid sequence of the C-terminal region of the cis-prenyltransferase (CPT) family protein not present on rubber particles is mutated so that it is identical to or similar to the amino acid sequence of the C-terminal region of the cis-prenyltransferase (CPT) family protein present on rubber particles. This makes it possible to produce polyisoprenoids with higher molecular weights than the cis-prenyltransferase (CPT) family protein before the mutation, and a method for producing polyisoprenoids using the mutant cis-prenyltransferase (CPT) family protein makes it possible to produce polyisoprenoids with higher molecular weights than when the cis-prenyltransferase (CPT) family protein before the mutation is used.
[0013] The method for producing a pneumatic tire according to the first aspect of the present disclosure includes a step of producing a polyisoprenoid by the method for producing a polyisoprenoid according to the first aspect of the present disclosure, a kneading step of kneading the resulting polyisoprenoid with additives to obtain a kneaded mixture, a raw tire molding step of molding a raw tire from the kneaded mixture, and a vulcanization step of vulcanizing the raw tire. Therefore, because pneumatic tires are produced from high-molecular-weight polyisoprenoid, plant resources can be effectively utilized, and pneumatic tires with excellent performance can be produced while being environmentally friendly.
[0014] The method for producing a rubber product according to the first aspect of the present disclosure includes a step of producing a polyisoprenoid by the method for producing a polyisoprenoid according to the first aspect of the present disclosure, a kneading step of kneading the resulting polyisoprenoid with additives to obtain a kneaded mixture, a raw rubber product molding step of molding the kneaded mixture into a raw rubber product, and a vulcanization step of vulcanizing the raw rubber product. Therefore, because rubber products are produced from high-molecular-weight polyisoprenoid, plant resources can be effectively utilized, and rubber products with excellent performance can be produced in an environmentally friendly manner.
[0015] The vector of the second disclosure is a vector containing a gene encoding the mutant cis-prenyltransferase (CPT) family protein of the first disclosure. By introducing the vector into a plant, the gene encoding the mutant cis-prenyltransferase (CPT) family protein of the first disclosure, contained in the vector, is expressed, enabling the plant to produce polyisoprenoids with higher molecular weights than before genetic modification.
[0016] The method for producing a pneumatic tire according to the second disclosure includes a step of producing a polyisoprenoid using a transformed plant obtained by introducing the vector according to the second disclosure into a plant, a kneading step of kneading the obtained polyisoprenoid with additives to obtain a kneaded mixture, a raw tire molding step of molding a raw tire from the kneaded mixture, and a vulcanization step of vulcanizing the raw tire. Therefore, since pneumatic tires are produced from high-molecular-weight polyisoprenoids obtained from transformed plants that make it possible to produce high-molecular-weight polyisoprenoids compared to before genetic modification, plant resources can be used effectively, and pneumatic tires with excellent performance can be produced that are environmentally friendly.
[0017] The method for producing a rubber product according to the second disclosure includes a step of producing a polyisoprenoid using a transformed plant obtained by introducing the vector according to the second disclosure into a plant, a kneading step of kneading the obtained polyisoprenoid with additives to obtain a kneaded mixture, a raw rubber product molding step of molding the kneaded mixture into a raw rubber product, and a vulcanization step of vulcanizing the raw rubber product. Therefore, since rubber products are produced from high-molecular-weight polyisoprenoids obtained from transformed plants that enable the production of high-molecular-weight polyisoprenoids compared to before genetic modification, plant resources can be used effectively, and rubber products with excellent performance can be produced in an environmentally friendly manner. [Brief explanation of the drawings]
[0018] [Figure 1] FIG. 1 is a schematic diagram showing a possible mechanism. [Figure 2] 1 is a graph showing the measurement results of the molecular weight distribution of polyisoprenoids synthesized in Example 1 and Comparative Examples 1 and 2. DETAILED DESCRIPTION OF THE INVENTION
[0019] In this specification, the first present disclosure and the second present disclosure are collectively referred to as the present disclosure. First, the first present disclosure will be described, followed by a description of the second present disclosure. (First of the present disclosure) The first mutant cis-prenyltransferase (CPT) family protein of the present disclosure is obtained by mutating the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein that is not present on rubber particles so that the amino acid sequence is identical to or similar to the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein that is present on rubber particles; The mutant cis-prenyltransferase (CPT) family protein is a cis-prenyltransferase (CPT) family protein that is not present on rubber particles, and the amino acid sequence of the C-terminal region of the cis-prenyltransferase (CPT) family protein that is present on rubber particles has been mutated so that it is identical to or similar to the amino acid sequence of the C-terminal region of the cis-prenyltransferase (CPT) family protein that is present on rubber particles. This makes it possible to produce polyisoprenoids with higher molecular weights than those produced by the cis-prenyltransferase (CPT) family protein before the mutation, and a method for producing polyisoprenoids using the mutant cis-prenyltransferase (CPT) family protein makes it possible to produce polyisoprenoids with higher molecular weights than those produced by the cis-prenyltransferase (CPT) family protein before the mutation. In this specification, the N-terminus of a protein means the amino terminus of the polypeptide chain, and the C-terminus of a protein means the carboxy terminus of the polypeptide chain.
[0020] The reason why the above-described effects can be obtained in the present disclosure is presumed to be as follows. As mentioned above, the present inventors focused on both the N-terminus and C-terminus of CPT. While other studies have focused on the N-terminus of CPT, they have only treated it as necessary for maintaining activity. No studies have suggested a relationship between the N-terminus of CPT and changes in the chain length of the product. The relationship between the N-terminus of CPT and changes in the chain length of the product has not been explored. Regarding the role of the C-terminus of CPT, it has been shown that in homodimeric CPT, mutations in the C-terminal RXG motif significantly reduce activity. Structural findings suggest that the C-terminal region approaches the substrate-binding site of another subunit, maintaining substrate binding. Meanwhile, in heteromeric CPT, the C-terminus of cPTL has been shown to function similarly to the RxG motif, but the function of the C-terminus of CPT bound to cPTL was unknown. (1) Wild-type HRT1 (a CPT family protein (rubber synthase) present on rubber particles derived from Hevea brasiliensis) showed no problems in its activity when bound to rubber particles. (2) Although the N-terminal truncated HRT1 was confirmed to bind to rubber particles, its enzymatic activity was not confirmed. This is consistent with previous findings. Furthermore, its interaction with NgBR was also weakened.
[0021] On the other hand, introducing mutations into the N-terminus of CPT, which is not present on the rubber particles, had a significant effect. (3) When wild-type AtCPT5 (a CPT not present on rubber particles from Arabidopsis thaliana) was bound to rubber particles, it produced the original product, C 35 In addition to the polyisoprenoids, long isoprene chains were also synthesized. (4) When AtCPT5 was mutated to N-terminal HRT1 (the N-terminus of AtCPT5 was replaced with that of HRT1), the product polymerized when bound to rubber particles and also interacted with HRBP. (5) When AtCPT5 was mutated to HRT1 at both ends (the N- and C-termini of AtCPT5 were replaced with those of HRT1), the product polymerized more strongly than the N-terminal mutant when bound to rubber particles. This is presumably due to both the interaction with NgBR caused by the N-terminal mutation and the membrane-binding ability of the C-terminus.
[0022] Comparing the results of (3) and (4) above, we found that the N-terminus of HRT1 also interacts with NgBR. This is also known for conventional CPT. However, the polymerization of the product in (4) is a new discovery. Furthermore, comparing the results of (3) to (5) above, we found that while the product is polymerized simply by introducing mutations into the N-terminus, the effect is further enhanced by introducing mutations into the C-terminus as well. In other words, we discovered that by changing the structure of the C-terminus as well as the N-terminus, we can obtain a greater effect of polymerizing the product.
[0023] The effect of the N-terminus on the polymerization of the product is presumed as follows. The interaction between CPT and NgBR is thought to be involved in the folding of CPT, but since AtCPT5 originally adopts a folded structure that is active without interacting with NgBR, it is unlikely that the folding action affects the polymerization. On the other hand, since NgBR is known to be bound to the membrane (rubber particle), it is expected that the interaction of CPT with NgBR will make CPT more likely to approach the membrane (rubber particle) (become deeply bound to the membrane), and it is speculated that this effect affects the polymerization of polyisoprenoids.
[0024] The effect of the C-terminus on the polymerization of the product is presumed to be as follows. It is not clear how the C-terminal mutation in CPT, which is not present on the rubber particle, exerts its effect, but based on the following points, it is speculated that it has the function of helping CPT to penetrate deeply into the membrane. In an interaction test between C-terminal HRT1-mutated AtCPT5 (the C-terminus of AtCPT5 was replaced with the C-terminus of HRT1) and HRBP (NgBR derived from Hevea brasiliensis), no interaction was confirmed.
[0025] Although the C-terminal HRT1-mutated AtCPT5 did not have mutations in Helix 2 and Helix 3, which determine the product chain length, the chain length control mechanism did not function properly, resulting in the production of high molecular weight products. The C-terminal structure of CPT is known to be located near the active center. Therefore, based on these findings, it is speculated that the C-terminus is located near the active center, and that by changing its structure (e.g., hydrophobicity), CPT penetrates deep into the membrane, close to the active center.
[0026] The above-mentioned predicted mechanism will be explained using FIG. Figure 1(a) shows a schematic diagram of the reaction of CPT, which is not present on rubber particles but is not bound to them. In this case, the presence of a stopper allows the chain length control mechanism to function, resulting in the production of polyisoprenoids with a predetermined molecular weight. Figure 1(b) is a schematic diagram of the reaction when CPT, not present on the rubber particle, reacts while bound to the rubber particle. In this case, the stopper is slightly embedded in the rubber particle (membrane), resulting in the production of a polyisoprenoid with a slightly higher molecular weight than when it is not bound to the rubber particle. Figure 1(c) is a schematic diagram of a "mutated CPT in which the C-terminal region of CPT not present on the rubber particle has been replaced with the C-terminal region of CPT present on the rubber particle" reacting while bound to the rubber particle. In this case, the C-terminus of the mutant CPT interacts with the rubber particle (membrane), allowing the CPT to penetrate deeper into the rubber particle (membrane), preventing the original stopper function and resulting in a high molecular weight product. Note that in this disclosure, the C-terminal region of CPT not present on the rubber particle is replaced rather than fusion, which adds an additional amino acid sequence to the C-terminal region of CPT not present on the rubber particle, and therefore it is presumed that the mechanism is more effectively exerted.
[0027] The C-terminus of CPT present on rubber particles is less important because CPT present on rubber particles is originally an enzyme that binds to rubber particles, and it is thought that there are parts other than the C-terminus that bind to rubber particles (membranes). Therefore, it is speculated that even if the C-terminus of CPT present on rubber particles no longer functions properly, other parts will help bind to the rubber particles (membranes). Furthermore, since the CPT present on the rubber particles does not have a stopper to control the product chain length, it is assumed that even if the bond to the rubber particles (membrane) becomes somewhat shallower, the impact will be small.
[0028] As described above, if the N-terminal region of a CPT family protein that is not present on rubber particles has been mutated (substituted) so that it is identical to or similar to the N-terminal region of a CPT family protein that is present on rubber particles, the mutated CPT will interact with NgBR, making it easier for the CPT to approach the membrane (rubber particle), resulting in a higher molecular weight product. Furthermore, as described above, if the C-terminal region of a CPT family protein that is not present on rubber particles has been mutated (substituted) so that it is identical to or similar to the C-terminal region of a CPT family protein that is present on rubber particles, the C-terminus of the mutated CPT will interact with the rubber particle (membrane), causing the CPT to penetrate more deeply into the rubber particle (membrane), preventing the original stopper from functioning, and resulting in a product with a high molecular weight.
[0029] Therefore, according to the first present disclosure, a mutant CPT family protein is obtained by mutating the amino acid sequence of the N-terminal region of a CPT family protein that is not present on rubber particles so that it is identical to or similar to the amino acid sequence of the N-terminal region of a CPT family protein that is present on rubber particles, and by mutating the amino acid sequence of the C-terminal region of the CPT family protein that is not present on rubber particles so that it is identical to or similar to the amino acid sequence of the C-terminal region of a CPT family protein that is present on rubber particles. This makes it possible to produce polyisoprenoids with higher molecular weights than the CPT family protein before the mutation, and a method for producing polyisoprenoids using the mutant CPT family protein makes it possible to produce polyisoprenoids with higher molecular weights than when the CPT family protein before the mutation is used.
[0030] <Mutant cis-prenyltransferase (CPT) family proteins> The mutant cis-prenyltransferase (CPT) family protein of the present disclosure is obtained by mutating the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein that is not present on rubber particles so that the amino acid sequence is identical to or similar to the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein that is present on rubber particles; The mutant cis-prenyltransferase (CPT) family protein is a mutated cis-prenyltransferase (CPT) family protein in which the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein not present on the rubber particle has been mutated so that it is identical to or similar to the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein present on the rubber particle.
[0031] More specifically, the mutant CPT family protein of the present disclosure is a mutant CPT family protein in which the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein not present on rubber particles is replaced with an amino acid sequence identical or similar to the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles, and the amino acid sequence of the C-terminal region of the cis-prenyltransferase (CPT) family protein not present on rubber particles is replaced with an amino acid sequence identical or similar to the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles.
[0032] The amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein that is not present on rubber particles is preferably an amino acid sequence that includes the N-terminus within the section from the N-terminus of the protein to the first β-strand (β-strand 1) that constitutes the β-sheet, and more preferably an amino acid sequence consisting of the amino acid sequence of the section from the N-terminus of the protein to β-strand 1. Similarly, the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein that is present on rubber particles is preferably an amino acid sequence that includes the N-terminus within the section from the N-terminus of the protein to β-strand 1, and more preferably an amino acid sequence consisting of the amino acid sequence of the section from the N-terminus of the protein to β-strand 1. In this specification, β strand 1 refers to the β strand closest to the N-terminus among the β strands that constitute the β sheet structure located at the core of the CPT structure. In addition, in this specification, the section from the N-terminus to β strand 1 refers to the section from the N-terminus to the amino acid immediately upstream of the amino acid sequence constituting β strand 1. In this specification, the amino acid sequence of the N-terminal region is a continuous amino acid sequence.
[0033] The amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein that is not present on rubber particles is preferably an amino acid sequence containing an N-terminus within 100 amino acids downstream from the N-terminus of the protein, more preferably an amino acid sequence containing an N-terminus within 90 amino acids downstream from the N-terminus of the protein, even more preferably an amino acid sequence containing an N-terminus within 85 amino acids downstream from the N-terminus of the protein, particularly preferably an amino acid sequence containing an N-terminus within 80 amino acids downstream from the N-terminus of the protein, and most preferably an amino acid sequence containing an N-terminus within 75 amino acids downstream from the N-terminus of the protein.
[0034] The amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein that is not present on rubber particles corresponds, for example, to the amino acid sequence from positions 1 to 72 in the amino acid sequence of AtCPT5 derived from Arabidopsis thaliana shown in SEQ ID NO: 3, and the amino acid sequence from positions 1 to 34 in the amino acid sequence of HbCPT5 derived from Hevea brasiliensis shown in SEQ ID NO: 4.
[0035] Similarly, the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein present on a rubber particle is preferably an amino acid sequence containing an N-terminus within 70 amino acids downstream from the N-terminus of the protein, more preferably an amino acid sequence containing an N-terminus within 60 amino acids downstream from the N-terminus of the protein, even more preferably an amino acid sequence containing an N-terminus within 50 amino acids downstream from the N-terminus of the protein, particularly preferably an amino acid sequence containing an N-terminus within 40 amino acids downstream from the N-terminus of the protein, and most preferably an amino acid sequence containing an N-terminus within 35 amino acids downstream from the N-terminus of the protein.
