Gene constructs for mRNA expression

Abstract

The present invention relates to a gene construct for mRNA expression, a pharmaceutical composition, a vaccine composition, and a composition for gene therapy comprising the gene construct, and more particularly to a gene construct comprising a 5' untranslated region (UTR) and / or a 3' untranslated region (UTR) derived from a coronavirus (SARS-CoV-2: Severe acute respiratory syndrome coronavirus 2), and a pharmaceutical composition, a vaccine composition, and a composition for gene therapy comprising the gene construct.

Description

[Technical Field]

[0001] The present invention relates to a gene construct for mRNA expression, a pharmaceutical composition, a vaccine composition, and a gene therapy composition comprising the gene construct, and more particularly to a gene construct comprising a 5' untranslated region (UTR) and / or a 3' untranslated region (UTR) derived from a coronavirus, and a pharmaceutical composition, a vaccine composition, and a gene therapy composition comprising the gene construct. [Background technology]

[0002] Gene therapy agents have been developed to treat or prevent disease by adding, modifying, or deleting new information from existing genes and then delivering the genes to the patient's cells in the form of plasmid DNA (pDNA) or messenger RNA (mRNA) (Dunbar, CE et al., Science 2018 1:12).

[0003] The goal of gene therapy is to correct genetic defects in people suffering from hereditary or rare diseases, thereby completely curing the disease. Recent technological innovations and R&D investments have led to an average annual growth rate of 10% for the global gene therapy market, and gene therapy has emerged as a new blue chip in the pharmaceutical market. Among these, mRNA has emerged as a promising therapeutic tool in the fields of vaccine development and protein replacement therapy. The principle of gene therapy is to deliver genes in the form of pDNA or mRNA into cells using viruses, liposomes, or antisense technology, allowing them to function as therapeutic agents (Dunbar, CE et al., Science 2018 1:12).

[0004] mRNA therapeutics have advantages over DNA therapeutics and viral therapeutics in terms of stability, efficiency, and productivity. First, because mRNA is generated in the cytoplasm, there is a low probability of mutations due to infection or genomic DNA insertion. Second, because mRNA can be modified in various ways in the cytoplasm, it can adjust half-life, increase the amount of translated protein, and increase intracellular stability. Third, because mRNA is easily used in in vitro experiments, it has the advantage of enabling rapid development and GMP production, facilitating mass production (Wang, Y., Su et al. Molecular therapy 2013 358-367).

[0005] mRNA is an RNA that transfers genetic information from DNA to ribosomes and expresses proteins through the mRNA-mediated translation process. Recombinant mRNA for therapeutic or vaccine development is produced from linear DNA using a promoter and RNA polymerase, such as (but not limited to) T7 or SP6, followed by in vitro transcription, where 5' capping and poly(A) adenylation are performed. The mRNA thus produced has a structure similar to that of mature mRNA in the cytoplasm, consisting of a 5' capping, 5' untranslated region (UTR), 3' UTR, poly(A), and the target gene to be expressed. The untranslated region (5' or 3' untranslated region) affects mRNA stability and translational activation, increasing its half-life and expression level, depending on the sequence. Furthermore, poly(A) prevents mRNA degradation in the cytoplasm, enhancing stability and expression. Therefore, in order for mRNA therapeutics to efficiently and stably express proteins in the body, it is important to find the optimal untranslated region sequence and poly(A) length (Pardi, N et al., Nature reviews 2018 261-279).

[0006] Against this technical background, the inventors of the present application developed a gene construct containing a 5' untranslated region (UTR) and / or a 3' untranslated region (UTR) derived from a coronavirus (SARS-CoV-2), and completed the present invention. Summary of the Invention [Problem to be solved by the invention]

[0007] An object of the present invention is to provide a gene construct comprising a 5' untranslated region (UTR) and / or a 3' untranslated region (UTR) derived from a coronavirus.

[0008] An object of the present invention is to provide a vector containing the gene construct.

[0009] An object of the present invention is to provide a pharmaceutical composition containing the gene construct.

[0010] An object of the present invention is to provide a vaccine composition comprising said gene construct.

[0011] An object of the present invention is to provide a composition for gene therapy containing the above gene construct. [Means for solving the problem]

[0012] To achieve the above object, the present invention provides a gene construct comprising a coding region for mRNA expression of a target gene; a 5' untranslated region (UTR) located upstream of the coding region; and a 3' untranslated region (UTR) located downstream of the coding region, wherein the 5' untranslated region (UTR) comprises a coronavirus leader sequence.

[0013] The present invention also provides a vector containing the gene construct.

[0014] The present invention also provides a pharmaceutical composition containing the gene construct, and a vaccine composition containing the gene construct.

[0015] The present invention also provides a composition for gene therapy containing the gene construct. [Brief explanation of the drawings]

[0016] [Figure 1] Schematic diagram of coronavirus structure and SARS-CoV-2 genomic and subgenomic RNA expression. (A) shows the structure of the coronavirus and the mRNA levels of each protein analyzed by Northern blot. (B) shows the SARS-CoV-2 genomic RNA structure and representative subgenomic RNAs expressed from it.

[0017] [Figure 2] Schematic diagram of template DNA for mRNA expression.

[0018] [Figure 3] FIG. 1 shows a process for preparing template DNA by PCR for mRNA expression of EGFP gene.

[0019] [Figure 4] This is a diagram showing the process of preparing template DNA by PCR for mRNA expression of the SARS-CoV-2N gene.

[0020] [Figure 5] FIG. 1 shows a process for preparing template DNA by PCR for mRNA expression of the human ADCYAP1 gene.

[0021] [Figure 6] This figure shows the mRNA expression of the control, EGFP, ADCYAP1, and N genes confirmed by the IVT (in vitro transcription) method.

[0022] [Figure 7] The GFP mRNA prepared in FIG. 6 was transfected into a HeLa cell line, and the expression of GFP protein was confirmed by imaging and Western blot.

[0023] [Figure 8] FIG. 7 is a diagram showing that the ADCYAP1 gene mRNA prepared in FIG. 6 was transfected into HeLa cell line, and the ADCYAP1 protein was expressed, which inhibited the growth of cervical cancer cells, as confirmed by Western blot.

[0024] [Figure 9] FIG. 7 is a diagram showing that the N gene mRNA prepared in FIG. 6 was transfected into HeLa cell line, and the ADCYAP1 protein was expressed, thereby suppressing the growth of cervical cancer cells, as confirmed by Western blot. DETAILED DESCRIPTION OF THE INVENTION

[0025] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one skilled in the art to which this invention belongs. Generally, the nomenclature used herein is well known and commonly used in the art.

[0026] The recent global outbreak of COVID-19 is caused by infection with SARS-CoV-2, a variant of coronavirus. Coronaviruses have a genetic structure consisting of approximately 30 kb of (+)RNA covered by N (nucleocapsid) protein. Above this, M (membrane) protein and E (envelope) protein form a membrane with lipids, and spike proteins protrude from the outside, giving the coronavirus an external shape similar to that of a crown (Figure 1).

[0027] After infection, coronavirus genomic RNA enters cells and immediately begins to function as mRNA. Transcription occurs at the orf1b (open reading frame 1b) located at the top of the front end, producing RdRP (RNA-dependent RNA polymerase), an enzyme that can synthesize RNA using RNA as a template (Imbert et al., EMBO Journal, 2006, 25:4933-4942).

[0028] Therefore, RdRP uses the genomic RNA that has entered the cell as a template to synthesize a negative strand genomic RNA of the same length through a replication process. The negative strand genomic RNA thus produced serves as a template for further transcription, producing various mRNAs that can produce various proteins.

