Markers of pulmonary hypertension

AHR and associated gene clusters are used as markers for PH and PAH, enabling diagnostic indicators and screening for effective treatment or prevention substances.

JP7802359B2Active Publication Date: 2026-01-20NAT CEREBRAL & CARDIOVASCULAR CENT
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2022500269
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-02-10
Filing Date
2021-01-12
Publication Date
2026-01-20
Estimated Expiration
2041-01-12

AI Technical Summary

Technical Problem

Current methods lack effective markers for identifying the presence, likelihood, and severity of pulmonary hypertension (PH) and pulmonary arterial hypertension (PAH), as well as efficient screening for candidate substances for treatment or prevention.

Method used

Identification of the aryl hydrocarbon receptor (AHR) gene and associated gene clusters (AHRR, CYP1A1, CYP1B1, NQO1, CCL3, EGR1, EGR2, PTGS2, SEMA6B, GSTM1, IFI44L, SIGLEC1, MYZAP, S100B) as markers for PH and PAH, along with methods to detect gene expression or activity for diagnostic purposes and screening candidate substances.

Benefits of technology

AHR and associated genes serve as diagnostic indicators for PH and PAH, allowing for severity assessment and identifying effective treatment or prevention candidates.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007802359000005
    Figure 0007802359000005
  • Figure 0007802359000006
    Figure 0007802359000006
  • Figure 0007802359000007
    Figure 0007802359000007
Patent Text Reader

Abstract

The purpose of the present invention is to identify a marker gene which can be used as an indicator of the severity of pulmonary hypertension (PH). The present disclosure relates to a use of a gene for aryl hydrocarbon receptor (AHR) or AHR as a marker for PH. The present invention also relates to a method for detecting the marker as an indicator of the severity of PH or an indicator for determining whether a subject is suffering from PH or has the potential to be affected by PH in the future in a specimen isolated from the subject. The present invention also relates to a method for screening for a candidate substance that may be effective for the treatment and / or prevention of PH among from test substances. The present invention also relates to a method for producing a disease model animal of PH.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present disclosure relates to markers for pulmonary hypertension or pulmonary arterial hypertension. The present disclosure also relates to markers for pulmonary arterial hypertension. The present disclosure relates to the use of certain genes as markers for pulmonary hypertension or pulmonary arterial hypertension. The present disclosure relates to a method for detecting specific genes as indicators for assessing the severity of pulmonary hypertension. The present disclosure relates to methods for detecting specific genes as an indicator of a subject suffering from or likely to suffer from pulmonary hypertension or pulmonary arterial hypertension. The present disclosure relates to a method for screening test substances for candidate substances that may be effective in treating and / or preventing pulmonary hypertension or pulmonary arterial hypertension. The present disclosure relates to kits for diagnosing pulmonary hypertension or pulmonary arterial hypertension. The present disclosure relates to a method for producing a pathological model animal of pulmonary hypertension. [Background technology]

[0002] Pulmonary hypertension (PH) is a group of progressive diseases with poor prognosis that result from elevated pulmonary arterial blood pressure, leading to cardiac and pulmonary dysfunction. According to the Nice Classification, PH is classified into three groups: Group 1: pulmonary arterial hypertension (PAH); Group 1': pulmonary veno-occlusive disease (PVOD) and / or pulmonary capillary hemangiomatosis (PCH); Group 1'': persistent pulmonary hypertension of the newborn; Group 2: pulmonary hypertension associated with left heart disease; Group 3: pulmonary hypertension associated with lung disease and / or hypoxemia; Group 4: chronic thromboembolic pulmonary hypertension (CTEPH); and Group 5: pulmonary hypertension associated with an unknown multifactorial mechanism.

[0003] Among PH, PAH is a disease characterized by inflammation primarily in the peripheral pulmonary arteries (small arteries or arterioles), accompanied by pathological changes such as muscularization, neointimal proliferation, and plexiform lesions (Non-Patent Documents 1 and 2). The etiology of PAH is complex and is likely caused by a combination of various factors, such as genetic background, epigenetic modifiers, pre-existing diseases, and environmental factors (Non-Patent Document 3). Among these, inflammation and autoimmune diseases are thought to contribute significantly to the pathogenesis of PAH (Non-Patent Documents 4 and 5).

[0004] The aryl hydrocarbon receptor (AHR) is a nuclear receptor activated by environmental or internal chemicals (e.g., tryptophan derivatives) and plays an important role in drug metabolism, including the detoxification of harmful substances, as well as in regulating immune responses and maintaining cellular homeostasis (Non-Patent Documents 6, 7). In experimental autoimmune encephalomyelitis (EAE) and multiple sclerosis (MS) mouse models, AHR activation promotes the generation of Th17 cells. Meanwhile, in ulcerative colitis (UC), AHR activation has been reported to activate type 3 innate lymphoid cells (ILC3s) and improve disease remission. The traditional Chinese medicine, Qingdai (Chinese daisy), contains the potent AHR agonist indirubin and is used to treat refractory UC. Oral administration of Seidai has been shown to improve clinical symptoms in 81% of UC patients, but some patients have been reported to develop pulmonary hypertension as a side effect (Non-patent documents 8-11).

[0005] Among animal models, the SU5416-hypoxia (SuHx) rat model is widely used and can accurately reproduce the major characteristics of human PH, including markedly elevated pulmonary artery pressure and pathological changes such as neointimal proliferation and plexiform lesions (Non-Patent Documents 12, 13). The mechanism of PH in this model has been attributed to the inhibitory effect of SU5416 on VEGFR2 (Non-Patent Documents 12, 13). However, the 50% inhibitory concentration (IC50) of SU5416 on VEGFR2 is low, at the μM level (Non-Patent Document 14). On the other hand, SU5416 potently activates the AHR, reportedly acting both in vivo and in vivo at nM-level concentrations (Non-Patent Document 15). [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Humbert M, Sitbon O, Simonneau G. Treatment of pulmonary arterial hypertension. The New England journal of medicine 2004;351:1425-36. [Non-patent document 2] Rabinovitch M. Molecular pathogenesis of pulmonary arterial hypertension. The Journal of clinical investigation 2012;122:4306-13. [Non-patent document 3] Humbert M, Guignabert C, Bonnet S, et al. Pathology and pathobiology of pulmonary hypertension: state of the art and research perspectives. The European respiratory journal 2019;53. [Non-patent document 4] Hashimoto-Kataoka T, Hosen N, Sonobe T, et al. Interleukin-6 / interleukin-21 signaling axis is critical in the pathogenesis of pulmonary arterial hypertension. Proceedings of the National Academy of Sciences of the United States of America 2015;112:E2677-86. [Non-Patent Document 5] Schermuly RT, Ghofrani HA, Wilkins MR, Grimminger F. Mechanisms of disease: pulmonary arterial hypertension. Nature reviews Cardiology 2011;8:443-55. [Non-patent document 6] Rothhammer V, Quintana FJ. The aryl hydrocarbon receptor: anenvironmental sensor integrating immune responses in health and disease. Naturereviews Immunology 2019;19:184-97. [Non-Patent Document 7] Stockinger B, Di Meglio P, Gialitakis M, Duarte JH. The aryl hydrocarbon receptor: multitasking in the immune system. Annual review of immunology 2014;32:403-32. [Non-patent document 8] Misumi K, Ogo T, Ueda J, et al. Development of Pulmonary Arterial Hypertension in a Patient Treated with Qing-Dai (Chinese Herbal Medicine). Internal medicine 2019;58:395-9.

Outdoor Tools9

Outdoor Tools 10

Outdoor Content11

Outdoor Tools 12

Non-Patent Document 13

Non-Patent Document 14

Non-Patent Document 15

[0007] An object of the present disclosure is to identify marker genes that serve as indicators of the presence or absence of PH, the likelihood of future onset, or the severity of PH, and to provide a method for screening for candidate substances useful as pharmaceuticals for the treatment or prevention of PH based on the marker genes. Another object of the present disclosure is to identify marker genes that serve as indicators of the presence or absence of PAH, the likelihood of future onset, or the severity of PAH, and to provide a method for screening for candidate substances useful as pharmaceuticals for the treatment or prevention of PAH based on the marker genes. [Means for solving the problem]

[0008] Based on the findings described above as background art, the present inventors hypothesized that AHR activation is the cause of PH in the SuHx rat model and in humans.

[0009] We found that subcutaneous administration of 6-Formylindolo (3,2-b) carbazole (FICZ), an endogenous AHR ligand, to wild-type rats under hypoxic conditions similar to those observed in the SuHx rat model resulted in the development of severe PH accompanied by pathological changes such as intimal lesions. Furthermore, AHR KO rats generated using the CRISPR-Cas9 system did not exhibit elevated pulmonary arterial pressure or pathological intimal lesions in the pulmonary arteries compared with vehicle-only controls in the SuHx rat model. Furthermore, we found that AHR activity (AHR transcriptional activity) was higher in human PAH patients compared with healthy controls, and that the more severe the PAH, the higher the circulating AHR activity in human PAH patients. These results suggest that inhibition of AHR signaling, including downstream molecules, may be applicable to the treatment of PH.

