A biological method for mass-producing collagen with a 164.88° triple helix structure.
The Pichia yeast expression system allows for large-scale production of recombinant human type III collagen with a 164.88° triple helix structure, addressing the limitations of animal-derived collagen by ensuring structural integrity and safety for medical and cosmetic uses.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2024-06-19
- Publication Date
- 2026-03-26
AI Technical Summary
Current methods for producing collagen with a natural triple helix structure face challenges such as disruption of the helix structure during extraction from animal tissues, heterogeneous molecular weights, potential immunogenicity, and safety issues, making them unsuitable for large-scale production and medical applications.
A method using a Pichia yeast expression system to produce recombinant human type III collagen with a 164.88° triple helix structure, involving the construction of yeast cells with a recombinant expression vector containing specific polynucleotides, and fermentation under controlled conditions to achieve large-scale synthesis.
Enables the mass production of recombinant humanized collagen with a stable triple helix structure, overcoming the limitations of animal-derived collagen and providing a safer, more consistent product for medical and cosmetic applications.
Smart Images

Figure 0007836461000005 
Figure 0007836461000006 
Figure 0007836461000007
Abstract
Description
Technical Field
[0001] Cross-reference This application claims the priority of a Chinese patent application with an application date of September 28, 2023, an application number of 202311272338.8, and an invention title of "Biological Method for Mass-producing Collagen with a 164.88° Triple Helix Structure".
[0002] The present invention relates to realizing a method for mass-producing collagen having a 164.88° triple helix structure by using biological fermentation and belongs to the technical field of synthetic biology.
Background Art
[0003] There are 28 types of collagen in humans. Collagen is the most abundant protein in the human and animal bodies, accounting for 25 - 30% of the total protein in the body and about 6% of the body weight. Collagen is an important structural protein present in the skin, bones, teeth, corneas, tendons, ligaments, and various tissues and organs, and plays a role in supporting and protecting human tissues. Collagen is the main component of the extracellular matrix, and its biological activity is mainly manifested in promoting functions such as cell adhesion, growth and differentiation, response to cell signal transduction pathways, platelet aggregation, maintenance of cell and tissue organ functions, and damage repair. Collagen has a spatial structure that intertwines in a triple helix shape, and three independent collagen α - peptide chains are intertwined by hydrogen bonds to form a helix structure. Collagen binds to tissues and cells in the body through its triple helix structure to exert biological effects. Therefore, the biological activity of collagen highly depends on its natural triple helix structure. Due to its excellent biological activity, collagen has great application value and future prospects in the fields of biomedical materials, medicine, beauty, cosmetics, etc.
[0004] Currently, the main collagen products on the market are extracted from animal tissues. This method disrupts the natural triple helix structure during the extraction process, affecting the biological activity of the collagen. Furthermore, collagen obtained through extraction processes using animal sources has heterogeneous molecular weights in peptide fragments, resulting in poor processability. Because animal collagen and human collagen have different amino acid sequences, they may cause potential immunogenicity in clinical settings, making them less safe. Moreover, animal tissues are affected by their source, and potential safety issues, such as animal viruses, must be resolved before they can enter the market. As market demands for the safety and efficacy of collagen products increase, conventional methods of extracting collagen from animal tissues can no longer meet current market needs. The demand for collagen as a biomaterial applied in medical settings is also increasing daily, necessitating alternative solutions to the problems currently facing the market. Producing recombinant collagen with a natural triple helix structure using molecular biology techniques such as genetic engineering offers a very high potential for solving the aforementioned problems.
[0005] While genetically modified type III collagen products exist on the market, achieving the triple helix structure is difficult, and fermenting collagen with the correct triple helix structure using synthetic biology presents significant technical challenges.
[0006] In this field, there is a need for methods to ferment collagen with the correct triple helix structure using synthetic biology. [Overview of the project]
[0007] The inventors discovered human type III collagen, and structural studies confirmed that the core functional region of human type III collagen has a 164.88° triple helix structure (CN109593126A). The inventors succeeded in producing recombinant humanized type III collagen using an E. coli expression system through genetic recombination. However, the inventors discovered that the E. coli expression system has drawbacks, such as limited process scaling due to the low protein expression level. Therefore, the inventors attempted to express human type III collagen using a eukaryotic expression system. After numerous preliminary screenings, the inventors discovered that expressing human type III collagen in Pichia yeast allows for the large-scale in vitro synthesis of collagen with a 164.88° triple helix structure. Furthermore, from previous applications, the inventors discovered that the presence of bacterial endotoxins in human type III collagen expressed by E. coli increases the complexity and difficulty of collagen purification. The inventors solve this technical problem by expressing collagen in a yeast expression system.
[0008] This invention enables the mass production of recombinant humanized collagen belonging to type A, having a 164.88° triple helix structure, by improving the "chassis strain," thereby meeting market demand through mass production.
[0009] In one embodiment, a method is provided for constructing yeast cells that express collagen, comprising the step of introducing a recombinant expression vector into yeast cells, wherein the recombinant expression vector comprises a polynucleotide encoding collagen, and the collagen comprises repeating units of the sequence shown in SEQ ID NO: 1, the number of repeating units being 2 to 32, and the repeating units are directly bound, thereby expressing collagen. In one embodiment, the collagen is recombinant type III humanized collagen. In one embodiment, the collagen is collagen with a 164.88° triple helix structure.