[0029] Although the transcriptional mechanism model for coronaviruses has not yet been clearly established, looking at the life cycle of the virus after infection, it is known that there are multiple subgenomic RNAs within the cell that act as mRNAs required to produce each of the necessary proteins (S, E, M, N) (Krzysztof Pyrc et al., Virology Journal 2004, 1:7).

[0030] In terms of structural characteristics, all subgenomic RNAs differ in length, but the rear (3' end) regions of all subgenomic RNAs share the 3'UTR region common to the genomic RNA.

[0031] In addition, a leader sequence consisting of a short length (approximately 75 nucleotides) is present at the front (5' end) of the genomic RNA, and this is also characteristically added to the front of all subgenomic RNAs. Characteristically, all subgenomic RNAs have an intergenic sequence between the protein-coding sequence and the leader sequence, and the leader sequence and intergenic sequence act as a 5'UTR that can be recognized by ribosomes during protein expression, and all subgenomic RNAs contain a 3'UTR sequence at their 3' ends.

[0032] Therefore, we constructed mRNA by linking a SARS-CoV-2 leader sequence and intergenic sequence that can function as a 5'UTR, followed immediately by the coding sequence of the gene to be expressed, the SARS-CoV-2 3'UTR sequence, and a poly(A) sequence. We confirmed that when this mRNA was introduced into cells, it was possible to express the desired protein (Figure 1). Furthermore, leader sequences from human coronaviruses 229E, OC43, HKU1, NL63, SARS-1, and MERS can also be used as the 5'UTR.

[0033] In this case, to express the mRNA of the desired target gene in vitro, a promoter sequence (T7, SP7, etc.) can be linked to the 5' end of the sequence, and the mRNA of the target gene can be produced by in vitro transcription (IVT).

[0034] Based on this, the present invention relates to a gene construct comprising a coding region for expressing mRNA of a target gene; a 5' untranslated region (UTR) located upstream of the coding region; and a 3' untranslated region (UTR) located downstream of the coding region, wherein the 5' untranslated region (UTR) comprises a coronavirus leader sequence.

[0035] Regarding the leader sequence, coronavirus genomic RNA and each transcribed subgenomic mRNA commonly have a leader sequence of approximately 72 to 77 bp at their 5' ends. This is a unique feature of coronaviruses and is the most abundant target of viral sequences in infected cells. This is because all coronavirus subgenomic RNAs exhibit a leader joining phenomenon, in which a leader sequence corresponding to approximately 72 bp derived from the 5' end of the genomic RNA binds to the 5' end of each subgenomic RNA. Therefore, the leader sequence has the highest replication number among all viral genes in cells, followed by the subgenomic RNA encoding the N protein.

[0036] Specifically, the 5' untranslated region (UTR) relates to a gene structure containing the leader sequence of coronavirus (SARS-CoV-2: Severe acute respiratory syndrome coronavirus 2) represented by SEQ ID NO: 1.

[0037] The leader sequence comprises the sequence represented by SEQ ID NO: 1 (ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACG).

[0038] As used herein, "nucleic acid" preferably refers to DNA or RNA. In connection with nucleic acids, the terms "polynucleotide," "nucleotide," "nucleotide sequence," and "oligonucleotide" are used interchangeably. A polynucleotide can have any length of polymeric form of nucleotides, deoxyribonucleotides or ribonucleotides, or analogs thereof. A polynucleotide can have any three-dimensional structure and can perform any function, known or unknown. A polynucleotide can contain one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. Modifications to the nucleotide structure are possible before or after assembly of the polymer.

[0039] Preferably, a nucleic acid is a polymer comprising or consisting of nucleotide monomers covalently linked to each other by phosphodiester linkages in a sugar / phosphate backbone. "Nucleic acid" also includes modified nucleic acids, such as base-modified, sugar-modified, or backbone-modified DNA or RNA molecules.

[0040] DNA is an abbreviation for deoxyribonucleic acid. It is a nucleic acid molecule, i.e., a polymer composed of nucleotides. These nucleotides are usually deoxyadenosine monophosphate, deoxythymidine monophosphate, deoxyguanosine monophosphate, and deoxycytidine monophosphate monomers, consisting of a sugar (deoxyribose), a base, and a phosphate, and are polymerized with a specific backbone structure. The backbone structure is typically formed by first, the sugar portion of the nucleotide, i.e., deoxyribose, and second, the phosphate portion, and a phosphodiester bond between adjacent monomers. The specific order of the monomers, i.e., the order of each base linked to the sugar / phosphate backbone, is called the DNA sequence. DNA can be single-stranded or double-stranded. In the double-stranded form, nucleotides of the first strand typically hybridize with nucleotides of the second strand, for example, by A / T base pairing and G / C base pairing.

[0041] The RNA includes, for example, mRNA. RNA is usually an abbreviation for ribonucleic acid. It is a nucleic acid molecule, i.e., a polymer composed of nucleotides. Nucleotides are usually adenosine monophosphate, uridine monophosphate, guanosine monophosphate, and cytidine monophosphate monomers linked to each other via a so-called backbone. The backbone is formed by a phosphodiester bond between, first, a sugar, e.g., ribose, and, second, the phosphate moiety of an adjacent monomer. The specific sequence of each monomer is called an RNA sequence. RNA is usually obtained, for example, within cells, by transcription of a DNA sequence. In eukaryotic cells, transcription typically occurs in the nucleus or mitochondria. In vivo, DNA transcription can usually be processed into mRNA, messenger RNA. For example, RNA processing within eukaryotic cells includes various post-transcriptional modifications such as splicing, 5'-capping, polyadenylation, and export from the nucleus, mitochondria, and the like. Messenger RNA usually provides a nucleotide sequence that can be translated into the amino acid sequence of a specific peptide or protein. Typically, mRNA contains a 5'-cap, a 5'UTR, an open reading frame, a 3'UTR, and a poly(A) sequence. Aside from messenger RNA, there are several non-coding forms of RNA that may be involved in the regulation of transcription and / or translation.

[0042] 5'UTR is located 5' of an open reading frame. 5'UTR begins at the transcription initiation site and ends at the nucleotide before the start codon of the open reading frame. 5'UTR can contain elements that regulate gene expression, such as a ribosome binding site. 5'UTR can be post-transcriptionally modified, for example, by adding a 5'-cap. 5'UTR corresponds to the sequence of mature mRNA located between the 5'-cap and the start codon.

[0043] The 5' untranslated region (UTR) is a combination of the SARS-CoV-2 leader sequence and the intergenic sequence, and may include one or more sequences selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 4.

[0044] The 3'UTR is typically a portion of an mRNA located between the protein-coding region (i.e., open reading frame) and the poly(A) sequence. The 3'UTR of an mRNA is not translated into an amino acid sequence. The 3'UTR sequence is usually encoded by the gene, which is transcribed into mRNA during the gene expression process. The gene sequence is preferentially transcribed into mRNA containing alternative introns. The mRNA then undergoes steps such as 5'-capping, splicing, and 3'-end modifications such as 3'-end polyadenylation, as well as alternative endo- or exonucleolytic degradation. The 3'UTR is located immediately 3' to the stop codon of the protein-coding region and includes the nucleotides immediately 5' to the poly(A) sequence.

[0045] The 3' untranslated region (UTR) may comprise the 3' UTR sequence of SARS-CoV-2 and may comprise the sequence of SEQ ID NO:5.