[0010] Furthermore, RNA sequencing analysis of peripheral blood mononuclear cells (PBMCs) from PAH patients and SuHx rats revealed increased expression of several common genes in both groups, and these genes are thought to be potential new biomarkers for PAH.

[0011] The present disclosure has been completed through further investigation based on these findings. That is, the present disclosure exemplifies the following embodiments. [1] A marker for pulmonary hypertension, comprising an aryl hydrocarbon receptor gene or an aryl hydrocarbon receptor. [2] The pulmonary hypertension marker according to [1], wherein the pulmonary hypertension is pulmonary arterial hypertension. [3] Use of the aryl hydrocarbon receptor gene or aryl hydrocarbon receptor as a marker for pulmonary arterial hypertension. [4] The use described in [3], wherein the pulmonary hypertension is pulmonary arterial hypertension. [5] A method comprising detecting gene expression or activity of an aryl hydrocarbon receptor in a sample isolated from a subject as an indicator for assessing the severity of pulmonary hypertension in the subject. [6] The method according to [5], wherein the pulmonary hypertension is pulmonary arterial hypertension. [7] A method comprising detecting gene expression or activity of the aryl hydrocarbon receptor in a sample isolated from a subject as an indicator that the subject has or may have pulmonary hypertension in the future. [8] The method according to [7], wherein the pulmonary hypertension is pulmonary arterial hypertension. [9] A kit for diagnosing pulmonary hypertension, comprising: A kit comprising a reagent for measuring gene expression or activity of an aryl hydrocarbon receptor.

[10] A kit according to [9] for assessing the severity of pulmonary hypertension.

[11] The kit according to [9] or

[10] , wherein the pulmonary hypertension is pulmonary arterial hypertension.

[12] A method for producing a pathological model animal of pulmonary hypertension, comprising: Administration of aryl hydrocarbon receptor agonists (excluding SU5416) to non-human animals A method comprising:

[13] The method for producing a pulmonary hypertension according to

[12] , wherein the pulmonary hypertension is pulmonary arterial hypertension.

[14] The first gene group includes AHRR, CYP1A1, CYP1B1, and NQO1; a second group of genes including AHRR, CCL3, EGR1, EGR2, PTGS2, and SEMA6B; A third gene cluster including GSTM1, IFI44L, and SIGLEC1; and The fourth gene cluster includes MYZAP and S100B A marker for pulmonary arterial hypertension, comprising one or more genes selected from the above or a protein produced by the expression of said one or more genes.

[15] The first gene group includes AHRR, CYP1A1, CYP1B1, and NQO1; a second group of genes including AHRR, CCL3, EGR1, EGR2, PTGS2, and SEMA6B; A third gene cluster including GSTM1, IFI44L, and SIGLEC1; and The fourth gene cluster includes MYZAP and S100B Use of one or more genes selected from the above or proteins produced by expression of said one or more genes as a marker for pulmonary arterial hypertension.

[16] in a sample isolated from a subject as an indicator of the subject having or likely to have pulmonary arterial hypertension. The first gene group includes AHRR, CYP1A1, CYP1B1, and NQO1; a second group of genes including AHRR, CCL3, EGR1, EGR2, PTGS2, and SEMA6B; A third gene cluster including GSTM1, IFI44L, and SIGLEC1; and The fourth gene cluster includes MYZAP and S100B or the activity of a protein produced by the expression of said one or more genes selected from the above.

[17] As an index for assessing the severity of pulmonary arterial hypertension in a subject, in a sample isolated from the subject, The first gene group includes AHRR, CYP1A1, CYP1B1, and NQO1; a second group of genes including AHRR, CCCL3, EGR1, EGR2, PTGS2, and SEMA6B; A third gene cluster including GSTM1, IFI44L, and SIGLEC1; and The fourth gene cluster includes MYZAP and S100B or the activity of a protein produced by the expression of said one or more genes selected from the above.

[18] A method for screening test substances for candidate substances that may be effective in treating and / or preventing pulmonary arterial hypertension, comprising: The test substance The first gene group includes AHRR, CYP1A1, CYP1B1, and NQO1; A second group of genes including AHRR, CCL3, EGR1, EGR2, PTGS2, and SEMA6B; and A third group of genes includes GSTM1, IFI44L, and SIGLEC1 providing an isolated cell or a non-human animal expressing one or more genes selected from measuring the expression level of the gene or the activity of a protein produced by the expression of the gene in the cell or the non-human animal; and If the expression level of the gene or the activity of the protein produced by the expression of the gene is suppressed compared to when the test substance is not administered, the test substance is determined to be the candidate substance. A method comprising:

[19] A method for screening test substances for candidate substances that may be effective in treating and / or preventing pulmonary arterial hypertension, comprising: The test substance providing an isolated cell or a non-human animal expressing one or more genes in a fourth group of genes including MYZAP and S100B; measuring the expression level of the gene or the activity of a protein produced by the expression of the gene in the cell or the non-human animal; and If the expression level of the gene or the activity of the protein produced by the expression of the gene is increased compared to when the test substance is not administered, the test substance is determined to be the candidate substance. A method comprising:

[20] A kit for diagnosing pulmonary arterial hypertension, comprising: The first gene group includes AHRR, CYP1A1, CYP1B1, and NQO1; a second group of genes including AHRR, CCL3, EGR1, EGR2, PTGS2, and SEMA6B; A third gene cluster including GSTM1, IFI44L, and SIGLEC1; and The fourth gene cluster includes MYZAP and S100B A kit comprising a reagent for measuring the expression of one or more genes selected from the above or the activity of a protein produced by the expression of said one or more genes. [Effects of the Invention]

[0012] The AHR gene or AHR can be used as a marker for PH, and can be detected as a diagnostic indicator for assessing the severity of PH in a subject, or as a diagnostic indicator for identifying a subject who is suffering from or likely to suffer from PAH in the future.

[0013] One or more genes belonging to gene groups 1 to 4 can be used as markers for PAH. In addition, one or more genes belonging to gene groups 1 to 4 can be detected as a diagnostic indicator for identifying a subject who is suffering from PAH or who may suffer from PAH in the future, or as a diagnostic indicator for evaluating the severity of PAH in a subject.

[0014] According to the screening method of the present invention, test substances can be screened for candidate substances that may be effective in treating and / or preventing PH.

[0015] PH can be diagnosed using the kit of the present invention.

[0016] According to the method of the present invention for producing a pathological model animal for PH, it is possible to produce a pathological model animal for PH. [Brief explanation of the drawings]

[0017] [Figure 1]FIG. 1 shows AHR activation in blood samples from PAH patients by AHR luciferase assay and its correlation with clinical findings. Figures A and D show the results indicating higher AHR activation in human PAH patient serum (PAH) than in healthy volunteer serum (HV). Figures B and E show the results of classifying PAH into mild (classes 1 and 2) and severe (classes 3 and 4) according to the World Health Organization functional classification (WHO-FC), an index of PAH severity, showing that the level of AHR activation was significantly higher in the mild (1, 2) group compared with healthy volunteers (HV), and further higher in the severe (3, 4) group than in the mild (1, 2) group. Figure C shows the results indicating a positive correlation between the level of AHR activation and pulmonary vascular resistance (PVR, Wood unit), which indicates the severity of PAH. Figure F shows a Kaplan-Meier curve plotting event-free survival (EFS) in patients divided into high and low AHR activity groups based on luciferase activity, showing that the high AHR activity group had a significantly lower EFS and a worse prognosis. In A and B, the vertical axis indicates the luciferase activity value, and in D and E, the vertical axis indicates the relative value when the mean luciferase activity of serum from healthy subjects (HV) is set to 1. In F, the mean luciferase activity (75339.5) was used as the cutoff value to stratify the AHR high activity group and the AHR low activity group. [Figure 2] Figure 2 shows the relationship between the level of AHR mRNA expression in PBMCs from human PAH patients and the severity of PAH. (A) shows the result indicating a positive correlation between the level of AHR mRNA and the degree of AHR activation; (B) shows the result indicating a positive correlation between AHR mRNA expression and PVR. [Figure 3] Figure 3 shows that subcutaneous administration of the endogenous AHR agonist FICZ and hypoxia induce severe PAH. A shows the experimental protocol; B shows the results of right ventricular systolic pressure (RVSP); C shows the results of Fulton's index; D shows the results of EVG staining of pulmonary small arteries; E shows the results of medial thickening index; and F shows the results of neointimal area index. The black bar in D indicates 50 μm. [Figure 4-1]Figure 4 (Figures 4-1 and 4-2) shows the generation of Ahr KO rats and the results of almost complete suppression of PH pathology in the SuHx rat model by Ahr KO. A shows the target sequence for Ahr KO generation using the CRISPR / Cas9 system and the DNA sequence of the corresponding site in the KO rats; B shows the results of Western blot analysis of AHR, demonstrating the absence of AHR protein expression in Ahr KO rats; C shows the experimental protocol for SuHx using Ahr KO rats; D shows the results of RVSP; E shows the results of Fulton's index; F shows the results of EVG staining of small pulmonary arteries; G shows the results of the medial hyperplasia index; and H shows the results of the neointimal area index. The black bar in F indicates 50 μm. [Figure 4-2] Continuation of Figure 4-1. Explanation as described for Figure 4-1. [Figure 5] These figures show the results of RNA-sequencing using lungs from wild-type and Ahr KO SuHx rat models on day 4. Panel A shows genes whose expression levels were altered in the wild-type SuHx rat model compared to the untreated group, with 911 genes showing a 1.5-fold or greater increase in expression; Panel B shows genes whose expression levels were altered in the Ahr KO SuHx rat model compared to the wild type, with 168 genes showing a decrease in expression to two-thirds or less; Panel C shows that of the 911 genes whose expression was increased in SuHx rats, 99 genes, or 11%, showed a decrease in expression in Ahr KO rats. [Figure 6-1]FIG. 1 shows the identification of genes whose expression is commonly altered in PBMCs of human and rat PAH. A shows the results of RNA-seq in patients with Aoi-induced PAH, revealing that many genes were elevated in the SuHx rat model on days 28 and 56, which are commonly expressed in humans; B shows a Venn diagram of the overlapping genes elevated in humans and rat PAH; C1 and C2 show the specific RPKM values ​​of genes commonly expressed in SuHx rat PBMCs on day 28 and in human PAH at the untreated wild-type group (Nx) and the wild-type and Ahr KO groups on day 28 (SuHx D28, SuHx D28 KO); D1-D3 show the specific RPKM values ​​of genes commonly expressed in SuHx rat PBMCs on days 28 and 56 and in human PAH at the untreated wild-type group (Nx) and the wild-type and Ahr KO groups on day 28; E1-E3 show the specific RPKM values ​​of genes commonly expressed in SuHx rat PBMCs on day 56 and in human PAH at the untreated wild-type group (Nx) and the wild-type and Ahr KO groups on day 28. FIG. 13 shows the results of specific RPKM values ​​on day 56 in KO. [Figure 6-2] Continuation of Figure 6-1. Explanation as described for Figure 6-1. [Figure 7] A shows the results of high mRNA levels of EGR1, EGR2, CYP1A1, SIGREC1, and PTGS2 in some PAH patients; B shows the results of a positive correlation between mean pulmonary artery pressure (mPAP) and CCL3 expression in PBMCs. DETAILED DESCRIPTION OF THE INVENTION

