12R-lipoxygenase production promoter

Abstract

To provide a 12R-lipoxygenase production promoter which makes a bright skin without dullness.SOLUTION: A 12R-lipoxygenase production promotor contains a comfrey extract which is configured to: promote production of a 12R-lipoxygenase which makes a linoleic acid residue in ω-O-acyl ceramide in a horny layer into a lipid peroxide, for promoting formation of a corneocyte lipid envelope structure and a cornified envelope structure being lipid membranes of a keratinocyte, and for suppressing formation of a fine villus-like projection, and normalizing a function of the keratinocyte, for making a bright skin without dullness. The invention provides a corneocyte lipid envelope formation promoter of the keratinocyte and a fine villus-like projection formation suppression agent of the keratinocyte. The invention can be blended to medical drugs, quasi drugs, cosmetics, food products and the like.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a promoter for promoting the production of 12R-lipoxygenase, which is characterized by containing a confree extract, and also relates to a pharmaceutical composition for preventing, improving or treating symptoms and diseases involving the promoter for promoting the production of 12R-lipoxygenase.

Background Art

[0002] The state of the stratum corneum covering the skin surface affects the beauty of the skin. In beautiful skin, keratinocytes are produced at a certain rate and exfoliated, always maintaining the normal function of the stratum corneum. However, when the production of keratinocytes is disrupted due to the influence of ultraviolet rays, drying, etc., the keratinocytes do not exfoliate and the stratum corneum thickens, resulting in a decrease in skin brightness and transparency, causing dullness, etc., which becomes a cosmetic problem.

[0003] Keratinocytes are cells located in the outermost layer of the epidermis formed by the differentiation of granular cells in the epidermis, and are covered by a cornified envelope (CE) formed by the aggregation of proteins. Furthermore, acylceramide binds to CE to form a corneosytolipid envelope (CLE). CE and CLE are structures necessary for the function of keratinocytes. Keratinocytes with normal CE and CLE exfoliate normally without physical treatments using scrub agents or wiping lotions or chemical interventions such as peeling, and the stratum corneum does not thicken, resulting in bright skin without dullness.

[0004] Microvilli-like protrusions are fine structures observed on the surface of keratinocytes, and are often observed in keratinocytes of skin diseases accompanied by inflammation such as atopic dermatitis and in dry skin due to ultraviolet exposure. They are an indicator of enhanced skin turnover and very poor skin condition (Patent Document 1). They are also one of the indicators showing abnormal CE structure. The corneodesmosomes, which are cell adhesion factors scattered on CE, accumulate on microvilli-like protrusions, and keratinocytes with microvilli-like protrusions adhere strongly to each other, making it difficult for keratinocytes to exfoliate. Also, microvilli-like protrusions have been shown to be improved by vitamin A derivatives (Patent Document 2).

[0005] 12R-lipoxygenase is required for the formation of CE and CLE. Studies have shown that a deficiency in this enzyme not only impairs CLE formation but also thins the CE of keratinocytes to which CLE binds, impairing the health of the keratinocytes (Non-Patent Literature 1). Therefore, this enzyme is considered an important factor in the formation of normal keratinocytes. However, no methods using 12R-lipoxygenase to improve skin dullness have been reported.

[0006] Comfrey (Japanese name: Hireharisou, scientific name: Symphytum officinale) is a perennial herb belonging to the genus Symphytum in the family Boraginaceae. It has been used in folk medicine since ancient times, and its leaves have been used as food. It has also been used as an antipruritic (Patent Document 4), an anti-inflammatory (Patent Document 4), and a DNA damage repair agent (Patent Document 5). Furthermore, Patent Document 6 shows that it has the effect of physically wiping away old keratinized cells when used as a wipe-off lotion. One of the causes of dull skin is the accumulation of old keratinized cells without shedding, but Patent Document 6 does not show any effect on improving dull skin. [Prior art documents] [Patent Documents]

[0007] [Patent Document 1] Japanese Patent Publication No. 2003-344390 [Patent Document 2] Japanese Patent Publication No. 2005-239623 [Patent Document 3] Japanese Patent Publication No. 2008-81505 [Patent Document 4] Japanese Patent Publication No. 2009-256222 [Patent Document 5] Japanese Patent Publication No. 2018-168166 [Patent Document 6] Japanese Patent Publication No. 2018-172343 [Non-patent literature]

[0008] [Non-Patent Document 1] D.Crumrine J. Invest. Dermatol. 139, 760-768 (2019) [Overview of the Initiative] [Problems that the invention aims to solve]