[0010] In one embodiment, the collagen comprises the amino acid sequence shown in SEQ ID NO: 2 or 3. In one embodiment, the polynucleotide comprises the nucleotide sequence shown in SEQ ID NO: 4 or 5. The polynucleotide of the present invention can effectively express collagen in yeast host cells.
[0011] In one embodiment, the recombinant expression vector is a yeast-based expression vector. In one embodiment, the yeast-based expression vector is pPICZα A, pPIC9, pPIC9K, pHIL-S1, or pYAM75P vector.
[0012] In one embodiment, the yeast is Pichia pastrix. In one embodiment, the Pichia pastrix strains are Pichia pastrix X33, GS115, SMD1168, KM71, or KM71H.
[0013] In one embodiment, the construction method is: (1) The step of inserting a polynucleotide into an expression vector, preferably between the NotI enzyme cleavage site and the XhoI enzyme cleavage site of the pPiczalαA expression vector, to obtain a recombinant expression plasmid. (2) The step of performing enzymatic cleavage of the recombinant expression plasmid, preferably with sac1, (3) A step of purifying the recombinant expression plasmid after enzyme cleavage, (4) The process includes one or more of the steps of introducing the recombinant expression plasmid after enzymatic cleavage into yeast cells by electroporation.
[0014] In another embodiment, a yeast cell expressing collagen is provided, wherein the collagen includes repeating units of the sequence shown in Sequence ID No. 1, the number of repeating units being 2 to 32, the repeating units being directly bound, and the yeast cell is Pichia pastris.
[0015] In one embodiment, Pichia pastris is strain Pichia pastris X33, GS115, SMD1168, KM71, or KM71H. In one embodiment, collagen contains the amino acid sequence shown in SEQ ID NO: 2 or 3. In one embodiment, collagen is recombinant type III humanized collagen. In one embodiment, collagen is collagen with a 164.88° triple helix structure.
[0016] In one embodiment, the yeast cells include a yeast-based expression vector. In one embodiment, the yeast-based expression vector is pPICZα A, pPIC9, pPIC9K, pHIL-S1, or pYAM75P vector. In one embodiment, the expression vector includes a polynucleotide, the polynucleotide including the nucleotide sequence shown in SEQ ID NO: 2 or 3.
[0017] In another embodiment, the use of yeast cells in the production of collagen as described herein is provided.
[0018] In one embodiment, the collagen contains repeating units of the sequence shown in SEQ ID NO: 1, with the number of repeating units ranging from 2 to 32, and the repeating units are directly bound together. In one embodiment, the collagen contains the amino acid sequence shown in SEQ ID NO: 2 or 3. In one embodiment, the collagen is recombinant type III humanized collagen. In one embodiment, the collagen is collagen with a 164.88° triple helix structure.
[0019] In another embodiment, a method for producing collagen by fermentation is provided, comprising the steps of culturing the yeast cells described herein under appropriate conditions, adding methanol to the yeast cells to induce expression, and collecting the culture supernatant to obtain collagen.
[0020] In one embodiment, the culture medium is BMMY medium supplemented with an amino acid-free yeast nitrogen base and biotin.
[0021] In one embodiment, the collagen contains a repeating unit of the sequence shown in SEQ ID NO: 1, the number of repeating units is 2 to 32, and the repeating units are directly linked. In one embodiment, the collagen contains the amino acid sequence shown in SEQ ID NO: 2 or 3. In one embodiment, the collagen is recombinant type III humanized collagen, preferably collagen with a triple helix structure of 164.88°.
[0022] The advantages of the present invention include the following.
[0023] 1. The inventors discovered yeast cells suitable for the expression of recombinant type III humanized collagen, as well as its construction method and production method.
[0024] 2. The yeast cells of the present invention are Pichia pastoris, which has the advantages of high expression level and scalable process compared with prokaryotic expression systems such as Escherichia coli.
[0025] 3. The method of the present invention synthesizes collagen with a triple helix structure of 164.88° in vitro, realizes large-scale mass production at the ton level, and has important industrial significance.
[0026] 4. The present invention does not require the step of removing cell endotoxin.
Brief Description of Drawings
[0027] [Figure 1] Shows the electrophoresis diagram of the induction of the expression of high molecular weight P-012. [Figure 2] Shows the electrophoresis diagram of the induction of the expression of medium molecular weight P-C3T8. [Figure 3] Shows the cell adhesion activity of high molecular weight P-012. [Figure 4] Shows the cell adhesion activity of medium molecular weight P-C3T8. [Figure 5] Shows the results of the circular dichroism spectrum of high molecular weight P-012. [Figure 6] Shows the results of the circular dichroism spectrum of medium molecular weight P-C3T8. [Modes for carrying out the invention]
[0028] To further clarify the object, technical means, and advantages of the present invention, the technical means in the embodiments of the present invention will be described clearly and completely below with reference to the embodiments of the present invention, and obviously the described embodiments are some embodiments of the present invention, not all embodiments. All other embodiments that a person skilled in the art can obtain without creative effort based on the embodiments of the present invention are all within the scope of the protection of the present invention.
