Aptamer nucleic acid molecules and their complexes and their uses

The novel nucleic acid aptamer molecule, like Pepper, forms stable complexes with fluorophores to enhance fluorescence intensity, addressing limitations of existing RNA labeling technologies and enabling effective real-time RNA/DNA imaging and monitoring in living cells.

JP7847358B2Active Publication Date: 2026-04-17EAST CHINA UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
EAST CHINA UNIV OF SCI & TECH
Filing Date
2020-04-28
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

Current RNA labeling technologies face challenges such as low signal-to-noise ratio, instability of fluorescence signals, limited spectral options, interference with target RNA function, and inability to label multiple RNAs simultaneously in living cells, particularly in mammalian cells.

Method used

Development of a novel nucleic acid aptamer molecule, such as the Pepper aptamer, which forms a complex with a fluorophore molecule, significantly enhancing fluorescence intensity under appropriate excitation light, and can be used to label and image RNA/DNA in living cells.

Benefits of technology

The nucleic acid aptamer-fluorophore complexes provide stable and distinct fluorescence spectra, enabling real-time RNA/DNA labeling and imaging in both prokaryotic and eukaryotic cells, allowing for the study of protein-RNA interactions and simultaneous monitoring of multiple RNAs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007847358000045
    Figure 0007847358000045
  • Figure 0007847358000046
    Figure 0007847358000046
  • Figure 0007847358000047
    Figure 0007847358000047
Patent Text Reader

Abstract

This application relates to aptamer nucleic acid molecules, complexes containing the aptamers and small fluorophore molecules, methods for using the aptamers to detect intracellular or extracellular RNA, DNA, or other target molecules, and kits containing the aptamers. The aptamers of this application specifically bind to small fluorophore molecules and can significantly increase their fluorescence intensity when excited by light of an appropriate wavelength.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This application relates to an aptamer nucleic acid molecule, a complex containing this aptamer nucleic acid molecule, a method for detecting intracellular or extracellular RNA, DNA or other target molecules, and a kit containing this aptamer. The aptamer of this application specifically binds to fluorophore small molecules and can significantly increase their fluorescence intensity when excited by light of an appropriate wavelength. [Background technology]

[0002] Among biomolecules, RNA exhibits the most diverse biological functions. According to the central dogma of biology, RNA functions as a carrier of genetic information (messenger RNA), a template for protein synthesis (ribosomal RNA), and a carrier of amino acids (transfer RNA), forming a series of physiological processes and ultimately enabling gene transcription and expression. Over the past few decades, scientists have gradually discovered that RNA, including many RNA-protein complexes such as telomerase, splicing enzymes, ribozymes, and riboswitches, plays crucial roles in various life activities. Furthermore, in recent years, non-coding RNAs such as short interfering RNA (siRNA), microRNA, and long non-coding RNA (lncRNA) have played an indispensable role in post-transcriptional gene expression regulation. Real-time monitoring of intracellular RNA transport and metabolic processes is crucial for studying the relationship between RNA localization and gene expression and cellular regulatory processes. Currently, scientists have identified several mechanisms that may lead to different intracellular localization of RNA, such as active transport, passive diffusion, and fixation. In many polar cells, particularly neurons, spatially specific expression of mRNA is closely related to neuronal plasticity, learning, and memory. Therefore, damage to the regulatory processes of these RNAs can lead to neurological dysfunction and neurological diseases.

[0003] RNA fluorescence INSITU hybridization is a widely used method for studying the intracellular level and distribution of RNA. It involves fluorescently labeling specific RNA molecules through molecular hybridization and then imaging them. However, its complex operation and the inclusion of an elution step prevent its use in real-time monitoring of the dynamic changes in RNA within living cells, and it is only used for studying immobilized cells, i.e., dead cells. Molecular beacon technology is the earliest developed living-cell RNA imaging technology. It uses stem-loop double-labeled oligonucleotide probes that form hairpin structures at the 5' and 3' ends. After binding to the target RNA, the quenching effect of the quenching group labeled at one end disappears, causing the fluorescent group to fluoresce, or the FRET of the fluorescent groups at both ends disappears. However, molecular beacons have drawbacks such as low fluorescence signal, difficulty in cell entry, easy degradation, severe nonspecific aggregation in the cell nucleus, susceptibility to RNA secondary structure, and the need to customize oligonucleotide probes for each RNA, thus limiting their widespread use.

[0004] Currently, the methods used for live-cell RNA imaging primarily utilize MCP-FPs systems. MCP-FPs specifically recognize and bind to mRNA molecules fused with multi-copy MS2 sequences, allowing for real-time monitoring of mRNA synthesis and distribution by detecting the signal of a fluorescent protein (Ozawa et al. Nature Methods 2007. 4: 413-419). However, MCP-FPs not bound to mRNA molecules generate very high background fluorescence, resulting in a very low signal-to-noise ratio for this method. Subsequently, scientists added a nuclear localization signal to the MCP-FPs fusion protein, causing GFP-MS2 not bound to mRNA molecules to localize to the cell nucleus. As a result, non-specific fluorescence in the cytoplasm was reduced to some extent, and the detected signal-to-noise ratio was increased.

[0005] In addition to RNA-binding protein-fluorescent protein technology for detecting cellular RNA, scientists were looking for RNA fluorescent tags like GFP for RNA imaging. Scientists constructed a fluorophore-quencher conjugate. When an aptamer of a fluorophore binds to the fluorophore, the quencher cannot quench the fluorophore's fluorescence signal, and the aptamer-fluorophore-quencher complex emits fluorescence. In the absence of the fluorophore aptamer, the fluorophore's fluorescence signal is quenched by the quencher.

[0006] Based on these principles, scientists have achieved imaging of mRNA within bacteria (Arora et al. Nucleic Acids Research 2015. 21: e144). They have also developed a tag called IMAGE (intracellular multi aptamergenetic), which consists of two different aptamer-small molecule complexes. When a small molecule binds to an aptamer in an RNA sequence, fluorescence resonance energy transfer (FRET) occurs at the fluorophores on the two adjacent small molecules, and the state of RNA within the cell can be detected by detecting changes in the fluorescence signal. However, neither of these methods has enabled real-time monitoring of RNA in mammalian cells.

[0007] In 2011, the S. Jaffrey research group obtained a nucleic acid aptamer called "Spinach" by specifically binding to a single fluorophore (3,5-difluoro-4-hydroxybenzyli-dene imidazolinone, DFHBI) and significantly increasing its fluorescence (Paige et al. Science 2011. 333: 642-646; Strack et al. Nature Methods 2013. 10: 1219-1224).

[0008] Spinach2, a mutant of Spinach, exhibits superior stability and provides an excellent tool for coding and labeling RNA in living cells. This research group replaced one of the stem-loop structures in Spinach with a nucleic acid aptamer that can specifically bind to cellular metabolites, developing a tool that can detect cellular metabolites based on the Spinach-DFHBI complex (Paige et al. Science 2012. 335: 1194).

[0009] To date, this method has successfully monitored and analyzed the dynamic changes of RNA in bacterial, yeast, and mammalian cells. Subsequently, the research group also developed a Corn-DFHO complex for detecting the activity of the RNA polymerase III promoter in mammalian cells (Song et al. Nature Chemical Biology 2017. 13: 1187-1194). However, this method has the following drawbacks and is not widely used: (1) The aptamer-fluorophore complex has low binding ability, and its dissociation constant (kd) is in the range of tens to hundreds of nM.

[0010] (2) The fluorescence signals of complexes formed from aptamer-fluorophores are unstable and easily quenched, making them difficult to detect (HaNet al. Journal of the American Chemical Society 2013. 135: 19033-19038).

[0011] (3) To date, only green and yellow spectra are available, so there are no spectra at longer wavelengths for imaging RNA in living animals (Song et al. Journal of the American Chemical Society 2014. 136: 1198-1201).

[0012] (4) Because Corn is a dimer, it may interfere with the function of the target RNA. (5) Because there are no other aptamer-fluorophore complexes yet, it is not possible to monitor multiple RNAs in the cell simultaneously.

[0013] Based on the above, each currently used RNA labeling technology has its own drawbacks. MCP-FPs labeling technology exhibits strong unbound background fluorescence and a low signal-to-noise ratio. RNA labeling technology based on complexes composed of aptamers, fluorophores, and quenchers can currently only label RNA in bacteria and not in mammalian cells.

[0014] While RNA labeling techniques based on single fluorophore-nucleic acid aptamers appear to be a very perfect RNA labeling technique, the complexes currently formed from fluorophores (DFHBI, DFHBI-1T, DFHO) and nucleic acid aptamers are not widely used due to undesirable properties. Therefore, the scientific research and industrial sectors are seeking more effective fluorophore-nucleic acid aptamer complexes that overcome the shortcomings of current fluorophore-nucleic acid aptamer complexes and can be used for real-time labeling of RNA or DNA in living cells. [Overview of the project]

[0015] This application provides a nucleic acid aptamer molecule, a DNA molecule encoding this nucleic acid aptamer molecule, a complex of the nucleic acid aptamer molecule and a fluorophore molecule, and the use of this complex.

[0016] This application provides a nucleic acid aptamer molecule comprising the following nucleotide sequence (a), (b), or (c). (a): Nucleotide sequence N1CCAAUCGUGGCGUGUCGN 19 -N 20 -N 21 ACUGGCGCCGN 32 (Hereafter referred to as the structure represented by the general formula Pepper) In the formula, N1, N 19 , N 20 , N21 and N 32 represents a fragment having a length of 1 nucleotide or more, and N1 and N 32 Among the nucleotide sequences, at least a pair of bases form complementary pairing, and N 19 and N 21 Among the nucleotide sequences, at least a pair of bases form complementary pairing (b): A nucleotide sequence having at least 70% identity with the nucleotide sequence defined in (a) (c): Among the nucleotide sequences defined in (a), nucleic acid aptamer molecules derived from (a) having one or more nucleotide substitutions, deletions and / or additions at positions excluding N1, N 19 , N 20 , N 21 and N 32 and having an aptamer function

[0017] In some embodiments, the nucleotide sequence (b) has at least 75%, 76%, 78%, 80%, 82%, 85%, 87%, 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity with the nucleotide sequence of the structure represented by the general formula Pepper of the nucleotide sequence (a). In some embodiments, the nucleotide sequence (c) is the nucleotide sequence of the structure represented by the general formula Pepper defined by the nucleotide sequence (a), among N1, N 19 , N 20 , N 21 and N 32 A nucleic acid aptamer molecule obtained through substitution, deletion and / or addition of 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide at positions excluding. In some embodiments, the nucleotide sequence (c) is a nucleic acid aptamer molecule obtained through substitution of 7, 6, 5, 4, 3, 2 or 1 nucleotide at positions excluding N1, N 19 , N 20 , N 21 and N 32 and having an aptamer function

[0018] In some embodiments, N1 in the nucleotide sequence (a) is N 32 When forming a complementary pairing, the orientation of the N1 nucleotide sequence is 5'-3', and N 32 The nucleotide sequence direction is 3'-5'. 19 is N 21 If it forms a complementary pairing with N 19 The nucleotide sequence direction is 5'-3', N 21 The nucleotide sequence is oriented 3'-5'.

[0019] In some examples, N1 and N in the nucleotide sequence (a) 32 If the length of at least one of the fragments is 5 nucleotides or more, then N1 and N 32 In a nucleotide sequence, at least two pairs of bases form complementary pairings. 19 and N 21 If the length of at least one of the fragments is 5 nucleotides or more, then N 19 and N 21 In a nucleotide sequence, at least two pairs of bases form complementary pairings.

[0020] In some examples, the nucleotide substitutions in the structure represented by the general formula Pepper are C3A, C3U, A4U, A4G, A4C, A5G, A5C, U6A, U6G, U6C, C7A, C7U, G8C, U9A, G11A, G11U, C12G, C12A, C12U, G13C, U14A, U14G, C17U, G18U, G18C, C27G, C27U, G28U, C29G, C29U, C30A, C30U, C2G / G31C, C2U / G31A, C2A / G31U, G 10A / C30U, G10C / C30G, G10U / C30A, C2G / G31C / C3A, C2G / G31C / A4C, C2G / G31C / A5C, C2G / G31C / G8C, C2G / G31C / C12U, C2G / G31C / U14G , C2G / G31C / C27U, C2G / G31C / C29G, C2G / G31C / C30U, C2G / G31C / g10A / C30U, C2G / G31C / G10C / C30G, C2G / G31C / G10U / C30A, C2U / G31A / G10A / C30U, C2U / G31A / G10C / C30G, C2U / G31A / G10U / C30A, C2A / G31U / G10A / C30U, C2A / G31U / G10C / C30G, C2A / G31U / G10U / C30A, C2G / G31C / G10C / C30G / C3A, C2G / G31C / G10C / C30G / A4C, C2G / G31C / G10C / C30G / A5C, C2G / G31C / G10C / C30G / G8C, C2G / G31C / G10C / C30G / It is one selected from the group consisting of C12U, C2G / G31C / G10C / C30G / U14G, C2G / G31C / G10C / C30G / C27U, C2G / G31C / G10C / C30G / C29G, C2G / G31C / G10A / C30U / U6G / C27U, C2G / G31C / G10C / C30G / U6G / C27U, C2G / G31C / G10U / C30A / U9A / U14G / C27U, and C2A / G31U / G10U / C30A / U9A / U14G / C27U.

[0021] In some examples, the nucleotide substitutions in the structure represented by the general formula Pepper are C3A, C3U, A4C, A5C, C7U, G8C, U9A, C12G, C12U, U14G, C27U, C29G, C30U, C2G / G31C, C2U / G31A, C2A / G31U, G10A / C30U, G10C / C30G, G10U / C30A, C2G / G31C / C3A, C2G / G31C / A4C, C2G / G31C / A5C, C2G / G31C / G8C, C2G / G31C / C12U, C2G / G31C / U14G, C2G / G31C / C27U, C2G / G31C / C29G, C2 G / G31C / C30U, C2G / G31C / G10A / C30U, C2G / G31C / G10C / C30G, C2G / G31C / G10U / C30A, C2U / G31A / G10A / C30U, C 2U / G31A / G10C / C30G, C2U / G31A / G10U / C30A, C2A / G31U / G10A / C30U, C2A / G31U / G10C / C30G, C2A / G31U / G10U / C30A, C2G / G31C / G10C / C30G / C3A, C2G / G31C / G10C / C30G / A4C, C2G / G31C / G10C / C30G / A5C, C2G / G31C / G10C / C It is one selected from the group consisting of 30G / G8C, C2G / G31C / G10C / C30G / C12U, C2G / G31C / G10C / C30G / U14G, C2G / G31C / G10C / C30G / C27U, C2G / G31C / G10C / C30G / C29G, C2G / G31C / G10A / C30U / U6G / C27U, and C2G / G31C / G10C / C30G / U6G / C27U.

[0022] In some examples, the nucleotide substitutions in the structure represented by the general formula Pepper are C3A, C3U, A4C, A5C, C7U, G8C, U9A, C12G, C12U, U14G, C27U, C29G, C30U, C2G / G31C, C2U / G31A, C2A / G31U, G10A / C30U, G10C / C30G, G10U / C30A, C2G / G31C / C3A, C2G / G31C / A4C, C2G / G31C / A5C, C2G / G31C / G8C, C2G / G31C / C12U, C2G / G31C / U1 It is one selected from the group consisting of 4G, C2G / G31C / C27U, C2G / G31C / C29G, C2G / G31C / C30U, C2G / G31C / G10A / C30U, C2G / G31C / G10C / C30G, C2G / G31C / G10U / C30A, C2U / G31A / G10A / C30U, C2U / G31A / G10C / C30G, C2U / G31A / G10U / C30A, C2A / G31U / G10A / C30U, C2A / G31U / G10C / C30G, and C2A / G31U / G10U / C30A.

[0023] In some examples, N1 and N in the nucleotide sequence (a) 32 The nucleotide sequence is F30 or a tRNA scaffold RNA sequence.

[0024] In some examples, the nucleic acid aptamer molecule is an RNA molecule or an RNA molecule modified with a base.

[0025] In some examples, the nucleic acid aptamer molecule is a DNA-RNA hybrid molecule or a DNA-RNA molecule modified with a base.

[0026] In some examples, the N in the nucleotide sequence (a) 19 -N 20 -N 21 It contains one nucleotide sequence that can recognize the target molecule.

[0027] In some examples, the target molecules include, but are not limited to, proteins, nucleic acids, lipid molecules, carbohydrates, hormones, cytokines, chemokines, and metabolite metal ions.

[0028] In some examples, the N in the nucleotide sequence (a) 19 -N 20 -N 21 This is a nucleotide sequence that can recognize GTP and adenosine molecules.