[0009] In view of these circumstances, the object of the present invention is to provide a 12R-lipoxygenase production promoter, a corneocytic lipid envelope formation promoter for keratinocytes, and a microvilli-like projection formation inhibitor for keratinocytes that have an effective and few-side-effect 12R-lipoxygenase production promoting effect, thereby resulting in bright, clear skin. [Means for solving the problem]

[0010] The inventors of this invention have found that in healthy individuals, insufficient formation of keratinocyte precursors (CLEs) covering the surface of keratinocytes makes it easier for microvilli-like projections, which are abnormalities in the surface shape of keratinocytes, to form. From this result, they hypothesized that promoting CLE formation would suppress the formation of microvilli-like projections, leading to the formation of keratinocytes that have sufficient CLE and CE and function normally, resulting in clear skin. Based on this idea, the inventors of this invention focused on 12R-lipoxygenase, which produces CLE precursors and promotes CLE formation, and searched for an active ingredient that promotes the production of this enzyme, identifying comfrey extract. They also revealed that comfrey extract exhibits both CLE formation promoting and microvilli-like projection formation inhibiting effects, and showed that these effects lead to the generation of normally functioning keratinocytes, improving the function of the stratum corneum and increasing skin brightness. The inventors then completed the invention by providing a 12R-lipoxygenase production promoter, a corneocytic lipid envelope formation promoter for keratinocytes, and a microvilli-like projection formation inhibitor for keratinocytes containing comfrey extract. Function of the invention

[0011] The comfrey extract of the present invention has the effect of promoting 12R-lipoxygenase production, promoting the formation of corneocytic lipid envelopes in keratinocytes, and inhibiting the formation of microvilli-like projections in keratinocytes. By promoting CLE formation on the surface of keratinocytes, it inhibits the formation of microvilli-like projections on the surface of keratinocytes, normalizes the function of keratinocytes, and brightens the skin. Therefore, it can be used in the fields of pharmaceuticals, quasi-drugs, cosmetics, and food products. [Best Mode for Carrying Out the Invention]

[0012] The present invention will be described in detail below.

[0013] The 12R-lipoxygenase (12R-LOX) described in this invention is an enzyme encoded by the ALOX12B gene that is involved in arachidonic acid metabolism. This enzyme catalyzes the reaction in the stratum corneum of the epidermis that converts the linoleic acid portion of O-linoleyl-ω-hydroxyceramide into lipid peroxide, producing a precursor of CLE, a lipid membrane bound to CE on the surface of keratinocytes. Therefore, if the ALOX12B gene is deficient, CLE formation will not occur (Y. Zheng, et. al. J. Biol Chem 286, 24046-24056 (2011)). Furthermore, 12R-LOX expression is suppressed by ultraviolet light, which is the cause of UV-induced suppression of CLE formation (D. Guneri, et al. Int. J. Cosmet. Sci. 41, 274-280 (2019)). In addition, the ALOX12B gene is involved in steroid production and lipid metabolism, and its role in reproductive function has attracted attention. In particular, it has been suggested that it may be the causative gene for premature ovarian failure, which occurs before the age of 40 and results in amenorrhea (absence of menstruation for three months or more) (A. Alavi, et al. Mol Genet Genomics 295, 1039-1053 (2020)). In other words, this enzyme, which is involved in the formation of normal keratinocytes in the skin and also in reproductive function, is attracting attention in the fields of cosmetic and reproductive medicine and is considered industrially important.

[0014] The corneocyte lipid envelope (CLE) described in the present invention is a lipid membrane composed of ω-acylceramides bound to the surface of keratinocytes, and is involved in the formation of the skin barrier by linking the CE to the intercellular lipid layer. The ceramides that make up the CLE have a precursor in which linoleic acid is bonded to an ω-hydroxyl group, and are characterized by a fatty acid chain length of C28 or more and very high hydrophobicity. Furthermore, since some cases of ichthyosis, a hereditary disease, are caused by abnormalities in genes involved in the transport and synthesis of ceramides that make up the CLE, there is a need to develop methods to improve skin barrier function and novel treatments for ichthyosis that target the CLE, its constituent lipids, or genes involved in ceramide synthesis.

[0015] The comfrey extract used in the present invention is extracted from a part or the whole plant of Symphytum officinale, a member of the Boraginaceae family, including its flowers, fruits, seeds, stems, leaves, and roots. Extracts from stems, leaves, and roots are preferred, and most preferably from leaves. These plant parts may be used as is for extraction, or they may be dried, crushed, or finely chopped.

