AAV gene therapy for treating nephrotic syndrome
AAV vector gene therapy using podocyte-specific promoters and serotypes effectively targets and expresses therapeutic proteins in podocytes, addressing the ineffectiveness of current treatments for nephrotic syndrome by improving renal function and extending survival in mouse models.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2024-09-26
- Publication Date
- 2026-03-25
AI Technical Summary
Current treatments for monogenotype nephrotic syndrome, particularly steroid-resistant nephrotic syndrome, are ineffective, leading to potential progression to end-stage renal disease and increased relapse risk after kidney transplantation, with existing gene therapy approaches failing to achieve specific and stable transduction of podocytes in the kidney.
Adeno-associated virus (AAV) vector gene therapy using NS-related transgenes under the control of podocyte-specific promoters, such as NPHS1 or NPHS2, combined with AAV serotypes like 2/9, LK03, and 3B, to target and express therapeutic proteins in podocytes, minimizing off-target expression.
The AAV vector therapy effectively targets and expresses therapeutic proteins in podocytes, reducing albuminuria, improving renal function, and extending survival in mouse models of nephrotic syndrome, with potential long-term expression and reduced immune response.
Smart Images

Figure 0007835461000006 
Figure 0007835461000007 
Figure 0007835461000008
Abstract
Description
[Technical Field]
[0001] This invention relates to gene therapy for use in the treatment of monogenotype nephrotic syndrome. [Background technology]
[0002] Nephrotic syndrome (NS) is a chronic kidney disease characterized by marked proteinuria, hypoalbuminemia, edema, and hyperlipidemia. It is the most common primary glomerular disease in children, affecting 2 out of every 100,000 children under 16 years of age in Europe and the United States. NS is associated with different ages of onset, from under 3 months of age at diagnosis to early adulthood, and is classified into different patient groups based on its sensitivity to corticosteroids. Approximately 80% of children with NS are classified as having steroid-sensitive nephrotic syndrome (SSNS), which can be successfully managed with corticosteroid treatment. A certain percentage of patients initially classified as SSNS relapse and require further steroid treatment, and another 10-15% of NS patients do not achieve remission after several weeks of corticosteroid treatment and are classified as having steroid-resistant nephrotic syndrome (SRNS). Up to 50% of these SRNS patients progress to end-stage renal disease within 10 years, and they all face an increased risk of relapse after kidney transplantation, highlighting the lack of appropriate and effective treatment options for these patients.
[0003] Podocyte dysfunction and the resulting disruption of the glomerular filtration barrier are central to the development of NS. Podocytes extend cellular projections called foot processes to cover the outside of glomerular capillaries, and through interlocking with adjacent foot processes, they form the glomerular slit membrane, which is crucial for the efficiency of the glomerular filtration barrier and the retention of proteins in the bloodstream. In the NS genotype, mutations in genes encoding important podocyte processes, such as podocyte development, migration, basement membrane interaction, or regeneration, result in loss of glomerular slit membrane integrity and the nephrotic syndrome phenotype. Approximately 30% of SRNS cases in children are hereditary, and the most common mutation in children is in the NPHS2-coding podosin, which accounts for 10-30% of sporadic genetic cases.
[0004] Podosin is a 42 kDa hairpin-like membrane-associated podocyte-specific protein that is a key component of the protein complex at the intercellular junction between adjacent podocyte foot processes in the slit diaphragm. Podosin localizes to lipid rafts and interacts with other important slit diaphragm proteins, such as nephrin, CD2AP, and TRPC6. Podosin is essential for the maintenance of the slit diaphragm and is therefore essential for the integrity of the glomerular filtration barrier. To date, 126 mutations have been reported, the most common being R138Q, which causes erroneous localization of podosin to the endoplasmic reticulum.
[0005] Because there are currently no effective treatments for patients with monogenotype NS, using gene therapy to transfer functional gene copies into diseased podocytes could constitute a promising novel strategy to address monogenotype NS, reverse the NS phenotype, and correct renal dysfunction. Indeed, US2003 / 0152954 generally proposed the use of viral vectors to deliver nucleic acids encoding polypeptides with podosin activity, but did not disclose or test any specific gene therapy constructs. This may be because the kidney has a complex anatomical structure with specialized compartments consisting of glomeruli, tubules, vascular systems, and interstitium, making it a difficult target for gene therapy vectors. To date, kidney-targeted gene therapy has been largely unsuccessful because it can be difficult to specifically transduce highly differentiated substructures of the kidney using viral vector approaches (van der Wouden et al., 2004).
[0006] Recent studies have attempted to target the kidney using rAAV vectors in combination with the CMV promoter and GFP or luciferase gene, administered via tail vein or renal vein injection (Rocca et al 2014). However, tail vein injection has been shown to be unsuitable for renal transduction, with low levels of gene expression observed in podocytes, while widespread expression was also observed in the liver, despite the use of promoters supposedly kidney-specific. This study further failed to demonstrate successful transduction of NS-related transgenes, such as podosin, and was unable to demonstrate long-term functional expression of such genes. This study also did not explore AAV serotypes suitable for human renal cell transduction. [Overview of the Initiative]
[0007] The present invention aims to reverse the NS phenotype in patients with a single genotype of NS and correct podocyte-related renal dysfunction by administering AAV gene therapy that expresses NS-related transgenes under the control of a podocyte-specific promoter.
[0008] The present invention provides an adeno-associated virus (AAV) vector gene therapy for use in the treatment of monogenotype nephrotic syndrome, wherein the AAV vector comprises an NS-associated transgene and a minimal nephrin promoter NPHS1 or a podosin promoter NPHS2. The gene therapy vector can reverse the NS phenotype and correct podocyte-associated renal dysfunction in patients with monogenotype NS.
[0009] Suitable AAV serotypes for use in vectors include 2 / 9, LK03, and 3B.
[0010] The AAV 2 / 9 serotype exhibits significant targeting to neonatal and adult mouse kidneys, localizing to the glomeruli and tubules (Luo et al., 2011, Picconi et al., 2014, Schievenbusch et al., 2010), and the AAV2 / 9 vector, combined with renal intravenous injection, has been shown to be suitable for renal targeted gene delivery (Rocca et al., 2014). Therefore, AAV 2 / 9 is a suitable vector for use in the gene therapy of the present invention.
[0011] Synthetic AAV capsids, such as LK03, may also be suitable vectors for use in the gene therapy of the present invention. This vector has been shown to transduce human primary hepatocytes with high efficiency in vitro and in vivo. However, it has not been used for kidney-targeted gene delivery. In this specification, the inventors demonstrate that the AAV-LK03 vector can achieve a high transduction rate of nearly 100% in human podocytes in vitro and can be used to specifically transduce podocytes in vitro.
