Methods and compositions for sensitizing tumor cells to immunotherapy

Inhibiting autophagy and the NF-κB pathway in cancer cells using CRISPR/Cas agents and small molecule inhibitors enhances sensitivity to TNF-α-mediated killing, addressing resistance to immunotherapy and improving treatment outcomes.

JP7837276B2Active Publication Date: 2026-03-30REGENERON PHARMACEUTICALS INC
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-03-03
Publication Date
2026-03-30

AI Technical Summary

Technical Problem

Cancer cells often develop resistance to immunotherapy, particularly due to loss-of-function mutations in β2-microglobulin (B2M) or JAK1/JAK2, leading to clinical resistance to checkpoint blockade, and the molecular mechanisms controlling tumor cell sensitivity to T-cell killing are not fully understood.

Method used

Inhibiting autophagy and/or the NF-κB pathway in cancer cells using agents such as CRISPR/Cas agents, TALEN nucleases, or small molecule inhibitors to enhance sensitivity to TNF-α-mediated killing, combined with cancer immunotherapy.

Benefits of technology

Enhances the sensitivity of cancer cells to T-cell killing, overcoming resistance and improving treatment efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007837276000008
    Figure 0007837276000008
  • Figure 0007837276000009
    Figure 0007837276000009
  • Figure 0007837276000010
    Figure 0007837276000010
Patent Text Reader

Abstract

Provided herein are methods and compositions related to treating or preventing cancer (e.g., by targeting tumors in a subject with cancer) by administering an agent that inhibits autophagy to a subject. In certain embodiments, provided herein are compositions related to methods of sensitizing cancer cells to tumor necrosis factor alpha (TNF-α)-mediated killing by contacting the cancer cells or administering an agent that inhibits autophagy. Provided herein are methods and compositions for increasing the sensitivity of cancer cells to T cell killing (e.g., tumor necrosis factor α (TNF-α)-mediated killing) by inhibiting autophagy and / or the NF-κB pathway.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims the interests of the following U.S. Provisional Patent Application No. 62 / 985,004, filed on March 4, 2020, the entire contents of which are incorporated herein by reference.

[0002] Sequence List This application includes an electronically submitted sequence listing in ASCII format, which is incorporated herein by reference in its entirety. The ASCII copy, created on March 3, 2021, is named RPB-02025_SL.txt and is 14,383 bytes in size. [Background technology]

[0003] Cancer is the second leading cause of death in the United States. Immunotherapy has transformed cancer treatment, but tumor cell resistance to these therapies remains a major challenge. For example, loss-of-function mutations in β2-microglobulin (B2M) or JAK1 / JAK2 in tumor cells are associated with clinical resistance to checkpoint blockade. Importantly, the molecular mechanisms controlling the sensitivity of tumor cells to T-cell killing have not yet been fully characterized. Therefore, there remains a need for novel and effective cancer treatments, including therapies that enhance the sensitivity of cancer cells to T-cell killing. [Overview of the project] [Means for solving the problem]

[0004] This specification provides methods and compositions for increasing the sensitivity of cancer cells to T-cell killing (e.g., tumor necrosis factor-α (TNF-α)-mediated killing) by inhibiting autophagy and / or the NF-κB pathway. This specification also provides methods and compositions for treating and / or preventing cancer in a subject (e.g., a subject in need thereof) by increasing the sensitivity of cancer cells in the subject to T-cell killing (e.g., TNF-α-mediated killing) by inhibiting autophagy and / or the NF-κB pathway. In some embodiments, the methods provided herein further include administering cancer treatment (e.g., cancer immunotherapy) to the subject.

[0005] In some embodiments, methods are provided herein for sensitizing cancer cells to TNF-α-mediated killing by contacting cancer cells with an agent that inhibits autophagy and / or the NF-κB pathway (e.g., at least one agent disclosed herein). In certain embodiments, methods are provided herein for increasing TNF-α-mediated killing of cancer cells in a subject by administering the subject with at least one agent that inhibits autophagy and / or the NF-κB pathway (e.g., an agent disclosed herein). In some embodiments, the cancer cells are located within the subject. In some embodiments, the cancer cells are located within a tumor (e.g., a solid tumor of the subject). In certain embodiments, the method further includes subjecting the subject to cancer treatment (e.g., cancer immunotherapy).

[0006] In some embodiments, the drug inhibits autophagy by inhibiting the expression or activity of an autophagy gene (i.e., a gene that, when inhibited, codes for a product that leads to a decrease in intracellular autophagy levels). In some embodiments, the drug targets an autophagy gene (e.g., the drug modifies the sequence of the autophagy gene). In certain embodiments, the drug targets an autophagy gene product (e.g., RNA or protein coded by the autophagy gene). In some embodiments, the autophagy gene may be selected from ATG12, WIPI2, RB1CC1, PIK3C3, ATG9A, ATG2A, ATG5, ATG14, EI24, NRBF2, ATG13, TAX1BP1, and ATG10.

[0007] In some embodiments, the drug inhibits the NF-κB pathway by inhibiting the expression or activity of NF-κB pathway genes. In some embodiments, the drug targets the NF-κB pathway genes themselves (e.g., the drug modifies the sequence of the NF-κB pathway genes). In certain embodiments, the drug targets the NF-κB pathway gene product (e.g., RNA or protein encoded by the NF-κB pathway genes). In certain embodiments, the NF-κB genes may be selected from CFLAR, UBE2L3, RNF31, IKBKB, MAP3K7, TAB1, RELA, IKKBKG, CHUK, TAB2, TBK1, MAPKAPK2, RBCK1, TRAF2, SHARPIN, and TNFAIP3.

[0008] Therefore, in certain embodiments, the drug can modify at least one autophagy gene or NF-κB gene, and modification of at least one autophagy gene and / or NF-κB gene results in decreased expression and / or activity of the autophagy gene product and / or NF-κB gene product. In certain embodiments, modification of the autophagy gene or NF-κB gene may include deletion, insertion, substitution, or a combination thereof. In certain embodiments, the drug may be a CRISPR / Cas agent, a TALEN nuclease, or a zinc finger nuclease.

[0009] In certain embodiments, the drug inhibits and / or reduces the activity of RNA or protein encoded by an autophagy gene or NF-κB gene. In some embodiments, the drug may be an interfering nucleic acid (e.g., siRNA, shRNA, miRNA, or antisense oligonucleotide) that targets RNA (e.g., mRNA) encoded by an autophagy gene or NF-κB gene. In some embodiments, the drug is a small molecule inhibitor of the autophagy or NF-κB pathway.

[0010] In certain embodiments, the methods provided herein further include administering additional anticancer therapies to subjects. In some embodiments, the additional anticancer therapy is cancer immunotherapy. In some embodiments, cancer immunotherapy includes administering autologous or allogeneic T-cell therapy to subjects, administering autologous or allogeneic CAR T-cell therapy to subjects, administering cancer vaccines to subjects, administering TNF-α to subjects, and / or administering immune checkpoint inhibitors to subjects. In some embodiments, the additional anticancer therapy includes administering Smac mimetic (e.g., LCL-161, APG-1387, TL32711, GDC-0917, HGS1029, AT-406) to subjects.

[0011] In certain embodiments, agents that inhibit autophagy in cancer cells for use in sensitizing target cancer cells to TNF-α-mediated killing are provided herein. Further, in some embodiments, agents that inhibit autophagy in cancer cells for use in increasing TNF-α-mediated killing of target cancer cells are provided herein. In some embodiments, agents that inhibit autophagy in cancer cells, and combination therapies comprising a cancer immunotherapy for use in the treatment of cancer are provided herein. In embodiments of the present invention, for example, the following items are provided. (Item 1) A method for sensitizing cancer cells to tumor necrosis factor alpha (TNF-α)-mediated cytosis, the method comprising contacting the cancer cells with a drug that inhibits autophagy of the cancer cells. (Item 2) The aforementioned drug is the method described in item 1, which inhibits the expression or activity of autophagy genes. (Item 3) The method according to item 2, wherein the autophagy gene is selected from ATG12, WIPI2, RB1CC1, PIK3C3, ATG9A, ATG2A, ATG5, ATG14, EI24, NRBF2, ATG13, TAX1BP1, and ATG10. (Item 4) The method according to item 2 or item 3, wherein the agent modifies at least one autophagy gene, and by modifying at least one autophagy gene, the expression or activity of the autophagy gene is reduced. (Item 5) The modification of the autophagy gene as described in item 4, comprising deletion, insertion, substitution, or a combination thereof. (Item 6) The method according to any one of items 1 to 5, wherein the agent is a composition comprising a guide RNA effective in inducing a Cas enzyme to cleave or ligate the sequence of the autophagy gene, the guide RNA comprising a DNA targeting segment that targets a guide RNA target sequence within the autophagy gene. (Item 7) The method according to item 6, wherein the guide RNA is configured to provide a cleavage event selected from double-strand breaks and single-strand breaks within the autophagy gene. (Item 8) The method according to item 6 or 7, wherein the guide RNA target sequence includes or is adjacent to the start codon of the autophagy gene. (Item 9) The method according to item 8, wherein the guide RNA target sequence is within approximately 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the start codon. (Item 10) The method according to any one of items 6 to 9, wherein the guide RNA comprises the DNA targeting segment and a cluster of regularly arranged short palindromic sequence repeat (CRISPR) RNA (crRNA) including the trans-activated CRISPR RNA (tracrRNA). (Item 11) The method according to item 10, wherein the guide RNA is a modular guide RNA in which crRNA and tracrRNA are separate molecules that hybridize with each other. (Item 12) The method according to any one of items 6 to 11, wherein the composition further comprises a Cas protein or a nucleic acid sequence encoding the Cas protein. (Item 13) The method according to item 12, wherein the Cas protein is a nuclease-active Cas protein. (Item 14) The aforementioned Cas protein is a nuclease-inactive Ca fused to a transcription repressor domain. The method described in item 12, which is an S protein. (Item 15) The method according to item 13 or 14, wherein the Cas protein is the Cas9 protein. (Item 16) The aforementioned Cas9 molecules are S. aureus Cas9 protein and S. pyogenes The method described in item 15, which is the Cas9 protein, or N. meningitidis Cas9 protein. (Item 17) The method according to any one of items 1 to 5, wherein the agent is a composition comprising a nucleic acid comprising a first nucleotide sequence encoding a guide RNA effective in inducing a Cas enzyme to cleave or ligate the sequence of the autophagy gene, the guide RNA comprising a DNA targeting segment that targets a guide RNA target sequence within the autophagy gene. (Item 18) The method according to item 17, wherein the guide RNA target sequence includes or is adjacent to the start codon of the autophagy gene. (Item 19) The method according to item 18, wherein the guide RNA target sequence is within approximately 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the start codon. (Item 20) The method according to item 17, wherein the guide RNA target sequence is located in exon 1 or exon 2 of the autophagy gene. (Item 21) The method according to any one of items 17 to 20, wherein the guide RNA comprises the DNA targeting segment and a cluster of regularly arranged short palindromic sequence repeat (CRISPR) RNA (crRNA) including the trans-activated CRISPR RNA (tracrRNA). (Item 22) The method according to any one of items 17 to 21, wherein the guide RNA is a modular guide RNA in which the crRNA and the tracrRNA hybridize with each other. (Item 23) The method according to item 22, wherein the composition further comprises a second nucleotide sequence encoding a Cas protein. (Item 24) The method according to item 23, wherein the Cas protein is a nuclease-active Cas protein or a nuclease-inactive Cas protein fused to a transcription repressor domain. (Item 25) The method according to item 23 or 24, wherein the Cas protein is the Cas9 protein. (Item 26) The method according to item 25, wherein the Cas9 protein is S. aureus Cas9 protein, S. pyogenes Cas9 protein, or N. meningitidis Cas9 protein. (Item 27) The method according to any one of items 1 to 5, wherein the drug is a TALEN nuclease or a zinc finger nuclease. (Item 28) The aforementioned drug is the method described in any one of items 1 to 3, which inhibits the activity of RNA or protein. (Item 29) The method described in item 28, wherein the drug is an interfering nucleic acid. (Item 30) The method according to item 29, wherein the interfering nucleic acid is siRNA, shRNA, miRNA, or antisense oligonucleotide. (Item 31) The aforementioned drugs include PI3 kinase inhibitors, phosphoinositide 3 kinase (PI3) inhibitors, Unc-51-like kinase 1 (ULK1) inhibitors, vacuolar protein sorting protein 18 (Vps18) inhibitors, vacuolar protein sorting protein 34 (Vps34) inhibitors, ubiquitin-specific peptidase (USP10 or USP13) inhibitors, thioxanthone-based autophagy inhibitors, ATG4 inhibitors, autofinib, 3-methyladenine, wartmannin, ammonium chloride, bafilomycin A1, eflornithine, leupeptin, betulinic acid, CA074, colchicine, thapsigargin, and vacuum. The method according to item 1, wherein the small molecule autophagy inhibitor is selected from Olin-1, vinblastine, desmethylclomipramine, LY294002, PT210, GSK-2126458, Spautin-1, SAR405, Compound 31, VPS34-IN1, PIK-III, Compound 6, MRT68921, SBI-0206965, Pepstatin A, E64d, clomipramine, lecanton, chloroquine, hydroxychlorquine, monensin, Lys05, ARN5187, Compound 30, MPT0L145, ROC325, verteporfin, NSC185058 and NSC377071. (Item 32) The method according to any one of items 1 to 31, wherein the cancer cells are lung cancer cells, breast cancer cells, colon cancer cells, cervical cancer cells, pancreatic cancer cells, kidney cancer cells, gastric cancer cells, gastrointestinal cancer cells, liver cancer cells, bone cancer cells, hematological cancer cells, nerve tissue cancer cells, melanoma cells, thyroid cancer cells, ovarian cancer cells, testicular cancer cells, prostate cancer cells, cervical cancer cells, vaginal cancer cells, or bladder cancer cells. (Item 33) The method described in item 32, wherein the cancer cells are breast cancer cells. (Item 34) The method according to item 32, wherein the cancer cells are colon cancer cells. (Item 35) The method according to item 32, wherein the cancer cells are lung cancer cells. (Item 36) The method according to item 32, wherein the cancer cells are ovarian cancer cells. (Item 37) The method according to item 32, wherein the cancer cells are cervical cancer cells. (Item 38) The method described in item 32, wherein the cancer cells are bladder cancer cells. (Item 39) The method according to item 32, wherein the cancer cells are kidney cancer cells. (Item 40) The method according to any one of items 1 to 39, wherein the cancer cells are within the subject, and the agent that inhibits autophagy of the cancer cells is administered to the subject. (Item 41) The aforementioned subject is a human subject, and the method described in item 40. (Item 42) A method for sensitizing target cancer cells to tumor necrosis factor alpha (TNF-α)-mediated killing, wherein the method involves administering a drug that inhibits autophagy of the cancer cells to the target cells. The method, including giving. (Item 43) A method for increasing tumor necrosis factor alpha (TNF-α)-mediated killing of target cancer cells, the method comprising administering to the target at least one agent that inhibits autophagy of the cancer cells. (Item 44) The aforementioned drug is the method described in item 42 or item 43, which inhibits the expression or activity of an autophagy gene. (Item 45) The autophagy gene is selected from ATG12, WIPI2, RB1CC1, PIK3C3, ATG9A, ATG2A, ATG5, ATG14, EI24, NRBF2, ATG13, TAX1BP1, and ATG10, as described in item 44. (Item 46) The method according to item 44 or item 45, wherein the agent modifies at least one autophagy gene, and by modifying the at least one autophagy gene, the expression or activity of the autophagy gene is reduced. (Item 47) The modification of the autophagy gene as described in item 46, comprising deletion, insertion, substitution, combination thereof, or attachment of a Cas protein. (Item 48) The method according to any one of items 42 to 47, wherein the agent is a composition comprising a guide RNA (gRNA) effective in inducing a Cas enzyme to cleave or ligate the sequence of the autophagy gene, the guide RNA comprising a DNA targeting segment that targets a guide RNA target sequence within the autophagy gene. (Item 49) The method according to item 48, wherein the guide RNA is configured to provide a cleavage event selected from double-strand breaks and single-strand breaks within the autophagy gene. (Item 50) The method according to item 48 or 49, wherein the guide RNA target sequence includes or is adjacent to the start codon of the autophagy gene. (Item 51) The method according to item 50, wherein the guide RNA target sequence is within approximately 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the start codon. (Item 52) The method according to item 48 or 49, wherein the guide RNA target sequence is located in exon 1 or exon 2 of the autophagy gene. (Item 53) The method according to any one of items 48 to 52, wherein the guide RNA comprises the DNA targeting segment and a cluster of regularly arranged short palindromic sequence repeat (CRISPR) RNA (crRNA) including trans-activated CRISPR RNA (tracrRNA). (Item 54) The method according to item 53, wherein the guide RNA is a modular guide RNA in which the crRNA and the tracrRNA hybridize with each other. (Item 55) The method according to any one of items 48 to 54, wherein the composition further comprises a Cas protein or a nucleic acid sequence encoding the Cas protein. (Item 56) The Cas protein is a nuclease-active Cas protein or a transcription repressor. The method described in item 55, which involves a nuclease-inactive Cas protein fused to the main molecule. (Item 57) The method according to any one of items 54 to 56, wherein the Cas protein is the Cas9 protein. (Item 58) The aforementioned Cas9 molecules are S. aureus Cas9 protein and S. pyogenes The method described in item 57, which is the Cas9 protein, or N. meningitidis Cas9 protein. (Item 59) The method according to any one of items 42 to 47, wherein the agent is a composition comprising a nucleic acid comprising a first nucleotide sequence encoding a guide RNA effective in inducing a Cas enzyme to cleave or ligate the sequence of the autophagy gene, the guide RNA comprising a DNA targeting segment that targets a guide RNA target sequence within the autophagy gene. (Item 60) The method according to item 59, wherein the guide RNA target sequence includes or is adjacent to the start codon of the autophagy gene. (Item 61) The method according to item 60, wherein the guide RNA target sequence is within approximately 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the start codon. (Item 62) The method according to item 59, wherein the guide RNA target sequence is located in exon 1 or exon 2 of the autophagy gene. (Item 63) The method according to any one of items 59 to 62, wherein the guide RNA comprises the DNA targeting segment and a cluster of regularly arranged short palindromic sequence repeat (CRISPR) RNA (crRNA) including the trans-activated CRISPR RNA (tracrRNA). (Item 64) The method according to item 3, wherein the guide RNA is a modular guide RNA in which the crRNA and the tracrRNA hybridize with each other. (Item 65) The method according to item 63 or 64, wherein the composition further comprises a second nucleotide sequence encoding a Cas protein. (Item 66) The method according to item 65, wherein the Cas protein is a nuclease-active Cas protein or a nuclease-inactive Cas protein fused to a transcription repressor domain. (Item 67) The method according to any one of items 64 to 66, wherein the Cas protein is the Cas9 protein. (Item 68) The method according to item 67, wherein the Cas9 protein is S. aureus Cas9 protein, S. pyogenes Cas9 protein, or N. meningitidis Cas9 protein. (Item 69) The method according to any one of items 42 to 46, wherein the drug is a TALEN nuclease or a zinc finger nuclease. (Item 70) The aforementioned drug inhibits the activity of RNA or protein, as described in any one of items 42 to 45. (Item 71) The aforementioned drug is an interfering nucleic acid, as described in item 70. (Item 72) The method according to item 71, wherein the interfering nucleic acid is siRNA, shRNA, miRNA, or antisense oligonucleotide. (Item 73) The aforementioned drugs include PI3 kinase inhibitors, phosphoinositide 3 kinase (PI3) inhibitors, Unc-51-like kinase 1 (ULK1) inhibitors, vacuolar protein sorting protein 18 (Vps18) inhibitors, vacuolar protein sorting protein 34 (Vps34) inhibitors, ubiquitin-specific peptidase (USP10 or USP13) inhibitors, thioxanthone-based autophagy inhibitors, ATG4 inhibitors, autofinib, 3-methyladenine, wartmannin, ammonium chloride, bafilomycin A1, eflornithine, leupeptin, betulinic acid, CA074, colchicine, thapsigargin, and bacuolin- 1. A small molecule autophagy inhibitor selected from vinblastine, desmethylclomipramine, LY294002, PT210, GSK-2126458, Spautin-1, SAR405, Compound 31, VPS34-IN1, PIK-III, Compound 6, MRT68921, SBI-0206965, Pepstatin A, E64d, Clomipramine, Lucanton, Chloroquine, Hydroxychlorquine, Monensin, Lys05, ARN5187, Compound 30, MPT0L145, ROC325, Verteporfin, NSC185058 and NSC377071, according to the method of item 42 or item 43. (Item 74) The method according to any one of items 42 to 73, wherein the cancer cells are lung cancer cells, breast cancer cells, colon cancer cells, cervical cancer cells, pancreatic cancer cells, kidney cancer cells, gastric cancer cells, gastrointestinal cancer cells, liver cancer cells, bone cancer cells, hematological cancer cells, nerve tissue cancer cells, melanoma cells, thyroid cancer cells, ovarian cancer cells, testicular cancer cells, prostate cancer cells, cervical cancer cells, vaginal cancer cells, or bladder cancer cells. (Item 75) The cancer cells are breast cancer cells, as described in item 74. (Item 76) The method described in item 74, wherein the cancer cells are colon cancer cells. (Item 77) The method described in item 74, wherein the cancer cells are lung cancer cells. (Item 78) The method described in item 74, wherein the cancer cells are ovarian cancer cells. (Item 79) The method described in item 74, wherein the cancer cells are cervical cancer cells. (Item 80) The method described in item 74, wherein the cancer cells are bladder cancer cells. (Item 81) The cancer cells are kidney cancer cells, as described in item 74. (Item 82) A method for sensitizing a target tumor to tumor necrosis factor alpha (TNF-α)-mediated necrosis, the method comprising administering to the target a drug that inhibits autophagy of the tumor. (Item 83) A method for increasing tumor necrosis factor alpha (TNF-α)-mediated killing of a target tumor, the method comprising administering to the target at least one agent that inhibits autophagy of the tumor. (Item 84) The aforementioned drug is the method described in item 82 or item 83, which inhibits the expression or activity of an autophagy gene. (Item 85) The autophagy gene is selected from ATG12, WIPI2, RB1CC1, PIK3C3, ATG9A, ATG2A, ATG5, ATG14, EI24, NRBF2, ATG13, TAX1BP1, and ATG10, as described in item 84. (Item 86) The method according to item 84 or item 85, wherein the agent modifies at least one autophagy gene, and by modifying the at least one autophagy gene, the expression or activity of the autophagy gene is reduced. (Item 87) The modification of the autophagy gene according to item 86, which includes deletion, insertion, substitution, combination thereof, or attachment of a Cas protein. (Item 88) The method according to any one of items 82 to 87, wherein the agent is a composition comprising a guide RNA effective in inducing a Cas enzyme to cleave or ligate the sequence of the autophagy gene, the guide RNA comprising a DNA targeting segment that targets a guide RNA target sequence within the autophagy gene. (Item 89) The method according to item 88, wherein the gRNA is configured to provide a cleavage event selected from double-strand breaks and single-strand breaks within the autophagy gene. (Item 90) The method according to item 88 or 89, wherein the guide RNA target sequence includes or is adjacent to the start codon of the autophagy gene. (Item 91) The method according to item 90, wherein the guide RNA target sequence is within approximately 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the start codon. (Item 92) The method described in item 88 or 89, wherein the guide RNA target sequence is located in exon 1 or exon 2 of the autophagy gene. (Item 93) The method according to any one of items 88 to 92, wherein the guide RNA comprises the DNA targeting segment and a cluster of regularly arranged short palindromic sequence repeat (CRISPR) RNA (crRNA) including trans-activated CRISPR RNA (tracrRNA). (Item 94) The method according to item 93, wherein the guide RNA is a modular guide RNA in which the crRNA and the tracrRNA hybridize with each other. (Item 95) The method according to any one of items 88 to 94, wherein the composition further comprises a Cas protein or a nucleic acid sequence encoding the Cas protein. (Item 96) The method according to item 95, wherein the Cas protein is a nuclease-active Cas protein or a nuclease-inactive Cas protein fused to a transcription repressor domain. (Item 97) The method according to any one of items 94 to 96, wherein the Cas protein is the Cas9 protein. (Item 98) The aforementioned Cas9 molecules are S. aureus Cas9 protein and S. pyogenes The method described in item 97, which is the Cas9 protein, or N. meningitidis Cas9 protein. (Item 99) The Cas9 molecule is the S. aureus Cas9 protein, as described in item 98. (Item 100) The method according to any one of items 82 to 87, wherein the agent is a composition comprising a nucleic acid comprising a first nucleotide sequence encoding a gRNA effective in inducing a Cas enzyme to cleave or ligate the sequence of the autophagy gene, and the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence within the autophagy gene. (Item 101) The method according to item 100, wherein the guide RNA target sequence includes or is adjacent to the start codon of the autophagy gene. (Item 102) The method according to item 100 or 101, wherein the guide RNA target sequence is within approximately 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the start codon. (Item 103) The method according to item 100, wherein the guide RNA target sequence is located in exon 1 or exon 2 of the autophagy gene. (Item 104) The method according to any one of items 100 to 103, wherein the guide RNA comprises the DNA targeting segment and a cluster of regularly arranged short palindromic sequence repeat (CRISPR) RNA (crRNA) including trans-activated CRISPR RNA (tracrRNA). (Item 105) The method according to item 104, wherein the guide RNA is a modular guide RNA in which the crRNA and the tracrRNA hybridize with each other. (Item 106) The method according to any one of items 100 to 105, wherein the composition further comprises a second nucleotide sequence encoding a Cas protein. (Item 107) The method according to item 106, wherein the Cas protein is a nuclease-active Cas protein or a nuclease-inactive Cas protein fused to a transcription repressor domain. (Item 108) The method according to any one of items 105 to 107, wherein the Cas protein is the Cas9 protein. (Item 109) The method according to item 108, wherein the Cas9 protein is S. aureus Cas9 protein, S. pyogenes Cas9 protein, or N. meningitidis Cas9 protein. (Item 110) The method according to any one of items 82 to 86, wherein the drug is a TALEN nuclease or a zinc finger nuclease. (Item 111) The aforementioned drug inhibits the activity of RNA or protein, one of items 82-85. The method described in item 1. (Item 112) The method described in item 111, wherein the drug is an interfering nucleic acid. (Item 113) The method according to item 112, wherein the interfering nucleic acid is siRNA, shRNA, miRNA, or antisense oligonucleotide. (Item 114) The aforementioned drugs include PI3 kinase inhibitors, phosphoinositide 3 kinase (PI3) inhibitors, Unc-51-like kinase 1 (ULK1) inhibitors, vacuolar protein sorting protein 18 (Vps18) inhibitors, vacuolar protein sorting protein 34 (Vps34) inhibitors, ubiquitin-specific peptidase (USP10 or USP13) inhibitors, thioxanthone-based autophagy inhibitors, ATG4 inhibitors, autofinib, 3-methyladenine, wartmannin, ammonium chloride, bafilomycin A1, eflornithine, leupeptin, betulinic acid, CA074, colchicine, thapsigargin, and bacuolin- 1. A small molecule autophagy inhibitor selected from vinblastine, desmethylclomipramine, LY294002, PT210, GSK-2126458, Spautin-1, SAR405, Compound 31, VPS34-IN1, PIK-III, Compound 6, MRT68921, SBI-0206965, Pepstatin A, E64d, Clomipramine, Lucanton, Chloroquine, Hydroxychlorquine, Monensin, Lys05, ARN5187, Compound 30, MPT0L145, ROC325, Verteporfin, NSC185058 and NSC377071, according to the method of item 82 or item 83. (Item 115) The method according to any one of items 82 to 114, wherein the tumor is an adenocarcinoma, adrenal tumor, anal tumor, bile duct tumor, bladder tumor, bone tumor, brain / CNS tumor, breast tumor, cervical tumor, colorectal tumor, endometrial tumor, esophageal tumor, Ewing's tumor, eye tumor, gallbladder tumor, gastrointestinal tumor, kidney tumor, laryngeal or hypopharyngeal tumor, liver tumor, lung tumor, mesothelioma, multiple myeloma, muscle tumor, nasopharyngeal tumor, neuroblastoma, oral tumor, osteosarcoma, ovarian tumor, pancreatic tumor, penile tumor, pituitary tumor, primary tumor, prostate tumor, retinoblastoma, rhabdomyosarcoma, salivary gland tumor, soft tissue sarcoma, melanoma, metastatic tumor, basal cell carcinoma, Merkel cell tumor, testicular tumor, thymic tumor, thyroid tumor, uterine tumor, vaginal tumor, vulvar tumor, or Wilms' tumor. (Item 116) The tumor is a breast tumor, as described in item 115. (Item 117) The tumor is a colorectal tumor, as described in item 115. (Item 118) The tumor is a lung tumor, as described in item 115. (Item 119) The tumor is an ovarian tumor, as described in item 115. (Item 120) The tumor is a cervical tumor, as described in item 115. (Item 121) The tumor is a bladder tumor, as described in item 115. (Item 122) The tumor is a renal tumor, as described in item 115. (Item 123) The tumor is a primary tumor, as described in any one of items 115 to 122. (Item 124) The tumor is a metastatic tumor, as described in any one of items 115 to 122. (Item 125) The subjects mentioned above are those who have received chemotherapy drugs prior to the administration of the aforementioned drug, and who meet the criteria for items 42-124. The method described in any one of the items. (Item 126) The method according to item 125, wherein the subject is resistant to the aforementioned chemotherapy drug. (Item 127) The aforementioned drug is administered systemically according to the method described in any one of items 42 to 126. (Item 128) The drug is administered intravenously according to the method described in item 127. (Item 129) The drug is administered subcutaneously according to the method described in any one of items 42 to 126. (Item 130) The aforementioned drug is administered intramuscularly according to the method described in any one of items 42 to 126. (Item 131) The drug is administered orally according to the method described in any one of items 42 to 126. (Item 132) The aforementioned drug is administered topically, according to the method described in any one of items 42 to 126. (Item 133) The method according to item 132, wherein the subject has a tumor, and the at least one agent is administered locally to the tumor or tumor microenvironment. (Item 134) The method according to any one of items 42 to 133, further comprising administering additional anticancer therapy to the subject. (Item 135) The aforementioned additional anti-cancer therapy is cancer immunotherapy, as described in item 134. (Item 136) The cancer immunotherapy described above includes autologous or allogeneic T-cell therapy, or autologous or allogeneic CAR T-cell therapy, as described in item 134 or item 135. (Item 137) The cancer immunotherapy described above is the method described in item 135, comprising administering TNF-α to the subject. (Item 138) The cancer immunotherapy described above is the method according to item 135, comprising administering an immune checkpoint inhibitor to the subject. (Item 139) The method according to item 138, wherein the immune checkpoint inhibitor comprises an antibody specific to an immune checkpoint protein selected from CTLA-4, PD-1, VISTA, B7-H2, B7-H3, PD-L1, B7-H4, B7-H6, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-1, TIM-3, TIM-4, LAG-3, BTLA, SIRPalpha (CD47), CD48, 2B4 (CD244), B7.1, B7.2, ILT-2, ILT-4, TIGIT, HHLA2, butyrophyllin, and A2aR. (Item 140) The aforementioned immune checkpoint inhibitors are semiprimab (REGN2810), nivolumab (BMS-936558, MDX-1106, ONO-4538), pembrolizumab (MK-3475, SCH900475), atezolizumab (MPDL3280A, RG7446, RO5541267), durvalumab (MEDI4736, MEDI-4736), and avelumab (MSB0010718C). ), ipilimumab (BMS-734016, IBI310, MDX-010), SHR1210, cintilimab (IBI308), spartalizumab (PDR001), tislerizumab (BGB-A317), pidilizumab, BCD-100, tripalimab (JS001), BAY1905254, ASP8374, PF-06801591, AMP-224, AB122, AK105, AMG40 4, BCD-100, BI754091, F520, HLX10, HX008, JTX-4014, LZM009, MEDI0680, MGA012, Sym021, T SR-042, PSB205, MGD019, MGD013, AK104, XmAb20717, RO7121661, CX-188, INCB086550, FS11 8, BCD-135, BGB-A333, CBT-502, CK-301, CS1001, FAZ053, HLX20, KN035, MDX-1105, MSB2311 , SHR-1316, TG-1501, ZKAB001, INBRX-105, MCLA-145, KN046, M7824, LY3415244, INCB086550 CA-170, CX-072, ADU-1604, AGEN1181, AGEN1884, MK-1308, REGN4659, XmAb22841, ATOR-1015, PSB205, MGD019, AK104, XmAb20717, BMS-986249, Tremerimumab, BMS-986258, BGB-A425, INCA The method described in item 139, which is GN02390, Sym023, JNJ61610588, BI754111, LAG525, MK-4280, REGN3767, Sym022, TSR-033, relatrimab, JTX-2011, MGD009, BMS-986207, OMP-313M32, MK-7684, or TSR-022. (Item 141) The cancer immunotherapy described above is the method described in item 135, which includes administering a cancer vaccine to the subject. (Item 142) A method for treating a target cancer, the method comprising administering to the target a drug that inhibits autophagy of the target cancer cells, and cancer immunotherapy. (Item 143) The cancer immunotherapy described above includes autologous or allogeneic T-cell therapy, or autologous or allogeneic CAR T-cell therapy, as described in item 142. (Item 144) The cancer immunotherapy described above is the method described in item 142, comprising administering TNF-α to the subject. (Item 145) The cancer immunotherapy described above is the method described in item 142, comprising administering an immune checkpoint inhibitor to the subject. (Item 146) The method according to item 145, wherein the immune checkpoint inhibitor comprises an antibody specific to an immune checkpoint protein selected from CTLA-4, PD-1, VISTA, B7-H2, B7-H3, PD-L1, B7-H4, B7-H6, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-1, TIM-3, TIM-4, LAG-3, BTLA, SIRPalpha (CD47), CD48, 2B4 (CD244), B7.1, B7.2, ILT-2, ILT-4, TIGIT, HHLA2, butyrophyllin, and A2aR. (Item 147) The aforementioned immune checkpoint inhibitors are semiprimab (REGN2810), nivolumab (BMS-936558, MDX-1106, ONO-4538), pembrolizumab (MK-3475, SCH900475), atezolizumab (MPDL3280A, RG7446, RO5541267), durvalumab (MEDI4736, MEDI-4736), avelumab (MSB0010718C), ipilimumab (BMS-734016, IBI310, MDX-010), SHR1210, Syntilimab (IBI308), Spartalizumab (PDR001), Tithrelizumab (BGB-A317), Pidilizumab, BCD-100, Tripalimab (JS001), BAY1905254, ASP8374, PF-06801591, AMP-224, AB122, AK105, AMG404, BCD-100, BI754091, F520, HLX10, HX008, JTX- 4014, LZM009, MEDI0680, MGA012, Sym021, TSR-042, PSB205, MGD019, MGD013, AK104, X mAb20717, RO7121661, CX-188, INCB086550, FS118, BCD-135, BGB-A333, CBT-502, CK- 301, CS1001, FAZ053, HLX20, KN035, MDX-1105, MSB2311, SHR-1316, TG-1501, ZKAB001 , INBRX-105, MCLA-145, KN046, M7824, LY3415244, INCB086550, CA-170, CX-072, ADU-1 The method described in item 145, which is 604, AGEN1181, AGEN1884, MK-1308, REGN4659, XmAb22841, ATOR-1015, PSB205, MGD019, AK104, XmAb20717, BMS-986249, Tremelimumab, BMS-986258, BGB-A425, INCAGN02390, Sym023, JNJ61610588, BI754111, LAG525, MK-4280, REGN3767, Sym022, TSR-033, Relatrimab, JTX-2011, MGD009, BMS-986207, OMP-313M32, MK-7684, or TSR-022. (Item 148) The cancer immunotherapy described above is the method described in item 142, which includes administering a cancer vaccine to the subject. (Item 149) The aforementioned drug is the method described in any one of items 142 to 148, which inhibits the expression or activity of an autophagy gene. (Item 150) The autophagy gene is selected from ATG12, WIPI2, RB1CC1, PIK3C3, ATG9A, ATG2A, ATG5, ATG14, EI24, NRBF2, ATG13, TAX1BP1, and ATG10, as described in item 149. (Item 151) The method according to item 149 or item 150, wherein the agent modifies at least one autophagy gene, and by modifying the at least one autophagy gene, the expression or activity of the autophagy gene is reduced. (Item 152) The modification of the autophagy gene as described in item 151 includes deletion, insertion, substitution, combination thereof, or attachment of a Cas protein. (Item 153) The method according to any one of items 142 to 152, wherein the agent is a composition comprising a guide RNA effective in inducing a Cas enzyme to cleave or ligate the sequence of the autophagy gene, the guide RNA comprising a DNA targeting segment that targets a guide RNA target sequence within the autophagy gene. (Item 154) The method according to item 153, wherein the gRNA is configured to provide a cleavage event selected from double-strand breaks and single-strand breaks within the autophagy gene. (Item 155) The method according to item 153 or 154, wherein the composition further comprises a Cas protein or a nucleic acid sequence encoding the Cas protein. (Item 156) The method according to item 155, wherein the Cas protein is a nuclease-active Cas protein. (Item 157) The method according to item 155, wherein the Cas protein is a nuclease-inactive Cas protein fused to a transcription repressor domain. (Item 158) The method according to any one of items 155 to 157, wherein the Cas protein is the Cas9 protein. (Item 159) The aforementioned Cas9 molecules are S. aureus Cas9 protein and S. pyogenes The method described in item 158, which is the Cas9 protein, or N. meningitidis Cas9 protein. (Item 160) The method according to any one of items 142 to 152, wherein the agent is a composition comprising a nucleic acid comprising a first nucleotide sequence encoding a guide RNA effective in inducing a Cas enzyme to cleave or ligate the sequence of the autophagy gene, the guide RNA comprising a DNA targeting segment that targets a guide RNA target sequence within the autophagy gene. (Item 161) The method according to item 160, wherein the composition further comprises a second nucleotide sequence encoding a Cas protein. (Item 162) The method according to item 161, wherein the Cas protein is a nuclease-active Cas protein. (Item 163) The method according to item 162, wherein the Cas protein is a nuclease-inactive Cas protein fused to a transcription repressor domain. (Item 164) The method according to any one of items 161 to 163, wherein the Cas protein is the Cas9 protein. (Item 165) The method according to item 164, wherein the Cas9 protein is S. aureus Cas9 protein, S. pyogenes Cas9 protein, or N. meningitidis Cas9 protein. (Item 166) The method according to any one of items 142 to 152, wherein the drug is a TALEN nuclease or a zinc finger nuclease. (Item 167) The aforementioned drug inhibits the activity of RNA or protein, as described in any one of items 142 to 150. (Item 168) The aforementioned drug is an interfering nucleic acid, as described in item 167. (Item 169) The method according to item 168, wherein the interfering nucleic acid is siRNA, shRNA, miRNA, or antisense oligonucleotide. (Item 170) The aforementioned drugs include PI3 kinase inhibitors, phosphoinositide 3 kinase (PI3) inhibitors, Unc-51-like kinase 1 (ULK1) inhibitors, vacuolar protein sorting protein 18 (Vps18) inhibitors, vacuolar protein sorting protein 34 (Vps34) inhibitors, ubiquitin-specific peptidase (USP10 or USP13) inhibitors, thioxanthone-based autophagy inhibitors, ATG4 inhibitors, autofinib, 3-methyladenine, and wort. Manin, ammonium chloride, bafilomycin A1, eflornithine, leupeptin, betulinic acid, CA074, colchicine, thapsigargin, bacuolin-1, vinblastine, desmethylclomipramine, LY294002, PT210, GSK-2126458, spautin-1, SAR405, compound 31, VPS34-IN1, PIK-III, compound 6, MRT68921, SBI-0206965, pepstatin A, E64d, The method according to any one of items 142 to 148, wherein the small molecule autophagy inhibitor is selected from clomipramine, lecanton, chloroquine, hydroxychlorquine, monensin, Lys05, ARN5187, compound 30, MPT0L145, ROC325, verteporfin, NSC185058 and NSC377071. (Item 171) The method according to any one of items 142 to 170, wherein the cancer cells are lung cancer cells, breast cancer cells, colon cancer cells, cervical cancer cells, pancreatic cancer cells, kidney cancer cells, gastric cancer cells, gastrointestinal cancer cells, liver cancer cells, bone cancer cells, hematological cancer cells, nerve tissue cancer cells, melanoma cells, thyroid cancer cells, ovarian cancer cells, testicular cancer cells, prostate cancer cells, cervical cancer cells, vaginal cancer cells, or bladder cancer cells. (Item 172) The method described in item 171, wherein the cancer cells are breast cancer cells. (Item 173) The method described in item 171, wherein the cancer cells are colon cancer cells. (Item 174) The method according to item 171, wherein the cancer cells are lung cancer cells. (Item 175) The method described in item 171, wherein the cancer cells are ovarian cancer cells. (Item 176) The method according to item 171, wherein the cancer cells are cervical cancer cells. (Item 177) The method described in item 171, wherein the cancer cells are bladder cancer cells. (Item 178) The method described in item 171, wherein the cancer cells are kidney cancer cells. (Item 179) The subject is a human, and the method described in any one of items 42 to 178. (Item 180) A drug that inhibits autophagy in cancer cells, used to sensitize target cancer cells to tumor necrosis factor alpha (TNF-α)-mediated killing. (Item 181) A drug that inhibits autophagy in cancer cells, used to increase tumor necrosis factor alpha (TNF-α)-mediated killing of target cancer cells. (Item 182) Combination therapies, including drugs that inhibit autophagy in cancer cells, and cancer immunotherapy for use in the treatment of cancer. [Brief explanation of the drawing]