[0029] As used herein, recombinant collagen is a novel biomaterial that is identical or similar in amino acid sequence to human collagen, produced by screening the genetic code of a functional region of a specific type of human collagen using advanced structural biology, genetic engineering, and other technologies.
[0030] As used herein, “human recombinant type III collagen” means a recombinant protein consisting of or essentially consisting of a sequence derived from human type III collagen. As used herein, human recombinant type III collagen consists of or essentially consisting of a fragment or multiple repeats of a fragment derived from human type III collagen. As used herein, “yeast” includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeasts belonging to the imperfect fungi (Blastomycetes).
[0031] As used herein, yeast host cells refer to any yeast host cells that can be easily transformed, transfected, transduced, etc., by the nucleic acid construct or recombinant expression vector containing the polynucleotide of the present invention. The yeast host cells may be from the genera Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia, for example, Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces crivelli These are cells of Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces oviformis, or Yarrowia lipolytica. Preferably, the yeast cells are Pichia pastris. More preferably, Pichia pastris strains X33, GS115, SMD1168, KM71, or KM71H.
[0032] As used herein, the term “expression” includes, but is not limited to, all steps involved in the production of a polypeptide, including transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0033] As used herein, the term “expression vector” refers to a linear or circular DNA molecule comprising a polynucleotide encoding a polypeptide and operably ligated to a control sequence that provides its expression. In this specification, the expression vector is a yeast-derived expression vector, preferably pPICZα A, pPIC9, pPIC9K, pHIL-S1, or pYAM75P vector.
[0034] As used herein, the term “recombinant expression vector” means a single-stranded or double-stranded nucleic acid molecule that is isolated from a naturally occurring gene, modified to include a nucleic acid segment in a manner not found in nature, or synthesized, and which contains one or more regulatory sequences.
[0035] As used herein, the term “control sequence” refers to a nucleic acid sequence necessary for the expression of the polynucleotide encoding the mature polypeptide of the present invention. Each control sequence may be spontaneous (i.e., from the same gene) or exogenous (i.e., from a different gene) with respect to the polynucleotide encoding the polypeptide, or may be mutually spontaneous or exogenous. Such control sequences include, but are not limited to, a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, and a transcription terminator. A control sequence includes at least a promoter and transcription and translation termination signals. These control sequences may be provided with multiple linkers for the purpose of introducing specific restriction sites that facilitate linking between the control sequence and the coding region of the polynucleotide encoding the polypeptide.
[0036] collagen The present invention provides collagen. The collagen may include repeating units of a sequence having 80-100% sequence identity with the sequence shown in Sequence ID No. 1, or 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. The number of repeating units is 2-32, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32. Each repeating unit may be directly linked. The collagen is recombinant type III humanized collagen, preferably a 164.88° triple helix structure collagen. The collagen may include the amino acid sequence shown in SEQ ID NO: 2 or 3, or an amino acid sequence having 80-100% sequence identity thereto (e.g., 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%). The collagen described herein may have a triple helix structure or three identical chains (i.e., trimer form). The sequence of each chain may be one of the sequences described herein.
[0037] Recombinant expression vector The present invention also relates to a recombinant expression vector comprising nucleic acids of the present invention, operably ligated to one or more control sequences, for directing the expression of a coding sequence in a suitable host cell under conditions compatible with the control sequences. The vector may comprise a recombinant expression vector. The nucleic acids of the present invention may comprise a nucleotide sequence shown in SEQ ID NO: 4 or 5.
[0038] Nucleic acids can be manipulated in various ways to provide collagen expression. Depending on the expression vector, it may be desirable or necessary to manipulate the nucleic acid before inserting it into the vector. Techniques for modifying nucleic acids using recombinant DNA are well known in this field.
[0039] The regulatory sequence may be a promoter, which is a polynucleotide recognized by the host cell for the expression of the polynucleotide encoding the collagen or polypeptide of the present invention. The promoter includes a transcriptional regulatory sequence that mediates the expression of collagen or polypeptide. The promoter may be any nucleic acid that exhibits transcriptional activity in the host cell, including mutant, truncated, and hybrid promoters, and may be obtained from a gene encoding extracellular or intracellular collagen or polypeptide of the same or different species as the host cell.
[0040] Examples of suitable promoters for directing transcription of the vector or recombinant expression vector of the present invention in yeast host cells are not particularly limited. In the yeast host, useful promoters can be obtained from the genes of Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2 / GAP), Saccharomyces cerevisiae triose phosphate isomerase (TPI), Saccharomyces cerevisiae metallothionein (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase.
[0041] The regulatory sequence may be a transcriptional terminator that is recognized by the host cell and terminates transcription. The terminator is operably ligated to the 3' end of a polynucleotide encoding collagen or polypeptide. Any terminator that functions in a host cell may be used in the present invention. Preferred terminators in yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. The regulatory sequence may be an mRNA stabilization region that is downstream of the promoter and upstream of the gene's coding sequence, which increases gene expression.
[0042] Examples of suitable mRNA stabilization regions can be obtained from the Bacillus thuringiensis cryIIIA gene (International Publication No. 94 / 25612) and the Bacillus subtilis SP82 gene (Hue et al., 1995, Journal of Bacteriology 177:3465-3471).