[0012] The AAV-LK03 cap sequence consists of fragments from seven different wild-type serotypes (AAV1, 2, 3B, 4, 6, 8, 9), with AAV-3B accounting for 97.7% of the cap gene sequence and 98.9% of the amino acid sequence. AAV-3B is also known for its human hepatocyte tropism and is another suitable vector for use in the gene therapy of this invention. To date, it has not been used for kidney-targeted gene delivery.
[0013] NS-related transgenes used in gene therapy are genes associated with single-genotype NS that are expressed in podocytes and encode proteins of approximately 833 amino acids or less. This size limitation allows NS-related transgenes to be adapted to the gene therapy vectors of the present invention.
[0014] Suitable NS-related transgenes include NPHS2, ADCK4, ALG1, ARHGAP24, ARGHDIA, CD151, CD2AP, COQ2, COQ6, DGKE, E2F3, EMP2, KANK2, LAGE3, LMNA, LMX1B, MAFB, NUP85, NUP93, NXF5, OSGEP, PAX2, PDSS2, PMM2, PODXL, SCARB2, SGPL1, Smad7, TP53RK, TPRKB, VDR, WDR73, WT1, ZMPSTE24, and APOL1.
[0015] In embodiments of the present invention, the NS-related transgene may be an SRNS-related transgene, such as ADCK4, CD2AP, DGKE, EMP2, NPHS2, NUP86, NUP93, SGPL1, WDR73, or WT1.
[0016] In a preferred embodiment of the present invention, the NS-related transgene is NPHS2 encoding podosin. An example of a suitable human NPHS2 transgene cDNA sequence is shown in Figure 6.
[0017] The transgene species preferably matches the patient's species. For example, when treating a human patient, a human transgene is typically used. The transgene may be naturally occurring, for example, wild-type, or recombinant. The transgene is typically included in the gene therapy vector as a cDNA sequence.
[0018] The use of minimal nephrin promoters, such as NPHS1 or podosin promoter NPHS2, makes it possible to specifically target gene therapy vectors to podocytes (Moeller et al., 2002, Picconi et al., 2014). This allows for the specific targeting of transgene expression to podocytes in the glomerular basement membrane of the kidney, minimizing off-target expression. Since podocytes are terminally differentiated, non-dividing cells, they can be targeted for stable transgene expression, reducing or avoiding any risk of vector dilution effects. In preferred embodiments of the present invention, the promoter is NPHS1. An example of a suitable DNA sequence for the NPHS1 promoter is shown in Figure 5. As with the transgene, the promoter species preferably matches the patient species. For example, when treating human patients, human NHPS1 or human NPHS2 is typically used.
[0019] AAV vectors may further contain woodchuck hepatitis post-transcriptional regulatory elements (WPREs). WPREs are DNA sequences that, upon transcription, form tertiary structures that enhance expression. The inclusion of WPREs may increase the expression of transgenes delivered by the vector. WPRE sequences may be mutated to reduce carcinogenicity without significantly losing RNA-enhancing activity (Schambach et al., 2005, incorporated herein by reference). An example of a suitable WPRE sequence is shown in Figure 7.
[0020] NS-related transgenes may contain hemagglutinin (HA) tags. HA can be used as an epitope tag and has been shown not to interfere with the bioactivity or biodistribution of the protein to which it is attached. HA tags can facilitate the detection, isolation, and purification of transgenes.
[0021] AAV vectors may further contain a Kozak sequence between the promoter and the podosin transgene. The Kozak sequence is known to play a major role in the initiation of the translation process and can therefore enhance the expression of the podosin transgene.
[0022] AAV vectors may also contain polyadenylation signals, such as the bovine growth hormone (bGH) polyadenylation signal, as shown in Figure 8. Polyadenylation is the addition of a poly(A) tail to messenger RNA. A poly(A) tail consists of multiple adenosine monophosphates; in other words, it is a stretch of RNA containing only adenine bases. Poly(A) tails are important for the nuclear transport, translation, and stability of mRNA. Therefore, including a polyadenylation signal can enhance the expression of podosin transgenes.
[0023] AAV vector gene therapy more typically further includes inverted terminal repeats (ITRs) at either end of the vector. For example, the vector construct can be, in order, ITR - promoter - transgene (with HA tag if necessary) - WRPE if necessary - polyadenylation signal - ITR.
[0024] Thus, the gene therapy vector of the present invention can be used to treat or manage a single - genotype NS in a patient. As used herein, the term "patient" can include any mammal, including humans. The patient can be an adult or pediatric patient, such as a neonate or infant. In embodiments of the present invention, the patient can be a pediatric patient between about 1 year and about 16 years of age.
[0025] The patient is suffering from a single - genotype NS. In other words, NS is caused by a mutation in one gene. Preferably, the mutation is in a gene expressed in podocytes. For example, NS can be SRNS caused by a mutation in NPHS2 that encodes podocin. Alternatively, the single - genotype NS can be caused by one or more mutations in any one of ADCK4, ALG1, ARHGAP24, ARGHDIA, CD151, CD2AP, COQ2, COQ6, DGKE, E2F3, EMP2, KANK2, LAGE3, LMNA, LMX1B, MAFB, NUP85, NUP93, NXF5, OSGEP, PAX2, PDSS2, PMM2, PODXL, SCARB2, SGPL1, Smad7, TPRKB, VDR, WDR73, WT1, ZMPSTE24, or APOL1. In embodiments of the present invention, the single - genotype NS can be single - genotype SRNS caused by one or more mutations in any one of ADCK4, CD2AP, DGKE, EMP2, NPHS2, NUP86, NUP93, SGPL1, WDR73, or WT1.
[0026] The gene mutations causing SRNS can be one or more of the NPHS2 mutations that affect podocin expression, such as one or more of the mutations listed in Table A below.
[0027]
Table 1
[0028] In a preferred embodiment of the present invention, the gene mutation can be p.Arg138Gln, also known as R138Q. R138Q is the most common podocin mutation in children with SRNS in the white population. The mutation causes retention of podocin in the endoplasmic reticulum, which prevents podocin from reaching the slit diaphragm and from interacting with other important slit diaphragm proteins to form a functional filtration barrier.
[0029] Since all NPHS2 mutations affect the same gene, any combination of these mutations can be treated with the AAV gene therapy vector of the present invention containing the NPHS2 transgene. In other words, a patient can have the p.Arg138Gln mutation and can also have one or more of the other mutations identified in Table A above.
[0030] The presence or absence of a single genotype of NS can be determined by tests in a laboratory, such as tests available from Bristol Genetics Laboratories, Bristol, UK. Typically, the genetic test can be performed by analysis of a blood sample obtained from the patient.
[0031] AAV vector gene therapy can be administered by systemic administration, such as intravenous injection. In an embodiment of the present invention, AAV vector gene therapy can be administered by injection into the renal artery. In an alternative embodiment of the present invention, AAV vector gene therapy can be administered by retrograde administration, such as via a urinary catheter using a urethral catheter.