[0018] 1. Terminology Unless otherwise specified, terms used herein have the meanings that are generally understood by those skilled in the art of medicine, pharmacology, molecular biology, microbiology, organic chemistry, etc. When a term defined herein does not have the same meaning as generally understood, the description in this specification takes precedence.

[0019] The term "subject" refers to a human or non-human animal that is the subject of assessment of the presence, onset, or severity of PAH or PAH accompanied by endometrial lesions. Examples of non-human animals include non-human mammals such as primates, rats, mice, gerbils, guinea pigs, hamsters, ferrets, rabbits, cows, horses, pigs, goats, dogs, and cats. The non-human animals, preferably rats or mice, can be used to produce a PAH pathological model animal.

[0020] Pulmonary hypertension (PH) is a group of progressive diseases with poor prognosis that cause cardiac and pulmonary dysfunction due to elevated pulmonary arterial blood pressure. According to the Nice Classification, PH is classified into the following groups: Group 1: pulmonary arterial hypertension (PAH); Group 1': pulmonary veno-occlusive disease (PVOD) and / or pulmonary capillary hemangiomatosis (PCH); Group 1'': persistent pulmonary hypertension of the newborn; Group 2: pulmonary hypertension associated with left heart disease; Group 3: pulmonary hypertension associated with lung disease and / or hypoxemia; Group 4: chronic thromboembolic pulmonary hypertension; and Group 5: pulmonary hypertension associated with an unknown multifactorial mechanism.

[0021] Examples of "specimens isolated from subjects" include body fluids such as blood, saliva, urine, sputum, and sweat isolated from the above-mentioned subjects, or samples prepared from body fluids, and samples collected from tissues such as lungs. Particularly preferred are the subject's blood or samples prepared from blood, or samples collected from lungs. Peripheral blood is preferred as blood. Preferred samples prepared from blood include samples containing peripheral blood mononuclear cells, plasma samples, serum samples, and whole blood samples.

[0022] 2. Markers of pulmonary arterial hypertension (PH) (1) The present inventors have found that the AHR gene or AHR is useful as a marker for PH, particularly for PH accompanied by endometrial lesions. That is, AHR gene expression or AHR activity resulting from gene expression increases in patients with PH. Therefore, in one embodiment of the present disclosure, increased AHR gene expression or activity serves as a diagnostic indicator for PH (particularly PH accompanied by endometrial lesions).

[0023] The AHR gene or AHR can be a marker for PH in any of Groups 1, 1', 1" (Nice Classification), 2, 3, 4, and 5. In one embodiment of the present disclosure, the AHR gene or AHR can be suitably used as a marker for PAH (Nice Classification Group 1), particularly as a marker for PH accompanied by intimal lesions. In another embodiment of the present disclosure, the AHR gene or AHR can be used as a marker for PVOD and / or PCH (Nice Classification Group 1'), particularly as a marker for PVOD and / or PCH accompanied by intimal lesions. In another embodiment of the present disclosure, the AHR gene or AHR can be used as a marker for chronic thromboembolic pulmonary hypertension (Nice Classification Group 4) or persistent pulmonary hypertension of the newborn (Nice Classification Group 1"), particularly as a marker for chronic thromboembolic pulmonary hypertension accompanied by intimal lesions or persistent pulmonary hypertension of the newborn.

[0024] In the present disclosure, an increase or decrease in AHR gene expression or activity can be determined by comparing it with a reference value for AHR gene expression or activity and determining whether it is higher or lower. Here, the "reference value" may be a measured value when the gene expression or activity of AHR in a specimen sample derived from a normal specimen is measured under the same conditions as the gene expression or activity of AHR in a specimen sample derived from a subject, or a standard value established from the measured value, or a measured value when the gene expression or activity of AHR in a sample derived from a patient with known PH or its severity is measured under the same conditions as the gene expression or activity of AHR in a specimen sample derived from a subject, or a standard value established from the measured value. The method for measuring AHR gene expression or activity is described below.

[0025] 2. Methods for detecting indicators of pulmonary arterial hypertension (PH) (1) One embodiment of the present disclosure relates to a method comprising detecting gene expression or activity of AHR in a sample isolated from a subject as an index for assessing the severity of PH in the subject. The method of this embodiment can also be described as a method for testing the severity of PH in a subject, in which gene expression or activity of AHR is detected in a sample isolated from the subject.

[0026] Another embodiment of the present disclosure relates to a method comprising detecting AHR gene expression or activity in a sample isolated from a subject as an indicator that the subject is suffering from or likely to suffer from PH in the future. The method of this embodiment can also be described as a method for testing whether a subject is suffering from or likely to suffer from PAH in the future, by detecting AHR gene expression or activity in a sample isolated from the subject.

[0027] The methods of each of the above embodiments of the present disclosure preferably include comparing the measured value of AHR gene expression or activity to a reference value.

[0028] In the methods of each of the above-described embodiments of the present disclosure, the higher or more elevated the measured value of AHR gene expression or activity, the more severe the subject's PH is determined to be, or the subject can be determined to be suffering from or more likely to suffer from PH, particularly PH accompanied by endometrial lesions, in the future.

[0029] In the method of the above embodiment of the present disclosure, the PH for which severity is assessed may be any of Groups 1, 1', 1'', 2, 3, 4, and 5 of the Nice Classification. In one aspect of the method of the above embodiment, the method is suitable for assessing the severity of PAH. In another aspect of the method of the above embodiment, the severity of PVOD and / or PCH can be assessed. In another aspect of the method of the above embodiment, chronic thromboembolic pulmonary hypertension or persistent pulmonary hypertension of the newborn can be assessed.

[0030] Furthermore, in the method of the above embodiment of the present disclosure, the PH for which the presence or absence of PH or the likelihood of future PH development is determined may be any of Groups 1, 1', 1'', 2, 3, 4, and 5 of the Nice Classification. One aspect of the method of the above embodiment is suitable for determining the presence or absence of PH or the likelihood of future PH development, particularly PAH accompanied by intimal lesions. In another aspect of the method of the above embodiment, the presence or absence of PH or the likelihood of future PH development can be determined for PVOD and / or PCH, particularly PVOD and / or PCH accompanied by intimal lesions. In another aspect of the method of the above embodiment, the presence or absence of PH or the likelihood of future PH development can be determined for chronic thromboembolic pulmonary hypertension or persistent pulmonary hypertension of the newborn, particularly chronic thromboembolic pulmonary hypertension accompanied by intimal lesions or persistent pulmonary hypertension of the newborn.

[0031] In the method of each of the above-described embodiments of the present disclosure, either the gene expression or activity of AHR may be measured, or both may be measured.