[0036] The amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles corresponds to, for example, the amino acid sequence from positions 1 to 32 in the amino acid sequence of HRT1 derived from Hevea brasiliensis shown in SEQ ID NO: 1.
[0037] An amino acid sequence similar to the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles is an amino acid sequence that preferably has 80% or more sequence identity, more preferably 85% or more sequence identity, even more preferably 90% or more sequence identity, particularly preferably 95% or more sequence identity, most preferably 98% or more sequence identity, and even more preferably 99% or more sequence identity with the amino acid sequence identical to the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles.
[0038] The amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein that is not present on rubber particles is preferably an amino acid sequence containing a C-terminus within 50 amino acids upstream from the C-terminus of the protein, more preferably an amino acid sequence containing a C-terminus within 45 amino acids upstream from the C-terminus of the protein, even more preferably an amino acid sequence containing a C-terminus within 40 amino acids upstream from the C-terminus of the protein, particularly preferably an amino acid sequence containing a C-terminus within 35 amino acids upstream from the C-terminus of the protein, and most preferably an amino acid sequence containing a C-terminus within 30 amino acids upstream from the C-terminus of the protein. In this specification, the amino acid sequence of the C-terminal region is a continuous amino acid sequence.
[0039] The amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein that is not present on rubber particles corresponds, for example, to the amino acid sequence from positions 278 to 302 in the amino acid sequence of AtCPT5 derived from Arabidopsis thaliana shown in SEQ ID NO: 3, and the amino acid sequence from positions 342 to 368 in the amino acid sequence of HbCPT5 derived from Hevea brasiliensis shown in SEQ ID NO: 4.
[0040] Similarly, the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein present on a rubber particle is preferably an amino acid sequence containing a C-terminus within 50 amino acids upstream from the C-terminus of the protein, more preferably an amino acid sequence containing a C-terminus within 45 amino acids upstream from the C-terminus of the protein, even more preferably an amino acid sequence containing a C-terminus within 40 amino acids upstream from the C-terminus of the protein, particularly preferably an amino acid sequence containing a C-terminus within 35 amino acids upstream from the C-terminus of the protein, and most preferably an amino acid sequence containing a C-terminus within 30 amino acids upstream from the C-terminus of the protein.
[0041] The amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles corresponds to, for example, the amino acid sequence from positions 263 to 290 in the amino acid sequence of HRT1 derived from Hevea brasiliensis shown in SEQ ID NO: 1.
[0042] An amino acid sequence similar to the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles is an amino acid sequence that preferably has 80% or more sequence identity, more preferably 85% or more sequence identity, even more preferably 90% or more sequence identity, particularly preferably 95% or more sequence identity, most preferably 98% or more sequence identity, and even more preferably 99% or more sequence identity with the amino acid sequence identical to the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles.
[0043] In the mutant CPT family protein, the amino acid sequence of the N-terminal region of the CPT family protein not present on the rubber particle and the amino acid sequence of the C-terminal region of the CPT family protein not present on the rubber particle may be derived from the same CPT family protein or from different CPT family proteins, but are preferably derived from the same CPT family protein.
[0044] Similarly, in the mutant CPT family protein, the amino acid sequence of the N-terminal region of the CPT family protein present on the rubber particle and the amino acid sequence of the C-terminal region of the CPT family protein present on the rubber particle may be derived from the same CPT family protein or from different CPT family proteins, but are preferably derived from the same CPT family protein.
[0045] Mutation (substitution) of the amino acid sequence can be carried out by known techniques, such as homologous recombination, overlap extension PCR, in-fusion cloning, and fusion of PCR products using restriction enzymes.
[0046] <<Cis-prenyltransferase (CPT) family proteins present on rubber particles>> The cis-prenyltransferase (CPT) family protein present on rubber particles is not particularly limited as long as it is a CPT family protein present on rubber particles, and may be, for example, a cis-prenyltransferase (CPT) family protein present on rubber particles derived from a plant. Among these, a cis-prenyltransferase (CPT) family protein present on rubber particles derived from a plant belonging to the genus Hevea or Taraxacum (particularly, the genus Hevea) is preferred, and a cis-prenyltransferase (CPT) family protein present on rubber particles derived from Hevea brasiliensis or Taraxacum koksaghyz (particularly, Hevea brasiliensis) is more preferred.
[0047] The plant is not particularly limited, and examples thereof include the genus Hevea, such as rubber tree (Hevea brasiliensis); the genus Sonchus, such as sowweed (Sonchus oleraceus), sowweed (Sonchus asper), and sowweed (Sonchus brachyotus); Solidago altissima, Solidago virgaurea subsp. asiatica, Solidago virgaurea subsp. leipcarpa, Solidago virgaurea subsp. leipcarpa f. paludosa, Solidago virgaurea subsp. gigantea, and Solidago gigantea Ait. var. leiophylla. The genus Solidago, including sunflower (Helianthus annuus), white-barked sunflower (Helianthus argophyllus), Helianthus atrorubens, dwarf sunflower (Helianthus debilis), little sunflower (Helianthus decapetalus), and giant sunflower (Helianthus giganteus); the genus Helianthus, including dandelion (Taraxacum), Siberian dandelion (Taraxacum venustum H. Koidz), Japanese dandelion (Taraxacum hondoense Nakai), Kanto dandelion (Taraxacum platycarpum Dahlst), Kansai dandelion (Taraxacum japonicum), and common dandelion (Taraxacum officinale Taraxacum species such as Ficus Weber, Taraxacum koksaghyz, and the like; fig (Ficus carica), rubber tree (Ficus elastica), Ficus pumila L., Ficus erecta Thumb., and Ficus ampelas Burm.f.Ficus species include Ficus benguetensis Merr., Ficus irisana Elm., Ficus microcarpa Lf., Ficus septica Burm.f., and Ficus benghalensis; Parthenium species include guayule (Parthenium argentatum), Parthenium hysterophorus, and ragweed; and lettuce (Lactuca sativa).
[0048] Specific examples of the CPT family proteins present on rubber particles include HRT1 and HRT2, which are CPT family proteins present on rubber particles derived from Hevea brasiliensis, CPT1, which is a CPT family protein present on rubber particles derived from Russian dandelion, and CPT3, which is a CPT family protein present on rubber particles derived from guayule. Of these, HRT1 is preferred.
[0049] Specific examples of the CPT family proteins present on the rubber particles include the following [1]. [1] A protein consisting of the amino acid sequence represented by SEQ ID NO: 1
[0050] It is also known that proteins may retain their original functions even when they contain one or more amino acid substitutions, deletions, insertions, or additions in their original amino acid sequence. Therefore, specific examples of the CPT family proteins include the following [2]. [2] A protein having an amino acid sequence represented by SEQ ID NO: 1, in which one or more amino acid substitutions, deletions, insertions, and / or additions are included, and which has an enzyme activity that catalyzes a reaction that elongates the chain length of an isoprenoid compound in a cis form.
[0051] In order to maintain the function as a CPT family protein, the amino acid sequence represented by SEQ ID NO: 1 preferably contains substitutions, deletions, insertions, and / or additions of one or more amino acids, more preferably 1 to 58 amino acids, even more preferably 1 to 44 amino acids, even more preferably 1 to 29 amino acids, particularly preferably 1 to 15 amino acids, most preferably 1 to 6 amino acids, and even most preferably 1 to 3 amino acids.
[0052] Conservative substitutions are preferred as examples of amino acid substitutions, and specific examples include substitutions within the following parenthesized groups: (glycine, alanine), (valine, isoleucine, leucine), (aspartic acid, glutamic acid), (asparagine, glutamine), (serine, threonine), (lysine, arginine), (phenylalanine, tyrosine).
[0053] It is also known that proteins with amino acid sequences highly identical to the original amino acid sequence may have similar functions. Therefore, specific examples of the CPT family proteins include the following [3]. [3] A protein consisting of an amino acid sequence having 80% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 1 and having an enzyme activity that catalyzes a reaction that elongates the chain length of an isoprenoid compound in a cis form.
[0054] In order to maintain the function as a CPT family protein, the sequence identity with the amino acid sequence represented by SEQ ID NO: 1 is preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, particularly preferably 98% or more, and most preferably 99% or more.
[0055] The sequence identity of amino acid sequences or nucleotide sequences can be determined using the algorithms BLAST [Proc. Natl. Acad. Sci. USA, 90, 5873 (1993)] or FASTA [Methods Enzymol., 183, 63 (1990)] by Karlin and Altschul.
[0056] As a method for confirming that the protein has the enzymatic activity, for example, a conventionally known method can be used, and examples thereof include a method in which the target protein is expressed by a transformant using Escherichia coli or the like, into which a gene encoding the target protein has been introduced, and the presence or absence of the function of the target protein is determined by measuring the activity or the like using the respective activity measurement method.
[0057] Specific examples of genes encoding CPT family proteins present on rubber particles include the following [1] and [2]. [1] DNA consisting of the base sequence represented by SEQ ID NO: 2 [2] A DNA that hybridizes under stringent conditions with a DNA consisting of a base sequence complementary to the base sequence represented by SEQ ID NO: 2 and encodes a protein having an enzymatic activity that catalyzes a reaction that elongates the chain length of an isoprenoid compound in cis form.
[0058] "Hybridizing" as used herein refers to the process of hybridizing DNA to DNA having a specific base sequence or to a portion of the DNA. Therefore, the DNA having the specific base sequence or the base sequence of a portion of the DNA may be useful as a probe for Northern or Southern blot analysis, or may be DNA of a length that can be used as an oligonucleotide primer for PCR (Polymerase Chain Reaction) analysis. Examples of DNA used as a probe include DNA of at least 100 bases, preferably at least 200 bases, and more preferably at least 500 bases, but may also be DNA of at least 10 bases, preferably at least 15 bases.
[0059] Methods for DNA hybridization experiments are well known and are described, for example, in Molecular Cloning, 2nd and 3rd editions (2001), Methods for General and Molecular Bacteriology, ASM Press (1994), and Immunology methods manual, Academic Press (Molecular). Hybridization conditions can be determined and experiments can be performed according to many other standard textbooks.
[0060] Examples of stringent conditions include incubating a DNA-immobilized filter and probe DNA overnight at 42°C in a solution containing 50% formamide, 5x SSC (750 mM sodium chloride, 75 mM sodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 μg / L denatured salmon sperm DNA, followed by washing the filter in a 0.2x SSC solution at approximately 65°C. However, less stringent conditions can also be used. Stringent conditions can be modified by adjusting the formamide concentration (lower formamide concentrations result in lower stringency), salt concentration, and temperature. Low stringency conditions include, for example, incubation overnight at 37°C in a solution containing 6x SSC (20x SSC is 3 mol / L sodium chloride, 0.2 mol / L sodium dihydrogen phosphate, 0.02 mol / L EDTA, pH 7.4), 0.5% SDS, 30% formamide, and 100 μg / L denatured salmon sperm DNA, followed by washing with a 1x SSC, 0.1% SDS solution at 50°C. Even lower stringency conditions include hybridization under the low stringency conditions described above using a solution with a high salt concentration (e.g., 5x SSC), followed by washing.
[0061] The various conditions described above can also be established by adding or changing blocking reagents used to suppress background in hybridization experiments. The addition of blocking reagents described above may be accompanied by changes in hybridization conditions to adapt the conditions.
[0062] Examples of DNA that can hybridize under the above-mentioned stringent conditions include DNA consisting of a base sequence that has at least 80% or more, preferably 90% or more, more preferably 95% or more, even more preferably 98% or more, and particularly preferably 99% or more sequence identity with the base sequence represented by SEQ ID NO: 2, when calculated based on the above parameters using programs such as BLAST and FASTA.
[0063] A conventionally known method can be used to confirm that DNA that hybridizes with the above-mentioned DNA under stringent conditions is DNA that encodes a protein having a predetermined enzymatic activity. For example, a method can be used in which the target protein is expressed by a transformant containing a gene encoding the target protein using Escherichia coli or the like, and the presence or absence of the function of the target protein is determined by measuring the activity or the like using the respective activity measurement method.
[0064] Furthermore, the amino acid sequence and nucleotide sequence of the protein can be identified by conventionally known methods. For example, total RNA is extracted from a growing plant, mRNA is purified as needed, and cDNA is synthesized by reverse transcription. Next, degenerate primers are designed based on the amino acid sequence of a known protein corresponding to the target protein, and RT-PCR is performed to partially amplify DNA fragments and partially identify the sequence. Next, the full-length nucleotide sequence and amino acid sequence are identified by a method such as RACE. The RACE method (Rapid Amplification of cDNA Ends) is a method in which, when the nucleotide sequence of a cDNA is partially known, PCR is performed based on the nucleotide sequence information of the known region to clone the unknown region up to the end of the cDNA. This method allows full-length cDNA to be cloned by PCR without the need to prepare a cDNA library. It is preferable that the degenerate primers are prepared from plant-derived sequences having a sequence site highly common to the target protein. Furthermore, when the nucleotide sequence encoding the protein is known, a primer including a start codon and a primer including a stop codon can be designed from the known nucleotide sequence, and the full-length nucleotide sequence and amino acid sequence can be identified by performing RT-PCR using the synthesized cDNA as a template.
[0065] <<Cis-prenyltransferase (CPT) family proteins not present on rubber particles>> The cis-prenyltransferase (CPT) family protein not present on rubber particles is not particularly limited as long as it is a CPT family protein not present on rubber particles, and may be, for example, a cis-prenyltransferase (CPT) family protein not present on rubber particles derived from a plant. Here, the plant is the same as the plants described above. Of these, a cis-prenyltransferase (CPT) family protein not present on rubber particles derived from a plant belonging to the genus Hevea or Taraxacum (particularly the genus Hevea) is preferred, and a cis-prenyltransferase (CPT) family protein not present on rubber particles derived from Hevea brasiliensis or Taraxacum koksaghyz (particularly Hevea brasiliensis) is more preferred. Also preferred is a cis-prenyltransferase (CPT) family protein not present on rubber particles derived from Arabidopsis thaliana. Furthermore, the CPT family protein not present on rubber particles is preferably a protein that does not interact with Nogo-B receptor (NgBR) family proteins.
[0066] Specific examples of the CPT family proteins not present on rubber particles include AtCPT4 and AtCPT5, which are CPTs derived from Arabidopsis thaliana that are not present on rubber particles, HbCPT4 and HbCPT5, which are CPTs derived from Hevea brasiliensis that are not present on rubber particles, and NDPS1, which is a CPT derived from tomato that is not present on rubber particles. Of these, AtCPT5 and HbCPT5 are preferred, with AtCPT5 being more preferred.
[0067] Specific examples of CPT family proteins that are not present on rubber particles include the following [4]. [4] A protein consisting of the amino acid sequence represented by SEQ ID NO: 3
[0068] It is also known that proteins may retain their original functions even when they contain one or more amino acid substitutions, deletions, insertions, or additions in their original amino acid sequence. Therefore, specific examples of the CPT family proteins include the following [5]. [5] A protein having an amino acid sequence represented by SEQ ID NO: 3, in which one or more amino acid substitutions, deletions, insertions, and / or additions are included, and which has an enzyme activity that catalyzes a reaction that elongates the chain length of an isoprenoid compound in a cis form.