[0032] Gene therapy can be administered in a single dose, meaning that subsequent doses of the vector may not be necessary. If repeated doses are required, different AAV serotypes can be used in the vector. For example, the vector used for the initial dose may contain AAV-LK03 or AAV-3B, while the vector used for subsequent doses may contain AAV 2 / 9.
[0033] Optionally, gene therapy may be administered in combination with transient immunosuppression of the patient, for example, by administering gene therapy concurrently with or after oral steroid treatment. Immunosuppression may be desirable before and / or during gene therapy treatment to suppress the patient's immune response to the vector. However, since the AAV capsid is not encoded by the vector, it is only transiently present in transduced cells. Therefore, the capsid gradually degrades and disappears, meaning that a short-term immunomodulatory regimen that blocks the immune response to the capsid until the capsid sequence disappears from the transduced cells may allow for long-term expression of the transgene. Therefore, immunosuppression may be desirable for a period of about 6 weeks after administration of gene therapy.
[0034] AAV vector gene therapy may be administered in the form of a pharmaceutical composition. In other words, AAV vector gene therapy may be combined with one or more pharmaceutically acceptable carriers or excipients. Suitable pharmaceutical compositions are preferably sterile. The present invention also provides the following embodiments. [1] Adeno-associated virus (AAV) vector gene therapy for use in the treatment of monogenotype nephrotic syndrome, wherein the AAV vector is: NS-related transgenes, and Minimal nephrin promoter NPHS1 or podosin promoter NPHS2 AAV vector gene therapy, including [2] AAV vector gene therapy for use as described in [1], wherein the AAV vector is AAV serotype 2 / 9, LK03, or 3B. [3] AAV vector gene therapy for use as described in [1] or [2], wherein the NS-related transgene is NPHS2;ADCK4;ALG1;ARHGAP24;ARGHDIA;CD151;CD2AP;COQ2;COQ6;DGKE;E2F3;EMP2;KANK2;LAGE3;LMNA;LMX1B;MAFB;NUP85;NUP93;NXF5;OSGEP;PAX2;PDSS2;PMM2;PODXL;SCARB2;SGPL1;Smad7;TP53RK;TPRKB;VDR;WDR73;WT1;ZMPSTE24; or APOL1. [4] AAV vector gene therapy for use as described in any of [1] to [3], the AAV vector further comprising a woodchuck hepatitis post-transcriptional regulatory element (WPRE). [5] AAV vector gene therapy for use as described in any of [1] to [4], wherein the NS-related transgene is human and / or includes a hemagglutinin (HA) tag. [6] AAV vector gene therapy for use according to any one of [1] to [5], wherein the AAV vector further comprises a Kozak sequence between the promoter and the podosin transgene. [7] AAV vector gene therapy for use according to any one of [1] to [6], wherein the AAV vector further comprises a polyadenylation signal, e.g., a bovine growth hormone (bGH) polyadenylation signal. [8] AAV vector gene therapy for use as described in any of [1] to [7], administered to human patients. [9] AAV vector gene therapy for use as described in [8], where the patient is a pediatric patient.
[10] AAV vector gene therapy for use as described in any of [1] to [9], wherein the monogenotype NS is monogenotype steroid-resistant nephrotic syndrome.
[11] AAV vector gene therapy for use as described in any of [1] to
[10] , administered systemically.
[12] AAV vector gene therapy for use as described in any of [1] to
[11] , administered by intravenous injection.
[13] AAV vector gene therapy for use as described in any of [1] to
[12] , administered by injection into the renal artery.
[0035] The present invention will be described in detail with reference to the drawings, which are merely examples. [Brief explanation of the drawing]
[0036] [Figure 1-1] This figure shows that AAV 2 / 9 administered by tail vein injection transduces into the kidney, leading to the expression of HA-tagged podosin in podocytes. A) AAV vectors used to express mouse or human podosin or GFP. All vectors contained a Kozak sequence between the promoter and transgene, as well as WPRE (Woodchuck hepatitis post-transcriptional regulatory element) and bovine growth hormone (bGH) polyadenylation signals. B) The vector or saline was injected via tail vein into 8-week-old iPod NPHS2fl / fl mice, and doxycycline induction was initiated 10-14 days later. C) qPCR showing the presence of AAV ITR in the renal cortex of mice injected with the viral vector. D) Representative immunofluorescence showing the expression of HA-tagged podosin along with podocyte-specific proteins nephrin and podosin in iPod NPHS2fl / fl mice injected with AAV 2 / 9. Since mice with diseased glomeruli showed loss of podocyte markers, the control (saline) images are of mice that were not injected with the complete iPod NPHS2fl / fl genotype and therefore did not develop proteinuria or diseased glomeruli. [Figure 1-2] This is a continuation of Figure 1-1. [Figure 1-3] This is a continuation of Figure 1-2. [Figure 2-1]This figure shows that tail vein injection of AAV 2 / 9 expressing wild-type podosin under a podocyte-specific promoter improves proteinuria in a conditional podosin knockout mouse model (iPod NPHS2fl / fl). A) Comparison of urinary albumin:creatinine ratios of mice injected with AAV 2 / 9 mNPHS1.mpod, AAV 2 / 9 hNPHS1.mpod, and saline (n=9 for each group, **p<0.01, ***p<0.001). B) Coomassie staining showing representative images of the degree of albuminuria in one mouse from each experimental group. The saline group showed proteinuria from day 14 onwards and showed large amounts of albumin, while the vector-treated group showed delayed onset of albuminuria and milder albuminuria. C) Survival curves showing improved survival in mice injected with either AAV 2 / 9 hNPHS1.mpod or AAV 2 / 9 mNPHS1.mpod (log-rank (Mantel-Cox) test, p=0.049, n=3 for each virus group and n=4 for the saline group). D) The copy number of viral DNA per 50 ng of total DNA was inversely correlated with the urinary albumin:creatinine ratio at day 42 (Spearman r=-0.4596, p=0.0477). E) Blood test results including cholesterol, albumin, urea, and creatinine at 6 weeks after doxycycline (excluding the lowest n=2 cholesterol levels in each group, and the lowest n=3 mice in each group). F) Histology showing representative images from each group using light microscopy. The saline-injected group showed tubular dilation, along with glomerular hypertrophy, increased collagen deposition, and segmental sclerosis, which was consistent with FSGS. Mice injected with AAV 2 / 9 expressing mouse podosin showed a wide range of histological findings, which correlated well with the urinary albumin:creatinine ratio at death. Some mice were healthy and had normal glomeruli, while others showed mild evidence of disease, such as pseudocrescent formation (arrow) observed in mice injected with AAV 2 / 9 