[0012] [Figure 1-1] The diagram has seven sections, A-G, and demonstrates that genome-wide CRISPR KO screening identifies tumor cell genes that regulate cytotoxic T cell killing. Section A shows a schematic of the pooled CRISPR screening. MC38 cancer cells modified with a mouse GeCKO sgRNA library were intermittently administered with Ova or scrambled control peptides and then cultured with activated Ova-specific cytotoxic T cells. After T cell killing, sgRNA expression in surviving tumor cells was evaluated by Illumina sequencing. Biological triple repeats were performed (B, D, F). Volcano plots show either genes that promote (abundant sgRNA) or restrict (depleted sgRNA) tumor cell killing. Target genes that promote killing are highlighted in B (e.g., antigen presentation, TNFα signaling, mTOR signaling). Target genes that restrict killing are highlighted in D and F (e.g., NF-κB pathway, autophagy). The X-axis shows the Z-score (calculated from the average log2 factor change of six sgRNAs targeting each gene in cells intermittently administered with Ova compared to cells intermittently administered with scrambled peptide). The Y-axis shows the P-value calculated by MAGeCK (C, E, G). Distribution of log2 factor changes for all 129,209 sgRNAs in the library (frequency histogram). Individual sgRNAs targeting the gene of interest are indicated by diagonal lines in C, and diagonal lines in E and G. [Figure 1-2] Same as above. [Figure 1-3] Same as above. [Figure 1-4] Same as above. [Figure 1-5] Same as above. [Figure 1-6] Same as above. [Figure 1-7] Same as above.

[0013] [Figure 2-1]The graph has seven parts, A through G, and demonstrates that TNFα-mediated apoptosis is a crucial component of tumor cell killing by T cells. Part A shows a simplified model of TNFα / NF-κB signaling. Part B shows that Ova peptide was intermittently administered to control (MC38-mGeCKO) or B2m KO cells and incubated with T cells from OT-1 mice in the presence of 10 μg / ml TNFα blocking antibody or isotype control. Cell viability was measured after 24 hours. The bar graph shows relative cell viability ± SD (n=3) compared to cells cultured in the absence of T cells. **P<0.005, ***P<0.0005, ****P<0.0001, one-way ANOVA by Tukey's multiple comparison test for MC38-mGeCKO + control Ab. +P<0.05, for MC38-B2mKO + control Ab. C shows the effect of caspase inhibition (25 μM z-VAD-FMK), Tnfrsf1a KO, Fadd KO, or Ripk1 KO on the viability of MC38 cells treated with 10 ng / ml TNFα for 24 hours. The bar graph shows relative cell viability ± SD (n=3). Western blots confirming target protein depletion are shown below the graph. * indicates Ripk1 KO used in the assay. D shows that cell viability was measured after 24 hours following the addition of the specified concentration of TNFα to tumor cell lines. n=3. E shows a Western blot showing the levels of the specified protein 24 hours after the addition of 10 ng / ml TNFα to each cell line. F and G show Western blots showing the levels of the specified protein in MC38 or B16F10 cells after treatment with 10 ng / ml TNFα for the specified time. [Figure 2-2] Same as above. [Figure 2-3] Same as above. [Figure 2-4] Same as above.

[0014] [Figure 3-1]The diagram has seven sections, A through G, and demonstrates that NF-κB signaling limits tumor cell killing by T cells. Section A shows a Western blot showing Map3k7 (aka Tak1) and β-actin protein levels in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or cells expressing Map3k7-targeted sgRNA (sg5 and sg3 were most significantly depleted in screening, while sg1 was the least depleted). Section B shows control or Map3k7 KO cells intermittently administered with Ova peptide and incubated with OT-1 T cells at a specified E:T ratio for 24 hours. The bar graph shows relative cell viability ± SD (n=3) compared to cells cultured in the absence of T cells. **P<0.005, ***P<0.0005, ****P<0.0001, one-way ANOVA with Tukey's multiple comparison test against parental MC38 cells. ++P<0.005, ++++P<0.0001, for Map3k7 sg5. C shows that T cell killing of the specified cell line was performed in the presence of 20 μg / ml TNFα blocking antibody. D shows that cells were treated with the specified concentration of TNFα and cell viability was measured after 24 hours. n=3. E shows a Western blot showing the level of the specified protein 2 hours after treatment with 10 ng / ml TNFα. F and G show that cells were treated with the specified amount of doxorubicin or paclitaxel and cell viability was measured after 24 hours. n=3. [Figure 3-2] Same as above.

[0015] [Figure 4-1]The diagram has six parts, A-F, and shows that autophagy limits T cell-mediated tumor cell killing. Part A shows a Western blot showing Rb1cc1 and β-actin protein levels in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or cells expressing Rb1cc1-targeted sgRNA (sg4 and sg5 were most significantly depleted in screening, while sg3 was the least depleted). Part B shows control or Rb1cc1 KO cells intermittently administered with Ova peptide and incubated with OT-1 T cells at a specified E:T ratio for 24 hours. The bar graph shows relative cell viability ± SD (n=3) compared to cells cultured in the absence of T cells. **P<0.005,****P<0.0001, one-way ANOVA with Tukey's multiple comparison test against parental MC38 cells. ++++P<0.0001, against Rb1cc1 sg4. C indicates that T cell killing of the specified cell line was performed in the presence of 20 μg / ml TNFα blocking antibody. *P<0.05, ***P<0.0005, against parental MC38 cells. D indicates that cells were treated with the specified concentration of TNFα and cell viability was measured after 24 hours. E and F indicate that cells were treated with the specified amount of doxorubicin or paclitaxel and cell viability was measured after 24 hours. n=3. [Figure 4-2] Same as above.

[0016] [Figure 5-1]The study has nine sections, A through I, and demonstrates that inhibition of autophagy promotes TNFα-mediated caspase 8 activation, independent of its effect on NF-βB signaling. Section A shows a Western blot illustrating the levels of the specified protein in control or Rb1cc1 KO MC38 cells 4 hours after treatment with 10 ng / ml TNFα. Section B shows a Western blot illustrating the levels of the specified protein in control or Rb1cc1 KO cells 30 minutes (Ik-Bα) or 4 hours (A20) after treatment with 10 ng / ml TNFα. Section C shows a Western blot illustrating the levels of the specified protein in control or Map3k7 (Tak1) KO cells. Section D shows the addition of soluble TNFα to Rb1cc1 KO cells for 24 hours in or without 25 μM z-VAD-FMK (a caspase inhibitor). The bar graph shows relative cell viability ± SD (n=3) compared to control cells (without TNFα, without caspase inhibitors). The groups were compared by one-way ANOVA with Tukey's multiple comparison test. E indicates that MC38 cells were treated untreated or with 10 ng / ml TNFα for 16 hours in the absence or presence of 5 μM autofinib. The bar graph shows relative cell viability ± SD (n=3) compared to control cells (without TNFα, without autofinib). F shows a Western blot showing the levels of specified proteins in cells treated untreated or with 10 ng / ml TNFα for 30 minutes (Ik-Bα) or 4 hours (caspase-8, p62) in the absence or presence of 5 μM autofinib. G indicates that control, Tnfrsf1a KO, Fadd KO, or Ripk1 KO cells were treated untreated or with 10 ng / ml TNFα for 24 hours, either in the absence or presence of 5 μM Autofinib or 1 μM LCL-161 (Smac mimetic). The bar graph shows relative cell viability ± SD (n=3) compared to control cells (empty vector cells without TNFα or inhibitors). ****P<0.0001, compared to empty vector cells treated with TNFα. H indicates that TNFα was added to Rb1cc1 KO cells for 24 hours, either in the absence or presence of 50 μM Nec-1 (necroptosis inhibitor).The bar graph shows the relative cell viability ± SD (n=3) compared to control cells (without TNFα, without caspase inhibitors). ∫ I shows Western blots indicating phosphoMLKL, totalMLKL, and β-actin levels in L929 mouse fibroblast cell lines and MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or cells expressing Rb1cc1-targeted sgRNA. Cells were treated for 30 minutes in or without 10 ng / ml TNFα, 50 μM Nec-1s, and 20 μM Z-VAD-FMK. [Figure 5-2] Same as above. [Figure 5-3] Same as above. [Figure 5-4] Same as above. [Figure 5-5] Same as above.

[0017] [Figure 6-1]The diagram has seven parts, A-G, and shows that mTOR signaling in tumor cells is required for maximum TNFα and T cell-mediated killing. A shows a Western blot showing the levels of specified proteins in MC38 cells transduced with an empty vector or cells expressing Mlst8-targeted sgRNA (sg4 and sg1 were most significantly enriched in screening, and sg3 was the least enriched). B shows control or Mlst8 KO cells treated with 10 ng / ml TNFα for 24 hours. The bar graph shows relative cell viability ± SD (n=3) compared to control cells (no TNFα). *P<0.05, **P<0.005, one-way ANOVA by Tukey's multiple comparison test against empty vector cells treated with TNFα. C shows control or Mlst8 KO cells intermittently administered with Ova peptide and incubated with OT-1 T cells for 24 hours. The bar graph shows relative cell viability ±SD (n=3) compared to control cells (no T cells). *P<0.05, **P<0.005, compared to empty vector cells incubated with T cells. D shows a Western blot showing the level of a specified protein in MC38 cells treated with 200 nM rapamycin for a specified time. E shows wells pre-treated with vehicle or 200 nM rapamycin followed by untreated or 10 ng / ml TNFα for 24 hours. The bar graph shows relative cell viability ±SD (n=3) compared to control cells (vehicle, no TNFα). F shows cells pre-treated with vehicle or rapamycin intermittently administered either scrambled control peptide or Ova peptide and incubated with OT-1 T cells for 24 hours. The bar graph shows relative cell viability ±SD (n=3) compared to control cells (no T cells, scrambled peptide). G shows a flowchart illustrating the tumor cell pathway that regulates T cell-mediated killing. [Figure 6-2] Same as above. [Figure 6-3] Same as above.

[0018] [Figure 7-1]The study has six parts, A through F, demonstrating that autophagy limits CD3 bispecific antibody-induced killing of human cancer cells. Part A shows human ZR-75-1 breast cancer cells treated for 24 hours untreated or with 10 ng / ml TNFα, in or without 5 μM Autofinib or SAR-405. The bar graph shows relative cell viability ± SD (n=3) compared to control cells (vehicle, without TNFα). The groups were compared by one-way ANOVA with Tukey's multiple comparison test. Part B shows a Western blot showing the levels of specified proteins after ZR-75-1 cells were treated for 16 hours with 5 μM Autofinib or SAR-405, in or without 10 ng / ml TNFα. D shows that ZR-75-1 cells were incubated for 24 hours with activated human T cells at a specified E:T ratio in the absence or presence of 5 μM SAR-405, in the presence of 12 ng / ml of control or breast tumor antigen xCD3 (TAAxCD3 (shown in C)) bispecific antibody. The bar graph shows relative cell viability ± SD (n=3) compared to control cells (no T cells, control bispecific antibody). E shows a Western blot showing the levels of specified proteins in ZR-75-1 control or Rb1cc1 KO cells. F shows that ZR-75-1 control or Rb1cc1 KO cells were incubated with T cells supplemented with the bispecific antibody as described above. The bar graph shows relative cell viability ± SD (n=3) compared to control cells + control bsAb. **P<0.005, compared to control cells. ****P<0.0001, compared to control cells + CD3bsAb. For ++++P<0.0001, Rb1cc1 KO+CD3bsAb. [Figure 7-2] Same as above. [Figure 7-3] Same as above.

[0019] [Figure 8-1]The diagram has seven sections, A through G, demonstrating that inactivation of autophagy sensitizes tumors to immunotherapy. Section A shows a Western blot showing the levels of specified proteins in EMT6 control (non-targeted sgRNA) or Rb1cc1 KO cells. Section B shows EMT6 control or Rb1cc1 KO cells treated with 10 ng / ml TNFα, with viability measured after 24 hours. The bar graph shows relative cell viability ± SD (n=3) compared to control cells (control, no TNFα). The groups were compared by one-way ANOVA with Tukey's multiple comparison test. Section C shows EMT-6 cells (control or Rb1cc1 KO) transplanted into Balb / c mice. Three days after transplantation, mice were treated with either isotype control or PD-1 plus CTLA-4 blocking antibody as described in the methods (n=10 mice per group). The line graph shows the mean tumor volume ± SEM for each group. The groups were compared using two-way ANOVA with Tukey's multiple comparison test. D shows the individual tumor growth curves for each mouse. E shows a Western blot showing the levels of specified proteins in MC38 control (non-targeted sgRNA) or Rb1cc1 KO cells. F shows that MC38 cells (control or Rb1cc1 KO) were transplanted into C57 / BL6 mice. Mice were randomized when the tumor was approximately 70 mm3 (7–12 mice per group) and treated with either an isotype control or a PD-1 plus CTLA-4 blocking antibody. The line graph shows the mean tumor volume ± SEM for each group. The groups were compared using two-way ANOVA with Tukey's multiple comparison test. G shows the individual tumor growth curves for each mouse. [Figure 8-2] Same as above. [Figure 8-3] Same as above. [Figure 8-4] Same as above.

[0020] [Figure 9]It relates to the use of B2M knockout cells having three parts A to C and used to optimize CRISPR KO screening conditions. A shows a Western blot indicating the B2M protein levels of MC38 cells infected with pLenti-Cas9-Blast and pLenti-guide-puro targeting B2M. B shows FACS analysis of H2-Kb cell surface expression in MC38 cells modified to express the mGeCKO library, or b2M KO cells untreated or treated with + / - 10 ng / ml of IFNγ for 24 hours. C shows a T cell killing assay of MC38-Cas9-mGeCKO cells intermittently administered with Ova or a scrambled peptide, and MC38-Cas9-B2M knockout cells intermittently administered with the Ova peptide. CD8+ T cells isolated from OT-1 mice were incubated with the cells at the indicated E:T ratios, and viability was measured after 24 hours.

[0021] [Figure 10] It shows that the library representation is maintained sufficiently throughout CRISPR KO screening, enabling the detection of depleted and abundant sgRNAs. Log2-normalized sgRNA counts in scrambled tumor cells versus tumor cells intermittently administered with Ova after T cell killing. R2 = 0.95.

[0022] [Figure 11]The diagram has two parts, A and B, and shows that CRISPR KO screening for growth modifiers in MC38 cells identifies a high proportion of core essential genes. Log2 normalized sgRNA counts of MC38-mGeCKO cells passaged 12 times (collected immediately after selection of library-infected cells) compared to reference control cells. A shows non-target sgRNAs. Only 5 out of 1000 non-target sgRNAs were significantly enriched or depleted by more than 2 times compared to the reference control. B shows sgRNAs targeting core essential genes in red. 96% (102 / 106) of core essential genes were identified as hits (defined as at least two sgRNAs being depleted by more than 2 times). At least four sgRNAs were depleted in more than 85% of core essential genes.

[0023] [Figure 12] This study demonstrates that gene knockout of autophagy genes does not inhibit the proliferation of MC38 cells. The results are based on a survival assay after 12 population doubling cycles in MC38 parent cells, cells expressing an empty vector, or cells expressing multiple sgRNAs targeting a specified autophagy gene.

[0024] [Figure 13] This study demonstrates that the cytotoxic function of pre-activated T cells is not limited by TNFα blockade. MC38 (TNFα-sensitive) or B16F10 (TNFα-resistant) cells were intermittently administered Ova peptide and incubated with OT-1 mouse-derived T cells at a specified E:T ratio at a specified temperature in the presence of 20 μg / ml of TNFα-blocking antibody or isotype control antibody. Cell viability was measured after 24 hours. The bar graph shows relative cell viability ± SD (n=3) compared to tumor cells incubated without T cells. *P<0.05, ***P<0.0005, one-way ANOVA by Tukey's multiple comparison test against MC38 cells containing control antibody.

[0025] [Figure 14]This demonstrates that the NF-κB signaling pathway is active in cell lines resistant to TNFα-mediated killing. Western blots show the levels of specified proteins in EMT6 or 4T1 cells after treatment with 10 ng / ml TNFα for a specified time.

[0026] [Figure 15-1] The diagram has seven sections, A-G, showing that Rbck1 knockout increases T cell-mediated tumor cell killing. Section A shows Western blots indicating Rbck1 and β-actin levels in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or cells expressing Rbck1-targeted sgRNA (sg5 and sg1 were most significantly depleted in screening, while sg3 was the least depleted). Section B shows control or Rbck1 knockout cells intermittently administered with Ova peptide and incubated with OT-1 T cells at a specified E:T ratio for 24 hours. The bar graphs show relative cell viability ± SD (n=3) compared to cells incubated in the absence of T cells. ****P<0.0001, one-way ANOVA by Tukey's multiple comparison test against parental MC38 cells. ++++P<0.0001, against Rbck1 sg5. C shows that T cell killing of the specified cell line was performed in the presence of 20 μg / ml of TNFα-blocking antibody. *P<0.05, relative to parental MC38 cells. D shows that cells were treated with the specified concentration of TNFα and cell viability was measured after 24 hours. n=3. E shows a Western blot showing the level of the specified protein 2 hours after treatment with 10 ng / ml of TNFα. F and G show that cells were treated with the specified amount of doxorubicin or paclitaxel and cell viability was measured after 24 hours. n=3. [Figure 15-2] Same as above.

[0027] [Figure 16-1]The diagram has seven sections, A-G, and shows that Rbla KO increases tumor cell killing by T cells. Section A shows Western blots indicating Rela and β-actin levels in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or cells expressing Rela-targeted sgRNA (sg2 and sg3 were most significantly depleted in screening, while sg6 was the least depleted). Section B shows control or Rela KO cells intermittently administered with Ova peptide and incubated with OT-1 T cells at a specified E:T ratio for 24 hours. The bar graph shows relative cell viability ± SD (n=3) compared to cells cultured in the absence of T cells. **P<0.005,****P<0.0001, one-way ANOVA by Tukey's multiple comparison test against parental MC38 cells. ++P<0.005,+++P<0.0005, against Rela sg2. C shows that T cell sterilization of the specified cell line was performed in the presence of a 20 μg / ml TNFα blocking antibody. D shows that cells were treated with a specified concentration of TNFα and cell viability was measured after 24 hours. n=3. E shows a Western blot showing the levels of the specified protein 2 hours after treatment with 10 ng / ml TNFα. F and G show that cells were treated with a specified amount of doxorubicin or paclitaxel and cell viability was measured after 24 hours. n=3. [Figure 16-2] Same as above.

[0028] [Figure 17-1]The diagram has seven sections, A through G, and shows that Atg9a knockout increases T cell-mediated tumor cell killing. Section A shows Western blots indicating Atg9a and β-actin levels in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or cells expressing Atg9a-targeted sgRNA (sg2 and sg1 were most significantly depleted in screening, while sg4 was the least depleted). Section B shows control or Atg9a KO cells intermittently administered with Ova peptide and incubated with OT-1 T cells at a specified E:T ratio for 24 hours. The bar graphs show relative cell viability ± SD (n=3) compared to cells cultured in the absence of T cells. **P<0.005, ***P<0.0005, ****P<0.0001, one-way ANOVA with Tukey's multiple comparison test against parental MC38 cells. +P<0.05, ++++P<0.0001, against Atg9a sg2. C shows that T cell killing of the specified cell line was performed in the presence of 20 μg / ml TNFα blocking antibody. *P<0.05, **P<0.005, ***P<0.0005, against parental MC38 cells. +P<0.05, against Atg9a sg2. D shows that cells were treated with the specified concentration of TNFα and cell viability was measured after 24 hours. n=3. E shows a Western blot showing the levels of the specified protein 8 hours after treatment with 10 ng / ml TNFα. F shows that cells were treated with the specified amount of doxorubicin or paclitaxel and cell viability was measured after 24 hours. n=3. [Figure 17-2] Same as above.

[0029] [Figure 18-1]The diagram has seven sections, A through G, and shows that Atg12 knockout increases T cell-mediated tumor cell killing. Section A shows Western blots indicating Atg12 and β-actin levels in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or cells expressing Atg12-targeted sgRNA (sg3 and sg5 were most significantly depleted in screening, while sg6 was the least depleted). Section B shows that control or Atg12 knockout cells were intermittently administered Ova peptide and incubated with OT-1 T cells at a specified E:T ratio for 24 hours. The bar graph shows relative cell viability ± SD (n=3) compared to cells incubated in the absence of T cells. ****P<0.0001, one-way ANOVA by Tukey's multiple comparison test against parental MC38 cells. Section C shows that T cell killing of the specified cell line was performed in the presence of 20 μg / ml of TNFα-blocking antibody. **P<0.005, ***P<0.0005, relative to parental MC38 cells. D shows cells treated with the specified concentration of TNFα and cell viability measured after 24 hours. n=3. E shows a Western blot showing the levels of the specified protein 8 hours after treatment with 10 ng / ml TNFα. F and G show cells treated with the specified amount of doxorubicin or paclitaxel and cell viability measured after 24 hours. n=3. [Figure 18-2] Same as above.

[0030] [Figure 19]The diagram has two parts, A and B, indicating that Rb1cc1 and Atg12 KO cells exhibit impaired autophagy activity. Part A shows a Western blot showing LC3B and β-actin protein levels in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or MC38-Cas9 cells expressing Rb1cc1-targeted sgRNA (Rb1cc1sg3 had a lower effect on depleting Rb1cc1 protein than sg4 or sg5 - see Figure 4). Part B shows a Western blot showing LC3B and β-actin levels in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or MC38-Cas9 cells expressing Atg12-targeted sgRNA. Cells were treated for 4 hours with 10 μg / ml pepstatin A and 10 μg / ml E-64-D to inhibit lysosomal proteases, which lead to LC3B-II accumulation unless autophagy is inhibited upstream. LC3B-II represents the lipid-added form of the protein (bound to phosphatidylethanolamine).

[0031] [Figure 20] This study demonstrates that inactivation of autophagy does not impair TNFα-mediated induction of NF-βB target genes. Control or Rb1cc1 KO MC38 cells were treated untreated or with 10 ng / ml TNFα for 4 hours. Cell lysates were then assayed using a mouse cytokine array to measure the levels of 40 mouse cytokines. Cytokines increased by TNFα were labeled.

[0032] [Figure 21-1]It has three parts A to C, and shows that pharmacological blockade of autophagy sensitizes human cancer cells to TNFα- and TRAIL-mediated killing. A shows that HCT-116 human colon cancer cells were untreated or treated with 10 ng / ml of TNFα or 10 ng / ml of TRAIL in the absence or presence of 5 μM of autophagy inhibitor. Cell viability was measured after 24 hours. B shows that HeLa human cervical cancer cells were untreated or treated with 50 ng / ml of TRAIL in the absence or presence of 5 μM of autophagy inhibitor. Cell viability was measured after 24 hours. The bar graph shows the relative cell viability ± SD (n = 3). The treatment groups were compared by one-way ANOVA with Tukey's multiple comparison test. C shows a Western blot showing the levels of the indicated proteins in HCT-116 cells 24 hours after treatment with 10 ng / ml of TNFα or 10 ng / ml of Trail in the absence or presence of 5 mM of autophagy inhibitor. D shows a Western blot showing the levels of the indicated proteins in HeLa cells 24 hours after treatment with 50 ng / ml of TRAIL in the absence or presence of 5 μM of autophagy inhibitor. E is a graph summarizing the results observed for MC38 cells untreated or treated with 10 ng / ml of TNFα or 10 ng / ml of TRAIL in the absence or presence of 5 μM of SAR405 or autophagy inhibitor. Cell viability was measured after 24 hours. F is a graph summarizing the results observed for EMT6 cells untreated or treated with 10 ng / ml of TNFα or 10 ng / ml of TRAIL in the absence or presence of 5 μM of SAR405 or autophagy inhibitor. Cell viability was measured after 24 hours. The bar graph shows the relative cell viability ± SD (n = 3). ****P < 0.0001, compared with untreated cells, by one-way ANOVA with Tukey's multiple comparison test. [Figure 21-2] Same as above.

[0033] [Figure 22-1]This study has two parts, A and B, demonstrating that pharmacological blockade of autophagy sensitizes multiple mouse and human cancer cell lines to TNFα-mediated killing. Part A shows that mouse tumor cell lines (EMT6, LL / 2, CT26, Colon26) were treated untreated or with 10 ng / ml TNFα, either in the absence or presence of 5 μM autofinib, and cell viability was measured after 24 hours. Part B shows that human tumor cell lines (BT-20, Me-180, MDA-MB-361) were treated untreated or with 10 ng / ml TNFα, either in the absence or presence of 5 μM autofinib or 5 μM SAR-405, and cell viability was measured after 24 hours. The bar graph shows relative cell viability ± SD (n=3). Treatment groups were compared using one-way ANOVA with Tukey's multiple comparison test. [Figure 22-2] Same as above.

[0034] [Figure 23-1] The diagram has two parts, A and B, and demonstrates that knockout of autophagy genes in MC38 cells does not affect cell surface MHC-1 levels or OVA peptide presentation. Part A shows a flow cytometry histogram of MHC-1(H2-kb) cell surface expression in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or cells expressing Rb1cc1, Atg9a, or Atg12-targeted sgRNAs. Part B shows a flow cytometry histogram of MHC-1(H2-kb)-Ova(SIINFEKL) cell surface expression in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or cells expressing Rb1cc1-targeted sgRNAs. As shown, cells were intermittently administered either Ova(SIINFEKL) peptide or scrambled peptide before staining. [Figure 23-2] Same as above.