[0069] In order to maintain the function as a CPT family protein, the amino acid sequence represented by SEQ ID NO: 3 preferably contains substitutions, deletions, insertions, and / or additions of one or more amino acids, more preferably 1 to 60 amino acids, even more preferably 1 to 45 amino acids, even more preferably 1 to 30 amino acids, particularly preferably 1 to 15 amino acids, most preferably 1 to 6 amino acids, and even most preferably 1 to 3 amino acids.
[0070] Conservative substitutions are preferred as examples of amino acid substitutions, and specific examples include substitutions within the following parenthesized groups: (glycine, alanine), (valine, isoleucine, leucine), (aspartic acid, glutamic acid), (asparagine, glutamine), (serine, threonine), (lysine, arginine), (phenylalanine, tyrosine).
[0071] It is also known that proteins with amino acid sequences highly identical to the original amino acid sequence may have similar functions. Therefore, specific examples of the CPT family proteins include the following [6]. [6] A protein consisting of an amino acid sequence having 80% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 3, and having an enzyme activity that catalyzes a reaction that elongates the chain length of an isoprenoid compound in a cis form.
[0072] In order to maintain the function as a CPT family protein, the sequence identity with the amino acid sequence represented by SEQ ID NO: 3 is preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, particularly preferably 98% or more, and most preferably 99% or more.
[0073] The sequence identity of amino acid sequences or nucleotide sequences can be determined using the algorithms BLAST [Proc. Natl. Acad. Sci. USA, 90, 5873 (1993)] or FASTA [Methods Enzymol., 183, 63 (1990)] by Karlin and Altschul.
[0074] As a method for confirming that the protein has the enzymatic activity, for example, a conventionally known method can be used, and examples thereof include a method in which the target protein is expressed by a transformant using Escherichia coli or the like, into which a gene encoding the target protein has been introduced, and the presence or absence of the function of the target protein is determined by measuring the activity or the like using the respective activity measurement method.
[0075] Specific examples of CPT family proteins not present on rubber particles include the following [7]. [7] A protein consisting of the amino acid sequence represented by SEQ ID NO: 4
[0076] It is also known that proteins may retain their original functions even when they contain one or more amino acid substitutions, deletions, insertions, or additions in their original amino acid sequence. Therefore, specific examples of the CPT family proteins include the following [8]. [8] A protein having an amino acid sequence represented by SEQ ID NO: 4, in which one or more amino acid substitutions, deletions, insertions, and / or additions are included, and which has an enzyme activity that catalyzes a reaction that elongates the chain length of an isoprenoid compound in a cis form.
[0077] In order to maintain the function as a CPT family protein, the amino acid sequence represented by SEQ ID NO: 4 preferably contains substitutions, deletions, insertions, and / or additions of one or more amino acids, more preferably 1 to 73 amino acids, even more preferably 1 to 55 amino acids, even more preferably 1 to 37 amino acids, particularly preferably 1 to 18 amino acids, most preferably 1 to 7 amino acids, and even more preferably 1 to 4 amino acids.
[0078] Conservative substitutions are preferred as examples of amino acid substitutions, and specific examples include substitutions within the following parenthesized groups: (glycine, alanine), (valine, isoleucine, leucine), (aspartic acid, glutamic acid), (asparagine, glutamine), (serine, threonine), (lysine, arginine), (phenylalanine, tyrosine).
[0079] It is also known that proteins with amino acid sequences highly identical to the original amino acid sequence may have similar functions. Therefore, specific examples of the CPT family proteins include the following [9]. [9] A protein consisting of an amino acid sequence having 80% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 4, and having an enzyme activity that catalyzes a reaction that elongates the chain length of an isoprenoid compound in a cis form.
[0080] In order to maintain the function as a CPT family protein, the sequence identity with the amino acid sequence represented by SEQ ID NO: 4 is preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, particularly preferably 98% or more, and most preferably 99% or more.
[0081] The sequence identity of amino acid sequences or nucleotide sequences can be determined using the algorithms BLAST [Proc. Natl. Acad. Sci. USA, 90, 5873 (1993)] or FASTA [Methods Enzymol., 183, 63 (1990)] by Karlin and Altschul.
[0082] As a method for confirming that the protein has the enzymatic activity, for example, a conventionally known method can be used, and examples thereof include a method in which the target protein is expressed by a transformant using Escherichia coli or the like, into which a gene encoding the target protein has been introduced, and the presence or absence of the function of the target protein is determined by measuring the activity or the like using the respective activity measurement method.
[0083] Specific examples of genes encoding CPT family proteins that are not present on rubber particles include the following [3] and [4]. [3] DNA consisting of the base sequence represented by SEQ ID NO: 5 [4] A DNA that hybridizes under stringent conditions with a DNA consisting of a base sequence complementary to the base sequence shown in SEQ ID NO: 5 and encodes a protein having an enzymatic activity that catalyzes a reaction that elongates the chain length of an isoprenoid compound in cis form.
[0084] "Hybridizing" as used herein refers to the process of hybridizing DNA to DNA having a specific base sequence or to a portion of the DNA. Therefore, the DNA having the specific base sequence or the base sequence of a portion of the DNA may be useful as a probe for Northern or Southern blot analysis, or may be DNA of a length that can be used as an oligonucleotide primer for PCR (Polymerase Chain Reaction) analysis. Examples of DNA used as a probe include DNA of at least 100 bases, preferably at least 200 bases, and more preferably at least 500 bases, but may also be DNA of at least 10 bases, preferably at least 15 bases.
[0085] Methods for DNA hybridization experiments are well known and are described, for example, in Molecular Cloning, 2nd and 3rd editions (2001), Methods for General and Molecular Bacteriology, ASM Press (1994), and Immunology methods manual, Academic Press (Molecular). Hybridization conditions can be determined and experiments can be performed according to many other standard textbooks.
[0086] Examples of stringent conditions include incubating a DNA-immobilized filter and probe DNA overnight at 42°C in a solution containing 50% formamide, 5x SSC (750 mM sodium chloride, 75 mM sodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 μg / L denatured salmon sperm DNA, followed by washing the filter in a 0.2x SSC solution at approximately 65°C. However, less stringent conditions can also be used. Stringent conditions can be modified by adjusting the formamide concentration (lower formamide concentrations result in lower stringency), salt concentration, and temperature. Low stringency conditions include, for example, incubation overnight at 37°C in a solution containing 6x SSC (20x SSC is 3 mol / L sodium chloride, 0.2 mol / L sodium dihydrogen phosphate, 0.02 mol / L EDTA, pH 7.4), 0.5% SDS, 30% formamide, and 100 μg / L denatured salmon sperm DNA, followed by washing with a 1x SSC, 0.1% SDS solution at 50°C. Even lower stringency conditions include hybridization under the low stringency conditions described above using a solution with a high salt concentration (e.g., 5x SSC), followed by washing.
[0087] The various conditions described above can also be established by adding or changing blocking reagents used to suppress background in hybridization experiments. The addition of blocking reagents described above may be accompanied by changes in hybridization conditions to adapt the conditions.
[0088] Examples of DNA that can hybridize under the above-mentioned stringent conditions include DNA consisting of a base sequence that has at least 80% or more, preferably 90% or more, more preferably 95% or more, even more preferably 98% or more, and particularly preferably 99% or more sequence identity with the base sequence represented by SEQ ID NO: 5, when calculated based on the above parameters using programs such as BLAST and FASTA.
[0089] A conventionally known method can be used to confirm that DNA that hybridizes with the above-mentioned DNA under stringent conditions is DNA that encodes a protein having a predetermined enzymatic activity. For example, a method can be used in which the target protein is expressed by a transformant containing a gene encoding the target protein using Escherichia coli or the like, and the presence or absence of the function of the target protein is determined by measuring the activity or the like using the respective activity measurement method.
[0090] Furthermore, the amino acid sequence and nucleotide sequence of the protein can be identified by conventionally known methods. For example, total RNA is extracted from a growing plant, mRNA is purified as needed, and cDNA is synthesized by reverse transcription. Next, degenerate primers are designed based on the amino acid sequence of a known protein corresponding to the target protein, and RT-PCR is performed to partially amplify DNA fragments and partially identify the sequence. Next, the full-length nucleotide sequence and amino acid sequence are identified by a method such as RACE. The RACE method (Rapid Amplification of cDNA Ends) is a method in which, when the nucleotide sequence of a cDNA is partially known, PCR is performed based on the nucleotide sequence information of the known region to clone the unknown region up to the end of the cDNA. This method allows full-length cDNA to be cloned by PCR without the need to prepare a cDNA library. It is preferable that the degenerate primers are prepared from plant-derived sequences having a sequence site highly common to the target protein. Furthermore, when the nucleotide sequence encoding the protein is known, a primer including a start codon and a primer including a stop codon can be designed from the known nucleotide sequence, and the full-length nucleotide sequence and amino acid sequence can be identified by performing RT-PCR using the synthesized cDNA as a template.
[0091] Specific examples of genes encoding CPT family proteins that are not present on rubber particles include the following [5] and [6]. [5] DNA consisting of the base sequence represented by SEQ ID NO: 6 [6] A DNA that hybridizes under stringent conditions with a DNA consisting of a base sequence complementary to the base sequence represented by SEQ ID NO: 6 and encodes a protein having an enzymatic activity that catalyzes a reaction that elongates the chain length of an isoprenoid compound in cis form.
[0092] "Hybridizing" as used herein refers to the process of hybridizing DNA to DNA having a specific base sequence or to a portion of the DNA. Therefore, the DNA having the specific base sequence or the base sequence of a portion of the DNA may be useful as a probe for Northern or Southern blot analysis, or may be DNA of a length that can be used as an oligonucleotide primer for PCR (Polymerase Chain Reaction) analysis. Examples of DNA used as a probe include DNA of at least 100 bases, preferably at least 200 bases, and more preferably at least 500 bases, but may also be DNA of at least 10 bases, preferably at least 15 bases.
[0093] Methods for DNA hybridization experiments are well known and are described, for example, in Molecular Cloning, 2nd and 3rd editions (2001), Methods for General and Molecular Bacteriology, ASM Press (1994), and Immunology methods manual, Academic Press (Molecular). Hybridization conditions can be determined and experiments can be performed according to many other standard textbooks.
[0094] Examples of stringent conditions include incubating a DNA-immobilized filter and probe DNA overnight at 42°C in a solution containing 50% formamide, 5x SSC (750 mM sodium chloride, 75 mM sodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 μg / L denatured salmon sperm DNA, followed by washing the filter in a 0.2x SSC solution at approximately 65°C. However, less stringent conditions can also be used. Stringent conditions can be modified by adjusting the formamide concentration (lower formamide concentrations result in lower stringency), salt concentration, and temperature. Low stringency conditions include, for example, incubation overnight at 37°C in a solution containing 6x SSC (20x SSC is 3 mol / L sodium chloride, 0.2 mol / L sodium dihydrogen phosphate, 0.02 mol / L EDTA, pH 7.4), 0.5% SDS, 30% formamide, and 100 μg / L denatured salmon sperm DNA, followed by washing with a 1x SSC, 0.1% SDS solution at 50°C. Even lower stringency conditions include hybridization under the low stringency conditions described above using a solution with a high salt concentration (e.g., 5x SSC), followed by washing.
[0095] The various conditions described above can also be established by adding or changing blocking reagents used to suppress background in hybridization experiments. The addition of blocking reagents described above may be accompanied by changes in hybridization conditions to adapt the conditions.
[0096] Examples of DNA that can hybridize under the above-mentioned stringent conditions include DNA consisting of a base sequence that has at least 80% or more, preferably 90% or more, more preferably 95% or more, even more preferably 98% or more, and particularly preferably 99% or more sequence identity with the base sequence represented by SEQ ID NO: 6, when calculated based on the above parameters using programs such as BLAST and FASTA.
[0097] A conventionally known method can be used to confirm that DNA that hybridizes with the above-mentioned DNA under stringent conditions is DNA that encodes a protein having a predetermined enzymatic activity. For example, a method can be used in which the target protein is expressed by a transformant containing a gene encoding the target protein using Escherichia coli or the like, and the presence or absence of the function of the target protein is determined by measuring the activity or the like using the respective activity measurement method.
[0098] Furthermore, the amino acid sequence and nucleotide sequence of the protein can be identified by conventionally known methods. For example, total RNA is extracted from a growing plant, mRNA is purified as needed, and cDNA is synthesized by reverse transcription. Next, degenerate primers are designed based on the amino acid sequence of a known protein corresponding to the target protein, and RT-PCR is performed to partially amplify DNA fragments and partially identify the sequence. Next, the full-length nucleotide sequence and amino acid sequence are identified by a method such as RACE. The RACE method (Rapid Amplification of cDNA Ends) is a method in which, when the nucleotide sequence of a cDNA is partially known, PCR is performed based on the nucleotide sequence information of the known region to clone the unknown region up to the end of the cDNA. This method allows full-length cDNA to be cloned by PCR without the need to prepare a cDNA library. It is preferable that the degenerate primers are prepared from plant-derived sequences having a sequence site highly common to the target protein. Furthermore, when the nucleotide sequence encoding the protein is known, a primer including a start codon and a primer including a stop codon can be designed from the known nucleotide sequence, and the full-length nucleotide sequence and amino acid sequence can be identified by performing RT-PCR using the synthesized cDNA as a template.
[0099] <<Examples of mutant cis-prenyltransferase (CPT) family proteins>> Specific examples of the mutant CPT family proteins include the following [A-1]. [A-1] Protein consisting of the amino acid sequence represented by SEQ ID NO: 7
[0100] It is also known that proteins may retain their original functions even when they contain one or more amino acid substitutions, deletions, insertions, or additions in their original amino acid sequence. Therefore, specific examples of the mutant CPT family proteins include the following [A-2]. [A-2] A protein consisting of an amino acid sequence represented by SEQ ID NO: 7, which contains one or more amino acid substitutions, deletions, insertions, and / or additions, and which has an enzyme activity that catalyzes a reaction that elongates the chain length of an isoprenoid compound in a cis form.
[0101] In order to maintain the function of the mutant CPT family protein, the amino acid sequence represented by SEQ ID NO: 7 preferably contains substitutions, deletions, insertions, and / or additions of one or more amino acids, more preferably 1 to 54 amino acids, even more preferably 1 to 40 amino acids, even more preferably 1 to 27 amino acids, particularly preferably 1 to 13 amino acids, most preferably 1 to 5 amino acids, and even more preferably 1 to 3 amino acids.
[0102] Conservative substitutions are preferred as examples of amino acid substitutions, and specific examples include substitutions within the following parenthesized groups: (glycine, alanine), (valine, isoleucine, leucine), (aspartic acid, glutamic acid), (asparagine, glutamine), (serine, threonine), (lysine, arginine), (phenylalanine, tyrosine).
[0103] It is also known that proteins with amino acid sequences highly identical to the original amino acid sequence may have similar functions. Therefore, specific examples of the mutant CPT family proteins include the following [A-3]. [A-3] A protein consisting of an amino acid sequence having 80% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 7 and having an enzyme activity that catalyzes a reaction that elongates the chain length of an isoprenoid compound in a cis form.
[0104] In order to maintain the function of the mutant CPT family protein, the sequence identity with the amino acid sequence represented by SEQ ID NO: 7 is preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, particularly preferably 98% or more, and most preferably 99% or more.
[0105] The sequence identity of amino acid sequences or nucleotide sequences can be determined using the algorithms BLAST [Proc. Natl. Acad. Sci. USA, 90, 5873 (1993)] or FASTA [Methods Enzymol., 183, 63 (1990)] by Karlin and Altschul.