mNPHS1.mpodHA. G) Saline-injected iPod NPHS2fl / fl mice showed podosin loss, but nephrin expression showed changes mainly from membrane staining to diffusion patterns. [Figure 2-2] This is a continuation of Figure 2-1. [Figure 2-3] This is a continuation of Figure 2-2. [Figure 2-4] This is a continuation of Figure 2-3. [Figure 2-5] This is a continuation of Figure 2-4. [Figure 3-1] This figure shows the efficient transduction of human podocytes in vitro with AAV LK03 and a minimal human nephrine promoter. A, C, E) Immunofluorescence demonstrating transduction of human podocytes (Pods), glomerular endothelial cells (GEnCs), and proximal tubular epithelial cells (PTECs) by AAV LK03 CMV GFP. GFP expression was obtained in podocytes only when the minimal nephrine promoter AAV LK03 hNPHS1 GFP was used. B) Western blot demonstrating GFP expression in podocytes only when using AAV LK03 and a minimal human nephrine promoter. D) Flow cytometry demonstrating highly efficient transduction of podocytes with AAV LK03 CMV GFP and supporting the finding that GFP expression with the minimal nephrine promoter was observed only in podocytes. In comparison, AAV 2 / 9 CMV GFP showed low transduction efficiency in podocytes (n=3). F) The bar graph shows the median fluorescence intensity in podocytes transduced with AAV LK03, and the histogram shows the degree of green fluorescence in podocytes transduced with AAV LK03 CMV GFP (right peak), AAV LK03 hNPHS1 GFP (center peak), and non-transduced cells (left peak). [Figure 3-2] This is a continuation of Figure 3-1. [Figure 3-3] This is a continuation of Figure 3-2. [Figure 3-4] This is a continuation of Figure 3-3. [Figure 4-1]This figure shows that AAV LK03, which expresses wild-type human podocin, rescues function in mutant podocin R138Q podocyte cell lines. A) Western blot showing that AAV LK03.CMV.hpodocinHA and AAV LK03.hNPHS1.hpodocinHA transduce R138Q podocytes and express HA-tagged podocin. B) Immunofluorescence demonstrating the expression of HA-tagged wild-type podocin in mutant podocin R138Q podocytes. C) Adhesion assay showing reduced adhesion in mutant podocin R138Q podocytes, showing adhesion rescue in R138Q podocytes treated with AAV LK03.hNPHS1.hpodHA.WPRE.bGH. D) Confocal microscopy showing that HA-tagged podocin does not colocalize with calnexin, an endoplasmic reticulum marker. E) TIRF microscopy to demonstrate the expression of HA-tagged podosin within 100 nm of the cell membrane, showing partial co-localization with the lipid raft marker caveolin. [Figure 4-2] This is a continuation of Figure 4-1. [Figure 4-3] This is a continuation of Figure 4-2. [Figure 4-4] This is a continuation of Figure 4-3. [Figure 5] This figure shows an example DNA sequence of the minimal human nephrine promoter (NPHS1). [Figure 6] This figure shows a cDNA sequence as an example of a human podosin transgene. [Figure 7] This figure shows an example DNA sequence of a WPRE sequence. [Figure 8] This figure shows an example DNA sequence of a bGH poly(A) signal sequence. [Figure 9] This figure shows human podocytes transduced with either HAVDR(A) or HASmad7(B) using AAV LK03 along with a minimal human nephrine promoter. [Modes for carrying out the invention]
[0037] [Examples] method Vector production The inventors prepared pAV.hNPHS1.mpodHA.WPRE.bGH, pAV.mNPHS1.mpodHA.WPRE.bGH, and pAV.hNPHS1.hpodHA.WPRE.bGH (Figure 1A), pAV.mNPHS1.hHAVDR.WPRE.bGH, and pAV.mNPHS1.hHASmad7.WPRE.bGH from the CMV eGFP L22Y pUC-AV2 construct (donated by Amit Nathwani) using human (Figure 6) and mouse (sequence not shown) podosin cDNA (Origene, Herford, Germany) and human VDR and Smad7 cDNA in their laboratory. Human embryonic kidney 293T cells were transfected with polyethyleneimine using capsid plasmids (pAAV9 from Penn Vector Core, pAAV LK03 donated by Mark Kay), a helper plasmid containing an adenovirus gene, and a transgene plasmid. Cells and supernatant were collected 72 hours post-transfection. Cells underwent five freeze-thaw cycles, and the supernatant was precipitated with PEG (8% PEG 0.5N NaCl). These were combined and incubated with 0.25% sodium deoxycholate and 70 units / ml benzoase at 37°C for 30 minutes. The vectors were purified by iodixanol gradient ultracentrifugation and then concentrated in PBS. The vectors were titrated by qPCR using a calibration curve with the following primers: ITR F GGAACCCCTAGTGATGGAGTT, ITR R CGGCCTCAGTGAGCGA, ITR probe FAM-5'-CACTCCCTCTCTGCGCGCTCG-3'-TAMRA.
[0038] animal All animal experiments and procedures were approved by the UK Home Office in accordance with the Animals (Scientific Procedures) Act 1986, and guidelines for the care and use of laboratory animals were followed during the experiments. NPHS2 flox / floxMice (donated by Corinne Antignac, INSERM U983, Paris) were crossed with NPHS2-rtTA / Tet-On Cre mice to produce NPHS2-rtTA / Tet-On Cre / NPHS2 mice. flox / flox We produced offspring possessing the following trait: When these mice are exposed to doxycycline, they develop podocyte-specific knockout of podosin. These are referred to as iPod NPHS2. fl / fl This study is called the AAV study. The mice had a mixed-breed background, and an equal number of each sex were used. At 8 weeks of age, mice were administered AAV via tail vein injection (Figure 1B). After 10–14 days, the mice were provided with drinking water supplemented with 2 mg / ml doxycycline and 5% sucrose for 3 weeks. Urine was collected weekly. The mice were euthanized 6 weeks after the start of doxycycline using the Schedule 1 method. A small number of mice were maintained for more than 6 weeks to test the effect on survival. All mice were re-generated from tissues collected at the time of death.
[0039] cell culture Conditionally immortalized human podocytes (Pods) were cultured in RPMI containing 10% fetal bovine serum (Sigma Aldrich, Gillingham, UK) along with L-glutamine and NaHCO3. Conditionally immortalized human glomerular endothelial cells (GEnCs) were cultured in EBMTM-2 endothelial cell proliferation medium-2 supplemented with EBMTM-2 endothelial cell proliferation medium-2 BulletKit™ (Lonza, Basel, Switzerland). Immortalized proximal tubular epithelial cells (ATCC, Teddington, UK) (PTECs) were cultured in DMEM / F12 supplemented with insulin, transferrin, selenium, hydrocortisone, and 10% FBS.
[0040] In the cells, apply AAV 5 × 10 5 Transduction was performed at the specified MOI. For GFP expression, cells were used 5-7 days post-transduction to allow comparison between different cell lines. For podosin, VDR, and Smad7 expression, cells were used 10-14 days post-transduction when podocytes were maximally differentiated.
[0041] quantitative PCR DNA was extracted from mouse renal cortex using the DNeasy Blood and Tissue Kit (Qiagen, Manchester, UK). AAV DNA was detected using the primers described above for viral titration and normalized to mouse beta-actin.