[0032] AHR gene expression may be measured by detecting mRNA encoding the amino acid sequence of the AHR in a test sample, or by detecting the amount of the AHR protein in the sample.

[0033] The measured level of AHR gene expression may be the relative level of AHR gene expression in a sample relative to the level of one or more endogenous controls, which may be housekeeping genes.

[0034] The mRNA encoding the amino acid sequence of AHR can be detected by Northern blotting, RT-PCR, real-time RT-PCR, RNA-Seq analysis, DNA microarray (a method using a DNA chip), dot blotting, RNase protection assay, etc. These methods can be performed by known methods.

[0035] The amount of AHR protein can be detected by immunoassay using an antibody that specifically recognizes and binds to the protein to be quantified. The antibody can be prepared by known methods. Examples of immunoassays include methods using a solid support to which an antibody that specifically binds to the protein to be detected is immobilized, as well as flow cytometry and Western blotting. Methods using a solid support include, but are not limited to, enzyme-linked immunosorbent assay (ELISA) using an immobilized microtiter plate and agglutination methods (immunoprecipitation) using immobilized particles. The amount of AHR protein in a sample can also be detected by known immunoassay methods. Furthermore, the amount of AHR protein can also be detected by methods using LC-MS / MS MRM, a protein mass spectrometry technique that does not use antibodies. These detection methods can also be performed by standard methods.

[0036] An example of the "activity" of AHR is its transcriptional activity.

[0037] AHR is a transcription factor that translocates into the nucleus when polycyclic aromatic hydrocarbon compounds such as dioxins bind as ligands, forming a heterodimer with the AHR Nuclear Translocator (ARNT). This heterodimer then binds to the xenobiotic response element (XRE), a responsive promoter on DNA, and activates the transcription of target genes such as drug-metabolizing enzymes and signaling molecules, thereby acting on various signal transductions.

[0038] The transcriptional activity of AHR can be measured by the following method. A reporter gene assay cell line is used, into which a plasmid vector carrying a reporter gene linked downstream of a foreign body response element (XRE) has been introduced. An example of the reporter gene is the luciferase gene. The reporter gene assay cell line is cultured in the presence of a sample isolated and prepared from a subject, and the expression level of the reporter gene is measured. The expression level of the reporter gene is proportional to the activity (transcriptional activity) of AHR. Therefore, the activity of AHR in the sample can be evaluated based on the expression level of the reporter gene. When the luciferase gene is used as the reporter gene, the expression level of the luciferase gene can be measured by measuring the amount of light emitted by the catalytic reaction of luciferase produced by the expression of the luciferase gene using a luminometer.

[0039] Reporter gene assays can be performed using commercially available reagents (including assay cell lines). An example of a reagent for performing aryl hydrocarbon receptor luciferase reporter assays is IB0600AhR from INDIGO Biosciences, which is described in the Examples.

[0040] Furthermore, AHR "activity" may be measured by detecting molecules involved in epigenetic regulation (e.g., DNA methylation) of gene regions involved in the regulation of AHR expression; molecules involved in the processing, degradation, or stabilization of AHR mRNA; molecules involved in the translation, degradation, or stabilization of AHR protein, including ubiquitination; molecules that directly or indirectly bind to AHR and regulate AHR functions such as AHR nuclear translocation and AHR transcriptional activity; or endogenous substances (e.g., nucleic acids, proteins) or exogenous substances that can regulate the expression of downstream molecules of AHR via gene sequences recognized by AHR. Furthermore, AHR "activity" may be measured using AHR agonists. For example, the number of cells producing AHR agonists, the amount of cells involved in AHR agonist production, the amount of precursor substances possessed by cells, the amount of enzymes, or the quality differences due to modification of these molecules may be measured, or the amount of substances that can serve as AHR agonist precursors in the blood may be measured.

[0041] 3. Pulmonary Hypertension (PH) Diagnostic Kit (1) Yet one or more embodiments of the present disclosure include: A kit for diagnosing PH, comprising: The present invention relates to a kit containing a reagent for measuring AHR gene expression or activity.

[0042] The PH to be diagnosed may be any of Groups 1, 1', 1'', 2, 3, 4, and 5 of the Nice Classification. In one embodiment of the kit of the present disclosure, the PH to be diagnosed is preferably PAH, particularly PAH accompanied by intimal lesions. In another embodiment of the kit of the present disclosure, the PH to be diagnosed may be PVOD and / or PCH, particularly PVOD and / or PCH accompanied by intimal lesions. In another embodiment of the kit of the present disclosure, the PH to be diagnosed may be chronic thromboembolic pulmonary hypertension or persistent pulmonary hypertension of the newborn, particularly chronic thromboembolic pulmonary hypertension accompanied by intimal lesions or persistent pulmonary hypertension of the newborn.

[0043] In one embodiment of the kit of the present disclosure, the kit is preferably for assessing the severity of PH, more preferably the severity of PAH.

[0044] Examples of the reagent include a primer pair for amplifying a nucleic acid containing the AHR gene to be measured (e.g., mRNA, cDNA derived from mRNA), a probe that hybridizes with the nucleic acid, an antibody that specifically binds to the AHR protein, and a reagent for measuring AHR activity.

[0045] Reagents for measuring AHR activity include the above-mentioned reagents for reporter gene assays (including assay cell lines). An example of a reagent for aryl hydrocarbon receptor luciferase reporter assay is IB0600AhR from INDIGO Biosciences, Inc., which is described in the Examples.

[0046] The antibody that specifically binds to the AHR protein may be a polyclonal or monoclonal antibody. Antibody fragments can also be used as long as they are capable of specifically binding to the protein to be measured. Examples of antibody fragments include Fab fragments, F(ab')2 fragments, and single-chain antibodies (scFv). The antibody may be immobilized on a solid support such as a microtiter plate or particles.

[0047] The kit according to the embodiment may further include a dilution or reaction buffer solution containing components necessary for the measurement, a washing solution, a coloring reagent, a reaction vessel, and the like.

[0048] 4. Method for producing a pathological animal model of pulmonary hypertension (PH) Yet another embodiment of the present disclosure comprises: A method for producing a pathological model animal of PH, comprising: Administration of AHR agonists (excluding SU5416) to non-human animals A method including Regarding.

[0049] Examples of the non-human animal include the non-human animals listed above, preferably rats or mice, more preferably rats.

[0050] AHR agonists are substances that bind to AHR and induce the transcriptional activity of AHR. An example of an agonist is 6-Formylindolo(3,2-b)carbazole (FICZ). SU5416 can also be called semaxinib or 3-[(2,4-dimethylpyrrol-5-yl)methylidenyl]-indolin-2-one.

[0051] The route of administration of the agonist to a non-human animal is not particularly limited, and can be, for example, subcutaneous administration. The dose, number of doses, and intervals of administration of the agonist to a non-human animal can be appropriately set so as to induce the pathology of PAH. The dose can be, for example, 1 to 100 mg / kg body weight / week, the number of doses can be, for example, 3 to 10 times, and the intervals of administration can be, for example, once every 5 to 10 days.

[0052] Preferably, the method for producing the pathological model animal of PH further comprises rearing the non-human animal under conditions of low oxygen concentration in order to efficiently induce PH in the non-human animal.

[0053] The low oxygen concentration condition refers to an atmosphere with an oxygen concentration of, for example, 8 to 15%, preferably 9 to 11%. Preferably, a combination of rearing of non-human animals under conditions of low oxygen concentration and rearing under conditions of normal oxygen concentration is carried out.

[0054] In a more preferred embodiment, the non-human animal is kept under hypoxic conditions during the period in which the agonist is administered multiple times to the non-human animal, and preferably, the non-human animal is kept under hypoxic conditions from the beginning to the middle of the period (e.g., 2 to 4 weeks from the start of administration), and the non-human animal is kept under normoxic conditions from the middle to the end of the period (e.g., a further 3 to 8 weeks).

[0055] The pathology model animal obtained by the production method of the present disclosure may be used as any of Groups 1, 1', 1'', 2, 3, 4, and 5 of the Nice Classification. In one embodiment of the production method of the present disclosure, the obtained pathology model animal is suitable as a pathology model animal for PAH. In another embodiment of the production method of the present disclosure, the obtained pathology model animal can be used as a pathology model animal for PVOD and / or PCH.

[0056] 5. Markers of Pulmonary Arterial Hypertension (PAH) (2) The present inventors have found that one or more genes selected from the first gene group (AHRR, CYP1A1, CYP1B1, and NQO1), the second gene group (AHRR, CCL3, EGR1, EGR2, PTGS2, and SEMA6B), the third gene group (GSTM1, IFI44L, and SIGLEC1), and the fourth gene group (MYZAP and S100B), or proteins produced by the expression of said one or more genes, are useful as markers for PAH. That is, in one embodiment of the present disclosure, at least one gene selected from the first to fourth gene groups, or a protein produced by the expression of at least one gene, serves as a diagnostic indicator for PAH, particularly PAH accompanied by endometrial lesions.