[0029] In some embodiments, the aptamer function means that the nucleic acid aptamer can increase the fluorescence intensity of a fluorophore molecule by at least 2 times, at least 5 to 10 times, at least 20 to 50 times, at least 100 to 200 times, or at least 500 to 1000 times with excitation light of an appropriate wavelength.

[0030] In some embodiments, the nucleic acid aptamer molecule can bind to multiple fluorophore molecules and may further comprise concatemers linked by spacer sequences having lengths of 2, 3, 4, 5, 6, 7, 8 or more nucleotide fragments. The nucleotides of the concatemer may be selected from, but are not limited to, SEQ ID NOs: 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19.

[0031] In some embodiments, the nucleic acid aptamer molecule has SEQ ID NOs: 1, 2, 3, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, or 23.

[0032] The present invention also relates to a complex of any one of the above nucleic acid aptamer molecules and a fluorophore molecule having the structure described in formula (I) below, [ka]

[0033] (In the formula, D- is X1O- or N(X2)(X3)-, X1, X2, and X3 are each independently selected from hydrogen, a linear or branched alkyl group having 1 to 10 carbon atoms, and a modified alkyl group, and X2 and X3 may be connected to each other in a saturated or unsaturated ring, R- is selected from hydrogen, a cyano group, a carboxyl group, an amide group, an ester group, a hydroxyl group, a linear or branched alkyl group having 1 to 10 carbon atoms, or a modified alkyl group, and Ar1 and Ar2 are each independently selected from a divalent aromatic group having a ring structure of 2 to 3 rings obtained by condensation of one or more monocyclic arylene groups, monocyclic heteroarylene groups, or monocyclic aryl groups and monocyclic heteroaryl groups.)

[0034] In Ar1 and Ar2, the hydrogen atoms are independently substituted with F, Cl, Br, I, hydroxyl groups, nitro groups, aldehyde groups, carboxyl groups, cyano groups, sulfonic acid groups, sulfate groups, phosphate groups, amino groups, primary amino groups, secondary amino groups, linear or branched alkyl groups having 1 to 10 carbon atoms, and modified alkyl groups.

[0035] The modified alkyl group is a group in which any carbon atom of the alkyl group is substituted with at least one group selected from F, Cl, Br, I, -O-, -OH, -CO-, -NO2, -CN, -S-, -SO2-, -(S=O)-, azide group, phenylene group, primary amino group, secondary amino group, tertiary amino group, quaternary ammonium group, ethylene oxide group, succinate group, isocyanate group, isothiocyanate group, acyl chloride group, sulfonyl chloride group, saturated or unsaturated monocyclic or bicyclic divalent cyclic group, or divalent crosslinked lactone heterocyclic group, wherein the modified alkyl group has 1 to 10 carbon atoms, and where carbon-carbon single bonds may be independently substituted with carbon-carbon double bonds or carbon-carbon triple bonds. The present invention provides a complex in which the nucleic acid aptamer molecule and the fluorophore molecule exist in separate solutions, or in which the nucleic acid aptamer molecule and the fluorophore molecule exist in the same solution.

[0036] In some examples, the modified alkyl group comprises at least one group selected from -OH, -O-, ethylene glycol unit, monosaccharide unit, disaccharide unit, -O-CO-, -NH-CO-, -SO2-O-, -SO-, Me2N-, Et2N-, -SS-, -CH=CH-, F, Cl, Br, I, -NO2, and cyano group.

[0037] In some embodiments, the aromatic ring contained in the fluorophore molecule is a structure selected from the following formulas (II-1) to (II-15). [ka]

[0038] In some examples, the fluorophore molecule is selected from the compounds represented by the following formula. [ka]

[0039] In some embodiments, the fluorophore molecule in the complex is selected from III-1, III-2, III-3, III-4, III-5, III-6, III-7, III-8, III-9, III-10, III-11, III-12, III-13, III-14, III-15, III-16, III-17, III-18, III-19, III-20, and III-21.

[0040] In some embodiments, the aptamer molecule in the complex includes nucleotide sequence numbers 1, 2, 3, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31.

[0041] The present invention also provides the use of any one of the above-mentioned complexes in the in vitro or in vivo detection or labeling of target nucleic acid molecules.

[0042] The present invention also provides the use of any one of the above-mentioned complexes in the detection or labeling of target molecules extracellularly or intracellularly.

[0043] This application also provides the use of any one of the above-mentioned complexes in genomic DNA imaging.

[0044] The present invention also provides the use of any one of the above-mentioned complexes in detecting the relationship between intracellular mRNA and protein content.

[0045] The present invention also provides a DNA molecule that transcribes any one of the above-mentioned nucleic acid aptamer molecules.

[0046] This application also provides an expression vector containing the above-mentioned DNA molecule.

[0047] The present invention also provides host cells containing the above-mentioned expression vector.

[0048] The present invention also provides a kit comprising any one of the above nucleic acid aptamer molecules and / or any one of the above expression vectors and / or any one of the above host cells and / or any one of the above complexes.

[0049] The present invention also includes the step of adding any one of the above complexes to a solution containing a target molecule, The steps include: exciting the complex with light of the appropriate wavelength, A step of detecting the fluorescence of the complex, The present invention provides a method for detecting target molecules, comprising the components described above.

[0050] The present invention also provides a method for detecting genomic DNA, which includes imaging genomic DNA with any one of the above-described complexes.

[0051] The present invention also provides a method for extracting and purifying RNA, comprising extracting and purifying RNA with any one of the above-described complexes. [Effects of the Invention]

[0052] The inventors designed a novel nucleic acid aptamer molecule and synthesized a novel fluorophore molecule, forming a new fluorophore-nucleic acid aptamer complex. After binding to the fluorophore molecule, the aptamer component can significantly increase the fluorescence intensity of the fluorophore molecule under excitation light of an appropriate wavelength, overcoming the shortcomings of conventional fluorophore-nucleic acid aptamer complexes and enabling effective use in real-time RNA / DNA labeling within living cells.

[0053] The nucleic acid aptamers of this invention exhibited strong affinity for fluorophore molecules, resulting in distinct fluorescence spectra and excellent photothermal and thermal stability. These nucleic acid aptamer-fluorophore molecule complexes can be used to label and image RNA / DNA in prokaryotic and eukaryotic cells in real time, detect protein-RNA interactions, study the relationship between intracellular mRNA content and proteins, or function as tags for RNA extraction and purification. [Brief explanation of the drawing]

[0054] [Figure 1] Prediction of the secondary structure of nucleic acid aptamer molecules. (A) is the predicted general structure of Pepper, including N1 and N32 which can form a stem structure, and N19, N20, and N21 which can form a stem-loop structure. (B) is the predicted structure of Pepper-1, with the nucleotide sequences of N1 and N32 shown in the dashed box corresponding to stem 1 in the figure, and the nucleotide sequences of N19, N20, and N21 shown in the dashed box corresponding to the stem-loop. [Figure 2] Prediction of the secondary structure of F30-Pepper-1. [Figure 3] Prediction of the secondary structure of tRNA-Pepper-2. [Figure 4]Identification of the properties of the F30-Pepper-1-III-3 complex. (A) Fluorescence excitation and emission spectra of the F30-Pepper-1-III-3 complex. (B) Absorption spectra of the F30-Pepper-1-III-3 complex and III-3. (C) Identification of oligomerization of the F30-Pepper-1-III-3 complex. The "ruler" is a single-stranded DNA standard, and the size of the aptamer is determined. (D) Measurement of the binding and dissociation constants of F30-Pepper-1 and III-3. (E) Measurement of the temperature stability of the F30-Pepper-1-III-3 complex. (F) Measurement of the pH stability of the F30-Pepper-1-III-3 complex. (G) Measurement of the K+ dependence of the F30-Pepper-1-III-3 complex. [Figure 5] Activation effect on III-3 by Pepper modified with different bases. (A) Schematic diagram of the secondary structure of the Pepper-3 aptamer containing deoxyribonucleotide (shown in dark color in the figure). (B) Schematic diagram of the secondary structure of the Pepper-4 aptamer containing 2'F modification (shown in dark color in the figure). (C) Activation effect on III-3 by Pepper with different modifications. In the "control group," a buffer was used instead of Pepper-3 or Pepper-4 aptamer. [Figure 6] Activation effect on III-3 by different Pepper concatemers. (A) Pepper concatemer obtained in the "series 1" configuration. (B) Pepper concatemer obtained in the "series 2" configuration. (C) Pepper concatemer obtained in the "series 3" configuration. (D) Activation effect on III-3 by different Pepper concatemers obtained in the "series 1" configuration. (E) Activation effect on III-3 by different Pepper concatemers obtained in the "series 2" configuration. (F) Activation effect on III-3 by different Pepper concatemers obtained in the "series 3" configuration. [Figure 7] Labeling effect of the F30-Pepper-1-III-3 complex on RNA within bacteria. [Figure 8] Labeling effect of the F30-Pepper-1-III-3 complex on RNA in yeast cells. [Figure 9] Labeling effects of Pepper, III-3, and their analogs on RNA in mammalian cells. (A) Comparison of the effects of F30-Pepper-1-III-3, F30-Broccoli-DFHBI-1T, and tRNA-Corn-DFHO on RNA labeling in mammalian cells. (B) Statistical results of fluorescence in Figure (A). (C) Effects of F30-8Pepper-5 and III-3 analogs on RNA labeling in mammalian cells. [Figure 10] Probe construction based on Pepper-1. (A) Schematic diagram of probe construction where the stem-loop structure can recognize adenosine or GTP. (B) Detection effect of adenosine probe. (C) Detection effect of GTP probe. [Figure 11] Use of Pepper to track the localization of RNA within cells. (A) Use of Pepper to detect the localization of GAPDH mRNA. (B) Use of Pepper to detect the localization of TMED2 mRNA. [Figure 12] Use of Pepper to study the relationship between mRNA and protein within cells. (A) Flow cytometry analysis results of BFP protein and its RNA expression. (B) Flow cytometry analysis results of mCherry protein and its RNA expression. [Figure 13] Use of Pepper for detecting genomic DNA. (A) Schematic diagram of dCas9 and different chimeric sgRNAs. (B) Genomic DNA imaging results using dCas9 and different chimeric sgRNAs. (C) Statistical results of bright particles in each cell in (B). [Figure 14] Use of Pepper in RNA super-resolution imaging. (A) Co-localization of 4Pepper-9-MS2 RNA and tdMCP-BFP-H2B protein. (B) Wide-field and SIM imaging results of the middle layer of the cell nucleus. (C) Wide-field and SIM imaging results of the uppermost layer of the cell nucleus. [Figure 15] Pepper tags used for RNA extraction and purification. The "ruler" is a single-stranded DNA standard, used to identify aptamer sizes. [Modes for carrying out the invention]

[0055] The present application will be described in detail below using the following definitions and examples. All content, including sequences, disclosed in the patent documents and publications referenced herein is expressly incorporated herein by reference. Hereinafter, "nucleotide" and "nucleotide base" are used interchangeably.

[0056] The following provides a detailed explanation of some of the technical terms used in this application.

[0057] nucleic acid aptamer molecule In this application, the term "nucleic acid aptamer molecule" is also called an "aptamer molecule." This nucleic acid aptamer molecule is (a) a nucleotide sequence N1CCAAUCGUGGCGUGUCGN 19 -N 20 -N 21 ACUGGCGCCGN 32 (Corresponding to the structure represented by the general formula Pepper in Figure 1A), or (b) containing a nucleotide sequence having at least 70% identity with the nucleotide sequence limited by (a).

[0058] In the formula, N1 and N 32 In the nucleotide sequence, at least one pair of bases form an inverse complementary pairing, i.e., the direction of the N1 nucleotide sequence is 5'-3', and N 32 The nucleotide sequence direction is 3'-5'. N1 and N 32 If the length of at least one nucleotide base is 4 or less, then at least one pair of bases must form a complementary pairing. N1 and N 32 If at least one of the nucleotide bases has a length of 5 or more, then at least two pairs of bases must form a complementary pairing. 19 and N 21 In a nucleotide sequence, at least one pair of bases form an inversely complementary pairing, i.e., N 19 The nucleotide sequence direction is 5'-3', N 21 The nucleotide sequence direction is 3'-5'.19 and N 21 If the length of at least one nucleotide base is 4 or less, then at least one pair of bases must form a complementary pairing. 19 and N 21 If at least one of the nucleotide bases has a length of 5 or more, then at least two pairs of bases must form a complementary pairing. 20 (c) a nucleotide base having any length and any composition, or (a) having 1 to 7 nucleotide substitutions, deletions and / or additions at any position in the nucleotide sequence (a).

[0059] Nucleic acid aptamer molecules contain nucleotide substitutions in a structure represented by the general formula Pepper, where these substitutions are C3A, C3U, A4U, A4G, A4C, A5G, A5C, U6A, U6G, U6C, C7A, C7U, G8C, U9A, G11A, G11U, C12G, C12A, C12U, G13C, U14A, U14G, C17U, G18U, G18C, C27G, C27U, G28U, C29G, C29U, C30A, C30U, C2G / G31C, C2U / G31A, C2A / G31U, G10A / C30U, G10C / C30G, G10U / C30A, C2G / G31C / C3A, C2G / G31C / A4C, C2G / G31C / A5C, C2G / G31C / G8C, C2G / G31C / C12U, C2G / G31C / U14G, C2G / G 31C / C27U, C2G / G31C / C29G, C2G / G31C / C30U, C2G / G31C / g10A / C30U, C2G / G31C / G10C / C30G, C2G / G31C / G10U / C30A, C2U / G31A / G10A / C30 U, C2U / G31A / G10C / C30G, C2U / G31A / G10U / C30A, C2A / G31U / G10A / C30U, C2A / G31U / G10C / C30G, C2A / G31U / G10U / C30A, C2G / G31C / G10C / C30G / C3A, C2G / G31C / G10C / C30G / A4C, C2G / G31C / G10C / C30G / A5C, C2G / G31C / G10C / C30G / G8C, C2G / G31C / G10C / C30G / C12U, C2G / G31C / The mutant is selected from the group consisting of G10C / C30G / U14G, C2G / G31C / G10C / C30G / C27U, C2G / G31C / G10C / C30G / C29G, C2G / G31C / G10A / C30U / U6G / C27U, C2G / G31C / G10C / C30G / U6G / C27U, C2G / G31C / G10U / C30A / U9A / U14G / C27U, and C2A / G31U / G10U / C30A / U9A / U14G / C27U (i.e., the ptamer molecular structures shown in Table 1). These mutants specifically bind to fluorophore molecules and, after binding, can significantly increase the fluorescence intensity of the fluorophore molecules under excitation light of an appropriate wavelength. The nucleotide position sequence is shown in Figure 1A.

[0060] The above mutations refer to nucleotide substitutions occurring at the relevant sites in the aptamer nucleotide sequence of the structure represented by the general formula Pepper. For example, C3A is a mutation in which the cytosine C at position 3 of Pepper is replaced with adenine A, i.e., Pepper(C3A) shown in Table 1, and C2G / G31C is a mutation in which the C at position 2 of Pepper is replaced with G, and the G at position 31 is replaced with C, i.e., Pepper(C2G / G31C) shown in Table 1.

[0061] Table 1: Aptamer structures in which the structure represented by the general formula Pepper is substituted with 7, 6, 5, 4, 3, 2, or 1 nucleotide. [Table 1]

[0062] An aptamer molecule is a single-stranded nucleic acid molecule having a secondary structure composed of one or more base-pairing regions (stems) and one or more unpairing regions (loops) (Figure 1). The nucleic acid aptamer molecule in this application includes, for example, one secondary structure as predicted in Figure 1. This secondary structure contains two loop structures, two stem structures, and one stem-loop structure, of which stem 1 is for stabilizing the entire nucleic acid aptamer molecular structure and can be substituted with nucleotide base pairs of any length and composition that can form other stem structures. The 5' or 3' end of the stem 1 structure is fused with any target RNA molecule to detect the target RNA molecule extracellularly or intracellularly. and are bound by covalent bonds. This is possible. In one preferred embodiment of the present application, the 5' end of the nucleic acid aptamer molecule is fused with a 5S RNA sequence (Genebank: NR_023377.1). In another preferred embodiment of the present application, the 5' end of the nucleic acid aptamer molecule is fused with a GAPDH RNA sequence (Genebank: BC009081).