[0046] Typically, the 3' untranslated region (UTR) can be a sequence of several nucleotide triplets that can be translated into a peptide or protein. An open reading frame preferably comprises an initiation codon, i.e., a combination of three subsequent nucleotides generally encoding the amino acid methionine (ATG or AUG) at its 5'-end, and a subsequent region usually exhibiting a length that is a multiple of three nucleotides. The ORF preferably terminates with a stop codon (e.g., TAA, TAG, TGA). This is the only stop codon in the open reading frame. Therefore, in the context of the present invention, an open reading frame is a nucleotide sequence consisting of a number of nucleotides that can be divided into three, preferably starting with an initiation codon (e.g., ATG or AUG) and preferably ending with a stop codon (e.g., TAA, TGA, or TAG, or UAA, UAG, or UGA, respectively). An open reading frame can be separated or combined into a longer nucleic acid sequence, such as a vector or mRNA. An open reading frame can also be referred to as a "polypeptide or protein coding region."

[0047] According to the present invention, it may further comprise a promoter and / or a poly(A) sequence.

[0048] The promoter may be located upstream of the 5' untranslated region (UTR). The promoter may include elements necessary for transcription, such as an RNA polymerase promoter. The promoter may include a phage RNA polymerase promoter such as SP6 or T7, preferably a T7 promoter encoding an mRNA sequence.

[0049] The length of the poly(A) sequence can vary. For example, the poly(A) sequence can be about 20 to about 300 adenine nucleotides, preferably about 40 to about 200, 60, 70, 80, 90, or 100 adenine nucleotides, more preferably about 50 to about 100, or about 20 to about 400 adenine nucleotides.

[0050] The poly(A) sequence may be located downstream of the 3' untranslated region (UTR), for example, the poly(A) sequence may be linked directly or via a linker, for example, via a linker of 1 to 50, preferably 1 to 20, nucleotides, or via a stretch of nucleotides, such as 2, 4, 6, 8, 10, 20, etc. nucleotides.

[0051] In a specific embodiment, the gene construct of the present invention may comprise a 5'-to-3'-direction structure of 5'-promoter-5'UTR-coding region (ORF)-3'UTR-poly(A). Specifically, to express mRNA of a target gene by in vitro transcription (IVT) using the 5'UTR and 3'UTR sequences of SARS-CoV-2, a template DNA composed of the sequence 5'-T7 promoter-5'UTR-target gene-3'UTR-poly(A) can be prepared.

[0052] The present invention also relates to a vector comprising the gene construct. The vector may be an expression vector, a cloning vector, etc. The vector may be used to produce an expression product such as mRNA or a peptide, polypeptide, or protein. The vector may comprise a promoter sequence, e.g., a sequence required for transcription of a sequence stretch of the vector, such as an RNA promoter sequence. The vector may be, for example, an RNA vector or a DNA vector. The vector may be a viral vector or a plasmid vector.

[0053] The vector may be a circular molecule or may include a double-stranded molecule. Circular and double-stranded DNA molecules can be easily used as storage forms for original artificial nucleic acid molecules. The vector can be used to transform cells, for example, cultured cells. The vector can be used for in vitro transcription to obtain artificial RNA molecules. The circular vector can be linearized, for example, by restriction enzyme digestion.

[0054] Optionally, the vector may contain sequences suitable for amplification of the vector, such as a cloning site, a selectable marker such as an antibiotic resistance factor, and an origin of replication.

[0055] The vectors are suitable for transcription using eukaryotic, prokaryotic, viral, or phage transcription systems, such as eukaryotic, prokaryotic, viral, or phage in vitro transcription systems. In some cases, the vectors are suitable for in vitro transcription using phage based in vitro transcription systems, such as T7 RNA polymerase based in vitro transcription systems.

[0056] The vector can be delivered to cells by various methods known in the art, including, but not limited to, microinjection, electroporation, DEAE-dextran treatment, lipofection, nanoparticle-mediated transfection, protein transduction domain-mediated introduction, and PEG-mediated transfection.

[0057] As the vector, known expression vectors such as a plasmid vector, a cosmid vector, or a bacteriophage vector can be used, and the vector can be easily produced by a person skilled in the art by any known method using DNA recombination technology.

[0058] A recombinant expression vector can contain a nucleic acid in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vector contains one or more regulatory elements that can be selected based on the host cell to be used for expression, i.e., operably linked to the nucleic acid sequence to be expressed.

[0059] Within a recombinant expression vector, "operably linked" means that the nucleotide sequence of interest is linked to regulatory elements in a manner that allows expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or in a host cell when the vector is introduced into a host cell).

[0060] The recombinant expression vector may contain a T7 promoter and may be in a form suitable for messenger RNA synthesis, meaning that it contains one or more regulatory elements that allow in situ mRNA synthesis, i.e., that messenger RNA can be synthesized by T7 polymerase.

[0061] "Regulatory elements" can include promoters, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, e.g., polyadenylation signals and poly-U sequences). Regulatory elements include elements that direct inducible or constitutive expression of a nucleotide sequence in many types of host cell, and elements that direct expression of a nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences).

[0062] Specifically, the regulatory element may comprise a gene construct comprising the sequence of SEQ ID NO: 18 or 19.

[0063] The nucleic acid may be injected in the form of ribonucleic acid, for example, messenger ribonucleic acid (mRNA). The nucleic acid according to the present invention may be in the form of mRNA, which allows transient protein expression.

[0064] In another aspect, the present invention relates to a vaccine composition comprising the above gene construct.

[0065] In another aspect, the present invention relates to a composition for gene therapy comprising the above gene construct.

[0066] The composition may include a delivery means for delivering the mRNA expressed in the composition.

[0067] The expressed mRNA can be delivered via nanoparticles, for example, gold nanoparticles.

[0068] The gold nanoparticles have a deformable surface. Specific examples of the deformable surface are given in Acc Chem Res. 2019 June 18; 52(6): 1496-1506 and Pharmaceutics 2021, 13, 900, which are incorporated herein by reference.

[0069] The mRNA can be linked to gold nanoparticles, complexed with a cationic endosomal disruptive polymer, and delivered to cells (Nature Biomedical Engineering, volume 1, pages 889-901 (2017)). The cationic endosomal disruptive polymer can be, for example, polyethyleneimine, poly(arginine), poly(lysine), poly(histidine), poly-[2-{(2-aminoethyl)amino}-ethyl-aspartamide] (pAsp(DET)), a block copolymer of poly(ethylene glycol) (PEG) and poly(arginine), a block copolymer of PEG and poly(lysine), or a block copolymer of PEG and poly{N-[N-(2-aminoethyl)-2-aminoethyl]aspartamide} (PEG-pAsp(DET)).

[0070] In some cases, gold particles whose surfaces have been modified with arginine can be used.

[0071] Arginine-modified gold particles can be assembled with a nucleic acid cleavage enzyme or a polynucleotide encoding the enzyme and / or a cleavage factor or a polynucleotide encoding the enzyme, and the resulting product fuses with the membrane of the target cell and moves into the cytoplasm (ACS Nano. 2017, 11:2452-2458).

[0072] The expressed mRNA can be delivered via liposomes, lipid nanoparticles (LNPs), or various nanoparticles. Liposomes or LNPs contain cationic lipids, non-cationic lipids, or neutral lipids, and may further contain other lipids such as polyethylene glycol (PEG) or cholesterol. Such mRNA delivery vehicles are specifically described in U.S. Patent Publication Nos. 2018 / 0311176, 2019 / 0032051, and 2021 / 0046192, and International Patent Publication Nos. WO2018 / 081480, WO2020 / 097540, WO2020 / 097548, and WO2021 / 007278, which are incorporated herein by reference.

