Heterocyclic karin RING ubiquitin ligase compounds and their use
Heterocyclic karin-RING ubiquitin ligase compounds induce ubiquitination and degradation of 'undruggable' proteins by enhancing karin-RING ubiquitin ligase activity, addressing the limitations of conventional degradants and enabling therapeutic targeting of proteins like CDK12, CDK13, and CCNK.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- PROXYGEN GMBH
- Filing Date
- 2021-10-15
- Publication Date
- 2026-04-23
AI Technical Summary
Existing small molecules and heterobifunctional degradants struggle to degrade target proteins lacking hydrophobic binding pockets and inhibitory binding sites, such as MYC, RAS, or β-catenin, due to their specific E3 ligase dependency and molecular weight limitations, limiting therapeutic applications.
Development of heterocyclic karin-RING ubiquitin ligase compounds that act as molecular glues to induce ubiquitination and degradation of target proteins by enhancing karin-RING ubiquitin ligase activity, independent of specific substrate receptors, using formulas (I), (II), (III), (IV), and (V), which can form covalent bonds with PROTACs to target proteins like CDK12, CDK13, and CCNK.
These compounds effectively degrade 'undruggable' proteins by orchestrating interactions between target proteins and karin-RING ligases, promoting ubiquitination and proteasomal degradation, overcoming limitations of conventional methods.
Smart Images

Figure 0007850460000125 
Figure 0007850460000126 
Figure 0007850460000127
Abstract
Description
[Technical Field]
[0001] Field of Invention The present invention relates to compounds having the ability to modulate, stimulate, and induce, particularly induce, the ubiquitination of target proteins(s). The compounds of the present invention can stimulate / induce the ubiquitination of target proteins(s), i.e., through the degradation of target proteins(s) by karin-RING ubiquitin ligase (CRL). Such target proteins(s) may be proteins involved in diseases such as cancer, metabolic disorders, infectious disorders, and / or neurological disorders. The present invention further relates to methods for identifying, obtaining, and / or testing compounds that can induce the ubiquitination of target proteins(s). The present invention also relates to compounds and compositions for use as pharmaceuticals, and pharmaceutical compositions containing these compounds. In particular, the compounds of the present invention can promote the degradation of proteins associated with cancer, metabolic disorders, infectious diseases, and / or neurological disorders. Furthermore, the present invention relates to compounds for use as pharmaceuticals, for example, compounds for use in the treatment of cancer, metabolic disorders, infectious diseases, and / or neurological disorders, and to methods for treating diseases such as cancer, metabolic disorders, infectious diseases, and / or neurological disorders, comprising administering the compounds of the present invention. [Background technology]
[0002] Background of the Invention Protein degradation plays a central role in many cellular functions, including cell maintenance and normal function. Therefore, the degradation of proteins, such as those related to maintenance functions, is significant in relation to cell proliferation, differentiation, and death. In this context, reducing protein activity by chemically inducing the degradation of a target protein and removing it represents a highly promising paradigm in drug discovery compared to protein inhibitors that simply block the protein to reduce its activity. Thus, utilizing cellular protein degradation pathways can provide means for reducing or removing protein activity.
[0003] Until recently, small molecules that induce protein destabilization were typically found unexpectedly. An example of this is fulvestran, or CRL4, an estrogen receptor (ER) regulator. CRBN These include the regulatory agent thalidomide and related compounds such as lenalidomide or pomalidomide (collectively referred to as "IMiDs," and also known in the art as "molecular glues"). All of these examples have become approved drugs, and the concept of TPD has been clinically confirmed as a treatment reality. Lenalidomide, in fact, was one of the most commercially successful drugs in 2018, with total revenues of $9.7 billion.
[0004] It is noteworthy that it took decades of research to elucidate the molecular mechanism of IMID as a low-molecular-weight degradation agent. A rational strategy for generalizing the concept of TPD has been explained by Winter et al. (Winter, GE) * ,buckley, DL * Paulk, J., Roberts, J., Souza, A., De-Phagano, S., and Bradner, JE (2015) Phthalimide Conjugation as a Strategy for in vivo Target Protein Degradation. Science 348, 1376-81) describes how heterobifunctional molecules are formed when IMiD-like chemical structures are conjugated to known targeting ligands via flexible linkers. These heterobifunctional small molecules (often also called "degrading agents") can be used to conjugate target proteins (via exchangeable targeting ligands) and the E3 ligase CRL4C RBNIt has been shown that it functions via binding to, i.e., via IMiD-like chemical agents. This binding induces molecular proximity between the target protein and the E3 ligase, promoting ubiquitination and the proteolysis of the former. In particular, ubiquitin conjugation of the target protein is mediated by an enzyme cascade consisting of an E1 ubiquitin activator, an E2 ubiquitin conjugate, and an E3 ubiquitin ligase that conjugate ubiquitin to the target protein (Hershko et al., Nat. Med. 6, 1073-1081 (2000); Komander et al., Annu. Rev. Biochem. 81, 203-229 (2012)).
[0005] Therefore, the ubiquitin-proteasome pathway, one of the major degradation pathways in cells, which controls important regulatory factor proteins and is a crucial pathway for degrading misfolded and abnormal proteins, has proven to be a useful tool for degrading target proteins by covalently binding ubiquitin to them, particularly in therapeutic applications.
[0006] The development of heterobifunctional degradants (PROTACs) capable of hijacking CRBN ligase complexes comes with certain caveats. For example, such heterobifunctional degradants can only utilize specific E3 ligases. As a result, the ligand typically binds to CRBN, VHL, cIAIP, or MDM2. Furthermore, since part of the structure of a PROTAC heterobifunctional degradant is a ligand for the target protein, this technique cannot be applied to "ligandable" proteins (see, e.g., Surade and Blundell (2012); Chemistry & Biology, Volume 19, Issue 1, pp. 42-50). Sometimes, the molecular weight of the resulting heterobifunctional degradant can affect its pharmacological and bioavailability properties.
[0007] There is a need for efficient, small molecules that can bind to the components of E3 ligases and are therefore suitable for degrading desired proteins.
[0008] Small molecules can modulate E3 ligases and other components of the ubiquitin-proteasome pathway by manipulating them through a "molecular glue" type mechanism. That is, such compounds may not depend on the availability of accessible hydrophobic binding pockets. For example, IMiD can induce cooperative association with target proteins that do not naturally bind to CRBN, i.e., without requiring additional binding to the targeting moiety. This leads to the promotion of ubiquitination and proteasomal degradation of bound target proteins such as transcription factors IKZF1 and IKZF3. As another example, aryl sulfonamides can redirect the activity of E3 ligase DCAF15 to degrade the splicing factor RBM39 in a manner similar to IMiD. Similarly, the plant hormone auxin is known to redirect the target space of E3 ligase Tir1 to induce the degradation of Aux / IAA transcriptional repressors.
[0009] Until now, targeting proteins that lack both hydrophobic binding pockets and binding sites that would inactivate the target protein has been beyond the reach of commonly used compounds developed for therapeutic purposes. In other words, this approach cannot degrade target proteins, such as those lacking accessible hydrophobic pockets and inhibitory binding sites. In this regard, intriguing disease-related targets such as MYC, RAS, or β-catenin remain beyond the reach of therapeutic development. [Overview of the Initiative] [Problems that the invention aims to solve]
[0010] Therefore, a new paradigm in drug design is strongly needed. Accordingly, from the above perspective, the underlying technical problem of the present invention is to provide compounds and methods for identifying compounds that can induce ubiquitination of target proteins (one or more), particularly target proteins (one or more) that are desirable to be degraded in cells such as diseased cells.
[0011] Solutions to this technical challenge are provided by embodiments defined below herein and embodiments characterized in the claims. [Means for solving the problem]
[0012] Summary of the Invention The present invention relates to the compounds of formulas (I), (II), (III), (IV), and (V) described herein, and their use in the treatment of various diseases that can be treated by the targeted degradation of specific proteins. [Brief explanation of the drawing]
[0013] [Figure 1] Dose-variable survival data for selected compounds Z1-Z3, Z5-Z7, Z9-Z11, Z13, and Z14 in a specified genetic background. Dose-variable survival data represent cell viability normalized with DMSO after 3 days of hit treatment in KBM7WT, CUL4Bmut, and UBE2Mmut cells. [Figure 2] Dose-variable survival data for selected compounds Z1-Z3, Z5-Z7, Z9-Z11, Z13, and Z14 in a specified genetic background. Dose-variable survival data represent cell viability normalized with DMSO after 3 days of hit treatment in KBM7WT, CUL4Bmut, and UBE2Mmut cells. [Figure 3]Dose-variable survival data for selected compounds Z1-Z3, Z5-Z7, Z9-Z11, Z13, and Z14 in a specified genetic background. Dose-variable survival data represent cell viability normalized with DMSO after 3 days of hit treatment in KBM7WT, CUL4Bmut, and UBE2Mmut cells. [Figure 4] Dose-variable survival data for selected compounds Z1-Z3, Z5-Z7, Z9-Z11, Z13, and Z14 in a specified genetic background. Dose-variable survival data represent cell viability normalized with DMSO after 3 days of hit treatment in KBM7WT, CUL4Bmut, and UBE2Mmut cells. [Figure 5] Dose-variable survival data for selected compounds Z1-Z3, Z5-Z7, Z9-Z11, Z13, and Z14 in a specified genetic background. Dose-variable survival data represent cell viability normalized with DMSO after 3 days of hit treatment in KBM7WT, CUL4Bmut, and UBE2Mmut cells. [Figure 6] Dose-variable survival data for selected compounds Z1-Z3, Z5-Z7, Z9-Z11, Z13, and Z14 in a specified genetic background. Dose-variable survival data represent cell viability normalized with DMSO after 3 days of hit treatment in KBM7WT, CUL4Bmut, and UBE2Mmut cells. [Figure 7] Dose-variable survival data for selected compounds Z1-Z3, Z5-Z7, Z9-Z11, Z13, and Z14 in a specified genetic background. Dose-variable survival data represent cell viability normalized with DMSO after 3 days of hit treatment in KBM7WT, CUL4Bmut, and UBE2Mmut cells. [Figure 8] Dose-variable survival data for selected compounds Z1-Z3, Z5-Z7, Z9-Z11, Z13, and Z14 in a specified genetic background. Dose-variable survival data represent cell viability normalized with DMSO after 3 days of hit treatment in KBM7WT, CUL4Bmut, and UBE2Mmut cells. [Figure 9]Dose-variable survival data for selected compounds Z1-Z3, Z5-Z7, Z9-Z11, Z13, and Z14 in a specified genetic background. Dose-variable survival data represent cell viability normalized with DMSO after 3 days of hit treatment in KBM7WT, CUL4Bmut, and UBE2Mmut cells. [Figure 10] Dose-variable survival data for selected compounds Z1-Z3, Z5-Z7, Z9-Z11, Z13, and Z14 in a specified genetic background. Dose-variable survival data represent cell viability normalized with DMSO after 3 days of hit treatment in KBM7WT, CUL4Bmut, and UBE2Mmut cells. [Figure 11] Dose-variable survival data for selected compounds Z1-Z3, Z5-Z7, Z9-Z11, Z13, and Z14 in a specified genetic background. Dose-variable survival data represent cell viability normalized with DMSO after 3 days of hit treatment in KBM7WT, CUL4Bmut, and UBE2Mmut cells. [Figure 12] CCNK degradation levels in KBM7WT cells treated with Z1-Z3, Z5-Z7, Z9-Z11, Z13, and Z14. [Figure 13] 1H NMR of Example 3-22 [Figure 14] 1H NMR of Examples 3-66 [Figure 15] Cdk12 [high ATP] in vitro kinase activity assays of Examples 3-36 and 3-45 [Figure 16] Western blot analysis of CCNK degradation. [Figure 17] CCNK retention rate after 4 hours of treatment at a 10 micromolar concentration, as evaluated using ImageJ with densitometry values normalized to actin levels. [Modes for carrying out the invention]
[0014] The compounds disclosed herein and in the context of the present invention can modulate / stimulate / induce the ubiquitination of target proteins(s), for example, through the degradation of target proteins(s) by ubiquitination systems. In the context of the present invention, the compounds have the ability to modulate / stimulate / induce, particularly induce, the ubiquitination of target proteins(s), by enhancing karin-RING ubiquitin ligase activity / CRL activity.
[0015] The compounds disclosed herein and in the context of the present invention can be used as molecular glues, particularly as described herein and illustrated in the accompanying examples. Furthermore, the compounds of the present invention may also be used in the development of heterobifunctional molecules such as PROTAC® (protein degradation targeting chimeras).
[0016] Therefore, it is assumed that the compounds of the present invention can be used as basic units for developing heterobifunctional molecules such as PROTAC®. When used as a basic unit for developing PROTAC®, it is preferable that the compounds of the present invention (compounds of formulas (I), (II), (III), (IV), and (V), etc.) bond to the remainder of PROTAC® by forming a covalent bond between them. Those skilled in the art will understand suitable synthetic methods for forming a bond between two molecules. Various types of coupling reactions are known in organic synthesis chemistry, and are described, for example, in “Cross-Coupling Reactions - A Practical Guide” 2002 by N. Miyaura, ISBN 978-3-540-45313-0. The terms “PROTAC®”, “PROTAC®”, “PROTAC”, “PROTAC®s”, “PROTAC®s”, “PROTAC®s”, or “protein degradation targeting chimera” are used interchangeably and refer in particular to heterobifunctional compounds. As described herein, it is known to those skilled in the art that PROTACs have advantageous properties, such as, but not limited to, interchangeable target-binding sites that can bind to desired targets to be degraded. However, certain proteins(s) to be degraded are considered “ligand-unbound” and therefore cannot be degraded by PROTACs. Such “ligand-unbound” (but desirable to be degraded) proteins(s)(s) cannot be degraded via the PROTAC mechanism because the target-binding sites of the “ligand-unbound” proteins(s)(s) are unknown or unavailable."Ligand-unbinding" proteins are known in the art and include, in particular, those having uncharacteristic binding sites, lacking hydrogen bond donors and acceptors, requiring adaptive changes in higher-order structure, and having lipophilic residues at the protein-ligand interface; see, for example, Surade and Blundell (2012); Chemistry & Biology, Volume 19, Issue 1, pp. 42-50. Therefore, and as described herein, the compounds of the present invention may be advantageous because they can modulate / induce / stimulate the degradation of one or more "ligand-unbinding" proteins, for example, as "molecular glue."
[0017] Molecular glues can degrade target proteins (one or more) by orchestrating the direct interaction between the target and karin-RING ligase (CRL). Molecular glues have the potential to induce the elimination of disease-related proteins that are otherwise considered "undruggable" for drug targeting. The mechanism of action of molecular glues can be illustrated by clinically approved thalidomide analog molecular glues / degraders (IMiDs). IMiDs target CRL4 CRBN Upon binding to E3 ligase, selected zinc finger transcription factors (TFs) are recruited, leading to ubiquitination and subsequent proteasomal degradation (Lu, G. et al. Science 343, 305-309, doi:10.1126 / science.1244917 (2014); Kronke, J. et al. Science 343, 301-305, doi:10.1126 / science.1244851 (2014); Sievers, QL et al. Science 362, doi:10.1126 / science.aat0572 (2018); Gandhi, AK et al. British journal of haematology 164, 811-821, doi:10.1111 / bjh.12708 (2014)).
[0018] It is noteworthy that IMiD itself does not possess measurable binding affinity to the TF being degraded. However, IMiD organizes molecular recognition between the ligase and TF by inducing several protein-protein interactions near the binding interface. Certain aryl sulfonamides surrounding indisram, a compound clinically tested, are found in CRL4 DCAF15 It acts as a molecular glue between ligase and splicing factor RBM39, causing targeted degradation of the latter (Han, T. et al. Science, doi:10.1126 / science.aal3755 (2017); Uehara, T. et al. Selective degradation of splicing factor CAPERalpha by anticancer sulfonamides. Nat Chem Biol 13, 675-680, doi:10.1038 / nchembio.2363 (2017); Bussiere, DE et al. Nat Chem Biol 16, 15-23, doi:10.1038 / s41589-019-0411-6 (2020); Ting, TC et al. Cell reports 29, 1499-1510.e1496). doi:10.1016 / j.celrep.2019.09.079 (2019);Faust, TB et al. Nat Chem Biol 16, 7-14, doi:10.1038 / s41589-019-0378-3 (2020);Du, X. et al. Structure (London, England: 1993) 27, 1625-1633.e1623, doi:10.1016 / j.str.2019.10.005 (2019).).
[0019] Therefore, due to the mechanism of action of molecular glue, it is possible to destabilize target proteins that are considered "unable to bind to ligands" by other methods, and thus cannot be addressed by conventional small molecule inhibitors or heterobifunctional degradation agents.
[0020] The compounds of the present invention are capable of inducing the destabilization of disease-related target proteins such as cyclin K (CCNK), CDK12, and / or CDK13. The compounds of the present invention particularly act as CCNK degraders. As described herein and shown in the accompanying examples, the compounds of the present invention can degrade one or more target proteins such as cyclin K (CCNK), CDK12, and / or CDK13 independently of specific substrate receptors, and in this respect, this mechanism is functionally distinct from already characterized degraders.