[0063] The stem-loop structure shown in Figure 1 is for stabilizing the entire nucleic acid aptamer molecular structure and can be substituted with nucleotide base pairs of any length and composition that can form other stem-loop structures. The aptamer molecule in this application also has N 19 -N 20 -N 21 The nucleotide sequence may include other nucleotide sequences that are inserted into the position and replace the stem-loop structure shown in Figure 1A. The nucleotide sequence can specifically recognize / bind to the target molecule. In the absence of the target molecule, the binding ability between the aptamer molecule and the fluorophore molecule is weak, and the fluorophore molecule emits weak fluorescence. In the presence of the target molecule, the binding of the target molecule to the aptamer promotes the binding of the aptamer to the fluorophore molecule, significantly increasing the fluorescence of the fluorophore molecule under excitation light of the appropriate wavelength.

[0064] The target molecule may be a small molecule, a cell surface signaling molecule, etc. These nucleic acid aptamers bind to a specific target molecule by non-covalent bonds. Such non-covalent bonds mainly depend on interionic interactions, dipole interactions, hydrogen bonds, van der Waals forces, positron-electron correlations, stacking interactions, or a combination of several of the above forces. The stem-loop structure may be replaced with an RNA sequence that recognizes the target molecule in order to detect the target molecule extracellularly or intracellularly. In one preferred embodiment of the present application, the stem-loop structure of the aptamer molecule can bind to a GTP molecule. In another preferred embodiment of the present application, the stem-loop structure can bind to an adenosine molecule.

[0065] In preferred embodiments of the present invention, the nucleic acid aptamer molecules are preferably SEQ ID NO: 1, 2, 3, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, or 23, or mutant sequences thereof that bind to fluorophore molecules and significantly increase their fluorescence under excitation light of an appropriate wavelength.

[0066] The nucleic acid aptamer molecule in this application may also include a nucleotide sequence that enhances its stability. In one preferred embodiment of this application, an F30 scaffold RNA (sequence 2) is used to bind to the nucleic acid aptamer molecule as shown in Figure 2. In another preferred embodiment of this application, a tRNA scaffold RNA (sequence 3) is used to bind to the nucleic acid aptamer molecule as shown in Figure 3.

[0067] In this application, the "nucleic acid aptamer molecule" is an RNA molecule or a DNA-RNA hybrid molecule in which some nucleotides are replaced with deoxyribonucleotides. Examples of nucleotides include their D-enantiomers and L-enantiomers, as well as their derivatives, and include, but are not limited to, polynucleotides modified with 2'-F, 2'-amino, 2'-methoxy, 5'-iodo, and 5'-bromo-. Nucleic acids contain a variety of modified nucleotides.

[0068] identity In this application, "identity" refers to the relationship between two nucleotide sequences. The calculation of identity between the two aptamer nucleotide sequences in this application involves (a) N1, N 19 , N 20 , N 21 , N 32It does not include. In this application, the degree of identity between two nucleotide sequences is determined, for example, using the Needle program of the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends ingenetics 16:276-277), preferably the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J.Mol.Biol.48: 443-45) incorporated in version 3.0.0 or later. The parameters that can be used are a gap penalty of 10, a gap extension penalty of 0.5, and an EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of the Needle label "longest identity" (obtained using the -nobrief option) is used as the identity (%) and calculated as follows.

[0069] (Number of identical residues × 100) / (Length of alignment - Total number of gaps in the alignment) For example, the arrangement of Pepper(C3A) in Table 1 of this application is N1C A AAucGUGGCGUGUCGN 19 -N 20 -N 21 ACUGGCGCCGN 32 Therefore, the arrangement of Pepper(C3U) is N1C U AAucGUGGCGUGUCGN 19 -N 20 -N 21 ACUGGCGCCGN 32 Therefore, their identity alignments are in accordance with the definition of this application. N 1 、N 19 -N 20 -N 21 and N 32The sequences are assumed to be free of the specified nucleotide base. Therefore, the result of the sequence identity alignment is 96.3% (difference of one nucleotide).

[0070] Fluorophore molecules In this application, "fluorophore molecule" is also called "fluorophore" or "fluorescent molecule." In this application, "fluorophore molecule" is a fluorophore molecule that can be conditionally activated and exhibits a relatively low quantum yield in the absence of a nucleic acid aptamer. In specific embodiments, when not bound to a specific aptamer, the quantum yield of the fluorophore is less than 0.1, more preferably less than 0.01, and most preferably less than 0.001. When the fluorophore is bound to a specific aptamer, the quantum yield of the fluorophore increases by more than 2, more preferably more than 10, and most preferably more than 100. The fluorophore molecule is preferably water-soluble, non-toxic to cells, and readily permeable to membranes. The fluorophore of this application is preferably capable of entering the cytoplasm or periplasm through the cell membrane or cell wall by active transport or passive diffusion. In the embodiments of the present application, the fluorophores can permeate the outer and inner membranes of Gram-negative bacteria, the cell walls and cell membranes of plant cells, fungi and their cell walls and cell membranes, the cell membranes of animal cells, and the GI and endothelial cell membranes of living animals.

[0071] The nucleic acid aptamer molecules in this application specifically bind to fluorophores and significantly increase their fluorescence values ​​under specific wavelength excitation. In this application, “increase in fluorescence signal,” “increase in fluorescence,” “improvement in fluorescence intensity,” and “increase in fluorescence intensity” refer to an increase in the quantum yield of the fluorophore under irradiation with excitation light of an appropriate wavelength, or a shift in the maximum emission peak of the fluorescence signal (relative to the emission peak of the fluorophore itself in ethanol or aqueous solution), or an increase in the molar extinction coefficient, or two or more of the above. In one preferred embodiment of this application, the increase in quantum yield is at least 2 times. In another preferred embodiment of this application, the increase in quantum yield is at least 5 to 10 times. In another more preferred embodiment of this application, the increase in quantum yield is at least 20 to 50 times. In another more preferred embodiment of this application, the increase in quantum yield is at least 100 to 200 times. In another more preferred embodiment of this application, the increase in quantum yield is at least 500 to 1000 times. In another more preferred embodiment of this application, the increase in quantum yield is at least 1000 to 10000 times. In another more preferred embodiment of the present application, the increase in quantum yield exceeds 10,000 times. The light source used to excite the fluorophore and generate a fluorescence signal may be any suitable lighting device, including, for example, an LED, an incandescent bulb, a fluorescent lamp, a laser, etc. The excitation light may be emitted directly from these devices or obtained indirectly from another fluorophore, for example, a donor fluorophore of FERT or a donor luminescent phosphodiol of BRET.

[0072] target molecule The target molecule in this application may be any biological material or small molecule, and includes, but is not limited to, proteins, nucleic acids (RNA or DNA), lipid molecules, carbohydrates, hormones, cytokines, chemokines, metabolite metal ions, etc. The target molecule may also be a molecule associated with disease or pathogen infection.

[0073] In the structure shown in Figure 1, the aptamer molecule in this application results in the inserted nucleotide sequence shown in Figure 1. 19 , N 20, N 21 By substituting the stem-loop structure, this nucleotide sequence can specifically recognize / bind to the target molecule. If the target molecule is absent, the aptamer molecule will not bind to the fluorophore molecule, or its binding ability will be weak, and it will not significantly increase the fluorescence of the fluorophore molecule under the appropriate excitation wavelength. If the target molecule is present, the binding of the target molecule to the nucleotide sequence promotes the binding of the aptamer molecule to the fluorophore molecule, significantly increasing the fluorescence of the fluorophore molecule under the appropriate excitation wavelength, enabling detection, imaging, and quantitative analysis of the target molecule.

[0074] The target molecule may also be a molecule expressed on an entire cell or on the surface of an entire cell. Typical cells include, but are not limited to, cancer cells, bacterial cells, fungal cells, and normal animal cells. The target molecule may also be a viral particle. Currently, numerous aptamers of the above target molecules have been identified and can be incorporated into the polyvalent nucleic acid aptamers in this application. RNA aptamers currently reported to be able to bind to target molecules include, but are not limited to, T4 RNA polymerase aptamers, HIV reverse transcriptase aptamers, and phage R17 capsid protein aptamers.

[0075] In one preferred embodiment of the present invention, the target molecule is adenosine, and the corresponding probe sequence for recognizing the target molecule is SEQ ID NO:21 (shown in Figure 10A). In one preferred embodiment of the present invention, the target molecule is GTP, and the corresponding probe sequence for recognizing the target molecule is SEQ ID NO:22 (shown in Figure 10A).

[0076] target nucleic acid molecule The "target nucleic acid molecule," also called the "target nucleic acid molecule," is the nucleic acid molecule to be detected, and may be intracellular or extracellular, and includes target RNA molecules and target DNA molecules. In this application, the objective is to significantly increase the fluorescence value of the fluorophore molecule under excitation light of an appropriate wavelength by having the target nucleic acid molecule bind to the nucleic acid aptamer molecule, and by having the fluorophore molecule bind to the nucleic acid aptamer molecule, thereby enabling the detection of the content and distribution of the target nucleic acid molecule.

[0077] In this application, "target RNA molecule" includes, but is not limited to, any RNA molecule, including pre-mRNA, mRNA encoding the cell itself or an exogenous expression product, pre-rRNA, rRNA, tRNA, hnRNA, snRNA, miRNA, siRNA, shRNA, sgRNA, crRNA, long non-coding RNA, phage capsid protein MCP recognition binding sequence MS2RNA, phage capsid protein PCP recognition binding sequence PP7RNA, λ phage transcription termination protein N recognition binding sequence boxB RNA, etc. The target RNA is the 5' end or 3' end or of the RNA aptamer molecule of this application. N 19 -N 20 -N 21 It can be fused to that position.

[0078] In this application, "sgRNA" refers to a single guide RNA (singleguide RNA, sgRNA) formed by transforming tracrRNA and crRNA with the CRISPR / Cas9 system. Its approximately 20 nt sequence at the 5' end targets a DNA site by forming complementary base pairs, prompting the Cas9 protein to induce a DNA double-strand break at this site.

[0079] Concatemers of nucleic acid aptamers The nucleic acid aptamer molecules in this application may further include concatemers that can bind to multiple fluorophore molecules. The concatemers are linked by spacer sequences of appropriate length, and the number of Pepper structures in series may be 2, 3, 4, 5, 6, 7, 8, 9, 10 or more. There are multiple forms of concatemers, and in one preferred embodiment of this application, as shown in Figure 6A, the series configuration is "series 1", the preferred nucleotide sequence is SEQ ID NO: 8, 9, 10, 11 or 12, and 2Pepper-5 represents concatemer 1 having two Pepper-5 structures.

[0080] In another preferred embodiment of the present application, as shown in Figure 6B, the series configuration is "series 2", the preferred nucleotide sequence is SEQ ID NO: 13, 14, 15, or 16, and 2xPepper-6 represents concatemer 2 having two Pepper-6 structures. In another preferred embodiment of the present application, as shown in Figure 6C, the series configuration is "series 3", the preferred nucleotide sequence is SEQ ID NO: 17, 18, or 19, and 2x2Pepper-5 is concatemer 3 having four Pepper-5 structures. In any configuration, the spacer sequences between concatemers are substitutable.

[0081] In this application, a monomeric aptamer refers to an aptamer containing only one Pepper structure, i.e., an aptamer containing two stem structures, two loop structures, and one stem-loop structure (Figure 1A).

[0082] A aptamer in a multimerized form includes, but is not limited to, aptamers containing one or more Pepper structures, and several series-configured aptamers shown in Figure 6.

[0083] Aptamer-fluorophore complex The aptamer-fluorophore complexes of the present application comprise one nucleic acid aptamer molecule and one or more fluorophore molecules. In one specific embodiment of the present application, molecular complexes comprising one nucleic acid molecule and one fluorophore molecule are F30-Pepper-2-III-3, F30-Pepper-2-III-7, F30-Pepper-2-III-6, F30-Pepper-2-III-8, F30-Pepper-2-III-4, F30-Pepper-2-III-15, F30-Pepper-2-III-18, and F30-Pepper-2-III-21.

[0084] In another specific embodiment of the present application, a concatemer nucleic acid molecule and a plurality of fluorophore molecules form a complex, for example, in the form of "series 1," and examples of complexes formed from F30-8Pepper-5 containing eight aptamer units and eight phosphor molecules III-3 include 8Pepper-5-8×(III-3), 8Pepper-5-8×(III-7), 8Pepper-5-8×(III-6), 8Pepper-5-8×(III-8), 8Pepper-5-8×(III-4), 8Pepper-5-8×(III-15), 8Pepper-5-8×(III-18), and 8Pepper-5-8×(III-21). The molecular complex may exist in vitro in the form of two separate solutions, or in the same solution, or may exist inside a cell.

[0085] Nucleic acid aptamer function In this application, aptamer function refers to the ability to significantly increase the fluorescence intensity of a fluorophore molecule under excitation light of an appropriate wavelength, and the aptamer can be detected according to the conventional experimental method (v) Functional detection of nucleic acid aptamers in specific examples. In one preferred embodiment of this application, the increase in fluorescence intensity is at least 2 times (fluorescence intensity was detected according to experimental method (v)). In another preferred embodiment of this application, the increase in fluorescence intensity is at least 5 to 10 times. In another more preferred embodiment of this application, the increase in fluorescence intensity is at least 20 to 50 times. In another more preferred embodiment of this application, the increase in fluorescence intensity is at least 100 to 200 times. In another more preferred embodiment of this application, the increase in fluorescence intensity is at least 500 to 1000 times. In another more preferred embodiment of this application, the increase in fluorescence intensity is at least 1000 to 10000 times. In another more preferred embodiment of this application, the increase in fluorescence intensity exceeds 10000 times.

[0086] Nucleic acid aptamer secondary structure The secondary structures of the nucleic acid aptamers in this application were predicted by simulation using the mFold online analysis software (http: / / unafold.rna.albany.edu / ?q=mfold). In the secondary structure, the stem structure refers to a partial double-stranded structure formed by complementary pairing rings via hydrogen bonds in a portion of the single-stranded nucleic acid aptamer molecule. Typically, complementary pairing does not need to occur in all nucleotides within this region for the formation of a double-stranded structure. Typically, N1 and N 32 , or N 19 and N 21 Of these, if at least 50% of the nucleotides of one sequence fragment are paired complementaryly with another fragment, a stem structure can be formed. N1 and N 32 If it is a single nucleotide, N1 and N form a stem structure. 32 These two elements must be completely complementary (Figure 1).

[0087] DNA molecules that express nucleic acid aptamers The DNA molecule contains a DNA sequence capable of encoding the nucleic acid aptamer molecule of the present application. The DNA molecule has a nucleotide sequence R1CCAATCGTGGCGTGTCGR 19 -R 20 -R 21 ACTGGCGCCGN 32 and a nucleotide sequence having at least 70% identity thereto. Specifically, R1 encodes N1 in the structure represented by the general formula Pepper, and R 19 encodes N 19 in the structure represented by the general formula Pepper, and R 20 encodes N 20 in the structure represented by the general formula Pepper, and R 21 encodes N 21 in the structure represented by the general formula Pepper, and R 32 encodes N 32 in the structure represented by the general formula Pepper. The DNA molecule can also contain one promoter that controls DNA transcription. The promoter is operably linked to the DNA sequence encoding the nucleic acid aptamer.

[0088] In one specific embodiment of the present application, the DNA molecule contains a U6 promoter. In another specific embodiment of the present application, the DNA molecule contains a CMV promoter. The DNA molecule can further contain a DNA sequence encoding any target nucleic acid molecule. In one specific embodiment of the present application, the DNA molecule encoding a target RNA contains DNA sequences encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and transmembrane emp24 domain-containing protein 2 (TMED2) (the sequences of the chimeric RNAs are SEQ ID No:24 and SEQ ID No:25, respectively). In another specific embodiment of the present application, the DNA molecule encoding a target RNA contains DNA sequences encoding mCherry and TagBFP (the sequences of the chimeric RNAs are SEQ ID No:26 and SEQ ID No:27, respectively).

[0089] promoter In this application, "promoter" includes both eukaryotic and prokaryotic promoters. Eukaryotic and prokaryotic promoter sequences are entirely different. Typically, eukaryotic promoters are not recognized by RNA polymerase in prokaryotic cells and cannot mediate RNA transcription. Similarly, prokaryotic promoters are not recognized by RNA polymerase in eukaryotic cells and cannot mediate RNA transcription. Different promoters differ greatly in their strength (strength refers to their ability to mediate transcription).

[0090] In practical applications, strong promoters can be used to achieve high levels of transcription. For example, when used for labeling, high levels of transcription are preferable, but when evaluating transcriptional behavior, low levels of transcription allow cells to process the transcription process in a timely manner. One or more appropriate promoters can be selected depending on the host cell.