[0057] Gene group 1 is a representative group of genes whose expression was increased in the lungs of wild-type rats treated with SuHx (see Examples) and decreased in the lungs of aryl hydrocarbon receptor knockout (Ahr KO) rats, as confirmed in the Examples. The NCBI gene ID and Ensembl gene ID of each gene in gene group 1 in humans are shown in Table 1.

[0058] [Table 1]

[0059] The second group of genes is a representative set of genes whose expression levels were elevated in both peripheral blood mononuclear cells (PMBCs) from patients with serotonin-induced PAH and in PMBCs from wild-type rats treated with SuHx, as confirmed in the Examples. The NCBI gene ID and Ensembl gene ID for each gene in the second group of genes in humans are shown in Table 2.

[0060] [Table 2]

[0061] The third group of genes is a representative example of genes that, as confirmed in the Examples, show little change in the PBMCs of SuHx rats or are absent in rats, but whose expression is elevated in the PBMCs of patients with cerebrospinal fluid-induced PAH. The NCBI gene ID and Ensembl gene ID for each gene in the third group of genes in humans are shown in Table 3.

[0062] [Table 3]

[0063] Gene group 4 is a representative example of genes confirmed in the Examples that show little change in PBMCs of SuHx rats or are absent in rats but show decreased expression in PBMCs of patients with cerebrospinal fluid-induced PAH. The NCBI gene ID and Ensembl gene ID of each gene in gene group 4 in humans are shown in Table 4.

[0064] [Table 4]

[0065] In patients with PAH, the gene expression or the activity of the protein produced by gene expression of one or more genes selected from the first gene group, the second gene group, and the third gene group increases, and therefore, an increase in the gene expression or protein activity of one or more genes selected from the first gene group, the second gene group, and the third gene group serves as a diagnostic indicator for PAH.

[0066] In one embodiment of the present disclosure, among one or more genes selected from the first gene group, the second gene group, and the third gene group, one or more genes selected from the first gene group and the second gene group or proteins produced by the expression of said one or more genes are particularly useful as markers for PAH, and one or more genes selected from the second gene group or proteins produced by the expression of said one or more genes are most useful as markers for PAH.

[0067] The gene expression or protein activity produced by gene expression of one or more genes selected from the fourth group of genes is reduced in PAH patients, and thus a decrease in the gene expression or protein activity of one or more genes selected from the fourth group of genes serves as a diagnostic indicator for PAH.

[0068] As used herein, an increase or decrease in gene expression or protein activity resulting from gene expression can be determined by whether it is higher or lower than a reference value for gene expression or protein activity. Here, the "reference value" may be a measured value obtained by measuring the gene expression or protein activity of the one or more genes in a specimen sample derived from a normal specimen under the same conditions as those for the gene expression or protein activity of the one or more genes in a specimen sample derived from a subject, or a standard value established from the measured value. Alternatively, it may be a measured value obtained by measuring the gene expression or protein activity of the one or more genes in a sample derived from a patient whose presence or severity of PAH is known under the same conditions as those for the gene expression or protein activity of the one or more genes in a specimen sample derived from a subject, or a standard value established from the measured value.

[0069] 6. Methods for detecting indicators of pulmonary arterial hypertension (PAH) (2) One embodiment of the present disclosure relates to a method comprising detecting, in a sample isolated from a subject, the expression of one or more genes selected from a first group of genes (AHRR, CYP1A1, CYP1B1, and NQO1), a second group of genes (AHRR, CCL3, EGR1, EGR2, PTGS2, and SEMA6B), a third group of genes (GSTM1, IFI44L, and SIGLEC1), and a fourth group of genes (MYZAP and S100B), or the activity of a protein produced by the expression of said one or more genes, as an indicator that the subject is suffering from or may be suffering from PAH in the future. The method of this embodiment can also be described as a method for testing whether a subject has PAH or the possibility of developing it in the future, by detecting, in a sample isolated from the subject, the expression of one or more genes selected from the first gene group (AHRR, CYP1A1, CYP1B1, and NQO1), the second gene group (AHRR, CCL3, EGR1, EGR2, PTGS2, and SEMA6B), the third gene group (GSTM1, IFI44L, and SIGLEC1), and the fourth gene group (MYZAP and S100B), or the activity of a protein produced by the expression of said one or more genes.

[0070] Another embodiment of the present disclosure relates to a method comprising detecting, in a sample isolated from a subject, the expression of one or more genes selected from a first gene group (AHRR, CYP1A1, CYP1B1, and NQO1), a second gene group (AHRR, CCL3, EGR1, EGR2, PTGS2, and SEMA6B), a third gene group (GSTM1, IFI44L, and SIGLEC1), and a fourth gene group (MYZAP and S100B), or the activity of a protein produced by the expression of the one or more genes, as an index for evaluating the severity of PAH in the subject. The method of this embodiment can also be described as a method for testing the severity of PAH, which involves detecting, in a sample isolated from a subject, the expression of one or more genes selected from the first gene group (AHRR, CYP1A1, CYP1B1, and NQO1), the second gene group (AHRR, CCL3, EGR1, EGR2, PTGS2, and SEMA6B), the third gene group (GSTM1, IFI44L, and SIGLEC1), and the fourth gene group (MYZAP and S100B), or the activity of a protein produced by the expression of said one or more genes.

[0071] The method of each of the above embodiments of the present disclosure preferably comprises comparing a measurement of the expression of said one or more genes or the activity of a protein resulting from the expression of said one or more genes with a reference value.

[0072] In the methods of each of the above-described embodiments of the present disclosure, the higher or more elevated the measured value of gene expression or protein activity of one or more genes selected from the first gene group, the second gene group, and the third gene group, the more likely the subject is to suffer from PAH or to suffer from PAH in the future, or the more severe the severity of the subject's PAH.

[0073] In one embodiment of the present disclosure, it is preferable to detect the gene expression or protein activity of one or more genes selected from the first gene group, the second gene group, and the third gene group, in particular one or more genes selected from the first gene group and the second gene group, and it is particularly preferable to detect the gene expression or protein activity of one or more genes selected from the second gene group.

[0074] In one embodiment of the present disclosure, when the measured value of gene expression or protein activity of one or more genes selected from the fourth group of genes is low or decreased, it can be determined that the subject is suffering from PAH or is likely to suffer from PAH in the future, or that the severity of the subject's PAH is more severe.

[0075] In the method of each of the above-described embodiments of the present disclosure, either the gene expression or the protein activity of the one or more genes may be measured, or both may be measured.

[0076] The gene expression of the one or more genes may be measured by detecting the mRNA of the one or more genes in a test sample, or by detecting the amount of protein produced by the one or more genes in a sample.

[0077] The measured expression level of the one or more genes may be the relative expression level of the one or more genes in the sample relative to the expression level of one or more endogenous controls, which may be housekeeping genes.

[0078] The mRNA of one or more genes can be detected by Northern blotting, RT-PCR, real-time RT-PCR, RNA-Seq analysis, DNA microarray (a method using a DNA chip), dot blotting, RNase protection assay, etc. These methods can be performed by known methods.

[0079] The amount of proteins produced by the one or more genes can be detected by immunoassay using an antibody that specifically recognizes and binds to the protein to be quantified. The antibody can be prepared by known methods. Examples of immunoassays include methods using a solid support to which an antibody that specifically binds to the protein to be detected is immobilized, as well as flow cytometry and Western blotting. Methods using a solid support include, but are not limited to, enzyme-linked immunosorbent assay (ELISA) using an immobilized microtiter plate and agglutination methods (immunoprecipitation) using immobilized particles. Known immunoassays can be employed to detect the amount of proteins produced by the one or more genes in a sample. Furthermore, the amount of proteins produced by the one or more genes can also be detected by methods using LC-MS / MS MRM, a protein mass spectrometry technique that does not use antibodies. These detection methods can also be performed by standard methods. The activity of the protein produced by the one or more genes can be measured by a method that depends on the activity of the protein to be measured.

[0080] 7. Method for screening candidate substances that may be effective in treating and / or preventing pulmonary arterial hypertension (PAH) Yet one or more embodiments of the present disclosure include: A method for screening test substances for candidate substances that may be effective in the treatment and / or prevention of PAH, comprising: administering a test substance to an isolated cell or a non-human animal expressing one or more genes selected from a first gene group (AHRR, CYP1A1, CYP1B1, and NQO1), a second gene group (AHRR, CCL3, EGR1, EGR2, PTGS2, and SEMA6B), and a third gene group (GSTM1, IFI44L, and SIGLEC1); measuring the expression level of the gene or the activity of a protein produced by the expression of the gene in the cell or the non-human animal; and determining that the test substance is the candidate substance when the expression level of the gene or the activity of the protein produced by the expression of the gene is suppressed compared to when the test substance is not administered; A method including Regarding.

[0081] Yet one or more embodiments of the present disclosure include: A method for screening test substances for candidate substances that may be effective in the treatment and / or prevention of PAH, comprising: administering the test substance to an isolated cell or a non-human animal expressing one or more genes selected from the fourth gene group (MYZAP and S100B); measuring the expression level of the gene or the activity of a protein produced by the expression of the gene in the cell or the non-human animal; and determining that the test substance is the candidate substance when the expression level of the gene or the activity of the protein produced by the expression of the gene is increased compared to when the test substance is not administered; A method including Regarding.