[0021] As described above, the compounds of the present invention may also be used in heterobifunctional molecules such as PROTACs. The term "PROTAC®" is used interchangeably and refers to a heterobifunctional compound, and as used herein, refers to a compound that induces proteasome-mediated degradation of a selected protein via recruitment to an E3 ubiquitin ligase and subsequent ubiquitination (Crews C, Chemistry & Biology, 2010, 17(6):551-555; Schnnekloth JS Jr., Chembiochem, 2005, 6(l):40-46). This term generally refers to a proteolytic targeting chimeric molecule having three components: an E3 ubiquitin ligase binding group (i.e., an E3 ligase binding moiety (EBM)), optionally a linker (L), and a target protein binding group (i.e., a target binding moiety (TBM)). PROTAC / protein degradation targeting chimeras can be exemplified by the following formula: [ka] In the formula, TBM is the part that binds to the target protein. Preferably, the TBM is a portion that binds to a target protein associated with cancer, metabolic disorders, neurological disorders, or infectious diseases; More preferably, one or more cancer-related proteins are selected from the group consisting of DNA-binding proteins containing transcription factors such as ESR1, AR, MYB, MYC; RNA-binding proteins; scaffold proteins; GTPases such as HRAS, NRAS, KRAS; solute transporters; kinases such as CDK4, CDK6, CDK9, EGFR, SRC, PDGFR, ABL1, HER2, HER3, BCR-ABL, MEK1, ARAF, BRAF, CRAF, and phosphatases; bromodomain and chromodomain-containing proteins such as BRD2, BRD3, BRD4, CBB, p300, ATAD2, SMARCA2, SMARCA4, and PBRM1; G protein-conjugated receptors; anti-apoptotic proteins such as SHP2, PTPN1, and PTPN12; immunoregulatory factors such as PDL1; and combinations thereof. More preferably, one or more cancer-related proteins are selected from the group consisting of BRD2, BRD3, BRD4, CBP, p300, ATAD2, SMARCA2, SMARCA4, PBRM1, CDK4, CDK6, CDK9, CDK12, and / or CDK13, EWS-FLI, CDC6, CENPE, EGFR, SRC, PDGFR, ABL1, HER2, HER3, BCR-ABL, MEK1, ARAF, BRAF, CRAF, HRAS, NRAS, KRAS, BCL2, MCL2, SHP2, PTPN1, PTPN12, ESR1, AR, MYB, MYC, PDL1, and combinations thereof; More preferably, one or more cancer-related proteins are selected from the group consisting of KRAS, NRAS, MYC, MYB, ESR1, AR, EGFR, HER2, BCR-ABL1, and BRAF; Most preferably, one or more cancer-related proteins are selected from the group consisting of KRAS, NRAS, MYC, and MYB; More preferably, one or more proteins associated with metabolic disorders are selected from the group consisting of ARX, SUR, DPP4, and SGLT; More preferably, one or more proteins associated with neuropathy are selected from the group consisting of Tau and β-amyloid; and, One or more proteins associated with infectious diseases were selected from the group consisting of CCR5 and PLA2G16. L is the linker part; and, EBM is a portion that modulates the function of E3 ligase and / or binds to at least one regulatory factor or member of the E3 ligase complex; Preferably, at least one member of the E3 ligase complex (CRL) is selected from the group consisting of CUL4B;DDB1;RBX1;UBE2G1; and CUL4A; and at least one regulatory factor of the E3 ubiquitin ligase complex is selected from the group consisting of UBE2M;UBA3;UBE2F;NAE1;COPS1, COPS2, COPS3, COPS4, COPS5, COPS6, COPS7A, COPS7B, COPS8;DCUN1D1;DCUN1D2;DCUN1D3;DCUN1D4;DCUN1D5; More preferably, at least one member or regulatory factor of the E3 ubiquitin ligase complex is CUL4B or DDB1; More preferably, the EBM is included in a structure selected from the group consisting of compounds of formulas (I), (II), (III), (IV), and (V).
[0022] If the EBM includes a structure selected from the group consisting of compounds of formulas (I), (II), (III), (IV), and (V), then the TBM-L-EBM structure shown above is understood to be formally obtained by establishing a bond between the linker portion (preferably also connected to the TBM) and the EBM including the structure selected from the compounds of formulas (I), (II), (III), (IV), and (V), for example, by formally removing hydrogen radicals from both the linker and the compound selected from the compounds of formulas (I), (II), (III), (IV), and (V) belonging to the EBM, and then combining the radicals of the linker thus hypothetically obtained with the radicals of the structure including the compound selected from the compounds of formulas (I), (II), (III), (IV), and (V) belonging to the EBM, so as to form a bond between two atoms each having two hypothetically two radicals. Preferably, the EBM has a structure selected from the group consisting of compounds of formulas (I), (II), (III), (IV), and (V).
[0023] The “target protein” is a target protein that is particularly desirable to be degraded via ubiquitination(s) or more. The term “target protein” also includes multiple proteins of the target protein when used in this context. This is illustrated in the accompanying examples. In one embodiment, the “target protein” in the context of the present invention is a protein that is desirable or preferred to be degraded in disease cells, such as cancer cells, in an in vivo or in vitro setting. A specific target protein, in one specific embodiment, is a protein that is the cause, driving, and / or maintaining entity of a malignant tumor, disease, or disease state. Such target proteins may include proteins that are overexpressed and / or overactive in disease cells, such as cancer cells. Thus, in one embodiment, the target protein is involved in the cause, onset, and / or maintenance of a disease state in cells and / or tissues. Potential target proteins are also described later herein, and exemplary and non-limiting examples are provided below herein. The target proteins(s) described herein may be degraded via direct or indirect binding to the compounds of the present invention. Specific examples of such target proteins include, but are not limited to, CDK12, CDK13, and / or CCNK. In this context, CDK12, CDK13, and / or CCNK are desirable or may be degraded in disease cells, such as cancer cells, in vivo or in vitro settings. Therefore, the target proteins(s) disclosed herein and in the context of the present invention may be cancer-related target proteins(s), and one or more cancer-related proteins may be selected from the group consisting of CDK12, CDK13, and CCNK. As another specific example, the target proteins may be cancer-related target proteins, and one or more cancer-related proteins may be kinases such as CDK12 and / or CDK13.
[0024] For example, the compound may promote the recognition of a target protein by the E3 ligase complex, or simultaneously promote ubiquitination without physically associating with the target protein. The compound may also enable the recognition of the target protein by the E3 ligase complex. Further non-limiting options for "induction of target protein ubiquitination" may include changes in the higher-order structure of the target protein induced as a direct result of binding / interaction with the compound that induces ubiquitination of the target protein. For example, when a compound described herein binds to a target protein, the higher-order structure of the protein changes, thereby stabilizing the interaction between one or more target proteins and one or more components of the E3 ligase complex, resulting in the ubiquitination and degradation of the one or more target proteins. Specifically, when a compound binds to CDK12 / 13:CCNK, the interaction with the DDB1:CUL4B E3 ligase complex is promoted, leading to the ubiquitination and degradation of CCNK. In other words, target proteins such as CCNK, as described herein and illustrated in the appended examples, can be degraded via direct or indirect binding mechanisms of the compounds described herein, for example, by binding to a protein associated with the target protein. The compounds can bind to CDK12 / 13 associated with CCNK, thereby ubiquitinating and degrading CCNK. This interaction is independent of the specific substrate receptor of the E3 ligase. Therefore, the compounds described herein and in the context of the present invention can degrade one or more target proteins via the E3 ligase, independently of the specific substrate receptor of the E3 ligase.
[0025] In particular, the compounds of the present invention bind to the active sites of CDK12 / 13, thereby promoting structural changes to higher-order structures, which in turn promotes the binding of CDK12:CCNK and CDK13:CCNK, respectively, to DDB1:CUL4B. Therefore, CDK12 and CDK13 essentially play a role in presenting CCNK to the ligase, thereby degrading CCNK in particular, and subsequently, CDK12 and CDK13 may undergo slightly weaker degradation.
[0026] The term "enhanced karin-ring ubiquitin ligase activity" / "enhanced CRL activity" means that the karin-ring ubiquitin ligase activity / CRL activity is enhanced in the presence of the compound compared to the karin-ring ubiquitin ligase activity / CRL activity in the absence of the compound of the present invention. Accordingly, the present invention relates to a compound having the ability to induce and / or stimulate the ubiquitination of one or more target proteins by enhancing CRL activity. Karin-ring ubiquitin ligase activity / CRL activity is known in the art and can be determined by the method provided below. Enhanced CRL activity is induced by the presence of the compound. The compound may be able to induce molecular proximity between the components of the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex and the target protein(s) that can bind to the compound or may be part of the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex, target protein(s), and target protein(s). The compound of the present invention may bind to target protein(s) via the compound's target binding site / TBM, and may bind to or modulate the function of the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex by recruiting, for example, the target protein(s) bound to the compound's target binding site / TBM to the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex. For example, the compound may bind to at least one member of the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex and target protein(s). As another example, the compounds in the context of the present invention may alter the function of a target protein, for example, by modulating post-translational modifications of the target protein. Post-translational modifications may include, but are not limited to, the phosphorylation state of the protein, such as tyrosine kinases that phosphorylate the protein.Therefore, a compound may induce ubiquitination of a target protein by modifying the target protein so that it can access the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex, thereby preventing the compound from associating with the target protein and / or the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex.
[0027] The target protein(s) can be ubiquitinated by the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex. Specifically, the inventors have found that target proteins, including those lacking hydrophobic binding pockets and / or inhibitory binding sites, can be recognized by the compounds of the present invention. Such target proteins may further include proteins that are not recognized by the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex in the absence of the compounds of the present invention. Surprisingly, it has been found that the compounds of the present invention can induce ubiquitination of the target protein(s), i.e., through the degradation of the target protein(s) by the ubiquitination system.
[0028] Description of the Invention Some target proteins involved in the cause, onset, and / or maintenance of disease states lack obvious ligand-binding sites, such as inhibitory binding sites or hydrophobic pockets. Such target proteins include, but are not limited to, transcription factors such as the zinc finger transcription factors IKZF1 and IKZF3, which do not have hydrophobic pockets. Another example of such target proteins may include, but are not limited to, CDK12, CDK13, and / or CCNK. Yet another example of such target proteins (one or more) may include, but are not limited to, kinases such as CDK12 and / or CDK13. Furthermore, target proteins that may not contain binding sites that alter the function of the target protein, such as being inhibited or activated when a compound binds to the binding site, are "difficult to target for drug discovery" because compounds targeting target proteins involved in the cause, onset, and maintenance of disease states include compounds that recognize hydrophobic binding pockets and / or binding sites that alter the function of the target protein.
[0029] Compounds that can act via ubiquitination of target proteins, thereby degrading them through the ubiquitination system, may overcome these limitations by linking the components of E3 ligases with the target protein. These molecules may organize novel interactions between the components of E3 ligases and the target protein at the dimerization interface, forming a trimer complex containing the components of the E3 ligase, the molecule, and the target protein.
[0030] For example, such a compound may be a molecular glue as described herein and used in the context of the present invention. As described herein and illustrated in the appended examples, the molecular glue can degrade proteins that are "difficult to target for drug discovery" and / or "unligand-binding."
[0031] As used herein, and as described above herein, the term “ligand-unbound” refers to a protein to which a ligand cannot bind and / or which does not have a suitable binding site for binding between the ligand and the ligand. For example, whether a target protein is ligand-unbound may be determined using a structure-based algorithm, and the ability of a ligand to bind to a protein is evaluated based on computer-calculated parameters of the binding pocket on the protein, including but not limited to parameters such as volume, surface area, lipophilic surface area, depth, and / or hydrophobicity ratio.
[0032] As used herein, the term "difficult to target for drug discovery" refers to a protein to which a drug compound cannot bind and / or which does not have a suitable binding site for binding to the drug compound. Therefore, a difficult-to-target protein for drug discovery refers to a protein that does not successfully interfere with the drug compound (e.g., a ligand such as an antibody) used in treatment. Thus, typically, a difficult-to-target protein for drug discovery may be a protein that does not have a binding site for a drug compound or, even if it has a binding site, has been proven difficult to successfully target.
[0033] Furthermore, molecular glues can degrade one or more target proteins through interaction with components of karin RING E3 ligase present in several family members of karin RING E3 ligase, as described herein and illustrated in the accompanying examples. Specifically, the family members of karin RING E3 ligase can be diversified by their respective substrate receptors, such as CRBN or DCAF15. The compounds described herein, in particular molecular glues, can bind to components of the karin RING E3 ligase family other than substrate receptors, and therefore these compounds can degrade one or more target proteins independently of substrate receptors. Thus, the ability of molecular glues to degrade one or more target proteins through interaction with karin RING E3 ligase may not be limited to specific family members of karin RING E3 ligase.
[0034] For example, the molecular glue described herein may degrade one or more cancer-related target proteins such as CDK12, CDK13, and / or cyclin K (CCNK). The mechanism by which the molecular glue degrades one or more target proteins such as CDK12, CDK13, and / or cyclin K (CCNK) may be due to the molecular glue's ability to organize protein-protein interactions between the karin RING E3 ligase and one or more target proteins to be degraded. As described herein, this can be achieved by stabilizing the interaction between CDK12 and / or CDK13 bound to CCNK and one or more components of the karin RING E3 ligase, particularly CUL4B and / or DDB1.
[0035] In this context, the present invention provides novel compounds that stimulate / induce ubiquitination of one or more target proteins, i.e., via target protein degradation by karin RING E3 ligase, and which have any one of the formulas (I), (II), (III), (IV), and (V) described herein.
[0036] In the context of the present invention, the compounds are particularly useful as pharmaceuticals in the treatment of diseases and / or disorders in which it is desirable, for example, to degrade one or more target proteins via ubiquitination. Accordingly, the present invention also provides a method for treating such diseases or disorders, comprising administering the compounds of the present invention, i.e., compounds that can stimulate / induce the ubiquitination of one or more target proteins, to an individual in need of such treatment. Specifically, the compounds of the present invention provided herein are used for the biochemical degradation of misfolded and / or abnormal proteins not only in vitro but also in vivo.
[0037] Examples of compounds of the present invention (particularly formulas (I), (II), (III), (IV), and (V)) are shown below. It is understood that these also include any stereoisomers, tautomers, pharmaceutically acceptable salts, solvates, and prodrugs of the compounds presented as mercurish formulas or specific formulas.
[0038] The term “molecular glue” is generally known in the art and refers to a compound that can bind at least two different molecules simultaneously by cooperative bonding, but does not have binding affinity to any one of the at least two different molecules individually. In other words, molecular glue refers to a compound that binds to a target protein(s) and a second protein simultaneously. In the context of the present invention, molecular glue refers to a compound that binds to a target protein(s) if the compound can simultaneously bind to the target protein(s) and at least one member or regulatory factor of the E3 ligase complex. Examples of molecular glues known in the art include, but are not limited to, non-chimeric small molecules, lenalidomide, pomalidomide, CC-885, and related immunomodulatory drugs (IMiDs). The compounds of the present invention may include molecular glues that bind to a target protein(s) if the compound can simultaneously bind to the target protein(s) and at least one member or regulatory factor of the E3 ligase complex. Such molecular adhesives of the present invention are described further below in this specification and illustrated by the attached examples.
[0039] Furthermore, the compounds of the present invention may include PROTAC® (Proteolytic Targeting Chimeras). The terms “PROTAC®,” “PROTAC®s,” or “Proteolytic Targeting Chimeras” are used interchangeably and refer to heterobifunctional compounds, and as used herein, refer to compounds that induce proteasome-mediated degradation of selected proteins via recruitment to E3 ubiquitin ligase and subsequent ubiquitination (Crews C, Chemistry & Biology, 2010, 17(6):551-555; Schnnekloth JS Jr., Chembiochem, 2005, 6(l):40-46). In other words, the term generally refers to a proteolytic targeting chimera molecule having three components: an E3 ubiquitin ligase binding group, optionally a linker, and a target protein binding group. Phthalimide conjugation as a strategy for in vivo target protein degradation. Science 348, 1376-1381 (2015), Bondeson, DP et al. Catalytic in vivo protein knockdown by small-molecule PROTAC(R)s. Nat. Chem. Biol. 11, 611-617 (2015). PROTAC(R) functions by inducing molecular proximity between the target protein (POI) and the intracellular E3 ligase substrate receptor by simultaneously binding to both proteins. This proximity induces ubiquitination and proteasomal degradation of the POI. In particular, the modular design consisting of a warhead that binds to the POI, a flexible linker, and a defined E3 ligase ligand makes the development of PROTAC(R) highly flexible. Currently, the list of proteins that tolerate targeted degradation includes numerous protein kinases, including one example of a single-pass transmembrane receptor tyrosine kinase.Some proteins with single transmembrane domains such as EGFR, HER2, c-Met, ALK, and FLT-3 (Cell Chem Biol. 2018 Jan 18;25(1):67-77. The Advantages of Targeted Protein Degradation Over Inhibition: An RTK Case Study. Burslem GM, Smith BE, Lai AC, Jaime-Figueroa S, McQuaid DC, Bondeson DP, Toure M, Dong H, Qian Y, Wang J, Crew AP, Hines J, Crews CM. / Eur J Med Chem. 2018 May 10;151:304-314. Proteolysis Targeting Chimeras (PROTAC(R)s) of Anaplastic Lymphoma Kinase (ALK). Zhang C, Han XR, Yang X, Jiang B, Liu J, Xiong Y, Jin J. J Am Chem Soc. 2018 Dec 5;140(48):16428-16432 / Enhancing Antiproliferative Activity and Selectivity of a FLT-3 Inhibitor by Proteolysis Targeting Chimera Conversion. Burslem GM, Song J, Chen X, Hines J, Crews CM) has been shown to be degradable by degradation induced by "PROTAC®".