[0042] RNA was extracted using the RNeasy Mini Kit with RNase-Free DNase set (Qiagen, Manchester, UK).
[0043] Immunofluorescence 5 μm sections were fixed with 4% PFA and blocked with 3% BSA, 0.3% Triton X-100, and 5% goat or donkey serum. Primary antibodies were high-affinity anti-HA from rat IgG1 (Roche, Basel, Switzerland), guinea pig anti-nephrine (1243-1256) antibody (Origene, Herford, Germany), and rabbit anti-NPHS2 antibody (Proteintech, Manchester, UK).
[0044] Cells were fixed with either 4% PFA and / or ice-cold methanol, incubated with 0.03 M glycine for 5 minutes, permeabilized with 0.3% Triton, and then blocked with 3% BSA. Primary antibodies were mouse HA.11 epitope tag antibody (Biolegend, San Diego, USA), mouse anti-GFP (Roche, Basel, Switzerland), rabbit anti-calnexin (Merck Millipore, Darmstadt, Germany), and rabbit anti-caveolin 1 (Cell Signaling, Danvers, USA).
[0045] Secondary antibodies included AlexaFluor 488 anti-mouse donkey, AlexaFluor 488 anti-rabbit donkey, AlexaFluor 488 anti-guinea pig goat, AlexaFluor 555 anti-rabbit goat, and AlexaFluor 633 anti-rat goat, as well as AlexaFluor 633 phalloidin (Invitrogen, Thermo Fisher Scientific, Waltham, USA). Sections were counterstained with DAPI and mounted with Mowiol. Images were acquired using LAS (Leica Application Suite) X software on a Leica SPE single-channel confocal laser scanning microscope connected to a Leica DMi8 inverted epifluorescence microscope, a Leica SP5-II confocal laser scanning microscope connected to a Leica DMI 6000 inverted epifluorescence microscope, or a Leica AM TIRF MC (multicolor) system connected to a Leica DMI 6000 inverted epifluorescence microscope.
[0046] Western blotting Cells were extracted in SDS lysis buffer. The samples were electrophoresed on a 12.5% gel and transferred to a PVDF membrane. The membrane was blocked in 5% milk in 0.1% TBST. The primary antibodies used were mouse HA.11 epitope-tagged antibody (Biolegend, San Diego, USA), mouse anti-GFP in 3% BSA in 0.1% TBST (Roche, Basel, Switzerland), or rabbit anti-NPHS2 antibody (Proteintech, Manchester, UK). The secondary antibody was anti-rabbit or anti-mouse IgG peroxidase in 3% BSA in 0.1% TBST (Sigma Aldrich, Gillingham, UK). The membrane was imaged using an Amersham Imager 600.
[0047] Flow cytometry Viable cells were stained with propidium iodide, and only viable single cells were included in the analysis. Flow cytometry was performed using a NovoCyte flow cytometer.
[0048] Adhesion assay The cells were treated with trypsin, 10 5 After resuspending at cells / ml and allowing to recover for 10 minutes, 50 μl of cells diluted 2-fold with PBS were seeded into a 96-well plate. Technical triplicates were used. The cells were kept adherent at 37°C for approximately 1 hour. After washing the cells with PBS to remove non-adherent cells, they were fixed with 4% PFA for 20 minutes. After washing the cells with distilled water, they were stained with 0.1% crystal violet in 2% ethanol at room temperature for 60 minutes. The cells were washed and incubated with 10% acetic acid on a shaker for 5 minutes. Absorbance at 570 nm was measured, and the results were normalized to a wild-type cell line transduced with AAV LK03 CMV GFP.
[0049] urine Albumin levels were measured using a mouse albumin ELISA kit (Bethyl Laboratories Inc, Montgomery, USA), and creatinine levels were measured using a Konelab Prime 60i analyzer.
[0050] blood test Mouse plasma was processed using either a Konelab Prime 60i analyzer or a Roche Cobas system, following the reagents and protocols provided by the manufacturer.
[0051] statistical analysis All data are expressed as mean ± SEM unless otherwise specified. Statistical analysis was performed using GraphPad Prism (Graphpad softward, La Jolla, USA). The statistical tests used for survival analysis included a two-tailed t-test, a one-way ANOVA with Tukey's multiple comparison post-hoc analysis, a two-way ANOVA with Tukey's multiple comparison post-hoc analysis, and the log-rank (Mantel-Cox) test.
[0052] result Tail vein injection of AAV serotype 9 demonstrates transduction of renal cells and expression in podocytes. At 8 weeks of age, mice were given 1.5 × 10 12 Either vg AAV2 / 9 hNPHS1.mpod, AAV2 / 9 mNPHS1.mpod, or saline solution was administered via tail vein. After 6 weeks, AAV ITR was detected in the renal cortex of AAV-injected mice (AAV 2 / 9 hNPHS1.mpod = 39,067 ± 13,285 copies of ssDNA, AAV 2 / 9 mNPHS1mpod = 76,533.33 ± 32047 copies of ssDNA, n = 5-6 / group) (Figure 1C). HA-tagged podosin was shown to co-localize with the podocyte markers nephrin and podosin (Figure 1D).
[0053] AAV2 / 9-expressing wild-type podocin is iPod NPHS2 fl / fl Reduces albuminuria in mice. The vector-treated group showed a reduction in the urinary albumin:creatinine ratio (ACR) (Figures 2A, 2B). The effect of tail vein injection of AAV 2 / 9-expressing podosin on urinary ACR resulted in an F ratio of F(2, 24) = 9.61 and p < 0.001 (n = 9 / group). On day 14 after doxycycline, urinary ACR was higher in the saline group than in either vector-treated group, but this was not statistically significant (AAV 2 / 9 hNPHS1.mpod = 758.1 ± 488.1 mg / mmol, AAV 2 / 9 mNPHS1.mpod = 59.8 ± 28.0 mg / mmol, saline = 3,770.1 ± 1337.6 mg / mmol, p=0.40 for comparison between AAV 2 / 9 hNPHS1.mpod and saline, p=0.25 for comparison between AAV 2 / 9 mNPHS1.mpod and saline). Day 28 (AAV 2 / 9 hNPHS1.mpod = 3,083.0 ± 932.8 mg / mmol, AAV 2 / 9 mNPHS1.mpod = 2,195.1 ± 778.9 mg / mmol, saline = 10,198 ± 3,189.5 mg / mmol, p=0.008 for comparison between AAV 2 / 9 hNPHS1.mpod and saline, p=0.002 for comparison between AAV 2 / 9 mNPHS1.mpod and saline) and Day 42 (AAV 2 / 9 hNPHS1.mpod = 3,266.8 ± 1,212.2 mg / mmol, AAV 2 / 9 mNPHS1.mpod = 3,553.3 ± 1,477.87 mg / mmol, saline = 13,488.8 ± 3,877.3 mg / mmol, AAV 2 / 9 In the comparison between hNPHS1.mpod and saline (p<0.001), and in the comparison between AAV 2 / 9 mNPHS1.mpod and saline (p<0.001), there was a significant reduction in urinary ACR in the vector-treated groups. In the vector-treated groups, 2 out of 9 mice in the AAV 2 / 9 hNPHS1.mpod group and 1 out of 9 mice in the AAV 2 / 9 mNPHS1.mpod group had a urinary ACR of less than 30 mg / mmol on day 42.