[0082] In the screening method of each of the above-described embodiments of the present disclosure, either the gene expression or the protein activity of the one or more genes may be measured, or both may be measured. The isolated cells include peripheral blood mononuclear cells (PMBCs) isolated from humans or other animals. Examples of the non-human animal include the non-human animals listed above.

[0083] 8. Pulmonary Arterial Hypertension (PAH) Diagnostic Kit (2) Yet one or more embodiments of the present disclosure include: A kit for diagnosing PAH, comprising: A kit comprising a reagent for measuring the expression of one or more genes selected from a first gene group (AHRR, CYP1A1, CYP1B1, and NQO1), a second gene group (AHRR, CCL3, EGR1, EGR2, PTGS2, and SEMA6B), a third gene group (GSTM1, IFI44L, and SIGLEC1), and a fourth gene group (MYZAP and S100B), or the activity of a protein produced by the expression of said one or more genes. Regarding.

[0084] Examples of the reagent include a primer pair for amplifying a nucleic acid (e.g., mRNA, cDNA derived from mRNA) containing the one or more genes to be measured, a probe that hybridizes with the nucleic acid, an antibody that specifically binds to a protein produced by the expression of the one or more genes, and a reaction substrate for measuring the enzymatic activity of a protein produced by the expression of the one or more genes.

[0085] The antibody that specifically binds to the protein produced by the expression of one or more genes may be a polyclonal antibody or a monoclonal antibody. Antibody fragments can also be used as long as they are capable of specifically binding to the protein to be measured. Examples of antibody fragments include Fab fragments, F(ab')2 fragments, and single-chain antibodies (scFv). The antibody may be immobilized on a solid support such as a microtiter plate or particles. The reaction substrate for measuring the activity of the protein produced by the expression of the one or more genes can be appropriately selected depending on the activity of the protein to be measured. The kit according to the embodiment may further include a dilution or reaction buffer solution containing components necessary for the measurement, a washing solution, a coloring reagent, a reaction vessel, and the like. [Example]

[0086] The present disclosure is not limited in any way to the description of the embodiments and examples of the invention. Various modifications within the scope of the claims and within the scope that can be easily conceived by a person skilled in the art are also included in the present invention. The contents of the documents and the like shown in this specification are hereby incorporated by reference in their entirety.

[0087] 1. Experimental Methods and Materials A) Human samples All experiments using human samples were approved by the Institutional Review Board of the National Cerebral and Cardiovascular Center. For the "relationship between AHR activation level by luciferase assay using PAH patient serum and PAH pathology," human peripheral blood samples were obtained from 18 group I PAH patients (mean age: 47.6 ± 14.3 years) and 12 healthy volunteers (mean age: 44.3 ± 10.4 years). For the "gene expression, AHR activation level, and PAH severity in human PAH PBMCs," qRT-PCR was performed on the serum of 29 group I PAH patients (mean age: 47.4 ± 15.6 years), including the 18 patients (excluding untreated patients) and other patients receiving treatment at the same hospital. For the "examination of the relationship between PAH pathology and PBMC gene expression," human peripheral blood samples obtained from 12 PAH patients (mean age: 47.4 ± 18.3 years) and 5 healthy volunteers (mean age: 36.8 ± 11.3 years) were used. For the "examination of AHR gene expression in PBMCs in PH patients other than PAH," human peripheral blood samples obtained from 2 PH patients (mean age: undisclosed) with a predisposition to chronic obstructive pulmonary disease (COPD) and 1 CTEPH patient (age: undisclosed) were used. Written informed consent was obtained from all patients and volunteers for the use of their blood samples in biological research.

[0088] B) Isolation of peripheral blood mononuclear cells (PBMCs) and serum PBMCs were isolated from each peripheral blood sample using Lymphoprep tubes (Cosmo Bio Co., Ltd.) or LSM (MP biomedicals, LLC) according to the manufacturer's instructions. Serum was collected in standard coagulant-containing blood collection tubes (Nipro Corporation, NP-SP1029) using holders (Terumo Corporation), centrifuged at 2800 g for 10 min, and stored at -80°C until use.

[0089] C) Analysis by qRT-PCR Total RNA was extracted from rat lung tissue or human PBMCs using TRIzol (Invitrogen) and purified using the PureLink RNA Mini Kit (Invitrogen) and PureLink DNase (Invitrogen). Quantitative real-time RT-PCR was performed using the QuantiFast SYBRGreen RT-PCR Kit (Qiagen) or the PrimeScript RT reagent kit (TAKARA BIO) and TB Green Premix Ex TaqII (TAKARA BIO). Reverse transcription was performed according to the manufacturer's instructions, and qPCR reactions were performed using 45 cycles of 95°C for 10 seconds, 60°C for 10 seconds, and 72°C for 30 seconds. Fluorescence data were collected and analyzed using a LightCycler 96 (Roche). The genes and primers used were as follows: hAHR: Fw primer: 5'-GAGTCTGGACAAGGAATTGAAGA-3' (SEQ ID NO: 1), Rv primer: 5'- GGAGGAATCTGGTCTGGGTTA -3' (SEQ ID NO: 2); hCYP1A1: Fw primer: 5'-TCTTTGGAGCTGGGTTTGAC-3' (SEQ ID NO: 3), Rv primer: 5'-TGACCTGCCAATCACTGTGT-3' (SEQ ID NO: 4); hEGR1: Fw primer: 5'-TGACCGCAGAGTCTTTTCCT-3' (SEQ ID NO: 5), Rv primer: 5'-TGGGTTGGTCATGCTCACTA-3' (SEQ ID NO: 6); hEGR2: Fw primer: 5'-GGGTGTGTGCACCATGTC-3' (SEQ ID NO: 7), Rv primer: 5'-GGTGGCGGAGAGTACAGGT-3' (SEQ ID NO: 8); hSIGLEC1: Fw primer: 5'-CCTGGACTTCCATGCCAAT-3' (SEQ ID NO: 9), Rv primer: 5'-TCCCATGTGTCGAAGAAGATAG-3' (SEQ ID NO: 10); hPTGS2: Fw primer: 5'-GCTTTATGCTGAAGCCCTATGA-3' (SEQ ID NO: 11), Rv primer: 5'-TCCAACTCTGCAGACATTTCC-3' (SEQ ID NO: 12); hGAPDH: Fw primer: 5'-ATGGGGAAGGTGAAGGTCG-3' (SEQ ID NO: 13), Rv primer: 5'-GGGGTCATTGATGGCAACAATA-3' (SEQ ID NO: 14)

[0090] D) AHR luciferase reporter assay The AHR luciferase reporter assay was performed using INDIGO Biosciences' IB0600AhR according to the manufacturer's instructions, except for the stimulation conditions, which were as follows: stimulation was performed using the medium specified in the instructions, with serum added to a final concentration of 10%.

[0091] E) Laboratory animals All animal experiments were performed using male rats aged 6 to 8 weeks. Experiments not described were performed using Sprague-Dawley (SD) rats purchased from Charles River, Japan. All rats were housed at 24±1°C under a 12-hour light / 12-hour dark cycle and were provided with standard mouse chow and water.

[0092] F) Creation of knockout rats using the CRISPR-Cas9 system The generation of knockout (KO) rats was outsourced to the Animal Experimental Facility, Osaka University Medical School. A guide RNA was designed for the target site adjacent to the PAM sequence in Exon-2, and Ahr KO rats were generated by gene editing using the CRISPR-Cas9 system in SD rats.

[0093] G) Preparation of a PH model by drug administration The SuHx rat model was established as previously reported. Six- to eight-week-old SD rats were subcutaneously administered 20 mg / kg of SU5416 and housed in a hypoxic chamber with 10% O for 3 weeks. They were then removed from the hypoxic chamber and housed under normoxic conditions for 2 to 5 weeks. Cage changes were performed twice weekly.

[0094] For FICZ-treated rats, the drug was administered subcutaneously at a dose of 10 mg / kg every week from the start of hypoxia. Similar to the SuHx rat model, the rats were housed in a hypoxic chamber with 10% O for 3 weeks, and then removed from the hypoxic chamber and housed under normoxic conditions for 5 weeks. Drug administration during hypoxia was performed when changing cages.

[0095] H) Hemodynamic measurements using right heart catheter Rats were anesthetized with 3% isoflurane inhalation, tracheotomized, and mechanically ventilated. Anesthesia was maintained with 1.5-2% isoflurane inhalation. Body temperature was maintained at 37-38°C during the procedure using a thermostatically controlled heat pad linked to a rectal temperature monitor. After tracheotomy, rats were ventilated with a high-oxygen ventilator at a tidal volume of 8 μl / g and 60-80 breaths / min.