[0106] As a method for confirming that the protein has the enzymatic activity, for example, a conventionally known method can be used, and examples thereof include a method in which the target protein is expressed by a transformant using Escherichia coli or the like, into which a gene encoding the target protein has been introduced, and the presence or absence of the function of the target protein is determined by measuring the activity or the like using the respective activity measurement method.
[0107] Specific examples of the gene encoding the mutant CPT family protein include the following [B-1] and [B-2]. [B-1] DNA consisting of the base sequence represented by SEQ ID NO: 8 [B-2] DNA that hybridizes under stringent conditions with DNA consisting of a base sequence complementary to the base sequence represented by SEQ ID NO: 8 and encodes a protein having an enzymatic activity that catalyzes a reaction that elongates the chain length of an isoprenoid compound in cis form.
[0108] "Hybridizing" as used herein refers to the process of hybridizing DNA to DNA having a specific base sequence or to a portion of the DNA. Therefore, the DNA having the specific base sequence or the base sequence of a portion of the DNA may be useful as a probe for Northern or Southern blot analysis, or may be DNA of a length that can be used as an oligonucleotide primer for PCR (Polymerase Chain Reaction) analysis. Examples of DNA used as a probe include DNA of at least 100 bases, preferably at least 200 bases, and more preferably at least 500 bases, but may also be DNA of at least 10 bases, preferably at least 15 bases.
[0109] Methods for DNA hybridization experiments are well known and are described, for example, in Molecular Cloning, 2nd and 3rd editions (2001), Methods for General and Molecular Bacteriology, ASM Press (1994), and Immunology methods manual, Academic Press (Molecular). Hybridization conditions can be determined and experiments can be performed according to many other standard textbooks.
[0110] Examples of stringent conditions include incubating a DNA-immobilized filter and probe DNA overnight at 42°C in a solution containing 50% formamide, 5x SSC (750 mM sodium chloride, 75 mM sodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 μg / L denatured salmon sperm DNA, followed by washing the filter in a 0.2x SSC solution at approximately 65°C. However, less stringent conditions can also be used. Stringent conditions can be modified by adjusting the formamide concentration (lower formamide concentrations result in lower stringency), salt concentration, and temperature. Low stringency conditions include, for example, incubation overnight at 37°C in a solution containing 6x SSC (20x SSC is 3 mol / L sodium chloride, 0.2 mol / L sodium dihydrogen phosphate, 0.02 mol / L EDTA, pH 7.4), 0.5% SDS, 30% formamide, and 100 μg / L denatured salmon sperm DNA, followed by washing with a 1x SSC, 0.1% SDS solution at 50°C. Even lower stringency conditions include hybridization under the low stringency conditions described above using a solution with a high salt concentration (e.g., 5x SSC), followed by washing.
[0111] The various conditions described above can also be established by adding or changing blocking reagents used to suppress background in hybridization experiments. The addition of blocking reagents described above may be accompanied by changes in hybridization conditions to adapt the conditions.
[0112] Examples of DNA that can hybridize under the above-mentioned stringent conditions include DNA consisting of a base sequence that has at least 80% or more, preferably 90% or more, more preferably 95% or more, even more preferably 98% or more, and particularly preferably 99% or more sequence identity with the base sequence represented by SEQ ID NO: 8, when calculated based on the above parameters using programs such as BLAST and FASTA.
[0113] A conventionally known method can be used to confirm that DNA that hybridizes with the above-mentioned DNA under stringent conditions is DNA that encodes a protein having a predetermined enzymatic activity. For example, a method can be used in which the target protein is expressed by a transformant containing a gene encoding the target protein using Escherichia coli or the like, and the presence or absence of the function of the target protein is determined by measuring the activity or the like using the respective activity measurement method.
[0114] Furthermore, the amino acid sequence and nucleotide sequence of the protein can be identified by conventionally known methods. For example, total RNA is extracted from a growing plant, mRNA is purified as needed, and cDNA is synthesized by reverse transcription. Next, degenerate primers are designed based on the amino acid sequence of a known protein corresponding to the target protein, and RT-PCR is performed to partially amplify DNA fragments and partially identify the sequence. Next, the full-length nucleotide sequence and amino acid sequence are identified by a method such as RACE. The RACE method (Rapid Amplification of cDNA Ends) is a method in which, when the nucleotide sequence of a cDNA is partially known, PCR is performed based on the nucleotide sequence information of the known region to clone the unknown region up to the end of the cDNA. This method allows full-length cDNA to be cloned by PCR without the need to prepare a cDNA library. It is preferable that the degenerate primers are prepared from plant-derived sequences having a sequence site highly common to the target protein. Furthermore, when the nucleotide sequence encoding the protein is known, a primer including a start codon and a primer including a stop codon can be designed from the known nucleotide sequence, and the full-length nucleotide sequence and amino acid sequence can be identified by performing RT-PCR using the synthesized cDNA as a template.
[0115] <Method of producing polyisoprenoid> The method for producing polyisoprenoids of the present disclosure is characterized by using a mutant cis-prenyltransferase (CPT) family protein of the present disclosure. The method for producing polyisoprenoids of the present disclosure is not particularly limited as long as it uses a mutant CPT family protein of the present disclosure, but preferably includes a binding step in vitro in which the mutant CPT family protein of the present disclosure is bound to membrane particles (preferably rubber particles). By binding the mutant CPT family protein to membrane particles (preferably rubber particles) in vitro, polyisoprenoids can be synthesized within the membrane particles (preferably rubber particles), making it possible to produce polyisoprenoids with higher molecular weights. This is because the polyisoprenoids produced accumulate inside the membrane particles (preferably rubber particles), making it possible to produce products with longer chain lengths than when the polyisoprenoids are not bound to membrane particles (preferably rubber particles).
[0116] In this specification, polyisoprenoid is a general term for natural products whose basic carbon skeleton is a polymer (cis-1,4-polyisoprene or trans-1,4-polyisoprene) composed of isoprene units (C5H8). Examples of polyisoprenoids include solanesol (C 45 ), undecaprenyl phosphate (C 55 Examples of the polyisoprenoid include polymers such as cellulose, gutta-percha, and rubber. The polyisoprenoid is preferably a cis-polyisoprenoid in which isoprene units are bonded in a cis configuration. In this specification, the term "isoprenoid" refers to a compound having an isoprene unit (C5H8), and is a concept that also includes polyisoprenoids.
[0117] The membrane particles are not particularly limited as long as they have a membrane structure, and examples thereof include biological membranes such as rubber particles and lipid droplets; and artificial membranes such as nanodisks and liposomes. These may be used alone or in combination of two or more. Among these, rubber particles are preferred. In the following, the case where the membrane particles are rubber particles will be described, but the same applies to other membrane particles.
[0118] The manufacturing method of the present disclosure may include other steps in addition to the bonding step, and each step may be performed once or repeatedly multiple times. Furthermore, the amount of mutant CPT family protein that binds to rubber particles is not particularly limited.
[0119] As used herein, "a mutant CPT family protein binds to a rubber particle" means that all or part of the mutant CPT family protein is incorporated into the rubber particle or inserted into the membrane structure of the rubber particle, but is not limited to this and also means that the mutant CPT family protein is localized on the surface or inside of the rubber particle. Furthermore, a complex formed between the protein bound to the rubber particle and the mutant CPT family protein and present as a complex on the rubber particle is also included in the concept of "bound to the rubber particle." The same applies to other membrane particles.
[0120] The origin of the rubber particles is not particularly limited, and may be derived from the latex of rubber-producing plants such as Hevea brasiliensis, Russian taraxacum, guayule, and sowberry.
[0121] The particle size of the rubber particles is not particularly limited, and rubber particles of a predetermined particle size may be separated and used, or a mixture of particles of various particle sizes may be used. Even when rubber particles of a predetermined particle size are separated and used, the rubber particles used may be small rubber particles (SRP) with a small particle size or large rubber particles (LRP) with a large particle size.
[0122] The method for separating rubber particles of the predetermined particle size can be any commonly used method, including, for example, centrifugation, more preferably multi-stage centrifugation. Specifically, the method includes sequentially performing centrifugation at 500 to 1500 × g, 1700 to 2500 × g, 7000 to 9000 × g, 15000 to 25000 × g, and 40000 to 60000 × g. The processing time for each centrifugation step is preferably 20 minutes or more, more preferably 30 minutes or more, and even more preferably 40 minutes or more. On the other hand, the processing time is preferably 120 minutes or less, more preferably 90 minutes or less. The processing temperature for each centrifugation step is preferably 0 to 10°C, more preferably 2 to 8°C, and particularly preferably 4°C.
[0123] In the binding step, the gene encoding the mutant CPT family protein is expressed in vitro, and the protein is bound to rubber particles.
[0124] The gene encoding the mutant CPT family protein is as described above.
[0125] Furthermore, the mutant CPT family protein is a protein in which the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein not present on rubber particles has been mutated so that it is identical to or similar to the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles, and the amino acid sequence of the C-terminal region of the cis-prenyltransferase (CPT) family protein not present on rubber particles has been mutated so that it is identical to or similar to the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles.However, if the origin of the CPT family protein present on the rubber particles is the same as the origin of the rubber particles to be bound to the mutant CPT family protein, the origin of the amino acid sequence of the N-terminal region and / or the origin of the amino acid sequence of the C-terminal region of the mutant CPT family protein will be the same as the origin of the rubber particles to be bound to the mutant CPT family protein, and the binding ability of the mutant CPT family protein to rubber particles can be further enhanced.
[0126] For example, when rubber particles derived from Para rubber tree are used, it is preferable to use a mutant protein in which the N-terminal and / or C-terminal regions of the mutant CPT family protein are replaced with the N-terminal and / or C-terminal regions of a CPT family protein (HRT1) present on rubber particles derived from Para rubber tree; or when rubber particles derived from Russian taraxacum are used, it is preferable to use a mutant protein in which the N-terminal and / or C-terminal regions of the mutant CPT family protein are replaced with the N-terminal and / or C-terminal regions of a CPT family protein present on rubber particles derived from Russian taraxacum.
[0127] In the binding step, other proteins may be bound to the rubber particles as long as the protein obtained by expressing the gene encoding the mutant CPT family protein in vitro is bound to the rubber particles.
[0128] The origin of the other protein is not particularly limited, but is preferably derived from a plant, more preferably derived from a rubber-producing plant, and even more preferably derived from a plant belonging to at least one genus selected from the group consisting of Hevea, Sonchus, Taraxacum, and Parthenium. Of these, it is even more preferable to be derived from at least one plant selected from the group consisting of Hevea brasiliensis, Sonchus oleracea, guayule, and Taraxacum kokkuri, and is particularly preferably derived from Hevea brasiliensis.
[0129] The other proteins are not limited in any way and may be any proteins, but from the viewpoint of the rubber synthesis ability of rubber particles, they are preferably proteins that are originally present on rubber particles in rubber-producing plants. The proteins present on rubber particles may be proteins that largely bind to the membrane surface of rubber particles, proteins that bind so as to be inserted into the membrane of rubber particles, or proteins that form a complex with the membrane-bound protein and become present on the membrane surface.
[0130] Examples of proteins that are originally present on rubber particles in rubber-producing plants include HRT1-REF-BRIDGING PROTEIN (HRBP), Rubber Elongation Factor (REF), Small Rubber Particle Protein (SRPP), β-1,3-glucanase, Hevein, etc. Of these, HRT1-REF-BRIDGING PROTEIN (HRBP) and Rubber Elongation Factor (REF) are preferred, with REF being more preferred.
[0131] The binding step may be carried out by any means that can bind the mutant CPT family protein to rubber particles outside of a living body, and examples of such methods include a method in which protein synthesis is carried out in the presence of rubber particles in a cell-free protein synthesis solution containing mRNA encoding the mutant CPT family protein, and the mutant CPT family protein is then bound to the rubber particles.
[0132] The binding step is preferably a step of synthesizing protein in the presence of rubber particles in a cell-free protein synthesis solution containing mRNA encoding the mutant CPT family protein, thereby binding the mutant CPT family protein to the rubber particles. In other words, it is preferable to obtain rubber particles to which mutant CPT family proteins are bound by performing protein synthesis in the coexistence of rubber particles with a cell-free protein synthesis solution containing mRNA encoding the mutant CPT family protein (more specifically, by mixing rubber particles with a cell-free protein synthesis solution containing mRNA encoding the mutant CPT family protein).
[0133] Protein synthesis carried out in the presence of rubber particles and a cell-free protein synthesis solution containing mRNA encoding the mutant CPT family protein is the synthesis of mutant CPT family proteins using a so-called cell-free protein synthesis method, which allows the synthesis of mutant CPT family proteins that retain biological function (in a native state).By carrying out this cell-free protein synthesis method in the presence of rubber particles, the synthesized mutant CPT family proteins can be bound to the rubber particles in a native state.
[0134] Here, "binding of a mutant CPT family protein to a rubber particle by protein synthesis in the presence of the cell-free protein synthesis solution and rubber particles" means that all or part of each protein of the mutant CPT family protein synthesized by the protein synthesis is incorporated into the rubber particle or inserted into the membrane structure of the rubber particle, but is not limited to this and also means localization on the surface or inside of the rubber particle, etc. Furthermore, the concept of "binding to a rubber particle" also includes the case where a complex is formed with a protein bound to the rubber particle as described above and the complex is present on the rubber particle.
[0135] Each of the mRNAs encoding the mutant CPT family proteins is a translation template that can be translated to synthesize the mutant CPT family protein.
[0136] There are no particular limitations on the method for preparing the mRNA encoding the mutant CPT family protein, as long as it is a translation template that can be translated to synthesize the mutant CPT family protein.
[0137] The cell-free protein synthesis solution may contain mRNA encoding other proteins, so long as it contains mRNA encoding the mutant CPT family protein. The mRNA encoding the other protein can be one that can be translated to express the other protein. Examples of the other protein include the same proteins as those mentioned above.
[0138] In the binding step, cell-free protein synthesis of the mutant CPT family protein is preferably carried out in the presence of rubber particles. This cell-free protein synthesis can be carried out in the same manner as conventional methods using the cell-free protein synthesis solution. The cell-free protein synthesis system used can be any commonly used cell-free protein synthesis system. For example, the Rapid Translation System RTS500 (Roche Diagnostics) or a wheat germ extract and cell-free protein synthesis system prepared according to Proc. Natl. Acad. Sci. USA, 97:559-564 (2000), JP 2000-236896 A, JP 2002-125693 A, and JP 2002-204689 A (JP 2002-204689 A, Proc. Natl. Acad. Sci. USA, 99:14652-14657 (2002)) can be used. Among these, systems using germ extracts are preferred.
[0139] The origin of the germ extract is not particularly limited, but from the viewpoint of translation efficiency, when synthesizing a plant protein by cell-free protein synthesis, it is preferable to use a germ extract derived from a plant, and it is particularly preferable to use a germ extract derived from wheat.
[0140] The method for preparing the germ extract is not particularly limited, and a conventional method for preparing a germ extract can be used, for example, the method described in JP-A-2005-218357.
[0141] The cell-free protein synthesis solution preferably further contains a cyclic nucleoside monophosphate derivative or a salt thereof (hereinafter also referred to simply as an "activity enhancer"). By including the activity enhancer, the protein synthesis activity can be further enhanced.