[0043] The regulatory sequence may be a leader sequence, which is an untranslated region of mRNA that is crucial for translation in the host cell. The leader sequence is operably ligated to the 5' end of a polynucleotide encoding collagen or polypeptide. Any leader sequence that functions in the host cell may be used. Suitable leader sequences in yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae α-factor, and Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH2 / GAP).
[0044] The regulatory sequence may be a polyadenylated sequence, which is operably ligated to the 3' end of a polynucleotide and recognized by the host cell as a signal to add a polyadenosine residue to the transcribed mRNA during transcription. Any polyadenylated sequence that functions in the host cell may be used. Useful polyadenylated sequences for yeast host cells are described in Guo and Sherman, 1995, Mol. Cellular Biol. [Molecular Cell Biology] 15:5983-5990.
[0045] The regulatory sequence may be a signal peptide coding region that codes for a signal peptide linked to the N-terminus of collagen, thereby directing collagen into the cell's secretory pathway. The 5'-terminus of the polynucleotide coding sequence may essentially contain the signal peptide coding sequence originally linked to the translational reading frame, along with the segment of the coding sequence that codes for collagen. Alternatively, the 5'-terminus of the coding sequence may contain an exogenous signal peptide coding sequence relative to the coding sequence. An exogenous signal peptide coding sequence may be required if the coding sequence does not originally contain a signal peptide coding sequence. Alternatively, the exogenous signal peptide coding sequence may simply replace the native signal peptide coding sequence to enhance the secretion of collagen or polypeptide. However, any signal peptide coding sequence that directs expressed collagen into the host cell's secretory pathway may be used. Useful signal peptides from yeast host cells are obtained from the genes for Saccharomyces cerevisiae α-factor and Saccharomyces cerevisiae invertase. Yeast cells may be applied to the production of collagen according to this specification.
[0046] host cell The present invention also relates to recombinant host cells comprising the polynucleotides of the present invention, operably linked to one or more regulatory sequences that direct the production of the collagen of the present invention. By introducing the polynucleotide-containing construct into a host cell, the construct is maintained as a chromosomal integration body or as a self-replicating extrachromosomal vector. The term “host cell” includes offspring of a parent cell that are not identical to the parent cell due to mutations that occur during replication. The selection of host cells depends largely on the genes encoding collagen or polypeptides and their sources.
[0047] In this specification, the host cell may be a yeast cell, and includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the imperfect fungi (Blastomycetes). The yeast host cells may be from the genera Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia, for example, Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces crivelli These are cells of Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces oviformis, or Yarrowia lipolytica. In particular, the inventors have found that Pichia pastris is suitable for the production of collagen as described herein. Yeast cells can express the collagen as described herein. Preferably, the collagen is recombinant type III humanized collagen, and preferably collagen with a 164.88° triple helix structure. The yeast cells are Pichia pastris, preferably Pichia pastris X33, GS115, SMD1168, KM71, or KM71H strains. The yeast cells may contain yeast-derived expression vectors, preferably pPICZα A, pPIC9, pPIC9K, pHIL-S1, or pYAM75P vectors.The expression vector may contain a polynucleotide, which includes the nucleotide sequence shown in SEQ ID NO: 4 or 5.
[0048] Construction method The present invention provides a method for constructing collagen-expressing yeast cells, the method comprising the step of introducing a recombinant expression vector into yeast cells, the recombinant expression vector comprising a polynucleotide encoding collagen as herein. The recombinant expression vector may also comprise a polynucleotide comprising the nucleotide sequence shown in SEQ ID NO: 4 or 5. The recombinant expression vector may be a yeast-based expression vector, preferably pPICZα A, pPIC9, pPIC9K, pHIL-S1, or pYAM75P vector. The yeast may be Pichia pastris, preferably Pichia pastris X33, GS115, SMD1168, KM71, or KM71H strains.
[0049] The construction method is, (1) The step of inserting a polynucleotide into an expression vector, preferably between the NotI enzyme cleavage site and the XhoI enzyme cleavage site of the pPiczalαA expression vector, to obtain a recombinant expression plasmid. (2) The step of performing enzymatic cleavage of the recombinant expression plasmid, preferably with sac1, (3) A step of purifying the recombinant expression plasmid after enzyme cleavage, (4) The step of introducing the recombinant expression plasmid after enzymatic cleavage into yeast cells by electroporation may include one or more of the above steps.
[0050] Fermentation method This specification provides a method for producing collagen through fermentation. The method may include the steps of culturing yeast cells described herein under appropriate conditions, adding methanol to the yeast cells to induce expression, and collecting the culture supernatant to obtain collagen. The conditions and media for culturing the yeast cells are known to those skilled in the art and are not particularly limited. For example, the medium may be BMMY medium supplemented with an amino acid-free yeast nitrogen base and biotin.
[0051] The fermentation method may include (1) a culture step of a basic culture medium of yeast cells as described herein, (2) a fermentation culture step in which the basic culture medium is inoculated into a fermentation medium, cultured in a fermenter, and methanol is added at an appropriate growth stage to induce expression, and (3) a fermentation supernatant preparation step in which the culture is terminated at an appropriate time, a fermentation liquid is obtained, the microbial cells are removed, and the liquid is filtered to obtain a fermentation supernatant.