[0091] For example, when used in E. coli cells, the T7 phage promoter, lac promoter, trp promoter, recA promoter, ribosomal RNA promoter, PR and PL promoters in λ phage, and other promoters are selected, and these other promoters include, but are not limited to, the lacUV5 promoter, ompF promoter, bla promoter, lpp promoter, etc. Furthermore, any E. coli promoter created by a single hybrid trp-lacUV5 promoter (tac promoter) or other recombinant DNA or synthetic DNA technology is used for RNA aptamer transcription in this application.

[0092] Some bacterial operator sequences can bind to promoter sequences to form inducible promoters. In this case, a specific inducer is needed to induce transcription of the DNA molecule. For example, lactose or a lactose analog (IPTG) needs to be added to induce the lac operator. Other operators include trp and pro.

[0093] As described above, the regulatory sequence at the 5' end of the coding sequence of a DNA molecule is the promoter. Whether obtaining RNA aptamers by in vitro transcription or expressing aptamers in cultured cells or tissues, it is necessary to select an appropriate promoter depending on the promoter strength. Since in vivo aptamer expression can be genetically engineered, another type of promoter is the inducible promoter, which induces DNA transcription in response to specific environments, such as being expressed in a specific tissue, at a specific time, or at a specific developmental stage. These different promoters can be recognized by RNA polymerase I, II, or III.

[0094] Initiation of transcription in eukaryotic cells also requires an appropriate promoter, including, but not limited to, the β-globulin protein promoter, CAG promoter, GAPDH promoter, β-actin promoter, actin promoter, Cstf2t promoter, SV40 promoter, PGK promoter, MMTV promoter, adenovirus Ela promoter, and CMV promoter. Termination of transcription in eukaryotic cells depends on a specific cleavage site in the RNA sequence. Similarly, RNA polymerases have vastly different transcription terminators because they transcribe different genes. However, screening for an appropriate 3' transcription terminator region can be achieved with the usual experimental skills of those skilled in the art.

[0095] Expression system The "expression system" in this application is also called an "expression vector" and includes an integrated DNA molecule that expresses a nucleic acid aptamer. The expression system in this application may be a single plasmid or a viral particle.

[0096] "Expression vector" recombinant viruses can be obtained by transfecting a plasmid into virus-infected cells. Suitable vectors include, but are not limited to, viral vectors such as λ vector system gt11, gt WES.tB, CharoN4, and plasmid vectors such as pBR322, pBR325, pACYC177, pACYC184, pUC8, pUC9, pUC18, pUC19, pLG399, pR290, pKC37, pKC101, pBluescript II SK+ / - or KS+ / - (see Stratagene cloning system), pET28 series, pACYCDuet1, pCDFDuet1, pRSET series, pBAD series, pQE, pIH821, pGEX, and pIIIEx426 RPR.

[0097] Numerous host expression systems are used for the expression of DNA molecules in this application. Importantly, the vector system must be compatible with the host cell in which it is used. Host vector systems include, but are not limited to, transformed phage DNA, plasmid DNA, or cosmid DNA in bacteria, yeast containing yeast vectors, virus-infected mammalian cells (e.g., adenovirus, adeno-associated virus, retrovirus), virus-infected insect cells (e.g., baculovirus), and bacterial-infected or particle-gun-transformed plant cells. The intensity and characteristics of the expression elements in these vectors vary considerably. Depending on the host-vector system used, one or more appropriate transcription elements should be selected.

[0098] Once the constructed DNA molecule is cloned into the vector system, it is readily introduced into host cells. Depending on the different vector or host cell system, the method includes, but is not limited to, transformation, transduction, conjugation, fixation, electrotransformation, etc.

[0099] In one specific embodiment of the present application, expression plasmids pET28a-T7-F30-Pepper-2, pLKO.1-F30-Pepper-2, and pYES2.1-F30-Pepper-2 are provided, each containing a DNA molecule encoding F30-Pepper-2 RNA.

[0100] In another specific embodiment of the present application, an expression plasmid pLKO.1-F30-8Pepper-5 is provided, containing a DNA molecule encoding F30-8Pepper-5 RNA. In another specific embodiment of the present application, an expression plasmid pCDNA3.1 hygro(+)-BFP-4Pepper-7, pCDNA3.1 hygro(+)-mCherry-4Pepper-7, pCDNA3.1 hygro(+)-GAPDH-4Pepper-7, and pCDNA3.1 hygro(+)-TMED2-4Pepper-7 is provided, containing DNA molecules encoding BFP-4Pepper-7, mCherry-4Pepper-7, GAPDH-4Pepper-7, and TMED2-4Pepper-7.

[0101] In another specific embodiment of the present application, we provide expression plasmids psgRNA-Pepper-8(loop1), psgRNA-Pepper-8(tetraloop), and psgRNA-Pepper-8(loop1 and tetraloop) containing DNA molecules encoding sgRNA-Pepper-8(loop1), sgRNA-Pepper-8(tetraloop), and psgRNA-Pepper-8(loop1 and tetraloop). In another specific embodiment of the present application, we provide expression plasmid pLKO.1-4Pepper-9-MS2 containing a DNA molecule encoding 4Pepper-9-MS2.

[0102] This invention also provides an expression vector in which the DNA molecule encoding the nucleic acid aptamer is integrated, but the coding DNA sequence of the target RNA molecule is missing. Due to the absence of the coding DNA sequence of the target RNA molecule, the user can freely select the coding DNA sequence of the target RNA molecule to be detected, for example, the coding DNA sequence corresponding to GAPDH mRNA, insert the DNA sequence into an expression vector like the one described in this invention using standard recombinant DNA technology, introduce the resulting expression vector into host cells (transfection, transformation, infection, etc.), and detect the content and distribution of the target RNA.

[0103] host cell In this application, "host cells" include, but are not limited to, bacteria, yeast, mammalian cells, insect cells, plant cells, zebrafish cells, Drosophila cells, and nematode cells. More preferably, host cells are cultured in vitro cells or entire in vivo biological tissue. Mammalian cells included in host cells in this application include, but are not limited to, 297T, COS-7, BHK, CHO, HEK293, HeLa, H1299, fertilized egg stem cells, induced pluripotent stem cells, and primary cultured cells directly isolated from mammalian tissue. Escherichia coli cells included include, but are not limited to, BL21(DE3), BL21(DE3, Star), TOP10, Mach1, and DH5α. Yeast cells included include, but are not limited to, BY4741, BY4742, and AH109.

[0104] Detection array The detection array in this application includes one or more nucleic acid aptamer molecules of this application, fixed at separate positions on the array surface. The array surface is composed of a solid support including, but not limited to, glass, metal, ceramic, etc. The following are, but are not limited to, methods for immobilizing the nucleic acid aptamer molecules described in this application on the array surface.

[0105] (1) The 5' or 3' end of the nucleic acid aptamer molecule is labeled with biotin, streptavidin is coated onto the array surface, and the nucleic acid aptamer molecule is immobilized by the specific binding of biotin and streptavidin.

[0106] (2) A sequence MS2 that recognizes and binds to the phage capsid protein MCP, a sequence PP7 that recognizes and binds to the phage capsid protein PCP, or a sequence boxB RNA sequence that recognizes and binds to the λ phage transcription termination protein N is fused to the 5' end, 3' end, or stem-loop structure of the nucleic acid aptamer molecule, thereby recognizing and binding the proteins MCP, PP7, or λ N The proteins are coated onto the array surface, and MS2 and MCP protein, PP7 and PCP protein, or boxB RNA and λ N The nucleic acid aptamer molecule is immobilized through specific interaction with the protein.

[0107] (3) A portion of the RNA or DNA sequence is fused to the 5' or 3' end of the nucleic acid aptamer molecule, and an RNA sequence complementary to this RNA sequence or a DNA sequence complementary to this DNA sequence is immobilized on the array surface, and the nucleic acid aptamer molecule is immobilized on the array surface based on hybridization. The detection array is used to detect the presence or absence and the concentration of the target molecule. Therefore, only when the target molecule is present, the nucleic acid aptamer molecule binds to the fluorophore molecule, significantly increasing its fluorescence intensity at the appropriate excitation light wavelength, and within a certain range, the higher the concentration of the target molecule, the higher the fluorescence intensity.

[0108] kit The kit of this application includes a nucleic acid aptamer molecule and / or a fluorophore molecule as described herein, and a corresponding instruction manual, or includes an expression system expressing the nucleic acid aptamer molecule and / or a fluorophore molecule, and a corresponding instruction manual, or includes a host cell for the expression system expressing the nucleic acid aptamer molecule and / or a fluorophore molecule, and a corresponding instruction manual. In the kit, the nucleic acid aptamer molecule and the fluorophore molecule are present in separate solutions, or the nucleic acid aptamer molecule and the fluorophore molecule are present in the same solution.

[0109] The present application will be further described below with reference to examples, but these examples are for illustrative purposes only and the present application is not limited to these examples. The examples mainly use general genetic engineering molecular biology cloning methods. These methods are well known to those skilled in the art, as described in the relevant chapters of Jane Roskams et al.'s "Handbook of Molecular Biology Experiments" and "Molecular Cloning: A Laboratory Manual" (edited by JF Sambrook and DW Russell, translated by Huang Peitang et al.) (Third edition, August 2002, Science Press, Beijing). Those skilled in the art can implement the present application by modifying and transforming the following examples according to their specific circumstances.

[0110] The pCDNA3.1 hygro(+) plasmid vector used in the examples was purchased from Invitrogen, the pLKO.1-puro plasmid vector from Sigma, the pET28a plasmid vector from Novagen, and the pYES2.1 TOPO TA plasmid vector from Invitrogen. All primers used in PCR were synthesized, purified, and correctly identified by mass spectrometry by Shanghai Generay Biotech Co., Ltd.

[0111] All expression plasmids constructed in the examples were sequenced by Shanghai Jieli Biotechnology Co., Ltd. The Taq DNA polymerase used in each example was purchased from Shanghai Yijing Biotechnology Co., Ltd., and the PrimeSTAR DNA polymerase was purchased from TaKaRa. The polymerases were purchased with corresponding polymerase buffers and dNTPs. Restriction enzymes such as EcoRI, BamHI, BglII, HindIII, NdeI, XhoI, SacI, XbaI, and SpeI, as well as T4 ligase, T4 phosphorylase (T4 PNK), and T7 RNA polymerase were purchased from Fermentas, and the corresponding buffers were purchased with them.

[0112] The Hieff Clone™ One Step cloning kit used in the examples was purchased from Shanghai Yijing Biotechnology Co., Ltd. Unless otherwise noted, all inorganic salt chemical reagents were purchased from Sinopharmaceutical Group Shanghai Chemical Reagents Co., Ltd. Kanamycin was purchased from Amersco, ampicillin (Amp) was purchased from Amersco, and the 384-well and 96-well fluorescence detection blackboards were purchased from Grenier. DFHBI-1T and DFHO were purchased from Lucerna. GTP and SAM were purchased from Sigma.

[0113] The DNA purification kits used in the examples were purchased from BBI (Canada), and the general plasmid miniprep kits were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. The BL21 (DE3, Star) strain was purchased from Invitrogen. The 293T / 17 cells and COS-7 cells were purchased from the Cell Bank of the Commission for Typical Cultures of the Chinese Academy of Sciences. The BY4741 yeast strain was purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0114] Main equipment used in the examples Synergy Neo2 multimode microplate reader (Bio-Tek, USA), X-15R high-speed cooled centrifuge (Beckman, USA), Microfuge22R desktop high-speed cooled centrifuge (Beckman, USA), PCR thermal cycler (Biometra, Germany), iNvivo imaging system (Kodak, USA), spectrophotometer (Wako Corporation, Japan), nucleic acid electrophoresis system (Shen Neng Bo Cai Co., Ltd.).

[0115] As abbreviations, "h" refers to hours, "min" to minutes, "s" to seconds, "d" to days, "μL" to microliters, "ml" to milliliters, "L" to liters, "bp" to base pairs, "mM" to millimoles, and "μM" to micromoles.

[0116] General experimental methods and materials in the examples

[0117] (1) Preparation of nucleic acid aptamer molecules: The cDNA corresponding to the detected RNA was amplified using a primer containing the T7 promoter. The recovered double-stranded cDNA was used as a template and transcribed using T7 RNA polymerase (purchased from Fermentas) to obtain RNA. 10 μL of 3 M NaAc and 115 μL of DEPC water were added to a 20 μL transcription system and mixed uniformly. Then, 150 μL of phenol-chloroform-isopropanol mixture (phenol:chloroform:isopropanol = 25:24:1) was added, and the mixture was shaken to mix uniformly. The mixture was then centrifuged at 10,000 rpm for 5 minutes, and the supernatant was collected. An equal volume of chloroform solution was added, the mixture was shaken to mix uniformly, and the mixture was centrifuged at 10,000 rpm for 5 minutes. The supernatant was collected, and this process was repeated once.

[0118] Add 2.5 times the volume of anhydrous ethanol to the supernatant, let it stand in a refrigerator at -20°C for 30 minutes, then centrifuge at 12000 rpm at 4°C for 5 minutes. Discard the supernatant, and wash the precipitate twice with 75% pre-cooled anhydrous ethanol. After the ethanol has completely evaporated, add an appropriate amount of the screened buffer to resuspend the precipitate, treat at 75°C for 5 minutes, and let it stand at room temperature for at least 10 minutes before using it in the experiments described below.

[0119] (ii) Cell culture and transfection In this example, all cells were cultured in a CO2 incubator on a hyperglycemic medium (DMEM) containing 10% fetal bovine serum (FBS), streptomycin, and penicillin, and subcultured after reaching 80-90% confluence. Transfection was performed using FuGENE® HD (purchased from Promega) according to the instructions for use.

[0120] (3) Fluorescence imaging The main imaging experiments in the examples were performed using a Leica SP8 confocal laser microscope with an HCXPL APO 63.0x1.47 oil lens and a HyD detector. A 488nm laser was used to image the fluorescence of the Pepepr-III-3 complex. A 405nm laser and a 561nm laser were used to image the fluorescence of BFP and mCherry, respectively. Lasers of 458nm, 458nm, 488nm, 488nm, 488nm, 561nm, and 561nm were used to image the fluorescence of Pepper-III-7, Pepper-III-6, Pepper-III-8, Pepper-III-4, Pepper-III-15, Pepper-III-18, and Pepper-III-21, respectively. A 488nm laser was used to image the fluorescence of Broccoli-DFHBI-1T and Corn-DFHO, respectively.

[0121] (iv) Construction of recombinant plasmids based on homologous recombination 1. Preparation of linearized vectors: An appropriate cloning site was selected, and the vector was linearized. Linearized vectors can be prepared by restriction enzyme digestion or reverse PCR amplification.

[0122] 2. Insert preparation by PCR amplification: A 15-25 bp (excluding restriction enzyme digestion sites) linearized vector terminal homologous sequence was inserted into the 5' end of the forward and reverse PCR primers of the insert, so that the 5' and 3' ends of the insert PCR product contained sequences that perfectly matched the sequences corresponding to both ends of the linearized vector, respectively.

[0123] 3. Concentration measurement of linearization vector and insert: Several isodilution gradients of linearization vector and insert amplification products were prepared. 1 μL of each product was taken from the original product and the diluted product and subjected to agarose gel electrophoresis. The intensity of the bands was compared with the DNA molecular weight standard (DNA marker) to determine the approximate concentration.

[0124] 4. Recombination Reaction In the recombinant reaction system, the most appropriate amount of vector to use is 0.03 pmol, the most appropriate molar ratio of vector to insert is 1:2 to 1:3, and therefore the most appropriate amount of insert to use is 0.06 to 0.09 pmol. [Table 2] X and Y were calculated according to the formulas to obtain the amounts of linearization vector and insert to be used. After the system was prepared, each component was homogeneously mixed and reacted at 50°C for 20 minutes. If the insert exceeds 5kb, the incubation temperature can be extended up to 25 minutes. After the reaction is complete, it is recommended to cool the reaction tube on ice for 5 minutes. The reaction product may be transformed directly, or it may be stored at -20°C and thawed and transformed as needed.