[0016] The extraction method is not particularly limited, but can be carried out by using water, hot water, or a mixed solvent of water and an organic solvent, and by stirring or column extraction. Examples of extraction solvents include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), and ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.). Preferably, polar solvents such as water, lower alcohols, and liquid polyhydric alcohols are used, and particularly preferably water, ethanol, 1,3-butylene glycol, and propylene glycol are used. These solvents may be used individually or in mixtures of two or more. Particularly preferred extraction solvents include water or a water-ethanol mixed polar solvent. There are no particular limitations on the amount of solvent used; for example, it should be 10 times or more, preferably 20 times or more, relative to the dry weight of the comfrey plant. However, for convenience in operations such as concentration or isolation after extraction, it is preferable to use 100 times or less. The extraction temperature and time can be appropriately selected depending on the type of solvent used and the pressure during extraction.

[0017] The above extract may be used as is, but if necessary, it may be used after treatment such as concentration (concentration by vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon, deodorization, ethanol precipitation, etc., to the extent that it achieves the effect of the present invention. Furthermore, the extracted solution may be treated by concentration to dryness, spray drying, freeze-drying, etc., and used as a dried product. The extract may be used alone, or two or more may be used in combination. When used in combination, the mixing ratio is not limited.

[0018] The extract may be directly used for compounding into the external or internal preparation of the present invention, or within the scope that does not impair the action of the extract, it may contain components used in cosmetics, quasi-drugs, pharmaceuticals, foods, etc., such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, ultraviolet absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, film-forming agents, sweeteners, acidulants, etc.

[0019] Examples of the dosage forms of the present invention include, for example, lotion, cream, massage cream, emulsion, gel agent, aerosol agent, pack, detergent, bath agent, foundation, face powder, lipstick, ointment, patch, paste agent, plaster agent, essence, powder, pill, tablet, injection, suppository, emulsion, capsule agent, granule agent, liquid agent (including tincture, fluid extract, spirit, suspension, lemonade, etc.), confectionery, beverage, etc.

[0020] The content of the comfrey extract used in the present invention, in terms of solids, is preferably 0.001% by weight or more, preferably 0.01 - 1% by weight. If it is less than 0.001% by weight, the action of the present invention may not be sufficiently exerted. Regarding the method of addition, it may be added in advance or during the manufacturing process, and it may be appropriately selected considering workability.

[0021] Next, in order to explain the present invention in detail, production examples, formulation examples, and experimental examples of the comfrey extract used in the present invention are given as examples, but the present invention is not limited thereto. The contents in the examples are all in % by weight.

[0022] The following shows a production example of the comfrey extract.

Example 1

[0023] Production Example 1 Hot water extract of comfrey 200 mL of purified water was added to 10 g of the dried comfrey leaves, extracted at 95 - 100 °C for 2 hours, then filtered, and the filtrate was concentrated and freeze-dried to obtain 1.6 g of the hot water extract of comfrey leaves.

[0024] Production Example 2: 50% ethanol extract of comfrey 10 g of dried comfrey leaves were added to 200 mL of 50% ethanol, extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness to obtain 1.2 g of comfrey leaf 50% ethanol extract.

[0025] Production Example 3: Comfrey Ethanol Extract 10 g of dried comfrey leaves were added to 200 mL of ethanol, extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness to obtain 0.8 g of comfrey leaf ethanol extract.

[0026] Production Example 4: 1,3-butylene glycol extract of comfrey 10 g of dried comfrey leaves were mixed with 200 mL of 1,3-butylene glycol, extracted at room temperature for 7 days, and then filtered to obtain 180 mL of comfrey leaf 1,3-butylene glycol extract. [Example 2]

[0027] Prescription Example 1: Lotion Formula Content (%) 1. Comfrey extract (Production example 4) 1.0 2,1,3-Butylene glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40 E.O.) 0.1 10.Fragrance (appropriate amount) 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Components 1-6 and 11 and components 7-10 are uniformly dissolved, mixed together, and filtered to obtain the product.

[0028] Comparative Example 1: Conventional lotion In Formula Example 1, the conventional lotion was created by replacing the comfrey extract with purified water.

[0029] Prescription example 2: Emulsion Formula Content (%) 1. Comfrey extract (Production example 1) 1.0 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetanol 1.5 6. Glyceryl monostearate 2.0 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate 2.0 9.Fragrance 0.1 10. Propylene glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 2-8, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 10-13, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool while stirring, add component 9 at 45°C, cool further to 30°C, add component 1 to form the final product.