[0040] In one embodiment, the present invention relates to a compound of the following formula (I): [ka]
[0041] The present invention also relates to any stereoisomers, tautomers, pharmaceutically acceptable salts, solvates, or prodrugs of the compounds of formula (I), (II), (III), (IV), and (V) (and any more specific definitions of the compounds according to the invention such as formula (B), (C), etc.). This includes any pharmaceutically acceptable salts of the stereoisomer or tautomer, any solvate of the stereoisomer or tautomer, any solvate of the pharmaceutically acceptable salt, any solvate of the pharmaceutically acceptable salt of the stereoisomer or tautomer (including any prodrugs of any of these).
[0042] R 1 is selected from optionally substituted bicyclic aryl and optionally substituted bicyclic heteroaryl. Preferably, R 1 is selected from optionally substituted naphthyl, benzothienyl, benzofuranyl, isobenzofuranyl, chromenyl, indolizinyl, isoindolyl, indolyl (e.g., 3H - indolyl), indazolyl, purinyl, isoquinolyl, quinolyl, phthalazinyl, naphthyridinyl, quinoxalinyl, cinnolinyl, 1,2 - benzisoxazol - 3 - yl, benzothiazolyl, benzoxazolyl, benzisoxazolyl, benzimidazolyl, coumarinyl, and chromonyl. More preferably, R 1 is selected from optionally substituted naphthyl, benzothienyl, benzofuranyl, indolizinyl, isoindolyl, indolyl (e.g., 3H - indolyl), indazolyl, purinyl, isoquinolyl, quinolyl, phthalazinyl, naphthyridinyl, quinoxalinyl, cinnolinyl, 1,2 - benzisoxazol - 3 - yl, benzothiazolyl, benzoxazolyl, benzisoxazolyl, and benzimidazolyl. Even more preferably, R 1 is selected from optionally substituted naphthyl, benzothienyl, benzofuranyl, isoquinolyl, and quinolyl. Even more preferably, R 1 is selected from optionally substituted naphthyl, benzo[b]thienyl, and benzo[b]furanyl. Most preferably, R 1The substituent is optionally substituted and selected from naphthyl and benzo[b]furanyl, and preferably the optional substituent(s) are independently selected from alkyl and heteroalkyl groups.
[0043] R 1 It is preferable that the compound is a bicyclic heteroaryl substituted with imidazopyridinyl (e.g., imidazo[1,2-a]pyridinyl), pyrrolopyridinyl (e.g., pyrrolo[2,3-b]pyridin-3-yl, pyrrolo[3,2-b]pyridin-3-yl), or quinazolinyl (e.g., (2-oxo)quinazolin-3(4H)-yl).
[0044] R 1 Such examples of bicyclic heteroaryls include the following, which are sometimes substituted: [ka]
[0045] R 1 Specific examples of bicyclic heteroaryls include the following: [ka]
[0046] The dashed lines indicate the positions where these bicyclic heteroaryls bond to the remainder of equation (I). 1 These preferred examples of bicyclic heteroaryls are understood to be substituted as described herein, in some cases.
[0047] R 1 If is a bicyclic heteroaryl which is optionally substituted, it is preferable that the optionally substituted bicyclic heteroaryl is linked to the remainder of formula (I) via one of its carbon ring atoms.
[0048] R 1 A preferred example of a bicyclic heteroaryl is, [ka] Of these, the following are more preferable: [ka]
[0049] The dashed lines indicate the positions where these bicyclic heteroaryls bond to the remainder of equation (I). 1 These preferred examples of bicyclic heteroaryls are understood to be substituted in some cases, as described below.
[0050] In that case, R including substituents 1 A particularly favorable example is, [ka] (In the formula, R BC (The element is selected from hydrogen, methyl, methoxy, fluoro, chloro, and bromo, and preferably selected from hydrogen, methyl, methoxy, fluoro, and chloro.)
[0051] In that case, R including substituents 1 A more preferred example is, [ka] That is the case.
[0052] The optional substituents of the optionally substituted bicyclic aryl and optionally substituted bicyclic heteroaryl (including any specific examples thereof) are preferably independently selected from halogens, alkyls, haloalkyls, haloalkoxys, and heteroalkyls.
[0053] Preferably, one or more optional substituents of optionally substituted bicyclic aryls and optionally substituted bicyclic heteroaryls (including any specific examples thereof) are preferably independently selected from halogens, alkyls, haloalkyls, and heteroalkyls.
[0054] R 2 is selected from hydrogen and alkyl. Preferably, R 2 R is selected from hydrogen, methyl, and ethyl. More preferably, 2 R is selected from hydrogen and methyl. More preferably, 2 It is hydrogen.
[0055] A 1 is a 5-membered or 6-membered monocyclic heteroaryl which may be substituted in some cases. Preferably, A 1 The following are optionally substituted and selected from pyrrolyl, furanyl, thienyl, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, isothiazolyl, triazolyl, flazanyl, oxadiazolyl, thiadiazolyl, tetrazolyl, pyridinyl, diazinyl (e.g., pyridazinyl, pyrimidinyl, pyrazinyl), oxazinyl, thiadinyl, triazinyl, and tetradinyl. More preferably, A 1 The following are optionally substituted, selected from pyrrolyl, furanyl, thienyl, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, isothiazolyl, triazolyl, flazanyl, oxadiazolyl, thiadiazolyl, and tetrazolyl. More preferably, A 1 The is selected from imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl, which may be substituted as needed. More preferably, A 1 The is selected from oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl, which may be substituted as needed. More preferably, A 1 It is selected from oxazolyl and thiazolyl, which may be substituted depending on the circumstances.
[0056] If G is selected from O, S, NH, and N (alkyl), then A 1 The appropriate compound is preferably selected from imidazolyl, oxazolyl, thiazolyl, triazolyl (especially 1H-1,2,4-triazolyl and 4H-1,2,4-triazolyl), oxadiazolyl (especially 1,2,4-oxadiazolyl and 1,3,4-oxadiazolyl), thiadiazolyl (especially 1,2,4-thiadiazolyl and 1,3,4-thiadiazolyl), tetrazolyl, pyrimidinyl, triazinyl (especially 1,2,4-triazinyl and 1,3,5-triazinyl), and tetradinyl (especially 1,2,4,5-tetradinyl and 1,2,3,5-tetradinyl), which may be optionally substituted; more preferably, the appropriate compound is selected from imidazolyl, oxazolyl, thiazolyl, triazolyl (especially 1H-1,2,4-triazolyl and 4H-1,2,4-triazolyl), which may be optionally substituted; more preferably, imidazolyl, which may be optionally substituted. Selected from dazolyl, oxazolyl, thiazolyl, triazolyl (especially 1H-1,2,4-triazolyl and 4H-1,2,4-triazolyl), oxadiazolyl (especially 1,2,4-oxadiazolyl and 1,3,4-oxadiazolyl), thiadiazolyl (especially 1,2,4-thiadiazolyl and 1,3,4-thiadiazolyl), and tetrazolyl; more preferably selected from imidazolyl, oxazolyl, and thiazolyl, which may be optionally substituted; even more preferably selected from oxazolyl and thiazolyl, which may be optionally substituted; and even more preferably selected from thiazolyl, which may be optionally substituted.
[0057] A in equation (I) 1 Specific examples of 5-membered or 6-membered monocyclic heteroaryl groups are: [ka] These include, and each is optionally substituted with one or more substituents as described below. The dashed lines indicate the positions where these five-membered or six-membered monocyclic heteroaryls are attached to the remainder of formula (I).
[0058] One or more substituents on optionally substituted five- or six-membered monocyclic heteroaryls (including any specific examples thereof) are preferably independently selected from halogens, alkyls, haloalkyls, heteroalkyls, and cycloalkyls. More preferably, one or more substituents on optionally substituted five- or six-membered monocyclic heteroaryls (including any specific examples thereof) are preferably independently selected from halogens, alkyls, haloalkyls, and heteroalkyls. Particularly preferred examples of these substituents are cycloproyl, trifluoromethyl, and isopropyl.
[0059] A 1 Preferred examples of substituted 5-membered or 6-membered monocyclic heteroaryls are: [ka] And, [ka] However, it is even more preferable.
[0060] The dashed lines indicate the positions where these five- or six-membered monocyclic heteroaryls attach to the remainder of equation (I).
[0061] G is a ring atom selected from oxygen, sulfur, carbon, and nitrogen. Preferably, G is selected from O, S, CH, N, NH, and N(alkyl). More preferably, G is selected from O, S, NH, and N(alkyl). Even more preferably, G is selected from O, S, and NH. Even more preferably, G is selected from O and S. Even more preferably, G is S.
[0062] Preferably, the optionally substituted five- or six-membered monocyclic heteroaryl substituent may also be located at the G position. Thus, the optionally substituent may also be located at the CH or NH position instead of H.
[0063] Specific examples of compounds of formula (I) are: [ka] Includes.
[0064] These two formulas are disclaimed from the claims of the product of the present invention. Optionally, they are also disclaimed from the claims of the first and second medical uses of the present invention (including methods of treatment).
[0065] In another embodiment, G in formula (I) is CH, and H is optionally substituted with one of the substituents mentioned above for a 5-membered or 6-membered monocyclic heteroaryl.
[0066] Furthermore, this type of compound can be represented by the following formula (B): [ka]
[0067] In formula (B), ring A 1 The upper left corner is understood to represent CH, in which H is optionally substituted by one of the substituents mentioned above for a 5-membered or 6-membered monocyclic heteroaryl. Preferably, ring A in formula (B). 1 The upper left corner represents CH.
[0068] In formula (B), A 1Preferably, A is selected from pyrrolyl, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, isothiazolyl, flazanil, oxadiazolyl (especially 1,2,3-oxadiazolyl and 1,2,5-oxadiazolyl), thiadiazolyl (especially 1,2,3-thiadiazolyl and 1,2,5-thiadiazolyl), pyridinyl, diazinyl (e.g., pyridazinyl, pyrimidinyl, pyrazinyl), triazinyl (especially 1,2,3-triazinyl and 1,2,4-triazinyl), and tetradinyl (especially 1,2,3,4-tetradinyl), which may be substituted as needed. 1 This is selected from pyrazolyl and pyridinyl, which may be substituted as needed. More preferably, A 1 A is selected from pyrazolyl and pyridinyl, which may be substituted as needed. More preferably, 1 This is pyrazolyl, which is sometimes substituted.
[0069] R in equation (B) 1 and R 2 This is the same as the definition above for equation (I).
[0070] Therefore, the present invention also relates in particular to compounds of formulas (BI) and (B-II): [ka] (In the formula, R N (wherein R represents substituents by one or more pyrazolyl and pyridinyl molecules, respectively). In formula (BI), the pyridine ring preferably has 1 to 4 substituents, more preferably 1 to 3, even more preferably 1 or 2, and most preferably 1 substituent R N It is understood that it has. Furthermore, in formula (B-II), the pyrazolyl ring preferably has 1 to 3 substituents R, more preferably 1 or 2, and most preferably 1 substituent R N It is understood that it has
[0071] A preferred example of formula (BI) is formula (B-Ia): [ka] That is the case.
[0072] A preferred example of equation (B-II) is equation (B-IIa): [ka] That is the case.
[0073] R in equations (BI) and (B-II) 1 and R 2 (and any examples thereof) are as defined with respect to formula (I).
[0074] One or more substituents on optionally substituted five- or six-membered monocyclic heteroaryls (including any specific examples thereof) are preferably independently selected from halogens, alkyls, haloalkyls, heteroalkyls, and cycloalkyls. More preferably, one or more substituents on optionally substituted five- or six-membered monocyclic heteroaryls (including any specific examples thereof) are preferably independently selected from halogens, alkyls, haloalkyls, and heteroalkyls. Particularly preferred examples of these substituents are cyclopropyl, trifluoromethyl, and isopropyl.
[0075] R N Similarly, preferably each is independently selected from halogens, alkyls, cycloalkyls, haloalkyls, and heteroalkyls. More preferably, R N Each of these is independently selected from halogens, alkyls, haloalkyls, and heteroalkyls. N Particularly preferred examples include cyclopropyl, trifluoromethyl, and isopropyl.
[0076] Preferred examples of compounds of formula (I) are: [ka] TIFF0007850460000018.tif242161 TIFF0007850460000019.tif250161 Includes.
[0077] In a further embodiment, the present invention relates to the following formula (C): [ka] (In the formula, R 1 , R 2 , G, and A 1 This is as defined with respect to equation (I), and each R 2 R is related to equation (I). 2 The compound relates to a group that is understood to be independently selected from a given group. Preferably, R 2 Both are hydrogen.
[0078] R in equation (C) 1 A particularly preferred example is that it is sometimes replaced. [ka] That is the case.
[0079] Preferred examples of formula (C) are the following compounds [ka] Includes.
[0080] In a further embodiment, the present invention further relates to a compound of the following formula (II): [ka] Regarding.
[0081] R 11is selected from -(optionally substituted aryl), -(optionally substituted heteroaryl), -C(O)-(optionally substituted aryl), and -C(O)-(optionally substituted heteroaryl). Preferably, R 11 is selected from -(an optionally substituted aryl) and -C(O)-(an optionally substituted aryl). More preferably, R 11 This is selected from -(optionally substituted phenyl) and -C(O)-(optionally substituted phenyl).
[0082] One or more optional substituents of -(optionally substituted aryl), -(optionally substituted heteroaryl), -C(O)-(optionally substituted aryl), and -C(O)-(optionally substituted heteroaryl) (including any specific examples of any of these) are preferably independently selected from halogens, alkyls, haloalkyls, and heteroalkyls.
[0083] R 12 R is selected from hydrogen and alkyl. 13 R is selected from hydrogen and alkyl. 12 and R 13 These are understood to be optionally linked together with the nitrogen and carbon atoms to which they are connected, to form optionally substituted heterocycloalkyl groups. The optionally substituted heterocycloalkyl groups preferably contain no oxygen or sulfur in the ring. It is more preferable that the optionally substituted heterocycloalkyl groups contain five or six ring atoms. One or more optionally substituted substituents on the optionally substituted heterocycloalkyl groups are preferably selected from halogens, alkyls, haloalkyls, and heteroalkyls. The optionally substituted heterosiloalkyl groups thus formed are preferably optionally substituted pyrrolidine groups, and more preferably pyrrolidine groups without any optionally substituted substituents.
[0084] R 13 is hydrogen, and R 12 Is it methyl, or R 12 and R 13 It is preferable that these are linked together and, together with the connected nitrogen and carbon atoms, form optionally substituted pyrrolidine groups.
[0085] A 2 This is an optionally substituted 5- to 10-membered heteroaryl group. One or more optionally substituted substituents of the optionally substituted 5- to 10-membered heteroaryl group (including any specific examples thereof) are preferably independently selected from halogens, alkyls, haloalkyls, and heteroalkyls. 2 This is either an optionally substituted 5-membered or 6-membered heteroaryl group or an optionally substituted 8- to 10-membered heteroaryl group, wherein the optionally substituted 8- to 10-membered heteroaryl group preferably contains one aromatic ring and one non-aromatic ring. In the optionally substituted 8- to 10-membered heteroaryl group, the aromatic ring is preferably an optionally substituted 5- or 6-membered heteroaryl group. In the optionally substituted 8- to 10-membered heteroaryl group, the aromatic ring is more preferably ring A in formula (II). 2The ring contains a nitrogen atom as shown in the formula (II). In other words, in the optionally substituted 8-10 membered heteroaryl group, the aromatic ring is preferably a ring directly linked to the NH group shown on the right side of formula (II). The optionally substituted 5- or 6 membered heteroaryl group is preferably selected from pyrrolyl, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, isothiazolyl, triazolyl, flazanyl, oxadiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, and triazinyl. The optionally substituted 5- or 6 membered heteroaryl group is more preferably selected from imidazolyl, oxazolyl, isoxazolyl, thiazolyl, isothiazolyl, pyridyl, pyridazinyl, pyrimidinyl, and pyrazinyl. The optionally substituted 5- or 6-membered heteroaryl groups are more preferably selected from oxazolyl, thiazolyl, pyridyl, pyridadinyl, pyrimidinyl, and pyrazinyl. The optionally substituted 5- or 6-membered heteroaryl groups are more preferably selected from oxazolyl, thiazolyl, and pyridyl. The optionally substituted 5- or 6-membered heteroaryl groups are more preferably selected from thiazolyl and pyridyl. These examples also apply to optionally substituted 5- or 6-membered heteroaryl groups within optionally substituted 8- to 10-membered heteroaryl groups. The optionally substituted 5- or 6-membered heteroaryl group preferably has one of its nitrogen atoms in ring A of formula (II). 2 It is understood that they are arranged so as to be located at the position indicated by the nitrogen atom.
[0086] Specific examples of compounds of formula (II) are as follows: [ka] Includes.