[0052] The fermentation method may further include a step of purifying the collagen. The purification step is known to those skilled in the art and is not particularly limited. For example, the purification method may be the purification step described in CN109593126A.
[0053] The present invention will be further described below with reference to examples. It should be understood that the scope of the present invention should be determined by the appended claims, and the examples should not be construed as limiting the scope of the invention.
[0054] Examples The present invention will be further illustrated by the following examples, but none of these examples or any combination thereof should be understood as limiting the scope or embodiments of the present invention. The scope of the present invention is limited by the appended claims, and those skilled in the art will be able to clearly understand the scope limited by the claims by combining this specification and common sense in the art. Without departing from the spirit and scope of the present invention, those skilled in the art can make any modifications or changes to the technical means of the present invention, and these modifications and changes are also included within the scope of the present invention.
[0055] Common methods for nucleotide PCR, cloning, and ligation are well known to those skilled in the art. For example, see "Molecular cloning: A laboratory manual," Sambrook et al. (1989), Cold Spring Harbor lab., Cold Spring Harbor, New York, Ausubl, FM et al. (eds.); "Current protocols in Molecular Biology," John Wiley and Sons (1995), Harwood, CR and Cutting, SM et al. (eds.); "DNA Cloning: A Practical Approach, Volumes I and II," DN Glover (ed.) (1985); "Oligonucleotide Synthesis," MJ Gait (ed.) (1984); "Nucleic Acid Hybridization," B.D. Hames & S.J. Higgins (eds.) (1985); "A Practical Guide To Molecular This can be found in "Cloning [A Practical Guide to Molecular Cloning]" by B. Perbal (1984).
[0056] Example 1: Construction, expression, and screening of protein fragments 1) Amino acid sequence of high molecular weight recombinant type III humanized collagen: gergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergap gfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpa gpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergap(Sequence code 2, repeating unit is gergapgfrgpagpngipgekgpagergap, Sequence code 1).
[0057] Nucleotide sequences of high molecular weight recombinant type III humanized collagen: aggtgaaagaggtgcc ccaggtttta gaggtccagc aggtccaaat ggtattccag gagagaaagg tccagcagga gaagaggtg cccccggtga gagaggtgct cccggattca gaggtcctgc cggtccaaat ggtattcccg gtgaaaaggg acctgcagga gagagaggtg ccccaggaga gagaggagca ccaggattca gaggtccagc tggtccaaat ggtatccctg gagagaaggg acccgctgga gaagaggtg cccctggaga aagaggtgcc cccggtttta gaggacctgc tggacccaac ggaatcccag gagagaaggg tcccgcaggt gagagaggtg ctcctggaga gagaggagca cctggattca gaggacctgc aggacccaac ggaatacctg gtgaaaaagg tcctgccggt gaagaggtg ctccaggtga aagaggagca ccaggtttta gaggaccagc tggtcctaac ggtatccctg gtgaaaaagg acccgctggt gaagaggag ccccaggtga gagaggtgct cccggtttta gaggtccagc aggtccaaac ggaatacccg gtgaaaaagg acctgctgga gagagaggtg ctcctggaga aagaggtgct cctggtttca gaggtccagc aggacccaat ggaatcccag gagaaaagg acctgcaggt gaagaggag cccctggtga aagaggagca cctggtttta gaggaccagc aggtcctaat ggtattccag gagagaaggg acccgccgga gaagaggag cacccggtga aagaggagca ccaggtttca gaggaccagc tggaccaaac ggtattccg gtgaaaaagg accagctgga gagagaggtg caccaggagaaagaggtgct cccggtttca gaggtccagc cggaccaaat ggtatacctg gagaaaaggg tccagcagga gaaagaggtg cacccggtga aagaggtgca ccaggtttta gaggtcccgc cggtccaaat ggaatccctg gtgaaaaggg acccgctggt gaaagaggtg ctccaggaga gagaggagcc cccggtttta gaggtcccgc tggtccaaat ggaatacctg gagagaaggg tcctgctggt gagagaggtg cacctggaga gagaggtgcc ccaggtttca gaggacctgc cggtcccaat ggaatacccg gagaaaaagg tcccgcagga gagagaggtg ccccaggtga aagaggtgca cccggtttca gaggacccgc cggtcctaat ggtatacctg gagaaaaagg accagccggt gagagaggtg ctcccggaga gagaggagcc cctggtttca gaggtccagc aggaccaaac ggtattccag gagaaaaggg accagcagga gagagaggag ccccatg (SEQ ID NO: 4).
[0058] 2) Amino acid sequence of medium molecular weight recombinant type III humanized collagen: Gergapgfrgpagpngipgekgpagergap gergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergap(Sequence ID 3).
[0059] Nucleotide sequences of medium-molecular-weight recombinant type III humanized collagen: (Sequence ID 5).
[0060] The above coding nucleotide sequence is commercially synthesized. By inserting the above coding nucleotide sequence between the NotI and XhoI enzyme cleavage sites of the pPiczalαA expression vector, and placing the target gene after the signal cleavage site, recombinant expression plasmids P-012 (high molecular weight) and P-C3T8 (medium molecular weight) were obtained.