[0035] [Figure 24]This demonstrates that autophagy activation does not increase the levels of key TNFα pathway components. Western blots show the levels of specified proteins in MC38 parental cells (mock), MC38-Cas9 cells transduced with an empty vector, or cells expressing Rb1cc1-targeted sgRNA, 30 minutes after treatment with 10 ng / ml TNFα.

[0036] [Figure 25] This study demonstrates that early treatment of MC38 tumors with PD-1 / CTLA-4 antibodies results in complete tumor reduction. MC38 cells were transplanted into C57 / BL6 mice. Three days after transplantation, mice were treated with either an isotype control or a PD-1 plus CTLA-4 blocking antibody. Individual tumor growth curves for each mouse are shown. n=15.

[0037] [Figure 26-1] This study demonstrates that genetic inactivation of tumor autophagy affects leukocyte infiltration. Flow cytometry analysis of CD45+, CD3+, CD4+, and CD8+ cells from MC38 and EMT6 parental or Rb1cc1 knockout tumors is shown. The graphs show individual tumors with specified medians (n=4). The groups were compared by one-way ANOVA with Tukey's multiple comparison test. [Figure 26-2] Same as above. [Modes for carrying out the invention]

[0038] overview The disclosure herein is, in part, based on the finding that inhibition of autophagy pathways, including inhibition of autophagy initiation, membrane material migration, or autophagosome expansion, sensitizes cancer cells to TNFα-mediated killing (e.g., by T cells). Furthermore, the applicant has shown herein that inhibition of the NF-κB pathway sensitizes cancer cells to TNFα-mediated killing. In particular, as shown herein, genetic inhibition of autophagy sensitizes tumor cells to T cell-mediated killing in vivo. The applicant has shown herein that the autophagy pathway and the NF-κB pathway are important regulators of immunotherapy responsiveness, and that inhibition of these pathways enhances the efficacy of cancer treatment, particularly T cell-targeted therapies.

[0039] Accordingly, in certain embodiments, a method is provided herein for sensitizing cancer cells to TNF-α-mediated cytosis by contacting cancer cells with an agent that inhibits autophagy and / or the NF-κB pathway in cancer cells (e.g., an agent disclosed herein). In some embodiments, a method is provided herein for sensitizing cancer cells in a subject to TNF-α-mediated cytosis by administering the subject a single agent that inhibits autophagy and / or the NF-κB pathway in cancer cells (e.g., an agent disclosed herein).

[0040] In another embodiment, a method is provided herein for increasing TNF-α-mediated killing of cancer cells in a subject by administering to the subject at least one agent (e.g., one of the agents disclosed herein) that inhibits autophagy and / or the NF-κB pathway of cancer cells.

[0041] In a further embodiment, the methods described herein include methods for sensitizing tumors in a subject to TNF-α-mediated killing or increasing TNF-α-mediated killing of tumors in a subject by administering to the subject an agent that inhibits the autophagy and / or NF-κB pathway of tumors (e.g., agents disclosed herein). Methods for treating cancer in a subject are also provided herein by administering to the subject an agent that inhibits the autophagy and / or NF-κB pathway of cancer cells in the subject (e.g., agents disclosed herein), and by administering to the subject a second agent that induces TNF-α-mediated killing, such as cancer immunotherapy.

[0042] definition The articles "a" and "an" are used herein to indicate that the grammatical object of the article is one or more (i.e., at least one). For example, "an element" means one or more elements.

[0043] The term “agent” is used herein to refer to chemical compounds, small molecules, mixtures of chemical compounds, biological macromolecules (such as nucleic acids (e.g., interfering nucleic acids), antibodies, antibody fragments, proteins, peptides, etc.), mixtures of biomacromolecules, and / or combinations thereof. In certain embodiments, the agents herein are compositions comprising components of the CRISPR / Cas system. The activity of such agents may be suitable for them to be “therapeutic agents,” which are biologically, physiologically, or pharmacologically active substances that act locally or systemically on a target.

[0044] As used herein, "autophagy gene" refers to a gene that, when inhibited, encodes a product that leads to a decrease in autophagy levels within a cell.

[0045] As used herein, the term "cancer" includes, but is not limited to, solid tumors and hematological tumors. The term "cancer" also includes diseases of the skin, tissues, organs, bones, cartilage, blood, and blood vessels. The term "cancer" further encompasses primary cancer and metastatic cancer.

[0046] "Codon optimization" involves modifying a nucleic acid sequence to enhance expression in a particular host cell by utilizing codon degeneracy, as indicated by the diversity of three-base-pair codon combinations that identify amino acids, and generally by replacing at least one codon in the natural sequence with a codon that is more or most frequently used in the host cell's gene while maintaining the natural amino acid sequence. For example, a polynucleotide encoding the Cas9 protein can be modified to replace codons that are more frequently used than the naturally occurring nucleic acid sequence in a given prokaryotic or eukaryotic cell, including bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, hamster cells, or any other host cell of interest. Codon usage tables are readily available, for example, in the "Codon Usage Database." These tables can be adapted in various ways. See Nakamura et al. (2000) Nucleic Acids Research 28:292, which is incorporated herein by reference in its entirety for all purposes. Computer algorithms are also available for codon optimization of specific sequences for expression in a particular host (see, for example, Gene Forge).

[0047] Nucleic acid "complementarity" means that, due to the orientation of nucleic acid base groups, the nucleotide sequence of one strand of nucleic acid forms hydrogen bonds with another sequence of nucleic acid on the opposite strand. In DNA, the complementary bases are typically A and T and C and G. In RNA, they are typically C and G and U and A. Complementarity can be complete or substantial / sufficient. Complete complementarity between two nucleic acids means that the two nucleic acids can form a double helix where all the bases in the double helix are bonded to complementary bases by Watson-Crick pairs. "Substantial" or "sufficient" complementarity means that the sequence of one strand is not completely and / or perfectly complementary to the sequence of the opposite strand, but sufficient bonding occurs between the bases of the two strands to form a stable hybrid complex under a set of hybridization conditions (e.g., salt concentration and temperature). Such conditions can be predicted by predicting the Tm (melting temperature) of the hybridized strands using sequences and standard mathematical calculations, or by empirically determining Tm using routine methods. Tm includes the temperature at which a population of hybridization complexes formed between two nucleic acid strands undergoes 50% denaturation (i.e., a population of double-stranded nucleic acid molecules partially dissociates into single strands). Below Tm, the formation of hybridization complexes is promoted, while above Tm, the melting or separation of strands within the hybridization complex is promoted. Tm can be estimated, for example, using Tm = 81.5 + 0.41 (G + C%) for nucleic acids with known G + C content in a 1 M NaCl aqueous solution, although other known Tm calculations take into account the structural properties of the nucleic acid.

[0048] As used herein, the term “combined therapy” refers to any form of administration of two or more different therapeutic agents such that a second drug is administered while a previously administered therapeutic agent is still effective in the body (for example, both drugs may be effective against the target simultaneously, and a synergistic effect of the two drugs may be included).

[0049] The term “gene” refers to a DNA sequence within a chromosome that codes for a product (e.g., an RNA product and / or a polypeptide product), and includes the coding region, any non-coding introns that interrupt the coding region, and sequences located adjacent to the coding region at both the 5' and 3' ends, so that the gene corresponds to a full-length mRNA (including the 5' and 3' uncoding sequences). The term “gene” also includes other non-coding sequences, including regulatory sequences (e.g., promoters, enhancers, and transcription factor binding sites), polyadenylation signals, internal ribosome entry sites, silencers, insulating sequences, and matrix-binding regions. These sequences may be close to (e.g., within 10 kb) or distant from the coding region of the gene and may affect the level or rate of transcription and translation of the gene.

[0050] A "guide RNA" or "gRNA" is an RNA molecule that binds to a Cas protein (e.g., the Cas9 protein) and targets the Cas protein to a specific location within target DNA. A guide RNA may contain two segments: a "DNA targeting segment" and a "protein-binding segment." A "segment" includes a section or region of a molecule, such as a continuous extension of nucleotides in the RNA. Some gRNAs, such as the Cas9 gRNA, may contain two separate RNA molecules: an "activator RNA" (e.g., tracrRNA) and a "targeter RNA" (e.g., CRISPR RNA or crRNA). Other gRNAs are single RNA molecules (single RNA polynucleotides) and may also be referred to as "single-molecule gRNAs," "single-guide RNAs," or "sgRNAs." For example, see International Patent Nos. WO2013 / 176772, WO2014 / 065596, WO2014 / 089290, WO2014 / 093622, WO2014 / 099750, WO2013 / 142578, and WO2014 / 131833, each of which is incorporated herein by reference in its entirety for all purposes. For example, in the case of Cas9, a single guide RNA may include a crRNA fused to a tracrRNA (e.g., via a linker). For example, in the case of Cpf1, only a crRNA is required to achieve binding to the target sequence. The terms “guide RNA” and “gRNA” include both bimolecule (i.e., modular) gRNAs and monomolecule gRNAs.

[0051] As used herein, the term “guide RNA target sequence” specifically refers to the sequence on the non-complementary strand that corresponds to (i.e., is the reverse complementary of) the sequence into which the guide RNA hybridizes on the complementary strand. That is, the guide RNA target sequence refers to the sequence on the non-complementary strand adjacent to the PAM (e.g., upstream or 5' of the PAM in the case of Cas9). The guide RNA target sequence corresponds to the DNA targeting segment of the guide RNA, but contains thymine instead of uracil. As an example, the guide RNA target sequence for the SpCas9 enzyme may refer to the sequence upstream of the 5'-NGG-3'PAM on the non-complementary strand.

[0052] The term "lipid particles" includes lipid formulations that can be used to deliver therapeutic nucleic acids (e.g., gRNA) to target sites of interest (e.g., cells, tissues, organs, etc.).

[0053] The term “lipid conjugate” refers to conjugated lipids that inhibit the aggregation of lipid particles. Such lipid conjugates include, but are not limited to, PEG-lipid conjugates such as PEG conjugated to dialkyloxypropyl (e.g., PEG-DAA conjugate), PEG conjugated to diacylglycerol (e.g., PEG-DAG conjugate), PEG conjugated to cholesterol, PEG conjugated to phosphatidylethanolamine, and PEG conjugated to ceramide (see, for example, U.S. Patent No. 5,885,613), cationic PEG lipids, polyoxazoline (POZ)-lipid conjugates (e.g., POZ-DAA conjugate), polyamide oligomers (e.g., ATTA lipid conjugate), and mixtures thereof. Further examples of POZ-lipid conjugates are described in PCT Publication WO2010 / 006282. PEG or POZ can be conjugated directly to lipids or conjugated to lipids via a linker moiety. For example, any linker moiety suitable for binding PEG or POZ to lipids can be used, including non-ester-containing and ester-containing linker moieties. In certain embodiments, non-ester-containing linker moieties such as amides or carbamates are used.

[0054] As used herein, the “NF-κB gene” is a gene that encodes a product that, when inhibited, results in a decrease in intracellular NF-κB signaling levels.

[0055] As used herein, “not naturally occurring” systems include anything that indicates human involvement, such as systems that are altered or mutated from their naturally occurring state, or systems that do not contain at least substantially one other component that is naturally related, or systems that are related to at least one other component that is not naturally related. For example, some CRISPR / Cas systems use a CRISPR complex that does not naturally occur, containing gRNA and Cas protein that do not occur together in nature, or use a Cas protein that does not occur in nature, or use a gRNA that does not occur in nature.

[0056] As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulation material, that is involved in transporting or delivering a subject compound from one organ or part of the body to another organ or part of the body.

[0057] The terms “polynucleotide” and “nucleic acid” are used interchangeably. They refer to polymeric forms of nucleotides of any length, which are either deoxyribonucleotides, ribonucleotides, or their analogues. Polynucleotides can have any three-dimensional structure and can perform any known or unknown function. Non-limiting examples of polynucleotides include coding or non-coding regions of genes or gene fragments, loci defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotides may include modified nucleotides such as methylated nucleotides and nucleotide analogues. If present, modifications to the nucleotide structure may be conferred before or after polymer assembly. The sequence of nucleotides may be interrupted by non-nucleotide components. Polynucleotides may be further modified, such as by binding with labeling components. The term "recombinant" polynucleotide refers to a polynucleotide of genomic, cDNA, semi-synthetic, or synthetic origin that is not naturally occurring or is linked to another polynucleotide in a non-natural configuration.

[0058] Nucleic acids are said to have a "5' end" and a "3' end." This is because mononucleotides react to form oligonucleotides in such a way that the 5' phosphate of one mononucleotide pentose ring is bound to the adjacent 3' oxygen in one direction via a phosphodiester bond. The end of an oligonucleotide is called the "5' end" if its 5' phosphate is not bound to the 3' oxygen of another mononucleotide pentose ring. The end of an oligonucleotide is called the "3' end" if its 3' oxygen is not bound to the 5' phosphate of another mononucleotide pentose ring. A nucleic acid sequence can be said to have a 5' end and a 3' end even when it is inside a larger oligonucleotide. In both linear and circular DNA molecules, distinct elements are referred to as the "downstream" or "upstream" or 5' of the 3' element.

[0059] Terms such as "prevent," "prevention," and "prevention" refer to reducing the likelihood of developing a disease, disorder, or condition in which a person does not currently have the disease, disorder, or condition, but is at risk of developing or is likely to develop.

[0060] The term "small molecule" is a term used in the art and includes molecules with a molecular weight of less than approximately 1000 or less than approximately 500. In one embodiment, a small molecule does not necessarily contain only peptide bonds. In another embodiment, a small molecule is not an oligomer. Exemplary small molecule compounds that can be screened for activity include, but are not limited to, peptides, peptidomimetic compounds, nucleic acids, carbohydrates, organic small molecules (e.g., polyketides) (Cane et al. (1998) Science 282:63), and natural product extract libraries.

[0061] "Small hairpin RNA" or "shRNA" contains a small RNA sequence that creates a tight hairpin turn that can be used to stop gene expression via RNA interference. The shRNAs provided herein may be chemically synthesized or transcribed from a transcription cassette in a DNA plasmid. The shRNA hairpin structure is cleaved into siRNA by cellular mechanisms and then bound to an RNA-induced silencing complex (RISC).

[0062] As used herein, the term “subject” means a human or non-human animal selected for treatment or therapy. In certain embodiments provided herein, the subject is a human subject. In some embodiments provided herein, the subject is a subject requiring the method provided herein, such as a subject with cancer.

[0063] The term "nuclease target sequence" refers to DNA sequences on which a nuclease induces a nick or double-strand break. Similarly, the term "DNA-binding protein target sequence" refers to DNA sequences on which a DNA-binding protein binds. Target sequences may be endogenous (or native) to the cell, or they may be exogenous.

[0064] As used herein, the terms “therapeutic dose” and “effective dose” mean the amount of drug that is effective in producing the desired therapeutic effect in at least a subpopulation of cells of interest, in a reasonable benefit-to-risk ratio applicable to any medical treatment.

[0065] To "treat" a disease or to "treat" a person with a disease means to administer drug therapy, such as the administration of drugs, to the person in question so that at least one symptom of the disease is alleviated or prevented from worsening.

[0066] Autophagy and the NF-κB pathway As stated above, the disclosure herein is in part based on the finding that inhibition of autophagy pathways, including inhibition of autophagy initiation, membrane material migration, or autophagosome expansion, sensitizes cancer cells to TNFα-mediated killing (e.g., by T cells). The applicant hereby demonstrates that the autophagy pathway and the NF-κB pathway are important regulators of immunotherapy responsiveness, and that inhibition of these pathways enhances the efficacy of cancer treatment, particularly T-cell targeted therapies.

[0067] Accordingly, methods for sensitizing cancer cells to TNF-α-mediated killing are provided herein by subjecting them to an agent that inhibits autophagy and / or the NF-κB pathway (e.g., at least one agent disclosed herein) or by contacting them with cancer cells. In some embodiments, the agent inhibits the expression or activity of autophagy genes and / or NF-κB genes. As used herein, “autophagy gene” includes, but is not limited to, genes that, when inhibited, result in a decrease in intracellular autophagy levels. Autophagy genes may include, for example, ATG12, WIPI2, RB1CC1, PIK3C3, ATG9A, ATG2A, ATG5, ATG14, EI24, NRBF2, ATG13, TAX1BP1, and ATG10. Exemplary NCBI sequence references to mRNA, protein, and genome (GRCh38.p13 primary assembly) sequences of these exemplary autophagy genes are provided in Table 1. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]

[0068] In some embodiments, the agent inhibits the expression or activity of NF-κB genes. As used herein, “NF-κB gene” includes, but is not limited to, genes encoding products that, when inhibited, result in a decrease in intracellular NF-κB signaling levels. NF-κB genes may be, for example, CFLAR, UBE2L3, RNF31, IKBKB, MAP3K7, TAB1, RELA, IKKBKG, CHUK, TAB2, TBK1, MAPKAPK2, RBCK1, TRAF2, SHARPIN, or TNFAIP3. Exemplary NCBI sequence references to the mRNA, protein, and genome (GRCh38.p13 primary assembly) sequences of these exemplary NF-κB genes are provided in Table 2. [Table 2-1] [Table 2-2] [Table 2-3]

[0069] In another embodiment, a method is provided herein for increasing TNF-α-mediated killing of cancer cells in a subject by administering to the subject at least one agent that inhibits autophagy and / or the NF-κB pathway in cancer cells (e.g., at least one agent disclosed herein, such as an agent that modifies at least one autophagy gene, such as the genes in Table 1 or Table 2, or at least one NF-κB gene). Also disclosed herein is a method for sensitizing a target tumor to TNF-α-mediated killing or increasing TNF-α-mediated killing of a tumor in a subject by administering to the target at least one agent that inhibits autophagy and / or the NF-κB pathway in a tumor (e.g., at least one agent disclosed herein, such as an agent that modifies at least one autophagy gene, such as the genes in Table 1 or Table 2, or at least one NF-κB gene). Methods for treating target cancer are also provided herein by administering agents that inhibit autophagy and / or the NF-κB pathway (e.g., at least one agent disclosed herein, such as agents that modify at least one autophagy gene or at least one NF-κB gene, such as the genes in Table 1 or Table 2) to target cancer cells and cancer therapies (e.g., cancer immunotherapy). In some embodiments, modifying at least one autophagy gene and / or NF-κB gene results in a decrease in gene expression or activity. In some embodiments, modifying at least one autophagy gene and / or NF-κB gene results in a loss of gene expression or activity.

[0070] Regulators of autophagy and the NF-κB pathway CRISPR / Cas systems In some embodiments, agents that inhibit the expression or activity of autophagy genes (e.g., autophagy genes in Table 1) or NF-κB genes (e.g., NF-κB genes in Table 2), and their use, are provided herein. In certain embodiments, the agent may be an agent that modifies at least one autophagy gene or NF-κB gene (e.g., modifying at least one gene results in a decrease and / or loss of gene expression or activity). In some embodiments, gene modification includes deletion, insertion, substitution, or a combination thereof. In some embodiments, the modification process includes the binding of a Cas protein to the gene.

[0071] In certain embodiments, a drug that inhibits the expression or activity of an autophagy gene (e.g., the autophagy genes listed in Table 1) or an NF-κB gene (e.g., the NF-κB genes listed in Table 2) is a composition comprising guide RNA. In some embodiments, the drug is a composition comprising a nucleic acid comprising a first nucleotide sequence encoding the guide RNA. The guide RNA may be effective in inducing a Cas enzyme to cleave or ligate a sequence within a gene, and the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence within the gene. In some embodiments, the guide RNA is configured to provide a cleavage event selected from double-strand breaks and single-strand breaks within the gene. In some embodiments, the guide RNA target sequence contains or is adjacent to the start codon of the gene. The guide RNA target sequence may be within approximately 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the start codon. In some embodiments, the gRNA target sequence is located in exon 1 of the targeted gene. In some embodiments, the gRNA target sequence is located in exon 2 of the targeted gene. In some embodiments, the agent that inhibits the expression or activity of the autophagy gene is a composition comprising multiple guide RNAs. For example, in some embodiments, the composition comprises a first guide RNA that targets the 5' end of the targeted gene and a second guide RNA that targets the 3' end of the targeted gene (for example, to induce disintegration). In some embodiments, the composition comprises a dual gRNA designed to modify or delete the functional domain of the targeted gene.

[0072] In certain embodiments, the guide RNA comprises at least 15 consecutive nucleotides that hybridize to an autophagy gene (e.g., the autophagy genes listed in Table 1) or an NF-κB gene (e.g., the NF-κB genes listed in Table 2). For example, at least 15 consecutive nucleotides can hybridize to a segment of an autophagy gene listed in Table 1 or an NF-κB gene listed in Table 2 that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the gene sequence provided in Table 1 or Table 2, respectively. Optionally, the guide RNA comprises a sequence that can hybridize to at least 15 consecutive nucleotides of the gene sequence provided in Table 1 or Table 2.

[0073] For example, in certain embodiments, targeted gene modifications to autophagy genes (e.g., autophagy genes listed in Table 1) or NF-κB genes (e.g., NF-κB genes listed in Table 2) in the cell genome can be created by contacting a cell or cell genome with a Cas protein and one or more guide RNAs that hybridize to one or more guide RNA recognition sequences within the target genomic locus of the autophagy gene (e.g., autophagy genes listed in Table 1) or NF-κB gene (e.g., NF-κB genes listed in Table 2). In other words, targeted gene modifications to autophagy genes (e.g., autophagy genes listed in Table 1) or NF-κB genes (e.g., NF-κB genes listed in Table 2) in the cell's genome can be created by exposing a cell or the cell's genome to a Cas protein and one or more guide RNAs that target one or more guide RNA target sequences within the target genomic locus of the autophagy gene (e.g., autophagy genes listed in Table 1) or NF-κB gene (e.g., NF-κB genes listed in Table 2). For example, such a method may involve exposing a cell to a Cas protein and guide RNA that target guide RNA target sequences within the autophagy gene (e.g., autophagy genes listed in Table 1) or NF-κB gene (e.g., NF-κB genes listed in Table 2). For example, the guide RNA target sequence may include, or be adjacent to, the start codon of an autophagy gene (e.g., the autophagy genes listed in Table 1) or an NF-κB gene (e.g., the ones listed in Table 2), or the stop codon of an autophagy gene (e.g., the autophagy genes listed in Table 1) or an NF-κB gene (e.g., the NF-κB genes listed in Table 2). For example, the guide RNA target sequence may be within approximately 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start or stop codon. In some embodiments, the gRNA target sequence is located in exon 1 of the target gene. In some embodiments, the gRNA target sequence is located in exon 2 of the target gene.In some embodiments, the agent that inhibits the expression or activity of an autophagy gene is a composition comprising multiple guide RNAs. For example, in some embodiments, the composition comprises a first guide RNA that targets the 5' end of the target gene and a second guide RNA that targets the 3' end of the target gene (e.g., to induce disintegration). In some embodiments, the composition comprises a dual gRNA designed to modify or delete the functional domain of the target gene.

[0074] In several ways, two or more nucleases can be used. For example, two or more nucleases can be used, each targeting a nuclease target sequence containing or adjacent to a start codon. As another example, two nucleases can be used, one targeting a nuclease target sequence containing or adjacent to a start codon, and the other targeting a nuclease target sequence containing or adjacent to a stop codon, so that the coding region between the two nuclease target sequences can be deleted by cleavage with the nucleases. As yet another example, three or more nucleases can be used, one or more (e.g., two) targeting nuclease target sequences containing or adjacent to a start codon, and one or more (e.g., two) targeting nuclease target sequences containing or adjacent to a stop codon, so that cleavage by the nucleases can delete the coding region between the nuclease target sequence containing or adjacent to the start codon and the nuclease target sequence containing or adjacent to the stop codon.

[0075] Examples of sgRNA sequences useful for targeting exemplary autophagy genes (gene name, sgRNA ID, sgRNA number and sequence, if applicable) include: Rb1cc1,MGLibA_44688,1,AGAGTGTGTACTTACAGCGC(SEQ ID NO: 38); Rb1cc1,MGLibA_44689,2,CTGAACGTGGCAAAGAACTT(SEQ ID NO: 39); Rb1cc1,MGLibA_44690,3,TCAGATAGACCCAATGATG(SEQ ID NO: 40); Rb1cc1,MGLibB_44675,4,CTCCATTGACCACCAGAACC(SEQ ID NO: 41); Rb1cc1,M GLibB_44676, 5, ATTTGAACAGTCCTCCAGAT (Sequence ID 42); Rb1cc1, MGLibB_44677, 6, CTTTAGGAATAGCAGGTGCA (Sequence ID 43); Atg9a, MGLibA_05661, 1, CATAGTCCACACAGCTAACC (Sequence ID 44); Atg9a, MGLibA_05662, 2, TTGGGATCCGAAGAGCATGT (Sequence ID 45); Atg9a, MGLibA05663, 3, CTGCCCAAGTCTGTAGTGCC (Array Number 46); Atg9a, MGLibB_05661, 4, TCTATAACATTTGCTGCTAT (Sequence ID 47); Atg9a, MGLibB_05662, 5, TACATGTGAAGCCATTCTTC (Sequence ID 48); Atg9a, MGLibB_05663, 6, AGGATATTCGAGAGAAGAAG (Sequence ID 49); Atg12, MGLibA_05619, 1, TGCAGTTTCGCCCGGAACGG (Sequence ID 50); Atg12, MGLibA_05620, 2, CTCTGGAAGG This includes, but is not limited to, CTCTCGCCGC (sequence number 51); Atg12, MGLibA_05621, 3, GAGCGAACCCGGACCATCCA (sequence number 52); Atg12, MGLibB_05619, 4, TCATCATACCAACTGTTCCG (sequence number 53); Atg12, MGLibB_05620, 5, CCTGCATTACTGCAAATCCC (sequence number 54) and Atg12, MGLibB_05621, 6, TTCTGGCTCATCCCCATGCC (sequence number 55).

[0076] Examples of sgRNA sequences useful for targeting exemplary NF-κB genes (gene name, sgRNA ID, sgRNA number and sequence if applicable) include: Map3k7,MGLibA_30286,1,GATGATCGAAGCGCCGTCGC(SEQ ID NO: 16);Map3k7,MGLibA_30287,2,CGGCGCTTCGATCATCTCAC(SEQ ID NO: 17);Map3k7,MGLibA_30288,3,GGGACTTACTGGATTCAGGC(SEQ ID NO: 18);Map3k7,MGLibB_30277,4,GAGTAGTTTGCAAAGCTAAG(SEQ ID NO: 19);Map3k7, MGLibB_30278, 5, TTAACTCAGGTTGTCGGAAG (Sequence ID 20); Map3k7, MGLibB_30279, 6, GAGGGGGGCTCATTGTATAA (Sequence ID 21); Rbck1, MGLibA_44718, 1, AGTACGCCCGGATATGACAG (Sequence ID 22); Rbck1, MGLibA_44719, 2, ACGTGTTGCGGGCTGACAGC (Sequence ID 23); Rbck1, MGLibA_44720, 3, CAGCTTACCGGTGGTGACTC (SEQ ID NO: 24); Rbck1, MGLibB_44705, 4, AACCTGTCCTTCCGAAGCCC (SEQ ID NO: 25); Rbck1, MGLibB_44706, 5, CGGGCGTACTGTGAGCCAAA (SEQ ID NO: 26); Rbck1, MGLibB_44707, 6, CTGCTATCAAGTATGCCACC (SEQ ID NO: 27); Rela, MGLibA_45072, 1, GCGATTCCGCTATAAATGCG (SEQ ID NO: 28); Rela, MGLibA_45073, 2, TCATCGA ACAGCCGAAGCAA (SEQ ID NO: 29); Rela, MGLibA_45074, 3, GCCCAGACCGCAGTATCCAT (SEQ ID NO: 30); Rela, MGLibB_45059, 4, CTGCCGGGATGGCTACTATG (SEQ ID NO: 31); Rela, MGLibB_45060, 5, ACCGTGAAAGGGGTTATTGT (SEQ ID NO: 32) and Rela, MGLibB_45061, 6, ACTTACCTGAGGGAAAGATG (SEQ ID NO: 33) are included, but are not limited to these.

[0077] In some embodiments, the guide RNA may include clustered and regularly arranged short palindromic sequence repeat (CRISPR) RNA (crRNA) containing a DNA targeting segment and transactivating CRISPR RNA (tracrRNA). The guide RNA may be a modular guide RNA, in which the crRNA and tracrRNA are separate molecules that hybridize with each other.

[0078] In some embodiments, the composition further comprises a Cas protein or a nucleic acid sequence encoding a Cas protein (e.g., a nuclease-active Cas protein or a nuclease-inactive Cas protein fused to a transcriptional repressor domain). The Cas protein may be a Cas9 protein. The Cas9 molecule may be a S. aureus Cas9 protein, a S. pyogenes Cas9 protein, or a N. meningitidis Cas9 protein.

[0079] In certain embodiments, the methods and compositions disclosed herein may utilize clustered and regularly arranged short palindromic repeat (CRISPR) / CRISPR-associated (Cas) systems or components of such systems to modify the intracellular genome. A CRISPR / Cas system comprises transcripts and other elements that are involved in the expression of or induce the activity of the Cas gene. A CRISPR / Cas system may be, for example, a type I, type II, type III, or type V system (e.g., a VA subtype or a VB subtype). The methods and compositions disclosed herein may utilize a CRISPR / Cas system by utilizing a CRISPR complex (containing a guide RNA (gRNA) complexed with a Cas protein) for site-specific binding or cleavage of nucleic acids. In some embodiments, the CRISPR / Cas systems used in the compositions and methods disclosed herein may not exist in nature.

[0080] A.Cas protein In some embodiments, Cas proteins generally include at least one RNA recognition domain or RNA binding domain capable of interacting with a guide RNA. Cas proteins may also include nuclease domains (e.g., DNase domains or RNase domains), DNA binding domains, helicase domains, protein-protein interaction domains, dimerization domains, and other domains. Some such domains (e.g., DNase domains) may be derived from native Cas proteins. Modified Cas proteins can be created by adding other such domains. Nuclease domains possess catalytic activity for nucleic acid cleavage, including the cleavage of covalent bonds in nucleic acid molecules. Cleavage can produce blunt or adherent ends, which can be single-stranded or double-stranded. For example, wild-type Cas9 proteins typically produce blunt cleavage products. Alternatively, wild-type Cpf1 proteins (e.g., FnCpf1) may yield a cleavage product with a 5' overhang of 5 nucleotides, where the cleavage occurs after the 18th base pair from the PAM sequence of the non-target strand and after the 23rd base of the target strand. The Cas protein may have complete cleavage activity that causes double-strand breaks (e.g., double-strand breaks with blunt ends) at the target genomic locus, or it may be a nickase that causes single-strand breaks at the target genomic locus.

[0081] Examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Casl0d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), Cse3 (Ca Examples include sE), Cse4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966, as well as their homologs or variants.

[0082] Exemplary Cas proteins are Cas9 proteins or proteins derived from Cas9 proteins. Cas9 proteins originate from the type II CRISPR / Cas system and typically share four key motifs with a conserved architecture. Motifs 1, 2, and 4 are RuvC-like motifs, and motif 3 is an HNH motif. Exemplary Cas9 proteins include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus species, Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas species, Crocosphaera watsonii, Cyanothece species, Microcystis aeruginosa, Synechococcus species, Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacilluscaldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter species, Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc species, Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, Neisseria meningitidis or Campylobacter jejuni. An example of additional Cas9 family members is described in International Patent No. WO2014 / 131833, which is incorporated herein by reference in its entirety for all purposes. Cas9 from S. pyogenes (SpCas9) (assigned SwissProt registry number Q99ZW2) is an exemplary Cas9 protein. Cas9 from S. aureus (SaCas9) (assigned UniProt registry number J7RUA5) is another exemplary Cas9 protein. Cas9 from Campylobacter jejuni (CjCas9) (assigned UniProt registry number Q0P897) is another exemplary Cas9 protein. See, for example, Kim et al. (2017) Nat.Commun. 8:14500, which is incorporated herein by reference in its entirety for all purposes. SaCas9 is smaller than SpCas9, and CjCas9 is smaller than both SaCas9 and SpCas9.

[0083] Another example of a Cas protein is the Cpf1 (CRISPR) protein derived from Prevotella and Francisella 1. Cpf1 is a large protein (approximately 1300 amino acids) and possesses a RuvC-like nuclease domain homologous to the corresponding domain in Cas9, as well as a counterpart to Cas9's characteristic arginine-rich cluster. However, Cpf1 lacks the HNH nuclease domain present in the Cas9 protein, and the RuvC-like domain is contiguous within the Cpf1 sequence, in contrast to Cas9, which includes a long insert containing the HNH domain. See, for example, Zetsche et al. (2015) Cell 163(3):759-771, which is incorporated herein by reference in its entirety for all purposes. Exemplary Cpf1 proteins are Francisella tularensis 1, Francisella tularensis subspecies novicida, Prevotella albensis, Lachnospiraceae bacterium MC2017 1, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_44_17, Smithella species SCADC, Acidaminococcus species BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3, Prevotella It is derived from *Disiens* and *Porphyromonas macacae*. Cpf1 (FnCpf1; assigned UniProt registry number A0Q7Q2) from *Francisella novicida* U112 is an exemplary Cpf1 protein.

[0084] The Cas protein may be a wild-type protein (i.e., one that exists in nature), a modified Cas protein (i.e., a Cas protein variant), or a fragment of a wild-type or modified Cas protein. The Cas protein may also be an active variant or fragment with respect to the catalytic activity of a wild-type or modified Cas protein. The active variant or fragment with respect to catalytic activity may contain 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the wild-type or modified Cas protein or a portion thereof, and the active variant retains the ability to cleave at a desired cleavage site, and therefore retains nick-inducing activity or double-strand break-inducing activity. Assays for nick-inducing activity or double-strand break-inducing activity are known and generally measure the overall activity and specificity of the Cas protein on a DNA substrate containing the cleavage site.