[0073] The cationic lipids are specifically exemplified in U.S. Patent Publication Nos. 2018 / 0311176 and 2019 / 0032051, and examples thereof include N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N- Dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-dilinoleyloxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-dilinoleyloxy-3-morpholinopropane (DLin-MA), 1,2-dilinoleoyl-3-di methylaminopropane (DLinDAP), 1,2-dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N -dilinoleylamino-1,2-propanediol (DLinAP), 3-(N,N-dioleylamino)-1,2-propanediol (DOAP), 1,2-dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-Octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (MC3), 1,1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1), 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane, β-L-arginyl-2,3-L-diaminopropionic acid-N-palmityl-N-oleylamide trihydrochloride, N',N'-dioctadecyl-N-4,8-diaza-10-aminodecanoylglycinamide

[71] , 1,2-Dilinoleyloxy-3-dimethylaminopropane, DLin-KC2-DMA, aminolipid 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA,1), 1,2-distearyloxy- / V,N-dimethylaminopropane (DSDMA), dilinoleylmethyl-4-dimethylaminobutyrate (DLin-MC3-DMA), DLin-D-DMA, C12-200, 98N12-5, (20Z,23Z)-N,N-dimethylnonacosa-20,23-dien-10-amine, (17Z,20Z)-N,N-dimethylhexacosa-17,20-dien-9-amine, (1Z,19Z)-N,N-dimethylpentacosa-16,19-dien-8-amine, (13Z,1 6Z)-N,N-Dimethyldocosa-13,16-dien-5-amine, (12Z,15Z)-N,N-Dimethylhenicosa-12,15-dien-4-amine, (14Z,17Z)-N,N-Dimethyltricosa-14,17-dien-6-amine, (15Z,18Z)-N,N-Dimethyltetracosa-15,18-dien-7-amine, (18Z,21Z)-N,N-Dimethylheptacosa-18,21-dien-10-amine, (15Z,18Z)-N,N-Dimethyltetracosa-15,18-dien-5-amine, (14Z,17Z)-N,N-Dimethyltricosa-14,17-dien-4-amine, (19Z,22Z)-N,N-dimethyloctacosa-19,22-dien-9-amine, (18Z,21Z)-N,N-dimethylheptacosa-18,21-dien-8-amine, (17Z,20Z)-N,N-dimethylhexacosa-17,20-dien-7-amine, (16Z,19Z)-N,N-dimethylpentacosa-16,19-dien-6-amine, (22Z,25Z)-N,N-dimethylhentriaconta-22,25-dien-10-amine, (21Z,24Z)-N,N-dimethyltriaconta-21,24-dien-9-amine, (18Z)-N,N-dimethylheptacosa-17,20-dien-7-amine N,N-dimethylheptacos-18-en-10-amine, (17Z)-N,N-dimethylhexacos-17-en-9-amine, (19Z,22Z)-N,N-dimethyloctacosa-19,22-dien-7-amine, N,N-dimethylheptacosane-10-amine, (20Z,23Z)-N-ethyl-N-methylnonacosa-20,23-dien-10-amine, 1-[(11Z,14Z)-1-nonylicosa-11,14-dien-1-yl]pyrrolidine, (20Z)-N,N-dimethylheptacos-20-en-10-amine, (15Z)-N,N-dimethylheptacosa (14Z)-N,N-dimethylnonacos-14-en-10-amine, (17Z)-N,N-dimethylnonacos-17-en-10-amine, (24Z)-N,N-dimethyltritriacont-24-en-10-amine, (20Z)-N,N-dimethylnonacos-20-en-10-amine, (22Z)-N,N-dimethylpentriacont-22-en-10-amine, (16Z)-N,N-dimethylpentacos-16-en-8-amine, (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12, 15-dien-1-amine, (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine, 1-[(1S,2R)-2-hexylcyclopropyl]-N,N-dimethylnonadecan-10-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]nonadecan-10-amine, N,N-dimethyl-21-[(1S,2R)-2-octylcyclopropyl]henicosan-10-amine, N,N-dimethyl-1-[(1S,2S)-2-{[(1R,2R)-2-pentylcyclopropyl]methyl}cyclopropyl]nonadecan-10-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]hexadecan-8-amine, N,N-dimethyl-[(1R,2S)-2-undecylcyclopropyl]tetradecan-5-amine, N,N-dimethyl-3-{7-[(1S,2R)-2-octylcyclopropyl]heptyl}dodecan-1-amine, 1-[(1R,2S)-2-heptylcyclopropyl]-N,N-dimethyl 1-[(1S,2R)-2-decylcyclopropyl]-N,N-dimethylpentadecan-6-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]pentadecan-8-amine, RN,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octyloxy)propan-2-amine, SN,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octyloxy)propan-2-amine, 1-{2-[ (9Z,12Z)-Octadeca-9,12-dien-1-yloxy]-1-octyloxy)methyl]ethyl}pyrrolidine, (2S)-N,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-[(5Z)-oct-5-en-1-yloxy]propan-2-amine, 1-{2-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-1-[(octyloxy)methyl]ethyl}azetidine, (2S)-1-(hexyloxy)-N,N-dimethyl-3-[(9Z,12Z)-oct- tadeca-9,12-dienyloxy]propan-2-amine, (2S)-1-(heptyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl-1-(nonyloxy)-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl-1-[(9Z)-octadec-9-en-1-yloxy]-3-(octyloxy)propan-2-amine; (2S)-N,N-dimethyl-1-[(6Z,9Z,12Z)-Octadeca-6,9,12-trien-1-yloxy]-3-(octyloxy)propan-2-amine, (2S)-1-[(11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N-dimethyl-3-(pentyloxy)propan-2-amine, (2S)-1-(hexyloxy)-3-[(11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N-dimethylpropan-2-amine, 1-[(11Z,14Z)-icosa-11,14-dien-1-yloxy]- N,N-dimethyl-3-(octyloxy)propan-2-amine, 1-[(13Z,16Z)-docosa-13,16-dien-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, (2S)-1-[(13Z,16Z)-docosa-13,16-dien-1-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amine, (2S)-1-[(13Z)-docosa-13-en-1-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amine, 1-[(13Z)-docos-13-en-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, 1-[(9Z)-hexadec-9-en-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, (2R)-N,N-dimethyl-H(1-methoyloctyl)oxy]-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, (2R)-1-[(3,7-dimethyloctyl)oxy]-N,N-dimethyl-3- [(9Z,12Z)-Octadeca-9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl-1-(octyloxy)-3-({8-[(1S,2S)-2-{[(1R,2R)-2-pentylcyclopropyl]-methyl}cyclopropyl]octyl}oxy)propan-2-amine, N,N-dimethyl-1-{[8-(2-octylcyclopropyl)octyl]oxy}-3-(octyloxy)propan-2-amine and (11E,20Z,23Z)-N,N-dimethylnonacosa-11,20,2-Trien-10-amine, 5-carboxyspermylglycine dioctaoleoylamide ("DOGS"), dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide ("DPPES"), 1,2-dimyristyloxypropyl-3-dimethyl-hydroxyethylammonium bromide (DMRIE), DMRIE-HP, Lipofectamine (DOSPA), 3b-(N-(N',N'-dimethylaminoethane)-caprylamide, (DC-Choi) N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), 1,2-dioleoyl-3-dimethylammonium-propane (DODAP), DMDMA, cationic lipid-based transfection reagent TransIT-TKO, LIPOFECTIN, lipofectamine, OLIGOFECTAMINE or DHARMAFECT, DSDMA, DODMA, DLinDMA, DLenDMA, ga The DMA may be, but is not limited to, mma-DLenDMA, DLin-K-DMA, DLin-K-C2-DMA (also known as DLin-C2K-DMA, XTC2, and C2K), DLin-K-C3-DMA, DLin-K-C4-DMA, DLen-C2K-DMA, y-DLen-C2K-DMA, DLin-M-C2-DMA (also known as MC2), DLin-M-C3-DMA (also known as MC3), or (DLin-MP-DMA) (also known as 1-B11), or mixtures thereof.