[0087] These two formulas are excluded from the claims of the product of the present invention. Optionally, they are also excluded from the claims of the first and second medical uses of the present invention (including methods of treatment).
[0088] In a further embodiment, the present invention further relates to the following formula (III): [ka] Regarding the compounds.
[0089] E is a linear C2 molecule in which one or more CH2 units are optionally substituted by one of S, O, and NH, independently selected. 2-4 Alkylene group (especially -(CH2)) 2-4 -) and the linear C 2-4 Alkylene groups are =O, -OH, -Hal, -C 1-6 Alkyl and -C 1-6 It is optionally substituted with one, two, three, or four substituents independently selected from the haloalkyl group. Preferably, E is a linear C group in which one of the CH2 units is optionally substituted with one independently selected from S, O, and NH. 2-3 It is an alkylene group, and the linear C 2-3 Alkylene groups are =O, -OH, -Hal, -C 1-6 Alkyl and -C 1-6 It is optionally substituted with one or two substituents independently selected from the haloalkyl group. More preferably, E is a linear C 2-3 It is an alkylene group, and the linear C 2-3 Alkylene groups are =O, -OH, -Hal, -C 1-6 Alkyl and -C 1-6 It is optionally substituted with one substituent selected from haloalkyl groups. More preferably, E is a linear C chain. 2-3 It is an alkylene group, and the linear C 2-3The alkylene group is optionally substituted with one substituent selected from =O, -Hal, -methyl, and -ethyl. More preferably, E is selected from -(CH2)3-, -(CH2)2-, and -(C=O)-(CH2)2-.
[0090] R 21 is selected from -halogen, -NO2, -C(=O)H, -C(=O)R 26 , -COOH, -C(=O)OR 27 , -CF3, and -CN (wherein R 26 and R 27 are each independently selected from alkyl and haloalkyl). Preferably, R 21 is selected from -halogen, -C(=O)R 26 , -C(=O)OR 27 , -CF3, and -CN (wherein R 26 and R 27 are each independently selected from alkyl and haloalkyl). Even more preferably, R 21 is selected from -halogen, -CF3, and -CN. The halogen is preferably selected from -Cl and -Br, and more preferably -Br.
[0091] R 22 is selected from hydrogen and alkyl. Alternatively, R 22 is linked to R 23 as described herein.
[0092] R 23 is selected from optionally substituted aryl and optionally substituted heteroaryl. The one or more optional substituents of optionally substituted aryl and optionally substituted heteroaryl (including any specific examples thereof) are preferably each independently selected from halogen, alkyl, haloalkyl, and heteroalkyl. Preferably, R 23 is optionally substituted aryl, and more preferably optionally substituted phenyl. Alternatively, R 23As described herein, R 22 It is connected to R. 23 As described herein, R 25 It is connected to.
[0093] R 24 O and NR 25 (In the formula, R 25 (is selected from alkyl or haloalkyl). Alternatively, R 25 R 23 It is connected to.
[0094] R 22 and R 23 When connected, R 22 and R 23 It forms ring α with nitrogen and carbon between them. Therefore, in this case, the compound of formula (III) is formula (IIIa): [ka] It can be represented by a compound.
[0095] In this equation (IIIa), R 24 It is preferable that it is O.
[0096] Ring α is a optionally anellated, optionally substituted, five- or six-membered heterocyclic group. Therefore, ring α can be an optionally substituted monocyclic or bicyclic heterocyclic group. The optionally substituted monocyclic or bicyclic heterocyclic group may be saturated, partially unsaturated, or aromatic. Either one or both rings (if α contains two rings) may be aromatic, or one ring may be aromatic while the other is partially unsaturated. It is preferable that ring α has a bicyclic structure.
[0097] More preferably, ring α is pyrimidone or benzpyrimidone, which may be substituted. In these cases, the -NC(=O)- of the pyrimidine moiety is -NC(=R) as shown in formula (IIIa).24 )- It is understood that they are arranged to correspond to the parts.
[0098] The substituents on ring α (including any more specific definitions thereof), one or more in some cases, are preferably independently selected from halogens, alkyls, haloalkyls, and heteroalkyls.
[0099] R 24 NR 25 If R 23 and R 25 Depending on the circumstances, they may be linked, R 23 and R 25 It forms a ring β with nitrogen and carbon between them. Therefore, in this case, the compound of formula (III) is formula (IIIb): [ka] It can be represented by a compound.
[0100] Ring β is a optionally anellated, optionally substituted, five- or six-membered heterocyclic group. Therefore, ring β can be an optionally substituted monocyclic or bicyclic heterocyclic group. The optionally substituted monocyclic or bicyclic heterocyclic group may be saturated, partially unsaturated, or aromatic. Either one or both rings (if β contains two rings) may be aromatic, or one ring may be aromatic while the other is partially unsaturated. It is preferable that ring β has a bicyclic structure.
[0101] More preferably, ring β is a bicyclic aromatic heterocycle which is optionally substituted and contains one or more heteroatoms selected from N, O, and S. Ring β is particularly preferably an oxadiazole or a thiadiazole. Ring β is more preferably an optionally substituted imidazothiadiazole, and more preferably an optionally substituted imidazo[2,1-b][1,3,4]thiadiazole. The imidazothiadiazole is preferably R in formula (IIIb) via the non-bridgehead carbon of the thiadiazole of the imidazothiadiazole. 22 It is understood that the nitrogen atom is bonded to a substituted nitrogen.
[0102] The substituents on ring β (including any more specific definitions thereof), which may be one or more, are preferably independently selected from halogens, alkyls, haloalkyls, and heteroalkyls.
[0103] A five-membered or six-membered heterocyclic group preferably refers to a five-membered or six-membered monoring containing one or more (e.g., one, two, or three) ring heteroatoms independently selected from O, S, and N, wherein one or more S ring atoms (if present) and / or one or more N ring atoms (if present) are optionally oxidized, and one or more carbon ring atoms are optionally oxidized.
[0104] The term "anellated" refers to a state in which two adjacent nonhydrogen atoms of a five- or six-membered heterocyclic group are not only part of the five- or six-membered heterocyclic group, but also part of another ring containing a total of five or six ring atoms. The other ring may be carbocyclic or heterocyclic, and may be saturated, partially unsaturated, or aromatic.
[0105] Specific examples of compounds of formula (III) are as follows: [ka] Includes.
[0106] These three formulas are excluded from the claims of the product of the present invention. Optionally, they are also excluded from the claims of the first and second medical uses of the present invention (including methods of treatment).
[0107] In further embodiments, the present invention further comprises the following formulas (IV) and (V): [ka] Regarding the compounds.
[0108] R 41 R is selected from -(optionally substituted aryl), -(optionally substituted heteroaryl), -(optionally substituted alkylene)-(optionally substituted aryl), and -(optionally substituted alkylene)-(optionally substituted heteroaryl). Preferably, R 41 is selected from -(optionally substituted aryl) and -(optionally substituted alkylene)-(optionally substituted aryl). More preferably, R 41 The aryl is preferably phenyl (and optionally substituted aryl) and selected from among them.
[0109] Of formulas (IV) and (V), formula (IV) is more preferred.
[0110] R 41 A preferred example is: [ka] This includes, of which the following are preferable: [ka]
[0111] The dashed lines indicate the positions where these groups attach to the remainder of formula (IV) or (V). It is understood that these preferred examples may be substituted in some cases, as described below.
[0112] The optional substituents of optionally substituted aryls, optionally substituted heteroaryls, and optionally substituted alkylenes (including any specific examples thereof) are preferably independently selected from halogens, alkyls, haloalkyls, heteroalkyls, and cycloalkyls. More preferably, the optional substituents of optionally substituted aryls, optionally substituted heteroaryls, and optionally substituted alkylenes (including any specific examples thereof) are preferably independently selected from halogens, alkyls, haloalkyls, and heteroalkyls.
[0113] R including substituents depending on the case 41 A preferred example is, [ka] That is the case.
[0114] A 4 A is a monocyclic or bicyclic heteroaryl which may be substituted. A monocyclic or bicyclic heteroaryl which may be substituted is understood to contain one ring or two fused rings. In the case of two fused rings, one or both (preferably both) rings are aromatic. In particular, A 4 A is a 5-membered or 6-membered heteroaryl that is sometimes anellated and sometimes substituted. 4 Preferred examples include pyrrolyl (e.g., 2H-pyrrolyl), imidazolyl, pyrazolyl, pyridyl (especially 2-pyridyl), pyrazinyl, pyrimidinyl, pyridadinyl, indolidinyl, isoindolyl, indolyl (e.g., 3H-indolyl), indazolyl, isoquinolyl, quinolyl, thiazolyl, isothiazolyl, phenothiazinyl, oxazolyl, isoxazolyl, flazanyl, benzothiazolyl, benzoxazolyl, benzisoxazolyl, and benzimidazolyl, which may be substituted as needed. 4More preferred examples include pyridyl, pyrimidinyl, thiazole, and benzimidazole, optionally substituted.
[0115] More preferably, A 4 is selected from thiazolyl, pyrazolyl, and pyridinyl, optionally substituted, preferably thiazolyl and pyrazolyl, optionally substituted.
[0116] A including optional substituents 4 Examples of
Chemical formula
Chemical formula
Chemical formula
[0117] A 4 One or more optional substituents of (and any specific examples of this group) are preferably each independently selected from halogen, alkyl, haloalkyl, and heteroalkyl.
[0118] The most preferred examples of the compounds of formulas (IV) and (V) are the following
Chemical formula
[0119] These four formulas are excluded from the claims of the subject matter of the present invention. Optionally, they are also excluded from the first and second medical use claims (including treatment methods) of the present invention.
[0120] Preferred examples of the compounds of formula (IV) are the following compounds:
Chem.
[0121] Any reference to "the compound of the present invention" is understood to be a reference to any one of the compounds of formulas (I), (II), (III), (IV), and (V).
[0122] Furthermore, the compounds specified to be excluded are optionally excluded in any form of their tautomers, pharmaceutically acceptable salts, and solvates. However, preferably, only the compounds represented by each formula are excluded.
[0123] Thus, and the compounds disclosed herein can modulate the function of the E3 ligase complex / cullin-RING ubiquitin ligase complex / CRL complex. This can occur, for example, by modulating the post-translational changes of target proteins as outlined above. The modulated functions of the E3 ligase complex / cullin-RING ubiquitin ligase complex / CRL complex include enhanced activity of the E3 ligase complex / cullin-RING ubiquitin ligase complex / CRL complex. This enhanced activity of the E3 ligase complex / cullin-RING ubiquitin ligase complex / CRL complex can be determined by the methods described above and below in this specification, as well as as exemplified in the attached examples. As disclosed herein and as exemplified in the attached examples, the enhanced activity of the E3 ligase complex / cullin-RING ubiquitin ligase complex / CRL complex can be determined by measuring the level / amount of the target protein(s) in cells expressing the target protein(s) in the presence of the compound, and in these cells the CRL activity is reduced compared to control cells. The control cells are preferably of the same cell type as the cells with reduced CRL activity. In the context of the present invention, the control cells are also referred to as "wild-type cells".
[0124] The terms “E3 ligase binding moiety” and “EBM” are used interchangeably, and the E3 ligase binding moiety / EBM means that the E3 ligase binding moiety / EBM is a moiety that modulates the function of E3 ligase and / or the binding of the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex to at least one regulatory factor or member. When used in the context of the present invention, “modulate the function of E3 ligase” means, for example, that the Karin-RING ubiquitin ligase / CRL activity is enhanced by the E3 ligase binding moiety / EBM by binding to E3 ligase / Karin-RING ubiquitin ligase / CRL, or by modifying the function of the E3 ligase complex / Karin-RING ubiquitin ligase / CRL complex.
[0125] The E3 ligase binding moiety / EBM can bind to or modulate the function of at least one member or regulatory factor of the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex. Such at least one member of the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex may be CUL4B (NP_001073341.1); DDB1 (NP_001914.3); RBX1 (NP_055063.1); UBE2G1 (NP_003333.1); and CUL4A (NP_001008895.1 and all isoforms). For example, at least one member of the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex may be DDB1 (NP_001914.3).
[0126] At least one regulator of such E3 ligase complex / karin-RING ubiquitin ligase complex / CRL complex is UBE2M(NP_003960.1);UBA3(NP_003959.3);UBE2F(NP_542409.1);NAE1(NP_003896.1);COPS1(NP_001308018.1),COPS2(NP_004227.1),COPS3(NP_003644.2),COPS4(NP_057213.2),COP These may be S5 (NP_006828.2), COPS6 (NP_006824.2), COPS7A (NP_001157566), COPS7B (NP_073567.1), COPS8 (NP_006701.1); DCUN1D1 (NP_065691.2); DCUN1D2 (NP_001014305.1); DCUN1D3 (NP_775746.1); DCUN1D4 (NP_001035492.1), and DCUN1D5 (NP_115675.1). As disclosed herein and in the context of the present invention, at least one member of such an E3 ligase complex may be identified by their respective accession numbers and / or sequences provided, for example, by NCBI. Specifically, at least one member of such an E3 ligase complex / karin-ring ubiquitin ligase complex / CRL complex may be CUL4B or DDB1. More specifically, at least one member of such an E3 ligase complex / karin-ring ubiquitin ligase complex / CRL complex may bind to the compound of the present invention.
[0127] The binding of the E3 ligase binding moiety / EBM to the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex, for example, to at least one member or regulatory factor of the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex, can be determined by methods known in the art. Further methods for determining the binding of the E3 ligase binding moiety / EBM to the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex, for example, to at least one member or regulatory factor of the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex, are known in the art, as outlined below. For example, known means and methods in the art for determining the E3 ligase binding site / EBM for the E3 ligase complex / karin-RING ubiquitin ligase complex / CRL complex include, in particular, immunoassays (such as Western blotting and ELISA tests) and / or reporter assays (such as luciferase assays).
[0128] In the context of the present invention, the target protein may include, but is not limited to, proteins associated with cancer, metabolic disorders, neurological disorders, or infectious diseases.
[0129] Non-exclusive examples of such cancer-related target proteins (one or more) include transcription factors such as ESR1 (NP_000116.2), AR (NP_000035.2), MYB (NP_001123645.1), MYC (NP_002458.2); RNA-binding proteins; scaffold proteins; GTPases, e.g., HRAS (NP_005334.1), NRAS (NP_002515.1), KRAS (NP_203524.1); solute transporters; CDK4 (NP_0000 66.1), CDK6(NP_001138778.1), CDK9(NP_001252.1), EGFR(NP_005219.2), SRC(NP_938033.1), PDGFR(NP_002600.1), ABL1(NP_ 005148.2), HER2(NP_004439.2), HER3(NP_001973.2), BCR-ABL(NP_009297.2), MEK1(NP_002746.1), ARAF(NP_001645.1), BRAF Kinases and phosphatases such as (NP_004324.2), CRAF(NP_001341618.1), BRD2(NP_001106653.1), BRD3(NP_031397.1), BRD4(NP_490597.1), CBP(NP_004371.2), p300(NP_001420.2), ATAD2(NP_054828.2), SMARCA2(NP_003061.3), SMARCA4(NP_001122316.1), PBRM1(NP_ These may include bromodomain and chromodomain-containing proteins such as 060783.3), G protein-coupled receptors, anti-apoptotic proteins such as BCL2 (NP_000624.2) and MCL1 (NP_068779.1), phosphatases, immunoregulatory factors such as SHP2 (NP_002825.3), PTPN1 (NP_002818.1), PTPN12 (NP_002826.3); PDL1 (NP_054862.1), and combinations thereof.Specific, non-limiting examples of such cancer-related target proteins (one or more) may include BRD2, BRD3, BRD4, CBP, p300, ATAD2, SMARCA2, SMARCA4, PBRM1, CDK4, CDK6, CDK9, CDK12 (NP_057591.2), and / or CDK13 (NP_003709.3), EWS-FLI (NP_002009.1), CDC6 (NP_001245.1), CENPE (NP_001804.2), EGFR, SRC, PDGFR, ABL1, HER2, HER3, BCR-ABL1, MEK1, ARAF, BRAF, CRAF, HRAS, NRAS, KRAS, BCL2, MCL1, SHP2, PTPN1, PTPN12, ESR1, AR, MYB, MYC, PDL1, and combinations thereof. More specific, non-limiting examples of such cancer-related target proteins (one or more) may include KRAS, NRAS, MYC, MYB, ESR1, AR, EGFR, HER2, BCR-ABL, and BRAF, and more specifically, KRAS, NRAS, MYC, and MYB. Even more specific, non-limiting examples of one or more cancer-related target proteins may include CDK12, CDK13, and / or CCNK, particularly CCNK.
[0130] Non-specific examples of one or more target proteins associated with metabolic disorders may include ARX (NP_620689.1), SUR (NP_001274103.1), DPP4 (NP_001926.2), and SGLT (NP_001243243.1). Non-specific examples of one or more target proteins associated with neurological disorders may include Tau (NP_058519.3) and β-amyloid (NP_000475.1). Non-specific examples of one or more target proteins associated with infectious diseases may include CCR5 (NP_000570.1) and PLA2G16 (NP_001121675.1).