[0085] One example of a modified Cas protein is the modified SpCas9-HF1 protein, a high-fidelity variant of Streptococcus pyogenes Cas9 possessing modifications (N497A / R661A / Q695A / Q926A) designed to reduce nonspecific DNA contact. See, for example, Kleinstiver et al. (2016) Nature 529 (7587): 490-495, which is incorporated herein by reference in its entirety for all purposes. Another example of a modified Cas protein is the modified eSpCas9 variant (K848A / K1003A / R1060A) designed to reduce nonspecific effects. See, for example, Slaymaker et al. (2016) Science 351 (6268): 84-88, which is incorporated herein by reference in its entirety for all purposes. Other SpCas9 variants include K855A and K810A / K1003A / R1060A.

[0086] Cas proteins can be modified to increase or decrease one or more of the following: nucleic acid binding affinity, nucleic acid binding specificity, and enzymatic activity. Cas proteins can also be modified to alter any other activity or property of the protein, such as stability. For example, one or more nuclease domains of a Cas protein can be modified, deleted, or inactivated, or a Cas protein can be cleaved to remove domains that are not essential to the protein's function, or to optimize (e.g., enhance or reduce) the activity or properties of the Cas protein.

[0087] Cas proteins may contain at least one nuclease domain, such as a DNase domain. For example, the wild-type Cpf1 protein typically contains a RuvC-like domain, possibly in a dimeric configuration, that cleaves both strands of target DNA. Cas proteins may also contain at least two nuclease domains, such as DNase domains. For example, the wild-type Cas9 protein typically contains a RuvC-like nuclease domain and an HNH-like nuclease domain. The RuvC and HNH domains can each cleave different strands of double-stranded DNA, thereby causing double-strand breaks of DNA. See, for example, Jinek et al. (2012) Science 337 (6096): 816-821, which is incorporated herein by reference in its entirety for all purposes.

[0088] One or more or all of the nuclease domains can be deleted or mutated so that the nuclease domain is no longer functional or its nuclease activity is reduced. For example, if one of the nuclease domains is deleted or mutated in the Cas9 protein, the resulting Cas9 protein may be called a nickase and can produce single-strand breaks in double-stranded target DNA but not double-strand breaks (i.e., it can cleave the complementary or non-complementary strand, but not both). If both nuclease domains are deleted or mutated, the resulting Cas protein (e.g., Cas9) has a reduced ability to cleave both strands of double-stranded DNA (e.g., a nuclease-free or nuclease-inactive Cas protein, or a Cas protein without catalytic activity (dCas)). An example of a mutation that converts Cas9 to a nickase is the D10A mutation (from aspartic acid to alanine at position 10 of Cas9) in the RuvC domain of Cas9 from S. pyogenes. Similarly, H939A (histidine to alanine at amino acid position 839), H840A (histidine to alanine at amino acid position 840), or N863A (asparagine to alanine at amino acid position N863) within the HNH domain of Cas9 from S. pyogenes can convert Cas9 to nickase. Other examples of Cas9-nickase-converting mutations include corresponding mutations to Cas9 from S. thermophilus. See, for example, Sapranauskas et al. (2011) Nucleic Acids Res. 39(21):9275-9282 and International Patent No. WO2013 / 141680, each of which is incorporated herein by reference in whole for all purposes. Such mutations can be generated using methods such as site-directed mutagenesis, PCR-mediated mutagenesis, or whole-gene synthesis. Other examples of mutations that produce nickase can be found, for example, in International Patent Nos. WO2013 / 176772 and WO2013 / 142578, each of which is incorporated herein by reference in its entirety for all purposes.If all nuclease domains are deleted or mutated in a Cas protein (for example, if both nuclease domains are deleted or mutated in the Cas9 protein), the resulting Cas protein (e.g., Cas9) will have a reduced ability to cleave both strands of double-stranded DNA (e.g., a nuclease-free or nuclease-inactive Cas protein). One specific example is the D10A / H840A S.pyogenes Cas9 double mutant, or the corresponding double mutant of Cas9 from another species when optimally aligned with S.pyogenes Cas9. Another specific example is the D10A / N863A S.pyogenes Cas9 double mutant, or the corresponding double mutant of Cas9 from another species when optimally aligned with S.pyogenes Cas9.

[0089] Examples of inactivating mutations in the catalytic domain of the Staphylococcus aureus Cas9 protein are also known. For example, the Staphylococcus aureus Cas9 enzyme (SaCas9) may include substitutions at position N580 (e.g., N580A substitution) and at position D10 (e.g., D10A substitution) to produce a nuclease-inactive Cas protein. See, for example, International Patent No. WO2016 / 106236, which is incorporated herein by reference in its entirety for all purposes.

[0090] Examples of mutations that inactivate the catalytic domain of the Cpf1 protein are also known. In relation to Cpf1 proteins from Francisella novicida U112 (FnCpf1), Acidaminococcus sp.BV3L6 (AsCpf1), Lachnospiraceae bacterium ND2006 (LbCpf1), and Moraxella bovoculi237 (MbCpf1 Cpf1), such mutations may include mutations at positions 908, 993, or 1263 of AsCpf1 or the corresponding positions in the Cpf1 ortholog, or at positions 832, 925, 947, or 1180 of LbCpf1 or the corresponding positions in the Cpf1 ortholog. Such mutations may include, for example, one or more of the mutations D908A, E993A, and D1263A of AsCpf1 or the corresponding mutations in the Cpf1 orthologs, or D832A, E925A, D947A, and D1180A of LbCpf1 or the corresponding mutations in the Cpf1 orthologs. See, for example, U.S. Patent No. 2016 / 0208243, which is incorporated herein by reference in its entirety for all purposes.

[0091] The Cas protein can also be operably ligated to a heterologous polypeptide as a fusion protein. For example, the Cas protein can be fused to a cleavage domain, an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repressor domain. See, for example, International Patent No. WO2014 / 089290, which is incorporated herein by reference in its entirety for all purposes. Examples of transcriptional activation domains include the herpes simplex virus VP16 activation domain, VP64 (a tetrameric derivative of VP16), the NFκB p65 activation domain, p53 activation domains 1 and 2, the CREB (cAMP response element-binding protein) activation domain, the E2A activation domain, and the NFAT (nuclear factor of activated T cells) activation domain. Other examples include activation domains derived from Oct1, Oct-2A, SP1, AP-2, CTF1, P300, CBP, PCAF, SRC1, PvALF, ERF-2, OsGAI, HALF-1, C1, AP1, ARF-5, ARF-6, ARF-7, ARF-8, CPRF1, CPRF4, MYC-RP / GP, TRAB1PC4, and HSF1. See, for example, U.S. Patent No. 2016 / 0237456, European Patent No. 3045537, and International Patent No. WO2011 / 146121, which are incorporated herein by reference in their entirety for all purposes. In some cases, a transcriptional activation system comprising a dCas9-VP64 fusion protein paired with MS2-p65-HSF1 may be used. Guide RNAs for such systems can be designed to attach an aptamer sequence to an sgRNA tetraloop and bind the stemloop 2 to a dimerized MS2 bacteriophage coat protein. See, for example, Konermann et al. (2015) Nature 517(7536):583-588, which is incorporated herein by reference in its entirety for all purposes. Examples of transcriptional repressor domains include the inducible cAMP early repressor (ICER) domain, the Kruppel-associated box A (KRAB-A) repressor domain, the YY1 glycine-rich repressor domain, the Sp1-like repressor, the E(spl) repressor, the IκB repressor, and MeCP2.Other examples include transcriptional repression domains derived from A / B, KOX, TGF-β-inducible early gene (TIEG), v-erbA, SID, SID4X, MBD2, MBD3, DNMT1, DNMG3A, DNMT3B, Rb, and ROM2. See, for example, European Patent No. 3045537 and International Patent No. WO2011 / 146121, each of which is incorporated herein in whole for all purposes by reference. The Cas protein can also be fused with heterologous polypeptides that provide increased or decreased stability. The fusion domain or heterologous polypeptide can be located at the N-terminus, C-terminus, or internally within the Cas protein.

[0092] As an example, a Cas protein can be fused to one or more heterologous polypeptides that provide intracellular localization. Such heterologous polypeptides may include, for example, one or more nuclear localization signals (NLS), e.g., a monosegmental SV40 NLS and / or a bisegmental α-importin NLS targeting the nucleus, a mitochondrial localization signal targeting mitochondria, an ER retention signal, and so on. See, for example, Lange et al. (2007) J. Biol. Chem. 282(8):5101-5105, which is incorporated herein by reference in its entirety for all purposes. Such intracellular localization signals can be located at the N-terminus, C-terminus, or any other location within the Cas protein. The NLS can contain a set of basic amino acids and may be a monosegmental or bisegmental sequence. Optionally, a Cas protein may contain two or more NLSs, including an N-terminal NLS (e.g., an α-importin NLS or a monosegmental NLS) and a C-terminal NLS (e.g., an SV40 NLS or a bisegmental NLS). The Cas protein may also contain two or more NLS at its N-terminus and / or two or more NLS at its C-terminus.

[0093] The Cas protein can also be operably linked to a cell permeability domain or a protein transduction domain. For example, the cell permeability domain may be derived from the HIV-1 TAT protein, the human hepatitis B virus-derived TLM cell permeability motif, MPG, Pep-1, VP22, the herpes simplex virus-derived cell permeability peptide, or a polyarginine peptide sequence. See, for example, International Patent No. WO2014 / 089290 and International Patent No. WO2013 / 176772, each of which is incorporated herein by reference in whole for all purposes. The cell permeability domain can be located at the N-terminus, C-terminus, or any other location within the Cas protein.

[0094] Cas proteins can also be operably ligated to heterologous polypeptides such as fluorescent proteins, purification tags, or epitope tags to facilitate tracking or purification. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, monomeric Azami Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow1), blue fluorescent proteins (eBFP, eBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-Sapphire), cyan fluorescent proteins (e.g., eCFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), and red fluorescent proteins (e.g., mKate, mKat Examples include e2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRaspberry, mStrawberry, Jred), orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, monomer-type Kusabira-Orange, mTangerine, tdTomato), and any other suitable fluorescent proteins. Examples of tags include glutathione-S-transferase (GST), chitin-binding protein (CBP), maltose-binding protein, thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, hemagglutinin (HA), nus, Softag1, Softag3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, histidine (His), biotin carboxyl carrier protein (BCCP), and calmodulin.

[0095] Furthermore, Cas proteins can be anchored to labeled nucleic acids. Such anchoring (i.e., physical linking) can be achieved through covalent or non-covalent interactions, and the anchoring can be direct (e.g., by direct fusion, or by chemical bonding achieved by modification of cysteine ​​or lysine residues of the protein or by intein modification), or through one or more intervening linker or adapter molecules such as streptavidin or aptamers. See, for example, Pierce et al. (2005) Mini Rev. Med. Chem. 5(1):41-55; Duckworth et al. (2007) Angew. Chem. Int. Ed. Engl. 46(46):8819-8822; Schaeffer and Dixon (2009) Australian J. Chem. 62(10):1328-1332; Goodman et al. (2009) Chembiochem. 10(9):1551-1557; and Khatwani et al. (2012) Bioorg. Med. Chem. 20(14):4532-4539, each of which is incorporated herein by reference in its entirety for all purposes. Examples of non-covalent strategies for synthesizing protein-nucleic acid conjugates include the biotin-streptavidin method and the nickel-histidine method. Covalent protein-nucleic acid conjugates can be synthesized by linking appropriately functionalized nucleic acids and proteins using a wide variety of chemistry methods. Some of these chemistry methods involve the direct addition of oligonucleotides to amino acid residues on the protein surface (e.g., lysine amine or cysteine ​​thiol), while other, more complex schemes require post-translational modification of the protein or the involvement of the protein's catalytic or reactive domain. Methods for covalently linking proteins to nucleic acids include, for example, chemical crosslinking of oligonucleotides with lysine or cysteine ​​residues of the protein, ligation of the protein to be expressed, chemienzymes, and the use of photoaptamers. Labeled nucleic acids can be anchored to the C-terminus, N-terminus, or internal regions within Cas proteins.In one example, the labeled nucleic acid is anchored to the C-terminus or N-terminus of the Cas protein. Similarly, the Cas protein can be anchored to its 5' end, 3' end, or an internal region within the labeled nucleic acid. That is, the labeled nucleic acid can be anchored in any orientation and polarity. For example, the Cas protein can be anchored to the 5' end or 3' end of the labeled nucleic acid.

[0096] The Cas protein can be provided in any form. For example, the Cas protein can be provided in the form of a Cas protein complexed with a protein, such as gRNA. Alternatively, the Cas protein can be provided in the form of a nucleic acid encoding the Cas protein, such as RNA (e.g., messenger RNA (mRNA)) or DNA. Optionally, the nucleic acid encoding the Cas protein can be codon-optimized to efficiently translate it into a protein in a specific cell or organism. For example, the nucleic acid encoding the Cas protein can be modified to substitute codons that are more frequently used than the native polynucleotide sequence in bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, or any other host cell of interest. When the nucleic acid encoding the Cas protein is introduced into cells, the Cas protein is expressed transiently, conditionally, or constitutively within the cell.

[0097] Cas proteins provided as mRNA can be modified to improve their stability and / or immunogenicity. Modifications can be made to one or more nucleosides within the mRNA. Examples of chemical modifications to mRNA nucleic acid bases include pseudouridine, 1-methylpsoiduridine, and 5-methylcytidine. For example, capped and polyadenylated Cas mRNA containing N1-methylpsoiduridine can be used. Similarly, Cas mRNA can be modified by removing uridine using synonymous codons.

[0098] The nucleic acid encoding the Cas protein can be stably incorporated into the cell's genome and operably linked to an active promoter within the cell. Alternatively, the nucleic acid encoding the Cas protein can be operably linked to the promoter of an expression construct. An expression construct includes any nucleic acid construct that can induce the expression of a gene or other nucleic acid sequence of interest (e.g., the Cas gene) and transfer such a nucleic acid sequence of interest into a target cell. For example, the nucleic acid encoding the Cas protein may be contained within a vector containing DNA encoding the gRNA. Alternatively, it may be contained within a separate vector or plasmid from the vector containing the DNA encoding the gRNA. Promoters that can be used in expression constructs include, for example, one or more active promoters from eukaryotic cells, human cells, non-human cells, mammalian cells, non-human mammalian cells, rodent cells, mouse cells, rat cells, pluripotent cells, embryonic stem (ES) cells, adult stem cells, developmentally restricted progenitor cells, induced pluripotent stem (iPS) cells, or one-cell stage embryos. Such promoters may be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Optionally, the promoter may be a bidirectional promoter that drives the expression of both the Cas protein in one direction and the guide RNA in the other direction. Such a bidirectional promoter may consist of 1) a complete conventional unidirectional Pol III promoter comprising three external regulatory elements: a distal sequence element (DSE), a proximal sequence element (PSE), and a TATA box, and 2) a second basic Pol III promoter comprising a TATA box fused in the opposite direction to the 5' ends of the PSE and DSE. For example, in the H1 promoter, the DSE is adjacent to the PSE and TATA box, and the promoter can be made bidirectional by creating a hybrid promoter that controls transcription in the reverse direction by adding a PSE and TATA box derived from the U6 promoter. See, for example, U.S. Patent No. 2016 / 0074535, which is incorporated herein by reference in its entirety for all purposes.By using bidirectional promoters, genes encoding Cas proteins and guide RNAs can be expressed simultaneously, creating a compact expression cassette that facilitates delivery.

[0099] B. Guide RNA Guide RNA is an RNA molecule that binds to a Cas protein (e.g., Cas9 protein) and targets the Cas protein to a specific location within target DNA. Exemplary bimolecular gRNAs include a crRNA-like molecule ("CRISPR RNA" or "targeter RNA" or "crRNA" or "crRNA repeat") and a corresponding tracrRNA-like molecule ("transactive CRISPR RNA" or "activator RNA" or "tracrRNA"). crRNAs include both the DNA targeting segment (single-stranded) of the gRNA and a set of nucleotides that form half of the dsRNA double helix of the protein-binding segment of the gRNA. An example of a crRNA tail positioned downstream (3') of the DNA targeting segment is GUUUUAGAGCUAUGCU (SEQ ID NO: 1), which is essentially derived from or consists of it. Any of the DNA targeting segments disclosed herein can bind to the 5' end of SEQ ID NO: 2 to form a crRNA.

[0100] The corresponding tracrRNA (activator RNA) contains a set of nucleotides that form the remaining half of the dsRNA double helix of the protein-binding segment of the gRNA. The nucleotides of the set of crRNA are complementary to the nucleotides of the set of tracrRNA and hybridize with the nucleotides of the set of tracrRNA to form the dsRNA double helix of the protein-binding domain of the gRNA. Therefore, it can be said that each crRNA has a corresponding tracrRNA. Examples of tracrRNA sequences include, essentially, or consist of one of the following: AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU (Sequence ID 3), AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Sequence ID 4), or GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (Sequence ID 5).

[0101] In systems requiring both crRNA and tracrRNA, the crRNA and its corresponding tracrRNA hybridize to form gRNA. In systems requiring only crRNA, the crRNA may be gRNA. The crRNA further provides a single-stranded DNA targeting segment that hybridizes to the complementary strand of the target DNA. When used for intracellular modification, the precise sequence of a particular crRNA or tracrRNA molecule may be designed to be species-specific to the RNA molecule being used. See, for example, Mali et al. (2013) Science 339 (6121): 823-826; Jinek et al. (2012) Science 337 (6096): 816-821; Hwang et al. (2013) Nat. Biotechnol. 31 (3): 227-229; Jiang et al. (2013) Nat. Biotechnol. 31 (3): 233-239 and Cong et al. (2013) Science 339 (6121): 819-823, each of which is incorporated herein in whole for all purposes by reference.

[0102] The DNA targeting segment (crRNA) of a particular gRNA contains a nucleotide sequence complementary to a sequence on the complementary strand of the target DNA, as will be described in more detail below. The DNA targeting segment of a gRNA interacts with the target DNA in a sequence-specific manner via hybridization (i.e., base pairing). Therefore, the nucleotide sequence of the DNA targeting segment can vary considerably, determining the location within the target DNA where the gRNA interacts with the target DNA. The DNA targeting segment of a target gRNA can be modified to hybridize to any desired sequence within the target DNA. Natural crRNAs, while varying between CRISPR / Cas systems and organisms, often contain a targeting segment of 21–72 nucleotides in length, flanked by two serial repeat sequences (DRs) between 21–46 nucleotides in length (see International Patent No. WO2014 / 131833, which is incorporated herein by reference in its entirety for all purposes). In the case of S. pyogenes, the DR is 36 nucleotides long and the targeting segment is 30 nucleotides long. The DR located at 3' is complementary to the corresponding tracrRNA, hybridizes with the corresponding tracrRNA, and then binds to the Cas protein.

[0103] DNA targeting segments can have lengths of, for example, at least about 12, 15, 17, 18, 19, 20, 25, 30, 35, or 40 nucleotides. Such DNA targeting segments can have lengths of, for example, about 12 to about 100, about 12 to about 80, about 12 to about 50, about 12 to about 40, about 12 to about 30, about 12 to about 25, or about 12 to about 20 nucleotides. For example, a DNA targeting segment may be about 15 to about 25 nucleotides (e.g., about 17 to about 20 nucleotides, or about 17, about 18, about 19, or about 20 nucleotides). See, for example, U.S. Patent 2016 / 0024523, which is incorporated herein by reference in its entirety for all purposes. In the case of Cas9 derived from S. pyogenes, typical DNA targeting segments have lengths between 16 and 20 nucleotides or between 17 and 20 nucleotides. For Cas9 derived from S. aureus, the typical DNA targeting segment is between 21 and 23 nucleotides long. For Cpf1, the typical DNA targeting segment is at least 16 nucleotides long or at least 18 nucleotides long.

[0104] TracrRNAs can be in any form (e.g., full-length tracrRNA or active-part tracrRNA) and can vary in length. They can include primary transcripts or processing forms. For example, a tracrRNA (as part of a single guide RNA or as a separate molecule as part of a bimolecular gRNA) may contain, be essentially, or be essentially of all or part of a wild-type tracrRNA sequence (e.g., about 20, 26, 32, 45, 48, 54, 63, 67, 85 or more nucleotides of a wild-type tracrRNA sequence). Examples of wild-type tracrRNA sequences from S. pyogenes include 171-nucleotide, 89-nucleotide, 75-nucleotide, and 65-nucleotide versions. See, for example, Deltcheva et al. (2011) Nature 471(7340):602-607, International Patent No. WO2014 / 093661, each of which is incorporated herein by reference in whole for all purposes. Examples of tracrRNA within a single guide RNA (sgRNA) include tracrRNAs found within the +48, ​​+54, +67, and +85 versions of the sgRNA, where "+n" indicates that the sgRNA contains up to +n nucleotides of the wild-type tracrRNA. See, for example, U.S. Patent No. 8,697,359, which is incorporated herein by reference in its entirety for all purposes.

[0105] The percentage of complementarity between the DNA targeting segment of the guide RNA and the complementary strand of the target DNA may be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%). The percentage of complementarity between the DNA targeting segment and the complementary strand of the target DNA may be at least 60% over approximately 20 consecutive nucleotides. As an example, the percentage of complementarity between the DNA targeting segment and the complementary strand of the target DNA may be approximately 100% over the 14 consecutive nucleotides at the 5' end of the complementary strand of the target DNA, and as low as 0% over the remainder. In such a case, the DNA targeting segment can be considered to be 14 nucleotides long. As another example, the degree of complementarity between the DNA targeting segment of the target DNA and its complementary strand may be approximately 100% over the seven consecutive nucleotides at the 5' end of the complementary strand of the target DNA, and as low as 0% over the remainder. In such a case, the DNA targeting segment can be considered to be 7 nucleotides long. In some guide RNAs, at least approximately 17 nucleotides within the DNA targeting segment are complementary to the complementary strand of the target DNA. For example, the DNA targeting sequence may be approximately 20 nucleotides long and may contain one, two, or three mismatches with respect to the complementary strand of the target DNA. In one example, the mismatch is not adjacent to a region of the complementary strand corresponding to the protospacer adjacency motif (PAM) sequence (i.e., the reverse complement of the PAM sequence) (for example, the mismatch is at the 5' end of the DNA targeting segment of the guide RNA, or the mismatch is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 base pairs away from the region of the complementary strand corresponding to the PAM sequence).

[0106] The protein-binding segment of a gRNA can contain two sets of complementary nucleotides. These complementary nucleotides hybridize to form a double-stranded RNA (dsRNA). The protein-binding segment of a target gRNA interacts with a Cas protein, and the gRNA guides the bound Cas protein to a specific nucleotide sequence within target DNA via its DNA-targeting segment.

[0107] A single guide RNA may include a DNA targeting segment and a scaffold sequence (i.e., a protein-binding or Cas-binding sequence of the guide RNA). For example, such a guide RNA may have a 5' DNA targeting segment bound to a 3' scaffold sequence. An example of a scaffolding arrangement is GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (version 1, sequence number 6);GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (version 2, sequence number 7);GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (version 3, sequence number 8) and GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAG UGGCACCGAGUCGGUGC(version 4, sequence number 9);GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAGUGGCACCGAGUCGGUGCUUUUUUU(version 5, sequence number 10);GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAGUGGCACCGAGUCGGUGCUUUU(version 6, sequence number 11) or GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU(version 7, sequence number 12), essentially consisting of, or comprising, the above. A guide RNA that targets any of the guide RNA target sequences disclosed herein may include, for example, a DNA targeting segment on the 5' end of the guide RNA fused to one of the exemplary guide RNA scaffold sequences on the 3' end of the guide RNA.In other words, any of the DNA targeting segments disclosed herein can be bound to the 5' end of any one of the above-mentioned scaffold sequences to form a single guide RNA (chimeric guide RNA).

[0108] Guide RNA may contain modifications or sequences that provide additional desirable features (e.g., altered or regulated stability, intracellular targeting, fluorescent tracking, or binding sites to proteins or protein complexes). Examples of such modifications include, for example, 5' caps (e.g., 7-methylguanylate caps (m7G)), 3' polyadenylated tails (i.e., 3' poly(A) tails), riboswitch sequences (e.g., to enable regulated stability and / or regulated accessibility by proteins and / or protein complexes), stability control sequences, sequences that form dsRNA double helixes (i.e., hairpins), modifications or sequences that target RNA to intracellular locations (e.g., nucleus, mitochondria, chloroplasts, etc.), modifications or sequences that provide tracking (e.g., direct binding to fluorescent molecules, binding to regions that facilitate fluorescence detection, sequences that enable fluorescence detection, etc.), modifications or sequences that provide binding sites to proteins (e.g., DNA-acting proteins, including transcription activators, transcription repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, etc.), and combinations thereof. Other examples of modifications include engineered stem-loop double helix structures, engineered bulge regions, engineered hairpin 3' of stem-loop double helix structures, or any combination thereof. See, for example, U.S. Patent No. 2015 / 0376586, which is incorporated herein by reference in its entirety for all purposes. A bulge can be an unpaired region of nucleotides within a double helix, comprising a crRNA-like region and a minimal tracrRNA-like region. A bulge may include an unpaired 5'-XXXY-3' region on one side of the double helix (wherein X is any purine and Y is a nucleotide capable of forming a fluctuation pair with a nucleotide on the opposing strand) and an unpaired nucleotide region on the other side of the double helix.

[0109] In some cases, a transcriptional activation system containing a dCas9-VP64 fusion protein paired with MS2-p65-HSF1 can be used. The guide RNA for such a system can be designed using a stem-loop 2, which is designed to bind an aptamer sequence attached to an sgRNA tetraloop to a dimerized MS2 bacteriophage coat protein. See, for example, Konermann et al. (2015) Nature 517(7536):583-588, which is incorporated herein by reference in its entirety for all purposes.

[0110] Unmodified nucleic acids may be more susceptible to degradation. Exogenous nucleic acids can also induce an innate immune response. Modifications can help introduce stability and reduce immunogenicity. Guide RNAs can include modified nucleosides and modified nucleotides, for example, including one or more of the following modifications: (1) alteration or substitution of one or both of the unbound phosphate oxygen and / or bound phosphate oxygen in phosphodiester backbone linkages; (2) alteration or substitution of components of ribose sugars, such as alteration or substitution of the 2' hydroxyl of ribose sugar; (3) substitution of the phosphate moiety with a dephosphorylating linker; (4) alteration or substitution of native nucleic acid bases; (5) substitution or modification of the ribose-phosphate backbone; (6) alteration of the 3' or 5' end of oligonucleotides (e.g., removal, modification or substitution of terminal phosphate groups, or site conjugation); and (7) alteration of sugars. Other possible guide RNA modifications include alteration or substitution of uracil or polyuracil tracts. See, for example, International Patent No. 2015 / 048577 and U.S. Patent No. 2016 / 0237455, each of which is incorporated herein by reference in its entirety for all purposes. Similar modifications can be made to nucleic acids encoding Cas, such as Cas mRNA.

[0111] As an example, the 5' or 3' terminal nucleotides of guide RNA may contain phosphorothioate bonds (for example, the base may have a modified phosphate group which is a phosphorothioate group). For example, guide RNA may contain phosphorothioate bonds between the 2, 3, or 4 terminal nucleotides of the 5' or 3' terminal of guide RNA. Another example is that the 5' and / or 3' terminal nucleotides of guide RNA may have 2'-O-methyl modifications. For example, guide RNA may have 2'-O-methyl modifications on the 2, 3, or 4 terminal nucleotides of the 5' and / or 3' terminal (e.g., the 5' terminal). See, for example, International Patent No. WO2017 / 173054A1 and Finn et al. (2018) Cell Rep. 22(9):2227-2235, each of which is incorporated herein by reference in whole for all purposes.

[0112] Guide RNA can be provided in any form. For example, gRNA can be provided in the form of either two RNA molecules (separate crRNA and tracrRNA) or one RNA molecule (sgRNA), and optionally in the form of a complex with a Cas protein. gRNA can also be provided in the form of DNA encoding gRNA. DNA encoding gRNA can encode a single RNA molecule (sgRNA) or separate RNA molecules (e.g., separate crRNA and tracrRNA). In the latter case, the DNA encoding gRNA can be provided as a single DNA molecule or as separate DNA molecules encoding crRNA and tracrRNA, respectively.

[0113] When gRNA is provided in DNA form, the gRNA can be expressed in cells transiently, conditionally, or constitutively. The DNA encoding the gRNA can be stably incorporated into the cell's genome and operably ligated to an active promoter in the cell. Alternatively, the DNA encoding the gRNA can be operably ligated to the promoter of an expression construct. For example, the DNA encoding the gRNA may be in a vector containing heterologous nucleic acids, such as the nucleic acid encoding the Cas protein. Alternatively, it may be in a separate vector or plasmid from the vector containing the nucleic acid encoding the Cas protein. Promoters that can be used for such expression constructs include, for example, one or more active promoters from eukaryotic cells, human cells, non-human cells, mammalian cells, non-human mammalian cells, rodent cells, mouse cells, rat cells, pluripotent cells, embryonic stem (ES) cells, adult stem cells, developmentally restricted progenitor cells, induced pluripotent stem (iPS) cells, or one-cell stage embryos. Such promoters may be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Such promoters may also be, for example, bidirectional promoters. Specific examples of appropriate promoters include RNA polymerase III promoters, such as the human U6 promoter, the rat U6 polymerase III promoter, or the mouse U6 polymerase III promoter.

[0114] Alternatively, gRNA can be prepared by a variety of other methods. For example, gRNA can be prepared by in vitro transcription using T7 RNA polymerase (see, for example, International Patent Nos. WO2014 / 089290 and WO2014 / 065596, each of which is incorporated herein by reference in whole for all purposes). Guide RNA can also be a synthetically produced molecule prepared by chemical synthesis.

[0115] Guide RNA (or nucleic acid encoding guide RNA) may be contained in a composition comprising one or more guide RNAs (e.g., 1, 2, 3, 4 or more guide RNAs) and a carrier that enhances the stability of the guide RNA (e.g., extending the period during which degradation products remain below a threshold (e.g., less than 0.5% by weight of the starting nucleic acid or protein) under given storage conditions (e.g., -20°C, 4°C, or ambient temperature), or increasing in vivo stability). Non-limiting examples of such carriers include poly(lactic acid) (PLA) microspheres, poly(D,L-lactic acid-coglycolic acid) (PLGA) microspheres, liposomes, micelles, reverse micelles, lipid cocreates, and lipid microtubules. Such compositions may further contain Cas proteins, such as Cas9 protein, or nucleic acids encoding Cas proteins.

[0116] C. Guide RNA target sequence The target DNA of a guide RNA includes nucleic acid sequences present on the DNA to which the gRNA's DNA-targeting segment binds, provided sufficient binding conditions are present. Suitable DNA / RNA binding conditions include physiological conditions normally present in cells. Other suitable DNA / RNA binding conditions (e.g., conditions in cell-free systems) are known in the art (see, for example, Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001), which is incorporated herein by reference in its entirety for all purposes). A strand of target DNA that is complementary to and hybridizes with the gRNA can be called the “complementary strand,” and a strand of target DNA complementary to the “complementary strand” (and therefore not complementary to the Cas protein or gRNA) can be called the “non-complementary strand” or “template strand.”

[0117] The target DNA includes both the sequence on the complementary strand into which the guide RNA hybridizes and the corresponding sequence on the non-complementary strand (e.g., adjacent to a protospacer fringe motif (PAM)). The guide RNA is designed to be complementary to the complementary strand of the target DNA, and hybridization between the DNA-targeting segment of the guide RNA and the complementary strand of the target DNA promotes the formation of the CRISPR complex. Perfect complementarity is not necessarily required, as long as there is sufficient complementarity to induce hybridization and promote the formation of the CRISPR complex. When the guide RNA is referred to herein as targeting a guide RNA target sequence, it means that the guide RNA hybridizes to the complementary strand sequence of the target DNA, which is the reverse complementary strand of the guide RNA target sequence on the non-complementary strand.

[0118] The target DNA or guide RNA target sequence may contain any polynucleotide and may be located, for example, in the nucleus or cytoplasm of a cell, or within a cellular organelle such as a mitochondria or chloroplast. The target DNA or guide RNA target sequence may be any nucleic acid sequence that is endogenous or exogenous to the cell. The guide RNA target sequence may be a sequence that codes for a gene product (e.g., a protein), a non-coding sequence (e.g., a regulatory sequence), or both.

[0119] The target sequence of a DNA-binding protein (e.g., a guide RNA target sequence) can be anywhere within an autophagy gene (e.g., the autophagy genes listed in Table 1) or an NF-κB gene (e.g., the NF-κB genes listed in Table 2) that is suitable for modifying the expression of the target gene. In one example, the target sequence may be located within or close to a regulatory element such as an enhancer or promoter. For example, the target sequence may contain or be close to the start codon of an autophagy gene (e.g., the autophagy genes listed in Table 1) or an NF-κB gene (e.g., the NF-κB genes listed in Table 2). For example, the target sequence may be within approximately 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon.