[0074] Specific examples of the non-cationic lipid are given in U.S. Patent Publication Nos. 2018 / 0311176 and 2019 / 0032051, and may be, for example, phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoylphosphatidylethanolamine, N-succinylphosphatidylethanolamine, N-glutarylphosphatidylethanolamine, or lysylphosphatidylglycerol. In some cases, the non-cationic lipid may be, for example, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans The phosphatidyl ester may be, but is not limited to, PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), cholesterol, phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoylphosphatidylethanolamine, N-succinylphosphatidylethanolamine, N-glutarylphosphatidylethanolamine, lysylphosphatidylglycerol, or palmitoyloleoylphosphatidylglycerol (POPG).

[0075] The neutral lipids are specifically exemplified in U.S. Patent Publication Nos. 2018 / 0311176 and 2019 / 0032051, and may include, but are not limited to, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, dihydrosphingomyelin, cephalin, or cerebroside.

[0076] PEG-fat may be included to prevent aggregation of particles generated during mRNA delivery. PEG-fat is specifically exemplified in U.S. Patent Publication Nos. 2018 / 0311176 and 2019 / 0032051, and may be, for example, PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), or a mixture thereof. As a non-limiting example, PLGA may be conjugated to lipid-terminating PEG to form PLGA-DSPE-PEG. In addition, the PEG lipids were PEG-c-DOMG, 1,2-dimyristoyl-sn-glycerol, methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol (PEG-DSG), PEG-c-DOMG, 1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol (PEG-DSG), PEG-c-DOMG, 1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol (PEG-DSG), 1,2-dipalmito ... The PEG may be selected from PEG-lipid conjugates such as polyethylene glycol (PEG-DPG), dialkyloxypropyl-conjugated PEG (e.g., PEG-DAA conjugates), diacylglycerol-conjugated PEG (e.g., PEG-DAG conjugates), cholesterol-conjugated PEG, phosphatidylethanolamine-conjugated PEG, ceramide-conjugated PEG, cationic PEG lipids, polyoxazoline (POZ)-lipid conjugates, polyamide oligomers (e.g., ATTA-lipid conjugates), and mixtures thereof. The PEG may be, but is not limited to, PEG-dilauryloxypropyl (C12), PEG-dimyristyloxypropyl (C14), PEG-dipalmityloxypropyl (C16), PEG-distearyloxypropyl (C18), PEG-c-DOMG, PEG-DMG, or mixtures thereof.

[0077] Peptides can be used for the mRNA transfer. The peptide must have a cation that can electrostatically interact with the anionic phosphate group of the nucleic acid, and can contain positively charged amino acids to electrostatically interact with the phosphate group. Specific details of peptides that can be used for mRNA transfer are described in AIMS Biophysics, 7(4):323-338, which is incorporated herein by reference.

[0078] The peptide usable for the mRNA delivery can include protamine. Protamine is a small nuclear protein rich in cationic arginine, which contributes to the stability of DNA during sperm formation in the testes, and protamine can stabilize mRNA molecules and deliver them efficiently. U.S. Patent Registration No. 9352028 specifically describes a protamine-mRNA complex, which is incorporated herein by reference.

[0079] Cell-penetrating peptides (CPPs) may also be promising cationic molecules for mRNA delivery. Amphipathic CPPs such as the arginine-rich RALA peptide (WEARLARALARALARHLARALARALRACEA), RALA, LAH4 (KKALLALALHHLAHLALHLALALKKA), and LAH4-L1 (KKALLAHALHLLALLALHLAHALKKA) can be used to deliver mRNA molecules.

[0080] In some cases, a peptide may be further included in addition to the liposome or LNP (lipid nanoparticle) for mRNA delivery. The peptide provides nucleic acid packaging and prevents DNA or RNA from being degraded intracellularly or extracellularly. Examples of such peptides are specifically described in U.S. Patent Publication No. 2021 / 0170046, which is incorporated herein by reference, but are not limited thereto. The composition may further include one or more pharmaceutically acceptable carriers. The pharmaceutically acceptable carrier must be compatible with the active ingredient of the present invention and may include saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, or any combination of these. Other common additives, such as antioxidants, buffers, and bacteriostats, may also be added as needed. In addition, diluents, dispersants, surfactants, binders, and lubricants may be added to the composition to prepare an injectable dosage form such as an aqueous solution, suspension, or emulsion. It is particularly preferable to provide the composition in a lyophilized form. To prepare a lyophilized dosage form, methods commonly known in the art to which the present invention pertains can be used, and stabilizers for lyophilization may be added. Furthermore, the composition may be formulated according to the disease or component, using appropriate methods in the art or the methods disclosed in Remington's Pharmaceutical Sciences (Mack Publishing Company, Easton PA).

[0081] The amount of active ingredients contained in the composition of the present invention and the method of administration can be determined by a person skilled in the art based on the symptoms and severity of the disease of a typical patient. The composition can be formulated into various forms such as powder, tablets, capsules, liquids, injections, ointments, syrups, etc., and can be provided in unit-dose or multi-dose containers, such as sealed ampoules and bottles.

[0082] The composition of the present invention can be administered orally or parenterally. The administration route of the composition of the present invention includes, but is not limited to, bronchial, oral, intravenous, intramuscular, intraarterial, intramedullary, intradural, intracardiac, transdermal, subcutaneous, intraperitoneal, intestinal, sublingual, or topical administration. The dosage of the composition of the present invention varies depending on the patient's weight, age, sex, health condition, diet, administration time, method, excretion rate, or disease severity, and can be easily determined by one of ordinary skill in the art. Furthermore, the composition of the present invention can be formulated into an appropriate dosage form for clinical administration using known techniques. [Example]

[0083] The present invention will be described in more detail below through examples. It will be obvious to those skilled in the art that these examples are merely for the purpose of illustrating the present invention and should not be construed as limiting the scope of the present invention.

[0084] Example 1. cDNA synthesis to confirm the 5'UTR and 3'UTR sequences of SARS-CoV-2 subgenomic RNA

[0085] To confirm the 5'UTR and 3'UTR sequences of SARS-CoV-2 subgenomic RNA, Vero cells were infected with SARS-CoV-2 and cultured. Total RNA was isolated from the cells and received from Chungnam National University's College of Veterinary Medicine (BSL3). To synthesize cDNA from this, 1 μg of extracted total RNA was added with 0.5 μg of oligo-dT to a total volume of 12.5 μl, which was then incubated on ice at 65°C for 5 minutes. 4 μL of 5X reaction buffer, 1 mM dNTP mix, and 1 μL of RevertAid H Minus Reverse Transcriptase (Enzynomics, Daejeon, South Korea) were added to the reaction mixture to a total volume of 20 μl. Reverse transcription was performed at 42°C for 60 minutes and then at 70°C for 10 minutes to synthesize single-stranded cDNA.