[0142] The cyclic nucleoside monophosphate derivative or a salt thereof is not particularly limited as long as it can enhance cell-free protein synthesis activity, and examples thereof include adenosine-3',5' cyclic monophosphate and a salt thereof, adenosine-3',5' cyclic thiomonophosphate (Sp isomer) and a salt thereof, adenosine-3',5' cyclic thiomonophosphate (Rp isomer) and a salt thereof, guanosine-3',5' cyclic monophosphate and a salt thereof, guanosine-3',5' cyclic thiomonophosphate (Sp isomer) and a salt thereof, guanosine-3',5' cyclic thiomonophosphate (Rp isomer) and a salt thereof, 8-bromoadenosine-3',5'-cyclic monophosphate (bromo-cAMP) and a salt thereof, and 8-(4-chlorophenylthio)adenosine. adenosine-3',5'-cyclic monophosphate (chlorophenylthio cAMP) and its salts, 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole adenosine-3',5'-cyclic monophosphate (dichlororibofuranosylbenzimidazole cAMP) and its salts, adenosine-2',5' cyclic monophosphate and its salts, adenosine-2',5' cyclic thiomonophosphate (Sp isomer) and its salts, adenosine-2',5' cyclic thiomonophosphate (Rp isomer) and its salts, guanosine-2',5' cyclic monophosphate and its salts, guanosine-2',5' cyclic thiomonophosphate (Sp isomer) and its salts, guanosine-2',5' cyclic thiomonophosphate (Rp isomer) and its salts, and the like.
[0143] The base that forms a salt with the cyclic nucleoside monophosphate derivative is not particularly limited as long as it is biochemically acceptable and forms a salt with the derivative, but preferred examples include alkali metal atoms such as sodium and potassium, and organic bases such as trishydroxyaminomethane.
[0144] Among these activity enhancers, adenosine-3',5' cyclic monophosphate and adenosine-3',5' cyclic monophosphate sodium are particularly preferred. These activity enhancers may be used alone or in combination of two or more.
[0145] The activity enhancer may be added to the cell-free protein synthesis solution in advance, but if it is unstable in the solution, it is preferable to add it when carrying out the protein synthesis reaction in the presence of the cell-free protein synthesis solution and rubber particles.
[0146] The amount of the activity enhancer to be added is not particularly limited, as long as it is a concentration that can activate (increase) the protein synthesis reaction in the cell-free protein synthesis solution. Specifically, the final concentration in the reaction system is usually 0.1 mmol / L or more. The lower limit of the concentration is preferably 0.2 mmol / L, more preferably 0.4 mmol / L, and particularly preferably 0.8 mmol / L. On the other hand, the upper limit of the concentration is preferably 24 mmol / L, more preferably 6.4 mmol / L, and particularly preferably 3.2 mmol / L.
[0147] The temperature of the cell-free protein synthesis solution when the activity enhancer is added to the cell-free protein synthesis solution is not particularly limited, but is preferably 0 to 30°C, more preferably 10 to 26°C.
[0148] The cell-free protein synthesis solution contains, in addition to mRNA (translation template) encoding the mutant CPT family protein, essential components for protein synthesis such as ATP, GTP, creatine phosphate, creatine kinase, L-amino acids, potassium ions, and magnesium ions, and may further contain activity enhancers as necessary. Use of such a cell-free protein synthesis solution can provide a cell-free protein synthesis reaction system. Since the embryo extract prepared by the method described in JP 2005-218357 A contains the amount of tRNA required for the protein synthesis reaction, when the embryo extract prepared by this method is used in a cell-free protein synthesis solution, it is not essential to add separately prepared tRNA. In other words, tRNA can be added to the cell-free protein synthesis solution as needed.
[0149] The binding step is preferably carried out by synthesizing the protein in the presence of rubber particles in a cell-free protein synthesis solution containing mRNA encoding the mutant CPT family protein. Specifically, the binding step can be carried out by adding rubber particles to the cell-free protein synthesis solution at an appropriate time before or after protein synthesis, preferably before protein synthesis. Furthermore, the concentration of rubber particles coexisting with the cell-free protein synthesis solution is preferably 5 to 50 g / L. That is, it is preferable to coexist 5 to 50 g of rubber particles per 1 L of cell-free protein synthesis solution. If the concentration of rubber particles coexisting with the cell-free protein synthesis solution is less than 5 g / L, a rubber layer may not be formed when performing a separation process such as ultracentrifugation to recover the rubber particles to which the synthesized mutant CPT family protein is bound, making it difficult to recover the rubber particles to which the synthesized mutant CPT family protein is bound. On the other hand, if the concentration of rubber particles coexisting with the cell-free protein synthesis solution exceeds 50 g / L, the rubber particles may aggregate, preventing the synthesized mutant CPT family protein from binding properly to the rubber particles. The concentration of the rubber particles is more preferably 10 to 40 g / L, even more preferably 15 to 35 g / L, and particularly preferably 15 to 30 g / L.
[0150] Furthermore, in protein synthesis in the coexistence of the cell-free protein synthesis solution and rubber particles, rubber particles may be added as appropriate as the reaction progresses. It is preferable that the cell-free protein synthesis solution and rubber particles coexist for as long as the cell-free protein synthesis system is active, for example, for 3 to 48 hours (preferably 3 to 30 hours, more preferably 3 to 24 hours) after adding the rubber particles to the cell-free protein synthesis solution.
[0151] The rubber particles do not need to be subjected to any special treatment, such as pretreatment, before being used in the binding step (more preferably, before being allowed to coexist with the cell-free protein synthesis solution). However, to increase the proportion of the mutant CPT family protein to be bound among the proteins present on the rubber particles, some protein may be removed from the rubber particles in advance using a surfactant. In this case, it is preferable that the rubber synthesis activity of the rubber particles after removal remains at least 50% of that before removal.
[0152] The surfactant is not particularly limited, and examples thereof include nonionic surfactants and amphoteric surfactants. Among these, nonionic surfactants and amphoteric surfactants are preferably used, and amphoteric surfactants are particularly preferably used, because they have little effect on denaturing proteins on the membrane. In other words, one preferred embodiment of the first present disclosure is one in which the surfactant is an amphoteric surfactant. These surfactants may be used alone or in combination of two or more.
[0153] Examples of the nonionic surfactant include polyoxyalkylene ether-based, polyoxyalkylene ester-based, polyhydric alcohol fatty acid ester-based, sugar fatty acid ester-based, alkyl polyglycoside-based, and polyoxyalkylene polyglucoside-based nonionic surfactants, as well as polyoxyalkylene alkylamines and alkyl alkanolamides. Among these, polyoxyalkylene ether-based nonionic surfactants and polyhydric alcohol fatty acid ester-based nonionic surfactants are preferred.
[0154] Examples of the polyoxyalkylene ether-based nonionic surfactants include polyoxyalkylene alkyl ethers, polyoxyalkylene alkylphenyl ethers, polyoxyalkylene polyol alkyl ethers, and polyoxyalkylene mono-, di-, or tristyrylphenyl ethers. Among these, polyoxyalkylene alkylphenyl ethers are preferably used. The polyol is preferably a polyhydric alcohol having 2 to 12 carbon atoms, such as ethylene glycol, propylene glycol, glycerin, sorbitol, glucose, sucrose, pentaerythritol, and sorbitan.
[0155] Examples of the polyoxyalkylene ester-based nonionic surfactant include polyoxyalkylene fatty acid esters and polyoxyalkylene alkyl rosinate esters. Examples of the polyhydric alcohol fatty acid ester-based nonionic surfactants include fatty acid esters of polyhydric alcohols having 2 to 12 carbon atoms and fatty acid esters of polyoxyalkylene polyhydric alcohols. More specific examples include sorbitol fatty acid esters, sorbitan fatty acid esters, glycerin fatty acid esters, polyglycerin fatty acid esters, and pentaerythritol fatty acid esters. Polyalkylene oxide adducts of these surfactants (e.g., polyoxyalkylene sorbitan fatty acid esters, polyoxyalkylene glycerin fatty acid esters, etc.) can also be used. Among these, sorbitan fatty acid esters are preferably used. Examples of the sugar fatty acid ester-based nonionic surfactants include fatty acid esters of sucrose, glucose, maltose, fructose, and polysaccharides, and polyalkylene oxide adducts thereof can also be used. Examples of the alkyl polyglycoside nonionic surfactant include glycosides such as glucose, maltose, fructose, and sucrose, such as alkyl glucosides, alkyl polyglucosides, polyoxyalkylene alkyl glucosides, and polyoxyalkylene alkyl polyglucosides, as well as fatty acid esters of these. Polyalkylene oxide adducts of all of these can also be used.
[0156] Examples of the alkyl group in these nonionic surfactants include linear or branched, saturated or unsaturated alkyl groups having 4 to 30 carbon atoms. Examples of the polyoxyalkylene group include those having alkylene groups having 2 to 4 carbon atoms, such as those having an added mole number of ethylene oxide of about 1 to 50. Examples of the fatty acid include linear or branched, saturated or unsaturated fatty acids having 4 to 30 carbon atoms.
[0157] Among the nonionic surfactants, polyoxyethylene ethylene (10) octylphenyl ether (Triton X-100) and sorbitan monolaurate (Span 20) are particularly preferred because they can stabilize the rubber particle membrane, minimize protein denaturation, and adequately remove membrane-bound proteins.
[0158] Examples of the amphoteric surfactant include zwitterionic surfactants such as quaternary ammonium base / sulfonic acid group (-SO3H) type, quaternary ammonium base / phosphate group type (soluble in water), quaternary ammonium base / phosphate group type (insoluble in water), and quaternary ammonium base / carboxyl group type. The acid group may be a salt. In particular, it is preferable that the zwitterionic surfactant has both positive and negative charges in one molecule, and the acid dissociation constant (pKa) of the acid group is preferably 5 or less, more preferably 4 or less, and even more preferably 3 or less.
[0159] Specific examples of the amphoteric surfactant include 3-[(3-cholamidopropyl)dimethylamino]-2-hydroxy-1-propanesulfonic acid (CHAPSO), 3-[(3-cholamidopropyl)dimethylamino]-propanesulfonic acid (CHAPS), N,N-bis(3-D-gluconamidopropyl)-cholamide, n-octadecyl-N,N'-dimethyl-3-amino-1-propanesulfonic acid, n-decyl-N,N'-dimethyl-3-amino-1-propanesulfonic acid, n-dodecyl-N,N'-dimethyl-3-amino-1-propanesulfonic acid, and n-tetradecyl-N,N'-dimethyl-3-amino-1-propanesulfonic acid {Zwittergent™-3-14}. ammonium sulfobetaines such as n-hexadecyl-N,N'-dimethyl-3-amino-1-propanesulfonic acid and n-octadecyl-N,N'-dimethyl-3-amino-1-propanesulfonic acid, phosphocholines such as n-octylphosphocholine, n-nonylphosphocholine, n-decylphosphocholine, n-dodecylphosphocholine, n-tetradecylphosphocholine and n-hexadecylphosphocholine, and phosphatidylcholines such as dilauroylphosphatidylcholine, dimyristoylphosphatidylcholine, dipalmitoylphosphatidylcholine, distearoylphosphatidylcholine, dioleoylphosphatidylcholine and dilinoleoylphosphatidylcholine. Among these, 3-[(3-cholamidopropyl)dimethylamino]-propanesulfonic acid (CHAPS) is particularly preferred because it can adequately remove proteins while stabilizing the membrane of the rubber particles.
[0160] The treatment concentration of the surfactant is preferably within 3 times the critical micelle concentration (CMC) of the surfactant used. Treatment with a surfactant at a concentration exceeding 3 times the critical micelle concentration may result in a decrease in the film stability of the rubber particles. The concentration is more preferably within 2.5 times, and even more preferably within 2.0 times. The lower limit is preferably 0.05 times or more, more preferably 0.1 times or more, and even more preferably 0.3 times or more.
[0161] Examples of reaction systems or devices for protein synthesis in the cell-free protein synthesis include a batch method (Pratt, J. Met al., Transcription and Translation, Hames, 179-209, B.D. & Higgins, S.J., eds., IRL Press, Oxford (1984)), a continuous cell-free protein synthesis system in which amino acids, energy sources, etc. are continuously supplied to a reaction system (Spirin, A.S. et al., Science, 242, 1162-1164 (1988)), a dialysis method (Kikawa et al., 21st Meeting of the Molecular Biology Society of Japan, WID6), and a bilayer method (PROTEIOS TM Examples include the Wheat germ cell-free protein synthesis core kit (Instruction Manual: manufactured by TOYOBO). Other methods that can be used include supplying template RNA, amino acids, energy sources, etc. to the protein synthesis reaction system as needed, and discharging synthesized or decomposed products as needed.
[0162] Among these, the layering method has the advantage of being easy to operate, but the rubber particles tend to disperse in the reaction solution, making it difficult to efficiently bind the synthesized mutant CPT family protein to the rubber particles. In contrast, the dialysis method is preferable because the amino acids that serve as the raw materials for the synthesized mutant CPT family protein can pass through the dialysis membrane but the rubber particles cannot, preventing the rubber particles from dispersing and allowing the synthesized mutant CPT family protein to efficiently bind to the rubber particles.
[0163] The dialysis method is a method of performing protein synthesis using an apparatus in which the synthesis reaction solution of the protein synthesis in the cell-free protein synthesis is used as the internal dialysis solution and is separated from the external dialysis solution by a dialysis membrane capable of mass transfer. Specifically, for example, the synthesis reaction solution from which the translation template has been removed is pre-incubated for an appropriate period of time as necessary, and then the translation template is added and the mixture is placed in a suitable dialysis container to form the internal reaction solution. Examples of dialysis containers include containers with a dialysis membrane attached to the bottom (e.g., Dialysis Cup 12,000 manufactured by Daiichi Kagaku Co., Ltd.) and dialysis tubes (e.g., 12,000 manufactured by Sanko Junyaku Co., Ltd.). Dialysis membranes with a molecular weight limit of 10,000 daltons or more are used, with those with a molecular weight limit of about 12,000 daltons being preferred.
[0164] The dialysis external solution used is a buffer containing an amino acid. The dialysis external solution can be replaced with a fresh one when the reaction rate slows down, thereby increasing the dialysis efficiency. The reaction temperature and time are appropriately selected depending on the protein synthesis system used. For example, in a system using a wheat germ extract, the reaction can be carried out typically at 10 to 40°C, preferably 18 to 30°C, and more preferably 20 to 26°C, for 10 minutes to 48 hours (preferably 10 minutes to 30 hours, and more preferably 10 minutes to 24 hours).
[0165] Furthermore, since the mRNA encoding the mutant CPT family protein contained in the cell-free protein synthesis solution is easily degraded, protein synthesis can be carried out more efficiently by appropriately adding the mRNA during the protein synthesis reaction. Note that the addition time, number of additions, amount of addition, etc. of the mRNA are not particularly limited and can be set appropriately.
[0166] In the first manufacturing method of the present disclosure, a binding step is performed in vitro to bind a protein obtained by expressing a gene encoding a mutant CPT family protein to rubber particles, and then, if necessary, a step of recovering the rubber particles may be performed.
[0167] The rubber particle recovery step is not particularly limited as long as it can recover rubber particles, and can be performed by a commonly used method for recovering rubber particles. Specific examples include a method using centrifugation. When recovering rubber particles by centrifugation, the centrifugal force, centrifugation time, and centrifugation temperature can be appropriately set so as to recover the rubber particles. For example, the centrifugal force of the centrifugation is preferably 15,000 × g or more, more preferably 20,000 × g or more, and even more preferably 25,000 × g or more. On the other hand, if the centrifugal force is too high, a commensurate separation effect cannot be expected. Therefore, the upper limit of the centrifugal force is preferably 50,000 × g or less, more preferably 45,000 × g or less. The centrifugation time is preferably 20 minutes or more, more preferably 30 minutes or more, and even more preferably 40 minutes or more. On the other hand, if the centrifugation time is too long, a commensurate separation effect cannot be expected. Therefore, the upper limit of the centrifugation time is preferably 120 minutes or less, more preferably 90 minutes or less. The temperature for the centrifugation treatment is preferably 0 to 10°C, more preferably 2 to 8°C, and particularly preferably 4°C, from the viewpoint of maintaining the protein activity of the mutant CPT family protein bound to the rubber particles.