[0131] The term "lower-order morphological mutation" refers to a mutation that reduces the function of at least one member or regulatory factor of the E3 ubiquitin ligase complex. In other words, a lower-order morphological mutation reduces the activity of the E3 ubiquitin ligase complex compared to the activity of the E3 ubiquitin ligase complex in the corresponding wild-type cell. This reduction in the activity of the E3 ubiquitin ligase complex can be achieved by reducing the expression level and / or activity level of at least one member of the E3 ubiquitin ligase complex compared to the level in the corresponding wild-type cell. For example, such lower-order morphological states are known in the art and can be induced by the methods described below herein. Non-limiting examples of lower-order morphological mutations of at least one member or regulatory factor of the E3 ubiquitin ligase complex include, but are not limited to, Cas9 / CRISPR, inhibitors, antibodies, monobodies and nanobodies, nucleic acid molecules including RNA and DNA, e.g., antisense oligonucleotides, siRNA, shRNA, or miRNA, or any combination thereof. Therefore, inactivation of at least one member or regulatory factor of the E3 ubiquitin ligase complex means that the function of at least one member of the E3 ubiquitin ligase complex is completely or substantially completely lost, resulting in a decrease in CRL activity. Means and methods for inactivating at least one member or regulatory factor of the E3 ubiquitin ligase complex are known in the art and may be caused by mutations in at least one member or regulatory factor of the E3 ubiquitin ligase complex, or by various synthetic or natural agents or substances that can inhibit at least one member or regulatory factor of the E3 ubiquitin ligase complex. Such synthetic or natural agents or materials may include, but are not limited to, small molecules, proteins including antibodies and polypeptides, and nucleic acid molecules including RNA and DNA, such as antisense oligonucleotides, siRNA, shRNA, or miRNA, or any combination thereof. For example, inactivation by mutation in at least one member or regulatory factor of the E3 ubiquitin ligase complex may be caused by knockout.Such knockout can be performed using Cas9 / CRISPR (clustered, regularly arranged short palindromic sequence repeats). Specifically, KBM-7 cells contain a mutant UBE2M with an 18 bp deletion introduced into the UBE2M sequence, resulting in the loss of 16 amino acids (SEQ ID NO: AGAC-------------------GTTGGGGTGATAG). In the attached example, cell A, containing the wild-type UBE2M sequence (SEQ ID NO: AGACGTTGCCCTCGAGGTCAATGTTGGGGTGATAG), was used as a control.
[0132] As provided herein, at least one member of such an E3 ubiquitin ligase complex that is mutated intracellularly by lower-order morphological mutations or inactivation that reduce CRL activity may be CUL4B, DDB1, RBX1;UBE2G1, and CUL4A. Accordingly, at least one regulator of such an E3 ubiquitin ligase complex that is mutated intracellularly by lower-order morphological mutations or inactivation that reduce CRL activity may be UBE2M, UBA3, UBE2F, NAE;COPS1, COPS2, COPS3, COPS5, COPS6, COPS7A, COPS7B, COPS8, DCUN1D2, DCUN1D3, DCUN1D4, and DCUN1D5. Specific examples of at least one member or regulator of such an E3 ubiquitin ligase may be CUL4B or DDB1.
[0133] In one embodiment, the compound preferably includes a portion that binds to at least one member or regulatory factor of the E3 ligase complex. For example, the at least one member or regulatory factor of the E3 ligase complex to which the compound binds may be a substrate receptor, adapter protein, or karin scaffold protein of the E3 ligase complex. Non-limiting examples of such substrate receptors may be DCAF15, DCAF16, DCAF1, DCAF5, DCAF8, DET1, FBXO7, FBXO22, KDM2A, or KDM2B, particularly CRBN and DCAF15. Non-limiting examples of such adapter proteins may be DDB1. Non-limiting examples of such karin may be karin of the CRL4 complex, such as CUL4A and CUL4B. Thus, for example, the compounds disclosed herein and used in the context of the present invention include a portion that binds to at least one member of the E3 ligase complex, and the at least one member of the E3 ligase complex to which the compound binds may be an adapter protein such as DDB1.
[0134] Quince may be found to be covalently conjugated with NEDD8, a ubiquitin-like molecule (expressed in neural progenitor cells and developmentally downregulated). As used herein, the term "NEDD8" refers to the protein encoded by the NEDD8 gene in humans. The nucleotide and amino acid sequences of the NEDD8 protein are known in the art. Non-restrictive examples of NEDD8 sequences include human NEDD8, whose nucleotide and amino acid sequences are described in GenBank accession numbers NM_006156 and NP_006147, respectively; mouse NEDD8, whose nucleotide and amino acid sequences are described in GenBank accession numbers NM_008683 and NP_032709, respectively (Kamitani et al. (1997) J Biol Chem 272:28557-28562; Kumar et al. (1992) Biochem Biophys Res Comm 185:1155-1161); and yeast Rub1, whose nucleotide and amino acid sequences are described in GenBank accession numbers Y16890 and CAA76516, respectively.
[0135] The compounds of the present invention may bind to one or more target proteins and may bind to or modulate the function of the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex by, for example, recruiting the target protein(s) to the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex. For example, the compounds may bind to at least one member of the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex and the target protein. As another example, the compounds in the context of the present invention may alter the function of the target protein, for example, by modulating post-translational modifications of the target protein. Post-translational modifications may include, but are not limited to, the phosphorylation state of the protein, such as tyrosine kinases that phosphorylate the protein. Therefore, a compound may induce ubiquitination of a target protein by modifying the target protein so that it can access the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex, thereby preventing the compound from associating with the target protein and / or the E3 ligase complex / Karin-RING ubiquitin ligase complex / CRL complex.
[0136] Non-limiting examples of one or more cancer-related proteins whose degradation may be induced by the compounds of the present invention include: DNA-binding proteins including transcription factors such as ESR1, AR, MYB, MYC; RNA-binding proteins; scaffold proteins; GTPases such as HRAS, NRAS, KRAS; solute transporters; CCNK, CDK4, CDK6, CDK9, EGFR, SRC, PDGFR, ABL1, HER2, HER3, BCR-ABL, MEK1, ARAF, BRAF, CRAF, and especially CDK4, CDK6, and CDK9. This includes kinases and phosphatases such as EGFR, SRC, PDGFR, ABL1, HER2, HER3, BCR-ABL, MEK1, ARAF, BRAF, and CRAF; bromodomain and chromodomain-containing proteins such as BRD2, BRD3, BRD4, CBP, p300, ATAD2, SMARCA2, SMARCA4, and PBRM1; G protein-coupled receptors; anti-apoptotic proteins such as SHP2, PTPN1, and PTPN12; immunoregulatory factors such as PDL1; and combinations thereof. Specific, non-limiting examples of one or more cancer-related proteins to which TBM may bind include CDK13, CDK12, CDK9, CDK6, CDK4, CCNK, BRD2, BRD3, BRD4, CBP, p300, ATAD2, SMARCA2, SMARCA4, PBRM1, CDK4, CDK6, CDK9, EWS-FLI, CDC6, CENPE, EGFR, SRC, PDGFR, ABL1, HER2, HER3, BCR-ABL, MEK1, ARAF, BRAF, CRAF, HRAS, NRAS, KRAS, BCL2, MCL2, SHP2, PTPN1, PTPN12, ESR1, AR, MYB, MYC, PDL1, and combinations thereof.Non-limiting examples of one or more cancer-related proteins whose degradation can be induced by the compounds of the present invention include BRD2, BRD3, BRD4, CBP, p300, ATAD2, SMARCA2, SMARCA4, PBRM1, CDK4, CDK6, CDK9, CDK12, and / or CDK13, EWS-FLI, CDC6, CENPE, EGFR, SRC, PDGFR, ABL1, HER2, HER3, BCR-ABL, MEK1, ARAF, BRAF, CRAF, HRAS, NRAS, KRAS, BCL2, MCL2, SHP2, PTPN1, PTPN12, ESR1, AR, MYB, MYC, PDL1, and combinations thereof, which may be bound to or include. More specific, non-limiting examples of one or more cancer-related proteins whose degradation can be induced by the compounds of the present invention include KRAS, NRAS, MYC, MYB, ESR1, AR, EGFR, HER2, BCR-ABL, and BRAF. Further, more specific, non-limiting examples of one or more cancer-related proteins whose degradation can be induced by the compounds of the present invention may include those that bind to and include KRAS, NRAS, MYC, and MYB. Non-limiting examples of one or more proteins related to metabolic disorders whose degradation can be induced by the compounds of the present invention include ARX, SUR, DPP4, and SGLT. Non-limiting examples of one or more proteins related to neurological disorders whose degradation can be induced by the compounds of the present invention include Tau and β-amyloid. Non-limiting examples of one or more proteins related to infectious diseases are selected from the group consisting of CCR5 and PLA2G16.
[0137] Means and methods for determining the binding of a compound to at least one member or regulatory factor of an E3 ligase complex and / or to a target protein are known in the art and are described herein as above and below. Such means and methods for determining the binding of a compound to an E3 ubiquitin ligase can be determined by immunoassays, including but not limited to radioimmunoassays, chemiluminescent and fluorescence immunoassays, enzyme-linked immunoassays (ELISA), Luminex-based bead arrays, protein microarray assays, assays suitable for point-of-care testing, and rapid test formats such as immunochromatographic strip tests. A suitable immunoassay may be selected from the group of immunoassays such as immunoprecipitation, enzyme immunoassay (EIA), enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), fluorescence immunoassay, chemiluminescence assay, agglutination assay, turbidimetric assay, turbidimetric assay, Western blotting, competitive immunoassay, non-competitive immunoassay, homogeneous immunoassay, heterogeneous immunoassay, bioassay, and reporter assays such as luciferase assay or Luminex® assay. An immunoassay is a biochemical test that measures the presence or concentration of macromolecules / polypeptides in a solution by using an antibody or immunoglobulin as a binder. According to the present invention, the antibody may be a monoclonal antibody as well as a polyclonal antibody. Therefore, at least one antibody is either a monoclonal antibody or a polyclonal antibody. In certain embodiments, the level of the marker is determined by high-performance liquid chromatography (HPLC). In certain embodiments, HPLC may be coupled to the immunoassay. For example, in a sandwich immunoassay, two antibodies are applied. In principle, all labeling techniques applicable to the above-mentioned assays can be used, including radioisotopes, enzymes, fluorescent labels, chemiluminescent labels, bioluminescent labels, and color labels that are directly optically detectable, such as gold atoms and dye particles.
[0138] Furthermore, the binding of the compound to E3 ubiquitin ligase can be detected, for example, by Western blotting. Western blotting involves applying a protein sample (lysis solution) to a polyacrylamide gel, then separating the complex mixture by electrophoresis, and then transferring or "electroblotting" the separated proteins onto a second matrix, generally a nitrocellulose or polyvinylidene fluoride (PVDF) membrane. After transfer, the membrane is "blocked" to prevent nonspecific binding of the antibody to the membrane surface. Many strategies for labeling or tagging antibodies are known to those skilled in the art. In the simplest protocol, the transferred protein is incubated or complexed with a primary enzyme-labeled antibody that acts as a probe. After blocking nonspecific binding sites, a suitable substrate is added to complex it with the enzyme, and then the two react to form a chromogenic, chemiluminescent, or fluorescently detectable product, which allows for visual, chemiluminescent, or fluorescent detection, respectively. This procedure is described in U.S. Patent No. 4,452,901 by Gordon et al., issued on June 15, 1984.
[0139] The present invention further relates to a method for identifying a compound having the ability to degrade one or more proteins, comprising contacting the compound with wild-type cells and mutant cells, wherein the mutation comprises a lower-order morphological mutation or inactivation of at least one member or regulatory factor of the E3 ubiquitin ligase complex, and the compound is determined to degrade the one or more proteins if the levels of the one or more proteins in the wild-type cells are reduced compared to the mutant cells.
[0140] The terms "karin ring ubiquitin E3 ligase" or "CRL" are used interchangeably and refer to ubiquitin ligases in a complex in which the catalytic core consists of members of the karin family and a ring domain protein, and the core associates with one or more additional proteins that confer substrate specificity. The ring domain protein of CRL mediates the transfer of ubiquitin from E2 to E3 binding substrates. Specifically, karin ring ubiquitin E3 ligase (CRL) is a modular multi-subunit complex all containing a common core that includes a karin subunit and a zinc-binding ring domain subunit. Specifically, the karin subunit folds into an extended structure that forms the backbone of CRL. The C-terminal region of the karin subunit wraps around the ring protein, then forms a globular domain that recruits an E2 conjugating enzyme to form the core of the enzyme. The N-terminal region of the karin subunit, located opposite the elongated karin structure, recruits a substrate receptor via an adapter protein.
[0141] Karin-based E3 ligases constitute a large family of ubiquitin ligases and are composed of several subunits consisting of one of seven mammalian karin homologs (CUL1, CUL2, CUL3, CUL4A / B, CUL5, or CUL7) that bind to the RING domain protein. The N-terminus of karin mediates binding to a karin homolog-specific substrate recognition subunit. Binding of the substrate recognition subunit often requires, but not always, a specific adapter protein that bridges the interaction with the karin homolog. For example, CUL1 is known to bind to a substrate recognition subunit containing a conserved F-box via the adapter protein Skp1 to form the SCF (Skp1-Cul1-F-box) E3 ligase, while CUL2 and CUL5 recruit substrate recognition subunits with VHL or SOCS boxes via the adapter proteins elongin B and C, respectively. In contrast, CUL3 is known to bind directly to the substrate recognition subunit via its BTB domain (also known as the POZ domain). CUL4A acts as an associater that provides a scaffold for assembling the ring box domain protein (RBX1) and the adapter protein, damaged DNA binding protein 1 (DDB1) (Angers et al., Nature, 2006. 443(7111):590-3). RBX1 is the docking site for the activated E2 protein, and DDB1 recruits the substrate-specific receptor or DCAF (DDB1-karin 4 associater) to form the substrate-presenting side of the CUL4 complex (Angers et al., Nature, 2006. 443(7111):590-3; He et al., Genes Dev, 2006. 20(21):2949-54; Higa et al. Nat Cell Biol, 2006. 8(11): p. 1277-83). Cereblon (CRBN) interacts with damaged DNA-binding protein 1 and forms an E3 ubiquitin ligase complex with CUL4, where it functions as a substrate receptor that allows proteins recognized by CRBN to be ubiquitinated and degraded by the proteasome.Quince may be found to be covalently conjugated with NEDD8, a ubiquitin-like molecule (expressed in neural progenitor cells and developmentally downregulated). As used herein, the term "NEDD8" refers to the protein encoded by the NEDD8 gene in humans. The nucleotide and amino acid sequences of the NEDD8 protein are known in the art. Non-limiting examples of NEDD8 sequences include human NEDD8, whose nucleotide and amino acid sequences are described in GenBank accession numbers NM_006156 and NP_006147, respectively; mouse NEDD8, whose nucleotide and amino acid sequences are described in GenBank accession numbers NM_008683 and NP_032709, respectively (Kamitani et al. (1997) J Biol Chem 272:28557-28562; Kumar et al. (1992) Biochem Biophys Res Comm 185:1155-1161); and yeast Rub1, whose nucleotide and amino acid sequences are described in GenBank accession numbers Y16890 and CAA76516, respectively. CRL can be activated when it is present in a NEDDized state, i.e., upon NEDDization. As used herein, the term “NEDDization” refers to a type of protein modification process in which the ubiquitin-like protein NEDD8 conjugates CRL via E1 activating enzymes (NAE; a heterodimer of NAE1 and UBA3 subunits), E2 conjugating enzymes (Ubc12, UBE2M), and E3 ligases (Gong et al. J. Biol. Chem. 2013; 274:1203612042). This modification, called NEDDization, activates the E3 ligase activity of CRL by promoting substrate ubiquitination. The NEDD conversion system is similar to the UPS (ubiquitin-proteasome system), which involves ubiquitin-activating enzyme E1, ubiquitin-conjugating enzyme E2 (UBC), and ubiquitin-protein isopeptide ligase E3 (Hershko, A. Cell Death Differ. 2005; 12: 1191-1197).Therefore, as used herein, the terms “NAE” or “NEDD8 activating enzyme” refer to a protein capable of catalyzing the transfer of NEDD8 E2 to the catalytic cysteine at the C-terminus of NEDDS, thereby forming a thiol-esterified E2-NEDD8 intermediate (Gong and Yeh (1999) J Biol Chem 274:12036-12042; and Liakopoulos et al. (1998) EMBO J 17:2208-2214; Osaka et al. (1998) Genes Dev 12:2263-2268). The NEDD8 E1 enzyme described in the art contains a heterodimer of NAE1 (also known as APPBP1; amyloid-beta precursor protein-binding protein 1; and NEDD8 activating enzyme E1 regulatory subunit). The nucleotide and amino acid sequences of the NAE1 protein are known in the art. Non-limiting examples of NAE1 sequences include human NAE1, whose nucleotide and amino acid sequences are described in GenBank accession numbers NM_001018159 and NP_001018169, respectively; and mouse NAE1, whose nucleotide and amino acid sequences are described in GenBank accession numbers NM_144931 and NP_659180, respectively. The NEDD8 E2 enzyme plays a central role in the E1-E2-E3 NEDD8 conjugation cascade. As used herein, the terms “NEDD8 conjugating enzyme” and “NEDD8 E2 enzyme” refer to proteins that transiently bind to the NEDD8 E1 enzyme for production and can interact with the NEDD8 E3 ligase. Two known NEDD8 conjugating enzymes are UBC12, also known as UBE2M, and UBE2F. The nucleotide and amino acid sequences of the UBE2M protein are known in the art.Non-limiting examples of UBE2M sequences include human UBE2M, whose nucleotide and amino acid sequences are described in GenBank accession numbers NM_003969 and NP_003960, respectively; mouse UBC12, whose nucleotide and amino acid sequences are described in GenBank accession numbers NM_145578 and NP_663553, respectively; and yeast UBC12, whose nucleotide and amino acid sequences are described in GenBank accession numbers NM_001182194 and NP_013409, respectively.