[0086] PCR was performed to amplify cDNA containing the 5'UTR and 3'UTR of the N, S, and E genes of SARS-CoV-2 from the cDNA produced. The primer sequences used for PCR are listed in Table 1.

[0087] [Table 1]

[0088] PCR reactions were performed in a total volume of 20 μl containing 1 ng of synthesized cDNA, 10 pmoles of forward primer (SEQ ID NO: 7), 10 pmoles of reverse primers (SEQ ID NOs: 7 to 9), and 10 μl of 2X pfu Master Mix (Biofact, Daejeon, South Korea). The PCR reaction conditions were as follows: 95°C for 2 minutes (1 cycle); 95°C for 20 seconds, 60°C for 40 seconds, and 72°C for 1 minute (30 cycles); 72°C for 5 minutes. The PCR product was ligated into pTOP Blunt V2 vector (Enzynomics, Daejeon, South Korea) and then transformed into DH5α (Enzynomics, Daejeon, South Korea). After transformation, the transformants were plated onto solid medium (Bioloard, Daejeon, South Korea) containing ampicillin (50 μg / ml, Sigma-Aldrich, USA) and cultured at 37°C for 8 hours. Plasmid DNA was then extracted using the HiGene™ Plasmid Mini Prep Kit (Ver. 2.0) (Biofact, Daejeon, South Korea) and subjected to Sanger sequencing.

[0089] Example 2. Confirmation of the 5'UTR and consensus 3'UTR sequences of the N, S, and E genes of SARS-CoV-2 through Sanger sequencing

[0090] [Table 2]

[0091] 3'UTR 5'- CAATCTTTAATCAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCACCGAGGCCACGCGGAGTACGATCGAGTGTACAGTGAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAATTTTAGTAGTGCTATCCCCATGTGATTTTAATAGCTTCTTAGGAGAATGAC-3' (SEQ ID NO: 5)

[0092] Example 3. Preparation of IVT template for GFP mRNA expression

[0093] To prepare an IVT template for GFP mRNA expression, the GFP gene coding sequence was ligated immediately after the 5'UTR of the SARS-CoV-2 N gene, followed by PCR ligation of the SARS-CoV-2 3'UTR sequence and a poly(A) sequence (65 nucleotides) (Figure 3).

[0094] To achieve this, a T7 promoter sequence (SEQ ID NO: 10: 5'-TAATACGACTCACTATAGGG-3') was ligated to the 5'UTR of the N gene by PCR. 1 ng of plasmid DNA containing the N gene prepared in Example 1 was used as a template, and 10 pmoles of forward primer (SEQ ID NO: 6), 10 pmoles of reverse primer (SEQ ID NO: 11), and 10 μL of 2X pfu master mix (Biofact, Daejeon, South Korea) were added. The PCR (Applied Biosystem) reaction conditions were as follows: 95°C for 2 minutes (1 cycle); 95°C for 20 seconds, 60°C for 40 seconds, and 72°C for 1 minute (30 cycles); 72°C for 5 minutes. The PCR products were confirmed by electrophoresis on a 2% agarose gel. The 3'UTR sequence of the N gene was determined by adding 1 ng of the plasmid DNA containing the N gene prepared in Example 1 to 10 pmoles of the forward primer (SEQ ID NO: 12), 10 pmoles of the reverse primer (SEQ ID NO: 13), and 10 μL of 2X pfu master mix (Biofact, Daejeon, South Korea). The PCR (Applied Biosystem) reaction conditions were as follows: 95°C for 2 minutes (1 cycle); 95°C for 20 seconds, 60°C for 40 seconds, and 72°C for 1 minute (30 cycles); 72°C for 5 minutes. The PCR product was confirmed by agarose gel electrophoresis (2%). The GFP gene was prepared using 1 ng of pFGFP N1 (Clontech) containing the GFP gene as a template. 10 pmoles of a forward primer (SEQ ID NO: 14) that linked the 3'-end sequence of the 5' UTR to the 5'-end sequence of the GFP gene, 10 pmoles of a reverse primer (SEQ ID NO: 15) that linked the 3'-end sequence of the GFP gene to the 5'-end sequence of the 3' UTR, and 10 μL of 2X pfu Master Mix (Biofact, Daejeon, South Korea) were added. The PCR (Applied Biosystem) reaction conditions were as follows: 95°C for 2 minutes (1 cycle); 95°C for 20 seconds, 60°C for 40 seconds, 72°C for 1 minute (30 cycles); 72°C for 5 minutes. The PCR products were confirmed by electrophoresis on a 2% agarose gel.

[0095] PCR was used to link the T7 promoter sequence, 5' UTR sequence, GFP gene sequence, 3' UTR sequence, and 65-nucleotide poly(A) sequence. Equal amounts of 100 pg of each PCR product were mixed and used as a template. 10 pmoles of a forward T7 promoter sequence primer (SEQ ID NO: 6), 10 pmoles of a reverse primer (SEQ ID NO: 16) linking the 20 nucleotides at the 3' end of the 3' UTR sequence with a 65-nucleotide poly(A) sequence, and 10 μL of 2X pfu master mix (Biofact, Daejeon, South Korea) were added. The PCR (Applied Biosystem) reaction conditions were as follows: 95°C for 2 minutes (1 cycle); 95°C for 20 seconds, 60°C for 40 seconds, 72°C for 2 minutes (30 cycles); 72°C for 5 minutes. The PCR products were confirmed by electrophoresis on a 2% agarose gel. The PCR product was ligated into pTOP Blunt V2 vector (Enzynomics, Daejeon, South Korea) and transformed into DH5α (Enzynomics, Daejeon, South Korea). After transformation, the transformed cells were plated on solid medium (Bioloard, Daejeon, South Korea) containing ampicillin (50 μg / ml, Sigma-Aldrich, USA) and cultured at 37°C for 8 hours. Plasmid DNA was extracted using the HiGene™ Plasmid Miniprep Kit (Ver. 2.0) (Biofact, Daejeon, South Korea), and the sequence of the IVT template was confirmed by Sanger sequencing (SEQ ID NO: 18).

[0096] To prepare an IVT template for control RNA expression without the target gene, 100 pg of the prepared 3'UTR DNA was used as a template. 10 pmoles of a forward primer (SEQ ID NO: 16) that combined the 3'-end sequence of the 5'UTR with the 5'-end sequence of the 3'UTR, 10 pmoles of a reverse primer (SEQ ID NO: 17) that combined 65 nucleotides from the 3'-end sequence of the 3'UTR, and 10 μL of 2X pfu Master Mix (Biofact, Daejeon, South Korea) were added. PCR (Applied Biosystems) reaction conditions were as follows: 95°C for 2 minutes (1 cycle); 95°C for 20 seconds, 60°C for 40 seconds, 72°C for 1 minute (30 cycles); 72°C for 5 minutes. The PCR products were confirmed by electrophoresis on a 2% agarose gel.

[0097] PCR was used to link the T7 promoter sequence, 5' UTR sequence, 3' UTR sequence, and 65-nucleotide poly(A) sequence. Equal amounts of 100 pg of each PCR product were mixed and used as a template. 10 pmoles of a forward T7 promoter sequence primer (SEQ ID NO: 6), 10 pmoles of a reverse primer (SEQ ID NO: 16) linking the 20 nucleotides at the 3' end of the 3' UTR sequence with a 65-nucleotide poly(A) sequence, and 10 μL of 2X pfu master mix (Biofact, Daejeon, South Korea) were added. The PCR (Applied Biosystem) reaction conditions were as follows: 95°C for 2 minutes (1 cycle); 95°C for 20 seconds, 60°C for 40 seconds, 72°C for 1 minute (30 cycles); 72°C for 5 minutes. The PCR products were confirmed by electrophoresis on a 2% agarose gel.