[0120] Site-specific binding and cleavage of target DNA by the Cas protein can occur at a location determined by both i) base pair complementarity between the guide RNA and the corresponding complementary strand of the target DNA, and ii) a short motif called a protospacer adjacency motif (PAM) within the non-complementary strand of the target DNA. The PAM can be adjacency of the guide RNA target sequence. Optionally, the guide RNA target sequence can be adjacency of the 3' end by the PAM (e.g., in the case of Cas9). Alternatively, the guide RNA target sequence can be adjacency of the 5' end by the PAM (e.g., in the case of Cpf1). For example, the cleavage site of the Cas protein can be approximately 1 to 10 or 2 to 5 base pairs (e.g., 3 base pairs) upstream or downstream of the PAM sequence (e.g., within the guide RNA target sequence). In the case of SpCas9, the PAM sequence (i.e., on the non-complementary strand) could be 5'-N1GG-3', where N1 is any DNA nucleotide, and the PAM is the 3' end immediately adjacent to the guide RNA target sequence on the non-complementary strand of the target DNA. Therefore, the sequence corresponding to the PAM of the complementary strand (i.e., the reverse complementary strand) is 5'-CCN2-3', where N2 is any DNA nucleotide and is the 5' end of the sequence that the DNA targeting segment of the guide RNA hybridizes on the complementary strand of the target DNA. In some such cases, N1 and N2 can be complementary, and the N1-N2 base pair can be any base pair (e.g., N1=C and N2=G, N1=G and N2=C, N1=A and N2=T, or N1=T and N2=A). For Cas9 from S. aureus, the PAM can be NNGRRT or NNGRR, where N can be A, G, C, or T, and R can be G or A. For Cas9 from C. jejuni, the PAM can be, for example, NNNNACAC or NNNNRYAC, where N can be A, G, C, or T, and R can be G or A. In some cases (for example, in the case of FnCpf1), the PAM sequence may be upstream of the 5' end and may have the sequence 5'-TTN-3'.

[0121] An example of a guide RNA target sequence is a 20-nucleotide DNA sequence immediately preceding the NGG motif recognized by the SpCas9 protein. For example, two examples of guide RNA target sequences + PAM are GN 19 NGG (SEQ ID NO: 13) or N 20 This is NGG (SEQ ID NO: 14). See, for example, International Patent No. WO2014 / 165825, which is incorporated herein by reference in its entirety for all purposes. The guanine at the 5' end can promote transcription by RNA polymerase in cells. Another example of a guide RNA target sequence + PAM is two guanine nucleotides at the 5' end (e.g., GGN) to promote efficient transcription by T7 polymerase in vitro. 20 This may include NGG (Sequence ID 15). See, for example, International Patent No. WO2014 / 065596, which is incorporated herein by reference in its entirety for all purposes. Other guide RNA target sequences + PAMs may have nucleotide lengths between 4 and 22, including 5'G or GG and 3'GG or NGG. Further other guide RNA target sequences + PAMs may have nucleotide lengths between 14 and 20. Exemplary sgRNA sequences include, but are not limited to, Sequence IDs 17-38, 40-41, 43, 48 and 50-55.

[0122] The formation of a CRISPR complex hybridized to target DNA can result in a cleavage of one or both strands of the target DNA within or near the region corresponding to the guide RNA target sequence (i.e., the guide RNA target sequence on the non-complementary strand of the target DNA, and the reverse complementary strand on the complementary strand into which the guide RNA hybridizes). For example, the cleavage site may be within the guide RNA target sequence (e.g., a position defined relative to the PAM sequence). The “cleavage site” includes the location on the target DNA where the Cas protein produces a single-strand or double-strand break. The cleavage site may be on only one strand of the double-stranded DNA (e.g., when using nickase) or on both strands. The cleavage site may be at the same location on both strands (producing a blunt end, e.g., Cas9) or at different locations on each strand (producing a twisted end (i.e., an overhang), e.g., Cpf1). A twisted end can be produced, for example, by using two Cas proteins, each producing a single-strand break at a different cleavage site on different strands, thereby producing a double-strand break. For example, a first nickase can create a single-strand break on the first strand of double-stranded DNA (dsDNA), and a second nickase can create a single-strand break on the second strand of dsDNA so that an overhang sequence is created. In some cases, the guide RNA target sequence or cleavage site of the nickase on the first strand is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, 250, 500, or 1,000 base pairs away from the guide RNA target sequence or cleavage site of the nickase on the second strand.

[0123] Additional gene modifiers In some embodiments, the agents disclosed herein are agents for genome editing other than the CRISPR / Cas system. DNA deletion can be performed using gene therapy that knocks out or disrupts a target gene. Knockout may be gene knockdown, or the gene may be knocked out by mutations using techniques known in the art, such as point mutations, insertions, deletions, frameshifts, or missense mutations, including but not limited to retroviral gene introduction. In some embodiments, the agent is a nuclease (e.g., zinc finger nuclease or TALEN) effective in binding to and modifying at least one of the genes disclosed herein (e.g., an autophagy gene such as the autophagy gene disclosed herein, or an NF-κB gene such as the NF-κB gene disclosed herein).

[0124] Any nuclease agent that induces a nick or double-strand break at a desired target sequence, or any DNA-binding protein that binds to a desired target sequence, can be used in the methods and compositions disclosed herein. Natural or native nuclease agents can be used insofar as they induce a nick or double-strand break at a desired target sequence. Similarly, natural or native DNA-binding proteins can be used insofar as they bind to a desired target sequence. Alternatively, modified or altered nuclease agents or DNA-binding proteins can be used. "Altered nuclease agents or DNA-binding proteins" include nuclease agents or DNA-binding proteins that have been modified (modified or induced) from their native form to specifically recognize a desired target sequence. Thus, altered nuclease agents or DNA-binding proteins may be derived from native natural nuclease agents or DNA-binding proteins, or they may be artificially created or synthesized. Modified nucleases or DNA-binding proteins can recognize target sequences, for example, in which case the target sequence is not a sequence that would be recognized by a native (unmodified) nuclease or DNA-binding protein. Modification of a nuclease or DNA-binding protein can be as simple as a single amino acid in a protein cleavage agent or a single nucleotide in a nucleic acid cleavage agent. Causing a nick or double-strand break in a target sequence or other DNA may be referred to herein as “cutting” or “cleaving” the target sequence or other DNA.

[0125] Active variants and fragments of nucleases or DNA-binding proteins (i.e., modified nucleases or DNA-binding proteins) are also provided. Such active variants have at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the natural nuclease or DNA-binding protein, and the active variants retain the ability to cleave at a desired target sequence, and thus retain nick or double-strand break inducing activity, or retain the ability to bind to a desired target sequence. For example, any of the nucleases described herein can be modified from a natural endonuclease sequence and designed to recognize and induce nicks or double-strand breaks at a target sequence not recognized by the natural nuclease. Thus, some modified nucleases have specificity to induce nicks or double-strand breaks at a target sequence different from the corresponding natural nuclease target sequence. Assays for nicks or double-strand break-inducing activity are known and generally measure the overall activity and specificity of an endonuclease on a DNA substrate containing a target sequence. The target sequence may be endogenous (or native) to the cell, or it may be exogenous. Exogenous target sequences are not naturally present in the cell's genome. A target sequence may also be exogenous to the polynucleotide of interest that it wishes to locate at a target locus. In some cases, the target sequence exists at only one location in the host cell's genome.

[0126] Active variants and fragments of exemplary target sequences are also provided. Such active variants have at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity with respect to a given target sequence, and the active variants retain biological activity and can therefore be recognized and cleaved in a sequence-specific manner by nuclease agents. Assays for measuring double-strand breaks of target sequences by nuclease agents are known (e.g., the TAQMAN® qPCR assay, Frendewey et al. (2010) Methods in Enzymology 476:295-307, which is incorporated herein by reference in its entirety for all purposes).

[0127] Target sequences can vary in length, but examples include target sequences of approximately 30–36 bp (i.e., approximately 15–18 bp for each ZFN) for zinc finger protein or zinc finger nuclease (ZFN) pairs, approximately 36 bp for activator-like effector (TALE) protein or activator-like effector nuclease (TALEN), or approximately 20 bp for CRISPR / Cas9 guide RNA.

[0128] The target sequence of a DNA-binding protein or nuclease can be located anywhere within or near the target genomic locus. The target sequence can be located within the gene's coding region or within a regulatory region that affects gene expression. The target sequence of a DNA-binding protein or nuclease can be located in an intron, exon, promoter, enhancer, regulatory region, or any non-protein-coding region.

[0129] One type of DNA-binding protein that can be used in the various methods and compositions disclosed herein is a transcription activator-like effector (TALE). TALEs can be fused to or ligated to, for example, an epigenetic modification domain, a transcription activating domain, or a transcription repressor domain. Examples of such domains are described below with respect to Cas proteins and can also be found, for example, in International Patent No. WO2011 / 145121, which is incorporated herein by reference in whole for all purposes. Correspondingly, one type of nuclease that can be used in the various methods and compositions disclosed herein is a transcription activator-like effector nuclease (TALEN). TAL effector nucleases are a class of sequence-specific nucleases that can be used to perform double-strand breaks at specific target sequences in the genomes of prokaryotes or eukaryotes. TAL effector nucleases are created by fusing a native or modified transcription activator-like (TAL) effector, or its functional portion, to the catalytic domain of an endonuclease such as FokI. The unique modular TAL effector DNA-binding domain enables the design of proteins with potentially arbitrary DNA recognition specificity. Therefore, the DNA-binding domain of a TAL effector nuclease can be designed to recognize a specific DNA target site and thus used to perform double-strand breaks at a desired target sequence. See International Patent No. WO2010 / 079430; Morbitzer et al. (2010) Proc. Natl. Acad. Sci. USA 107 (50:21617-21622); Scholze & Boch (2010) Virulence 1:428-432; Christian et al. (2010) Genetics 186:757-761; Li et al. (2011) Nucleic Acids Res. 39(1):359-372; and Miller et al. (2011) Nature Biotechnology 29:143-148, each of which is incorporated herein by reference in its entirety for all purposes.

[0130] Using the nonspecific DNA cleavage domain from the terminal of the FokI endonuclease, hybrid nucleases active in yeast assays can be constructed. These reagents are also active in plant and animal cells. The FokI domain functions as a dimer, requiring two constructs with DNA-binding domains specific to a site in the target genome, with appropriate orientation and spacing. Both the number of amino acid residues between the TALEN DNA-binding domain and the FokI cleavage domain, and the number of bases between the two individual TALEN binding sites, are parameters for achieving high levels of activity. The number of amino acid residues between the TALEN DNA-binding domain and the FokI cleavage domain can be modified by introducing a spacer (different from the spacer sequence) between multiple TAL effector repeat sequences and the FokI endonuclease domain. The spacer sequence can be 12–30 nucleotides.

[0131] The relationship between amino acid sequences and DNA recognition by TALEN-binding domains enables the design of proteins. In this case, artificial gene synthesis presents problems due to improper annealing of repetitive sequences found in TALEN-binding domains. One solution to this is to use publicly available software programs (DNAWorks) to calculate suitable oligonucleotides for assembly in two-step PCR, oligonucleotide assembly, and subsequent whole-gene amplification. Numerous modular assembly schemes for generating manipulated TALEN constructs have also been reported. Both methods offer a systematic approach to manipulating DNA-binding domains, conceptually similar to modular assembly methods for generating zinc finger DNA recognition domains.

[0132] Once TALEN genes are assembled, they are inserted into plasmids. The plasmids are then used to transfect target cells that express the gene product, allowing it to enter the nucleus and access the genome. TALENs can be used to edit genomes by inducing double-strand breaks (DSBs) in which cells respond through repair mechanisms.

[0133] Examples of suitable TAL nucleases and methods for preparing suitable TAL nucleases refer, for example, to U.S. Patents 2011 / 0239315A1, 2011 / 0269234A1, 2011 / 0145940A1, 2003 / 0232410A1, 2005 / 0208489A1, 2005 / 0026157A1, 2005 / 0064474A1, 2006 / 0188987A1, and 2006 / 0063231A1, each of which is incorporated herein by reference in its entirety for all purposes. In various embodiments, the TAL effector nuclease is designed, for example, to cleave a target nucleic acid sequence or its vicinity at a genomic locus of interest, where the target nucleic acid sequence is located near or adjacent to the sequence to be modified.

[0134] In some TALENs, each monomer of the TALEN contains 33–35 TAL repeats that recognize a single base pair via two hypervariable residues. In some TALENs, the nuclease is a chimeric protein containing a TAL repeat-based DNA-binding domain operably linked to an independent nuclease, such as FokI endonuclease. For example, the nuclease may contain a first TAL repeat-based DNA-binding domain and a second TAL repeat-based DNA-binding domain, each of which is operably linked to a FokI nuclease. The first and second TAL repeat-based DNA-binding domains recognize two adjacent target DNA sequences in each strand of a target DNA sequence separated by spacer sequences of varying lengths (12–20 bp), and the FokI nuclease subunit dimerizes to produce an active nuclease that performs double-strand breaks at the target sequences.

[0135] Transcription activator-like effector nucleases (TALENs) are artificial restriction enzymes produced by fusing a TAL effector DNA-binding domain to a DNA-cleaving domain. These reagents enable efficient, programmable, and specific DNA cleavage, making them a powerful tool for in situ genome editing. Transcription activator-like effectors (TALENs) can be rapidly manipulated to bind to virtually any DNA sequence. As used herein, the term TALEN is broad and includes monomeric TALENs that can cleave double-stranded DNA without the assistance of another TALEN. The term TALEN is also used to refer to one or both members of a pair of TALENs that have been manipulated to cooperate in cleaving DNA at the same site. TALENs working together are sometimes referred to as left TALENs and right TALENs, which refer to the DNA's dominant hand. See U.S. Patent Nos. 12 / 965,590, 13 / 426,991 (U.S. Patent No. 8,450,471), 13 / 427,040 (U.S. Patent No. 8,440,431), 13 / 427,137 (U.S. Patent No. 8,440,432), and 13 / 738,381, all of which are incorporated herein by reference in their entirety.

[0136] Another example of a DNA-binding protein is the zinc finger protein. Such zinc finger proteins can be ligated to or fused to, for example, an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repressor domain. Examples of such domains are described below with respect to the Cas protein and can also be found, for example, in International Patent No. WO2011 / 145121, which is incorporated herein by reference in whole for all purposes. Correspondingly, another example of a nuclease agent that can be used in the various methods and compositions disclosed herein is the zinc finger nuclease (ZFN). In some ZFNs, each monomer of the ZFN contains three or more zinc finger-based DNA-binding domains, each zinc finger-based DNA-binding domain binding to a 3 bp subdomain. In other ZFNs, the ZFN is a chimeric protein containing a zinc finger-based DNA-binding domain operably ligated to an independent nuclease, such as FokI endonuclease. For example, the nuclease agent may contain a first ZFN and a second ZFN, each of which is operably linked to a FokI nuclease subunit. The first and second ZFNs recognize two adjacent target DNA sequences on each strand of the target DNA sequence separated by a spacer of approximately 5-7 bp, and the FokI nuclease subunit dimerizes to produce an active nuclease that performs double-strand breaks. For example, see U.S. Patent Nos. 2006 / 0246567, 2008 / 0182332, 2002 / 0081614, 2003 / 0021776, International Patent No. WO2002 / 057308A2, U.S. Patent Nos. 2013 / 0123484, 2010 / 0291048, International Patent No. WO2011 / 017293A2, and Gaj et al. (2013) Trends in Biotechnology 31(7):397-405, each of which is incorporated herein by reference in its entirety for all purposes.

[0137] Interfering nucleic acid agents In certain embodiments, interfering nucleic acid molecules that selectively target and inhibit the activity or expression of autophagy or NF-κB gene products (e.g., mRNA products) (e.g., genes listed in Table 1 or Table 2) are used in the methods provided herein and / or the methods described herein. In some embodiments, the interfering nucleic acid induces cytotoxicity in cells expressing the product of at least one autophagy gene or at least one NF-κB gene (e.g., genes listed in Table 1 or Table 2). The agent may inhibit the expression or activity of the product (e.g., mRNA product) of at least one autophagy gene or at least one NF-κB gene by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%. The agents disclosed herein may have at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementarity to the product (e.g., mRNA product) of at least one autophagy gene or at least one NF-κB gene.

[0138] In some embodiments, interfering nucleic acids are siRNA, shRNA, PNA, or miRNA molecules. Interfering nucleic acids generally contain a sequence of cyclic subunits that form an oligomeric heteroduplex within the target sequence, each having a base-pairing portion linked by an inter-subunit bond that allows the base-pairing portion to hybridize to a target sequence in the nucleic acid (usually RNA) by Watson-Crick base-pairing. Interfering RNA molecules include, but are not limited to, antisense molecules, siRNA molecules, single-stranded siRNA molecules, miRNA molecules, and shRNA molecules.

[0139] Typically, at least 17, 18, 19, 20, 21, 22, or 23 nucleotides of the complement of the target mRNA sequence are sufficient to mediate the inhibition of the target transcript. Complete complementation is not required. In some embodiments, the interfering nucleic acid molecule is double-stranded RNA. The double-stranded RNA molecule may have a 2-nucleotide 3' overhang. In some embodiments, the two RNA strands are joined via a hairpin structure to form an shRNA molecule. The shRNA molecule may contain a hairpin derived from a microRNA molecule. For example, an RNAi vector can be constructed by cloning an interfering RNA sequence into a pCAG-miR30 construct containing a hairpin derived from miR30 miRNA. The RNA interfering molecule may contain DNA residues as well as RNA residues.

[0140] The interfering nucleic acid molecules provided herein may include RNA bases, non-RNA bases, or mixtures of RNA and non-RNA bases. For example, the interfering nucleic acid molecules provided herein may consist mainly of RNA bases, but may also include DNA bases or nucleotides that do not exist in nature.

[0141] Interfering nucleic acids can utilize a variety of oligonucleotide chemicals. Examples of oligonucleotide chemicals include, but are not limited to, peptide nucleic acids (PNAs), linked nucleic acids (LNAs), phosphorothioates, 2'O-Me modified oligonucleotides, and morpholino chemicals (including any combination of the above). Generally, PNAs and LNAs have relatively higher target binding strengths compared to 2'O-Me oligonucleotides, allowing for the use of shorter targeting sequences. Phosphothioates and 2'O-Me modified chemicals are often combined to produce 2'O-Me modified oligonucleotides with a phosphorothioate backbone. See, for example, PCT Publications WO / 2013 / 112053 and WO / 2009 / 008725, which are incorporated in their entirety by reference.

[0142] Peptide nucleic acids (PNAs) are DNA analogs with a deoxyribose backbone that is structurally homologous, consisting of N-(2-aminoethyl)glycine units bonded to pyrimidines or purine bases. PNAs containing natural pyrimidines and purine bases hybridize to complementary oligonucleotides according to the Watson-Crick base pairing rules, mimicking DNA in terms of base pair recognition (Egholm, Buchardt et al. 1993). Because the PNA backbone is formed by peptide bonds rather than phosphodiester bonds, it is suitable for antisense applications (see structure below). The backbone is uncharged, resulting in PNA / DNA or PNA / RNA double helixes that exhibit superior thermal stability compared to conventional PNAs. PNAs are not recognized by nucleases or proteases.

[0143] Despite fundamental structural changes from its natural structure, PNA is capable of helical sequence-specific binding to DNA or RNA. Features of PNA include high binding affinity to complementary DNA or RNA, destabilization effects caused by single-nucleotide mismatches, resistance to nucleases and proteases, salt-independent hybridization with DNA or RNA, and triple-strand formation with homopurine DNA. PANAGENE® has developed a proprietary BtsPNA monomer (Bts, benzothiazole-2-sulfonyl group) and a proprietary oligomerization process. PNA oligomerization using the BtsPNA monomer consists of repeated cycles of deprotection, coupling, and capping. PNA can be synthesized using any technique known in the art. See, for example, U.S. Patent Nos. 6,969,766, 7,211,668, 7,022,851, 7,125,994, 7,145,006 and 7,179,896. Also, for the preparation of PNA, see U.S. Patent Nos. 5,539,082, 5,714,331 and 5,719,262. Further teachings on PNA compounds can be found in Nielsen et al, Science, 254:1497-1500, 1991. Each of the above is incorporated in whole by reference.

[0144] Interfering nucleic acids may also contain “locked nucleic acid” subunits (LNAs). LNAs are a type of modification called cross-linked nucleic acids (BNAs). BNAs are characterized by covalent bonds that lock the ribose ring structure to a C30-end (northern) sugar packer. In the case of LNAs, the cross-linking consists of methylene groups between the 2'-O and 4'-C positions. LNAs enhance the pre-organization and base stacking of the skeleton, thereby improving hybridization and thermal stability.

[0145] The structure of LNA can be found, for example, in Wengel, et al., Chemical Communications (1998) 455; Tetrahedron (1998) 54:3607, and Accounts of Chem. Research (1999) 32:301; Obika, et al., Tetrahedron Letters (1997) 38:8735; (1998) 39:5401 and Bioorganic Medicinal Chemistry (2008) 16:9230. The compounds provided herein may incorporate one or more LNA, and in some cases, the compounds may consist entirely of LNA. Methods for the synthesis of individual LNA nucleoside subunits and their incorporation into oligonucleotides are described, for example, in U.S. Patents 7,572,582, 7,569,575, 7,084,125, 7,060,809, 7,053,207, 7,034,133, 6,794,499 and 6,670,461, each of which is incorporated in whole by reference. Typical intersubunit linkers include phosphodiester and phosphorothioate moieties. Alternatively, phosphorus-free linkers can be used. One embodiment is an LNA-containing compound in which each LNA subunit is separated by a DNA subunit. A particular compound consists of alternating LNA subunits and DNA subunits, with the intersubunit linker being a phosphorothioate.

[0146] Phosphothioates (or S-oligonucleotides) are variants of normal DNA in which one of the uncrosslinked oxygen atoms is replaced by sulfur. Sulfurization of internucleotide bonds reduces the activity of endonucleases and exonucleases, including DNA POL1 exonuclease, nucleases S1 and P1, RNase, serum nuclease, and snake venom phosphodiesterase, at the 5'-to-3' and 3'-to-5' ends. Phosphothioates are produced by two main pathways: by reacting a solution of elemental sulfur in carbon disulfide with hydrogen phosphonate, or by sulfurizing triestite phosphate with tetraethylthiuram disulfide (TETD) or 3H-1,2-benzoditiol-3-one 1,1-dioxide (BDTD) (see, e.g., Iyer et al., J. Org. Chem. 55, 4693-4699, 1990). The latter method avoids the problem that elemental sulfur is insoluble in most organic solvents, as well as the toxicity of carbon disulfide. The TETD and BDTD methods also yield phosphorothioates of higher purity.

[0147] "2'O-Me oligonucleotide" molecules have a methyl group at the 2'-OH residue of a ribose molecule. 2'-O-Me-RNA exhibits the same (or similar) behavior as DNA but is protected from nuclease degradation. 2'-O-Me-RNA can also be combined with phosphothioate oligonucleotides (PTOs) for further stabilization. 2'O-Me oligonucleotides (phosphodiesters or phosphothioates) can be synthesized according to the usual techniques in the art (see, for example, Yoo et al., Nucleic Acids Res. 32:2008-16, 2004).

[0148] The interfering nucleic acids described herein may be brought into contact with cells or administered to organisms (e.g., humans). Alternatively, constructs and / or vectors encoding interfering RNA molecules may be brought into contact with or introduced into cells or organisms. In certain embodiments, viruses, retroviruses, or lentiviral vectors are used. In some embodiments, the vector has tropism towards cardiac tissue. In some embodiments, the vector is an adeno-associated virus.

[0149] In one embodiment, the interfering nucleic acid molecule is an siRNA molecule. Such an siRNA molecule should contain a region that has sufficient homology to the target region and should be of sufficient length with respect to nucleotides, so that the siRNA molecule can downregulate the target RNA. The terms “ribonucleotide” or “nucleotide” may also refer to the modified nucleotide or substitution site at one or more positions in the case of modified RNA or nucleotide substitutes. There does not need to be perfect complementarity between the siRNA molecule and the target, but there needs to be sufficient correspondence so that the siRNA molecule can induce sequence-specific silencing, such as by RNAi cleavage of the target RNA. In some embodiments, the sense strand only needs to be sufficiently complementary to the antisense strand in order to maintain the overall double-stranded nature of the molecule.

[0150] Furthermore, siRNA molecules may be modified or may contain nucleoside substitutes. Single-stranded regions of siRNA molecules may be modified or may contain nucleoside substitutes, for example, unpaired regions or hairpin-structured regions, such as regions linking two complementary regions, may have modifications or nucleoside substitutes. Modifications to stabilize one or more 3' or 5' ends of an siRNA molecule with respect to an exonuclease, or modifications to facilitate entry of antisense siRNA agents into RISC, may also be useful. Modifications may include C3 (or C6, C7, C12) aminolinkers, thiol linkers, carboxyl linkers, non-nucleotide spacers (C3, C6, C9, C12, debase, triethylene glycol, hexaethylene glycol), and special biotin or fluorescein reagents having a phosphoramidite and another DMT-protected hydroxyl group, enabling multiple couplings during RNA synthesis.

[0151] Non-limiting examples of shRNA include double-stranded polynucleotide molecules assembled from single-stranded molecules, in which sense and antisense regions are linked by nucleic acid-based or non-nucleic acid-based linkers, as well as double-stranded polynucleotide molecules having a hairpin secondary structure with self-complementary sense and antisense regions. In some embodiments, the sense and antisense strands of shRNA are linked by a loop structure containing about 1 to about 25 nucleotides, about 2 to about 20 nucleotides, about 4 to about 15 nucleotides, about 5 to about 12 nucleotides, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides.

[0152] Further embodiments of shRNA and methods for designing and synthesizing such shRNA are described in U.S. Patent Application Publication No. 2011 / 0071208, the disclosure of which is incorporated herein by reference in its entirety for all purposes.

[0153] In some embodiments, microRNAs (miRNAs) are provided herein. miRNAs represent a large group of small RNAs that are naturally produced in organisms, some of which regulate the expression of target genes. miRNAs are formed by dicers from single-stranded hairpin precursor transcripts of about 70 nucleotides. Instead of being translated into proteins, miRNAs bind to specific messenger RNAs, thereby blocking translation. In some cases, miRNAs improperly base-pair with a target, thereby inhibiting translation.

[0154] In certain embodiments, antisense oligonucleotides may be 100% complementary to the target sequence, or they may contain mismatches to improve selective targeting of alleles, for example, disease-associated mutations, as long as the heteroduplex formed between the oligonucleotide and the target sequence is sufficiently stable to withstand the action of cellular nucleases and other modes of degradation that may occur in vivo. Thus, certain oligonucleotides may have approximately or at least approximately 70% sequence complementarity between the oligonucleotide and the target sequence, e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity. This specification describes oligonucleotide skeletons that are less susceptible to nuclease cleavage. Where present, mismatches are generally less destabilizing towards the terminal region of a hybrid double helix than towards the intermediate region. The acceptable number of mismatches depends on the oligonucleotide length, the G:C base pair ratio in the double helix, and the location of the mismatch(s) in the double helix, according to well-understood principles of double-strand stability.

[0155] Interfering nucleic acid molecules can be prepared, for example, by chemosynthesis, in vitro transcription, or digestion of long dsRNAs with RNase III or Dicer. These can be introduced into cells by transfection, electroporation, or other methods known in the art. Hannon,GJ,2002,RNA Interference,Nature418:244-251;Bernstein E et al.,2002,The rest is silence.RNA7:1509-1521;Hutvagner G et al.,RNAi:Nature abhors a double-strand. Curr.Opin. Genetics&Development12:225-232;Brummelkamp,2002,A system for stable expression of short interfering RNAs in mammalian cells. Science296:550-553;Lee NS,Dohjima T,Bauer G,Li H,Li MJ,Ehsani A,Salvaterra P, and Rossi J.(2002).Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells.Nature Biotechnol.20:500-505;Miyagishi M,and Taira K.(2002).U6-promoter-driven siRNAs with four uridine 3'overhangs efficiently suppress targeted gene expression in mammalian cells.Nature Biotechnol.20:497-500;Paddison PJ, Caudy AA, Bernstein E, Hannon GJ, and Conklin DS.(2002).Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells.Genes&Dev.See 16:948-958; Paul CP, Good PD, Winer I, and Engelke DR. (2002). Effective expression of small interfering RNA in human cells. Nature Biotechnol. 20:505-508; Sui G, Soohoo C, Affar E-B, Gay F, Shi Y, Forrester WC, and Shi Y. (2002). A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proc. Natl. Acad. Sci. USA 99(6):5515-5520; Yu J-Y, DeRuiter SL, and Turner DL. (2002). RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells. Proc. Natl. Acad. Sci. USA 99(9):6047-6052.

[0156] In this method, interfering nucleic acids encoding interfering nucleic acids or polynucleotides can be administered to a target, for example, as naked nucleic acids, in combination with a delivery reagent, and / or as nucleic acids containing a sequence that expresses the interfering nucleic acid molecule. In some embodiments, the interfering nucleic acid is administered directly to the tumor of the target. In some embodiments, the nucleic acid containing a sequence that expresses the interfering nucleic acid molecule is delivered within a vector, such as a plasmid, viral, or bacterial vector. Any nucleic acid delivery method known in the art can be used in the method described herein. Suitable delivery reagents include, but are not limited to, Mirus Transit TKO lipophilic reagents, lipofectin, lipofectamine, cellfectin, polycations (e.g., polylysine), atelocollagen, nanoplexes, and liposomes. The use of atelocollagen as a delivery vehicle for nucleic acid molecules is described in Minakuchi et al. Nucleic Acids Res., 32(13):e109 (2004); Hanai et al. Ann NY Acad Sci., 1082:9-17 (2006); and Kawata et al. Mol Cancer Ther., 7(9):2904-12 (2008), each of which is incorporated herein by reference in whole. Exemplary interfering nucleic acid delivery systems are provided in U.S. Patents 8,283,461, 8,313,772, 8,501,930, 8,426,554, 8,268,798, and 8,324,366, each of which is incorporated herein by reference in whole.

[0157] In some embodiments of the methods described herein, liposomes are used to deliver inhibitory oligonucleotides to targets. Liposomes suitable for use in the methods described herein may be formed from standard vesicle-forming lipids, generally containing neutral or loaded phospholipids and sterols such as cholesterol. Lipid selection is generally made by considering factors such as the desired size of the liposomes and the half-life of the liposomes in the bloodstream. Various methods for preparing liposomes are known, for example, as described in Szoka et al. (1980), Ann. Rev. Biophys. Bioeng. 9:467 and U.S. Patents 4,235,871, 4,501,728, 4,837,028 and 5,019,369, the entirety of which these disclosures are incorporated herein by reference.

[0158] The liposomes used in this method may also be modified to avoid clearance by the mononuclear macrophage system ("MMS") and the reticuloendothelial system ("RES"). Such modified liposomes either have opsonization inhibition sites on their surface or are incorporated into the liposome structure.

[0159] Small molecule formulations Certain embodiments of the methods and compositions disclosed herein relate to the use of small molecule drugs, for example, small molecule drugs that inhibit the expression or activity of products of autophagy genes (e.g., autophagy genes disclosed herein) or NF-κB genes (e.g., NF-κB genes disclosed herein) in cancer cells. In some embodiments, the small molecule induces cytotoxicity in cells expressing products of autophagy genes (e.g., autophagy genes disclosed herein) or NF-κB genes (e.g., NF-κB genes disclosed herein). Such drugs include those known in the art and those identified using the screening assays described herein. The small molecules provided herein may have specificity of at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% to the products of autophagy genes (e.g., autophagy genes disclosed herein) or NF-κB genes (e.g., NF-κB genes disclosed herein).

[0160] In certain embodiments, the agents include PI3 kinase inhibitors, phosphoinositide 3 kinase (PI3) inhibitors, Unc-51-like kinase 1 (ULK1) inhibitors, vacuolar protein sorting protein 18 (Vps18) inhibitors, vacuolar protein sorting protein 34 (Vps34) inhibitors, ubiquitin-specific peptidase (USP10 or USP13) inhibitors, thioxanthone-based autophagy inhibitors, ATG4 inhibitors, autofinib, 3-methyladenine, wartmannin, ammonium chloride, bafilomycin A1, eflornithine, leupeptin, betulinic acid, CA074, colchicine, These may be small molecule autophagy inhibitors such as thapsigargin, bacuolin-1, vinblastine, desmethylclomipramine, LY294002, PT210, GSK-2126458, spautin-1, SAR405, compound 31, VPS34-IN1, PIK-III, compound 6, MRT68921, SBI-0206965, pepstatin A, E64d, clomipramine, lecanton, chloroquine, hydroxychlorquine, monensin, Lys05, ARN5187, compound 30, MPT0L145, ROC325, verteporfin, NSC185058, and NSC377071.Further information on additional autophagy inhibitors and autophagy inhibitors can be found in Waleska K. Martins and Mauricio S. Baptista (November 10, 2016). Autophagy Modulation for Organelle-Targeting Therapy, Autophagy in Current Trends in Cellular Physiology and Pathology, Nikolai V. Gorbunov and Marion Schneider, IntechOpen, DOI: 10.5772 / 63976 (available at https: / / www.intechopen.com / books / autophagy-in-current-trends-in-cellular-physiology-and-pathology / autophagy-modulation-for-organelle-targeting-therapy); and Pasquier, Benoit. "Autophagy inhibitors." Cellular and Molecular Life These can be found in Sciences 73 (2015): 985-1001; U.S. Patent Nos. 8,524,762 and 9,926,326; and WIPO Publication No. WO2011011522, each of which is incorporated herein by reference in its entirety.

[0161] In some embodiments, the agent may be an inhibitor of the NF-κB pathway. Small molecule autophagy inhibitors include IKK and IκB phosphorylation inhibitors, IκB degradation inhibitors, proteasome and protease inhibitors, IκBα upregulation, NF-κB nuclear translocation inhibitors, as well as NF-κB expression inhibitors, NF-κB DNA binding inhibitors, NF-κB transcription activation inhibitors, antioxidants, or upstream target inhibitors. A list of NF-κB inhibitors can be found in Gilmore, T., Herscovitch, M. "Inhibitors of NF-κB signaling: 785 and counting." Oncogene 25, 6887-6899 (2006), which is incorporated herein by reference in its entirety.