[0061] Example 2: Improvement of yeast strain for recombinant type III humanized collagen 1. Enzymatic cleavage of plasmids Constructed expression plasmids P-012 and P-C3T8, each in a quantity of 20-40 μg, were enzymatically digested with sac1. The digestion was then carried out at 37°C for 2-3 hours according to the restriction enzyme digestion ratio. After digestion, nucleic acid gel electrophoresis was performed to detect the plasmids before and after digestion, and it was confirmed whether all of the plasmid was digested and whether the band position after digestion was larger than that before digestion.
[0062] 2. Plasmid purification After enzymatic cleavage, the plasmid is purified using a plasmid purification kit to remove impurities such as ions, dissolved in 20-25 μl of sterile pure water, the plasmid concentration is detected, and the plasmid is left at 4°C to prepare for use.
[0063] 3. Improvement of yeast strains Perform the following procedure on yeast competent cells (X33) in a biological safety cabinet.
[0064] a. Disinfect a 0.2 cm electroporation cup by immersing it in 75% alcohol for 10 minutes, then rinse it three times with sterile water and dry it. b. Place the electroporation cup in an ice bath for 20 minutes, then turn on the electroporator. c. Add 80 μl of competent cells and 5-15 μg of enzyme-cleaved plasmid to a 1.5 ml sterile EP tube, and mix thoroughly by repeatedly using a pipette. d. Transfer 100 μl of the mixture to the electroporation cup, place it in an ice bath for 5 minutes, wipe the outside of the electroporation cup, transfer the electroporation cup to the electroporator tank, press the start button, and perform electroporation. e. After electroporation is complete, add 1 ml of 1 M sterile sorbitol solution to the electroporation cup, seal it with a sealing film, and incubate at 30°C for 2 hours. f. Transfer the mixture in the electroporation cup to a 10 ml sterile EP tube, then add 1 ml of YPD liquid medium (0.2 g / L yeast peptone, 0.1 g / L yeast extract powder) to the EP tube and incubate at 30°C and 300 rpm for 1 hour.
[0065] g. Plate preparation: Take 200 μl of the transformed and incubated bacterial suspension in a biological safety cabinet, place it in plates 1-3, and use plate 4 as a control. After uniformly spreading the plates using a sterile convection rod, incubate the plates at 30°C for approximately 2-5 days.
[0066] h. Strain culture: Plate culture until plaques are formed, add 10 ml of anhydrous glucose solution to 40 ml of YPD liquid medium, wait until the medium temperature drops to room temperature, dispense 50 ml of medium into 10 50 ml bioreaction tubes at 5 ml / tube, add 2000 mg / L of bleomycin solution proportionally, select 10 monoclonals from the plate and inoculate each into 10 small tubes, and culture overnight at 30°C and 300 rpm. Prepare 200 ml of BMGY medium, sterilize, add 20 ml of 10 × YNB stock solution and 20 μl of 500 × biotin stock solution to a shaking flask, mix uniformly, dispense 200 ml of medium into 10 50 ml centrifuge tubes at 20 ml / tube, then inoculate 4 ml of the cultured bacterial suspension into 10 20 ml / tube centrifuge tubes, and culture overnight until the bacterial suspension OD value is 3 to 10.
[0067] i. Expression induction: Prepare 500 ml of BMMY medium. After sterilization, add 50 ml of 10× YNB stock solution and 500 μl of 500× biotin stock solution to a shaking flask and mix uniformly. Dispense the 500 ml of medium into 10 250 ml shaking flasks at a rate of 50 ml / tube. Centrifuge the cultured bacterial suspension at 1500 rpm for 10 minutes. Discard the supernatant. Separate the bacterial cells from the 10 centrifuge tubes into the medium in each of the 10 shaking flasks to precipitate and suspend them, then transfer them to each shaking flask. The cells were cultured in a shaking flask at 30°C and 300 rpm. Every 24 hours, 1 ml of sample was taken from 10 shaking flasks, placed in 1.5 ml EP tubes, and stored at -20°C. Expression was induced by adding 1% methanol to the shaking flasks (filtered through a 0.22 μm filter). The process was completed on day 5, the samples in the 1.5 ml EP tubes were centrifuged at 12000 rpm for 5 minutes, the supernatant was taken and subjected to electrophoresis detection, and the expression status of each of the 10 clones was observed.
[0068] 4. Electrophoresis detection The specific procedure is as follows: Take 40 μl of sample solution, add 10 μl of 5× protein loading buffer (250 mM Tris-HCl (pH: 6.8), 10% SDS, 0.5% bromophenol blue, 50% glycerol, 5% β-mercaptoethanol), boil in 100°C water for 10 minutes, then add 10 μl of SDS-PAGE protein gel to each well, perform electrophoresis at 80 V for 2 hours, stain the protein with Coomassie Brilliant Blue stain (0.1% Coomassie Brilliant Blue R-250, 25% isopropanol, 10% glacial acetic acid) for 20 minutes, and then destain with protein destaining solution (10% acetic acid, 5% ethanol). The electrophoretic detection results are shown in Figures 1 and 2. The P-012 target protein has a theoretical molecular weight of 44.75 kD and an apparent molecular weight of 50 kD, while the P-C3T8 target protein has a theoretical molecular weight of 22.39 kD and an apparent molecular weight of 28 kD. The electrophoretic detection results indicate that the yeast strain was successfully improved.