[0098] The PCR product was ligated into pTOP Blunt V2 vector (Enzynomics, Daejeon, South Korea) and transformed into DH5α (Enzynomics, Daejeon, South Korea). After transformation, the transformed cells were plated on solid medium (Bioloard, Daejeon, South Korea) containing ampicillin (50 μg / ml, Sigma-Aldrich, USA) and cultured at 37°C for 8 hours. Plasmid DNA was extracted using the HiGene™ Plasmid Miniprep Kit (Ver. 2.0) (Biofact, Daejeon, South Korea), and the sequence of the IVT template was confirmed by Sanger sequencing (SEQ ID NO: 19).

[0099] [Table 3]

[0100] [SEQ ID NO: 18] T7 5UTR eGFP 3'UTR oligo dT (65)

[0101] [SEQ ID NO: 19] T7 5'UTR 3'UTR oligo dT(65) TAATACGACTCACTATAGGGATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACAAACTAAACAATCTTTAATCAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCACCGAGGCCACGCGGAGTACGAT CGAGTGTACAGTGAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAATTTTAGTAGTGCTATCCCCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0102] Example 4. Preparation of IVT template for SARS-CoV-2 N gene mRNA expression

[0103] PCR was performed using 1 ng of the cDNA synthesized in Example 1 in a total volume of 20 μL. The PCR reaction was performed with 10 pmoles of forward primer (SEQ ID NO: 6), 10 pmoles of reverse primer (SEQ ID NO: 16), and 10 μL of 2X pfu master mix (Biofact, Daejeon, South Korea). The PCR conditions were as follows: 95°C for 2 minutes (1 cycle); 95°C for 20 seconds, 60°C for 40 seconds, and 72°C for 2 minutes and 30 seconds (30 cycles); 72°C for 5 minutes. The PCR product was ligated into pTOP Blunt V2 vector (Enzynomics, Daejeon, South Korea) and then transformed into DH5α (Enzynomics, Daejeon, South Korea). After transformation, the transformants were plated on solid medium (Bioloard, Daejeon, South Korea) containing ampicillin (50 μg / ml, Sigma Aldrich, USA) and cultured at 37°C for 8 hours. Plasmid DNA was extracted using the HiGene™ Plasmid Miniprep Kit (Ver. 2.0) (Biofact, Daejeon, South Korea) and subjected to Sanger sequencing (SEQ ID NO: 20).

[0104] Example 5. Preparation of IVT template for human ADCYAP1 gene mRNA expression

[0105] To prepare an IVT template for ADCYP1 mRNA expression, the ADCYAP1 gene coding sequence was ligated immediately after the 5'UTR of the SARS-CoV-2 N gene, followed by PCR ligation of the SARS-CoV-2 3'UTR sequence and a poly(A) sequence (65 nucleotides) (Figure 3).

[0106] To this end, 1 ng of pcDNA3 plasmid DNA (Korea Patent Registration No. 1399077) containing the ADCYAP1 gene was used as a template. 10 pmoles of a forward primer (SEQ ID NO: 21) that combined the 3'-end sequence of the 5' UTR with the 5'-end sequence of the ADCYAP1 gene, 10 pmoles of a reverse primer (SEQ ID NO: 22) that combined the 3'-end sequence of the ADCYAP1 gene with the 5'-end sequence of the 3' UTR, and 10 μL of 2X pfu master mix (Biofact, Daejeon, South Korea) were added. The PCR conditions were as follows: 95°C for 2 minutes (1 cycle); 95°C for 20 seconds, 60°C for 40 seconds, and 72°C for 2 minutes (30 cycles); and 72°C for 5 minutes.

[0107] PCR was used to link the T7 promoter sequence, 5' UTR sequence, ADCYAP1 gene sequence, 3' UTR sequence, and 65-nucleotide poly(A) sequence. Equal amounts of 10 pg of each PCR product were mixed and used as a template. 10 pmoles of a forward T7 promoter sequence primer (SEQ ID NO: 6), 10 pmoles of a reverse primer (SEQ ID NO: 16) linking the 20 nucleotides at the 3' end of the 3' UTR sequence with a 65-nucleotide poly(A) sequence, and 10 μL of 2X pfu master mix (Biofact, Daejeon, South Korea) were added. The PCR reaction conditions were as follows: 95°C for 2 minutes (1 cycle); 95°C for 20 seconds, 60°C for 40 seconds, and 72°C for 2 minutes and 30 seconds (30 cycles); 72°C for 5 minutes. The PCR products were confirmed by electrophoresis on a 2% agarose gel. The PCR product was ligated into pTOP Blunt V2 vector (Enzynomics, Daejeon, South Korea) and transformed into DH5α (Enzynomics, Daejeon, South Korea). After transformation, the transformed cells were plated on solid medium (Bioloard, Daejeon, South Korea) containing ampicillin (50 μg / ml, Sigma-Aldrich, USA) and cultured at 37°C for 8 hours. Plasmid DNA was extracted using the HiGene™ Plasmid Miniprep Kit (Ver. 2.0) (Biofact, Daejeon, South Korea) and subjected to Sanger sequencing (SEQ ID NO: 23).

[0108] [Table 4]

[0109] [SEQ ID NO: 23] T7 5'UTR ADCYAP1 3'UTR oligo dT (65) TAATACGACTCACTATAGGGATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACAAACTAAAATGACCATGTGTAGCGGAGCGAGGCTGGCCCTGCTGGTCTATGGGATAATCATGCACAGCAGCGTCTACAGCTCACCTGCCGCCGCCGGACTCCGGTTCCCCGGGATCAGGCCAGAGGAAGAGGCGTACGGCGAGGACGGAAACCCGCTGCCAGACTTCGATGGCTCGGAGCCGCCGGGCGCAGGGAGCCCCGCCTCCGCGCCGCGCGCCGCCGCCGCCTGGTACCGCCCGGCCGGGAGAAGAGATGTCGCCCACGGGATCCTTAACGAGGCCTACCGCAAAGTGCTGGACCAGCTGTCCGCCGGGAAGCACCTGCAGTCGCTCGTGGCCCGGGGCGTGGGTGGGAGCCTCGGCGGCGGCGCGGGGGACGACGCGGAGCCGCTCTCCAAGCGCCACTCGGACGGGATCTTCACGGACAGCTACAGCCGCTACCGGAAACAAATGGCTGTCAAGAAATACTTGGCGGCCGTCCTAGGGAAGAGGTATAAACAAAGGGTTAAAAACAAAGGACGCCGAATAGCTTATTTGTAGCAATCTTTAATCAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCACCGAGGCCACGCGGAGTACGATCGAGTGTACAGTGAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAATTTTAGTAGTGCTATCCCCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0110] Example 6. Confirmation of GFP, N gene, and ADCYAP1 mRNA expression through IVT

[0111] To prepare each mRNA using the IVT method, PCR was performed using 10 pmoles of a forward primer (SEQ ID NO: 6) corresponding to the T7 promoter sequence, 10 pmoles of a reverse primer (SEQ ID NO: 16) containing a 3'UTR and a 65-nucleotide poly(A) fragment, and 10 μl of 2X pfu Master Mix (Biofact, Daejeon, South Korea) for a total volume of 20 μL. The PCR reaction conditions were as follows: 95°C for 2 minutes (1 cycle); 95°C for 20 seconds, 60°C for 40 seconds, and 72°C for 2 minutes and 30 seconds (30 cycles); 72°C for 5 minutes. The amplified PCR products were electrophoresed on a 1% agarose gel, purified using a Qiaquick® Gel Extraction Kit (QIAGEN, Hilden, Germany), and used as templates for IVT.