[0096] An 18-gauge BD angiocath catheter was inserted into the right external jugular vein and advanced to the right ventricle to measure right ventricular pressure (RVP). The RVP signal was detected by a pressure transducer (MLT0670; AD Instruments), relayed to a pressure amplifier (ML117; AD Instruments), continuously sampled by a Power Lab system (AD Instruments, Colorado Springs, CO), and recorded on a computer using Chart software (AD Instruments). Measurements were limited to heart rates between 200 and 500 beats per minute. Heart rates below 200 beats per minute were excluded from the measurements. Mean arterial pressure (MAP) was measured using the same system as the venous catheter, using a polyethylene tube inserted into the right internal carotid artery before venous catheter insertion. Heart rate (HR) was calculated from the peak of the right ventricular systole in the arterial pressure waveform.

[0097] I) Western blot experiments Frozen rat lungs were homogenized (disrupted and lysed) using a Polytron homogenizer in lysis buffer (50 mM HEPES, 100 mM sodium fluoride, 2 mM sodium orthovanadate, 4 mM EDTA, 1% Tween-20, 0.1% SDS, protease inhibitor cocktail Complete (Roche Applied Science)). After centrifugation, the supernatant was subjected to SDS-PAGE electrophoresis using standard methods. Blots were developed using the ECL system (GE Healthcare). The following antibodies were used in the Western blot analysis. Anti-AHR antibody (BML-SA210, Enzo Life Sciences). Anti-β-tubulin antibody (T5201, Sigma-Aldrich). Western blot analysis using anti-β-tubulin antibody was performed to detect endogenous expression control.

[0098] J) RNA sequencing The quality of the RNA and library preparation was assured using TapeStation (Agilent). For RNA-sequencing analysis of rat lung, 100 ng of total RNA was used for ribosomal RNA removal, followed by library preparation using the TruSeq Stranded mRNA Sample Preparation Kit (Illumina). For RNA-sequencing analysis of human or rat PBMC, 100 pg of total RNA was used, and library preparation was performed using the SMART-seq v4 Ultra Low Input RNA Kit (Takara Clontech). More than 25 million reads with 75 bp paired-end reads were obtained per sample. Quality control of the sequencing data was performed using FastQC. After trimming and filtering, each read was aligned to the rat genome version rn6 reference genome using the rat genome (Rn6) for rats and to the human genome (hg38) reference genome using Hisat2 for humans. Genes specifically expressed in lung tissue were defined as those showing a 1.5-fold or less than 2 / 3 change in expression level and satisfying a false discovery rate (FDR) of <0.05. Genes specifically expressed in PBMCs were defined as those showing a 1.5-fold or less than 2 / 3 change in expression level in humans and a 2-fold or less than 2 / 3 change in expression level in rats and satisfying a P <0.05.

[0099] K) Morphological analysis of pulmonary vascular tissue and myocardial tissue After hemodynamic measurements using a right heart catheter, the heart and lungs were perfused with saline and fixed with 4% paraformaldehyde (PFA) at constant pressure, ensuring complete distention of the pulmonary vascular bed and airways. The heart and lungs were then excised, and the right ventricle (RV) was separated from the left ventricle (LV) and septum. After blotting, tissue weights were measured, and the RV / LV + septum ratio was used as the Fulton index to assess right ventricular hypertrophy. Resected lung samples were fixed overnight in 4% PFA at 4°C, embedded in paraffin, and sectioned at 4 μm thickness. Morphological analysis of pulmonary vessels was performed using Elastica van Gieson (EVG) staining. Arterial images were captured using an Aperio (Leica) camera. Pulmonary vascular remodeling was assessed using the medial thickness index (% wall thickness) and neointimal area index of the vascular lumen. The target vessels were pulmonary arteries in the lung parenchyma, small arteries at the terminal bronchioles, and arterioles at the pulmonary lobule level, with diameters of 30–100 μm. At least 50 vessels were selected for evaluation in each treatment group. The medial thickening index was defined as doubling the distance between the internal and external elastic lamina, divided by the distance between the external elastic lamina (vessel diameter), and then multiplied by 100. In vessels with only a single elastic lamina, the distance between the elastic lamina and the subendothelial basement membrane was measured. Medial thickening was analyzed only in vessels sectioned into approximately circular shapes. Pulmonary artery diameter was determined using an Aperio ImageScope (Leica). The neointimal area index for the vascular lumen was calculated by classifying each blood vessel into three groups: no neointimal lesions (Open), intimal lesions in less than 50% of the vascular lumen (Partial), and intimal lesions occupying 50% or more of the vascular lumen (Close), and the proportion of blood vessels in each group was evaluated.

[0100] L) Statistical analysis All data are expressed as mean ± standard error (Figures 1, 2, 7, 8) or standard deviation (Figures 3-6). Significant differences between multiple groups were tested using one-way ANOVA and the Turkey-Kramer method. Differences between two groups were analyzed using the Student t-test. A P value of less than 0.05 was considered statistically significant. * indicates P<0.05, ** indicates P<0.01, *** indicates P<0.001, and **** indicates P<0.0001.

[0101] 2. Results A) Relationship between AHR activation level determined by luciferase assay using PAH patient serum and PAH pathology To examine the degree of AHR activation (degree of activation) in patient blood, we performed an AHR luciferase reporter assay using sera from PAH patients and healthy controls. Results showed significantly higher luciferase activation in PAH patients compared with healthy controls (Fig. 1A, 1D). When PAH was classified into mild (Class 1 and 2) and severe (Class 3 and 4) PAH severity according to the WHO Functional Classification of Pulmonary Hypertension (WHO FC Class), a marker of PAH severity, activation was significantly higher in the mild group compared with healthy controls, and even higher in the severe group compared with the mild group (Fig. 1B, 1E). Furthermore, a positive correlation was observed with pulmonary vascular resistance (PVR, Wood's unit), another marker of PAH severity (Fig. 1C). Furthermore, PAH patients with high AHR activity had significantly lower event-free survival (EFS) and a poorer prognosis (Fig. 1F). In other words, it became clear that serum AHR activation is an indicator of the severity of PAH, and serum AHR agonist activity (degree of AHR activation) is a prognostic predictor.

[0102] B) Gene expression in human PAH PBMCs, AHR activation level, and PAH severity When AHR gene expression in PBMCs was examined, AHR mRNA expression levels in PAH patients tended to be positively correlated with serum AHR luciferase activity (Figure 2A). Furthermore, AHR mRNA expression levels tended to be positively correlated with PVR (Figure 2B). These findings suggest that AHR expression levels in PBMCs can be used as an indicator of the severity of PAH.

[0103] C) Verification of the induction effect of severe PAH by administration of the AHR-specific agonist FICZ in a rat model SU5416 has potent AHR agonist activity. To examine whether AHR activation is important in the induction of severe PH in the SuHx rat model, 6- to 8-week-old SD rats were subcutaneously administered FICZ, an endogenous AHR agonist, or vehicle alone weekly. Similar to the SuHx rat model, these rats were exposed to hypoxia (10% O2) for 3 weeks followed by normoxia for 2 to 5 weeks (Fig. 3A). At 5 weeks, FICZ-treated rats showed significantly elevated RVSP (right ventricular systolic pressure) and Fulton index compared with controls, similar to SuHx rats. At 8 weeks after the start of FICZ treatment, the RVSP and Fulton index were further elevated (Fig. 3B, C), medial thickening was significantly greater than in controls (Fig. 3D, E), and intimal lesions were also observed (Fig. 3D, F). These results demonstrate that administration of an AhR agonist can induce severe PAH in rats, with pathological findings similar to those in humans.

[0104] D) pH suppression effect of Ahr knockout rats in the SuHx rat model To verify whether AHR activation is required for the induction of severe PH using the SuHx rat model, we generated Ahr KO rats using the CRISPR-Cas9 system (Fig. 4A). Western blot analysis confirmed the detection of Ahr protein. The SuHx rat model was generated by subcutaneously administering SU5416 at 20 mg / kg to 6- to 8-week-old Ahr KO(- / -) rats, sibling wild-type (Ahr (+ / +)), and heterozygous (Ahr (+ / -)) rats, followed by 3 weeks of hypoxia and 2 to 5 weeks of normoxia (Fig. 4C). At 5 weeks after SU5416 administration, Ahr (+ / +) and Ahr (+ / -) rats showed significant increases in RVSP and Fulton index (Fig. 4D,E), whereas Ahr (- / -) rats showed no significant increases in RVSP and Fulton index compared with the vehicle-only control group, and these increases were significantly suppressed compared with Ahr (+ / +) and Ahr (+ / -) rats (Fig. 4D,E). Furthermore, at 8 weeks after SU5416 administration, Ahr KO rats not only showed significantly suppressed medial thickening compared with wild-type rats, but also showed almost no intimal lesions (Fig. 4F,G). These results indicate that activation of the AHR pathway induces PH in the SuHx rat model.