[0162] Drugs useful by the methods disclosed herein can be obtained from any available source, including systematic libraries of natural and / or synthetic compounds. Drugs can also be obtained by any of the numerous approaches in combinatorial library methods known in the art, including biological libraries; peptoid libraries (libraries of molecules having novel non-peptide backchains that possess peptide functionality but are resistant to enzymatic degradation and nevertheless maintain biological activity, see, e.g., Zuckermann et al., 1994, J.Med.Chem. 37:2678-85); spatially addressable parallel solid-phase or solution-phase libraries; synthetic library methods requiring reverse superposition; "one bead, one compound" library methods; and synthetic library methods using affinity chromatography selection. While the biological library and peptoid library approaches are limited to peptide libraries, the other four approaches can be applied to small molecule libraries of peptides, non-peptide oligomers, or compounds (Lam, 1997, Anticancer Drug Des. 12:145).

[0163] Examples of molecular library synthesis methods can be found in the art, for example, in DeWitt et al. (1993) Proc.Natl.Acad.Sci.USA90:6909; Erb et al. (1994) Proc.Natl.Acad.Sci.USA91:11422; Zuckermann et al. (1994) J.Med.Chem.37:2678; Cho et al. (1993) Science261:1303; Carrell et al. (1994) Angew. Chem.Int.Ed.Engl.33:2059; Carrell et al. (1994) Angew. Chem.Int.Ed.Engl.33:2061 and Gallop et al. (1994) J.Med.Chem.37:1233.

[0164] Drug libraries can be stored in solution (e.g., Houghten, 1992, Biotechniques 13:412-421), on beads (Lam, 1991, Nature 354:82-84), on tips (Fodor, 1993, Nature 364:555-556), on bacteria and / or spores (Ladner, USP 5, 223, 409), on plasmids (Cull et al, 1992, Proc Natl Acad Sci USA 89:1865-1869), or on phages (Scott and Smith, 1990, Science 249:386-390; Devlin, 1990, Science 249:404-406; Cwirla et al.). (Al, 1990, Proc. Natl. Acad. Sci. 87:6378-6382; Felici, 1991, J. Mol. Biol. 222:301-310; Ladner, supra.) may exist.

[0165] Drugs useful for the methods disclosed herein can be identified, for example, by using assays to screen for candidate or test drugs, such as drugs that reduce the activity or expression of the product of an autophagy gene (e.g., the autophagy gene disclosed herein) or an NF-κB gene (e.g., the NF-κB gene disclosed herein).

[0166] Drug delivery Nucleic acid and protein agents disclosed herein (e.g., CRISPR / Cas agents, TALEN agents, ZFN agents, interfering nucleic acid agents) can be introduced into cells (e.g., cancer cells) by any available means. "Introducing" includes presenting the nucleic acid or protein in a cell in a manner that allows the sequence to access the inside of the cell. Introduction can be achieved by any means, and one or more components (e.g., two components, or all components) can be introduced into the cell simultaneously or sequentially in any combination. Contacting the cell's genome with a nuclease agent may include introducing one or more nuclease agents or nucleic acids encoding nuclease agents (e.g., one or more Cas proteins or one or more nucleic acids encoding Cas proteins, and one or more guide RNAs or nucleic acids encoding one or more guide RNAs (i.e., one or more CRISPR RNAs and one or more tracrRNAs)) into the cell. Contacting the cell's genome (i.e., contacting the cell) may include introducing only one of the above components, one or more components, or all of the above components into the cell.

[0167] In some embodiments, suitable delivery methods for nucleic acid and protein drugs provided herein include, but are not limited to, electroporation, iTOP, lipid nanoparticles, polymer nanoparticles, CPP delivery, DNA nanostructures, or gold nanoparticles.

[0168] Appropriate delivery methods for nucleic acid drugs disclosed herein (e.g., plasmid-based gRNA-Cas, Ca9 mRNA, sgRNA, interfering nucleic acid drugs) include, but are not limited to, electroporation, hydrodynamic injection, microinjection, mechanical cell deformation, lipid nanoparticles, AAV, or lentiviruses.

[0169] Nucleases can be introduced into cells in the form of proteins or nucleic acids that encode them, such as RNA (e.g., messenger RNA (mRNA)) or DNA. When introduced in the form of DNA, the DNA can be operably ligated to an active promoter within the cell. Such DNA can be present in one or more expression constructs.

[0170] For example, Cas proteins can be introduced into cells in the form of a protein, such as a Cas protein complexed with gRNA, or in the form of a nucleic acid encoding the Cas protein, such as RNA (e.g., messenger RNA (mRNA)) or DNA. Guide RNA can be introduced into cells in the form of RNA, or in the form of DNA encoding the guide RNA. When introduced in the form of DNA, the DNA encoding the Cas protein and / or guide RNA can be operably ligated to an active promoter in the cell. Such DNA can be present in one or more expression constructs. For example, such an expression construct may be a component of a single nucleic acid molecule. Alternatively, they can be separated in any combination between two or more nucleic acid molecules (i.e., one or more DNAs encoding CRISPR RNAs, one or more DNAs encoding tracrRNAs, and DNA encoding the Cas protein may be components of separate nucleic acid molecules).

[0171] The disclosures herein also provide pharmaceutical compositions comprising one or a cocktail of gRNA molecules targeting autophagy or NF-κB gene expression and a pharmaceutically acceptable carrier. For example, the present invention provides pharmaceutical compositions comprising 1, 2, 3 or more gRNA molecules, each targeting autophagy or NF-κB genes.

[0172] The agents provided herein may include gRNA encapsulated within lipid particles. With respect to formulations comprising a cocktail of gRNAs encapsulated within lipid particles, different gRNA molecules may be co-encapsulated within the same lipid particle, or each type of gRNA species present in the cocktail may be encapsulated in separate particles, or some gRNA species may be co-encapsulated in the same particle while others are encapsulated in different particles within the formulation. In certain embodiments, the lipid particles may contain both gRNA and mRNA encoding Cas proteins. In certain embodiments, one population of lipid particles may contain gRNA, and another population of lipid particles may contain Cas proteins or mRNA encoding Cas proteins, and these lipid particles may be of the same or different composition and may be administered simultaneously or sequentially.

[0173] In some embodiments, lipid particles are formed from cationic lipids, non-cationic lipids, and optionally complex lipids that prevent particle aggregation. Lipid particles containing nucleic acid molecules (e.g., gRNA molecules) are referred to as nucleic acid-lipid particles. Nucleic acids can be completely encapsulated within the lipid particles, thereby protecting them from enzymatic degradation. In some embodiments, nucleic acid-lipid particles have a total lipid:gRNA mass ratio of about 5:1 to about 15:1. In specific embodiments, nucleic acid-lipid particles have a total lipid:gRNA mass ratio of about 5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, or 15:1, or a portion or range thereof. In certain embodiments, nucleic acid-lipid particles have a total lipid:gRNA mass ratio of about 9:1 (e.g., lipid:drug ratios of 8.5:1 to 10:1 or 8.9:1 to 10:1 or 9:1 to 9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1 and 9.8:1). Administration of nucleic acid-lipid particles can be by any route known in the art, such as oral, intranasal, intravenous, intraperitoneal, intramuscular, intraarticular, intrafocal, intratracheal, subcutaneous, or intradermal. In certain embodiments, nucleic acid-lipid particles are administered systemically, for example, via enteral or parenteral administration routes. The nucleic acid may form a complex with a condensing agent as described in PCT Publication WO00 / 03683 and be encapsulated within the lipid particles, the disclosure of which is incorporated herein by reference in whole for all purposes.

[0174] The lipid particles provided herein may have an average diameter of approximately 30 nm to 150 nm, approximately 40 nm to 150 nm, approximately 50 nm to 150 nm, approximately 60 nm to 130 nm, approximately 70 nm to 110 nm, approximately 70 nm to 100 nm, approximately 80 nm to 100 nm, approximately 90 nm to 100 nm, approximately 70 nm to 90 nm, approximately 80 nm to 90 nm, approximately 70 nm to 80 nm, or approximately 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. Nucleic acid-lipid particles and methods for preparing them are disclosed, for example, in U.S. Patent Publications 20040142025 and 20070042031, which are incorporated herein by reference in their entirety for all purposes.

[0175] Nucleic acid-lipid particles may contain lipid conjugates. Such lipid conjugates include, but are not limited to, PEG-lipid conjugates such as PEG coupled to dialkyloxypropyl (e.g., PEG-DAA conjugate), PEG coupled to diacylglycerol (e.g., PEG-DAG conjugate), PEG coupled to cholesterol, PEG coupled to phosphatidylethanolamine, and PEG conjugated to ceramide (see, for example, U.S. Patent No. 5,885,613), cationic PEG lipids, polyoxazoline (POZ)-lipid conjugates (e.g., POZ-DAA conjugate), polyamide oligomers (e.g., ATTA-lipid conjugate), and mixtures thereof. Further examples of POZ-lipid conjugates are described in PCT Publication WO2010 / 006282. PEG or POZ may conjugate directly to lipids or may be bound to lipids via a linker moiety. For example, any linker site suitable for coupling PEG or POZ to lipids can be used, including non-ester-containing linker sites and ester-containing linker sites. In certain embodiments, non-ester-containing linker sites such as amides or carbamates are used.

[0176] In some embodiments, the lipid conjugate in nucleic acid-lipid particles inhibits particle aggregation and may include, for example, one or more of the lipid conjugates described herein. In one particular embodiment, the lipid conjugate includes a PEG-lipid conjugate. Examples of PEG-lipid conjugates include, but are not limited to, PEG-DAG conjugates, PEG-DAA conjugates, and mixtures thereof. In certain embodiments, the PEG-lipid conjugate is selected from PEG-diacylglycerol (PEG-DAG) conjugate, PEG-dialkyloxypropyl (PEG-DAA) conjugate, PEG-phospholipid conjugate, PEG-ceramide (PEG-Cer) conjugate, and mixtures thereof. In certain embodiments, the PEG-lipid conjugate is a PEG-DAA conjugate. In certain embodiments, the PEG-DAA conjugate in the lipid particles may include PEG-didecyloxypropyl (C10) conjugate, PEG-dilauryloxypropyl (C12) conjugate, PEG-dimyristyloxypropyl (C14) conjugate, PEG-dipalmityloxypropyl (C16) conjugate, PEG-distearyloxypropyl (C18) conjugate, or mixtures thereof. In certain embodiments, the PEG-DAA conjugate is PEG-dimyristyloxypropyl (C14) conjugate. In another embodiment, the PEG-DAA conjugate is compound (66)(PEG-C-DMA) conjugate. In another embodiment, the lipid conjugate includes POZ-lipid conjugates such as POZ-DAA conjugate.

[0177] In certain embodiments, the complexed lipids that inhibit particle aggregation comprise approximately 0.5 mol% to approximately 3 mol% of the total lipids present in the particles.

[0178] Additional embodiments of useful formulations are described in published U.S. Patent Applications No. 2011 / 0076335A1 and No. 2018 / 0245074A1, the disclosures thereof which are incorporated herein by reference in their entirety for all purposes.

[0179] In certain embodiments, the nucleic acid agent provided herein (e.g., DNA encoding a Cas protein and / or gRNA) is delivered by a vector (e.g., a viral vector / virus or plasmid).

[0180] The vector may include sequences encoding a donor template that has high homology to the Cas protein and / or gRNA molecule and / or the targeted region (e.g., the target sequence). In certain embodiments, the donor template includes all or part of the target sequence. Exemplary donor templates are repair templates, e.g., gene modification templates, or gene mutation templates, e.g., point mutation (e.g., single nucleotide (nt) substitution) templates. The vector may also include sequences encoding a signal peptide (e.g., for nuclear localization, nucleolar localization, or mitochondrial localization) fused to, for example, the Cas molecular sequence. For example, the vector may include a nuclear localization sequence (e.g., derived from SV40) fused to the sequence encoding the Cas molecule.

[0181] One or more regulatory / control elements, such as a promoter, enhancer, intron, polyadenylation signal, Kozak consensus sequence, internal ribosome entry site (IRES), 2A sequence, and splice acceptor or donor, may be included in the vector. In certain embodiments, the promoter is recognized by RNA polymerase II. In other embodiments, the promoter is recognized by RNA polymerase III (e.g., U6 promoter). In certain embodiments, the promoter is a regulatory promoter (e.g., inductive promoter). In certain embodiments, the promoter is a constitutive promoter. In certain embodiments, the promoter is a tissue-specific promoter. In certain embodiments, the promoter is a viral promoter. In certain embodiments, the promoter is a non-viral promoter.

[0182] In certain embodiments, the vector or delivery vehicle is a viral vector (e.g., for the production of recombinant viruses). In certain embodiments, the virus is a DNA virus (e.g., a dsDNA or ssDNA virus). In certain embodiments, the virus is an RNA virus (e.g., an ssRNA virus). In certain embodiments, the virus infects dividing cells. In other embodiments, the virus infects non-dividing cells. Exemplary viral vectors / viruses include, for example, retroviruses, lentiviruses, adenoviruses, adeno-associated viruses (AAVs), vaccinia viruses, poxviruses, and herpes simplex viruses.

[0183] In certain embodiments, the virus infects dividing cells. In other embodiments, the virus infects non-dividing cells. In certain embodiments, the virus infects both dividing and non-dividing cells. In certain embodiments, the virus can be incorporated into the host genome. In certain embodiments, the virus is engineered to induce immunosuppression, for example, in humans. In certain embodiments, the virus is replicable. In other embodiments, the virus is replication-deficient and packages, for example, one or more coding regions of genes required for further rounds of virion replication and / or replaced or deleted by other genes. In certain embodiments, the virus induces transient expression of Cas molecules and / or gRNA molecules. In other embodiments, the virus induces sustained expression of Cas molecules and / or gRNA molecules, for example, for at least one week, two weeks, one month, two months, three months, six months, nine months, one year, two years, or permanent expression. The packaging ability of a virus can vary, for example, from at least about 4kb to at least about 30kb, for example, at least about 5kb, 10kb, 15kb, 20kb, 25kb, 30kb, 35kb, 40kb, 45kb, or 50kb.

[0184] In certain embodiments, viral vectors recognize specific cell types or tissues. For example, viral vectors can be pseudotyped with different / alternative viral coat glycoproteins; they can be manipulated with cell type-specific receptors (e.g., genetic modification(s) of one or more viral coat glycoproteins to incorporate target ligands such as peptide ligands, single-chain antibodies, or growth factors); and / or they can be manipulated to have a molecular crosslink with bispecificity, where one end recognizes a viral glycoprotein and the other end recognizes a site on the target cell surface (e.g., ligand receptors, monoclonal antibodies, avidin-biotin, and chemical bonds).

[0185] Exemplary viral vectors / viruses include, for example, retroviruses, lentiviruses, adenoviruses, adeno-associated viruses (AAVs), vaccinia viruses, poxviruses, and herpes simplex viruses.

[0186] In certain embodiments, sequences encoding Cas and / or gRNA are delivered by a recombinant retrovirus. In certain embodiments, the retrovirus (e.g., Moloney's mouse leukemia virus) includes, for example, a reverse transcriptase that enables integration into the host genome. In certain embodiments, the retrovirus is replicable.

[0187] In certain embodiments, the retrovirus is replication-deficient, for example, packaging one of the more coding regions of a gene required for a further round of virion replication and having been replaced or deleted by another gene.

[0188] In certain embodiments, the nucleic acid sequence encoding Cas and / or gRNA (optionally a donor template nucleic acid) is delivered by a recombinant lentivirus. For example, the lentivirus is replication-deficient and, for example, does not contain one or more genes necessary for viral replication.

[0189] In certain embodiments, the nucleic acid sequence encoding Cas and / or gRNA (optionally a donor template nucleic acid) is delivered by recombinant adenovirus.

[0190] In certain embodiments, the adenovirus is engineered to induce immunosuppression in humans. In certain embodiments, a nucleic acid sequence encoding Cas and / or gRNA (optionally a donor template nucleic acid) is delivered by recombinant AAV. In certain embodiments, the AAV does not integrate its genome into the genome of a host cell, e.g., a target cell as described herein. In certain embodiments, the AAV can integrate at least a portion of its genome into the genome of a host cell, e.g., a target cell as described herein. In certain embodiments, the AAV is a self-complementary adeno-associated virus (scAAV), e.g., a scAAV that packages both strands together to form double-stranded DNA when annealed. AAV serotypes that can be used in the disclosed method include AAV1, AAV2, modified AAV2 (e.g., modified with Y444F, Y500F, Y730F and / or S662V), AAV3, modified AAV3 (e.g., modified with Y705F, Y73IF and / or T492V), AAV4, AAV5, AAV6, modified AAV6 (e.g., modified with S663V and / or T492V), AAV8, AAV8.2, AAV9, and AAVrh10, and pseudotyped AAVs, e.g., AAV2 / 8, AAV2 / 5, and AAV2 / 6 can also be used in the disclosed method. In certain embodiments, the AAV capsids that can be used by the method described herein are capsid sequences derived from serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh8, AAV.rh10, AAV.rh32 / 33, AAV.rh43, AAV.rh64R1, or AAV7m8.

[0191] In certain embodiments, a nucleic acid sequence encoding Cas and / or gRNA (optionally a donor template nucleic acid) is delivered in a remanufactured AAV capsid having, for example, more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, or more than 95% sequence homology with a capsid sequence derived from serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh8, AAV.rh10, AAV.rh32 / 33, AAV.rh43, or AAV.rh64R1.

[0192] In certain embodiments, a nucleic acid sequence encoding Cas and / or gRNA (optionally a donor template nucleic acid) is delivered by a chimeric AAV capsid. Exemplary chimeric AAV capsids include, but are not limited to, AAV9i1, AAV2i8, AAV-DJ, AAV2G9, AAV2i8G9, or AAV8G9.

[0193] In certain embodiments, the AAV is a self-complementary adeno-associated virus (scAAV), for example, an scAAV that packages both strands together to form double-stranded DNA through annealing.

[0194] In certain embodiments, the DNA encoding Cas9 and / or gRNA (optionally, a donor template nucleic acid) is delivered by a hybrid virus, e.g., a hybrid of one or more of the viruses described herein. In certain embodiments, the hybrid virus is a hybrid of Bocavirus, B19 virus, porcine AAV, goose AAV, feline AAV, canine AAV, or AAV with MVM (e.g., any AAV serotype). Additional information regarding the delivery of the drug via a viral vector is found in WIPO Publication WO2018081504A1, which is incorporated in its entirety by reference.

[0195] In certain embodiments, the delivery vehicle is a non-viral vector. In certain embodiments, the non-viral vector is an inorganic nanoparticle. Exemplary inorganic nanoparticles include, for example, magnetic nanoparticles (e.g., Fe3MnO2) and silica. The outer surface of the nanoparticle can be conjugated with a positively charged polymer (e.g., polyethyleneimine, polylysine, polycerin) that allows for the attachment (e.g., binding or capture) of the payload.

[0196] In several methods, DNA encoding a nuclease (e.g., Cas protein and guide RNA) can be introduced into cells via DNA minicircles. See, for example, International Patent No. WO2014 / 182700, which is incorporated herein by reference in its entirety for all purposes. DNA minicircles are supercoiled DNA molecules that can be used for nonviral gene delivery and do not have an origin of replication or an antibiotic selection marker. Therefore, DNA minicircles are typically smaller in size than plasmid vectors. These DNAs lack bacterial DNA and therefore do not have the unmethylated CpG motif found in bacterial DNA.

[0197] The methods provided herein do not depend on any specific method for introducing nucleic acids or proteins into cells, but only on the access of the nucleic acid or protein to the interior of at least one cell. Methods for introducing nucleic acids and proteins into various cell types are known, including, for example, stable gene transfer methods, transient gene transfer methods, and virus-mediated methods.

[0198] Gene transfer protocols and protocols for introducing nucleic acids or proteins into cells can vary. Non-limiting gene transfer methods include chemical-based gene transfer methods using liposomes, nanoparticles, calcium phosphate (Graham et al. (1973) Virology 52(2):456-67, Bacchetti et al. (1977) Proc. Natl. Acad. Sci. USA 74(4):1590-4 and Kriegler, M (1991). Transfer and Expression: A Laboratory Manual. New York: WH Freeman and Company. pp.96-97), dendrimers, or cationic polymers such as DEAE-dextran or polyethyleneimine. Non-chemical methods include electroporation, sonoporation, and photogene transfer. Particle-based gene transfer methods include the use of gene guns or magnet-assisted transfection (Bertram (2006) Current Pharmaceutical Biotechnology 7, 277-28). Viral methods can also be used for gene transfer.

[0199] The introduction of nucleic acids or proteins into cells can also be mediated by electroporation, intracytoplasmic injection, viral infection, adenovirus, adeno-associated virus, lentivirus, retrovirus, translocation, lipid-mediated translocation, or nucleofection. Nucleofection is an improved electroporation method that allows nucleic acid substrates to be delivered not only to the cytoplasm but also into the nucleus via the nuclear membrane. Furthermore, the use of nucleofection in the methods disclosed herein typically requires far fewer cells than conventional electroporation (e.g., about 2 million compared to 7 million for conventional electroporation). In one example, nucleofection is performed using the LONZA® NUCLEOFECTOR® system.

[0200] The introduction of nucleic acids or proteins into cells can also be achieved by microinjection. Microinjection of mRNA is preferably performed in the cytoplasm (e.g., to deliver mRNA directly to the translation mechanism), while microinjection of proteins, or DNA encoding Cas proteins, is preferably performed in the nucleus. Alternatively, microinjection can be performed by injection into both the nucleus and cytoplasm: the needle can be first introduced into the nucleus, a first volume injected, and a second volume injected into the cytoplasm while withdrawing the needle from the cell. When injecting nuclease proteins into the cytoplasm, a nuclear localization signal is preferably included in the protein to ensure delivery to the nucleus / pronucleus. Methods for performing microinjection are known. For example, see Nagy et al. (Nagy A, Gertsenstein M, Vintersten K, Behringer R., 2003, Manipulating the Mouse Embryo. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); Meyer et al. (2010) Proc. Natl. Acad. Sci. USA 107:15022-15026 and Meyer et al. (2012) Proc. Natl. Acad. Sci. USA 109:9354-9359.

[0201] Other methods for introducing nucleic acids or proteins into cells include, for example, vector delivery, particle delivery, exosome delivery, lipid nanoparticle delivery, cell-permeable peptide delivery, or delivery via implantable devices. Methods for administering nucleic acids or proteins to modify cells in vivo are disclosed elsewhere in this specification.

[0202] The introduction of nucleic acids and proteins into cells can also be achieved by hydrodynamic delivery (HDD). Hydrodynamic delivery has emerged as a method for intracellular DNA delivery in vivo. Gene delivery to parenchymal cells requires the injection of only essential DNA sequences via selected blood vessels, eliminating the safety concerns associated with current viral and synthetic vectors. Once injected into the bloodstream, the DNA can reach cells in various tissues that have access to the blood. Hydrodynamic delivery utilizes the forces generated by rapidly injecting a large volume of solution into circulating, incompressible blood to overcome the physical barriers of the endothelium and cell membranes that prevent large, membrane-impermeable compounds from entering parenchymal cells. In addition to DNA delivery, this method is useful for the efficient intracellular delivery of RNA, proteins, and other small molecule compounds in vivo. See, for example, Bonamassa et al. (2011) Pharm. Res. 28(4):694-701, which is incorporated herein by reference in its entirety for all purposes.

[0203] Other methods for introducing nucleic acids or proteins into cells include, for example, vector delivery, particle delivery, exosome delivery, lipid nanoparticle delivery, cell-permeable peptide delivery, or delivery via implantable devices. Specifically, nucleic acids or proteins can be introduced into cells in carriers such as poly(lactic acid) (PLA) microspheres, poly(D,L-lactic acid-coglycolic acid) (PLGA) microspheres, liposomes, micelles, reverse micelles, lipid cocreates, or lipid microtubules.

[0204] In some cases, the cells used in the methods and compositions have DNA constructs stably integrated into their genomes. In such cases, contact may include providing cells that already have constructs stably integrated into their genomes. For example, the cells used in the methods disclosed herein may have existing Cas coding genes stably integrated into their genomes (i.e., Cas activatable cells). "Stably integrated," "stably introduced," or "stably incorporated" includes introducing polynucleotides into cells so that the nucleotide sequence can be incorporated into the cell's genome and inherited by its offspring. Any protocol may be used for the stable integration of various components of DNA constructs or targeted genome integration systems.

[0205] DNA-binding proteins or nucleases may be introduced into cells by any known means. Polypeptides encoding DNA-binding proteins or nucleases may be introduced directly into cells. Alternatively, polynucleotides encoding DNA-binding proteins or nucleases can be introduced into cells. When polynucleotides encoding DNA-binding proteins or nucleases are introduced into cells, the DNA-binding proteins or nucleases can be expressed transiently, conditionally, or constitutively within the cells. For example, polynucleotides encoding DNA-binding proteins or nucleases can be included in an expression cassette and operably linked to a conditional promoter, an inducible promoter, a constitutive promoter, or a tissue-specific promoter. Such promoters are discussed in more detail elsewhere in this specification. Alternatively, DNA-binding proteins or nucleases can be introduced into cells as mRNA encoding them.

[0206] Polynucleotides encoding DNA-binding proteins or nucleases can be stably incorporated into the cell genome and operably linked to active promoters within the cell. Alternatively, the polynucleotides encoding DNA-binding proteins or nucleases can be present within a targeting vector, or in a separate vector or plasmid from the targeting vector containing the insert polynucleotide.

[0207] When a DNA-binding protein or nuclease is delivered to a cell by introducing a polynucleotide encoding the DNA-binding protein or nuclease, such polynucleotide encoding the DNA-binding protein or nuclease can be modified to substitute with codons that are more frequently used in the target cell than the native polynucleotide sequence encoding the DNA-binding protein or nuclease. For example, a polynucleotide encoding a DNA-binding protein or nuclease can be modified to substitute with codons that are more frequently used in the native polynucleotide sequence in a given target prokaryotic or eukaryotic cell, including bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, or any other target host cell.

[0208] Treatment method In some embodiments, a method is provided herein for sensitizing cancer cells in a subject to TNF-α-mediated killing by administering to the subject one agent (e.g., agents disclosed herein) that inhibits autophagy and / or the NF-κB pathway of cancer cells. In other embodiments, a method is provided herein for increasing TNF-α-mediated killing of cancer cells in a subject by administering to the subject at least one agent (e.g., agents disclosed herein) that inhibits autophagy and / or the NF-κB pathway of cancer cells. In further embodiments, the method herein includes a method for sensitizing a tumor in a subject to TNF-α-mediated killing or increasing TNF-α-mediated killing of a tumor in a subject by administering to the subject an agent (e.g., agents disclosed herein) that inhibits autophagy and / or the NF-κB pathway of the tumor.

[0209] Methods of treating cancer in a subject by administering to the subject an agent that inhibits autophagy and / or the NF-κB pathway of the target cancer cells (e.g., agents disclosed herein) and by additional cancer therapies. In some embodiments, the additional cancer therapy is cancer immunotherapy. In certain embodiments, the additional therapy is a treatment that induces TNF-α-mediated killing of cancer cells. In some embodiments, the additional therapy is a treatment that induces T-cell killing of cancer cells (e.g., cytotoxic T-cell killing of cancer cells). In some embodiments, the additional cancer therapy includes immune checkpoint inhibitors, TNF-α administration, T-cell immunotherapy (e.g., CAR-T-cell immunotherapy) and / or cancer vaccines.

[0210] Therefore, in certain embodiments, the agents of the present invention can be used alone or administered in combination with other types of therapeutic agents. For example, different therapeutic agents can be administered simultaneously or consecutively in the same formulation or in separate formulations. In certain embodiments, different therapeutic agents can be administered to each other within about 1 hour, about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, or about 1 week. Thus, subjects receiving such treatment can benefit from the combined effects of different therapeutic agents.

[0211] In certain embodiments, a pharmaceutical composition is provided, for example, one comprising at least one of the agents described herein together with a pharmaceutically acceptable carrier. In one embodiment, the composition comprises a combination of several (e.g., two or more, three or more, four or more, or five or more) agents described herein.

[0212] In some embodiments, the pharmaceutical composition is administered topically or systemically. In some embodiments, the pharmaceutical composition may be administered topically to a tumor or tumor microenvironment present in the target. In some embodiments, the drug or pharmaceutical composition is administered together with a second cancer treatment agent.

[0213] The agents described herein may be administered in combination with any other cancer therapies, including immunotherapy. Additional cancer therapies include immune checkpoint inhibition. In some embodiments, immune checkpoint inhibitors inhibit immune checkpoint proteins. Immune checkpoint inhibition broadly refers to inhibiting checkpoints that cancer cells can produce to prevent or downregulate the immune response. Examples of immune checkpoint proteins include CTLA-4, PD-1, VISTA, B7-H2, B7-H3, PD-L1, B7-H4, B7-H6, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-1, TIM-3, TIM-4, LAG-3, BTLA, SIRPalpha (CD47), CD48, 2B4 (CD244), B7.1, B7.2, ILT-2, ILT-4, TIGIT, HHLA2, butyrophyllin, A2aR, and combinations thereof.Immune checkpoint inhibitors include semiprimab (REGN2810), nivolumab (BMS-936558, MDX-1106, ONO-4538), pembrolizumab (MK-3475, SCH900475), atezolizumab (MPDL3280A, RG7446, RO5541267), durvalumab (MEDI4736, MEDI-4736), avelumab (MSB0010718C), ipilimumab (BMS-734016, IBI310, MDX-010), SHR1210, cintilimab (IBI308), and Spar. Talizumab (PDR001), Tithrelizumab (BGB-A317), Pidilizumab, BCD-100, Tripalimab (JS001), BAY1905254, ASP8374, PF-06801591, AMP-224, AB122, AK105, AMG404, BCD-100, BI754091, F520, HLX10, HX008, JTX-4014, LZM009, MEDI0680, MGA012, Sym021, TSR-042, PSB205, MGD019, MGD013, AK104, XmAb20717, R O7121661, CX-188, INCB086550, FS118, BCD-135, BGB-A333, CBT-502, CK-301, CS1001, FAZ053, HLX20, KN035, MDX-1105, MSB2311, SHR-1316, TG -1501, ZKAB001, INBRX-105, MCLA-145, KN046, M7824, LY3415244, INCB086550, CA-170, CX-072, ADU-1604, AGEN1181, AGEN1884, MK-1308, REGN4 Possible candidates include 659, XmAb22841, ATOR-1015, PSB205, MGD019, AK104, XmAb20717, BMS-986249, Tremelimumab, BMS-986258, BGB-A425, INCAGN02390, Sym023, JNJ61610588, BI754111, LAG525, MK-4280, REGN3767, Sym022, TSR-033, Relatrimab, JTX-2011, MGD009, BMS-986207, OMP-313M32, MK-7684, or TSR-022.

[0214] Additional cancer immunotherapies include adoptive immunotherapy such as autologous or allogeneic T-cell therapy, or autologous or allogeneic CAR T-cell therapy. Adoptive immunotherapy is a treatment designed to enhance a patient's immune response to tumors or cancer cells. The method involves removing immune cells from an individual, forming effector cells ex vivo, proliferating the cells to a clinically appropriate number, and reinjecting the cells into the patient. Methods disclosed herein include co-administration of a drug disclosed herein with allogeneic or autologous CTLs expressing T-cell receptors that specifically bind to peptides (e.g., cancer peptides or target-specific peptides) presented on class I MHCs. In some embodiments, the CTLs are derived from a cell bank or from the subject to which the CTLs are being administered. In some embodiments, the MHC is class I MHC. In some embodiments, the class II MHC has an α-chain polypeptide which is HLA-DMA, HLA-DOA, HLA-DPA, HLA-DQA, or HLA-DRA. In some embodiments, the class II MHC has a β-chain polypeptide that is HLA-DMB, HLA-DOB, HLA-DPB, HLA-DQB, or HLA-DRB. In some embodiments, the CTLs are stored in a cell library or bank before being administered to the subject.

[0215] In some embodiments, T cells are brought into contact with antigen-presenting cells (APCs) that present peptides specific to the target cancer or tumor. In some embodiments, the APCs are B cells, antigen-presenting T cells, dendritic cells, or artificial antigen-presenting cells (e.g., aK562 cells). The dendritic cells used in this process can be prepared by collecting PBMCs from a patient's sample and attaching them to plastic. Generally, the monocyte population adheres, and all other cells can be washed away. The adherent population is then differentiated with IL-4 and GM-CSF to produce monocyte-derived dendritic cells. These cells can be matured by adding IL-1β, IL-6, PGE-1, and TNF-α (which upregulate important costimulatory molecules on the surface of dendritic cells) and then transduced with one or more peptides provided herein. In some embodiments, the APCs are artificial antigen-presenting cells such as aK562 cells. In some embodiments, artificial antigen-presenting cells are engineered to express CD80, CD83, 41BB-L, and / or CD86. Exemplary artificial antigen-presenting cells, including aK562 cells, are described in U.S. Patent No. 2003 / 0147869, which is incorporated herein by reference. Exemplary methods for producing antigen-presenting cells can be found in International Patent No. WO2013088114, which is incorporated herein by reference in its entirety.