[0168] For example, when cell-free protein synthesis is performed, the centrifugation process separates the rubber particles into an upper layer and the cell-free protein synthesis solution into a lower layer. The lower layer, the cell-free protein synthesis solution, can then be removed to recover the rubber particles to which the mutant CPT family protein is bound. The recovered rubber particles can be stored by resuspending them in an appropriate buffer solution with a neutral pH.
[0169] The rubber particles recovered after the rubber particle recovery step can be used in the same way as ordinary natural rubber without any further special treatment.
[0170] Furthermore, the polyisoprenoid obtained by the first method for producing a polyisoprenoid according to the present disclosure can be recovered by subjecting the rubber particles to the following solidification step.
[0171] In the solidification step, the solidification method is not particularly limited, and examples thereof include a method of adding rubber particles to a solvent that does not dissolve polyisoprenoids, such as ethanol, methanol, or acetone, or a method of adding an acid to rubber particles. By performing the solidification step, rubber (a type of polyisoprenoid) can be recovered as a solid from the rubber particles. The obtained rubber can be dried as needed before use.
[0172] Thus, according to the first aspect of the present disclosure, polyisoprenoids can be synthesized in rubber particles by expressing a gene encoding a mutant CPT family protein in vitro and binding the protein to rubber particles, making it possible to efficiently produce high molecular weight polyisoprenoids in a reaction vessel (test tube, plant, etc.).
[0173] (Rubber product manufacturing method) The method for producing a rubber product according to the first disclosure includes a step of producing a polyisoprenoid by the method for producing a polyisoprenoid according to the first disclosure, a kneading step of kneading the polyisoprenoid obtained with additives to obtain a kneaded mixture, a raw rubber product molding step of molding the kneaded mixture into a raw rubber product, and a vulcanization step of vulcanizing the raw rubber product.
[0174] The rubber product is not particularly limited as long as it can be produced using rubber (preferably natural rubber), and examples include pneumatic tires, rubber rollers, rubber fenders, gloves, and medical rubber tubes.
[0175] When the rubber product is a pneumatic tire, i.e., when the rubber product manufacturing method of the first present disclosure is the pneumatic tire manufacturing method of the first present disclosure, the raw rubber product molding step corresponds to a raw tire molding step of molding a raw tire from the kneaded mixture, and the vulcanization step corresponds to a vulcanization step of vulcanizing the raw tire. That is, the pneumatic tire manufacturing method of the first present disclosure is a pneumatic tire manufacturing method including a step of manufacturing a polyisoprenoid by the polyisoprenoid manufacturing method, a kneading step of kneading the obtained polyisoprenoid with additives to obtain a kneaded mixture, a raw tire molding step of molding a raw tire from the kneaded mixture, and a vulcanization step of vulcanizing the raw tire.
[0176] <Kneading process> In the kneading step, the polyisoprenoid obtained by the method for producing polyisoprenoid is kneaded with additives to obtain a kneaded mixture.
[0177] The additives are not particularly limited, and additives used in the production of rubber products can be used. For example, when the rubber product is a pneumatic tire, examples of the additives include rubber components other than the polyisoprenoid, reinforcing fillers such as carbon black, silica, calcium carbonate, alumina, clay, and talc, silane coupling agents, zinc oxide, stearic acid, processing aids, various antioxidants, softeners such as oil, wax, vulcanizing agents such as sulfur, and vulcanization accelerators.
[0178] The kneading in the kneading step may be carried out using a rubber kneading machine such as an open roll, a Banbury mixer, or an internal kneader.
[0179] <Raw rubber product molding process (raw tire molding process in the case of tires)> In the raw rubber product molding process, a raw rubber product (a raw tire in the case of a tire) is molded from the kneaded material obtained in the kneading process. The method for molding the raw rubber product is not particularly limited, and any method commonly used for molding raw rubber products may be applied as appropriate. For example, when the rubber product is a pneumatic tire, the kneaded product obtained in the kneading step may be extruded to match the shapes of the respective tire components, molded in a conventional manner on a tire building machine, and the respective tire components may be bonded together to form a raw tire (unvulcanized tire).
[0180] <Vulcanization process> In the vulcanization step, the raw rubber product obtained in the raw rubber product molding step is vulcanized to obtain a rubber product. The method for vulcanizing the raw rubber product is not particularly limited, and any method commonly used for vulcanizing raw rubber products may be applied as appropriate. For example, when the rubber product is a pneumatic tire, the raw tire (unvulcanized tire) obtained in the raw rubber product molding step is vulcanized by heating and pressurizing it in a vulcanizer to obtain a pneumatic tire.
[0181] (Second Disclosure) (vector) A second vector of the present disclosure is a vector containing a gene encoding a mutant cis-prenyltransferase (CPT) family protein of the present disclosure. By introducing such a vector into a plant to perform transformation, the gene encoding the mutant CPT family protein contained in the vector is expressed, enabling the plant to produce polyisoprenoids with higher molecular weights than before genetic modification.
[0182] The vector preferably contains a promoter used for protein expression in plants and a gene encoding the mutant CPT family protein operably linked to the promoter, thereby enabling more efficient expression of the gene encoding the mutant CPT family protein in plants. Here, in this specification, operably linking a gene to a promoter means linking the gene sequence downstream of the promoter so that it is under the control of the promoter.
[0183] The promoter used for protein expression in plants is not particularly limited as long as it functions in plant cells, and examples include the cauliflower mosaic virus (CaMV) 35S promoter, rice actin 1 promoter, nopaline synthase gene promoter, tobacco mosaic virus 35S promoter, rice-derived actin gene promoter, and ubiquitin promoter.
[0184] More preferably, the vector comprises a promoter having promoter activity that drives mammary duct-specific gene expression, and a gene encoding the mutant CPT family protein operably linked to the promoter. By introducing such a vector into a plant to perform transformation, the gene encoding the mutant CPT family protein contained in the vector is expressed in a mammary duct-specific manner, making it possible to more effectively produce high-molecular-weight polyisoprenoids in the plant compared to before genetic modification.
[0185] In this specification, a promoter having promoter activity that induces mammary duct-specific gene expression means that when a desired gene is functionally linked to the promoter and introduced into a plant, the promoter has the activity of regulating gene expression so that the desired gene is specifically expressed in the mammary duct. Here, mammary duct-specific gene expression means that the gene is not expressed at all or almost not at all in parts of the plant other than the mammary duct, and is expressed substantially exclusively in the mammary duct.
[0186] The vector of the second disclosure can be prepared, for example, by inserting, into a vector generally known as a plant transformation vector, the nucleotide sequence of a promoter having promoter activity that induces duct-specific gene expression and the nucleotide sequence of a gene encoding a mutant CPT family protein by a conventionally known method. Examples of vectors that can be used to prepare the vector of the second disclosure include pBI-based vectors, binary vectors such as pGA482, pGAH, and pBIG, intermediate plasmids such as pLGV23Neo, pNCAT, and pMON200, and pH35GS containing a GATEWAY cassette.
[0187] The vector of the second disclosure may contain other nucleotide sequences in addition to the promoter nucleotide sequence, as long as it contains the nucleotide sequence of the gene encoding the mutant CPT family protein. In addition to these nucleotide sequences, a vector usually contains vector-derived sequences, including restriction enzyme recognition sequences, spacer sequences, marker gene sequences, and reporter gene sequences.
[0188] Examples of the marker gene include drug resistance genes such as a kanamycin resistance gene, a hygromycin resistance gene, and a bleomycin resistance gene. The reporter gene is introduced to confirm the expression site in the plant body, and examples of the reporter gene include a luciferase gene, a GUS (β-glucuronidase) gene, GFP (green fluorescent protein), and RFP (red fluorescent protein).
[0189] The gene encoding the mutant CPT family protein is as described above in the first aspect of the present disclosure.
[0190] The promoter having promoter activity for expressing a gene specifically in the mammary duct is preferably at least one selected from the group consisting of a promoter for the gene encoding Rubber Elongation Factor (REF), a promoter for the gene encoding Small Rubber Particle Protein (SRPP), a promoter for the gene encoding Hevein2.1 (HEV2.1), and a promoter for the gene encoding MYC1 transcription factor (MYC1).
[0191] In this specification, Rubber Elongation Factor (REF) refers to a rubber particle-binding protein that binds to rubber particles present in the latex of rubber-producing plants such as the rubber tree (Hevea brasiliensis), and contributes to the stabilization of rubber particles. Small Rubber Particle Protein (SRPP) is a rubber particle-binding protein that binds to rubber particles present in the latex of rubber-producing plants such as the rubber tree (Hevea brasiliensis). Hevein 2.1 (HEV2.1) is a protein that is highly expressed in the lactiferous duct cells of rubber-producing plants such as the rubber tree (Hevea brasiliensis). It is involved in the aggregation of rubber particles and has antifungal activity. Furthermore, MYC1 transcription factor (MYC1) is a transcription factor involved in jasmonic acid signaling that is highly expressed in the latex of rubber-producing plants such as Hevea brasiliensis. Here, transcription factor refers to a protein that has the activity of increasing or decreasing (preferably increasing) the transcription level of a gene. In other words, as used herein, MYC1 refers to a protein that has the activity (transcription factor activity) of increasing or decreasing (preferably increasing) the transcription level of a gene encoding at least one protein involved in jasmonic acid signaling.
[0192] By introducing the vector of the second disclosure (a vector containing a gene encoding the mutant CPT family protein) into a plant, a transformed plant can be obtained that is transformed to express the mutant CPT family protein involved in polyisoprenoid biosynthesis. In the transformed plant, the mutant CPT family protein involved in polyisoprenoid biosynthesis is expressed, thereby enhancing the functions of the protein, such as a specific enzymatic activity, within the plant into which the vector of the second disclosure has been introduced, thereby enabling the plant to more effectively produce high-molecular-weight polyisoprenoids than before the genetic modification.
[0193] Next, a method for producing the transformed plant will be briefly explained. Such a transformed plant can be produced by a conventionally known method.
[0194] The plant into which the vector of the second disclosure of the present disclosure is introduced to produce the transformed plant is not particularly limited, but rubber-producing plants are preferred because expressing a mutant CPT family protein in a plant capable of polyisoprenoid biosynthesis is particularly expected to produce high-molecular-weight polyisoprenoids. Among these, plants belonging to the genus Hevea or Taraxacum are preferred, with Hevea brasiliensis or Taraxacum koksaghyz being more preferred.
[0195] The vector of the second disclosure can be introduced into plants (including plant cells such as callus, cultured cells, spheroplasts, and protoplasts) using any method for introducing DNA into plant cells, such as a method using Agrobacterium (Japanese Patent Laid-Open Nos. 59-140885, 60-70080, and WO 94 / 00977), electroporation (Japanese Patent Laid-Open No. 60-251887), or a method using a particle gun (gene gun) (Japanese Patent Nos. 2606856 and 2517813). Among these, the method using Agrobacterium (the Agrobacterium method) is preferred for introducing the vector of the second disclosure into plants to produce transformed plants (transformed plant cells). Furthermore, it is also possible to produce cis-isoprenoids and polyisoprenoids by introducing the vector of the second disclosure into organisms, parts of organisms, organs, tissues, cultured cells, spheroplasts, protoplasts, etc., such as microorganisms, yeast, animal cells, and insect cells, using the DNA introduction method described above.
[0196] The transformed plant (transformed plant cell) can be obtained by the above-mentioned method. The term "transformed plant" encompasses not only the transformed plant cell obtained by the above-mentioned method, but also its progeny or clones, and further all progeny plants obtained by subcultivating them. Once a transformed plant cell into which the vector of the second present disclosure has been introduced is obtained, it is possible to obtain progeny or clones from the transformed plant cell by sexual reproduction, asexual reproduction, tissue culture, cell culture, cell fusion, or the like. Furthermore, it is also possible to obtain propagation materials (e.g., seeds, fruits, cuttings, tubers, tuberous roots, stumps, adventitious buds, adventitious embryos, callus, protoplasts, etc.) from the transformed plant cell or its progeny or clone, and then mass-produce the transformed plant based on these.
[0197] Methods for regenerating plants (transformed plants) from transformed plant cells include, for example, the method of Doi et al. (Japanese Patent Application No. 11-127025) for eucalyptus, the method of Fujimura et al. (Fujimura et al. (1995), Plant Tissue Culture Lett., vol. 2: p. 74-) for rice, the method of Shillito et al. (Shillito et al. (1989), Bio / Technology, vol. 7: p. 581-) for maize, the method of Visser et al. (Visser et al. (1989), Theor. Appl. Genet., vol. 78: p. 589-) for potato, and the method of Akama et al. (Akama et al. (1992), Plant Cell Rep., vol. 12: p. 7-) for Arabidopsis. Those skilled in the art will be able to regenerate plants from transformed plant cells by referring to these methods.
[0198] In the regenerated plant, expression of the gene for the protein of interest can be confirmed by well-known techniques, for example, by Western blot analysis.
[0199] For example, a method for obtaining seeds from the transformed plant includes rooting the transformed plant in a suitable medium and transplanting the rooted plant into a pot containing moist soil. The plant is grown under suitable cultivation conditions, and finally, seeds are formed to obtain the seeds. For example, a method for obtaining plants from seeds includes sowing the seeds derived from the transformed plant obtained as described above in moist soil and growing them under suitable cultivation conditions to obtain plants.
[0200] In the second disclosure, by introducing the vector of the second disclosure into a plant, the gene encoding the mutant CPT family protein involved in polyisoprenoid biosynthesis contained in the vector is expressed, enabling the plant to produce polyisoprenoids with higher molecular weights than before genetic modification. Specifically, high-molecular-weight cis-isoprenoids and polyisoprenoids can be produced by culturing the transformed plant cells obtained by the above-mentioned method, callus obtained from the transformed plant cells, cells redifferentiated from the callus, etc. in an appropriate medium, or by growing the transformed plant redifferentiated from the transformed plant cells, plants obtained from seeds obtained from the transformed plant, etc. under appropriate cultivation conditions.
[0201] (Rubber product manufacturing method) The method for producing a rubber product according to the second disclosure includes a step of producing a polyisoprenoid using a transformed plant obtained by introducing the vector according to the second disclosure into a plant, a kneading step of kneading the obtained polyisoprenoid with additives to obtain a kneaded mixture, a raw rubber product molding step of molding the kneaded mixture into a raw rubber product, and a vulcanization step of vulcanizing the raw rubber product.
[0202] The rubber products are the same as those described above in the first aspect of this disclosure.
[0203] When the rubber product is a pneumatic tire, i.e., when the method for producing a rubber product according to the second present disclosure is the method for producing a pneumatic tire according to the second present disclosure, the raw rubber product molding step corresponds to a raw tire molding step of molding a raw tire from the kneaded mixture, and the vulcanization step corresponds to a vulcanization step of vulcanizing the raw tire. In other words, the method for producing a pneumatic tire according to the second present disclosure is a method for producing a pneumatic tire including: a step of producing a polyisoprenoid using a transformed plant obtained by introducing the vector according to the second present disclosure into a plant; a kneading step of kneading the obtained polyisoprenoid with additives to obtain a kneaded mixture; a raw tire molding step of molding a raw tire from the kneaded mixture; and a vulcanization step of vulcanizing the raw tire.