[0142] Neddylation can be reversed by the COP9 signalosome (CSN), which enzymatically removes NEDD8 from the cullin molecule. Thus, CSN is a central component of the cycle of activation and remodeling of cullin-RING E3 ubiquitin ligases (Schlierf et al., Nat. Commun. 7, 13166 (2016)). Human CSN consists of nine protein subunits (COPS1-7A, 7B, 8), of which COPS5 contains a metalloprotease motif that provides the catalytic center of the complex. COPS5 exhibits appropriate deneddylation activity only in the context of the holocomplex, and only fully assembled CSN has the ability to specifically remove NEDD8 from CRL.
[0143] Karin-RING ubiquitin ligase, its activity, and means and methods for detecting and / or measuring this activity can be determined by methods known in the art. For example, such methods may include, but are not limited to, FRET (Förster resonance energy transfer) analysis. The theory of FRET defines distance-dependent, non-radioactive energy transfer from an excited donor (D) to a receptor molecule (A). The relationship between readily accessible spectroscopic data and theoretical formulas is thanks to Theodor Forster, which has enabled many FRET applications in all natural sciences. FRET is used in biochemical applications on the 1–10 nm scale (KE Sapsford et al., Angew. Chem. Int. Ed., 45, 4562, 2006) (e.g., protein-protein binding, protein folding, intermolecular interactions at the cell membrane, DNA hybridization and sequencing, antigen-antibody immunoreactions). The details of the theory of FRET are well known. Further examples include protein complementation assays (PCAs). PCAs provide a means for detecting the interaction of two biomolecules, such as polypeptides. PCAs utilize two fragments of the same protein, such as an enzyme, that can be reconstituted into a functional and active protein when they are in close proximity to each other. NANOBIT® technology (Promega Corporation) can be used to detect molecular proximity by reconstitution of a luminescent enzyme via the binding interactions of enzyme components or subunits. By design, NanoBiT subunits (i.e., 1.3 kDa peptides, 18 kDa polypeptides) weakly associate so that their assembly into a luminescent complex is directed by the interaction properties of a target protein, such as at least one member of the E3 ligase complex used herein to which they are attached.Further details are provided, in particular, in Dixon et al., “NanoLuc Complementation Reporter Optimized for Accurate Measurement of Protein Interactions in Cells,” ACS Chem. Biol., Publication Date (Web): November 16, 2015. In some embodiments, the Nano-Glo® HiBiT Detection System (Promega Corporation) may be used to quantify HiBiT-tagged proteins in cell lysates using an add-mix-read assay protocol. Alternatively, HiBiT-tagged proteins such as ligase substrate receptors, e.g., DCAF15, may be expressed ectopically. HiBiT-DCAF15 fusion proteins may be expressed ectopically via a viral vector. HiBiT is an 11-amino acid peptide tag that is fused to the N-terminus or C-terminus of the protein of interest, or inserted at an accessible position within the protein structure. The amount of HiBiT-tagged protein expressed in cells can be determined by adding a lysis detection reagent containing the substrate flimazine and Large BiT (LgBiT), the large subunit used in NanoLuc® Binary Technology (NanoBiT®; 1). Alternatively, if LgBit can be ectopically introduced by, for example, lentiviral expression (not limited to this), HiBit levels can be measured in living cells by adding one or more luciferase substrates.
[0144] The term "cancer cell," as used herein, means a tumor cell that has the ability to proliferate in a way that depends on a specific oncogene expressed in the cancer cell. Cancer cells may include primary cultured cells, cell lines, or cancer stem cells. As used herein, "dependence" with respect to cell proliferation refers to oncogene toxicity or a state of toxicity in which a cell proliferates in a way that depends on a specific oncogene. Whether a cell proliferates in a way that depends on a specific oncogene can be determined by treating the cell with an inhibitor of the specific oncogene and then evaluating the proliferative capacity of the treated cell. For example, when used in the context of the method of the present invention, the cell may be a cancer cell. Specifically, such cancer cells may be KBM-7 cells, Mv4-11 cells, or Jurkat cells; pancreatic cancer cells, especially AsPC-1 cells; lung cancer cells, especially NCI-H446 cells; gastric cancer cells; melanoma cells; sarcoma cells; colorectal cells, especially HCT116 cells or RKO cells; or neuroblastoma cells, especially Be(2)C cells; more specifically, the cancer cells may be KBM-7 cells.
[0145] Proliferative capacity can be evaluated, for example, by the MTT assay or MTS assay. It is known that when cells that are oncogene-toxic to a particular oncogene are treated with an inhibitor of such oncogene, apoptosis-mediated cell death can be induced. Therefore, oncogene toxicity in cells for a particular oncogene can be confirmed by evaluating whether apoptosis can be induced by inhibiting the oncogene. Induction of apoptosis can be evaluated, for example, by the TUNEL assay, detection of active caspases, or detection of annexin V. Cancer cells may originate from any tissue. Examples of such tissues may include respiratory tissue (e.g., lungs, trachea, bronchi, pharynx, nasal cavity, paranasal sinuses), digestive tissue (e.g., stomach, small intestine, large intestine, rectum), pancreas, kidney, liver, thymus, spleen, heart, thyroid gland, adrenal gland, prostate, ovary, uterus, brain, skin, and blood tissue (e.g., bone marrow, peripheral blood). In other words, cancer cells may be adherent or non-adherent cells (i.e., blood cells). From yet another perspective, cancer cells may be cells present in the above-mentioned tissues or other tissues. Examples of such cells may include glandular cells (e.g., glandular cells (glandular secretory cells) in the lungs, mammary gland cells), epithelial cells, endothelial cells, epidermal cells, stromal cells, fibroblasts, adipocytes, pancreatic P cells, nerve cells, glial cells, and blood cells.
[0146] As used herein, cancer cells include a lower-order morphological mutation or inactivation of at least one member of the E3 ligase complex. Therefore, a lower-order morphological mutation or inactivation of at least one member of the E3 ligase complex can be induced in cancer cells, for example, host cancer cells. The terms “host cell,” “host cell line,” and “host cell culture” are used interchangeably and refer to cells into which exogenous nucleic acids have been introduced, and also include the progeny of such cells. Host cells include “transformers” and “transformed cells,” which include primary transformed cells and progeny derived therefrom, regardless of the number of passages. Transformed cells include transiently transformed cells or stably transformed cells. Progeny may not have exactly the same nucleic acid content as the parent cells and may contain mutations. As used herein, mutant progeny having the same function or biological activity as those screened or selected in the initially transformed cells are included. In some embodiments, host cells are transiently transfected with exogenous nucleic acids. In other embodiments, host cells are stably transfected with exogenous nucleic acids. An "isolated" fusion protein is one that has been isolated from the host cell environment that recombinantly produces the fusion protein. In some embodiments, the fusion protein of the present invention is purified to a purity of over 95% or 99% as determined, for example, by electrophoresis (e.g., SDS-PAGE, isoelectrophoresis (IEF), capillary electrophoresis) or chromatography (e.g., ion exchange or reverse-phase HPLC). For a review of purity evaluation methods, see, for example, Flatman et al., J. Chromatogr.B 848:79-87 (2007).
[0147] As will be apparent from the attached examples, a method provided herein for identifying compounds capable of inducing the degradation of one or more cancer-related proteins comprises determining the viability of cancer cells compared to mutant cancer cells, wherein the mutation in the mutant cells includes a lower-order morphological mutation or inactivation of at least one member of the E3 ligase complex. As provided in one aspect of the present invention, a mutation in at least one member of the E3 ligase complex impairs the activity of the E3 ligase complex, for example, impairing NEDDization of the E3 ligase complex resulting from the mutation in at least one member of the E3 ligase complex.
[0148] As provided herein, "at least one member of the E3 ligase complex" means any protein that can associate directly or indirectly with the E3 ligase complex. As used herein, "at least one member of the E3 ligase complex" means a polypeptide containing amino acids as recognized by those skilled in the art. For example, the at least one member of the E3 ligase complex used according to the method of the present invention is at least one member whose molecule is in close proximity to CRL, which can be ubiquitinated by CRL, and which can be degraded by CRL.
[0149] For example, at least one mutated member of the E3 ligase complex could be UBE2M. Another example is that at least one mutated member of the E3 ligase complex could be karin of the E3 ligase complex, such as CUL4B. Yet another example is that at least one mutated member of the E3 ligase complex could be an adapter protein of the E3 ligase complex, such as DDB1. Yet another example is that at least one mutated member of the E3 ligase complex could be a substrate receptor, such as cereblon (CRBN) or DCAF15. The term "cereblon" refers to polypeptides containing the amino acid sequence of any CRBN, such as human CRBN protein (e.g., human CRBN isoform 1, GenBank accession number NP-057386, or human CRBN isoform 2, GenBank accession number NP-001166953, each incorporated herein by reference in its entirety) and related polypeptides containing its SNP variants (the terms "polypeptide," "peptide," and "protein" are used interchangeably herein). Relevant CRBN polypeptides include allelic variants (e.g., SNP variants); splice variants; fragments; derivatives; substitution, deletion, and insertion variants; fusion polypeptides; and interspecific homologs, which, in certain embodiments, are sufficient to retain CRBN activity and / or produce an anti-CRBN immune response. In another example, the substrate receptor may be DCAF15.
[0150] Those skilled in the art will understand that proteins involved in the ubiquitination pathway of E3 ligase are also included in the mutated at least one member of the E3 ligase complex of the present invention, insofar as the activity of the E3 ligase complex is impaired. In this context, those skilled in the art can identify such proteins involved in the ubiquitination pathway of E3 ligase. These proteins include, but are not limited to, NAE1. It will also be understood that at least one member of the E3 ligase complex may be inactivated by means other than mutation, such as the addition of a compound that inhibits at least one member of the E3 ligase complex, such as an antibody or shRNA. Therefore, as provided herein, the term inactivation also includes the use of inhibitory molecules that can reduce the activity of the E3 ligase complex by inhibiting at least one member of the E3 ligase complex.
[0151] Furthermore, those skilled in the art recognize the fact that the CRL activity of a cell may depend on the type of cell used. CRL can be activated when it dissociates from karin-associated NEDD8 dissociation protein 1 (CAND1) and / or karin-associated NEDD8 dissociation protein 2 (CAND2). The CAND1 gene encodes an essential regulator of the karin-RING ubiquitin ligase, which is involved in the ubiquitination of proteins degraded by the ubiquitin-proteasome system. Encoded CAND1 binds to the non-NEDDated karin-RING box protein complex and acts as an inhibitor of karin NEDDation, as well as the assembly and activity of the Skp1, karin, and F-box ubiquitin ligase complex (Liu et al., (2018) Molecular Cell 69, 773-786).
[0152] The ubiquitination of these proteins is mediated by a cascade of enzymatic activity. As used herein, “ubiquitin” refers to a polypeptide that is ligated to another polypeptide by a ubiquitin ligase enzyme. Ubiquitin may originate from any species, preferably eukaryotes. Preferably, ubiquitin is mammalian. More preferably, ubiquitin is human ubiquitin. In a preferred embodiment, once ubiquitin is ligated to a target protein of interest, that protein becomes a target for degradation by the 26S proteasome. Naturally occurring alleles are also included in “ubiquitin.” Ubiquitin is first activated in an ATP-dependent manner by ubiquitin-activating enzyme (E1). The C-terminus of ubiquitin forms a high-energy thiol ester bond with E1. Ubiquitin is then passed to ubiquitin conjugating enzyme (E2; also called ubiquitin transport protein), which also ligates via a thiol ester bond. Under the guidance of ubiquitin ligase (E3), ubiquitin ultimately binds to its target protein, forming a terminal isopeptide bond. In this process, a chain of ubiquitin is formed on the target protein, each covalently ligated to the next chain by the activity of E3. Therefore, as used herein, the term "ubiquitination" refers to the covalent binding of ubiquitin to a protein through the activity of a ubiquitinating enzyme. The E3 enzyme has two distinct activities: ubiquitin ligase activity, which conjugates ubiquitin to the target protein and forms a ubiquitin chain via isopeptide bonds, and targeting activity, which physically ligates the ligase and the target protein to each other. The specificity of this process is controlled by the E3 enzyme that recognizes and interacts with the target protein being degraded. Therefore, as used herein, the terms “ubiquitin ligase,” “ubiquitin E3 ligase,” or “E3 ligase” are interchangeable and refer to ubiquitinating enzymes capable of catalyzing the covalent bonding of ubiquitin to another protein. When used in the context of the present invention, ubiquitination of a target protein, such as a cancer-related protein, is understood to be induced when the target protein is in molecular proximity to the CRL.The term "molecularly close" refers to the physical distance between two molecules that, when in close proximity, can cause biological events to occur. This often involves some kind of chemical bond, such as a non-covalent or covalent bond, but is not always the case.
[0153] In one embodiment, the present invention relates to compounds for use in pharmaceuticals. As used herein, the term “pharmaceutical” is intended to be a general term encompassing prescription and non-prescription drugs. Compounds for use in pharmaceuticals should be understood as being useful in promoting the maintenance of health or recovery from disease, preferably cancer. Furthermore, the term “pharmaceutical” includes any form of pharmaceutical, including, but not limited to, pills, salves, creams, powders, ointments, capsules, injectable drugs, drops, vitamins, and suppositories. The scope of the present invention is not limited by the type, form, or dosage of pharmaceutical. Compounds described herein and in the context of the present invention may be for use in the treatment or prevention of cancer, metabolic disorders, neurological disorders, or infectious diseases. In this regard, compounds described herein and in the context of the present invention may directly or indirectly degrade proteins associated with cancer, metabolic disorders, neurological disorders, or infectious diseases via the E3 ligase described herein. For example, as shown by proteomic profiling analysis, proteins associated with cancer, metabolic disorders, neurological disorders, or infectious diseases can be downregulated when CCNK is degraded by E3 ligase.
[0154] In particular, proteins associated with neurological disorders, such as HECTD1, MBP, and FEM1A, are downregulated when CCNK is degraded. As another example, proteins associated with metabolic disorders, such as HMMR, LMNA, and TMPO, are also downregulated when CCNK is degraded. Furthermore, proteins associated with infectious diseases, such as ICAM2, CALCOCO2, and CDC6, are downregulated when CCNK is degraded. And yet another example: proteins associated with cancer, such as BUB1, BUB1B, MCM10, CDCA7, and CDC6, are all downregulated when CCNK is degraded. Thus, proteins downregulated when CCNK is degraded include those associated with cancer, metabolic disorders, neurological disorders, or infectious diseases.
[0155] In one aspect of the present invention, a chemical compound or agent is intended for use in the treatment of cancer. As used interchangeably herein, “disorder,” “disease,” or “pathological condition” refers to any pathological condition that would benefit from treatment with a composition described herein (e.g., a pharmaceutical composition), for example, a composition comprising the fusion protein of the present invention (e.g., a pharmaceutical composition). This includes chronic and acute disorders or diseases, including pathological conditions that make mammals susceptible to the disorder in question.
[0156] The term "pharmaceutical composition" or "pharmaceutical preparation" refers to a preparation that is in a form that allows the biological activity of the active ingredient contained therein to be effective, and that does not contain any additional ingredients that are unacceptably toxic to the subject to which the pharmaceutical composition is administered.
[0157] When used in connection with the compositions of the present invention, the term “pharmaceutically acceptable” refers to molecular entities and other components of such compositions that are physiologically acceptable when administered to mammals (e.g., humans) and do not normally produce adverse reactions. The term “pharmaceutically acceptable” may also mean that it is approved by a federal or state regulatory authority or is listed in the United States Pharmacopeia or other generally accepted pharmacopoeias for use in mammals, more specifically in humans. “pharmaceutically acceptable carrier” refers to components other than the active ingredient in a pharmaceutical composition or formulation that are nontoxic to the subject. Pharmaceutically acceptable carriers include, but are not limited to, buffers, excipients, stabilizers, or preservatives. Such pharmaceutically acceptable carriers may be sterile liquids, e.g., water, saline, dextrose aqueous solution, glycerol aqueous solution, and oils, including those of petroleum, animal, plant, or synthetic origin, e.g., peanut oil, soybean oil, mineral oil, sesame oil, etc. Suitable pharmaceutical carriers are listed in “Remington's Pharmaceutical Sciences” by AR Gennaro, 20th Edition.