[0216] Another exemplary adoptive immunotherapy protocol involves the administration of autologous tumor-infiltrating lymphocytes (TILs). TIL cells are highly lethal. TIL cells are effector cells differentiated in vivo in solid tumors (see U.S. Patent Nos. 5,126,132 describing methods for generating TIL cells for adoptive immunotherapy of cancer). TIL cells can be produced, for example, by taking a tumor sample from a patient, isolating the lymphocytes that infiltrated the tumor sample, growing these TIL cells ex vivo in the presence of IL-2, and reinjecting the cells with IL-2 into the patient.

[0217] An additional cancer treatment may be CAR-T cell therapy. Chimeric antigen receptors (CARs) are molecules that combine antibody-based specificity for tumor-associated surface antigens with a T cell receptor-activating intracellular domain that possesses specific anti-tumor cell immune activity (Eshhar, 1997, Cancer Immunol Immunother 45(3-4) 131-136; Eshhar et al., 1993, Proc Natl Acad Sci USA 90(2): 720-724; Brocker and Karjalainen, 1998, Adv Immunol 68: 257-269). These CARs enable T cells to achieve MHC-independent primary activation via a single-chain Fv (scFv) antigen-specific extracellular domain fused to an intracellular domain that provides T cell activation and co-stimulatory signals. Second and third-generation CARs also provide appropriate co-stimulatory signaling via CD28 and / or CD137(4-1BB) intracellular activation motifs, enhancing cytokine secretion and antitumor activity in various solid tumor and leukemia models (Pinthus, et al, 2004, J Clin Invest 114(12):1774-1781; Milone, et al., 2009, Mol Ther 17(8):1453-1464; Sadelain, et al., 2009, Curr Opin Immunol 21(2):215-223). Chimeric antigen receptor (CAR) T-cell therapy involves genetically modifying the patient's own T cells to express tumor antigen-specific CARs, then growing the cells ex vivo and reinjecting them into the patient. CARs are fusion proteins of a select single-stranded fragment that is variable from a specific monoclonal antibody and one or more T-cell receptor intracellular signaling domains. This genetic modification of T cells can occur via either a virus-based gene transfer method or a non-viral method such as DNA-based transposons, CRISPR / Cas9 technology, or direct introduction of in vitro transcribed mRNA via electroporation.

[0218] Also provided herein is a method for treating cancer in a subject by obtaining a sample containing T cells from the subject, isolating cytotoxic T lymphocytes (CTLs) from the sample, growing the CTLs ex vivo, and administering the grown CTLs to the subject in combination with at least one agent (e.g., any agent disclosed herein). Cytotoxic T cells may be tumor-infiltrating lymphocytes. Growing CTLs may involve contacting the CTLs with antigen-presenting cells (APCs) expressing cancer-specific or tumor-specific antigens to produce antigen-specific CTLs. In some embodiments, the sample containing T cells or isolated CTLs is stimulated before administration to the subject. The method may further include contacting the CTLs with an anti-CD3 monoclonal antibody (OKT3) before administration to the subject. In other embodiments, the method further includes contacting the CTLs with human interleukin (IL)-2 before administration to the subject.

[0219] In some embodiments, subjects are administered chemotherapeutic agents before the administration of the drug. Subjects may be resistant to chemotherapeutic agents. Subjects may be administered chemotherapeutic agents following or concurrently with the administration of additional cancer treatment agents disclosed herein. Chemotherapy agents include alkylating agents (e.g., thiotepa and cyclophosphamide (Cytoxan®)), alkyl sulfonates (e.g., busulfan, improsulfan and piposulfan), aziridines (e.g., benzodopa, carbocon, metsuredopa, and uredopa), emilermines and memiramelamamines (including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphaolamide, and trimimyloromelamamine), acetogenins (especially bratacin and Bratacinone), Camptothecin (including synthetic analog Topotecan), Briostatin, Callistatin, CC-1065 (including its synthetic analogs Adzelesin, Carzelesin and Biseresin), Cryptophycin (artificial Cryptophycin 1 and Cryptophycin 8), Dorastatin, Duocalmycin (including synthetic analogs KW-2189 and CBI-TMI), Erytherobin, Pancratistatin, Sarcodictiin, Spongistatin, Nitrogen Mustard (e.g., Chlorambucil, Chlornafadin, Colophosphamide, Estramustine, Ifosfamide, Mechloretamine, Mechloretamine Oxide Hydrochloride, Melphalan, Nobuenvicin, Fenesterine, Prednimustine, Trophosphamide, Ura Sil mustard), nitrosourea (e.g., carmustine, chlorozotocin, fotemustine, lomustine, nimustine, ranimustine), antibiotics such as engine antibiotics (e.g., calicheamicin, especially calicheamicin γ1 and affinity calicheamicin), dinemycin (including dinemycin A), bisphosphonates (e.g., clodronate), esperamicin, and neocardinostatin chromophore and related pigment proteins engine antibacterial chromophore, acrasinomycin, actinomycin, ausramycin, azaserin, bleomycin, kakutinomycin, carabicin, carminomycin, cartinophylline, chromomycins, dactinomycin, daunorubicin, detrubicin,6-Diazo-5-oxo-L-norleucine, Doxorubicin (Adramycin®) (including morpholinodoxorubicin, cyanomorpholinodoxorubicin, 2-pyrrolinodoxorubicin and deoxydoxorubicin), Epirubicin, Esolubicin, Idarubicin, Marcelomycin, Mitomycin such as Mitomycin C, Mycophenolic acid, Nogaramycin, Olibomycin, Peplomycin, Potophyllomycin, Puromycin, Queramycin, Rhodolubicin, Streptonigrin, Streptozocin, Tubercidine, Ube Nimex, dinostatin, zolubicin, antimetabolites (e.g., methotrexate and 5-fluorouracil (5-FU)), folic acid analogs (e.g., demopterin, methotrexate, pteropterin, trimethrexate), purine analogs (e.g., fludarabine, 6-mercaptopurine, thiamiprine, thioguanine), pyrimidine analogs (e.g., ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine), androgens (e.g., carsterone, pr (Dromostanolone ropionate, epithiostanol, mepitiostane, testolactone), anti-adrenal agents (e.g., aminoglutethimide, mitotane, trilostane), folic acid supplements (e.g., folinic acid), acegraton, aldofasphamide glycosides, aminolevulinic acid, enyluracil, amsacrin, hestrabusil, bisanthren, edatraxate, defofamine, demecolsin, diazicone, elformin, eriptinium acetate, epotilon, etogluside, gallium nitrate, hydroxyurea, lentinan, ronidamine, mytansino (e.g., mytansine and anthamitosine), mitogwazone, mitoxantrone, mopidamol, nitracrine, pentostatin, fenamet, pirarubicin, losoxantrone, podophyllic acid, 2-ethylhydrazide, procarbazine, PSK (trademark), razoxane, rhizoxin, schizophyllan, spirogermanium, tenuazonic acid, triadicone, 2,2',2"-triquatriemylamine, trichothecenes (especially T-2 toxin, beracrine A, loridine A and anguidin), urethane, vindesine, dacarbazine, mannomustine,Mitobronitol, Mitractol, Pipobroman, Gacitosine, Arabinoside ("Ara-C"), Cyclophosphamide, Thiopeta, Taxoids (e.g., Paclitaxel (Taxol®, Bristol Meyers Squibb Oncology, Princeton, NJ) and Docetaxel (Taxoteret®, Rhone-Poulenc) This includes Rorer, Antony, France), chlorambucil, gemcitabine (Gemzar®), 6-thioguanine, mercaptopurine, methotrexate, platinum analogs (e.g., cisplatin and carboplatin), vinblastine, platinum, etoposide (VP-16), ifosfamide, mitoxantrone, vincristine, vinorelbine (Navelbine®), novantrone, teniposide, edatrexate, daunomycin, aminopterin, xeoroda, ibandronate, CPT-11, topoisomerase inhibitor RFS2000, difluoromethylornithine (DMFO), retinoin (e.g., retinoic acid), capecitabine, and any pharmaceutically acceptable salts, acids, or derivatives of the above. Antihormone agents that act to regulate or inhibit hormonal effects on tumors (e.g., anti-estrogens and selective estrogen receptor modifiers (SERMs) including tamoxifen (including NOLVADEX®), raloxifene, droxifene, 4-droxitamoxifen, trioxyfen, keoxyfen, LY117018, onapristone and toremifene (Fareston®)); aromatase inhibitors that regulate estrogen production in the adrenal gland (e.g., 4(5) )-Imidazole, aminoglutethimide, megestrol acetate (Megace®), exemestane, formestein, fadrozol, borozol (Rivisor®), letrozole (Femara®), and anastrozole (Arimidex®); antiandrogens (e.g., flutamide, nilutamide, bicalutamide, leuprohyde, and goserelin); and any pharmaceutically acceptable salts, acids, or derivatives of any of the above are also included in the definition of “chemotherapeutic agents.”

[0220] As described in detail below, the pharmaceutical compositions and / or agents disclosed herein may be specifically formulated for administration in solid or liquid form, including (1) oral administration, e.g., drenches (aqueous or nonaqueous solutions or suspensions), tablets, e.g., those intended for oral mucosa, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue, or (2) parenteral administration, e.g., by subcutaneous, intramuscular, intravenous, subarachnoid, intracerebral, or epidural injection, e.g., sterile solutions or suspensions, or those adapted for sustained-release formulations. Methods for preparing pharmaceutical formulations or compositions include the step of associating the agents described herein with a carrier and optionally one or more auxiliary components. Generally, formulations are prepared by homogeneously and closely associating the agents described herein with a liquid carrier or a micronized solid carrier or both, and then, if necessary, shaping the product.

[0221] efficacy In some embodiments, the methods described herein can be used to treat any cancer, including any cancerous or precancerous tumor. Cancers that can be treated by the methods and compositions provided herein include, but are not limited to, cancers of the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestinal tract, gums, head, kidney, liver, lung, nasopharynx, neck, ovaries, prostate, skin, stomach, testes, tongue, or uterus. Furthermore, cancers may specifically be, but are not limited to, the following histological types: malignant neoplasms; cell carcinomas; undifferentiated cell carcinomas; giant and spindle cell carcinomas; small cell carcinomas; papillary carcinomas; squamous cell carcinomas; lymphoepithelial carcinomas; basal cell carcinomas; piloma cell carcinomas; transitional cell carcinomas; papillary transitional cell carcinomas; adenocarcinomas; malignant gastrinomas; cholangiocarcinomas; hepatocellular carcinomas; combinations of hepatocellular carcinomas and cholangiocarcinomas; fibroadenomas; adenoid cystic carcinomas; adenocarcinomas of adenomatous polyps; familial adenomatous polyposis adenocarcinomas; solid tumors; malignant carcinoid tumors; Bronchoalveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; eosinophilic carcinoma; eosinophilic adenocarcinoma; basophilic carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; Adenocarcinoma; auditory canal adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; invasive ductal carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; Paget's disease of the breast; acinar cell carcinoma; adenosquamous carcinoma; squamous cell carcinoma Adenocarcinoma; malignant thymoma; malignant ovarian stromal tumor; malignant tecoma; malignant granulosa cell tumor; and malignant neuroblastoma; Sertoli cell carcinoma; malignant Leydig cell tumor; malignant lipid cell tumor; malignant paraganglioma; malignant extramammary paraganglioma; pheochromocytoma; angioglobulosarcoma; malignant melanoma; achromatic melanoma; superficial spreading melanoma; malignant melanoma of a giant pigmented nevus; epithelioid cell melanoma; malignant blue nevus; sarcoma; fibrosarcoma; malignant fibrous histiocytoma; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; fetal Rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; malignant mixed tumor; Müllerian duct mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; malignant mesenchymal tumor; malignant Brenner tumor; malignant phyllodes tumor; synovial sarcoma; malignant mesothelioma; undifferentiated germ cell tumor; embryonic carcinoma; malignant teratoma; malignant ovarian goiter; choriocarcinoma; malignant mesonephroma; angiosarcoma; malignant hemangioendothelioma; Kaposi's sarcoma; malignant hemangioendothelioma; lymphangiosarcoma; osteosarcoma; paraosteal osteosarcoma; chondrosarcoma; malignant chondroblastoma; mesenchymal chondrosarcoma; giant cell tumor of bone; Ewing's sarcoma;Malignant odontogenic tumors; ameloblastic odontosarcoma; malignant ameloblastoma; ameloblastic fibrosarcoma; malignant pineal glandoma; chordoma; malignant glioma; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrous astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroglioma; primitive neuroectodermal tumors; cerebellar sarcoma; gangliblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumors; malignant meningioma; neurofibrosarcoma; malignant schwannoma; malignant granular cell tumor; malignant lymphoma; Hodgkin's disease Hodgkin lymphoma; lateral granuloma; small lymphocytic lymphoma; diffuse large cell lymphoma; follicular lymphoma; mycosis fungoides; other designated non-Hodgkin lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative bowel disease; leukemia; lymphocytic leukemia; plasmacytic leukemia; erythroleukemia; lymphosarcomatic leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myelosarcoma; and pilocytic cell leukemia.

[0222] In some embodiments, cancer includes solid tumors. In some embodiments, tumors are adenocarcinoma, adrenal tumors, anal tumors, bile duct tumors, bladder tumors, bone tumors, hematological tumors, brain / CNS tumors, breast tumors, cervical tumors, colorectal tumors, endometrial tumors, esophageal tumors, Ewing's tumors, eye tumors, gallbladder tumors, gastrointestinal tumors, kidney tumors, laryngeal or hypopharyngeal tumors, liver tumors, lung tumors, mesothelioma, multiple myeloma, muscle tumors, nasopharyngeal tumors, neuroblastoma, oral tumors, osteosarcoma, ovarian tumors, pancreatic tumors, penile tumors, pituitary tumors, primary tumors, prostate tumors, retinoblastoma, rhabdomyosarcoma, salivary gland tumors, soft tissue sarcoma, melanoma, metastatic tumors, basal cell carcinoma, Merkel cell tumors, testicular tumors, thymic tumors, thyroid tumors, uterine tumors, vaginal tumors, vulvar tumors, or Wilms' tumor.

[0223] In certain embodiments, the cancer is selected from colon cancer, breast cancer, ovarian cancer, bladder cancer, kidney cancer, or cervical cancer.

[0224] Additional methods In a particular embodiment, a method for determining whether a drug (e.g., a test drug) is an anticancer agent is provided herein, comprising determining whether the test drug inhibits the expression or activity of the product of at least one autophagy gene or NF-κB gene (e.g., the genes listed in Table 1 or Table 2), wherein the test drug is determined to be an anticancer agent if it inhibits the expression or activity of the product of at least one autophagy gene or NF-κB gene (e.g., the genes listed in Table 1 or Table 2). Furthermore, a method for determining whether a guide RNA test drug is an anticancer agent is provided herein, comprising determining whether the guide RNA test drug is effective in inducing the Cas enzyme to cleave or bind a sequence in an autophagy gene or NF-κB gene (e.g., the genes listed in Table 1 or Table 2), wherein the guide RNA includes a DNA targeting segment that targets a guide RNA target sequence within the autophagy gene or NF-κB gene, and the test drug is determined to be an anticancer agent if it is effective in inducing the Cas enzyme to cleave or bind a sequence within the gene. The test agents disclosed herein may reduce the expression of the product of at least one gene disclosed herein by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the cell population.

[0225] In some embodiments, the test agent is a member of a library of test agents. The test agent may be any agent disclosed herein, including gRNA, TALEN or zinc finger endonuclease, interfering nucleic acid or small molecule. The test agents disclosed herein may inhibit the expression or activity of the product of at least one autophagy gene or NF-κB gene by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%. The test agents disclosed herein may inhibit the expression or activity of the product of at least one gene in Table 1 or Table 2 by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%.

[0226] Methods for determining whether a patient is a candidate for the cancer treatment provided herein are also provided herein. In some embodiments, the expression of gene products listed in Table 1 or Table 2 by cells in the tumor of interest indicates that the subject is a candidate for treatment. In some embodiments, the gene product is an mRNA product. In some embodiments, the gene product is a protein product. Protein products can be detected by IHC using antibodies specific to the protein product, or by flow cytometry (e.g., FACS). Gene products (e.g., mRNA products) can be detected by nucleic acid amplification, nucleic acid probes, or sequencing.

[0227] In some embodiments, methods are provided herein for targeting and killing cancer cells or tumor cells by first measuring the expression level of at least one autophagy gene or NF-κB gene (e.g., at least one gene listed in Table 1 or Table 2), and if the expression level exceeds a determined threshold, the cancer or tumor cells are targeted and killed by administering one of the drugs disclosed herein. The threshold for a gene (e.g., the genes in Table 1 or Table 2) can be determined by many techniques, including, but not limited to, determining the expression of the gene or gene product in diseased tissue (e.g., tumor or cancerous tissue) versus healthy tissue (e.g., tissue not associated with tumor or cancer). The threshold for a gene (e.g., the genes in Table 1 or Table 2) can be determined by comparing the expression of the gene product in cancer cells or tumors at a certain point in time with that at a later point in time. Healthy and diseased tissues can be collected from the subject or from different individuals. In other embodiments, the expression threshold for a gene or gene product is determined by testing the expression of the gene or gene product in tissue from a tissue bank or third-party source. For example, if tumor or cancer cells from diseased tissue of a subject or a third party show higher expression of a gene product, the subject is a candidate for treatment. If tumor or cancer cells from a later point in time show higher expression of a gene product, the subject is a candidate for treatment. [Examples]

[0228] While immune checkpoint inhibitors have revolutionized cancer treatment, the molecular determinants of tumor cell sensitivity to T cell-mediated killing remain largely unknown. A genome-wide CRISPR knockout screening to identify tumor cell genes / pathways that regulate T cell-mediated killing is described herein. This screening identified tumor cell antigen presentation and TNFα signaling as requirements for killing, and conversely, identified NF-κB signaling and autophagy as key protective mechanisms. Knockout of individual autophagy genes or pharmacological inhibition of autophagy sensitized various strains of tumor cells to T cell and / or TNFα-mediated killing. Conversely, inhibition of mTOR signaling, resulting in increased autophagy activity, protected tumor cells from T cell killing. Mechanistically, enhanced T cell / TNFα-mediated killing under conditions of impaired autophagy is associated with increased caspase-8 activation rather than defective NF-κB signaling, suggesting a role of autophagy in relatively early stages of the TNFα signaling pathway. Finally, genetic inactivation of tumor cell autophagy enhances the efficacy of T cell checkpoint inhibitors in tumor models, suggesting that autophagy is a key regulator of anti-tumor immunity. These findings suggest that targeting protective NF-κB or autophagy pathways may sensitize tumors to T cell-targeted immunotherapy.

[0229] To systematically elucidate the genes / pathways that regulate tumor cell sensitivity to T cell killing, multiple groups utilized pooled CRISPR / Cas9 screenings. These screenings confirmed the crucial roles of antigen presentation and IFNγ signaling in tumor cell killing. Furthermore, these screenings identified novel regulators of killing, including the tyrosine phosphatase Ptpn2, the apelin receptor APLNR, Pbrm1, and the SWI / SNF chromatin remodeling complex. Interestingly, some of these screenings also suggested important roles of TNFα or TRAIL signaling in tumor cells during the T cell killing process. Although successful, in most cases these screenings identified tumor cell genes necessary for T cell killing (i.e., single guide RNAs (sgRNAs) rich in surviving tumor cells).

[0230] Pooled, genome-wide CRISPR / Cas9 knockout (KO) screening conducted under carefully optimized conditions enabled the efficient identification of tumor cell genes that limit T cell killing. In addition to demonstrating the crucial role of TNFα / NF-κB signaling in regulating T cell-mediated tumor cell killing, the results reveal a previously unrecognized role of autophagy in protecting tumor cells from T cell-induced apoptosis. Here, we have shown that autophagy limits TNFα-dependent caspase-8 activation without modulating NF-κB pathway activity, and that genetic inhibition of autophagy sensitizes tumors to T cell checkpoint inhibitors. Therefore, the autophagy pathway appears to be a key regulator of immunotherapy responses, suggesting that inhibition of this pathway may enhance the efficacy of T cell-targeted therapies.

[0231] Identification of tumor cell genes that regulate sensitivity to T cell killing. To identify genes that regulate tumor cell sensitivity to cytotoxic T cell killing, we performed genome-wide CRISPR / Cas9 screening of MC38 colon adenocarcinoma cells. Tumor cells transduced with a mouse single guide RNA (sgRNA) KO library were intermittently administered with MHC class I restriction Ova peptide or scrambled control peptide, and activated CD8 isolated from OT-1 transgenic mice (expressing a T cell receptor that recognizes the Ova peptide) were also used. + T cells were incubated with sgRNA (Figure 1A). B2m KO cells (protected from T cell killing) were used as a positive control to optimize and validate the screening conditions. The goal was to achieve approximately 90% tumor cell killing during screening (Figure 9). After 24 hours of exposure to T cells, viable tumor cells were collected, and sgRNA expression in tumor cells intermittently treated with Ova versus control tumor cells was evaluated by NGS. Due to the high initial presentation of the library (approximately 2000x coverage), sgRNA presentation was maintained in tumor cells even after killing, allowing for efficient detection of depleted and enriched sgRNA (R 2 =0.95, Ova vs. control peptide intermittently administered cells) (Table 3, Figure 10). To identify genes that regulate tumor cell proliferation / survival independently of T cell killing, parallel screening was performed using library-modified tumor cells passaged for 12 population doubling cycles without the addition of T cells. A significant proportion of sgRNAs targeting known core essential genes were depleted in this parallel proliferation screening, while the expression of non-target sgRNAs remained largely unchanged (Figure 11), confirming the effectiveness and specificity of CRISPR / Cas9-mediated gene modification in MC38 cells.

[0232] Analysis of enriched sgRNAs identified antigen presentation and TNFα-induced apoptotic signaling as crucial pathways necessary for T cell-mediated tumor cell killing (Figure 1B). As expected, several sgRNAs targeting B2m and MHC class I molecule H2-K1 were significantly enriched, confirming that T cell killing is dependent on the cell surface presentation of the Ova peptide. The recovery of all six sgRNAs targeting H2-K1 and B2m further highlights the effectiveness of CRISPR / Cas9-mediated gene modification in cells. Interestingly, several sgRNAs targeting Tnfrsf1a (TNF receptor 1, TNFR1), caspase-8 (required for TNFα-induced apoptosis), and Tradd (an important adapter molecule in the TNFα signaling pathway) were also enriched (Figure 1B and C), suggesting that T cell-derived TNFα plays a vital role in tumor cell death. Finally, sgRNAs targeting several genes in the mTOR signaling pathway were enriched (e.g., Mtor, Mlst8, Rictor, Mapkap1, Tti2, Telo2, Tti1). As shown below, inactivation of mTOR signaling protects tumor cells from T cell killing by resulting in increased autophagy activity.

[0233] Analysis of depleted sgRNAs identified NF-κB signaling and autophagy as two key pathways that limit T cell-mediated tumor cell killing. Multiple sgRNAs targeting genes involved in NF-κB signaling, including members of LUBAC (Sharpin, Rbck1, and Rnf31), TAK1 (Map3k7 / Tak1, Tab1, Tab2), and the Nemo complex (Chuk, Ikbkb, and Ikbkg), were significantly depleted. Furthermore, sgRNAs targeting additional NF-κB pathways or NF-κB target genes (Traf2, Tbk1, Mapkapk2, Rela, Cflar, and Tnfaip3) were also depleted (Figure 1D and E). These findings are consistent with the important role of TNFα in T cell-mediated killing, as the NF-κB pathway is well-established in limiting TNFα-dependent apoptosis through transcriptional induction of survival genes such as Cflar (c-Flip).

[0234] Interestingly, several sgRNAs targeting genes in the autophagy pathway (Rb1cc1, Pik3c3, Nrbf2, Atg13, Atg14), membrane material transport (Atg9a, Atg2a, Tax1bp1), or autophagosome proliferation (Atg5, Atg12, Atg10) were significantly depleted (Figure 1, F and G). These data suggest that autophagy activity in tumor cells plays a protective role in relation to T cell killing. While autophagy is known to limit cell death in other environments (e.g., nutrient deficiency), this is the first indication that autophagy plays a crucial role in T cell-induced tumor cell apoptosis. Importantly, sgRNAs targeting NF-κB pathway genes or autophagy genes were not depleted in parallel cell proliferation screening, and follow-up experiments confirmed that knockout of autophagy genes in MC38 cells did not impair cell proliferation (Figure 12), indicating that knockout of these genes reduces cellular fitness, particularly in T cell-mediated killing. The protective role of autophagy is consistent with the observation that sgRNAs targeting multiple mTOR pathway genes were enriched in the screening, as mTOR signaling has an established role in inhibiting autophagy (Figure 1B).

[0235] TNFα-induced apoptotic signaling plays a crucial role in T cell-mediated tumor cell killing. CRISPR screening demonstrated a crucial role of T cell-derived TNFα in tumor cell killing. While cytotoxic T cell killing is thought to be primarily due to the release of perforin and granzyme from T cell granules, the role of TNFα (and other cell death receptor ligands) in this process has been previously proposed. TNFα can promote cell death either by apoptosis (caspase-8 dependent) or necroptosis, but several molecular checkpoints (including NF-κB activation) function to inhibit TNFα-induced cell death. Therefore, the default response of most cells to TNFα is thought to be the induction of pro-survival and pro-inflammatory genes. See Figure 2A for a simplified model of TNFα / NF-κB signaling.

[0236] As shown in Figure 2B, the addition of a TNFα-blocking antibody to the T cell killing assay significantly reduced MC38 cell death (CRISPR / Cas9-mediated inactivation of B2m), confirming the role of TNFα signaling. It is important to note that the effect of TNFα blockade on tumor cell killing in the assay (using pre-activation T cells) is not due to inhibition of T cell function, as TNFα blockade does not limit the killing of TNFα-insensitive tumor cells (Figure 13). Consistent with the significant contribution of TNFα to T cell killing in MC38 cells, soluble TNFα promoted MC38 cell death via an apoptotic mechanism (i.e., killing was blocked by the caspase inhibitor z-VAD-FMK) (Figure 2C). Furthermore, the generation of KO cell lines using CRISPR / Cas9 confirmed that TNFα-mediated killing of MC38 cells is entirely dependent on TNFR1 and partially dependent on FADD (an adapter protein crucial for the construction of the caspase-8 activation complex) and RIPK1 (a kinase that interacts with caspase-8 to promote apoptosis) (Figure 2C).

[0237] The ability of TNFα to induce caspase-8 activation and apoptosis was evaluated in a panel of tumor cell lines. Most of these cell lines (CT26, B16F10, 4T1) were not killed by TNFα, while EMT6 cells (along with MC38) showed TNFα-induced caspase-8 activation and apoptosis (Figure 2D and E). (See Figure 22 for examples of human cancer cell lines sensitive to TNFα killing). As mentioned above, NF-κB signaling is thought to play a crucial role in limiting TNFα-dependent apoptosis. However, no clear differences in NF-κB activation were observed between TNFα-sensitive and resistant cell lines. TNFα-sensitive MC38 and EMT6 cells showed efficient degradation of Iκ-Bα (which inhibits NF-κB by sequestering it in the cytoplasm) and phosphorylation of the NF-κB subunit p65 / Rela, similar to what was observed in TNFα-resistant B16F10 and 4T1 cells (Figure 2F, Figure 14). Furthermore, MC38 cells showed potent TNFα-inducible expression of two NF-κB target genes, A20 and ICAM-1 (Figure 2G). Therefore, while the NF-κB pathway clearly limits TNFα dependence, susceptibility to TNFα-induced killing may be attributable to factors other than defective NF-κB activation.

[0238] NF-κB signaling limits tumor cell killing by T cells and TNFα. To confirm screening data illustrating the role of the NF-κB pathway in limiting T cell killing of MC38 cells, three key NF-κB pathway genes (Map3k7 / Tak1, Rbck1, and Rela) were inactivated using sgRNAs depleted during screening. Inactivation of Map3k7 with multiple sgRNAs sensitized MC38 cells to T cell killing, and the degree of Map3k7 protein depletion by different sgRNAs correlated with the degree of sensitization, demonstrating these effects as expected (Figure 3A and B). Map3k7 knockout significantly inhibited TNFα-mediated induction of NF-κB target genes A20 and ICAM-1, confirming that Map3k7 knockout disables the NF-κB pathway (Figure 3E). Similar effects on T cell killing were observed with knockout of Rbck1 (Figure 15) and NF-κB subunit p65 (Rela) (Figure 16), further exploring the protective effects on NF-κB signaling.

[0239] Importantly, in the presence of saturated TNFα-blocking antibodies, Map3k7 KO (as well as Rbck1 and Rela KO) no longer enhanced T cell-mediated killing of MC38 cells (Figure 3C, as well as Figures 15 and 16). This indicates that the protective effect of the NF-κB pathway reflects TNFα-mediated apoptosis inhibition (more so than perforin / granzyme-mediated killing). Consistent with this hypothesis, Map3k7, Rbck1, and Rela KO significantly increased TNFα-inducible caspase 8 activation and cell death (Figures 3D and E, Figures 15 and 16). In contrast to its effect on TNFα-dependent apoptosis, Map3k7 KO (as well as Rbck1 and Rela KO) did not affect MC38 cell killing by the chemotherapeutic drugs doxorubicin and paclitaxel, indicating that NF-κB did not broadly protect these cells from any apoptosis-inducing stimuli (Figure 3F, Figures 15 and 16).

[0240] Autophagy limits tumor cell killing by T cells and TNFα. To investigate the role of autophagy in limiting T-cell-mediated tumor cell killing, three essential autophagy genes (Rb1cc1, Atg9a, and Atg12) were inactivated using sgRNAs depleted through screening. Inactivation of Rb1cc1 (also known as FIP200) by multiple sgRNAs sensitized MC38 cells to T-cell killing, and the degree of Rb1cc1 protein depletion correlated with the degree of sensitization, confirming these effects as expected (Figure 4A and B). Similar results were observed with knockout of Atg9a (Figure 17) and Atg12 (Figure 18), further exploring the protective role of autophagy. Importantly, knockout of these three key autophagy components does indeed impair autophagy activity in MC38 cells, as indicated by a significant increase in the level of the autophagy cargo receptor p62 (also known as sequestosome 1, sqstm1) (Figure 5A, Figures 17 and 18) and a decrease in the level of LC3-II, the lipidized form of the autophagosome protein LC3 (Figure 18). p62 increases in level when autophagy is inhibited because it binds ubiquitinated proteins to autophagosomes, which themselves are degraded by autophagy. LC3-II is converted to LC3-II via binding to phosphatidylethanolamine, initiating autophagosome formation and elongation. Therefore, inhibiting autophagy upstream of this conversion inhibits LC3-II formation (Deretic, 2008).

[0241] Autophagy has been proposed to inhibit apoptosis through multiple mechanisms, such as mitophagy—particularly the removal of damaged mitochondria that can trigger outer membrane permeation and apoptotic cascades. A series of experiments were conducted to gain insight into the mechanisms by which autophagy limits T cell-mediated tumor cell killing. Genetic inactivation of autophagy had little to no effect on cell surface MHC-I expression or Ova peptide presentation in MC38 cells (Figure 23).

[0242] As shown in Figure 4C, Rb1cc1 knockout had only a slight effect on killing MC38 cells in the presence of a TNFα-blocking antibody, indicating that the protective effect of autophagy associated with T cell killing is primarily mediated by the inhibition of TNFα-dependent apoptosis. Similar results were observed with Atg9a and Atg12 knockout cells (Figures 17 and 18). Consistent with these observations, knockout of Rb1cc1, Atg9a, or Atg12 significantly increased TNFα-dependent caspase 8 activation and apoptosis (Figure 4D, Figure 5A, and Figures 17 and 18). Therefore, autophagy appears to modulate the early stages of the TNFα signaling cascade at the level of caspase 8 activation (upstream of any mitochondrial involvement). Consistent with the specific signaling function of autophagy in this setting, knockout of autophagy genes did not sensitize MC38 cells to killing with the chemotherapeutic drugs doxorubicin or paclitaxel (Figure 4E, Figures 17 and 18).

[0243] Considering that both the NF-κB pathway and the autophagy pathway limit T cell-mediated tumor cell killing, we investigated the possibility of mechanistic connections between these pathways. One possibility is that inactivation of autophagy somehow leads to abnormalities in NF-κB signaling, thereby sensitizing to TNFα-mediated apoptosis. However, knockout of the autophagy gene Rb1cc1 did not affect TNFα-mediated Iκ-Bα degradation, induction of the NF-κB target gene A20, or induction of several chemokines that require NF-κB for expression (e.g., CXCL10 and CCL2) (Figure 5B, Figure 20). Therefore, autophagy does not limit TNFα-mediated apoptosis in MC38 cells as a result of its role in NF-κB activation. Conversely, levels of the autophagy receptor p62 were unaffected by Map3k7 knockout (Figure 5C), suggesting that an intact NF-κB pathway is not required for autophagy activity.

[0244] Next, we investigated the mechanism by which TNFα kills cells when autophagy is inhibited. Our observation that inactivation of Rb1cc1 increases the activation of TNFα-inducible caspase 8 suggests that in situations where the autophagy pathway is impaired, TNFα kills cells via apoptosis rather than necroptosis. Supporting this claim, pancaspase inhibitors blocked TNFα-mediated killing in Rb1cc1 KO cells (Figure 5D), while necropsis inhibitors had no effect (Figure 5H). Consistent with these observations, TNFα did not induce phosphorylation of mixed kinase domain-like protein (MLKL), a mediator of necroptosis, in Rb1cc1 KO cells (Figure 51).