[0125] (5) Functional detection of nucleic acid aptamers Pepper or Pepper mutant nucleic acid aptamer molecules were prepared according to conventional experimental method (1). 5 μM of the nucleic acid aptamer molecule and 1 μM of the fluorophore molecule were incubated in detection buffer (40 mM HEPES, pH 7.4, 125 mM KCl, 5 mM MgCl2, 5% DMSO). The maximum excitation and emission peaks of the nucleic acid aptamer-fluorophore molecule complex were detected using a Synergy Neo2 multimode microplate reader. Furthermore, the fluorescence intensity of the nucleic acid aptamer-fluorophore molecule complex under maximum excitation and emission conditions was detected using a Synergy Neo2 multimode microplate reader. A control group sample (excluding the 1 μM nucleic acid aptamer fluorophore molecule) was also measured under the same conditions, and the ratio of fluorescence intensities was calculated. For example, the maximum excitation peak of fluorescence for a complex formed from 5 μM F30-Pepper-2 nucleic acid aptamer and 1 μM III-3 fluorophore molecule was 485 nm, and the maximum emission peak was 530 nm. Using a Synergy Neo2 multimode microplate reader, the fluorescence intensity of this complex was detected as 36000 under conditions of excitation at 485 ± 10 nm and emission at 530 nm ± 10 nm. If the fluorescence intensity of the control group (1 μM III-3 fluorophore molecule) under the same detection conditions was 10, then the activation factor of the III-3 fluorophore molecule by the F30-Pepper-2 nucleic acid aptamer is 3600-fold.

[0126] Example 1. Secondary structure of a Pepper nucleic acid aptamer molecule The secondary structure of the Pepper nucleic acid aptamer was analyzed using mFold online RNA structure analysis software. Pepper contains two stem structures, two loop structures, and one stem-loop structure (Figure 1A). For the sequence of one of these, stem 1 and the stem-loop, the predicted secondary structure of Pepper-1 (SEQ ID NO:1) is shown in Figure 1B.

[0127] Example 2. Identification of the properties of the Pepper-III-3 composite. To detect the spectral characteristics of the Pepper-III-3 complex, F30-Pepper-1 (SEQ ID NO:2)RNA was prepared according to the conventional experimental method (I). 1 μM of III-3 was incubated with 5 μM of F30-Pepper-1. The detection results showed that the F30-Pepper-1-III-3 complex had a maximum excitation wavelength of 485 nm and a maximum emission wavelength of 530 nm (Figure 4A). To detect the difference between the light absorption of the F30-Pepper-1-III-3 complex and the light absorption of the III-3 fluorophore molecule itself, 5 μM of III-3 was incubated with 25 μM of F30-Pepper-1, or 5 μM of III-3 alone was incubated with the F30-Pepper-1-III-3 complex and III-3, respectively. The detection results showed that the maximum light absorption of the F30-Pepper-1-III-3 complex exhibited a larger redshift compared to III-3 alone, with the maximum absorption light occurring at 484 nm (Figure 4B).

[0128] To detect whether Pepper bound to III-3 was in monomeric or polymeric form, F30-Pepper-1 was identified by Native PAGE, and known monomeric nucleic acid aptamers F30-Broccoli (SEQ ID NO:4) and F30-2dBroccoli (SEQ ID NO:5) (Filonov et al. Journal of the American Chemical Society 2014. 136:16299-16308; Filonov et al. Chemistry & Biology 2015. 22: 649-660) were used as control groups. By comparing the fluorescence imaging results with the results of SYBRgold (a common nucleic acid dye, purchased from Invitrogen), it was found that F30-Pepper-1 was located at approximately 100 bp, similar to F30-Broccoli, and its actual size was located at 103 bp. Therefore, it was determined that F30-Pepper-1 bound to III-3 in monomeric form (Figure 4C).

[0129] To detect the binding constant between Pepper and III-3, 2 nm F30-Pepper-1 was incubated with III-3 at different concentrations, and their fluorescence values ​​were detected. The detection results showed that the binding constant between F30-Pepper-1 and III-3 was 3.5 nm (Figure 4D).

[0130] To detect the temperature stability of pepper, 10 μM III-3 was incubated with 1 μM F30-Pepper-1, and the fluorescence values ​​were detected after 5 minutes at different temperatures. As a control group, 10 μM DFHBI-1T was incubated with 1 μM F30-Broccoli. The detection results showed that the Tm value of F30-Pepper-1 was 55°C, which was significantly higher than that of F30-Broccoli (48°C, Figure 4E), indicating that F30-Pepper-1 has superior temperature stability.

[0131] To detect the stability of the Pepper-III-3 complex under different pH conditions, the F30-Pepper-1-III-3 complex was placed for 60 minutes under different pH environments, and its fluorescence value was detected. The F30-Broccoli-DFHBI-1T complex was used as a control group. The detection results showed that the F30-Pepper-1-III-3 complex maintained a very high fluorescence signal across the entire pH range from 5 to 9, but the fluorescence of F30-Broccoli-DFHBI-1T decreased rapidly with decreasing pH (Figure 4F), indicating that the F30-Pepper-1-III-3 complex has superior pH stability.

[0132] K of Pepper-III-3 complex + To detect ion dependence, 1 μM F30-Pepper-1 and 5 μM III-3 were incubated in buffers containing 100 mM KCl or 100 mM LiCl, respectively, treated at 70°C for 5 minutes, and then left at room temperature for 15 minutes or more. Fluorescence values ​​under different conditions were detected. The F30-Broccoli-DFHBI-1T complex was used as the control group. According to previous literature, the structure of Broccoli contains a guanine quadruplex, and the stability of the guanine quadruplex structure is K +It is highly dependent on the presence of ions. This is consistent with experimental results, where the fluorescence of the F30-Broccoli-DFHBI-1T complex in LiCl buffer was only a fraction of the fluorescence in KCl buffer (Figure 4G). In contrast, the fluorescence of the F30-Pepper-1-III-3 complex was K + Since it does not depend on the presence of ions (Figure 4G), it was determined that the Pepper structure does not have a guanine quadruple chain structure.

[0133] Example 3. Fluorescence activation effect on III-3 fluorophore molecules by different Pepper mutants. To detect the fluorescence activation effect on the III-3 fluorophore molecule by different Pepper mutants, point mutations shown in Table 1 were induced in the Pepper-1 sequence of F30-Pepper-1, and Pepper mutant RNAs containing different base mutations were prepared according to the conventional experimental method (I). 1 μM of III-3 was incubated with 5 μM of each different F30-Pepper-1 mutant RNA, and the fluorescence activation factor for the III-3 fluorophore molecule was detected according to the conventional experimental method (V). The results showed that most F30-Pepper-1 mutants containing a single base mutation maintained a relatively strong fluorescence activation effect (>10x) on III-3 (Table 2). Some F30-Pepper-1 mutants containing 2 to 7 base mutations still maintained a relatively strong fluorescence activation effect (>100x) on III-3 (Table 3). From the above, it was found that many mutants of Pepper, including single-nucleotide and multi-nucleotide mutants, still retain aptamer function that activates III-3 fluorophore molecules.

[0134] Table 2: Activation effect on III-3 by Pepper mutants containing single nucleotide variants. [Table 3] Note: F30-Pepper-1, shown in Table 2, is a nucleic acid aptamer with sequence number 2. The other aptamers are produced by inducing point mutations in the Pepper-1 sequence of F30-Pepper-1 at the nucleotide positions corresponding to Pepper shown in Figure 1A.

[0135] Table 3. Activation effect on III-3 by Pepper mutants containing multiple bases. [Table 4] Example 4. Activation effect of base-modified pepper on III-3 To detect the activation effect of base-modified Pepper on III-3, base-modified Pepper-3 (SEQ ID NO: 6, this sequence GGCCCCCAAUCGUGGCGUGUCGG) was used. CCUGCUUCGGCAGG The underlined bases in CACUGGCGCCGGGGCC are deoxyribonucleotide bases. ) and Pepper-4 (SEQ ID NO: 7, this sequence GGCCCCCCAAUCGUGGCGUGUCGG C CUGCUUCGGC A The underlined bases in GGCACUGGCGCCGGGGGCC are 2'-F modified bases. These were synthesized (by ShanghaigenePharma Co., Ltd). In each case, the stem-loop structure bases were replaced with deoxyribonucleotides (the shaded areas in Figure 5A) and some of the bases were modified with 2'-F (the shaded areas in Figure 5B). The fluorescence activation effect of these base-modified Peppers on III-3 fluorophore molecules was detected according to conventional experimental methods (v). The detection results showed that base-modified Pepper-3 and Pepper-4 could still significantly activate the fluorescence of III-3 fluorophore molecules (Figure 5C).

[0136] Example 5. Pepper Concatenation To detect the activation effect of Pepper concatemer on the fluorescence of III-3, Pepper was coupled in series in the following three different configurations.

[0137] (1) "Serial 1" configuration (Figure 6A). The "head" and "tail" of the Pepper structure were joined "head to tail" to obtain nPepper (where n is the number of Peppers that can be arbitrarily copied). In this example, cDNAs encoding F30-2Pepper-5, F30-4Pepper-5, F30-8Pepper-5, F30-16Pepper-5, and F30-32Pepper-2 were prepared by artificial gene synthesis (the sequences encoding the RNA aptamers are SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, respectively). After PCR amplification, nucleic acid aptamer RNA was prepared according to the conventional experimental method (i), and 0.1 μM of RNA aptamer was incubated with 10 μM of III-3, after which the fluorescence intensity was detected according to the conventional experimental method (v). The detection results showed that the fluorescence of nPepper-III-3 increased with increasing n (Figure 6D). When n > 8, the fluorescence of nPepper-III-3 did not increase proportionally with increasing n, but it was still much higher than the fluorescence of Pepper-III-3 (Figure 6D), indicating that the fluorescence intensity of the Pepper-III-3 complex can be increased by the "series 1" configuration.

[0138] (2) "Series 2" configuration (Figure 6B). Pepper was linked in series as a single structural unit to obtain nxPepper (where n is a Pepper that can be arbitrarily copied). In this example, cDNAs encoding 2xPepper-6, 4xPepper-6, 8xPepper-6, and 16xPepper-6 were prepared by artificial gene synthesis (the sequences encoding the RNA aptamers are SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, and SEQ ID NO:16, respectively). Nucleic acid aptamer RNA was prepared according to the conventional experimental method (I), and 0.1 μM of RNA aptamer was incubated with 10 μM of III-3, after which the fluorescence intensity was detected according to the conventional experimental method (V). The detection results showed that the fluorescence of nPepper-III-3 increased with increasing n (Figure 6E), indicating that the fluorescence intensity of the Pepper-III-3 complex can be increased by the "Series 2" configuration.

[0139] (3) "Series 3" configuration (Figure 6C). By combining the above "Series 1" and "Series 2", the nPepper obtained by "Series 1" was joined in series as one structural unit in the "Series 2" configuration to obtain n1xn2Pepper (wherein n1 and n2 are arbitrarily copyable Peppers). In this example, cDNAs encoding 2x2Pepper-5, 4x2Pepper-5, and 8x2Pepper-5 (the sequences encoding the RNA aptamers are SEQ ID NO:17, SEQ ID NO:18, and SEQ ID NO:19, respectively) were prepared by artificial gene synthesis, nucleic acid aptamer RNA was prepared according to the conventional experimental method (i), and 0.1 μM of RNA aptamer was incubated with 20 μM of III-3, after which the fluorescence intensity was detected according to the conventional experimental method (v). The detection results showed that the fluorescence intensity of Pepper concatemer-III-3 obtained in this "series 3" configuration was significantly higher than that of Pepper-III-3 (Figure 6F), indicating that the fluorescence intensity of the Pepper-III-3 complex can be increased by the "series 3" configuration.

[0140] Example 6.III-3 Identification of the properties of analogs According to conventional experimental methods (1), F30-Pepper-1 RNA aptamer molecules were prepared, and their fluorescence spectra, molar extinction coefficients, quantum yields, fluorescence activation factors, and binding constants (Kd) were used to detect basic characteristics of the III-3 analog after binding to Pepper. The detection results are shown in Table 4. From the data in the table, it was found that F30-Pepper-1 can activate the fluorescence intensity of the III-3 analog to varying degrees.

[0141] Table 4: Physicochemical properties of F30-Pepper-1 RNA aptamer molecules bound to different fluorescent molecules [Table 5] Example 7. Use of Pepper-III-3 complex in labeling RNA in bacteria To detect the effect of Pepper-III-3 in bacteria, a bacterial expression plasmid expressing F30-Pepper-1 was first constructed. F30-Pepper-1 from Example 2 was amplified using primers, and pET28a was amplified using primers to remove the promoter and multi-cloning site regions. The amplified F30-Pepper-1 DNA fragment was then conjugated to the pET28a linearized vector according to experimental method (IV), and the resulting recombinant plasmid was named pET28a-T7-F30-Pepper-1.

[0142] The primers used for amplification of the F30-Pepper-1 fragment are as follows:

[0143] Upstream primer (P1): 5'-TCGATCCCGCGAAATTAATACGACTCACTATAGGGTTGCCA TGTGTATGTGGGG-3' Downstream primer (P2): 5'-CAAGGGGTTATGCTATTGCCATGAATGATCC-3' (SEQ ID No:) The primers used to amplify and linearize the pET28a vector are as follows:

[0144] Upstream primer (P3): 5'-TAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAG-3' Downstream primer (P4): 5'-ATTTCGCGGGATCGAGATCTCGATCCTCTACGCCGGACG-3' The pET28a-T7-F30-Pepper-1 recombinant plasmid was used to transform the BL21(DE3, Star) E. coli strain, one clone was selected, and cultured at 37°C. 600 After the pH reached approximately 0.2, 1 mM IPTG was added to induce F30-Pepper-1 expression. After 4 hours, the bacteria were harvested and resuspended in PBS solution containing 2 μM III-3. BL21(DE3,Star) E. coli transformed with a pET28a empty vector was used as the control group. As a result, the bacteria exhibited bright yellow-green fluorescence only when expressing F30-Pepper-1 and in the presence of III-3 (Figure 7), indicating that the Pepper-III-3 complex is used for fluorescent labeling of RNA within bacteria.

[0145] Example 8. Use of Pepper-III-3 complex in labeling RNA in yeast cells To detect the effect of Pepper-III-3 in yeast, a yeast expression plasmid expressing F30-Pepper-1 was first constructed. The F30-Pepper-1 DNA fragment from Example 2 was amplified using primers, and the F30-Pepper-1 fragment obtained by amplification according to experimental method (IV) was inserted into the pYES2.1TOPO TA vector. The resulting recombinant plasmid was named pYES2.1-F30-Pepper-1.

[0146] The primers used for amplification of the F30-Pepper-1 fragment are as follows:

[0147] Upstream primer (P5): 5'-GGAATATTAAGCTCGCCCTTTTGCCATGTGTATGTGGG-3' Downstream primer (P6): 5'-TGACCTCGAAGCTCGCCCTTGTTGCCATGAATGATCC-3' The BY4741 strain was transformed with the pYES2.1-F30-Pepper-1 recombinant plasmid, one clone was selected and cultured at 30°C, and OD 600 After the ratio was reduced to approximately 0.1, 1 mM galactose was added to induce F30-Pepper-1 expression. After 10 hours, the bacteria were harvested and resuspended in a PBS solution containing 2 μM III-3. An untreated BY4741 strain was used as the control group. As a result, yeast cells exhibited bright yellow-green fluorescence only when F30-Pepper-1 was expressed and in the presence of III-3 (Figure 8), indicating that the Pepper-III-3 complex is used for fluorescent labeling of RNA within yeast cells.

[0148] Example 9. Use of Pepper, III-3 and its analogues in labeling RNA in mammalian cells To detect the use of Pepper and III-3 in labeling RNA within mammalian cells, mammalian cell expression plasmids were constructed using reported Broccoli and Corn nucleic acid aptamer molecules (bound to DFHBI-1T and DFHO fluorophore molecules, respectively) as control groups (Filonov et al. Journal of the American Chemical Society 2014. 136:16299-16308; Song et al. Nature Chemical Biology 2017. 13: 1187-1194). F30-Pepper-1 and F30-Broccoli from Example 2 were amplified using primers P7 and P8, respectively, and tRNA-CorNcDNA fragments (the encoded RNA sequence having SEQ ID No: 20) produced by artificial gene synthesis were amplified using primers P9 and P10. These fragments were then inserted into the pLKO.1 puro vector according to experimental method (IV). The obtained expression vectors were named pLKO.1-F30-Pepper-1, pLKO.1-F30-Broccoli, and pLKO.1-tRNA-Corn, and these plasmids expressed F30-Pepper-1, F30-Broccoli, and tRNA-CorNRNA, respectively.

[0149] pLKO.1-F30-Pepper-1, pLKO.1-F30-Broccoli, and pLKO.1-tRNA-Corn plasmids were transfected into 293T / 17 cells. After 24 hours, 1 μM of III-3, 20 μM of DFHBI, and 10 μM of DFHO were added to label F30-Pepper-1, F30-Broccoli, and tRNA-Corn, respectively. Cells that did not express the corresponding aptamers were used as a control group, and the labeling effect was detected according to experimental method (III). As a result, the F30-Pepper-1-III-3 complex showed very bright yellow-green fluorescence, and its fluorescence intensity was significantly higher than that of the F30-Broccoli-DFHBI-1T and tRNA-Corn-DFHO complexes (Figures 9A and B), indicating that Pepper-III-3 can function well in mammalian cells.