[0112] IVT was performed using the Hiscrit T7 ARCA mRNA kit (NEB) according to the manufacturer's instructions. Using 1 μg of the PCR product as a template, 10 μl of 2X ARCA / NTP mix and 2 μl of T7 polymerase were added. The control was incubated at 37°C for 16 hours, while the GFP, ADCYAP, and N genes were incubated at 37°C for 1 hour to synthesize mRNA. Anti-reverse cap analog (ARCA) was added to the 5' end of the mRNA. After the reaction, 2 μl of DNase I was added and the DNA template was removed by incubation at 37°C for 15 minutes. After the IVT reaction, the reaction solution was mixed with LiCl solution (NEB, Massachusetts, USA) in a 2:1 ratio, incubated at -20°C for 30 minutes, and then centrifuged at 13,000 rpm for 15 minutes to remove the supernatant. After adding 500 μL of cold 70% ethanol and centrifuging at 13,000 rpm for 10 minutes, the supernatant was removed and the remaining solution was removed by incubation at room temperature for 10 minutes. The final solution was eluted in 50 μL of RNase-free distilled water. The purified RNA was quantified using Qubit and electrophoresed on an agarose gel (1%, 0.5X TBE) to confirm the mRNA product (Figure 6). After electrophoresis, the size was confirmed to be consistent with the expected size.

[0113] Example 7. Confirmation of GFP, N gene, and ADCYAP1 protein expression in human cell lines

[0114] 7-1. Transfection and cell harvesting

[0115] The mRNA synthesized using the IVT method was mixed with Lipofectamine Messenger MAX at a 1:1 ratio (w:v) and transfected into HeLa cells, a cervical cancer cell line, and then cultured in a CO2 incubator for 48 hours. For GFP mRNA-transfected cells, GFP expression was confirmed under a fluorescent microscope 48 hours after transfection and the cells were harvested. For ADCYAP1 mRNA-transfected cells, cell imaging was performed 48 hours after transfection, and cells were counted using a hematocytometer to determine cell viability before harvesting. For N gene mRNA-transfected cells, cell imaging was performed 48 hours after transfection and the cells were harvested. Protein was extracted from the harvested cells using pro-prep (iNtRON biotechnology, Seongnam, South Korea) according to the manufacturer's instructions.

[0116] 7-2. Western blot

[0117] The extracted proteins were subjected to SDS-PAGE using a Mini-PROTEAN® Tetra Vertical Electrophoresis Cell (Bio-Rad, California, USA) and then transferred to a nitrocellulose membrane (Bio-Rad, California, USA). The transferred proteins were blocked with 5% skim milk (Biopure, Seoul, South Korea) for 1 hour, and then placed in a solution of anti-GFP (Invitrogen, Massachusetts, USA), anti-ADCYAP1 (Santa Cruz Biotechnology, Texas, USA), anti-SARS-CoV-2 nucleocapsid (bioServUK, Sheffield, UK), and anti-GAPDH (Santa Cruz Biotechnology, Texas, USA) antibodies diluted in 5% skim milk and incubated at 4°C for 16 hours. The resulting material was washed three times for 10 minutes with 1X TBS-T and then incubated with secondary antibodies (goat anti-mouse IgG HRP and goat anti-rabbit IgG HRP) (Santa Cruz Biotechnology, Texas, USA) diluted in 5% skim milk for 2 hours at room temperature. The material was then washed three times for 10 minutes with 1X TBS-T. WesternBright Peroxide solution (Advansta, California, USA) and WesternBright ECL solution (Advansta, California, USA) were mixed at a 1:1 ratio and applied to the membrane. After incubation at room temperature for 1 minute, protein expression was confirmed using a Chemidoc XRS+ (Bio-Rad, California, USA) instrument.

[0118] 7-3. Confirmation of GFP protein expression through fluorescent imaging and Western blot

[0119] Fluorescence microscopy observations of HeLa cells 48 hours after transfection confirmed no GFP expression in cells treated with the reagent or control mRNA, but GFP expression was confirmed in cells treated with GFP mRNA. Western blotting of the cells after harvesting and protein extraction also confirmed GFP expression only in cells treated with GFP mRNA (Figure 7). This confirmed that the mRNA constructed in this invention using the 5'UTR and 3'UTR sequences of SARS-CoV-2 was able to enter cells and be successfully expressed as protein. Therefore, this invention demonstrates that other mRNAs can be expressed.

[0120] 7-4. Confirmation of the cell proliferation inhibitory effect of ADCYAP1 and confirmation of ADCYAP1 protein expression through Western blot

[0121] ADCYAP1 is known to suppress the growth of cervical cancer cells (Korea Patent No. 1399077). Forty-eight hours after transfection into a cervical cancer HeLa cell line, cell growth was monitored, revealing a 40% decrease in cells transfected with ADCYAP mRNA compared to cells transfected with control mRNA (Figure 8). Western blotting of cells harvested and protein extracted confirmed increased ADCYAP1 protein expression in cells treated with ADCYAP1 mRNA. This confirms that intracellularly expressed ADCYAP1 protein suppresses cell proliferation (Figure 8). These results suggest that the mRNA produced according to the present invention can be used as a cancer therapeutic agent.

[0122] 7-5. Confirmation of nucleocapsid protein expression by Western blot

[0123] Forty-eight hours after transfection into the HeLa cell line, the cells were harvested, and proteins were extracted and then subjected to Western blotting. The results confirmed that SARS-CoV-2 nucleocapsid protein was expressed in cells treated with N gene mRNA (Figure 9).

[0124] Although certain parts of the present invention have been described in detail above, it will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the present invention. Therefore, the true scope of the present invention is to be defined by the appended claims and their equivalents. [Industrial Applicability]

[0125] The gene constructs of the present invention can express mRNA that can provide increased protein production, thereby providing pharmaceutical compositions that can be used for vaccines or gene therapy. [Sequence List Free Text]

[0126] Electronic file attached.

Claims

1. a coding region for mRNA expression of the target gene; a 5' untranslated region (UTR) located upstream of the coding region, comprising the sequence of SEQ ID NO: 2-4; and A gene construct for use in mRNA expression of a target gene, comprising: a 3' untranslated region (UTR) located downstream of the coding region, the 3' untranslated region (UTR) comprising the sequence of SEQ ID NO: 5; A gene construct wherein the 5' untranslated region (UTR) is located upstream of the coding region and the 3' untranslated region (UTR) is located downstream of the coding region.

2. The gene construct of claim 1 , further comprising a promoter and / or a poly(A) sequence.

3. The gene construct of claim 2 , wherein the promoter is located upstream of a 5′ untranslated region (UTR).

4. The gene construct of claim 2 , wherein the poly(A) sequence is located downstream of the 3′ untranslated region (UTR).

5. A vector comprising the gene construct according to any one of claims 1 to 4.

6. A pharmaceutical composition comprising the gene construct according to any one of claims 1 to 4.

7. A vaccine composition comprising the gene construct of any one of claims 1 to 4.

8. A composition for gene therapy comprising the gene construct according to any one of claims 1 to 4.

Images