[0069] Example 3: Mass spectrometry detection of recombinant type III humanized collagen 1. Laboratory equipment: 1) High-resolution mass spectrometer: XevoG2-XS QTof (Waters) 2) Ultra-high-performance liquid chromatography: ULC (Acquity UPLC I-Class) (Waters) 2. Materials and Reagents 1) Guanidine HCl (Sigma) 2) Urea (Bio-Rad) 3) Trisbase (Bio-Rad) 4) DTT (Bio-Rad) 5) IAM (Sigma) 6) Zeba spin column (Pierce) 7) ACQUITY UPLC peptide BEH C18 column, 300 angstroms, 1.7 μm, 2.1 mm × 150 mm (Waters) 8) UNIFI (Waters) 9) Trypsin (Promega) 10) Chymotrypsin (Sigma) 11) Glu-C (Wako) 12) LysC (Wako) 3. Experimental method: 1) Enzymatic digestion with trypsin, chymotrypsin, and Glu-C: An appropriate amount of the test substance is taken out, pretreated appropriately, then trypsin, chymotrypsin, and Glu-C are added, and the substance is enzymatically digested at 37°C for 20 hours.
[0070] 2) High-Performance Liquid Chromatography: The test substance was enzymatically digested and then separated using an ultra-high-performance liquid chromatography system, Acquity UPLC I-Class. Liquid phase A was a 0.1% FA aqueous solution, and liquid phase B was a 0.1% FA acetonitrile solution. The test substance was loaded onto the column using an autosampler and separated by chromatography. The column temperature was set to 55°C, the flow rate to 300 μl / min, and the TUV detector wavelength to 214 nm. The relevant liquid phase gradient was as follows: [Table 1]
[0071] 3) Mass Spectrometry Identification: The test substance is desalted and separated by ultra-high-performance liquid chromatography, and then analyzed by mass spectrometry using a Waters XevoG2-XS QTof mass spectrometer. Analysis time: 63 minutes, Detection method: positive ions, MS, Scanning range (m / z): 300~2000.
[0072] 4) Mass Spectrometry Data Processing: Originally, database queries were performed using UNIFI (1.8.2, Waters) software, and the main parameters are as follows (Table 1): [Table 2]
[0073] 4. Experimental Results and Analysis Using trypsin, chymotrypsin, and Glu, the test substance was enzymatically hydrolyzed in solution to obtain peptide fragment samples. These samples were then analyzed using an LC-MS / MS instrument, and the resulting raw data was queried from a database using UNIFI software.
[0074] 1) Detection of P-012 molecular weight and corresponding polypeptide by mass spectrometry [Table 3] It is detected that the polypeptide fragment coverage rate is 100%.
[0075] 2) Detection of P-C3T8 molecular weight and corresponding polypeptide by mass spectrometry [Table 4] It is detected that the polypeptide fragment coverage rate is 100%.
[0076] The enzymatically digested samples were analyzed by LC-MS / MS, database queries were performed, and the results were integrated. The final sample peptide fragment coverage was 100%, indicating highly reliable detection results.
[0077] Example 4: Detection of cell adhesion activity of recombinant type III humanized collagen For information on methods for detecting collagen activity, please refer to the literature: Juming Yao, Satoshi Yanagisawa, Tetsuo Asakura, Design, Expression and Characterization of Collagen-Like Proteins Based on the Cell Adhesive and Crosslinking Sequences Derived from Native Collagens, J Biochem. 136, 643-649 (2004). The specific procedure is as follows.
[0078] (1) Using the ultraviolet absorption method, the concentration of the target protein sample containing bovine type I collagen (China Food and Drug Administration, No.: 380002) and the recombinant humanized protein according to the present invention is detected.
[0079] Specifically, the amount of ultraviolet absorption of the sample at 215 nm and 225 nm is measured, and the protein concentration is calculated according to the empirical formula C(μg / mL) = 144 × (A215 - A225). Note that detection is necessary when A215 < 1.5. The principle of this method is as follows: It measures the characteristic absorption of peptide bonds in far ultraviolet light, is unaffected by the content of chromophore, has few disturbing substances, is easy to handle, and is suitable for detecting human collagen and its analogs that do not fluoresce with Coomassie Brilliant Blue. (Reference: Walker JM. The Protein Protocols Handbook, second edition. HumanaPress. 43-45.) After detecting the protein concentration, the concentration of all target proteins is adjusted to 0.5 mg / mL with PBS.
[0080] (2) Add 100 μL each of the protein solutions and a control blank PBS solution to a 96-well plate and let stand at room temperature for 60 minutes.
[0081] (3) Add 105 NIH / 3T3 cells in good culture condition to each well and incubate at 37°C for 60 minutes.
[0082] (4) Wash each well four times with PBS.
[0083] (5) The absorbance at OD492nm is detected using an LDH detection kit (Roche, 04744926001). Based on the values of the blank control, the cell adhesion rate can be calculated. The formula is: cell adhesion rate = × 100%. The cell adhesion rate can reflect the activity of collagen. The higher the activity of the protein, the faster it can provide a good external environment to the cells and help cell adhesion. The detection results are shown in Figures 3 and 4 below.