[0030] Comparative Example 2: Conventional Emulsion In formulation example 2, the conventional emulsion was created by replacing the comfrey extract with purified water.

[0031] Prescription example 3: Cream Component Content (%) 1. Comfrey extract (Production example 2) 1.0 2. Polyglyceryl-10 isostearate 1.3 3. Polyglyceryl-10 myristate 1.3 4. Glycerin 4.5 5. Dimethicone 10.0 6. Diphenylsiloxyphenyl trimethicone 10.0 7. EDTA-2Na 0.05 8. Carboxyvinyl polymer 0.3 9,1,3-Butylene glycol 10.0 10. Methyl parahydroxybenzoate 0.3 11. AMPD 0.15 12. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and mix ingredients 2-6, maintain at 70°C to form the oil phase. Heat and dissolve ingredients 7-12, mix, maintain at 70°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, cool while stirring, add ingredient 1 at 45°C, and cool further to 30°C to obtain the product.

[0032] Comparative Example 3: Conventional Cream In formulation example 3, the conventional cream is one in which the comfrey extract is replaced with purified water.

[0033] Prescription example 4: Gel Component Content (%) 1. Comfrey extract (Production example 3) 0.5 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60 E.O.) 0.1 5.Fragrance (appropriate amount) 6.1,3-Butylene glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve components 2-5 and components 1 and 6-11 uniformly, then mix them together to obtain the product.

[0034] Prescription Example 5: Bath Additive Component Content (%) 1. Comfrey extract (Production example 2) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) appropriate amount 4.Fragrance (appropriate amount) 5. Add sodium sulfate to bring the total volume to 100. [Manufacturing Method] Mix ingredients 1-5 uniformly to form the product.

[0035] Prescription example 6: Tablets Component Content (%) 1. Comfrey extract (Production example 3) 0.5 2. Dried cornstarch 29.5 3. Carboxymethylcellulose calcium 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing Method] Mix ingredients 1-4, then add an aqueous solution of ingredient 5 as a binder and form into granules. Add ingredient 6 to the formed granules and compress into tablets. Each tablet should weigh 0.52g.

[0036] Prescription example 7: Tablet confectionery Component Content (%) 1. Comfrey extract (Production example 3) 0.5 2. Dried corn starch 50.8 3. Erythritol 40.5 4. Citric acid 5.0 5. Sucrose fatty acid ester 3.0 6.Fragrance 0.1 7.Purified water 0.1 [Manufacturing Method] Mix ingredients 1-4 and 7 and form into granules. Add ingredients 5 and 6 to the formed granules and compress into tablets. Each tablet should weigh 1.0g. [Example 3]

[0037] The following are experimental examples to illustrate the function of the present invention. However, the present invention is not limited thereto.

[0038] Experimental Example 1: Promotion of ALOX12B expression of the 12R-lipoxygenase gene. The expression-promoting effect of the ALOX12B gene was measured under the following conditions.

[0039] Human epidermal keratinocytes were differentiated by adding 3 mM CaCl2 for 72 hours, and then comfrey extract (Preparation Example 4) was added to the culture medium to a solid content of 0.015%, and the cells were cultured for a further 24 hours. After culturing, the saturation level was 50 mJ / cm³. 2 The samples were irradiated with UVB, and RNA was isolated using RNAiso+ (Takara Bio) 2 hours after irradiation. cDNA synthesis was performed on this RNA by reverse transcription using the High Capacity RNA to cDNA Kit (ThermoFisher Scientific), followed by PCR using SYBR Select Master Mix (ThermoFisher Scientific) to measure the gene expression level of ALOX12B. The PCR primers used were as shown below. After initial denaturation at 95°C for 2 minutes, the PCR reaction consisted of 40 cycles of 95°C for 15 seconds, followed by 60°C for 60 seconds. For other operations, the gene expression level of ALOX12B was determined as a percentage of the gene expression level of the internal standard, GAPDH, according to the prescribed method. The gene expression ratios were calculated for the untreated sample (no comfrey extract added and no UV irradiation), the UV-irradiated sample (UVB irradiation only) without comfrey extract, and the UV-irradiated sample (UVB irradiation + comfrey addition).