[0054] While the vector-treated mice showed improvement, significant variability was observed between the groups. The inventors hypothesized that this could be due to the amount of vector that reached the kidneys after systemic injection. The amount of viral DNA detected in the renal cortex showed an inverse correlation with the degree of albuminuria on day 42 (Spearman r = -0.4596, p = 0.0477) (Figure 2D).
[0055] AAV2 / 9-expressing wild-type podocin is iPod NPHS2 fl / fl Partially rescuing phenotypes in mice Vector-treated mice showed reduced creatinine (saline = 39.0 ± 8.5 μmol / L, AAV 2 / 9 hNPHS1.mpod = 27.3 ± 7.9 μmol / L, AAV 2 / 9 mNPHS1.mpod = 18.6 ± 4.4 mmol / L, p = 0.1622), reduced urea (saline = 39.4 ± 17.6 mmol / L, AAV 2 / 9 hNPHS1.mpod = 12.0 ± 2.0 mmol / L, AAV 2 / 9 mNPHS1.mpod = 11.6 ± 1.6 mmol / L, p = 0.058), and increased albumin (saline = 10.5 ± 5.4 g / L, AAV 2 / 9 hNPHS1.mpod = 17.1 = 4.8 ± g / L, AAV 2 / 9 The study showed a significant reduction in cholesterol levels (mNPHS1.mpod = 17.1 ± 3.6 g / L, p = 0.5602) and a substantial reduction in cholesterol (saline solution = 15.76 ± 1.75 mmol / L, AAV 2 / 9 hNPHS1.mpod = 2.64 ± 0.60 mmol / L, AAV 2 / 9 mNPHS2.mpod = 4.86 ± 0.76 mmol / L, p = 0.009) (Figure 2E).
[0056] Saline-treated mice exhibited the histological features of FSGS by 6 weeks. Vector-treated mice did not exhibit the histological features of FSGS on light microscopy, but demonstrated a wide range of histological findings, from completely normal glomeruli to pseudocrescent or mesangial cell proliferation (Figure 2F).
[0057] These mice also showed an extended survival period (n = 3 - 4 / group), with the median survival period in the saline group being 75.5 days (range 38 - 111 days), while in the AAV 2 / 9 hNPHS1.mpod group, the median survival period was 192 days (range 74 - 206 days and still alive), and in the AAV 2 / 9 mNPHS1.mpod group, the median survival period was 192 days (range 131 - 206 days and still alive) (p = 0.049).
[0058] Untreated mice showed a loss of podocin expression, and the expression pattern of nephrin changed to a diffuse pattern (Figure 2G). This is in marked contrast to the mainly membrane expression pattern of nephrin and podocin observed in vector-treated mice (Figure 1D).
[0059] AAV LK03 efficiently transduces human podocytes in vitro by the minimal human nephrin promoter Using AAV LK03 with CMV GFP and AAV LK03 hNPHS1 GFP, human podocytes, glomerular endothelial cells, and proximal tubular epithelial cells were transduced at a MOI of 5×10 5 . By flow cytometry (n = 3), AAV LK03 CMV GFP had very efficient transduction of podocytes (% GFP expression = 98.83 ± 0.84), AAV LK03 hNPHS1 GFP had good transduction (% GFP expression = 71.3 ± 3.39), and non-transduced cells had negligible expression (% GFP expression = 0.89 ± 0.36) (Figure 3D). This was reflected in immunofluorescence (Figure 3A, 3C, 3E) and western blot (Figure 3B). The proportion of GFP-expressing positive cells was high in podocytes transduced with AAV LK03 hNPHS1 GFP, but the cells had lower fluorescence intensity than those transduced with AAV LK03 CMV GFP (Figure 3F).
[0060] Interestingly, AAV LK03 CMV GFP showed considerably low transduction in glomerular endothelial cells (%GFP expression = 7.35 ± 0.19). AAV LK03 hNPHS1 GFP showed the least transduction in glomerular endothelial cells (%GFP expression = 0.59 ± 0.10), which was at a similar level to that of non-transduced glomerular endothelial cells (%GFP expression = 0.23 ± 0.02). Since AAV 2 / 9 was the serotype that showed the best transduction in renal cells in vivo in rodent kidneys, we investigated the expression of AAV 2 / 9 CMV GFP in human renal cell lines. AAV 2 / 9 CMV GFP showed low transduction efficiency in both podocytes (%GFP expression = 13.9 ± 1.98) and glomerular endothelial cells (%GFP expression = 21.99 ± 4.35) (Figure 3D). When human podocytes were transduced using AAV LK03 containing AAV LK03 hNPHS1 HAVDR and AAV LK03 hNPHS1 hSmad7, both proteins were well expressed (Figure 9).
[0061] Human podosin expressing AAV LK03 under minimal nephrin promoter conditions demonstrates functional rescue in mutant podosin R138Q podocyte cell lines. The R138Q podosin mutant results in the mislocalization of podosin from the cell membrane to the endoplasmic reticulum. R138Q podocyte cell lines were obtained from patient kidneys and conditionally immortalized using the temperature-sensitive SV40 T antigen. AAV LK03 hNPHS1 hpods transduced R138Q podocytes, expressing HA-tagged podosin (Figure 4A, 4B). HA-tagged podosin was observed on the cell membrane by confocal microscopy and colocalized with the lipid raft protein caveolin-1, as observed by TIRF microscopy (Figure 4B, 4E). Untransduced R138Q podocytes showed no podosin expression on the cell membrane (Figure 4B). HA-tagged podosin did not colocalize with the endoplasmic reticulum marker calnexin (Figure 4D).
[0062] Podocytes exhibit decreased or increased adhesion in disease states. Previous research at our laboratory has shown that the R138Q mutation causes decreased podocyte adhesion. AAV transduction causes decreased podocyte adhesion, but R138Q podocytes still show reduced adhesion compared to wild-type podocytes, and transduction of AAV LK03 hNPHS1 hpod results in the rescue of the adhesive function of R138Q podocytes (Figure 4C).