[0158] As used herein, “treatment” (and grammatical variations such as “to treat” or “treating”) refers to a clinical intervention in an attempt to alter the natural course of a disease in the individual being treated, and which may be performed for preventive purposes or during the course of a clinicopathological condition. Desired effects of treatment include, but are not limited to, prevention of disease onset or recurrence, reduction of symptoms, attenuation of any direct or indirect pathological consequences of the disease, reduction of disease exacerbation rates, remission or mitigation of the disease state, and remission or improvement of prognosis. “Mitigation,” “mitigation,” or their equivalents refer to both therapeutic and prophylactic or preventive treatments, the purpose of which is to induce, prevent, slow (attenuate), reduce, or inhibit the disease or condition, such as the formation of atherosclerotic lesions. Those in need of treatment include not only those who already have the disease or condition, but also those who are prone to developing the disease or condition, or those who wish to prevent such disease or condition.
[0159] As used herein, the term “cancer” refers to any malignant tumor in the aforementioned tissues and cell types. Examples of cancer may include cancers that may be caused by abnormal adherent cells or cancers that may be caused by abnormal blood cells (e.g., leukemia, lymphoma, multiple myeloma). Specifically, examples of cancers that may be caused by abnormal adherent cells may include lung cancer (e.g., non-small cell carcinomas such as squamous cell carcinoma, adenocarcinoma and large cell carcinoma, as well as small cell carcinoma), gastrointestinal cancers (e.g., stomach cancer, small intestine cancer, colorectal cancer, rectal cancer), pancreatic cancer, kidney cancer, liver cancer, thymic cancer, spleen cancer, thyroid cancer, adrenal cancer, prostate cancer, bladder cancer, ovarian cancer, uterine cancer (e.g., endometrial cancer, cervical cancer), bone cancer, skin cancer, brain tumors, sarcomas, melanoma, blastomas (e.g., neuroblastoma), adenocarcinoma, squamous cell carcinoma, solid tumors, epithelial carcinoma, and mesothelioma. Specifically, cancer may be leukemia, particularly acute myeloid leukemia (AML) and B-cell acute lymphoblastic leukemia (B-ALL), chronic leukemia, such as chronic myeloid leukemia; adenoid cystic carcinoma; osteosarcoma; ovarian cancer; Ewing's sarcoma; lung adenocarcinoma and prostate cancer; lymphoma, neuroblastoma, gastrointestinal cancer, endometrial cancer, medulloblastoma, prostate cancer, esophageal cancer, breast cancer, thyroid cancer, meningioma, liver cancer, colorectal cancer, pancreatic cancer, chondrosarcoma, osteosarcoma, and kidney cancer, and preferably, cancer is leukemia.
[0160] As discussed above, cancers treated in accordance with the present invention and by the means and methods provided herein may be cancers associated with cell cycle regulators such as cyclin-dependent kinases or transcription kinases, such as CDK12 and CDK13, and / or cyclins, such as CCNK. As used herein, “cancers associated with CDK12, CDK13, and / or CCNK” also include cancers associated with the CDK12 / 13 and CCNK complex. The same applies to other disorders discussed herein, such as neurological disorders / diseases, metabolic disorders / diseases, and / or infectious diseases. Furthermore, these disorders may also be associated with cell cycle regulators such as cyclin-dependent kinases or transcription kinases, such as CDK12 and CDK13, and / or cyclins, such as CCNK, in the context of the present invention.
[0161] CCNK degradation has been described as inducing genomic instability in cancers such as prostate cancer (see Wu et al 2018, Cell. 2018 Jun 14;173(7):1770-1782.e14. doi: 10.1016 / j.cell.2018.04.034), and it has been suggested to be effective in cancers with mutations in DNA damage response genes, such as those listed in Table 1 of Lord et al 2016, Nat Rev Cancer. 2016 Feb;16(2):110-20. doi: 10.1038 / nrc.2015.21. Epub 2016 Jan 18.
[0162] Furthermore, CCNK degradation has been described as particularly effective in cancers with elevated cyclin E1 levels. Therefore, as described herein, cancers associated with cell cycle regulators such as CDK12, CDK13, and / or CCNK include, but are not limited to, cancers with cyclin E1 overexpression, such as breast cancer, ovarian cancer, melanoma, bladder cancer, gastric cancer, gastric adenocarcinoma, lung squamous cell carcinoma, lung adenocarcinoma, glioblastoma multiforme, and colorectal cancer; see Lei et al.; Nat Commun. 2018 May 14;9(1):1876.
[0163] Furthermore, the term "cancer" in cancer-related terms such as "cancer cell" and "oncogene" may have a similar meaning. Cancer cells may originate from any mammalian species. Such mammalian species may include, for example, humans, monkeys, cattle, pigs, mice, rats, guinea pigs, hamsters, and rabbits. From the viewpoint of clinical application, the mammalian species is preferably human. Therefore, cancer cells may be cancer cells isolated from cancer patients or cancer cells derived therefrom. Cancer cells may be cells that are not infected with a virus or cells that are infected with a virus. Examples of oncogenic viruses that can infect cells may include Epstein-Barr virus, hepatitis viruses, human papillomavirus, human T-cell leukemia virus, and Kaposi's sarcoma-associated herpesvirus. Cancer cells may also be derived from embryonic stem cells, somatic stem cells, or artificial stem cells (e.g., iPS cells) generated from normal cells. Cancer cells from which the artificial cells of the present invention are derived can express unique oncogenes. As used herein, the term “inherent oncogene” means an oncogene that is expressed in cancer cells that can be used as material when establishing the artificial cells of the present invention and is involved in the proliferation of cancer cells. An oncogene may be a gene that is overexpressed in cancer cells (e.g., overexpression due to an increase in the number of copies of the gene) and excessively transmits growth signals, or a gene that has undergone a mutation that continuously transmits growth signals within the cancer cell. Examples of mutations may include point mutations (e.g., substitutions), deletions, additions, insertions, and mutations that cause fusions (e.g., inversions, transpositions). As used herein, the term “gene” may also mean a mutated gene. Examples of inherent oncogenes may include genes for kinases such as tyrosine kinases (receptor and non-receptor types) and serine / threonine kinases, small G proteins, and transcription factors. Examples of tyrosine kinases that may play a role in cancer cell proliferation include molecules belonging to the epidermal growth factor receptor (EGFR) family (e.g., EGFR, HER2, HER3, HER4), molecules belonging to the platelet-derived growth factor receptor (PDGFR) family (e.g., PDGFRα, PDGFRβ), anaplastic lymphoma kinase (ALK), hepatocyte growth factor receptor (c-MET), and stem cell factor receptor (c-KIT).As another example, kinases that may play a role in cancer growth may include CDK12, CDK13, and / or CCNK. For example, CDK12, CDK13, and / or CCNK may play a role in the growth of cancers including, but not limited to, breast cancer, ovarian cancer, melanoma, bladder cancer, gastric cancer, gastric adenocarcinoma, lung squamous cell carcinoma, lung adenocarcinoma, glioblastoma multiforme, and colorectal cancer.
[0164] In one embodiment, the present invention further relates to a method for treating cancer, comprising administering a chemical compound or agent to a patient having cancer. For example, the compound may be a compound that binds to one or more proteins to be degraded, the one or more proteins being cancer-related proteins, and may be kinases such as cyclin-dependent kinases and / or transcription kinases selected from the group consisting of CDK12, CDK13, and / or CCNK, and / or cyclins. In this context, the present invention may relate to a method for treating cancer, comprising administering a chemical compound or agent to a patient having cancer, wherein the compound may be a compound that binds to one or more proteins selected from the group consisting of CDK12, CDK13, and / or CCNK. For example, the chemical compound or agent is used to treat cancer, the cancer may be selected from breast cancer, ovarian cancer, melanoma, bladder cancer, gastric cancer, gastric adenocarcinoma, lung squamous cell carcinoma, lung adenocarcinoma, glioblastoma multiforme, and colorectal cancer.
[0165] "Patient," "individual," or "subject" is a mammal. Mammals include, but are not limited to, domesticated animals (e.g., cattle, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In certain embodiments, the patient, individual, or subject is human. In one embodiment, the patient may be a "cancer patient," i.e., a person who has or is at risk of developing one or more symptoms of cancer.
[0166] It is understood that the specific dose level for any particular patient depends on a variety of factors, including the activity of the specific compound used, age, weight, overall health, sex, diet, administration time, route of administration, elimination rate, drug combination, and the causative mechanism and severity of the specific disease being treated.
[0167] When used herein, the terms “optionally,” “may,” and “may” indicate that a specified feature may or may not be present. Whenever the terms “optionally,” “may,” or “may” are used, the present invention specifically relates to both possibilities, i.e., the possibility that the corresponding feature is present or that the corresponding feature is not present. For example, the expression “X is optionally substituted with Y” (or “X may be substituted with Y”) means that X is either substituted with Y or not substituted. Similarly, when a component of a composition is specified as “optionally,” the present invention specifically relates to both possibilities, i.e., the possibility that the corresponding component is present (contained in the composition) or that the corresponding component is not present in the composition. If the expression “may be substituted” precedes a list of groups, it is understood that the expression “may be substituted” applies not only to the first item in the list but to each of the groups in that list.
[0168] In this specification, various groups are referred to as “optionally substituted.” Generally, these groups may have one or more substituents, such as one, two, three, or four substituents. It is understood that the maximum number of substituents is limited by the number of available bonding sites in the substituted portion. Unless otherwise defined, “optionally substituted” groups referred to herein preferably have two or fewer substituents, and in particular may have only one substituent. Furthermore, unless otherwise defined, it is preferable that there are no optional substituents, i.e., that the corresponding group is unsubstituted. When the term “optionally substituted” precedes a list of chemical groups, it is understood that it applies to each member of this list of chemical groups, and to all members. Unless otherwise explicitly indicated, one or more case substituents are preferably independently selected from halogens, CN, OH, NH2, alkyl, haloalkyl, heteroalkyl (preferably alkoxy), haloalkoxy, NH(alkyl), N(alkyl)2, cycloalkyl, cycloheteroalkyl, monocyclic aryl, and monocyclic heteroaryl, and the cycloalkyl, cycloheteroalkyl, monocyclic aryl, and monocyclic heteroaryl are each optionally further substituted independently with one or more selected from halogens, CN, OH, NH2, alkyl, haloalkyl, heteroalkyl (including alkoxy), NH(alkyl), and N(alkyl)2. If two substituents can be present on the same carbon atom, this is also included, as the case substituent = O corresponds to a hydrated form of two OH groups on the same carbon atom. Unless otherwise explicitly indicated, one or more case substituents are preferably independently selected from halogens, alkyl, haloalkyl, and heteroalkyl.
[0169] As used herein, the term "halogen" refers to fluoro(-F), chloro(-Cl), bromo(-Br), or iodine(-I).
[0170] As used herein, the term “alkyl” refers to a monovalent saturated acyclic (i.e., acyclic) hydrocarbon group which may be linear or branched. Therefore, the “alkyl” group does not contain any carbon-carbon double bonds or any carbon-carbon triple bonds. The term “alkyl” is preferably “C 1-6 It refers to "alkyl". 1-6 "Alkyl" means an alkyl group having 1 to 6 carbon atoms. Preferred exemplary alkyl groups are methyl, ethyl, propyl (e.g., n-propyl or isopropyl), or butyl (e.g., n-butyl, isobutyl, sec-butyl, or tert-butyl). Unless otherwise defined, the term "alkyl" more preferably means C 1-4 Alkyl, more preferably methyl or ethyl, and even more preferably methyl. As used herein, the term “alkoxy” means “-O-(alkyl)” (wherein “alkyl” is as defined above).
[0171] As used herein, the term “haloalkyl” refers to an alkyl group substituted with one or more (preferably 1 to 6, more preferably 1 to 3) halogen atoms, independently selected from fluoro, chloro, bromo, and iodine, and preferably all being fluoro atoms. The maximum number of halogen atoms is limited by the number of available bonding sites and therefore depends on the number of carbon atoms in the alkyl portion of the haloalkyl group. “Haloalkyl” may refer to, for example, -CF3, -CHF2, -CH2F, -CF2-CH3, -CH2-CF3, -CH2-CHF2, -CH2-CF2-CH3, -CH2-CF2-CF3, or -CH(CF3)2. As used herein, the term “haloalkoxy” refers to “-O-haloalkyl” (wherein “haloalkyl” is as defined above).
[0172] As used herein, the term "heteroalkyl" means that one or two of the -CH2- groups are independently -O-, -S-, and -N(C) 1-6This refers to an alkyl group substituted with a group selected from alkyl-. Preferred examples include alkoxy groups such as methoxy.
[0173] As used herein, the term “alkenyl” refers to a monounsaturated acyclic hydrocarbon group that may be linear or branched and contains one or more (e.g., one or two) carbon-carbon double bonds but no carbon-carbon triple bonds. 2-6 "Alkenyl" means an alkenyl group having 2 to 6 carbon atoms. Preferred exemplary alkenyl groups are ethenyl, propenyl (e.g., propa-1-en-1-yl, propa-1-en-2-yl, or propa-2-en-1-yl), butenyl, butadienyl (e.g., buta-1,3-dien-yl or buta-1,3-dien-2-yl), pentenyl, or pentadienyl (e.g., isoprenyl). Unless otherwise defined, the term "alkenyl" preferably means C 2-6 Alkenil, more preferably C 2-4 This refers to Alkenil.
[0174] As used herein, the term "alkynyl" refers to a monounsaturated acyclic hydrocarbon group which may be linear or branched and comprises one or more (e.g., one or two) carbon-carbon triple bonds and optionally one or more carbon-carbon double bonds. 2-6 "Alkynyl" refers to an alkynyl group having 2 to 6 carbon atoms. Preferred exemplary alkynyl groups are ethynyl, propynyl, or butynyl. Unless otherwise defined, the term "alkynyl" preferably means C 2-6 Alkinyl, more preferably C 2-4 This refers to alkinyl.
[0175] As used herein, the term “aryl” refers to an aromatic hydrocarbon ring group that includes, in addition to monocyclic aromatic rings, a system of bridging rings and / or fused rings containing at least one aromatic ring (e.g., a ring system consisting of two or three fused rings in which at least one of the fused rings is aromatic, or a bridging ring system consisting of two or three rings in which at least one of the bridging rings is aromatic). “Aryl” may refer to, for example, phenyl, naphthyl, dialinyl (i.e., 1,2-dihydronaphthyl), tetralinyl (i.e., 1,2,3,4-tetrahydronaphthyl), anthracenyl, or phenantrenyl. Unless otherwise defined, “aryl” preferably has 6 to 14 ring atoms, more preferably 6 to 10 ring atoms, and most preferably phenyl. The term “bicyclic aryl” refers to an aromatic hydrocarbon ring group that preferably contains an anellated aromatic ring. “Bicyclic aryl” may refer to, for example, naphthyl. Unless otherwise defined, a "bicyclic aryl" preferably has 10 ring atoms.
[0176] As used herein, the term “heteroaryl” means an aromatic ring group that, in addition to a monocyclic aromatic ring, also includes a system of bridging rings and / or fused rings containing at least one aromatic ring (e.g., a ring system consisting of two or three fused rings in which at least one of the fused rings is aromatic, or a bridging ring system consisting of two or three rings in which at least one of the bridging rings is aromatic), comprising one or more (e.g., one, two, three, or four) ring heteroatoms independently selected from O, S, and N, the remaining ring atoms being carbon atoms, and one or more S ring atoms (if present) and / or one or more N ring atoms (if present) may be optionally oxidized, and furthermore, one or more carbocyclic atoms may be optionally oxidized (i.e., to form an oxo group). "Heteroaryls" include, for example, thienyl (i.e., thiophenyl), benzo[b]thienyl, naphtho[2,3-b]thienyl, thianthrenyl, furyl (i.e., furanyl), benzofuranyl, isobenzofuranyl, clomenyl, xanthenyl, phenoxathiinyl, pyrrolyl (e.g., 2H-pyrrolyl), imidazolyl, pyrazolyl, pyridyl (i.e., pyridinyl; e.g., 2-pyridyl, 3-pyridyl, or 4-pyridyl), pyrazinyl, pyrimidinyl, pyridadinyl, indolidinyl, isoindolyl, indolyl (e.g., 3H-indolyl), indazolyl, prinyl, isoquinolyl, quinolyl, phthalazinyl, naphthyridinyl, quinoxalinyl, cinolinyl, and pteridyl. This may refer to nyl, carbazolyl, β-carbolinyl, phenanthridinel, acridinyl, perimidinyl, phenanthrolinyl (e.g., [1,10]phenanthrolinyl, [1,7]phenanthrolinyl, or [4,7]phenanthrolinyl), phenazinyl, thiazolyl, isothiazolyl, phenothiazinyl, oxazolyl, isoxazolyl, flazanil, phenoxazinyl, pyrazolo[1,5-a]pyrimidinyl (e.g., pyrazolo[1,5-a]pyrimidine-3-yl), 1,2-benzoisoxazole-3-yl, benzothiazolyl, benzoxazolyl, benzisoxazolyl, benzimidazolyl, 1H-tetrazolyl, 2H-tetrazolyl, coumarinil, or chromonyl.Unless otherwise defined, “heteroaryl” preferably refers to a 5- to 14-membered (more preferably 5- to 10-membered) monocyclic or fused ring system comprising one or more (e.g., one, two, three, or four) ring heteroatoms independently selected from O, S, and N, wherein one or more S ring atoms (if present) and / or one or more N ring atoms (if present) may be optionally oxidized, and one or more carbocyclic atoms may be optionally oxidized; even more preferably, “heteroaryl” refers to a 5- or 6-membered monocyclic ring comprising one or more (e.g., one, two, or three) ring heteroatoms independently selected from O, S, and N, wherein one or more S ring atoms (if present) and / or one or more N ring atoms (if present) may be optionally oxidized, and one or more carbocyclic atoms may be optionally oxidized. A particularly preferred example of the term “heteroaryl” is pyridyl. The term “bicyclic heteroaryl” refers to an aromatic ring group containing two preferably anellated rings, one or both of which are aromatic. “Bicyclic heteroaryl” may refer to, for example, benzo[b]thienyl, benzofuranyl, isobenzofuranyl, clomenyl, indolidinyl, isoindolyl, indolyl (e.g., 3H-indolyl), indazolyl, prinyl, isoquinolyl, quinolyl, phthalazinyl, naphthilidinyl, quinoxalinyl, cinolinyl, 1,2-benzoisoxazole-3-yl, benzothiazolyl, benzoxazolyl, benzisoxazolyl, benzimidazolyl, coumalinyl, or chromolyl. Unless otherwise defined, “bicyclic heteroaryl” preferably has 8 to 12 ring atoms, more preferably 9 or 10 ring atoms.