[0040] Primer set for ALOX12B Forward GCTGGAGACACACCTCATTGC (Sequence ID 1) Reverse CTGGACGGTGTATCGGGTATG (Sequence No. 2) Primer set for GAPDH Forward TGCACCACCAACTGCTTAGC (Sequence ID 3) Reverse TCTTCTGGGTGGCAGTGATG (Sequence No. 4)

[0041] The test results are shown in Table 1. The gene expression level of ALOX12B decreased when cells were irradiated with UVB. However, when 0.015% comfrey extract was added to the culture medium beforehand, ALOX12B gene expression was promoted under UVB irradiation conditions, and a recovery in expression level comparable to that under untreated conditions was observed.

[0042] [Table 1] -: No additives or irradiation were applied, +: Additives or irradiation were applied. [Example 4]

[0043] Experimental Example 2: Promotion of CLE formation by continuous use of comfrey-containing formulations Thirteen women were given a lotion prepared according to Formulation Example 1 to use continuously for four weeks. Before and after continuous use of the formulation, stratum corneum samples were collected from the cheeks using adhesive tape. The collected stratum corneum was peeled off the adhesive tape and seeded onto a glass slide. After air drying, it was mounted using a 75% glycerol solution in which Nile Red was dissolved at a concentration of 30 μg / mL. It was observed using a fluorescence microscope with excitation light at 470-490 nm and observation light at 520 nm, and the amount of CLE on the surface of keratinocytes was measured from the fluorescence intensity.

[0044] The fluorescence intensity observed in keratinocytes before continuous use increased 2.9 times after continuous use (Table 2). This result indicates that applying a formulation containing comfrey extract to the skin promotes the expression of the ALOX12B gene in keratinocytes that make up the skin, and that a sufficient amount of CLE is formed on the surface of keratinocytes differentiated from keratinocytes with high 12R-lipoxygenase activity.

[0045] [Table 2] • The fluorescence intensity of keratinocytes before continuous use was set to 100. [Example 5]

[0046] Experimental Example 3: Suppression of microvilli-like projection formation by continuous use of a comfrey-containing formulation. Thirteen women were given a lotion prepared according to Formula Example 1 to use continuously for four weeks. Before and after continuous use of the formulation, stratum corneum samples were collected from the cheek area using adhesive tape. The collected stratum corneum samples were fixed with glutaraldehyde and then treated with 2% osmium oxide to prepare samples for electron microscopy observation. Microvilli-like projections on keratinocytes were observed using a scanning electron microscope, and images were acquired. The uneven shape was detected from the acquired images, and the area of ​​the uneven shape within the analysis region was evaluated as the prominence of the microvilli-like projections.

[0047] The prominence of microvilli-like projections observed in keratinocytes before continuous use decreased after continuous use (Table 3). Since microvilli-like projections are an indicator of abnormal CE structure, this result indicates that the use of a formulation containing comfrey extract promoted the normalization of CE structure.

[0048] [Table 3] The area of ​​the uneven surface shape on keratinocytes observed before continuous use was set to 100. [Example 6]

[0049] Experimental Example 4: Improvement of skin brightness through continuous use of a comfrey-containing preparation. Thirteen women were given lotion prepared according to Prescription Example 1 to use continuously for four weeks. Before and after continuous use of the formulation, the skin color of the cheek area was measured using a spectrophotometer CM-2600d (Konica Minolta). * The value was evaluated as skin brightness.

[0050] Compared to the cheek before continuous use, the L after continuous use * The values ​​increased, and continued use of Formula Example 1 resulted in brighter, more translucent skin (Table 4).

[0051] [Table 4]

[0052] This improvement in skin brightness was thought to be due to improved keratinocyte function resulting from the promotion of ALOX12B gene expression in keratinocytes constituting the skin after 4 weeks of continuous use of the comfrey-containing formulation. This led to the formation of a sufficient amount of CLE on the surface of keratinocytes differentiated from keratinocytes with high 12R-lipoxygenase activity, as well as the suppression of microvilli formation and the normalization of CE formation. In addition, no skin irritation was observed with the use of formulations 1-5, indicating high safety. [Industrial applicability]

[0053] The present invention provides a 12R-lipoxygenase production promoter that promotes the production of 12R-lipoxygenase, a corneocytic lipid envelope formation promoter for keratinocytes, and a microvilli-like projection formation inhibitor for keratinocytes, by using comfrey extract.

Claims

1. A 12R-lipoxygenase production promoter characterized by containing comfrey extract.

2. A corneocytic lipid envelope formation promoter for keratinocytes, characterized by containing comfrey extract.

3. An inhibitor of microvilli-like projection formation in keratinocytes, characterized by containing comfrey extract.

Images