[0063] Consideration In this specification, the inventors successfully expressed mouse podosin by targeting podocytes with AAV 2 / 9 using a minimal nephrin promoter in a conditional mouse knockout model, resulting in partial phenotypic rescue and improvement of albuminuria in vector-treated mice. As an initial proof-of-principle study, the inventors chose to inject the vector before doxycycline induction to ensure effective rescue by the vector in the event of podosin knockout. The effect of doxycycline induction was rapid, with progression to severe nephrotic syndrome (8-14 days) and FSGS relatively rapid (approximately 6 weeks). In this specification, the inventors demonstrated that introducing wild-type human podosin into R138Q podocytes in vitro enabled the expression of podosin reaching the cell membrane, thereby rescuing podocyte adhesion.
[0064] The inventors have shown that the vector improves albuminuria and survival in these mice, but there is considerable variability in the degree of albuminuria in both treated and untreated mice. The variability within treated mice can be explained at least in part by the amount of viral transduction in the kidneys (Figure 2D).
[0065] AAV LK03 exhibits high transduction, nearly 100%, in human podocytes in vitro, which is reduced to 72.3% when a minimal human nephrine promoter is used. We have shown that we can specifically transduce podocytes in vitro using this serotype, and that the expression of wild-type podosin in R138Q mutant podocytes demonstrates functional rescue. The use of AAV LK03 has translational implications because such effective transduction of human podocytes allows for a significant reduction in effective doses in humans. A recent UK study showed a low seropositivity rate of 23% for anti-AAV LK03 neutralizing antibodies, lowest in late childhood (Perocheau, DP et al.), which makes this particular serotype a promising candidate for translational studies.
[0066] The inventors have shown that AAV transduction of podocytes by a podocyte-specific promoter is possible in iPod NPHS2 fl / fl This paper describes the first proof-of-principle study demonstrating improvement of albuminuria in a mouse model. The inventors also demonstrate that the synthetic capsid AAV LK03 exhibits highly efficient transduction of human podocytes. Combined, this study represents the first step toward the translation of AAV gene therapy targeting monogenic podocyte disorders.
[0067] References TIFF0007835461000004.tif53154TIFF0007835461000005.tif169154
[0068] Sequence listing free text [Sequence ID 1] indicates an ITR forward primer.
[0069] [SEQ ID NO: 2] represents an ITR reverse primer.
[0070] [Sequence ID 3] shows the DNA sequence of the ITR probe FAM-5'-CACTCCCTCTCTGCGCGCTCG-3'-TAMRA.
[0071] [Sequence ID 4] shows the DNA sequence as an example of the minimal human nephrine promoter (NPHS1) shown in Figure 5.
[0072] [Sequence ID 5] shows the cDNA sequence as an example of a human podosin transgene, as shown in Figure 6.
[0073] [Sequence ID 6] shows a DNA sequence as an example of a WPRE sequence, as shown in Figure 7.
[0074] [Sequence ID 7] shows a DNA sequence as an example of a bGH poly(A) signal sequence, as shown in Figure 8.
[0075] SEQUENCE LISTING <110> The University of Bristol <120> AAV GENE THERAPY FOR TREATING NEPHROTIC SYNDROME <130> PA24-495 <140> JP 2024-167091 <141> 2020-01-17 <150> GB 1900702.0 <151> 2019-01-18 <160> 7 <170> PatentIn version 3.5 <210> 1 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> ITR Forward primer <400> 1 ggaaccccta gtgatggagt t 21 <210> 2 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> ITR Reverse primer <400> 2 cggcctcagt gagcga 16 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ITR probe <400> 3 cactccctct ctgcgcgctc g 21 <210> 4 <211> 1192 <212> DNA <213> Homo sapiens <400> 4 cacctgaggt caggagttcg agaccagcgt ggccaacatg atgaaacccc gtctctagta 60 aaaatacaaa aattagccag gcatggtgct atatacctgt agcaccagct acttgggaga 120 cagaggtggg agaattactt gaacctggga ggttcaagcc atgggaggtg gaagttgcag 180 tgagccgaga tgccactgca ctccagcctg agcaacagag caagactatc tcaagaaaag 240 aaagaaagaa agaaagagac ttgccaaggt catgtatcag ggcaaggaag agctgggggc 300 ccagctggct gctcccctgc tgagctggga gaccaccttg atctgacttc tcccatcttc 360 ccagcctaag ccaggccctg gggtcacgga ggctggggag gcaccgagga acgcgcctgg 420 catgtgctga caggggattt tatgctccag ctgggccagc tgggaggagc ctgctgggca 480 gaggccagag ctgggggctc tggaaggtac ctgggggagg ttgcactgtg agaatgagct 540 caagctgggt cagagagcag ggctgactct gccagtgcct gcatcagcct catcgctctc 600 ctaggctcct ggcctgctgg actctgggct gcaggtcctt cttgaaaggc tgtgagtagt 660 gagacaagga gcaggagtga ggggtggcag gagagaagat agagattgag agagagagag 720 shake shake shake shake shake shake shake shake shake 780 ggagagaaag atggaagat aagagactg ggcgcagtgg ctcacgcctg taatcccaac 840 acttgggag gccaaggtgg gaggatggct tgaggaag agtctgagat cacctggcc 900 aacatagtga gaccccgtct ctaaaaaaaaaaaaaaaaaaaaaaaaaaaaagg 960 tttttttaa gagagagaga agagactca gagattgaga ctgagagaca gagagaga 1020 gatccaca ggagagggg gagagaaaagggaagggaagggaaagg 1080 aaaaaaga aaagcaggtg gcagagacac acagagggg accagagaa accagacac 1140 acggcaggtgg ctggcagcgg gcgctgtggg gtcacagta gggggacctg tg 1192 <210> 5 <211> 1149 <212> DNA <213> Homo sapiens <400> 5 atggagagga gggcgcggag ctcctccagg gagtcccgg ggcgaggcgg caggactccg 60 cacaaggaga acaagagggc aaaggccgag aggagcggcg ggggccgcgg gcgccaggag 120 gctgggcccg agccgtcggg ctccggacgg gcggggaccc cggggagcc ccgagcgccc 180 gccgccacgg tggtggacgt ggatgaggtc cgaggctccg gcgaggaggg caccgaggtg 240 gtggcgctgt tggagagcga gcggcccgag gaaggtacca aatcctccgg cttaggggcc 300 tgtgagtggc ttcttgtcct catttccctg ctcttcatca tcatgacctt ccctttttcc 360 atctggttct gcgtaaaggt tgtacaagag tatgaaagag taattatatt ccgactggga 420 catctgcttc ctggagaagc caaaggccct ggtcttttct tttttttgcc ctgcctggat 480 acctaccaca aggttgacct tcgtctccaa actctggaga taccttttca tgagatcgtg 540 accaaagaca tgtttataat ggagatagat gccatttgct actaccgaat ggaaaatgcc 600 tctcttctcc taagcagtct tgctcatgta tctaaagctg tgcaattcct tgtgcaaacc 660 actatgaagc gtctcctagc acatcgatcc ctcactgaaa ttcttctaga gaggaagagc 720 atcgcccaag atgcaaaggt tgccttggat tcagtgacct gtatttgggg aatcaaagtg 780 gagagaatag aaattaaaga tgtgaggttg ccagctgggc ttcagcactc actggctgtg 840 gaggctgaag cgcaaagaca agccaaagtg cggatgattg ctgcagaagc ggaaaaggct 900 gcttctgagt ccctgaggat ggcagctgag attctgtcag gcacccctgc tgctgttcag 960 cttcgatacc tccacaccct tcagtctctg tccacagaga agccttccac tgtggtttta 1020 cctttgccat ttgacctact gaattgcctg tcttccca gcaacagaac tcagggaagc 