[0084] Example 5: Circularly polarized dichroic spectral ultraviolet scanning analysis of recombinant type III humanized collagen Experimental method (1) Setting of equipment parameters Bandwidth: 1.0nm Step: 1.0nm Measurement range: 190-260nm (scanning in the far-UV region) / 250-340nm (scanning in the near-UV region) Time-per-point: 0.5s Repeats: 3 times Cell length: 10mm|0.5mm Temperature: room temperature (2) Far ultraviolet scanning and near ultraviolet scanning of standard products The scanning wavelength was set to 180-340 nm, and background tests and buffer blank tests were performed to obtain the circular dichroism (far-ultraviolet, near-ultraviolet) absorbance of a 1 mg / mL CSA standard solution in the 180-340 nm range.
[0085] (3) Sample processing Protein samples of P-012 and P-C3T8 were concentrated using a 10KD ultrafiltration filter (Millipore) until the protein concentration reached 1 mg / ml.
[0086] (4) Far ultraviolet scanning of the sample The cuvette is immersed overnight in 2M HNO3, washed with deionized water and dried, background data is collected, then blank buffer is collected, an appropriate amount of the test substance is added to the cuvette, and data is acquired by performing far-ultraviolet scanning at 190-260 nm based on the above parameters.
[0087] (5) Near-ultraviolet scanning of the sample The cuvette is immersed overnight in 2M HNO3, washed with deionized water and dried, and the background is collected. Then, the blank buffer is collected, an appropriate amount of the test substance is added to the cuvette, and near-ultraviolet scanning is performed at 250-340 nm based on the above parameters to acquire data.
[0088] (6) Scanning spectral processing After scanning, baseline subtraction and smoothing are performed on all spectra using the Pro-Data Viewer software.
[0089] Experimental results and analysis The results showed that both P-012 and P-C3T8 exhibited a positive peak at 221 nm, indicating that both proteins possess a triple helix structure. The results are shown in Figures 5 and 6.
Claims
1. A method for constructing yeast cells expressing collagen, comprising the step of introducing a recombinant expression vector into yeast cells, wherein the recombinant expression vector comprises a polynucleotide encoding collagen, the collagen comprises the amino acid sequence shown in SEQ ID NO: 2 or 3 or an amino acid sequence having 90% to 100% sequence identity with the amino acid sequence shown in SEQ ID NO: 2 or 3, the yeast is Pichia pastris, and the collagen has cell adhesion activity and a triple helix structure.
2. The method according to claim 1, wherein the polynucleotide comprises the nucleotide sequence shown in SEQ ID NO: 4 or 5, or a nucleotide sequence having 80% to 100% sequence identity with the nucleotide sequence shown in SEQ ID NO: 4 or 5.
3. The method according to claim 1, wherein the recombinant expression vector is pPICZα A, pPIC9, pPIC9K, pHIL-S1, or pYAM75P vector.
4. The method according to claim 1, wherein the yeast is strain Pichia pastrius X33, GS115, SMD1168, KM71, or KM71H.
5. (1) A step of inserting polynucleotides into an expression vector to obtain a recombinant expression plasmid, (2) The step of enzymatically cleaving the recombinant expression plasmid, (3) A step of purifying the recombinant expression plasmid that has been cleaved by enzyme, and (4) Step of introducing the recombinant expression plasmid, which has been enzymatically cleaved by electroporation, into yeast cells. The method according to claim 1, comprising one or more of the steps of claim 1.
6. The method according to claim 5, wherein a polynucleotide is inserted between the NotI enzyme cleavage site and the XhoI enzyme cleavage site of the pPiczalαA expression vector.
7. The method according to claim 1, wherein the collagen has a 164.88° triple helix structure.
8. Yeast cells expressing collagen constructed by the method described in any one of Claims 1 to 7.
9. Use of yeast cells for the production of collagen according to claim 8.
10. A method for producing collagen by fermentation, comprising culturing the yeast cells described in claim 8 under appropriate conditions, inducing expression by adding methanol to the yeast cells, and collecting the culture supernatant to obtain collagen.
11. The method according to claim 10, wherein the culture medium is BMMY medium supplemented with an amino acid-free yeast nitrogen base and biotin.
12. (1) Culture step of the basic culture medium of yeast cells, (2) Fermentation culture step, in which the basic culture medium is inoculated into a fermentation medium, cultured in a fermenter, and methanol is added at the appropriate growth stage to induce expression, and (3) Cultivate until the appropriate time, terminate the culture, obtain the fermentation liquid, remove the yeast cells, filter the fermentation liquid, and obtain the fermentation supernatant, fermentation supernatant preparation step, The method according to claim 10, including the method described in claim 10.
Citation Information
Patent Citations
Polypeptide, and production method and application thereof
CN109593126A
Recombinant full-length III type humanized collagen yeast engineering strain and construction method thereof
CN115558612A
Yeast recombinant XVII type humanized collagen and preparation method thereof
CN116375847A
Production of recombinant human collagen
US20080081353A1
Novel recombinant collagen polypeptides and molecules
WO2023135300A1