[0150] The primers used for amplification of F30-Pepper-1 and F30-Broccoli are as follows.

[0151] Upstream primer (P7): 5'-GGAAAGGACGAAACTCTAGATTGCCATGTGTATGTGGG-3'; Downstream primer (P8): 5'-TGTCTCGAGGTCGAGAATTCAAAAAAAGTTGCCATGAATGATCC-3' The primers used for tRNA-Corn amplification are as follows:

[0152] Upstream primer (P9): 5'-GGAAAGGACGAAACTCTAGAGCCCGGATAGCTCAGTCGG-3' Downstream primer (P10): 5'-TGTCTCGAGGTCGAGAATTCAAAAAAATGGCGCCCGAACAGGGACTTGCGAGCTCAGGATCCTTCCGTTTCGCACTGG-3'.

[0153] To detect the use of Pepper and III-3 analogs in labeling mammalian RNA, a mammalian expression plasmid expressing F30-8Pepper-5 was constructed. Using primers P7 and P8 in this example, the F30-8Pepper-5 fragments from Example 5 were amplified, and these fragments were inserted into the pLKO.1 puro vector according to experimental method (IV). The resulting expression vector was named pLKO.1-F30-8Pepper-5.

[0154] The pLKO.1-F30-8Pepper-5 plasmid was transfected into 293T / 17 cells, and after 24 hours, different III-3 analogs were added for labeling. The labeling effect was then detected according to experimental method (III). As a result, all different III-3 analogs could specifically label cells expressing F30-8Pepper-5, but did not label control cells that did not express F30-8Pepper-5 (Figure 9C). Therefore, it was found that Pepper-containing III-3 and its analogs can be used to label RNA in mammalian cells.

[0155] Example 10. Probe construction based on Pepper To construct a detectable probe based on Pepper, the nucleotides on the stem-loop structure of the Pepper-1 (SEQ ID No:2) structure were replaced with RNA aptamers that can specifically recognize and bind to adenosine and guanosine triphosphate (GTP). These aptamers were then linked to Pepper-1 with bases of different lengths and compositions (Figure 10A), and probe RNAs were prepared according to the conventional experimental method (I). These were then incubated with III-3, and the fluorescence intensity in the presence or absence of adenosine and GTP was detected using a multimode microplate reader. As a result of the detection, the adenosine probe showed an activation factor of 88-fold when the binding base between the adenosine aptamer and Pepper-1 was the base pair of linkage 2 shown in Figure 10B, and the corresponding probe RNA sequence was SEQ ID No:21. When the binding base between the GTP aptamer and Pepper-1 was the base pair of binding 3 shown in Figure 10B, the activation factor of the GTP probe was 10-fold, and the corresponding probe RNA sequence was SEQ ID No: 22.

[0156] Example 11. Use of Pepper to track the localization of RNA within cells To detect the use of Pepper to track the localization of RNA within cells, we first constructed an expression plasmid of chimeric RNA in which Pepper fused with a different RNA. We synthesized 4Pepper-7 cDNA (the sequence encoding the RNA aptamer is SEQ ID No: 23) using artificial gene synthesis, amplified the 4Pepper-7 gene fragment using primers, and inserted it into a pCDNA3.1 hygro(+) vector digested with restriction enzymes HindIII and XhoI using homologous recombination to obtain the pCDNA3.1 hygro(+)-4Pepper-7 recombinant plasmid. GAPDH and TMED2 gene fragments (the gene sequences encoding GAPDH and TMED2 are Genebank: BC009081 and BC025957, respectively) were synthesized artificially. The GAPDH and TMED2 gene fragments were amplified using primers and inserted into a pCDNA3.1 hygro(+)-4Pepper-7 vector that had been double digested with restriction enzymes NheI and HindIII. This yielded recombinant plasmids pCDNA3.1 hygro(+)-GAPDH-4Pepper-7 and pCDNA3.1 hygro(+)-TMED2-4Pepper-7, respectively, encoding GAPDH-4Pepper-7 and TMED2-4Pepper-7 chimeric RNAs, whose sequences were SEQ ID No: 24 and 25.

[0157] The primers used for amplification of 4Pepper-7 are as follows:

[0158] Upstream primer (P11): 5'-TAGCGTTTAAACTTAAGCTTCCCACGGAGGATCCCCAATC-3' Downstream primer (P12): 5'-ACGGGCCCTCTAGACTCGAGCCCACGGAGGATCCCGGCGCC-3' The primers used for GAPDH amplification are as follows:

[0159] Upstream primer (P13): 5'-GGAGACCCAAGCTGGCTAGCATGGGGAAGGTGAAGGTCGG-3' Downstream primer (P14): 5'-GGATCCTCCGTGGGAAGCTTAACCATGCTCTAGCGAGTGTTACTCCTTGGAGGCCATGT-3' The primers used for TMED2 amplification are as follows:

[0160] Upstream primer (P15): 5'-GGAGACCCAAGCTGGCTAGCATGGTGACGCTTGCTGAACT-3' Downstream primer (P16): 5'-GGATCCTCCGTGGGAAGCTTAACCATGCTCTAGCGAGTTAAACAACTCTCCGGACTTC-3' After constructing the plasmid described above, sequencing was used to confirm that the inserted sequence was completely correct, and the plasmid was extracted using a transfection-grade plasmid extraction kit for subsequent transfection experiments.

[0161] The recombinant plasmids pCDNA3.1 hygro(+)-GAPDH-4Pepper-7 and pCDNA3.1 hygro(+)-TMED2-4Pepper-7 constructed in this example were co-transfected into COS-7 cells together with pCDNA3.1 hygro(+)-BFP, respectively. After 24 hours of transfection, the cells were imaged according to the fluorescence imaging method described in Specific Experimental Method (III). The imaging results showed that the fluorescence of GAPDH-4Pepper-7-III-3 was mainly concentrated in the cytoplasm, while the fluorescence of TMED2-4Pepper-7-III-3 showed a decrease in endoplasmic reticulum enrichment, which is consistent with previous reports and also consistent with the results of fluorescence iNsitu hybridization (FISH) (Figure 11). From the above results, it was found that Pepper can track the localization of RNA.

[0162] Example 12. Use of Pepper to Detect the Relationship between Intracellular mRNA and Protein Content To detect intracellular mRNA translation by Pepper, first, it is necessary to construct mRNA expression plasmids fused with different Peppers. Using respective primers, mCherry2 - N1 (Addgene: 54517) and EasyFusioNT2A - H2B - TagBFP (Addgene: 113086) were used as templates to amplify the mCherry and TagBFP gene fragments, which were inserted into the pCDNA3.1 hygro(+)-GAPDH - 4Pepper - 7 vector double - digested with restriction enzymes NheI and HindIII to obtain pCDNA3.1 hygro(+)-mCherry - 4Pepper - 7 and pCDNA3.1 hygro(+)-TagBFP - 4Pepper - 7 recombinant plasmids, encoding mCherry - 4Pepper - 7 and TagBFP - 4Pepper - 7 respectively, and their RNA sequences were SEQ ID No: 26 and 27 respectively.

[0163] The primers used for the amplification of mCherry are as follows. Forward primer (P17): 5’-gGAGACCCAAGCTGGCTAGCATGGTGAGCAAGGGCGAGGAGG-3’ Reverse primer (P18): 5’-GGATCCTCCGTGGGAAGCTTAACCATGCTCTAGCGAGTTACTTGTACAGCTCGTCCATG-3’ The primers used for the amplification of TagBFP are as follows.

[0164] Forward primer (P19): 5’-GGAGACCCAAGCTGGCTAGCATGAGCGAGCTGATTAAGGA-3’ Reverse primer (P20): 5’-GGATCCTCCGTGGGAAGCTTCTCCCAAACCATGCTCTAGCGAGTGTTAATTGAGCTTGTGCCCCA-3’ COS-7 cells were transfected with the recombinant plasmids pCDNA3.1 hygro(+)-BFP-4Pepper-7 and pCDNA3.1 hygro(+)-mCherry-4Pepper-7, respectively. After 24 hours, the cells transfected with the recombinant plasmids pCDNA3.1 hygro(+)-BFP-4Pepper-7 and pCDNA3.1 hygro(+)-mCherry-4Pepper-7 were labeled with 0.2 μM III-3. The fluorescence of mRNA (4Pepper-7-III-3) and proteins (BFP and mCherry) was detected by flow cytometry, and the mRNA fluorescence and protein fluorescence were fitted using the Michaelis-Menten formula. 2 The results showed a significant difference in the translation efficiency of different mRNAs (Figure 12), indicating that Pepper can detect the relationship between mRNA and protein content.

[0165] Example 13. Use of Pepper for detecting genomic DNA To detect genomic DNA using Pepper, first, a recombinant plasmid expressing Pepper-8 and sgRNA chimeric RNA was constructed. cDNA of sgRNA-Pepper-8(loop1), sgRNA-Pepper-8(tetraloop), and sgRNA-Pepper-8(loop1 and tetraloop) containing centromere targeting sequences was prepared by artificial gene synthesis, and the encoded RNA sequences were SEQ ID No:28, 29, and 30, respectively. The cDNA of the above chimeric RNA was amplified using primers P21 and P22, and the psgRNA plasmid was amplified using primers P23 and P24 (Shao et al. Nucleic acids research 2016. 44: e86). The cDNA obtained by amplification and the linearized psgRNA vector were ligated according to the experimental method (IV), and the resulting plasmids were named psgRNA-Pepper-8(loop1), psgRNA-Pepper-8(loop2), and psgRNA-Pepper-8(loop1 and tetraloop), respectively (Figure 13A). Using primers P25 and P26, the dCas9-GFP gene fragment was amplified with pSLQ1645(dCas9-GFP) (Shao et al. Nucleic acids research 2016. 44: e86) as a template and inserted into the pCDNA3.1 hygro(+) vector double-digested with restriction enzymes HindIII and XhoI according to the experimental method (IV), and the resulting plasmid was named pCDNA3.1 hygro(+)-dCas9-GFP.

[0166] The primers used for amplification of cDNA corresponding to Pepper and sgRNA chimeric RNA are as follows.

[0167] Forward primer (P21): 5’-AAAGGACGAAACACCGAATCTGCAAGTGGATATTGTTTGAG-3’ Reverse primer (P22): 5’-TGATCTAGAAAAAAAGCACCGACTCGGTGCCAC-3’ The primers used to amplify and linearize the psgRNA plasmid are as follows:

[0168] Upstream primer (P23): 5'-TTTTTTTCTAGATCATAATCAGCCATACC-3' Downstream primer (P24): 5'-GGTGTTTCGTCCTTTCCACAAG-3' The primers used for amplifying SpdCas9-GFP are as follows:

[0169] Upstream primer (P25): 5'-TAGCGTTTAAACTTAAGCTTGTGCAGGCTGGCGCCACCATGGCCCC-3' Downstream primer (P26): 5'-ACGGGCCCTCTAGACTCGAGTTACTTGTACAGCTCGTCCATGC-3' pCDNA3.1 hygro(+)-dCas9-GFP was co-transfected into COS-7 cells with recombinant plasmids of psgRNA-Pepper-6(loop1), psgRNA-Pepper-6(loop2), and psgRNA-Pepper-6(loop1 and tetraloop), respectively. After 24 hours of transfection, the cells were labeled with 1 μM III-21 and Hoechst, and the fluorescence of Pepper-8-III-21, GFP, and Hoechst was observed using a fluorescence microscope. The imaging results showed that the fluorescence of Pepper-8-III-21 was mainly concentrated in the cell nucleus and aggregated in dots (centromeres), almost perfectly matching the fluorescence of dCas9-GFP (Figure 13B), and the number of dots also matched that of a single sgRNA (Figure 13C). Therefore, it was found that Pepper can be used for imaging gene DNA.

[0170] Example 14. Use of Pepper in RNA super-resolution imaging To use Pepper for super-resolution imaging of RNA, we first constructed a plasmid in which RNA was immobilized in the cell nucleus. We synthesized the 4Pepper-9-MS2 DNA fragment (SEQ ID No: 31) using artificial gene synthesis, and used it as a template. We amplified it using primers P27 and P28, and inserted the resulting fragment into a pLKO.1 vector that had been double-digested with restriction enzymes XbaI and EcoRI according to experimental method (IV). The resulting plasmid was named pLKO.1-4Pepper-9-MS2. Using primers, the H2B gene fragment was amplified using pCS-H2B-EGFP (Addgene: 53744) as a template, the tdMCP gene fragment was amplified using pHAGE-Ubc-NLS-HA-tdMCP-GFP (Addgene: 40649) as a template, and the tagBFP gene fragment was amplified using primers. The tdMCP, tagBFP, and H2B gene fragments were then combined by overlap PCR to obtain a tdMCP-tagBFP-H2B fusion fragment. This fusion fragment was inserted into pmTurquoise2-Golgi (Addgene: 36205) according to experimental method (IV), and the resulting plasmid was named pH2B-tdMCP-tagBFP, encoding tdMCP-tagBFP localized in the cell nucleus.

[0171] The primers used for amplifying the 4Pepper-9-MS2 DNA fragment are as follows:

[0172] Upstream primer (P27): 5'-GGAAAGGACGAAACTCTAGAGGGGCCCCCCAATCGTGG-3' Downstream primer (P28): 5'-TGTCTCGAGGTCGAGAATTCAAAAAAAGGGGCCCCCGGCGCCAGTG-3' The primers used for amplification of the tdMCP gene fragment are as follows:

[0173] Upstream primer (P29): 5'-GAACCGTCAGATCCGCTAGCCACCATGGGCTACCCCTACGACGTGCCCG-3' Downstream primer (P30): 5'-TCCAGAATCCGCGTAGATGCCGG-3' The primers used to amplify the tagBFP gene fragment are as follows:

[0174] Upstream primer (P31): 5'-CTACGCGGATTCTGGAGGCGGTGGATCCATGAGCGAGCTGATTAAGGAG-3' Downstream primer (P32): 5'-AGATCTATTGAGCTTGTGCCCCAGTTTG-3' The primers used for amplification of the H2B gene fragment are as follows:

[0175] Upstream primer (P33): 5'-CAAGCTCAATAGATCTATGCCTGAACCGGCAAAATCC-3' Downstream primer (P34): 5'-GACTGCAGAATTCGAAGCTTACTTGGAGCTGGTGTACTTG-3'.

[0176] COS-7 cells were cotransfected with the pLKO.1-4Pepper-9-MS2 and pH2B-tdPP7-tagBFP recombinant plasmids. After 24 hours, the cells were labeled with a III-21 fluorophore molecule, and the fluorescence distribution of the Pepper-III-21 complex was detected using a Zeiss Elyra PS.1 super-resolution fluorescence microscope. A 561 long-pass filter was used as the excitation light, the lens was a Zeiss Plan-Apochromat 63×(NA, 1.4)Oil DIC M27, the CMOS size was 1024 x 1024 pixels, and the images were processed with ZEN2011 Black (Zeiss) software. Imaging results showed that cells cotransfected with pLKO.1-4Pepper-9-MS2 and pH2B-tdMCP-tagBFP exhibited clear nuclear pore structure (Figure 14). This result indicates that Pepper can be used for RNA super-resolution imaging.

[0177] Example 15. Pepper tag used for RNA extraction and purification. To detect the use of Pepper for RNA extraction and purification, COS-7 cells were transfected with the pCDNA3.1 hygro(+)-TagBFP-4Pepper-7 and pCDNA3.1 hygro(+)-mCherry-4Pepper-7 recombinant plasmids from Example 12, respectively. After 24 hours, the cells were harvested, and the total RNA was extracted using Eaststep Super Total RNA ExtractioNKit (Promega). The extracted total RNA was dissolved in a buffer containing 40 mM HEPES, pH 7.4, 125 mM KCl, and 5 mM MgCl2, incubated at 70°C for 10 minutes, and then left at room temperature for 30 minutes or more.