1080 ctccccttcc caagtccttc caaacctgtt gagccactaa atcctaaaaa gaaagactct 1140 cccatgtta 1149 <210> 6 <211> 589 <212> DNA <213> Woodchuck hepatitis virus <400> 6 aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa ctatgttgct 60 ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat tgcttcccgt 120 atggctttca ttttctcctc cttgtataaa tcctggttgc tgtctcttta tgaggagttg 180 tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc aacccccact 240 ggttggggca ttgccaccac ctgtcagctc ctttccggga ctttcgcttt ccccctccct 300 attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg ggctcggctg 360 ttgggcactg acaattccgt ggtgttgtcg gggaaatcat cgtcctttcc ttggctgctc 420 gcctgtgttg ccacctggat tctgcgcggg acgtccttct gctacgtccc ttcggccctc 480 aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt 540 cgccttcgcc ctcagacgag tcggatctcc ctttgggccg cctccccgc 589 <210> 7 <211> 225 <212> DNA <213> Artificial Sequence <220> <223> bGH poly(A) <400> 7 ctgtgccttc tagttgccag ccatctgttg tttgccccctc cccgtgcct tccttgaccc 60 tggaaggtgc cactcccact gtccttttcct aataaaatga ggaaattgca tcgcattgtc 120 tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt 180 gggaagacaa tagcaggcat gctggggatg cggtgggctc tatgg 225
Claims
1. A pharmaceutical composition for kidney-targeted gene therapy comprising the AAV-LK03 vector, wherein the AAV-LK03 vector transduces podocytes.
2. The pharmaceutical composition according to claim 1, wherein the AAV-LK03 vector contains a human transgene.
3. The pharmaceutical composition according to claim 2, wherein the human transgene is naturally occurring or recombinant.
4. The pharmaceutical composition according to any one of claims 1 to 3, wherein the AAV-LK03 vector comprises a podocyte-specific promoter.
5. The pharmaceutical composition according to claim 4, wherein the podocyte-specific promoter is a minimal nephrine promoter or a podosin promoter.
6. The pharmaceutical composition according to claim 5, wherein the minimal nephrine promoter or podosin promoter is a human minimal nephrine promoter or podosin promoter.
7. The pharmaceutical composition according to any one of claims 4 to 6, wherein the AAV-LK03 vector comprises a minimal human nephrine promoter.
8. The pharmaceutical composition according to any one of claims 1 to 7, wherein the AAV-LK03 vector comprises a woodchuck hepatitis post-transcriptional regulatory element (WPRE).
9. The pharmaceutical composition according to any one of claims 1 to 8, wherein the AAV-LK03 vector contains a polyadenylation signal.
10. The pharmaceutical composition according to claim 9, wherein the polyadenylation signal is a bovine growth hormone (bGH) polyadenylation signal.
11. The pharmaceutical composition according to any one of claims 1 to 10, wherein the AAV-LK03 vector includes a terminal inversion sequence (ITR) at one of the ends of the vector.
12. The pharmaceutical composition according to any one of claims 1 to 11, comprising the AAV-LK03 vector in the following order: ITR-promoter-transgene-WRPE-polyadenylation signal-ITR, if necessary.
13. A pharmaceutical composition according to any one of claims 1 to 12, which is administered systemically.
14. A pharmaceutical composition according to any one of claims 1 to 13, administered by intravenous injection.
15. A pharmaceutical composition according to any one of claims 1 to 13, administered by injection into the renal artery.
16. A pharmaceutical composition according to any one of claims 1 to 15, administered to a human patient.
17. The pharmaceutical composition according to claim 16, wherein the patient is an adult patient.
18. The pharmaceutical composition according to claim 16, wherein the patient is a pediatric patient between approximately 1 and 16 years of age.
19. The pharmaceutical composition according to any one of claims 16 to 18, wherein the AAV-LK03 vector is transduced into the patient's podocytes.
20. Use of the AAV-LK03 vector in the manufacture of a pharmaceutical product for kidney-targeted gene therapy, wherein the AAV-LK03 vector transduces podocytes.
21. The use according to claim 20, wherein the AAV-LK03 vector comprises a human transgene.
22. The use according to claim 21, wherein the human transgene is naturally occurring or recombinant.
23. The use according to any one of claims 20 to 22, wherein the AAV-LK03 vector comprises a podocyte-specific promoter.
24. The use according to claim 23, wherein the podocyte-specific promoter is a minimal nephrin promoter or a podosin promoter.
25. The use according to claim 24, wherein the minimal nephrine promoter or podosin promoter is a human minimal nephrine promoter or podosin promoter.
26. The use according to any one of claims 23 to 25, wherein the AAV-LK03 vector comprises a minimal human nephrine promoter.
27. The use according to any one of claims 20 to 26, wherein the AAV-LK03 vector comprises a woodchuck hepatitis post-transcriptional regulatory element (WPRE).
28. The use according to any one of claims 20 to 27, wherein the AAV-LK03 vector includes a polyadenylation signal.
29. The use according to claim 28, wherein the polyadenylation signal is a bovine growth hormone (bGH) polyadenylation signal.
30. The use according to any one of claims 20 to 29, wherein the AAV-LK03 vector includes a terminal inversion sequence (ITR) at one of the ends of the vector.
31. The use of the AAV-LK03 vector according to any one of claims 20 to 30, comprising, in the following order: ITR-promoter-transgene-WPRE-polyadenylation signal-ITR.
32. The use according to any one of claims 20 to 31, wherein the AAV-LK03 vector is administered systemically.
33. The use according to any one of claims 20 to 31, wherein the AAV-LK03 vector is administered by intravenous injection.
34. The use according to any one of claims 20 to 31, wherein the AAV-LK03 vector is administered by injection into the renal artery.
35. The use according to any one of claims 20 to 34, wherein the AAV-LK03 vector is administered to a human patient.
36. The use according to claim 35, wherein the patient is an adult patient.
37. The use according to claim 35, wherein the patient is a pediatric patient between approximately 1 and 16 years of age.
38. The use of the AAV-LK03 vector according to any one of claims 35 to 37, wherein the AAV-LK03 vector transduces patient podocytes.
39. An in vitro transduction method for podocytes, comprising contacting the podocytes with the AAV-LK03 vector.
Citation Information
Patent Citations
Adeno-associated virus vector
JP2017506521A