[0245] TNFα-induced apoptosis can occur via multiple molecular mechanisms distinguished by the involvement of the kinase RIPK1. To enable genetic analysis of TNFα signaling in relation to autophagy inhibition, autofinib, a selective small molecule inhibitor of the lipid kinase Vps34, was employed. It is essential for autophagosome formation. Treatment of MC38 cells with autofinib increased TNFα-mediated caspase 8 activation and killing (and significantly increased p62 levels, confirming blockade of autophagy) (Figure 5E and F). Importantly, autofinib did not affect TNFα-mediated Iκ-Bα degradation (Figure 5F), indicating that impaired autophagy does not lead to defects in the NF-κB pathway (consistent with the Rb1cc1 KO data described above).

[0246] It is well established that one of the key mechanisms by which cells limit TNFα-induced killing is the inhibition of RIPK1 apoptotic activity. Among the molecular events contributing to this “early checkpoint” in the TNFR1 signaling pathway is cIAP-mediated ubiquitination of RIPK1. Therefore, inhibition of cIAP function by Smac mimetic promotes FADD / RIPK1 / caspase-8-dependent apoptosis (see model A in Figure 2). Consistent with this model, CRISPR-mediated inactivation of Ripk1, Fadd, or Tnfrsf1a significantly reduced TNFα-induced killing in the presence of Smac mimetic (Figure 5G). However, inactivation of Ripk1, Tnfrsf1a, or Fadd also significantly reduced TNFα-induced killing in the presence of autofinib, while inactivation of Ripk1 had no effect (Figure 5G). Therefore, in cells with impaired autophagy, TNFα-induced apoptosis is FADD / caspase-8 dependent but not RIPK1 dependent, suggesting that the early checkpoint of the TNFR1 signaling pathway continues to function. Thus, autophagy appears to inhibit TNFα-induced apoptosis by limiting the formation and / or activity of the FADD / caspase-8 complex and not limiting RIPK1 activity. Inactivation of autophagy did not affect the total protein levels of TNFR1, TRADD (TNFR1-associated death domain protein), or FADD, indicating that the enhancement of TNFα-induced apoptosis is not simply caused by elevated levels of these key pathway components (Figure 24).

[0247] Considering that both the NF-κB pathway and the autophagy pathway limit T cell-mediated tumor cell killing, we investigated the possibility of mechanistic connections between these pathways. One possibility is that inactivation of autophagy leads to abnormalities in NF-κB signaling, thereby sensitizing to TNFα-mediated apoptosis. However, knockout of Rb1cc1 did not affect TNFα-mediated degradation of Iκ-Bα, induction of the NF-κB target gene A20, or induction of several chemokines that require NF-κB for expression (e.g., CXCL10 and CCL2) (Figure 4G and Figure 20). Therefore, even if autophagy is impaired, NF-κB activation is not impaired. Conversely, levels of the autophagy receptor p62 were unaffected by Map3k7 knockout (Figure 4H), suggesting that an intact NF-κB pathway is not necessary for autophagy activity.

[0248] TRAIL promotes apoptosis through the activation of two TNFRSF family receptors, TRAIL-R1 and TRAIL-R2. To determine whether autophagy can also restrict downstream apoptotic signaling of TRAIL-R, cancer cells were attacked with TRAIL in the absence or presence of autofinib. As shown in Figures 21A–C, blocking autophagy increased caspase-8 activation and TRAIL-induced apoptosis in human cancer cells, suggesting that autophagy can restrict apoptotic signaling by multiple cell death receptors (presumably via the effect of the FADD / caspase-8 complex activity, which is essential for the induction of apoptosis by both TNFα and TRAIL). Although MC38 cells were sensitized to TRAIL by autophagy inhibition, these cells were more effectively killed by TNFα (Figures 21A–F).

[0249] Tumor cell mTOR signaling enhances sensitivity to T cell / TNFα-mediated killing. Multiple sgRNAs targeting mTOR pathway genes (e.g., Mlst8, Mtor, Rictor, Mapkap1) were enriched in the screening, suggesting that mTOR signaling is required for efficient tumor cell killing. The mTOR pathway is a crucial regulator of cellular metabolism, linking trophic levels and growth factors to cell growth and proliferation. Consistent with its role in promoting cell proliferation, mTOR signaling inhibits autophagy activity through multiple mechanisms. Given our understanding of the protective role of autophagy, it appears that mTOR may enhance the susceptibility of tumor cells to T cell-mediated killing by inhibiting autophagy.

[0250] To confirm the screening results, Mlst8 (an essential component of both mTORC1 and mTORC2, which are mTOR signaling complexes) was inactivated using sgRNA enriched during screening. Inactivation of Mlst8 inhibited the activity of both mTORC1 and mTORC2, as evidenced by a decrease in phospho-S6 (mTORC1-dependent) and phospho-Akt levels (mTORC2-dependent) (Figure 6A). Consistent with the inhibition of autophagy by mTOR signaling, Mlst8 KO cells showed decreased p62 levels and confirmed increased autophagy activity (Figure 6A). The increased autophagy in Mlst8 KO cells was associated with decreased sensitivity to both TNFα and T cell-mediated killing (Figure 6B and C). Importantly, the magnitude of the effect of each Mlst8 sgRNA on tumor cell killing correlated with the degree of Mlst8 protein depletion (Figure 6A), confirming that these effects were as expected. To further illustrate the effect of the mTOR pathway on tumor cell killing, blocking mTORC1 signaling with rapamycin reduced phospho-S6 and p62 levels (indicating increased autophagy activity) (Figure 6D). Similar to Mlst8 knockout, inhibition of mTORC1 with rapamycin significantly reduced both TNFα and T cell-mediated killing (Figure 6E and F).

[0251] These findings regarding the effects of mTOR regulation further support the importance of autophagy as a protective mechanism for tumor cells. Figure 6G shows the regulation of T cell-mediated tumor cell killing by various signaling pathways identified through screening.

[0252] Autophagy protects various types of cancer cells from T cell and TNFα-mediated killing. To extend our understanding of the protective role of autophagy, we evaluated the effects of autophagy inhibition in a panel of cancer cell lines using autofinib and another Vps34 blocker, SAR405. Although both autofinib and SAR405 target Vps34, these inhibitors are structurally different and therefore may have different off-target effects. Both autophagy inhibitors significantly increased TNFα-mediated killing in multiple mouse and human cancer cell lines from different strains (e.g., colon, breast, lung), including cell lines that were not sensitive to TNFα at baseline (Figure 7A, Figure 22). The autophagy inhibitors significantly increased p62 levels (confirming autophagy blockade) and enhanced TNFα-induced caspase-8 activation in human breast cancer cells (Figure 7B). Therefore, the protective role of autophagy appears to be broadly relevant from the perspective of TNFα therapy.

[0253] To date, it has been shown that when T cells are activated through the involvement of the T cell receptor by the MHC class I / peptide complex of target cells, TNFα contributes to tumor cell killing. Under these conditions, autophagy in tumor cells has been shown to play a substantial protective role. To further support the potential clinical relevance of these findings, we sought whether autophagy also modulates tumor cell killing by T cells stimulated with CD3 bispecific antibodies. These antibodies, a novel and promising class of therapeutics, bind to the tumor antigen with one arm and to CD3 on T cells with the other arm, thereby cross-linking tumor cells with cytotoxic T cells to enable tumor cell killing (Figure 7C). We used a breast tumor antigen xCD3 bispecific antibody (generated with Regeneron) to promote the killing of ZR-75-1 human breast cancer cells by human T cells. As shown in Figure 7C, inhibition of autophagy with SAR-405 significantly increased tumor cell killing. Consistent with the pharmacological blockade of autophagy, genetic inactivation of autophagy by Rb1cc1 knockout enhanced CD3 bispecific antibody-induced killing (Figure 7D and E). In summary, these findings confirm the protective role of autophagy in CD3 bispecific antibody-induced T cell killing and its protective role in human breast cancer cells.

[0254] Genetic inactivation of autophagy sensitizes tumors to immunotherapy. To further evaluate the clinical relevance of our findings, we sought to determine whether genetic inactivation of autophagy enhances tumor responsiveness to T cell checkpoint inhibitors. Rb1cc1 knockout in EMT6 mouse mammary cancer cells resulted in a significant increase in p62 protein levels, confirmed decreased autophagy activity (Figure 8A), and increased sensitivity of EMT6 cells to TNFα-induced apoptosis (Figure 8B). Control or Rb1cc1 knockout cells were transplanted into mice, and 3 days after transplantation, the mice were treated with either a control antibody or a combination of PD-1 and CTLA4 blocking antibodies. As shown in Figure 8C, combined blocking of PD-1 and CTLA4 promoted complete regression of Rb1cc1 knockout tumors, while having only a slight growth inhibitory effect on control EMT6 tumors. Individual tumor growth curves show 10 / 10 regression in Rb1cc1 knockout tumors compared to 0 / 10 in control tumors (Figure 8D).

[0255] Next, similar experiments were performed using MC38 tumors. As shown in Figure 8E, knockout of Rb1cc1 in MC38 cells resulted in impaired autophagy, as evidenced by a significant increase in p62 protein levels. Co-blockade of PD-1 + CTLA4 reduced the growth of control MC38 tumors, but the effect of checkpoint blockade on Rb1cc1 KO tumors was significantly greater (Figure 8F). The delayed growth of Rb1cc1 KO tumors versus control tumors in response to immunotherapy is readily apparent from the individual tumor growth curves shown in Figure 8G. In summary, these findings indicate that tumors with impaired autophagy exhibit increased responsiveness to clinically relevant T cell checkpoint inhibitors.

[0256] The effects of Tnfrsf1a (encoding TNFR1) knockout were tested in association with Rb1cc1 knockout tumors. As disclosed herein, the increased TNFα-mediated apoptosis observed in Rb1cc1 knockout cells was reversed in Rb1cc1 / Tnfrsf1a double knockout EMT6 cells (Figure 8A and B). In vivo gene inactivation of Tnfrsf1a limited sensitization to immunotherapy observed in Rb1cc1 knockout tumors (Figure 8C and D). Therefore, Tnfrsf1a knockout is protective in association with tumors with impaired autophagy. In control tumors with intact autophagy, Tnfrsf1a knockout did not protect the tumor from immune checkpoint blockade, but actually sensitized it to treatment (Figure 8C). It is clear that Tnfrsf1a knockout has a context-dependent effect on tumors. Nevertheless, the data indicates that TNFα-induced apoptosis is a crucial component of anti-tumor immunity in situations where tumor cell autophagy is impaired.

[0257] Leukocyte infiltration in Rb1cc1 KO tumors was evaluated. In both the EMT6 and MC38 models, Rb1cc1 KO tumors showed an increased number of CD45+ leukocytes compared to control tumors (Figure 26). However, while overall leukocyte infiltration increased, preferential infiltration of CD4+ or CD8+ T cells was not observed. Nevertheless, both increased leukocyte infiltration and increased sensitivity to T cell-mediated killing may contribute to the enhanced response to immunotherapy observed in autophagy-impaired tumor models.

[0258] Using genome-wide CRISPR screening, we identified TNFα signaling in tumor cells as a critical component of T cell-mediated killing, and conversely, identified its protective role in both the NF-κB pathway and the autophagy pathway. The data presented herein indicate that autophagy limits TNFα-mediated tumor cell killing by inhibiting caspase-8 activation upstream of mitochondrial involvement. More specifically, autophagy appears to inhibit the formation and / or activity of the FADD / caspase-8 complex, which is consistent with our observation that autophagy can limit tumor cell killing by TRAIL, and this also induces FADD / caspase-8-mediated cytotoxicity.

[0259] These in vivo experiments have shown that genetic inactivation of autophagy in tumor cells enhances the efficacy of T cell checkpoint inhibitors, suggesting that pharmacological inhibition of autophagy may also enhance the efficacy of such therapies. While the role of autophagy in cancer has been widely studied, the extent to which this process is crucial for tumor cell proliferation / survival remains unclear. Nevertheless, the data presented herein suggest that autophagy inhibitors may sensitize cancer cells to TNFα-induced apoptosis, in addition to their potential regulation of tumor cell proliferation.

[0260] In summary, the analysis presented herein revealed the role of autophagy in limiting the susceptibility of tumor cells to T cell-mediated killing. The identification of autophagy as a potential mechanism for tumor immune evasion suggests that autophagy inhibitors may enhance the efficacy of T cell-mediated immunotherapy. Furthermore, the data provided herein demonstrate that autophagy limits T cell and TNFα-mediated tumor cell killing by inhibiting caspase-8 activation upstream of mitochondrial involvement. Moreover, inhibition of autophagy does not sensitize tumor cells to chemotherapy-induced apoptosis, suggesting a relatively specific role of autophagy in regulating TNFα signaling rather than a more general anti-apoptotic function (e.g., mitophagy). Therefore, the data provided herein suggest a novel therapeutic use of autophagy inhibitors, namely making cancer cells more susceptible to T cell killing even when cancer cells are not dependent on autophagy for proliferation / survival.

[0261] Materials and methods cancer cell lines MC38 mouse colon cancer cells were obtained from the U.S. National Institutes of Health (NIH) repository. 4T1, B16F10, CT26, EMT6, L929 mouse cancer cells, and ZR75-1, HCT-116, HeLa, BT-20, Me-180, MDA-MB-361 human cancer cells, as well as human embryonic kidney (HEK) 293T human cells, were from the U.S. Cell Culture and Cell Lineage Preservation Center (ATCC). Colon26 mouse cancer cells were from the Cancer Therapy and Diagnostics Division of the U.S. National Cancer Institute (operated by Charles River Laboratories). All cells were cultured in the manufacturer's recommended medium. All cell lines were validated in 2016 by short tandem repeat profiling (IDEXX BioResearch).

[0262] mouse The OT-1 C57BL / 6-Tg(TcraTcrb)1100Mjb / J mouse (003831), C57BL / 6 mouse (000664), and Balb / c mouse (000651) were from Jackson Laboratory.

[0263] CRISPR knockout sgRNA library and genome-wide screening Mouse sgRNA libraries (GeCKO A and B; total amount of approximately 130,000 sgRNAs) and the pLentiCas9-Blast plasmid were purchased from GenScript. Whole-genome CRISPR / Cas9 screening was performed using MC38 cells engineered to express Cas9 nuclease by lentiviral infection (pLentiCas9-Blast) and selection with blastosidine (12 μg / ml). MC38-Cas9 cells were infected with the mouse GeCKO libraries (A and B combined) at an infection fold of 0.3, so that each sgRNA was introduced into approximately 200 cells. Cells were selected with 12 μg / ml puromycin for 3 days, and approximately 130 million cells were set aside as a reference sample. Seven days after infection, a T-cell killing assay was set up three times using the same method. Cells expressed in a library at approximately 2000x were intermittently administered the Ova peptide, while cells expressed in a library at approximately 200x were intermittently administered the control peptide. After intermittent peptide administration, cells were activated CD8 +T cells (isolated from OT-1 mice) were co-cultured with tumor cells in a 1:3 E:T ratio. After 24 hours of co-culture, when approximately 90% of the tumor cells had been killed, non-adherent cells were washed away with PBS, and live tumor cells were collected. Genomic DNA extraction was then performed using the DNeasy Blood & Tissue Kit (Qiagen), and an NGS library was prepared as described above. The NGS library was then multiplexed and run on NextSeq500 (Illumina) to generate 80 base pair (bp) single-ended reads. After demultiplexing with bcl2fastq software (Illumina), reads were screened for 16 bp vector sequences adjacent to sgRNA, and downstream 20 bp sgRNA reads were extracted for sgRNA counting. Reads were then counted using MAGECK, and gene / sgRNA enrichment and statistical analysis were performed. MC38 cells grown without T cell addition were harvested one week post-infection, and their sgRNA expression was compared to that of reference control cells.

[0264] The sgRNA sequences used in the validation experiment (gene name, sgRNA ID, sgRNA number and sequence if applicable) are as follows (each sgRNA was cloned into either the pLenti-Guide-Puro or pLentiCRISPR v2 plasmid): Map3k7,MGLibA_30286,1,GATGATCGAAGCGCCGTCGC(SEQ ID NO: 16);Map3k7,MGLibA_30288,3,GGGACTTACTGGATTCAGGC(SEQ ID NO: 18);Map3k7,MGLibB_30278,5,TTAACTCAGGTTGTCGGAAG(SEQ ID NO: 20);Rbck1,MGLibA_44718,1,AGTACGCCCGGATATGACAG( Sequence ID 22); Rbck1, MGLibA_44720, 3, CAGCTTACCGGTGGTGACTC (Sequence ID 24); Rbck1, MGLibB_44706, 5, CGGGCGTACTGTGAGCCAAA (Sequence ID 26); Rela, MGLibA_45073, 2, TCATCGAACAGCCGAAGCAA (Sequence ID 29); Rela, MGLibA_45074, 3, GCCCAGACCGCAGTATCCAT (Sequence ID 30); Rela, MGLibB_4 5061, 6, ACTTACCTGAGGGAAAGATG (Sequence ID 33); Rb1cc1, MGLibA_44690, 3, TCAAGATAGACCCAATGATG (Sequence ID 36); Rb1cc1, MGLibB_44675, 4, CTCCATTGACCACCAGAACC (Sequence ID 37); Rb1cc1, MGLibB_44676, 5, ATTTGAACAGTCCTCCAGAT (Sequence ID 38); Atg9a, MGLibA_05661, 1, CATAGTCCA CACAGCTAACC(SEQ ID NO: 40);Atg9a,MGLibA_05662,2,TTGGGATCCGAAGAGCATGT(SEQ ID NO: 41);Atg9a,MGLibB_05661,4,TCTATAACATTTGCTGCTAT(SEQ ID NO: 43);Atg12,MGLibA_05621,3,GAGCGAACCCGGACCATCCA(SEQ ID NO: 48);Atg12,MGLibB_05620,5,CCTGCATTACTGCAAATCCC(SEQ ID NO: 50);Atg12,MGLibB_05621,6,TTCTGGCTCATCCCCATGCC(Sequence ID 51);Tnfrsf1a,MGLibA_55116,GTGTCTCACTCAGGTAGCGT(Sequence ID 52);Ripk1,MGLibA_45635,3,GTACACGTCCGACTTCTCCG(Sequence ID 53);Fadd,MGLibA_16988,2,TAGATCGTGTCGGCGCAGCG(Sequence ID 54);B2M,MGLibA_06111,1,AGTAT ACTCACGCCACCCAC(SEQ ID NO: 55);Rb1cc1,HGLibB_40366,6,GGCTGCAATCATGGCCAACC(SEQ ID NO: 56);Mlst8,MGLibA_31480,1,GACTCCGTCATAACTGATGA(SEQ ID NO: 57);Mlst8,MGLibA_31482,3,CGAAGCATGATTGCTGCTGC(SEQ ID NO: 58);Mlst8,MGLibB_31471,4,AGCACTCACGGCACTATTGA(SEQ ID NO: 59).

[0265] Lentiviral packaging / transduction and CRISPR-mediated gene knockout In validation experiments, sgRNAs targeting the target gene were cloned into pLenti-Guide-Puro or pLentiCrispr v2 (GenScript). HEK293T cells were transfected with pLenti-Cas9-Blast, pLenti-Guide-Puro, or pLentiCrispr v2, as well as the packaging plasmids psPAX and pMD2.G, using Lipofectamine 2000. After 6 hours, the medium was replaced with complete growth medium. After 72 hours, the supernatant containing the lentivirus was collected, filtered, concentrated by ultracentrifugation, and stored at -80°C. For lentiviral transduction, tumor cells were seeded in complete medium containing 5 ug / ml polyblen and lentivirus at an MOI of 0.3. Using a sufficient number of HEK293T cells to maintain library expression, mouse GeCKO A and B plasmid libraries were pooled and packaged into lentiviruses in the same manner. After 24 hours, the culture medium was replaced with a complete growth medium containing DNase, and the lentivirus was concentrated as described above.

[0266] Isolation and activation of CD8+ T cells CD8 +T cells were isolated from the spleens and lymph nodes of 6- to 8-week-old male OT-1 mice. These mice contain a transgenic insert of the murine Tcra-V2 and Tcrb-V5 genes. The transgenic T cell receptor was designed to recognize ovalbumin peptide residues 257-264 in the context of the H-2Kb MHC class I protein. In some experiments, human CD8+ T cells were isolated from PBMC. T cells were activated in vitro with CD3 / CD28 beads at a bead:cell ratio of 1:2 for 2-3 days. T cells were activated in RPMI-1640 medium containing 20 ng / ml of murine IL-2, 10% heat-inactivated fetal bovine serum, 20 mM HEPES, 2 mM L-glutamine, 1 mM sodium pyruvate, 0.05 mM 2-mercaptoethanol, and 50 U / ml penicillin / streptomycin. In human tumor cell killing experiments using a CD3 bispecific antibody, human T cells were isolated from peripheral blood mononuclear cells (PBMC) (ReachBio) using the Dynabeads Untouched Human T Cell Kit (Thermo Fisher Scientific).

[0267] In vitro cytotoxicity assay MC38 cells were seeded at 34,000 cells per 24-well and were intermittently dosed with 1 ng / ml of Ova or scrambled peptide starting 24 hours after seeding. The intermittently dosed cells were cultured with activated CD8 + T cells (isolated from OT-1 mice) at the indicated E:T ratios. After 24 hours, non-adherent tumor cells were washed away with PBS and cell viability was assessed. Where indicated, neutralizing TNFα antibody or isotype control antibody was added at a concentration of 10 or 20 μg / ml.

[0268] Human ZR-¬75-1 cells were seeded at 100,000 cells per 24-well. After 24 hours, cells were cultured in the absence or presence of 5 μM of the autophagy inhibitor SAR-405 and in the presence of 12 ng / ml of breast tumor antigen xCD3 or a control (not bound to ZR-¬75-1 cells) bispecific antibody with activated CD8 +T cells (isolated from human PBMCs) were incubated for 24 hours at a specified E:T ratio.

[0269] The effects of TNFα, TRAIL, doxorubicin, or paclitaxel on cell viability were evaluated after 24-hour incubation at the specified concentrations. The effects of 5 μM autofinib or SAR-405 on TNFα (10 ng / ml) or TRAIL (10 ng / ml or 50 ng / ml)-induced killing were evaluated after 24-hour incubation unless otherwise noted. In all cases, cell viability was measured using the CCK8 cell counting kit-8 (CCK-8) reagent, which reduces cell dehydrogenase activity and produces a yellow formazan dye (Dojindo). Absorbance was measured using a SpectraMax M3 microplate reader (Molecular Devices).

[0270] Xenograft experiment In the EMT6 xenotransplant experiment, 5 × 10 6 The cells were subcutaneously injected into the right flank of 6-8 week old female BALB / c mice. Three days after transplantation, the mice were treated with either a CTLA-4 plus PD-1 blocking antibody or an isotype control (n=10 mice / group). On the first day of treatment, a CTLA-4 plus PD-1 blocking antibody (5 mg / kg) was administered by intraperitoneal injection. On days 3 and 6 of treatment, a CTLA-4 antibody (2.5 mg / kg) was administered. On days 4, 8, 11, and 15, a PD-1 antibody of 5 mg / kg was administered. Tumor growth was monitored three times a week with calipers, and the tumor volume (mm3) was calculated using the following formula: 1 / 2 × length × width 2 This was estimated using [the specified method].

[0271] In the MC38 xenotransplant experiment, 3 × 10 5The cells were subcutaneously injected into the right flank of 6-8 week old female C57BL / 6 mice. Ten days after transplantation, when the tumor volume was approximately 70 mm3, the mice were randomized and treated with either CTLA-4 plus PD-1 blocking antibody or isotype control as described above (n=7-12 mice / group). In tumor experiments using CRISPR-modified cells, Cas9 protein and sgRNA were delivered to the cells via transient ribonucleoprotein transduction to overcome the increased immunogenicity associated with lentiviral modification. The sgRNA sequences were CUCCAUUGACCACCAGAACC for Rb1cc1 KO, UUCUCCCGGUCACCAAG for Tnfrsf1a KO, and AAAUGUGAGAGAUCAGAGUAAU for non-targeting. After transduction, clones were isolated and tested for gene knockouts. For MC38 cells, a pool of eight knockout clones was used for tumor experiments, and for EMT6 cells, a pool of four knockout clones was used.

[0272] Antibodies and reagents The PD-1 blocking antibody (clone RMP1-14) and rat IgG2a isotype control antibody were manufactured by BioXCell. An in-house version of the CTLA4 blocking antibody (clone 9D9) based on isotype IgG2a was generated using the publicly available primary sequence. The CD3 bispecific antibody was generated in Regeneron using the previously described method (Murphy et al., 2014; Smith et al., 2015). The mouse reactive TNFα neutralizing antibody (clone MP6-XT22) and rat IgG1 isotype control antibody were manufactured by Biolegend. The human reactive TNFα neutralizing antibody (clone MAB1) and mouse IgG1 isotype control antibody were manufactured by Biolegend. Recombinant mice and human TNFα and IFNγ were manufactured by PeproTech. Recombinant human TRAIL was manufactured by Enzo. The Z-VAD-FMK pancaspase inhibitor was manufactured by InvivoGen. The Ova SIINFEKL (257-264) peptide and the scrambled control peptide FILKSINE (257-264) were manufactured by AnaSpec. EasySep mouse CD8+ The T cell isolation kit was manufactured by Stemcell. The Dynabeads mouse T-activator CD3 / CD28 beads were manufactured by ThermoFisher. The Dynabeads untouched human CD8 T cell kit was manufactured by ThermoFisher. Human PBMCs were purchased from ReachBio. The mouse cytokine array panel A was manufactured by R&D Systems. The protease / phosphatase inhibitors and BCA reagents were manufactured by ThermoFisher. Autofiniv was manufactured by Biovision, SAR-405 by MedChemExpress, and LCL-161 (Smac mimetic) by Selleckchem. Nec-1s was manufactured by BioVision. The Cas9 protein and trueguide synthesis gRNA were manufactured by ThermoFisher. Doxorubicin and paclitaxel were manufactured by Selleckchem.

[0273] Immunoblot Whole cell lysates were prepared in tris-glycine SDS sample buffer (ThermoFisher) containing 5% 2-mercaptoethanol. Western blotting was performed using conventional methods with tris-glycine polyacrylamide SDS gel (ThermoFisher) and PVDF membrane (BioRad). The blots were blocked with 5% milk powder and 0.5% Tween®-20 in TBS and incubated overnight with primary antibody. After adding secondary antibody, the membranes were incubated with SuperSignal West Pico Plus or Femto substrate (ThermoFisher), and the luminescence was stored using a C300 imaging system (Azure Biosystems). Primary antibodies were used against TAK1, Rbck1, RelA p65, Rb1cc1, Atg12, cleavage caspase-8, procaspase-8, RIPK1, RIPK1 phospho-Ser321, RIPK1 phospho-Ser166, Iκ-Bα, A20, p62, phospho-p65, LC3B, TNFR1 (CST), Atg9a (Novus), cIAP1 (Enzo), β2M (ThermoFisher), FADD, and ICAM (Abcam). Secondary antibodies against horseradish peroxidase-conjugated β-actin, as well as against mouse IgG, rabbit IgG, and goat IgG, were manufactured by Santa Cruz Biotechnology.

[0274] Xenograft experiments. To overcome the increased immunogenicity associated with cell modification by lentiviral vectors, Cas9 protein and sgRNA were delivered to cells via transient ribonucleoprotein transfusion. The sgRNA sequence used for Rb1cc1 KO was CUCCAUUGACCACCAGAACC, and the non-targeting sgRNA sequence was AAAUGUGAGAUCAGAGUAAU. After transfusion, clones were isolated and tested for gene knockout. For MC38 cells, a pool of eight KO clones was used for tumor experiments, and for EMT6 cells, a pool of four KO clones was used.

[0275] Mouse cytokine array Control or Rb1cc1KO MC38 cells expressing Rb1cc1-targeting sgRNA were treated with 10 ng / ml mouse TNFα for 4 hours. After treatment, cells were washed twice with ice-cold PBS and lysed in 1 mL of 1% IGEPAL CA-630, pH 8.0, 20 mM Tris-HCl, 137 mM NaCl, 10% glycerol, and 2 mM EDTA plus 1XHalt protease / phosphatase inhibitor cocktail. After swishing at 4°C for 30 minutes, the lysates were clarified by centrifugation at 14,000 g at 4°C for 5 minutes, and protein concentrations were measured using a standard BCA assay. To evaluate cytokine production, the Proteome Profiler Mouse Cytokine Array Panel A (R&D Systems) was used. 300 μg of cell lysates were used according to the standard kit protocol.

[0276] Tumor immunophenotype and flow cytometry analysis Tumors were harvested and mechanically dissected into fragments (over 4 mm), then enzymatically digested at 37°C for 45 minutes using a mouse tumor dissociation kit (Miltenyi Biotec). Single-cell suspensions were prepared, and erythrocytes were lysed with ACK buffer (Lonza). Cells were counted, blocked on ice for 30 minutes with Fc blockers (BioLegend), and stained with viability dyes and CD45, CD3, CD4, and CD8 antibodies (BioLegend) as shown. MC38 parental and autophagy KO cells were stained with MHC-I(H2-kb) or isotype control (Invitrogen) antibody, or MHC-I(H2-kb)-Ova (SIINFEKL) or isotype control (BioLegend) antibody.

[0277] Quantification and statistical analysis For the analysis of pooled CRISPR screenings, data were first normalized by multiplying each sample by a scaling factor so that all samples had the same total read count. To compare groups, the normalized read count table was used as input to MAGeCK (version 0.5.8), with one group assigned as treatment and the other as control (58). One-way ANOVA with Tukey's multiple comparison test was used to compare data from cell-based assays with multiple treatment groups. One-way ANOVA with Tukey's multiple comparison test was used to compare tumor growth under different treatments. P-values ​​less than 0.05 were considered significant. Statistical comparisons were performed using GraphPad Prism.

[0278] Built-in by reference All publications, patents, and patent applications referenced herein are incorporated herein by reference in whole, just as each individual publication, patent, or patent application is specifically and individually indicated to be incorporated by reference. In the event of any conflict, including any definitions herein, this application shall prevail.

[0279] Any polynucleotide and polypeptide sequences that reference accession numbers corresponding to entries in public databases such as those maintained on the World Wide Web by The Institute for Genomic Research (TIGR) and / or the National Center for Biotechnology Information (NCBI) on the World Wide Web are also incorporated in their entirety by reference.

[0280] Equal portions Those skilled in the art will be able to recognize or confirm numerous equivalents of the specific embodiments of the present invention described herein by means of ordinary experiments. Such equivalents are intended to be covered by the following claims.

Claims

1. A composition for use in a method for sensitizing cancer cells to T cell-mediated killing in a human subject undergoing cancer immunotherapy, the method comprising administering the agent to the human subject such that the agent and the cancer cells come into contact in the presence of T cells, The aforementioned drug, (a) A composition for targeted genome editing of the RB1CC1 gene, wherein the composition comprises a guide RNA that targets a sequence in the RB1CC1 gene, a zinc finger protein that targets a sequence in the RB1CC1 gene, a transcription activator-like effector (TALE) protein that targets a sequence in the RB1CC1 gene, or a nucleic acid encoding any of the above, or (b) Interfering nucleic acid targeting the RB1CC1 gene product, wherein the interfering nucleic acid is selected from siRNA, shRNA, miRNA or antisense oligonucleotides, A composition.

2. The composition according to claim 1, wherein the drug modifies the RB1CC1 gene, and the expression or activity of the RB1CC1 gene is reduced by modifying the RB1CC1 gene.

3. The composition according to claim 1 or 2, wherein the agent is a composition comprising a guide RNA or a nucleic acid encoding a guide RNA, the guide RNA comprising a DNA targeting segment that targets a guide RNA target sequence in the RB1CC1 gene, and is effective in inducing a Cas enzyme to cleave or join the sequence of the RB1CC1 gene.

4. The composition according to claim 3, wherein the guide RNA target sequence includes the start codon of the RB1CC1 gene or is located within approximately 100 nucleotides of the start codon.

5. The composition according to claim 3 or 4, further comprising a Cas protein or a nucleic acid sequence encoding the Cas protein.

6. The composition according to claim 1, wherein the drug is an interfering nucleic acid that targets the RB1CC1 gene product, and the interfering nucleic acid is selected from siRNA, shRNA, miRNA, or antisense oligonucleotide.

7. The composition according to any one of claims 1 to 6, wherein the cancer cells are lung cancer cells, breast cancer cells, colon cancer cells, cervical cancer cells, pancreatic cancer cells, kidney cancer cells, gastric cancer cells, gastrointestinal cancer cells, liver cancer cells, bone cancer cells, hematological cancer cells, nerve tissue cancer cells, melanoma cells, thyroid cancer cells, ovarian cancer cells, testicular cancer cells, prostate cancer cells, cervical cancer cells, vaginal cancer cells, or bladder cancer cells.

8. The composition according to any one of claims 1 to 7, wherein the cancer immunotherapy comprises T-cell therapy, and / or the method does not involve the administration of isolated tumor necrosis factor alpha (TNF-α).

9. The composition according to claim 8, wherein the cancer immunotherapy comprises autologous or allogeneic T-cell therapy, autologous or allogeneic CAR T-cell therapy, or administration of TNF-α, an immune checkpoint inhibitor, a bispecific antibody, or a cancer vaccine to the subject.

10. The composition according to any one of claims 3 to 5, wherein the guide RNA comprises a nucleotide sequence that is at least 90% identical to the sequence described in any one of sequence numbers 38 to 42.

Citation Information

Patent Citations

  • RB1 gene-induced protein (RB1CC1) and gene

    JP2004057003A

  • Therapeutic immune cells with improved function and method for producing same

    JP2022544592A

  • Anticancer agent containing RB1CC1 protein or RB1CC1 gene

    KR1020090102317A

  • Method of regulating cell size and / or cell cycle

    WO2007072645A1