[0105] E) RNA-sequencing results of lungs from the SuHx rat model To clarify the molecular mechanism underlying AHR-dependent induction of PH, we searched for genes that were AHR-dependently altered in the lungs 4 days after SuHx treatment. We identified 911 genes (SuHx-up genes) that were significantly (FDR < 0.05) increased by 1.5-fold or more in the SuHx group compared with the untreated control group (Fig. 5A). Meanwhile, 168 genes were significantly (FDR < 0.05) decreased by two-thirds or more in the Ahr KO rats compared with the SuHx-treated wild-type rats (Fig. 5B). Of these, 99 genes (11%) were AHR-dependent (Fig. 5C). These 99 genes included AHRR, CYP1A1, CYP1B1, and NQO1 (Table 1). Furthermore, of the 168 genes whose expression was decreased in the Ahr KO rats, 69 genes were not elevated in the SuHx-treated wild-type rats.

[0106] F) Gene expression in PBMCs from human PAH patients and SuHx rats Infiltration of bone marrow-derived cells is often observed in PAH lesions. Therefore, to investigate the possible involvement of AHR in human PAH, we examined differences in gene expression in PBMCs from patients with sedum-induced PAH, which is thought to be highly AHR-dependent, compared with healthy controls, in an attempt to identify genes that are thought to be highly AHR-dependent. Sedum-induced PAH patients are patients who developed PAH as a side effect of sedum administration. Furthermore, by comparing gene expression in PBMCs from SuHx rats (D28, D56), we identified genes commonly associated with AHR-dependent expression in both humans and rats (Figure 6A). Among these genes, genes whose expression levels were commonly elevated in both sedum-induced PAH and SuHx rats included AHRR, CCL3, EGR1, EGR2, PTGS2, and SEMA6B (Table 2). Furthermore, genes whose expression levels were elevated in PBMCs from human patients with cerebrospinal fluid-induced PAH, but not in rats, included GSTM1, IFI44L, and SIGLEC1 (Table 3). Gene expression levels that were decreased in PBMCs from cerebrospinal fluid-induced PAH or SuHx rats included MYZAP and S100B (Table 4).

[0107] Furthermore, the mRNA levels of EGR1, EGR2, CYP1A1, SIGLEC1, and PTGS2 were elevated in some PAH patients (Fig. 7A).

[0108] G) Examination of the relationship between PAH pathology and PBMC gene expression When we examined the relationship between gene expression in PBMCs of PAH patients and clinical findings, we found a positive correlation between higher CCL3 mRNA expression and higher mean pulmonary artery pressure (mPAP) (Figure 7B).

[0109] H) AHR gene expression in PBMCs of patients with PH other than PAH We investigated the relationship between AHR gene expression and pathology using PBMCs from patients with PH other than PAH. AHR mRNA expression was examined in two patients with PH (pulmonary hypertension associated with lung disease and / or hypoxemia) who were predisposed to COPD and one patient with CTEPH. The AHR mRNA expression was higher than the mean (0.067 ± 0.0285) of 29 PAH patients shown in Figure 2B (0.117 and 0.129 for PH patients with COPD predisposition, 0.155 for CTEPH patients). Furthermore, the mean pulmonary artery pressures of these patients were 50 mmHg and 48 mmHg for PH patients with COPD predisposition, and 34 mmHg for CTEPH patients. Both patients had severe PH (WHO-FC class 3). This suggests that AHR can be used as a marker for PH in general.

[0110] 3. Overall Consideration As described above, it has been suggested that the presence or absence of PAH and the likelihood of future onset can be assessed by using the AHR gene or AHR as an indicator, specifically by measuring AHR gene expression or AHR activity. Considering that PAH is a form of PH and exhibits pathological conditions that are partially common to the pathological conditions of groups 2 to 5 of PH, it is believed that the severity of PH, the presence or absence of PH, and the likelihood of future onset can be assessed by detecting the AHR gene or AHR in samples isolated from a subject.

[0111] Furthermore, we confirmed the inhibitory effect of Ahr knockout rats on PH in the SuHx rat model, demonstrating that activation of the AHR pathway induces PH in this model. These test results also support the possibility of using the AHR gene or AHR as an indicator to assess the presence or absence of PH and the likelihood of future PH development.

[0112] Furthermore, the results of the study of AHR gene expression using PBMCs in patients with PH other than PAH shown above suggest that the AHR gene or AHR can be used as an indicator to evaluate the presence or absence of PH other than PAH and the likelihood of future onset, even in patients with PH other than PAH, and that detection of the AHR gene or AHR in samples isolated from subjects can be used to evaluate the severity, presence or absence of PH other than PAH, and the likelihood of future onset. In other words, these results suggest that the AHR gene or AHR can be used as a marker for PH classified into any of Nice Classification Groups 1, 1', 1'', 2, 3, 4, and 5.

[0113] Furthermore, the results of gene expression studies in PBMCs of human PAH patients suggested that specific genes could be used as indicators to assess the presence or absence of PAH and the likelihood of future PAH development. Furthermore, the detection of specific genes in samples isolated from subjects suggested that the severity of PAH, the presence or absence of PAH, and the likelihood of future PAH development could be assessed. Furthermore, the results suggested that candidate substances useful as pharmaceuticals for the treatment or prevention of PAH could be screened based on marker genes that indicate PAH severity.

[0114] The present disclosure is not limited in any way to the description of the embodiments and examples of the invention. Various modifications within the scope of the claims and within the scope that can be easily conceived by a person skilled in the art are also included in the present invention. The contents of the documents and the like shown in this specification are hereby incorporated by reference in their entirety.

Claims

1. Use of the aryl hydrocarbon receptor gene in peripheral blood mononuclear cells, or the aryl hydrocarbon receptor in blood or a sample prepared from blood, as a marker for pulmonary arterial hypertension.

2. A method comprising detecting aryl hydrocarbon receptor gene expression in peripheral blood mononuclear cells isolated from a subject, or aryl hydrocarbon receptor activity in blood isolated from the subject or a sample prepared from the blood, as an indicator for assessing the severity of the subject's pulmonary arterial hypertension.

3. A method comprising detecting gene expression of aryl hydrocarbon receptor in peripheral blood mononuclear cells isolated from a subject, or aryl hydrocarbon receptor activity in blood isolated from a subject or a sample prepared from the blood, as an indicator that the subject is suffering from or may suffer from pulmonary arterial hypertension in the future.

4. A kit for diagnosing pulmonary arterial hypertension, comprising: A kit comprising reagents for measuring gene expression of aryl hydrocarbon receptor in peripheral blood mononuclear cells, or aryl hydrocarbon receptor activity in blood or a sample prepared from said blood.

5. A kit as described in claim 4 for assessing the severity of pulmonary arterial hypertension.

6. A gene in peripheral blood mononuclear cells, a second group of genes including AHRR, EGR1, EGR2, PTGS2, and SEMA6B; A third gene cluster including GSTM1, IFI44L, and SIGLEC1; and A fourth gene cluster includes MYZAP and S100B One or more genes selected from Use as a marker of pulmonary arterial hypertension.

7. In peripheral blood mononuclear cells isolated from a subject, as an indicator of the subject having or likely to have pulmonary arterial hypertension, a second group of genes including AHRR, EGR1, EGR2, PTGS2, and SEMA6B; A third gene cluster including GSTM1, IFI44L, and SIGLEC1; and A fourth gene cluster includes MYZAP and S100B A method comprising detecting the expression of one or more genes selected from:

8. As an index for assessing the severity of pulmonary arterial hypertension in a subject, peripheral blood mononuclear cells isolated from the subject are a second group of genes including AHRR, EGR1, EGR2, PTGS2, and SEMA6B; A third gene cluster including GSTM1, IFI44L, and SIGLEC1; and A fourth gene cluster includes MYZAP and S100B A method comprising detecting the expression of one or more genes selected from:

9. A method for screening test substances for candidate substances that may be effective in treating and / or preventing pulmonary arterial hypertension, comprising: The test substance A second group of genes including AHRR, EGR1, EGR2, PTGS2, and SEMA6B; and A third group of genes includes GSTM1, IFI44L, and SIGLEC1 providing isolated peripheral blood mononuclear cells or non-human animals expressing one or more genes selected from the group consisting of: measuring the expression level of the gene in the peripheral blood mononuclear cells or peripheral blood mononuclear cells collected from the non-human animal; and If the expression level of the gene is suppressed compared to when the test substance is not administered, the test substance is determined to be the candidate substance. A method comprising:

10. A method for screening test substances for candidate substances that may be effective in treating and / or preventing pulmonary arterial hypertension, comprising: The test substance providing isolated peripheral blood mononuclear cells or a non-human animal expressing one or more genes in a fourth group of genes including MYZAP and S100B; measuring the expression level of the gene in the peripheral blood mononuclear cells or peripheral blood mononuclear cells collected from the non-human animal; and If the expression level of the gene is increased compared to when the test substance is not administered, the test substance is determined to be the candidate substance. A method comprising:

11. A kit for diagnosing pulmonary arterial hypertension, comprising: a reagent for measuring gene expression in peripheral blood mononuclear cells, The gene is a second group of genes including AHRR, EGR1, EGR2, PTGS2, and SEMA6B; A third gene cluster including GSTM1, IFI44L, and SIGLEC1; and A fourth gene cluster includes MYZAP and S100B The kit is one or more selected from the following:

Citation Information

Patent Citations

  • JPP6596724B