[0178] 500 μL of activated thiol Sepharose 4B (GE Healthcare) was washed twice with 500 μL of PBS, then PBS containing 10 mM TCEP (Sigma) was added and incubated at room temperature for 1 hour. After washing twice with 500 μL of PBS, a maleamide-containing III-3 fluorophore molecule (Mal-III-3) was added and reacted at room temperature for 30 minutes, followed by three washes with 500 μL of PBS. The total RNA treated above was incubated with the treated beads at room temperature for 30 minutes, then centrifuged at 4000 rpm for 2 minutes, discarded the supernatant, and the agarose beads were washed six times with a buffer of 40 mM HEPES, pH 7.4, 125 mM KCl, and 5 mM MgCl2, with the supernatant removed by centrifugation each time. The beads were re-selected with DEPC water, treated at 70°C for 10 minutes, centrifuged at 4000 rpm for 2 minutes, and the supernatant was collected. To the collected supernatant, 1 / 10 volume of NaAc and 2.5 times volume of anhydrous ethanol were added, and the mixture was allowed to stand in a refrigerator at -80°C for 20 minutes. The mixture was then centrifuged at 14000 rpm for 10 minutes at 4°C, leaving the precipitate behind, discarding the supernatant. The precipitate was washed with a 70% pre-cooled ethanol solution, and the mixture was centrifuged at 14000 rpm for 10 minutes at 4°C, leaving the precipitate behind, discarding the supernatant. This process was repeated once. The precipitate was left at room temperature for 5 minutes, and after all the alcohol had evaporated, the precipitate was resuspended in a small amount of DEPC water.

[0179] The recovered RNA was identified by electrophoresis, and the resulting gel was incubated for 30 minutes in a buffer containing 5 μM III-3, 40 mM HEPES, pH 7.4, 125 mM KCl, and 5 mM MgCl2, to detect the fluorescence of 4Pepper-III-3 in the gel. Imaging results showed that three RNA bands in the gel clearly exhibited Pepper-III-3 fluorescence signals, corresponding to TagBFP-4Pepper and mCherry-4Pepper, respectively (Figure 15), indicating that Pepper can be used as a tag for RNA isolation and purification.

[0180] Synthesis of Example 16.III-3 and its analogues Compound III-1: [Chemical formula] 4-N,N-dimethyl-benzaldehyde (0.35 g, 2.3 mmol), 4-cyano-benzeneacetonitrile (0.4 g, 2.8 mmol) were placed in a 100 ml round-bottom flask, 40 ml of absolute ethanol was added and dissolved, 2 drops of piperidine were added, and it was heated under reflux in an oil bath for 2 h under Ar protection. After the reaction was completed, it was cooled to room temperature, a large amount of solid precipitated, filtered, the cake was washed 3 times with cold ethanol, and vacuum dried to obtain an orange solid (0.60 g, 95%). 1 HnmR (400 MHz, DMSO-d6): δ = 3.05 (s, 6H), 6.83 (d, J = 9.2 Hz, 2H,), 7.84 - 7.94 (m, 6H), 8.02 ppm (s, 1H). HRMS (ESI-TOF): Calcd. For C 18 H 16 O3[M + H] + : 274.1344. Found: 274.1345. Compound III-2:

[0181] [Chemical formula] Please refer to the synthesis method of Compound III-1 (0.34 g, 89%). 1 HnmR (400 MHz, DMSO-d6): δ = 1.23 (t, J = 7.60 Hz, 6H), 3.05 (t, J = 7.60 Hz, 4H), 6.84 (d, J = 9.2 Hz, 2H,), 7.84 - 7.95 (m, 6H), 8.09 ppm (s, 1H). HRMS (ESI-TOF): Calcd. For C 20 H 20 O3[M + H] + : 302.1657. Found: 302.1658. Compound III-3:

[0182] [Chemical formula] Please refer to the synthesis method for compound III-1 (0.33g, 95%). 1 HnmR(400 MHz, DMSO-d6): δ= 7.96(s, 1H), 7.85(d, J = 16.0 Hz, 6H), 6.81(d, J = 8.0 Hz, 2H), 4.77(s, 1H), 3.55(d, J = 28.0 Hz, 4H), 3.04(s, 1H). LR-HRMS(ESI-TOF): Calcd. For C 19 H 18 N3O [M+H] + : 304.1450. Found: 304.1451. Compound III-4:

[0183] [ka] Compound III-3 (0.61 g, 2.0 mMol) was added to 40 ml of dry DCM, TEA (0.25 g, 2.2 mMol) was added, and 10 ml of DCM solution of p-toluenesulfonyl chloride (0.38 g, 2.0 mMol) was slowly added under 0°C conditions. The mixture was slowly heated to room temperature under Ar protection, and once the reaction was complete, 2 ml of water was added to stop the reaction. The organic phase was separated, dried over Na2SO4, and the organic solvent was removed under reduced pressure. The residue was used directly in the next step without further treatment.

[0184] The residue was dissolved in 20 ml of acetonitrile, 1 ml of methanol solution of methylamine was added, and the system was heated overnight under reflux in an oil bath under the protection of Ar. Once the reaction was complete, the solvent was removed under pressure, and the system was dissolved in 50 ml of DCM. The mixtures were washed with water and saturated brine (2 × 100 ml), respectively, the organic phase was dried over Na₂SO₄, the solvent was removed under pressure, and the residue was separated by column chromatography to obtain an orange-red solid (0.54 g, 82%). 1HnmR(400 MHz, CDCl3): δ= 7.88(d, J = 9.0 Hz, 2H), 7.74 ― 7.65(m, 4H), 7.48(s, 1H), 6.73(d, J = 9.1 Hz, 2H), 3.60 ― 3.55(m, 2H), 3.08(s, 3H), 2.57 ― 2.52(m, 2H), 2.34(s, 6H). LR-MS(ESI-TOF): Calcd. For C 21 H 23 N4[M+H] + : 331.1923. Found: 331.1925. Compound III-5:

[0185] [ka] 4-Hydroxyl-3,5-difluorobenzaldehyde (0.32 g, 2.0 mMol) and 4-cyanobenzeneacetonitrile (0.35 g, 2.4 mMol) were placed in a 100 ml round-bottom flask, dissolved in 40 ml of anhydrous ethanol, two drops of piperidine were added, and the mixture was heated under reflux in an oil bath under Ar protection for 2 hours. Once the reaction was complete, it was cooled to room temperature, a large amount of solid precipitated, filtered, the cake was rinsed three times with cold ethanol, and vacuum dried to obtain an orange solid. 1 HnmR(400 MHz, CDCl3): δ= 7.80(d, J = 9.0 Hz, 2H), 7.74 ― 7.66(m, 4H), 7.48(s, 1H). LR-MS(ESI-TOF): Calcd. For C 16 H9F2N2O [M+H] + : 283.0683. Found: 283.0684. Compound III-6:

[0186] [ka] 5-(N-methyl-N-hydroxyethyl)aminopyrazine-2-carbaldehyde:

[0187] [ka] 4-N-methyl-N-hydroxyethylamine (2.6 g, 35 mMol) and 5-chloropyrazine-2-carbaldehyde (0.50 g, 3.5 mMol) were placed in a 100 ml round-bottom flask, dissolved in 20 ml of anhydrous acetonitrile, and K2CO3 (0.71 g, 5.3 mMol) was added. The mixture was heated under reflux in an oil bath under Ar protection for 24 hours until the reaction was complete. After cooling to room temperature, the mixture was filtered, the solvent was removed under vacuum, and the residue was dissolved in 100 ml of DCM. The mixtures were washed with water and saturated brine respectively (2 × 100 ml), the organic phase was dried over Na2SO4, the organic solvent was removed, and the residue was separated by column chromatography to obtain 5-(N-methyl-N-hydroxyethyl)-pyrazine-2-aldehyde (0.48 g, 76%). 1 HnmR(400 MHz, CDCl3): δ 9.88(s, 1H), 8.62(d, J = 1.2 Hz, 1H), 8.14(d, J = 1.1 Hz, 1H), 3.92(m, 2H), 3.88 ― 3.83(m, 2H), 3.28(s, 3H). LR-MS(ESI-TOF): Calcd. For C8H 12 N3O2[M+H] + : 182.1. Found: 182.1. For the preparation of compound III-6, please refer to the synthesis method for compound III-1 (0.36 g, 96%). 1 HnmR(400 MHz, CDCl3): δ 8.39(s, 1H), 8.30(s, 1H), 7.80(d, J = 8.5 Hz, 2H), 7.72(d, J = 8.4 Hz, 2H), 7.51(s, 1H), 3.93(t, J = 4.9 Hz, 2H), 3.88 ― 3.83(m, 2H), 3.29(s, 3H). LR-HRMS(ESI-TOF): Calcd. For C 17 H 16 N5O [M+H] + : 306.1355. Found: 306.1357. Compound III-7:

[0188] [ka] Please refer to the synthesis method for compound III-4 (0.21g, 67%). 1 HnmR(400 MHz, DMSO-d6): δ 8.37(d, J = 5.2 Hz, 2H), 8.06(s, 1H), 8.00 ― 7.85(m, 4H), 3.77(t, J = 6.5 Hz, 2H), 3.20(s, 3H), 2.56(m, 2H), 2.23(s, 6H). LR-HRMS(ESI-TOF): Calcd. For C 19 H 21 N6[M+H] + : 333.1828. Found: 333.1829. Compound III-8:

[0189] [ka] 6-(N-methyl-N-hydroxyethyl)aminopyrazine-3-aldehyde:

[0190] [ka] Please refer to the synthesis method for 5-(N-methyl-N-hydroxyethyl)aminopyrazine-2-aldehyde (0.45g, 68%). 1 HnmR(400 MHz, CDCl3): δ =9.69(s, 1H), 8.43(d, J = 2.1 Hz, 1H), 7.86(dd, J = 9.0, 2.3 Hz, 1H), 6.56(d, J = 9.1 Hz, 1H), 3.86 ― 3.79(m, 4H), 3.15(s, 3H). LR-MS(ESI-TOF): Calcd. For C9H 13 O2N2[M+H] + : 181.1. Found: 181.1. For the preparation of compound III-8, please refer to the synthesis method for compound III-1 (0.39 g, 89%). 1HnmR(400 MHz, DMSO-d6): δ =8.54(d, J = 4.0 Hz, 1H), 8.30(dd, J = 9.3, 2.5 Hz, 1H), 8.03(s, 1H), 7.92(d, J = 8.0 Hz, 2H), 7.85(d, J = 8.0 Hz, 2H), 6.84(d, J = 8.0 Hz, 1H), 4.77(t, J = 5.4 Hz, 1H), 3.67(t, J = 5.3 Hz, 2H), 3.60(q, J = 5.4 Hz, 2H), 3.15(s, 3H). LR-HRMS(ESI-TOF): Calcd. For C 18 H 27 N4O [M+H] + Found: 305.1402. Found: 305.1401. Compound III-9:

[0191]

change

[0192] [ka] 4-N,N-dimethyl-6 aldehyde-pyridine:

[0193] [ka] Please refer to the synthesis method for 4-N-methyl-N-(2-N',N'-dimethyl-ethyl)-benzaldehyde (0.31g, 49%). 1 HnmR(400 MHz, DMSO-d6): δ = 9.86(d, J = 0.6 Hz, 1H), 8.17(d, J = 2.9 Hz, 1H), 7.83(d, J = 8.9 Hz, 1H), 6.94(dd, J = 8.8, 2.9 Hz, 1H), 3.10(s, 6H). LR-HRMS(ESI-TOF): Calcd. For C8H 11 N2O [M+H] + : 151.1. Found: 151.1. For the preparation of compound III-10, please refer to the synthesis method for compound III-1 (0.36 g, 96%). 1 HnmR(400 MHz, DMSO-d6): δ = 9.86(d, J = 0.6 Hz, 1H), 8.26(s, 1H), 8.17(d, J = 2.9 Hz, 1H), 7.83(d, J = 8.9 Hz, 1H), 7.46(m, 4H), 6.94(dd, J = 8.8, 2.9 Hz, 1H), 3.10(s, 6H). LR-HRMS(ESI-TOF): Calcd. For C 17 H 15 N4[M+H] + : 275.1297. Found: 275.1298. Compound III-11:

[0194] [ka] 2-(N-methyl-N-hydroxyethyl)amino-5-aldehyde-pyrimidine:

[0195] [ka] Please refer to the synthesis method for 4-N-methyl-N-(2-N',N'-dimethyl-ethyl)-benzaldehyde (0.42g, 72%). 1 HnmR(400 MHz, DMSO-d6): δ = 9.89(s, 1H), 8.73(s, 2H), 3.64(t, J = 8.9 Hz, 2H), 3.45(t, J = 8.8 Hz, 2H), 3.10(s, 3H). LR-MS(ESI-TOF): Calcd. For C8H 12 N3O [M+H] + : 182.1. Found: 182.1. For the preparation of compound III-11, please refer to the synthesis method for compound III-1 (0.36 g, 96%). 1 HnmR(400 MHz, DMSO-d6): δ = 8.26(s, 1H), 8.73(s, 2H), 7.64(m, 4H), 3.64(t, J = 8.9 Hz, 2H), 3.44(t, J = 8.8 Hz, 2H), 3.11(s, 3H). LR-HRMS(ESI-TOF): Calcd. For C 17 H 16 N5O [M+H] + : 306.1355. Found: 306.1356. 5-(N-methyl-N-hydroxyethyl)amino-2-aldehyde-pyrimidine:

[0196] [ka] Please refer to the synthesis method for compound 4-N-methyl-N-(2-N',N'-dimethyl-ethyl)-benzaldehyde (0.42g, 72%). 1HnmR(400 MHz, DMSO-d6): δ = 9.98(s, 1H), 8.21(s, 2H), 3.64(t, J = 8.9 Hz, 2H), 3.44(t, J = 8.8 Hz, 2H), 3.12(s, 3H). LR-MS(ESI-TOF): Calcd. For C8H 12 N3O2[M+H] + : 182.1. Found: 182.1. Compound III-12:

[0197] [ka] 1-Cyano-1-(4-benzeneacetonitrile)-2-2-(5-(N-methyl-N-hydroxyethyl)amino-)pyrimidine-ethylene:

[0198] [ka] Please refer to the synthesis method for compound III-1 (0.56g, 89%). 1 HnmR(400 MHz, DMSO-d6): δ = 8.21(s, 2H), 7.99(s, 1H), 7.64(s, 4H), 3.64(t, J = 8.9 Hz, 2H), 3.44(t, J = 8.8 Hz, 2H), 3.12(s, 3H). LR-MS(ESI-TOF): Calcd. For C 17 H 16 N5O [M+H] + : 306.1. Found: 306.1. For the preparation of compound III-12, please refer to the synthesis method for compound III-4 (0.36 g, 96%). 1 HnmR(400 MHz, DMSO-d6): δ = 8.21(s, 2H), 7.99(s, 1H), 7.64(s, 4 H), 3.77(t, J = 6.5 Hz, 2H), 3.20(s, 3H), 2.56(m, 2H), 2.23(s, 6H). LR-HRMS(ESI-TOF): Calcd. For C 19 H21 N6[M+H] + : 333.1828. Found: 333.1829. Compound III-13:

[0199] [ka] 2-Acetonitrile-5-cyanopyridine:

[0200] [ka] 2-bromomethyl-5-cyanopyridine (0.50 g, 2.5 mM) was placed in a 100 ml round-bottom flask, dissolved in 50 ml of THF, and 10 ml of 2 M aqueous solution of NaCN was added under the protection of Ar. The mixture was heated under reflux in an oil bath for 12 hours until the reaction was complete. After the reaction was complete, the system was cooled to room temperature and extracted with DCM (3 × 100 ml). The organic phases were combined and washed with water and saturated brine respectively (2 × 100 ml). The organic phases were dried over NaSO4, the solvent was removed under reduced pressure, and the residue was purified and separated by column chromatography to obtain 2-acetonitrile-5-cyanopyridine (0.19 g, 56%). 1 HnmR(400 MHz, DMSO-d6): δ=8.78(s, 1H), 7.95(m, 1H), 7.56(m, 1H), 4.01(s, 2H). LR-MS(ESI-TOF): Calcd. For C8H6N3[M+H] + : 144.1. Found: 144.1. For the preparation of compound III-13, please refer to the synthesis method for compound III-1 (0.45 g, 95%). 1HnmR(400 MHz, DMSO-d6): δ=8.78(s, 1H), 8.21(s, 1H), 7.94(m, 1H), 7.86(d, J=8.0 Hz, 2H), 7.57(m, 1H), 6.80(d, J=8.0 Hz, 2H), 3.64(t, J = 8.9 Hz, 2H), 3.44(t, J = 8.8 Hz, 2H), 3.12(s, 3H). LR-MS(ESI-TOF): Calcd. For C 18 H 17 N4O [M+H] + : 305.1402. Found: 305.1403. Compound III-14:

[0201] [ka] 2-Cyano-5-acetonitrile-pyrazine:

[0202] [ka] 2-Chloropyrazine-5-acetonitrile (0.32 g, 2.0 mMol) and CuCN (0.93 g, 10.0 mMol) were placed in a 100 ml round-bottom flask, dissolved in 30 ml of dry DMSO, and heated in an oil bath at 80°C for 12 hours under the protection of Ar. Once the reaction was complete, the system was placed in 100 ml of water and extracted with DCM (4 × 50 ml). The organic phases were combined and washed with water and saturated brine respectively (2 × 100 ml). The organic phases were dried over Na₂SO₄, the organic solvent was removed under reduced pressure, and the residue was separated by column chromatography to obtain 2-cyanopyrazine-5-acetonitrile (0.20 g, 69%). 1 HnmR(400 MHz, DMSO-d6): δ=8.60(s, 1H), 8.48(s, 1H), 3.92(s, 2H). LR-MS(ESI-TOF): Calcd. For C7H5N4[M+H] + : 145.1. Found: 145.1. For the preparation of compound III-14, please refer to the synthesis method for compound III-1 (0.25 g, 91%). 1 HnmR(400 MHz, DMSO-d6): δ=8.60(s, 1H), 8.48(s, 1H), 8.11(s, 1 H), 7.81(d, J=8.2 Hz, 2H), 6.84(d, J=8.2 Hz, 2H), 3.60(t, J=9.2 Hz, 2H), 3.46(t, J=9.2 Hz, 2H), 3.12(s, 3H). LR-MS(ESI-TOF): Calcd. For C 17 H 16 N5O [M+H] + : 306.1355. Found: 306.1354. Compound III-15:

[0203] [ka] Please refer to the synthesis method for compound III-1 (0.25g, 91%). 1 HnmR(400 MHz, DMSO-d6): δ =8.22(s, 1H), 8.00(d, J = 9.1 Hz, 1H), 7.77 ― 7.69(m, 1H), 7.43 ― 7.34(m, 1H), 6.88(d, J = 9.1 Hz, 1H), 4.81(t, J = 5.2 Hz, 1H), 3.64 ― 3.52(m, 3H), 3.09(s, 1H). LR-HRMS(ESI-TOF): Calcd. For C 19 H 18 N3O2[M+H] + : 320.1399. Found: 320.1397. Compound III-16:

[0204] [ka] Please refer to the synthesis method for compound III-1 (0.29g, 94%). 1HnmR(400 MHz, DMSO-d6): δ =8.11(2H, d, J =10.4Hz), 7.99(3H, dd, J =8.6, 3.0Hz), 7.54(1H, dd, J =8.0, 8.0Hz), 7.44(1H, dd, J =8.0, 8.0Hz),6.88(2H, d, J =9.2Hz), 4.82(1H, bt, t, J =5.2Hz), 3.60(2H, t, J =5.2Hz), 3.56(2H, t, J =5.2Hz), 3.09(3H, s). LR-HRMS(ESI-TOF): Calcd. For C 19 H 18 N3OS [M+H] + : 336.1171. Found: 336.1170. Compound III-17:

[0205] [ka] 6-Methylamine-benzo[b]thiophene-2-carbaldehyde:

[0206] [ka] 6-bromobenzo[b]thiophene-2-carbaldehyde (0.42 g, 1.7 mMol), dimethylethylamine (40% aqueous solution, 1 g, 8.9 mMol), CuI (13.9 mg, 0.073 mMol), K3PO4·H2O (155.4 mg, 0.73 mMol), and methylamine (33% aqueous solution, 1 g) were added to a 100 ml pressure-resistant bottle and heated in a 60°C oil bath for 12 hours under sealed conditions. The system was cooled to room temperature, 50 ml of water was added, and the mixture was extracted with DCM (3 × 100 ml). The organic phase was combined, dried over Na2SO4, and the organic solvent was removed under reduced pressure. The residue was separated and purified by column chromatography (0.23 g, 68%). 1HnmR(400 MHz, DMSO-d6): δ =9.92(1H, s), 8.14(1H, s), 7.82(1H, d, J =9.1Hz), 7.18(1H, d, J =2.1Hz),7.01(1H, dd, J =9.1, 2.3Hz), 3.05(3H, s). LR-MS(ESI-TOF): Calcd. For C 10 H 10 NOS [M+H] + : 192.0. Found: 192.0. For the preparation of compound III-17, please refer to the synthesis method for compound III-1 (0.29 g, 94%). 1 HnmR(400 MHz, DMSO-d6): δ =8.45(s, 1H), 7.92(d, J = 8.6 Hz, 2H), 7.85(d, J = 8.3 Hz, 3H), 7.73(dd, J = 8.6, 3.9 Hz, 1H), 7.21(d, J = LR-HRMS(ESI-TOF): Calcd. For C 19 H 14 N3S [M+H] + : 360.1171. Found: 360.1173. Compound III-18:

[0207] [ka] 6-N-methyl-N-hydroxyethyl-benzo[b]thiophene-2-carbaldehyde:

[0208] [ka] See the synthesis method for compound 6-methylamine-benzo[b]thiophene-2-carbaldehyde (0.54 g, 79%). 1HnmR(400 MHz, DMSO-d6): δ= 9.91(s, 1 H), 8.14(s, 1 H), 7.81(d, J=5.2 Hz, 1 H), 7.17(d, J=2.0 Hz, 1 H), 7.01(dd, J=2.0, 8.8 Hz, 1 H), For C 12 H 14 NO2S, [M+H] + 235.1. Found 236.1. The preparation method of compound III-18 and the synthesis method of compound III-1 are as follows: されたい (0.21g, 95%). 1 HnmR(400 MHz, DMSO-d6): δ= 8.45(s, 1H), 7.92(d, J = 8.6 Hz, 2H), 7.85(d, J = 8.3 Hz, 3H), 7.73(dd, J = 8.6, 3.9 Hz, 1H), 7.21(d, J = 1.9 Hz, 1H), 7.21(d, J = 1.9 Hz, 1H), 6.96(dd, J = 9.1, 2.3 Hz, 1H), 3.63 ― 3.57(m, 2H), 3.52(t, J = 5.7 Hz, 2H), 3.05(s, 3H). LR-HRMS(ESI-TOF): Calcd. For C 21 H 19 N3OS [M+H] + Found: 360.1171. Found: 360.1173. Compound III-19:

[0209]

change

[0210]

change

[0211] [ka] 5-N,N-diethylamine-2-aldehyde dithiophene:

[0212] [ka] See the synthesis method for 6-N-methyl-N-hydroxyethyl-benzo[b]thiophene-2-carbaldehyde (0.44g, 75%). 1HnmR(400 MHz, DMSO-d6): δ= 9.78(s, 1 H), 8.09(s, 1 H), 6.30(s, 1 H), 4.87(bt, 1 H), 3.27(t, J=8.4 Hz, 4 H), 1.26(t, J=8.4 Hz, 4 H). MS(ESI): m / z Calcd. For C9H 12 NOS2[M+H] + : 214.0; found 214.0. For the preparation of compound III-20, please refer to the synthesis method for compound III-1 (0.31 g, 90%). 1 HnmR(400 MHz, DMSO-d6): δ =8.34(s, 1H), 7.86(d, J = 8.0 Hz, 2H), 7.81(s, 1H), 7.77(d, J = 8.0Hz, 2H), 6.32(s, 1H), 4.88(t, J = 4.0 Hz, 1H), 3.27(t, J=8.4 Hz, 4 H), 1.26(t, J=8.4 Hz, 4 H). LR-HRMS(ESI-TOF): Calcd. For C 20 H 18 N3S2[M+H] + : 364.0942. Found: 364.0943. Compound III-21:

[0213] [ka] 5-(N-methyl-N-hydroxyethyl)amino-2-aldehyde dithiophene:

[0214] [ka] See the synthesis method for compound 6-N-methyl-N-hydroxyethyl-benzo[b]thiophene-2-carbaldehyde (0.44 g, 75%). 1HnmR(400 MHz, DMSO-d6): δ= 9.66(s, 1 H), 8.05(s, 1 H), 6.30(s, 1 H), 4.88(bt, 1 H), 3.64(t, J =5.6 Hz, 2 H), 3.44(t, J =5.6 Hz, 2 H), 3.07(s, 3 H). MS(ESI): m / z Calcd. For C 10 H 12 NO2S2[M+H] + : 241.0; found 242.0. For the preparation of compound III-21, please refer to the synthesis method for compound III-1 (0.31 g, 90%). 1 HnmR(400 MHz, DMSO-d6): δ 8.34(s, 1H), 7.86(d, J = 8.0 Hz, 2H), 7.81(s, 1H), 7.77(d, J = 8.0Hz, 2H), 6.32(s, 1H), 4.88(t, J = 4.0 Hz, 1H), 3.65(q, J = 5.5 Hz, 2H), 3.44(t, J = 5.5 Hz, 2H), 3.34(s, 1H), 3.08(s, 3H). LR-HRMS(ESI-TOF): Calcd. For C 19 H 16 N3OS2[M+H] + : 366.0735. Found: 366.0736.

[0215] The amounts used, reaction conditions, etc., in each example herein are approximate unless otherwise specified, and should be understood that they can be modified according to actual circumstances to obtain similar results. Except for specific definitions, technical and scientific terms used herein have the same meaning as understood by those skilled in the art. All references used herein are incorporated herein by reference. The embodiments described herein are exemplary and preferred embodiments, and those skilled in the art can carry out the present invention using similar methods and materials and obtain the same or similar effects, and any changes or modifications to the present invention remain within the scope limited by the claims herein.

Claims

1. A nucleic acid aptamer molecule containing the following nucleotide sequence (a), (b), or (c). (a): Nucleotide sequence N 1 CCAAUCGUGGGCGUGUCGGN 19 -N 20 -N 21 ACUGGCGCCGN 32 A nucleic acid aptamer molecule that specifically binds to a fluorophore molecule and has the function of increasing the fluorescence intensity of the fluorophore molecule under excitation light of a specific wavelength; wherein, N 1 , N 19 , N 20 , N 21 and N 32 represent fragments with a length of 1 nucleotide or more, and N 1 and N 32 form a complementary pairing of at least one pair of bases among the nucleotide sequences, and N 19 and N 21 form a complementary pairing of at least one pair of bases among the nucleotide sequences; (b): A nucleic acid aptamer molecule derived from (a) that specifically binds to a fluorophore molecule and has the function of increasing the fluorescence intensity of the fluorophore molecule under excitation light of a specific wavelength, wherein, among the nucleotide sequences limited in (a), N 1 , N 19 , N 20 , N 21 and N 32 Nucleic acid aptamer molecules having a nucleotide sequence that is at least 75% identical to the nucleotide sequence limited by (a) at positions other than (a); (c): A nucleic acid aptamer molecule derived from (a) that specifically binds to a fluorophore molecule and has the function of increasing the fluorescence intensity of the fluorophore molecule under excitation light of a specific wavelength, wherein, among the nucleotide sequences limited in (a), N 1 , N 19 , N 20 , N 21 and N 32 Nucleic acid aptamer molecules having a nucleotide sequence with one, two, three, four, five, six, or seven nucleotide substitutions at positions other than the specified position; Here, the fluorophore molecule is selected from the compounds represented by the following formula. 【Transformation 38】

2. N in nucleotide sequence (a) 1 is N 32 When a complementary pairing is formed, N 1 The nucleotide sequence direction is 5'-3', N 32 The nucleotide sequence direction is 3'-5', N 19 is N 21 When a complementary pairing is formed, N 19 The nucleotide sequence direction is 5'-3', N 21 The nucleic acid aptamer molecule according to claim 1, wherein the direction of the nucleotide sequence is 3'-5'.

3. N 1 and N 32 If the length of at least one of the fragments is 5 nucleotides or more, then N 1 and N 32 In the nucleotide sequence, at least two pairs of nucleotide bases form complementary pairings; N 19 and N 21 If the length of at least one of the fragments is 5 nucleotides or more, then N 19 and N 21 The nucleic acid aptamer molecule according to claim 2, wherein at least two pairs of bases in the nucleotide sequence form a complementary pairing.

4. The nucleotide substitution in the nucleotide sequence (c) is C3A, C3U, A4U, A4G, A4C, A5G, A5C, U6A, U6G, U6C, C7A, C7U, G8C, U9A, G11A, G11U, C12G, C12A, C12U, G13C, U14A, U14G, C17U, G18U, G18C, C27G, C27U, G28U, C29G, C29U, C30A, C30U, C2G / G31C, C2U / G31A, C2A / G31U, G10A / C30U, G10C / C30G, G10U / C30A, C2G / G31C / C3A, C2G / G31C / A4C, C2G / G31C / A5C, C2G / G31C / G8C, C2G / G31C / C12U, C2G / G31C / U14G, C2G / G31C / C27U, C2G / G31C / C29G, C2G / G31C / C30U, C2G / G31C / g10A / C30U, C2G / G31C / G10C / C30G, C2G / G31C / G10U / C30A, C2U / G31A / G10A / C3 0U, C2U / G31A / G10C / C30G, C2U / G31A / G10U / C30A, C2A / G31U / G10A / C30U, C2A / G31U / G10C / C30G, C2A / G31U / G10U / C30A, C2G / G31C / G10 C / C30G / C3A, C2G / G31C / G10C / C30G / A4C, C2G / G31C / G10C / C30G / A5C, C2G / G31C / G10C / C30G / G8C, C2G / G31C / G10C / C30G / C12U, C2G / G31 A nucleic acid aptamer molecule according to claim 1, which is one selected from the group consisting of C / G10C / C30G / U14G, C2G / G31C / G10C / C30G / C27U, C2G / G31C / G10C / C30G / C29G, C2G / G31C / G10A / C30U / U6G / C27U, C2G / G31C / G10C / C30G / U6G / C27U, C2G / G31C / G10U / C30A / U9A / U14G / C27U, and C2A / G31U / G10U / C30A / U9A / U14G / C27U.

5. N in nucleotide sequence (a) 1 and N 32 The nucleic acid aptamer molecule according to claim 1, wherein the nucleotide sequence is F30 or a tRNA scaffold RNA sequence.

6. The nucleic acid aptamer molecule according to claim 1, wherein the nucleic acid aptamer molecule is an RNA molecule or an RNA molecule modified with a base.

7. The nucleic acid aptamer molecule according to claim 1, wherein the nucleic acid aptamer molecule is a DNA-RNA hybrid molecule or a DNA-RNA molecule modified with a base.

8. N in nucleotide sequence (a) 19 -N 20 -N 21 A nucleic acid aptamer molecule according to claim 1, comprising one nucleotide sequence capable of recognizing a target molecule.

9. The nucleic acid aptamer molecule according to claim 8, wherein the target molecule is at least one of a protein, nucleic acid, lipid molecule, carbohydrate, hormone, cytokine, chemokine, and metabolite metal ion.

10. N in nucleotide sequence (a) 19 -N 20 -N 21 The nucleic acid aptamer molecule according to claim 8 or 9, wherein the nucleotide sequence is capable of recognizing GTP and adenosine molecules.

11. The nucleic acid aptamer molecule according to claim 1, wherein the function of the nucleic acid aptamer molecule is that the nucleic acid aptamer can increase the fluorescence intensity of a fluorophore molecule by at least 2 times, at least 5 to 10 times, at least 20 to 50 times, at least 100 to 200 times, or at least 500 to 1000 times by excitation light of an appropriate wavelength.

12. The nucleic acid aptamer molecule according to claim 1, further comprising a concatemer that can bind to multiple fluorophore molecules and is connected by a spacer sequence having a length of 2, 3, 4, 5, 6, 7, 8 or more nucleotide fragments, wherein the nucleotides of the concatemer are selected from SEQ ID NOs: 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 and 19.

13. A nucleic acid aptamer molecule according to claim 1, having sequence numbers 1, 2, 3, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, or 23.

14. A complex comprising a nucleic acid aptamer molecule according to claim 1 and a fluorophore molecule selected from the compounds represented by the following formula, 【Chemistry 39】 The nucleic acid aptamer molecule and the fluorophore molecule are a complex that exists in the same solution in order to form the complex.

15. The complex according to claim 14, wherein the nucleic acid aptamer molecule comprises nucleotide sequence numbers 1, 2, 3, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31.

16. A kit comprising at least one of the following: a nucleic acid aptamer molecule according to claim 1, a complex according to claim 14, an expression vector containing a DNA molecule that transcribes the nucleic acid aptamer molecule according to claim 1, or a host cell containing the expression vector.

17. Use of the complex according to claim 14 in the detection or labeling of target nucleic acid molecules extracellularly or in vitro cultured cells, detection or labeling of target molecules extracellularly or in vitro cultured cells, genomic DNA imaging, detection of intracellular mRNA and protein content, detection of genomic DNA, or RNA extraction and purification.