[0204] <Kneading process> In the kneading step, a polyisoprenoid obtained from a transformed plant obtained by introducing the vector of the second present disclosure into a plant is kneaded with an additive to obtain a kneaded mixture.
[0205] The polyisoprenoid obtained from the transformed plant obtained by introducing the vector of the second present disclosure into a plant can be obtained by collecting latex from the transformed plant and subjecting the collected latex to the following solidification step. The method for collecting latex from the transformed plant is not particularly limited, and any commonly used method can be adopted. For example, latex can be collected by tapping the trunk of the plant after wounding it, by cutting a part of the transformed plant such as the roots and collecting the latex that exudes from the cut part, or by crushing the cut tissue and extracting it using an organic solvent.
[0206] <Solidification process> The collected latex is subjected to a solidification step. The solidification method is not particularly limited, and examples thereof include a method of adding the latex to a solvent that does not dissolve polyisoprenoids, such as ethanol, methanol, or acetone, or a method of adding an acid to the latex. By carrying out the solidification step, rubber (a type of polyisoprenoid) can be recovered as a solid content from the latex. The obtained rubber can be dried as needed before use.
[0207] The additives are not particularly limited, and additives used in the production of rubber products can be used. For example, when the rubber product is a pneumatic tire, examples of the additives include rubber components other than the rubber obtained from the latex, reinforcing fillers such as carbon black, silica, calcium carbonate, alumina, clay, and talc, silane coupling agents, zinc oxide, stearic acid, processing aids, various antioxidants, softeners such as oil, wax, vulcanizing agents such as sulfur, and vulcanization accelerators.
[0208] The kneading in the kneading step may be carried out using a rubber kneading machine such as an open roll, a Banbury mixer, or an internal kneader.
[0209] <Raw rubber product molding process (raw tire molding process in the case of tires)> The raw rubber product molding process is the same as the process described above in the first aspect of this disclosure.
[0210] <Vulcanization process> The vulcanization process is similar to that described above in the first aspect of this disclosure. [Example]
[0211] The present disclosure will be specifically described based on examples, but the present disclosure is not limited to these examples.
[0212] First, an outline of the examples and comparative examples will be described. Example 1: Assay on rubber particles using AtCPT5-both terminal (N-terminal and C-terminal) HRT1 forms Comparative Example 1: Assay on rubber particles using AtCPT5 Comparative Example 2: Assay on rubber particles using AtCPT5-N-terminal HRT1 type In Example 1 and Comparative Examples 1 and 2, the product chain lengths of both terminal mutants of CPT that do not interact with NgBR family proteins were compared with those of the N-terminal mutant and normal form. Here, AtCPT5 corresponds to a CPT family protein that is not present on rubber particles, and HRT1 corresponds to a CPT family protein that is present on rubber particles. Furthermore, the sequence of the AtCPT5-N-terminal HRT1 type protein was identified, and the full-length nucleotide sequence and amino acid sequence were identified (SEQ ID NOs: 11 and 12).
[0213] (Acquisition of each gene) (1) HRT1 gene [Total RNA extraction from Hevea latex] Total RNA was extracted from Hevea brasiliensis latex using the hot phenol method. 6 mL of 100 mM sodium acetate buffer, 1 mL of 10% SDS solution, and 12 mL of water-saturated phenol preheated to 65°C were added to 6 mL of latex. After 5 minutes of incubation at 65°C, the mixture was vortexed and centrifuged at room temperature for 10 minutes at 7000 rpm. After centrifugation, the supernatant was transferred to a new tube, and 12 mL of a phenol:chloroform (1:1) solution was added. The mixture was then shaken for 2 minutes. After stirring, the mixture was centrifuged again at room temperature for 10 minutes at 7000 rpm. The supernatant was then transferred to a new tube, and 12 mL of a chloroform:isoamyl alcohol (24:1) solution was added. The mixture was then shaken for 2 minutes. After mixing, the mixture was centrifuged again at 7,000 rpm at room temperature for 10 minutes. The supernatant was transferred to a new tube, and 1.2 mL of 3 M sodium acetate solution and 13 mL of isopropanol were added and vortexed. The mixture was incubated at -20°C for 30 minutes to precipitate total RNA. After incubation, the mixture was centrifuged at 15,000 rpm at 4°C for 10 minutes, and the supernatant was removed to recover the total RNA precipitate. The recovered total RNA was washed twice with 70% ethanol and then dissolved in RNase-free water.
[0214] [Synthesis of cDNA from total RNA] cDNA was synthesized from the recovered total RNA according to the instructions for the PrimeScript II 1st strand cDNA Synthesis Kit (Takara). [Isolation of the HRT1 gene from cDNA] The HRT1 gene was isolated using the first-strand cDNA as a template. PCR was performed using a KOD-plus-Neo (TOYOBO) kit according to the manufacturer's instructions. 35 cycles of PCR were performed, each cycle consisting of 98°C for 10 seconds, 58°C for 30 seconds, and 68°C for 1 minute. The HRT1 gene was obtained using the following primers: Primer 1: 5'- ttggatccgatggaattatacaacggtgagagg-3' Primer 2: 5'- ttgcggccgcttattttaagtattccttatgtttctcc-3' was used. The HRT1 gene was obtained by the above-mentioned method. The sequence of the obtained gene was identified, and the full-length nucleotide sequence and amino acid sequence were determined.
[0215] [Obtaining REF genes from cDNA] Primer 3: 5'- tttctcgagatggctgaagacgaagac -3' Primer 4: 5'- tttggatcctcaattctctccataaaac-3' was used. The REF gene was obtained by the above-mentioned method. The sequence of the obtained gene was identified, and the full-length nucleotide sequence and amino acid sequence were identified (SEQ ID NOs: 9 and 10).
[0216] [Vector construction] The obtained DNA fragment was subjected to dA addition, and then inserted into pGEM-T Easy Vector using pGEM-T Easy Vector System (Promega) to prepare pGEM-HRT1, pGEM-HRBP, and pGEM-REF.
[0217] [Transformation of E. coli] The vector thus prepared was used to transform Escherichia coli DH5α, and the transformants were cultured on LB agar medium containing ampicillin and X-gal. E. coli into which the target gene had been introduced were selected by blue / white screening.
[0218] [Plasmid extraction] E. coli transformed with a plasmid containing the target gene was cultured overnight at 37°C in LB liquid medium, and then the cells were harvested and the plasmid was recovered. The plasmid was recovered using the Fast Gene Plasmid Mini Kit (Nihon Genetics). Sequence analysis confirmed that the base sequence of the gene inserted into the recovered plasmid was free of mutations.
[0219] (2) AtCPT5 gene The full-length cDNA of AtCPT5 (At5g58780) was provided by the RIKEN BioResource Center through the National Bio-Resource Project (resource number: RAFL06-16-E16).
[0220] (Creation of mutant genes) [Preparation of each fragment] The PCR fragments used to generate the mutant genes were generated by PCR using the following primers. PCR was performed using a KOD-plus-Neo (TOYOBO) kit according to the manufacturer's instructions. PCR was performed 35 times, with one cycle consisting of 98°C for 10 seconds, 58°C for 30 seconds, and 68°C for 1 minute.
[0221] AtCPT5 N-terminal missing (217-909) Primer 5: FW 5'-TCCCATCCCTACTCATGTGGCAGTG-3' Primer 6: Rv 5'-TACAGGTTTTCCTCGAGTCAAACCCGACAGCCAA-3'
[0222] HRT1 N-terminal only (1-102) for AtCPT5 fusion Primer 7: Fw 5'-ACATCACCAAGATATCATGGAATTATACAACGGTGAGAGG-3' Primer 8: Rv 5'-CACTGCCACATGAGTAGGGATGGGA-3'
[0223] AtCPT5 (217-834) Primer 9: Fw 5'-TCCCATCCCTACTCATGTGGCAGTG-3' Primer 10: Rv 5'-GTCGAAGACCAATATCAGGCCAAAGG-3'
[0224] HRT1 C-terminus only (787-873) for AtCPT5 fusion Primer 11: Fw 5'-CCTTTGGCCTGATATTGGTCTTCGAC-3' Primer 12: Rv 5'-TACAGGTTTTCCTCGAGTTATTTTAAG-3'
[0225] The PCR product was electrophoresed on a 2.0% agarose gel, and bands of the desired size were gel-collected using the FastGene™ Gel / PCR Extraction Kit (Nippon Genetics). Chimeric sequences were generated by overlap extension PCR using the resulting PCR product as a template. PCR was performed for 30 cycles, each cycle consisting of 94°C for 2 minutes, 98°C for 10 seconds, 55°C for 30 seconds, and 68°C for 30 seconds.
[0226] AtCPT5 without N-terminus + HRT1 N-terminus only Primer 13: Fw 5'-ACATCACCAAGATATCATGGAATTATACAACGGTGAGAGG-3' Primer 14: Rv 5'-TACAGGTTTTCCTCGAGTCAAACCCGACAGCCAA-3'
[0227] AtCPT5 (both termini absent) + HRT1 (N terminus only) + HRT1 (C terminus only) Primer 15: Fw 5'-ACATCACCAAGATATCATGGAATTATACAACGGTGAGAGG-3' Primer 16: Rv 5'-TACAGGTTTTCCTCGAGTTATTTTAAG-3'
[0228] The resulting PCR product was recovered from a 0.8% agarose gel, dA-attached using 10x A-attachment mix (TOYOBO), and ligated into pGEM-T EASY Vector (Promega). This product was transformed into E. coli DH5α, plated onto LB agar medium (+50 μg / mL Amp, + 5% (w / v) X-gal 20 μL, + 100 mM IPTG 25 μL), and cultured overnight at 37°C for blue-white determination. Several white colonies were selected and cultured overnight at 37°C with shaking in 4 mL of LB liquid medium (+50 μg / mL Amp). The plasmid was recovered using the FastGene™ Plasmid Mini Kit (Nippon Genetics). Insertion was confirmed by digestion with EcoRI (NEB) for 20 minutes. The PCR-amplified sequence was sequenced to confirm the absence of mutations.
[0229] (Construction of mutant expression vectors) The cell-free expression vector pEU-E01-MCS-TEV-His-C1 was digested with the restriction enzymes EcoRV and KpnI and purified by gel collection. The SLiCE solution used in the SLiCE reaction was prepared as follows. 0.3-0.4 g of cultured E. coli DH5α was gently suspended in 1.2 mL of 50 mM Tris-HCl (pH 8.0) containing 3% Triton X-100 and incubated at room temperature for 10 minutes. After incubation, the suspension was centrifuged at 4°C and 20,000 x g for 2 minutes, and the supernatant was collected. An equal volume of 80% glycerol solution was added to the collected supernatant to prepare the SLiCE solution. The SLiCE solution was divided into aliquots and stored at -80°C until use.
[0230] [PCR] AtCPT5 full length Primer 17: Fw 5'-ACATCACCAAGATATCATGTTGTCTATTCTCTCTTCTCTTTTATCT-3' Primer 18: Rv 5'-TGATTGGCCGAGGCGGCCTCAAACCCGACAGCCAA-3'
[0231] AtCPT5-N-terminal HRT1 Primer 19: Fw 5'-ACATCACCAAGATATCATGGAATTATACAACGGTGAGAGG-3' Primer 20: Rv 5'-TACAGGTTTTCCTCGAGTCAAACCCGACAGCCAA-3'
[0232] AtCPT5-HRT1 Primer 21: Fw 5'-ACATCACCAAGATATCATGGAATTATACAACGGTGAGAGG-3' Primer 22: Rv 5'-TACAGGTTTTCCTCGAGTTATTTTAAG-3'
[0233] The resulting PCR fragment and the restriction enzyme-treated vector were mixed in a ratio of 1:1 to 3:1, and 10x SLiCE Buffer (500 μM Tris-HCl (pH 7.5), 100 mM MgCl2, 10 mM ATP, 10 mM DTT) was added in an amount of 1 / 10 of the final volume of the reaction system, and SLiCE solution was added in an amount of 1 / 10 of the final volume of the reaction system. The reaction was carried out at 37°C for 15 minutes to produce pEU-AtCPT5 (Comparative Example 1), pEU-AtCPT-N-terminal HRT1 (Comparative Example 2), and pEU-AtCPT5-both-terminal HRT1 (Example 1).
[0234] [Transformation of E. coli] Escherichia coli DH5α was transformed using the prepared vector, and the transformants were cultured on LB agar medium containing ampicillin and X-gal, and Escherichia coli into which the target gene had been introduced were selected by colony PCR.
[0235] [Plasmid extraction] E. coli transformed with a plasmid containing the target gene was cultured overnight at 37°C in LB liquid medium, and the cells were then harvested and the plasmid was isolated using the Fast Gene Plasmid Mini Kit (Nippon Genetics).
[0236] (Construction of REF expression vector) pGEM-REF was treated with restriction enzymes XhoI and BamHI, and then inserted into the cell-free expression vector pEUE01-MCS-TEV-His-C1, which had also been treated with restriction enzymes XhoI and BamHI, to prepare pEU-C1-REF.
[0237] [Transformation of E. coli] Escherichia coli DH5α was transformed using the prepared vector, and the transformants were cultured on LB agar medium containing ampicillin and X-gal, and Escherichia coli into which the target gene had been introduced were selected by colony PCR.
[0238] [Plasmid extraction] E. coli transformed with a plasmid containing the target gene was cultured overnight at 37°C in LB liquid medium, and the cells were then harvested and the plasmid was isolated using the Fast Gene Plasmid Mini Kit (Nippon Genetics).
[0239] (Enzyme Assay) [Preparation of rubber particles] Rubber particles were prepared from Hevea latex by five-stage centrifugation. A latex solution was prepared by adding 100 mL of 1 M Tris buffer (pH 7.5) containing 20 mM dithiothreitol (DTT) to 900 mL of Hevea latex. The resulting latex solution was centrifuged at different speeds: 1000 × g, 2000 × g, 8000 × g, 20,000 × g, and 50,000 × g. All centrifugation was performed at 4°C for 45 minutes. After centrifugation at 50,000 × g, 3-[(3-cholamidopropyl)dimethylamino]propanesulfonic acid (CHAPS) was added to the rubber particle layer to a final concentration of 0.1–2.0 × CMC (0.1–2.0 times the critical micelle concentration CMC) to wash the rubber particles. After washing, the washed rubber particles were collected by ultracentrifugation (40,000×g, 4° C., 45 minutes) and resuspended in an equal volume of 100 M Tris buffer (pH 7.5) containing 2 mM dithiothreitol (DTT).
[0240] [Cell-free protein synthesis reaction (STEP1 mRNA transcription reaction)] Cell-free protein synthesis was carried out using the WEPRO7240H Expression kit (Cell Free Sciences, Inc.). Using the vector obtained in the above section "Preparation of vector for cell-free protein synthesis" as a template, mRNA transcription reaction was carried out according to the WEPRO7240H Expression kit protocol.
[0241] [mRNA purification] After the transcription reaction, the resulting mRNA was purified by ethanol precipitation.
[0242] [Cell-free protein synthesis reaction (STEP 2: Protein synthesis by dialysis)] The following amounts were added to a dialysis cup (MWCO 12000) (Bio-Teck). A reaction solution was prepared in a total volume of 60 μL according to the WEPRO7240H Expression kit protocol. 1-2 mg of rubber particles were added to the reaction solution. Furthermore, 650 μL of SUB-AMIX was added to PP container No. 2 (Maruem container). The dialysis cup was placed in PP container No. 2, and the protein synthesis reaction was initiated at 26°C. After the start of the reaction, mRNA was added twice and the dialysis solution (SUB-AMIX) was replaced. The reaction was continued for 24 hours.
[0243] [Recovery of rubber particles after reaction] The solution in the dialysis cup was transferred to a new 1.5 μL tube, and the reacted rubber particles were recovered by ultracentrifugation (40,000 × g, 4 °C, 45 min) and resuspended in an equal volume of 100 M Tris buffer (pH 7.5) containing 2 mM dithiothreitol (DTT).
[0244] [Measurement of rubber synthesis activity of rubber particles after reaction] The rubber synthesis activity of the recovered rubber particles after the reaction was measured by the following method. First, a reaction solution (total 100 μL) was prepared by mixing 50 mM Tris-HCl (pH 7.5), 2 mM DTT, 5 mM MgCl, 15 μM dimethylallyl diphosphate (DMAPP), 100 μM 1-C isopentenyl diphosphate ([1-C]IPP) (specific activity: 5 Ci / mol), and 10 μL of rubber particle solution, and the mixture was allowed to react at 30°C for 16 hours. After the reaction, 200 μL of saturated NaCl was added, and isopentenol and other components were extracted with 1 mL of diethyl ether. Next, the aqueous polyprenyl diphosphate was extracted with 1 mL of saline-saturated BuOH. The very long-chain polyisoprenoid (rubber) in the aqueous phase was then extracted with 1 mL of toluene / hexane (1:1), and radioactivity was measured. The radioactivity in each layer was measured as 14C counts using a liquid scintillation counter. Higher radioactivity (dpm) indicates greater production of very long-chain polyisoprenoid (rubber) and higher rubber synthesis activity.
[0245] [Molecular weight distribution measurement of synthesized ultra-long chain polyisoprenoids] The molecular weight distribution of the synthesized ultra-long chain polyisoprenoid (rubber) was measured by Radio HPLC under the following conditions. The results are shown in Figure 2. HPLC system: GILSON Columns: TOSOH TSKguardcolumn MP (XL), TSKgel Multipore HXL-M (2 columns) Column temperature: 40℃ Solvent: THF manufactured by Merck Flow rate: 1ml / min UV detection: 215 nm RI detection: Ramona Star (Raytest GmbH)
[0246] (Test results) [Comparative Examples 1 and 2 and Example 1] The results are shown in Figure 2. As can be seen from Figure 2, when the molecular weight distribution was confirmed by GPC, it was found that the molecular weight of the product had increased.
[0247] The experimental results demonstrated that a mutant cis-prenyltransferase (CPT) family protein in which the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein not present on rubber particles is mutated so that it is identical to or similar to the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles, and the amino acid sequence of the C-terminal region of the cis-prenyltransferase (CPT) family protein not present on rubber particles is mutated so that it is identical to or similar to the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles, is capable of producing polyisoprenoids with a higher molecular weight than the cis-prenyltransferase (CPT) family protein before the mutation, and that a method for producing polyisoprenoids using the mutant cis-prenyltransferase (CPT) family protein enables the production of polyisoprenoids with a higher molecular weight than when the cis-prenyltransferase (CPT) family protein before the mutation is used.
[0248] Therefore, it was found that by introducing a vector containing a gene encoding the mutant cis-prenyltransferase (CPT) family protein of the first disclosure into a plant, the gene encoding the mutant cis-prenyltransferase (CPT) family protein of the first disclosure contained in the vector is expressed, making it possible to produce higher molecular weight polyisoprenoids in the plant compared to before genetic modification.
[0249] The present disclosure (1) relates to a mutant cis-prenyltransferase (CPT) family protein in which the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein not present on rubber particles is mutated so that it is identical to or similar to the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles, and the amino acid sequence of the C-terminal region of the cis-prenyltransferase (CPT) family protein not present on rubber particles is mutated so that it is identical to or similar to the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles.
[0250] Disclosure (2) is a mutant cis-prenyltransferase (CPT) family protein according to Disclosure (1), in which the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein not present on rubber particles is replaced with an amino acid sequence identical or similar to the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles, and the amino acid sequence of the C-terminal region of the cis-prenyltransferase (CPT) family protein not present on rubber particles is replaced with an amino acid sequence identical or similar to the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles.
[0251] The present disclosure (3) is a mutant cis-prenyltransferase (CPT) family protein according to the present disclosure (1) or (2), wherein the cis-prenyltransferase (CPT) family protein present on rubber particles is a cis-prenyltransferase (CPT) family protein present on rubber particles derived from a plant belonging to the genus Hevea or Taraxacum.
[0252] The present disclosure (4) is a mutant cis-prenyltransferase (CPT) family protein according to the present disclosure (1) or (2), wherein the cis-prenyltransferase (CPT) family protein present on rubber particles is a cis-prenyltransferase (CPT) family protein present on rubber particles derived from Hevea brasiliensis or Taraxacum koksaghyz.
[0253] The present disclosure (5) is a mutant cis-prenyltransferase (CPT) family protein according to any one of the present disclosures (1) to (4), wherein the amino acid sequence of the N-terminal region of the cis-prenyltransferase (CPT) family protein not present on the rubber particle is an amino acid sequence that includes the N-terminus within the section from the N-terminus of the protein to the first β-strand that constitutes the β-sheet, and the amino acid sequence of the C-terminal region of the cis-prenyltransferase (CPT) family protein not present on the rubber particle is an amino acid sequence that includes the C-terminus of the protein within 50 amino acids upstream from the C-terminus.
[0254] The present disclosure (6) is a method for producing a polyisoprenoid, characterized by using a mutant cis-prenyltransferase (CPT) family protein according to any one of the present disclosures (1) to (5).
[0255] The present disclosure (7) is a method for producing a polyisoprenoid described in the present disclosure (6), which includes a binding step of binding a mutant cis-prenyltransferase (CPT) family protein described in any one of the present disclosures (1) to (5) to a membrane particle in vitro.
[0256] The present disclosure (8) is a method for producing a pneumatic tire, including a step of producing a polyisoprenoid by the method for producing a polyisoprenoid described in the present disclosure (6) or (7), a kneading step of kneading the obtained polyisoprenoid with additives to obtain a kneaded mixture, a raw tire molding step of molding a raw tire from the kneaded mixture, and a vulcanization step of vulcanizing the raw tire.
[0257] The present disclosure (9) is a method for producing a rubber product, including a step of producing a polyisoprenoid by the method for producing a polyisoprenoid described in the present disclosure (6) or (7), a kneading step of kneading the obtained polyisoprenoid with additives to obtain a kneaded mixture, a raw rubber product molding step of molding the kneaded mixture into a raw rubber product, and a vulcanization step of vulcanizing the raw rubber product.
[0258] The present disclosure (10) is a vector containing a gene encoding the mutant cis-prenyltransferase (CPT) family protein according to any one of the present disclosures (1) to (5).
[0259] The present disclosure (11) is a vector according to the present disclosure (10), which comprises a promoter used for protein expression in plants and a gene encoding a mutant cis-prenyltransferase (CPT) family protein operably linked to the promoter.
[0260] The present disclosure (12) is a vector according to the present disclosure (10), which comprises a promoter having promoter activity that induces mammary duct-specific gene expression, and a gene encoding a mutant cis-prenyltransferase (CPT) family protein operably linked to the promoter.
[0261] The present disclosure (13) is a transformed plant into which the vector according to any one of the present disclosures (10) to (12) has been introduced.
[0262] The present disclosure (14) is a method for producing a polyisoprenoid in a plant by introducing the vector according to any one of the present disclosures (10) to (12) into the plant.
[0263] The present disclosure (15) is a method for producing a pneumatic tire, including a step of producing a polyisoprenoid using a transformed plant obtained by introducing the vector according to any one of the present disclosures (10) to (12) into a plant, a kneading step of kneading the obtained polyisoprenoid with an additive to obtain a kneaded mixture, a raw tire forming step of forming a raw tire from the kneaded mixture, and a vulcanization step of vulcanizing the raw tire.
[0264] The present disclosure (16) is a method for producing a rubber product, including a step of producing a polyisoprenoid using a transformed plant obtained by introducing the vector according to any one of the present disclosures (10) to (12) into a plant, a kneading step of kneading the obtained polyisoprenoid with additives to obtain a kneaded mixture, a raw rubber product molding step of molding the kneaded mixture into a raw rubber product, and a vulcanization step of vulcanizing the raw rubber product.
[0265] (Sequence listing free text) SEQ ID NO: 1: Amino acid sequence of HRT1 from Hevea brasiliensis SEQ ID NO: 2: Nucleotide sequence of the gene encoding HRT1 derived from Hevea brasiliensis SEQ ID NO: 3: Amino acid sequence of AtCPT5 from Arabidopsis thaliana SEQ ID NO: 4: Amino acid sequence of HbCPT5 from Hevea brasiliensis SEQ ID NO: 5: Nucleotide sequence of the gene encoding AtCPT5 derived from Arabidopsis thaliana SEQ ID NO: 6: Nucleotide sequence of the gene encoding HbCPT5 derived from Hevea brasiliensis SEQ ID NO: 7: Amino acid sequence of AtCPT5-HRT1 SEQ ID NO: 8: Nucleotide sequence of the gene encoding AtCPT5-HRT1 SEQ ID NO: 9: Nucleotide sequence of the gene encoding REF from Hevea brasiliensis SEQ ID NO: 10: Amino acid sequence of REF from Hevea brasiliensis SEQ ID NO: 11: Nucleotide sequence of the gene encoding AtCPT5-N-terminal HRT1 SEQ ID NO: 12: Amino acid sequence of AtCPT5-N-terminal HRT1 SEQ ID NO: 13: Primer 1 SEQ ID NO: 14: Primer 2 SEQ ID NO: 15: Primer 3 SEQ ID NO: 16: Primer 4 SEQ ID NO: 17: Primer 5 SEQ ID NO: 18: Primer 6 SEQ ID NO: 19: Primer 7 SEQ ID NO: 20: Primer 8 SEQ ID NO: 21: Primer 9 SEQ ID NO: 22: Primer 10 SEQ ID NO: 23: Primer 11 SEQ ID NO: 24: Primer 12 SEQ ID NO: 25: Primer 13 SEQ ID NO: 26: Primer 14 SEQ ID NO: 27: Primer 15 SEQ ID NO: 28: Primer 16 SEQ ID NO: 29: Primer 17 SEQ ID NO: 30: Primer 18 SEQ ID NO: 31: Primer 19 SEQ ID NO: 32: Primer 20 SEQ ID NO: 33: Primer 21 SEQ ID NO: 34: Primer 22
Claims
1. mutating the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein not present on rubber particles to an amino acid sequence identical to or similar to the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein present on rubber particles; mutating the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein not present on the rubber particle to an amino acid sequence identical to or similar to the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein present on the rubber particle; The amino acid sequence similar to the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein present on a rubber particle is an amino acid sequence that has 90% or more sequence identity with the same amino acid sequence as the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein present on a rubber particle and is capable of being present on a rubber particle, The amino acid sequence similar to the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein present on a rubber particle is an amino acid sequence that has 90% or more sequence identity with the same amino acid sequence as the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein present on a rubber particle and is capable of being present on a rubber particle, the cis-prenyltransferase (CPT) family protein present on the rubber particles is a cis-prenyltransferase (CPT) family protein present on rubber particles derived from Para rubber tree, Russian dandelion, or guayule; the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein not present on the rubber particle is an amino acid sequence including the N-terminus of the protein within a section from the N-terminus to the first β-strand constituting the β-sheet, the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein not present on the rubber particle is an amino acid sequence including a C-terminus that is 50 amino acids upstream from the C-terminus of the protein, the N-terminal region of a cis-prenyltransferase (CPT) family protein present on a rubber particle is a section from the N-terminus of the protein to the first β-strand constituting the β-sheet, A mutant cis-prenyltransferase (CPT) family protein present on a rubber particle, wherein the C-terminal region of the cis-prenyltransferase (CPT) family protein is 50 amino acids upstream from the C-terminus of the protein.
2. The amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein not present on the rubber particle is replaced with an amino acid sequence identical to or similar to the amino acid sequence of the N-terminal region of a cis-prenyltransferase (CPT) family protein present on the rubber particle; A mutant cis-prenyltransferase (CPT) family protein according to claim 1, in which the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein not present on the rubber particle is replaced with an amino acid sequence identical to or similar to the amino acid sequence of the C-terminal region of a cis-prenyltransferase (CPT) family protein present on the rubber particle.
3. A mutant cis-prenyltransferase (CPT) family protein according to claim 1 or 2, wherein the cis-prenyltransferase (CPT) family protein present on the rubber particles is a cis-prenyltransferase (CPT) family protein present on rubber particles derived from Para rubber tree or Russian dandelion.
4. A method for producing a polyisoprenoid, comprising using the mutant cis-prenyltransferase (CPT) family protein according to any one of claims 1 to 3.
5. The method for producing the polyisoprenoid according to claim 4, comprising a binding step of binding the mutant cis-prenyltransferase (CPT) family protein according to any one of claims 1 to 3 to membrane particles in vitro.
6. 6. A method for producing a pneumatic tire, comprising: a step of producing a polyisoprenoid by the method for producing a polyisoprenoid according to claim 4 or 5; a kneading step of kneading the resulting polyisoprenoid with additives to obtain a kneaded mixture; a raw tire molding step of molding a raw tire from the kneaded mixture; and a vulcanization step of vulcanizing the raw tire.
7. 6. A method for producing a rubber product, comprising: a step of producing a polyisoprenoid by the method for producing a polyisoprenoid according to claim 4 or 5; a kneading step of kneading the obtained polyisoprenoid with additives to obtain a kneaded mixture; a raw rubber product molding step of molding a raw rubber product from the kneaded mixture; and a vulcanization step of vulcanizing the raw rubber product.
8. A vector comprising a gene encoding the mutant cis-prenyltransferase (CPT) family protein according to any one of claims 1 to 3.
9. 9. The vector according to claim 8, comprising a promoter used for protein expression in plants and a gene encoding a mutant cis-prenyltransferase (CPT) family protein operably linked to the promoter.
10. The vector according to claim 8, comprising a promoter having promoter activity that induces mammary duct-specific gene expression, and a gene encoding a mutant cis-prenyltransferase (CPT) family protein functionally linked to the promoter.
11. A transformed plant into which the vector according to any one of claims 8 to 10 has been introduced.
12. A method for producing a polyisoprenoid in a plant by introducing the vector according to any one of claims 8 to 10 into the plant.
13. A method for producing a pneumatic tire, comprising: a step of producing a polyisoprenoid from a transformed plant obtained by introducing the vector according to any one of claims 8 to 10 into a plant; a kneading step of kneading the obtained polyisoprenoid with additives to obtain a kneaded mixture; a raw tire molding step of molding a raw tire from the kneaded mixture; and a vulcanization step of vulcanizing the raw tire.
14. A method for producing a rubber product, comprising: a step of producing a polyisoprenoid using a transformed plant obtained by introducing the vector according to any one of claims 8 to 10 into a plant; a kneading step of kneading the obtained polyisoprenoid with additives to obtain a kneaded mixture; a raw rubber product molding step of molding a raw rubber product from the kneaded mixture; and a vulcanization step of vulcanizing the raw rubber product.
Citation Information
Patent Citations
Truncated sophora flavescens isopentenyl transferase and application thereof
CN113388594A
Chimeric terpene synthase and application thereof
CN113480660A
Method for producing polyisoprenoid, transformed plant, method for producing pneumatic tire, and method for producing rubber product
JP2017012058A
Chimeric isoprenoid synthases and uses thereof
US20040078840A1
Fusion proteins useful for modifying terpenes
US20210292797A1