[0177] Expressions such as "5-membered or 6-membered heterocyclic group" are understood to refer to a heterocyclic group having 5 or 6 atoms in the ring. Similarly, expressions such as "5- to 10-membered heteroaryl group" refer to a heteroaryl group having 5 to 10 atoms in one or two rings. Therefore, in the context of cyclic groups, "x-membered" indicates the number of ring atoms x in one or more rings, but does not imply any limitation regarding the number of acyclic atoms such as hydrogen that are normally present as substituents on the ring(s).
[0178] As used herein, the term “cycloalkyl” refers to a saturated hydrocarbon ring group that includes not only monocyclic rings but also systems of bridging rings, spiro rings, and / or fused rings (e.g., which may consist of two or three rings; e.g., fused ring systems consisting of two or three fused rings). “Cycloalkyl” may refer to, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, or adamantyl. Unless otherwise defined, “cycloalkyl” preferably refers to C 3-11 This refers to cycloalkyl groups, and more preferably C 3-8 This refers to cycloalkyl groups. Particularly preferred "cycloalkyl groups" are monocyclic saturated hydrocarbon rings having 3 to 8 ring members.
[0179] As used herein, the term “cycloheteroalkyl” (which may also be referred to as “heterocycloalkyl”) refers to a saturated ring group comprising not only monocyclic rings but also a system of bridging rings, spiro rings, and / or fused rings (e.g., a system of two or three rings; e.g., a system of two or three fused rings), wherein it contains one or more (e.g., one, two, three, or four) ring heteroatoms independently selected from O, S, and N, and the remaining ring atoms are carbon atoms, and one or more S ring atoms (if present) and / or one or more N ring atoms (if present) may be optionally oxidized, and furthermore, one or more carbocyclic atoms may be optionally oxidized (i.e., to form an oxo group). "Cycloheteroalkyl" may refer to, for example, oxetanyl, tetrahydrofuranil, piperidinyl, piperazinyl, azilidinyl, azetidinyl, pyrrolidinyl, imidazolidinyl, morpholinyl (e.g., morpholin-4-yl), pyrazolidinyl, tetrahydrothienyl, octahydroquinolinyl, octahydroisoquinolinyl, oxazolidinyl, isoxazolidinyl, azepanyl, diazepanyl, oxazepanyl, or 2-oxa-5-azabicyclo[2.2.1]hepta-5-yl. Unless otherwise defined, "cycloheteroalkyl" preferably refers to a 3- to 11-membered saturated ring group which is a monocyclic ring or a fused ring system (e.g., a fused ring system composed of two fused rings), containing one or more (e.g., one, two, three, or four) ring heteroatoms independently selected from O, S, and N, wherein one or more S ring atoms (if present) and / or one or more N ring atoms (if present) may be oxidized, and one or more carbocyclic atoms may be oxidized; more preferably, "cycloheteroalkyl" refers to a 5- to 8-membered saturated monocyclic ring group which contains one or more (e.g., one, two, or three) ring heteroatoms independently selected from O, S, and N, wherein one or more S ring atoms (if present) and / or one or more N ring atoms (if present) may be oxidized, and one or more carbocyclic atoms may be oxidized.
[0180] When used herein, terms such as "binding to at least one member of the E3 ligase complex" do not necessarily mean that the compound must directly bind to a portion of the E3 ligase. Rather, the compound may bind to a protein that is part of the E3 ligase complex or to a protein that interacts with the E3 ligase complex (optionally as part of the protein complex, either before or after the compound binds to the protein).
[0181] Those skilled in the art will understand that the substituents in the compounds of the present invention (in particular, those of formulas (I), (II), (III), (IV), and (V)) can be bonded to the remainder of each compound via a number of different positions of the corresponding specific substituent. Unless otherwise defined, preferred bonding positions of various specific substituents are as illustrated in the examples.
[0182] As used herein, unless otherwise explicitly specified or contextually inconsistent, the terms “a,” “an,” and “the” are used interchangeably with “one or more” and “at least one.” Therefore, for example, a composition comprising “a” of the present invention (in particular, of formulas (I), (II), (III), (IV), and (V)) can be interpreted as referring to a composition comprising “one or more” of the present invention.
[0183] As used herein, the term “comprising” (or “comprise,” “comprises,” “contain,” “contains,” or “containing”) means, in particular, “contains,” or “contains,” unless otherwise explicitly specified or contextually inconsistent. In addition, the term also includes the narrower meanings of “essentially consisting of” and “consisting of.” For example, the term “A containing B and C” means “A particularly containing B and C,” and A may contain any further elements (for example, “A containing B, C, and D” is also included), but the term also includes the meanings of “A essentially consisting of B and C” and “A consisting of B and C” (i.e., A does not contain any components other than B and C).
[0184] Furthermore, unless otherwise specified, any reference to industry standards, pharmacopoeias, or manufacturers' manuals refers to the most recent corresponding edition available on the priority date of this application (i.e., the earliest filing date).
[0185] The scope of the present invention includes, for example, compounds provided herein that can be formed by protonation of an atom having a protonable lone pair of electrons, such as an amino group, with an inorganic or organic acid, or as a salt of an acid group (such as a carboxylic acid group) with a physiologically acceptable cation, and in particular all pharmaceutically acceptable salt forms of the compounds of the present invention (especially those of formulas (I), (II), (III), (IV), and (V)). Examples of base addition salts include alkali metal salts such as sodium or potassium salts; alkaline earth metal salts such as calcium or magnesium salts; zinc salts; ammonium salts; aliphatic amine salts such as trimethylamine, triethylamine, dicyclohexylamine, ethanolamine, diethanolamine, triethanolamine, procaine salt, meglumine salt, ethylenediamine salt, or choline salt; aralkylamine salts such as N,N-dibenzylethylenediamine salt, benzathine salt, benetamine salt; heterocyclic aromatic amine salts such as pyridine salt, picoline salt, quinoline salt, or isoquinoline salt; quaternary ammonium salts such as tetramethylammonium salt, tetraethylammonium salt, benzyltrimethylammonium salt, benzyltriethylammonium salt, benzyltributylammonium salt, methyltrioctylammonium salt, or tetrabutylammonium salt; and basic amino acid salts such as arginine salt, lysine salt, or histidine salt.Exemplary acid addition salts include, for example, mineral salts such as hydrochloride, hydrobromide, hydroiodide, sulfate (e.g., sulfate or hydrogen sulfate), nitrate, phosphate (e.g., phosphate, hydrogen phosphate, or dihydrogen phosphate), carbonate, bicarbonate, perchlorate, borate, or thiocyanate; acetate, propionate, butyrate, pentane, hexanoate, heptaneate, octane, cyclopentanepropionate, decanoate, undecanoate, oleate, stearate, lactate, maleate, oxalate, fumarate, tartrate, malate, citrate, succinate, adipine, gluconate, and glycerides. This includes organic salts such as cholate, nicotinate, benzoate, salicylate, ascorbate, pamoate (embonate), camphorate, glucoheptanoate, or pivalate; sulfonates such as methanesulfonate (mesylate), ethanesulfonate (esylate), 2-hydroxyethanesulfonate (isethionate), benzenesulfonate (besilate), p-toluenesulfonate (tosylate), 2-naphthalenesulfonate (napsylate), 3-phenylsulfonate, or camphorsulfonate; glycerophosphate; and acidic amino acid salts such as aspartate or glutamate.
[0186] Furthermore, the scope of the present invention includes, for example, the compounds provided herein in any solvate form, including solvates with water (i.e., as hydrates), or solvates with organic solvents such as methanol, ethanol, or acetonitrile (i.e., as methanol, ethanol, or acetonitrile), or any crystalline form (i.e., as any polymorph), or any amorphous form, in particular the compounds of the present invention (especially those of formulas (I), (II), (III), (IV), and (V)). It is understood that such solvates of the compounds provided herein, in particular the compounds of the present invention, also include solvates of pharmaceutically acceptable salts of the corresponding compounds.
[0187] Furthermore, the compounds provided herein, in particular the compounds of formulas (I), (II), (III), (IV), and (V), may exist in the form of different isomers, in particular stereoisomers (e.g., geometric isomers (or cis / trans isomers), enantiomers, and diastereomers) or tautomers. All such isomers of the compounds provided herein are intended to be part of the present invention, either in mixed form or in pure or substantially pure form. With respect to stereoisomers, the present invention encompasses separated optical isomers of the compounds according to the present invention and any mixture thereof (in particular, including racemic mixtures / racemates). Racemates can be separated by physical methods, for example, fractional crystallization, separation or crystallization of diastereomer derivatives, or separation by chiral column chromatography. Alternatively, individual optical isomers can be obtained from racemates by forming salts with optically active acids and subsequently crystallizing them. The present invention further encompasses any tautomers of the compounds provided herein.
[0188] The scope of the present invention also includes compounds provided herein in which one or more atoms are substituted with specific isotopes of the corresponding atoms, in particular the compounds of formulas (I), (II), (III), (IV), and (V). For example, the present invention includes compounds in which one or more hydrogen atoms (or, for example, all hydrogen atoms) are substituted with deuterium atoms (i.e., 2 This invention includes compounds of formulas (I), (II), (III), (IV), and (V) substituted with H (also referred to as "D"). Therefore, the present invention also includes compounds of formulas (I), (II), (III), (IV), and (V) that are concentrated with deuterium. Naturally occurring hydrogen is approximately 99.98 mol% hydrogen-1(1 H ) and approximately 0.0156 mol% deuterium (2 Hor isotope mixture containing D). The deuterium content at one or more hydrogen positions of the compounds of formulas (I), (II), (III), (IV), and (V) can be increased using deuterating techniques known in the art. For example, the compounds of formulas (I), (II), (III), (IV), and (V), or reactants or precursors used in the synthesis of the compounds of formulas (I), (II), (III), (IV), and (V), may be subjected to an H / D exchange reaction using heavy water (D2O), for example. For more suitable deuteration techniques, see: Atzrodt J et al., Bioorg Med Chem, 20(18), 5658-5667, 2012; William JS et al., Journal of Labelled Compounds and Radiopharmaceuticals, 53(11-12), 635-644, 2010; or Modvig A et al., J Org Chem, 79, 5861-5868, 2014. The deuterium content can be determined, for example, by mass spectrometry or NMR spectroscopy. Unless otherwise specifically specified, it is preferable that compounds of formulas (I), (II), (III), (IV), and (V) are not concentrated with deuterium. Therefore, compounds of formulas (I), (II), (III), (IV), and (V) contain naturally occurring hydrogen atoms or 1 The presence of hydrogen atoms (H) is preferable.
[0189] The present invention also relates to compounds provided herein, in particular, in which one or more atoms are, for example 18 F, 11 C, 13 N, 15 O, 76 Br, 77 Br, 120 I, and / or 124The present invention also includes compounds of formulas (I), (II), (III), (IV), and (V) in which the corresponding atoms are substituted with positron-emitting isotopes such as I. Such compounds can be used as tracers or imaging probes in positron emission tomography (PET). Thus, the present invention includes (i) one or more fluorine atoms (or, for example, all fluorine atoms) 18 Compounds of formulas (I), (II), (III), (IV), and (V) in which fluorine atoms are substituted, (ii) one or more carbon atoms (or, for example, all carbon atoms) 11 Compounds of formulas (I), (II), (III), (IV), and (V) that are substituted with C atoms, (iii) one or more nitrogen atoms (or, for example, all nitrogen atoms) 13 Compounds of formulas (I), (II), (III), (IV), and (V) that are substituted with N atoms, (iv) one or more oxygen atoms (or, for example, all oxygen atoms) 15 Compounds of formulas (I), (II), (III), (IV), and (V) that are substituted with an O atom, (v) one or more bromine atoms (or, for example, all bromine atoms) 76 Compounds of formulas (I), (II), (III), (IV), and (V) substituted with Br atoms, (vi) one or more bromine atoms (or, for example, all bromine atoms) 77 Compounds of formulas (I), (II), (III), (IV), and (V) substituted with Br atoms, (vii) one or more iodine atoms (or, for example, all iodine atoms) 120 Compounds of formulas (I), (II), (III), (IV), and (V) in which one or more iodine atoms (or, for example, all iodine atoms) 124 This includes compounds of formulas (I), (II), (III), (IV), and (v) that are substituted with an I atom. In general, it is preferable that none of the atoms in the compounds of formulas (I), (II), (III), (IV), and (V) are substituted with a specific isotope.
[0190] The compounds provided herein, in particular the pharmaceutically acceptable prodrugs of the compounds of formulas (I), (II), (III), (IV), and (V), are derivatives having chemically or metabolically cleavable groups and which, by solvation or under physiological conditions, become pharmaceutically active compounds of the present invention in vivo. Prodrugs of the compounds according to the present invention can be formed by conventional methods using, for example, functional groups of the compound such as amino groups, hydroxyl groups, or carboxyl groups. The form of the prodrug often provides advantages in terms of solubility, histocompatibility, or delayed release in mammalian organisms (see Bundgaard, H., Design of Prodrugs, pp. 7-9, 21-24, Elsevier, Amsterdam 1985). Prodrugs include acid derivatives, such as esters prepared by the reaction of a hydrophilic compound with a suitable alcohol or amides prepared by the reaction of a hydrophilic compound with a suitable amine. When the compound of the present invention has a carboxyl group, ester derivatives prepared by reacting the carboxyl group with a suitable alcohol or amide derivatives prepared by reacting the carboxyl group with a suitable amine are exemplified as prodrugs. Particularly preferred ester derivatives as prodrugs are methyl esters, ethyl esters, n-propyl esters, isopropyl esters, n-butyl esters, isobutyl esters, tert-butyl esters, morpholinoethyl esters, N,N-diethyl glycolamide esters, or α-acetoxyethyl esters. When the compound of the present invention has a hydroxyl group, acyloxy derivatives prepared by reacting the hydroxyl group with a suitable acyl halogen or a suitable acid anhydride are exemplified as prodrugs. Particularly preferred acyloxy derivatives as prodrugs are -OC(=O)-CH3, -OC(=O)-C2H5, -OC(=O)-(tert-Bu), and -OC(=O)-C 15 H 31These are -OC(=O)-(m-COONa-Ph), -OC(=O)-CH2CH2COONa, -O(C=O)-CH(NH2)CH3, or -OC(=O)-CH2-N(CH3)2. When the compound of the present invention has an amino group, amide derivatives prepared by reacting the amino group with a suitable acid halide or a suitable mixed anhydride are exemplified as prodrugs. Particularly preferred amide derivatives as prodrugs are -NHC(=O)-(CH2)2OCH3 or -NHC(=O)-CH(NH2)CH3.
[0191] In particular, the compounds provided herein, including compounds of formulas (I), (II), (III), (IV), and (V), may be administered as compounds themselves or formulated as pharmaceuticals. The pharmaceuticals / pharmaceutical compositions may optionally contain one or more pharmaceutically acceptable excipients, such as carriers, diluents, fillers, disintegrants, lubricants, binders, colorants, pigments, stabilizers, preservatives, antioxidants, and / or solubility enhancers.
[0192] The pharmaceutical composition contains one or more solubility enhancers, for example, poly(ethylene glycol) (e.g., PEG200, PEG300, PEG400, or PEG600) having a molecular weight in the range of about 200 to about 5000 Da, ethylene glycol, propylene glycol, glycerol, nonionic surfactant, tyroxapole, polysorbate 80, macrogol-15-hydroxystearoyl (e.g., Kolliphor® HS15, CAS70142-34-6), phospholipids, lecithin, dimyristoyl phosphatidylcholine, dipalmitoyl phosphatidylcholine, distearoyl phosphatidylcholine, cyclodextrin, α-cyclodextrin, β-cyclodextrin, γ-cyclodextrin, hydroxyethyl-β-cyclodextrin, hydroxypropyl-β-cyclodextrin, hydroxyethyl-γ-cyclodextrin, hydroxyethyl This may include droxypropyl-γ-cyclodextrin, dihydroxypropyl-β-cyclodextrin, sulfobutyl ether-β-cyclodextrin, sulfobutyl ether-γ-cyclodextrin, glucosyl-α-cyclodextrin, glucosyl-β-cyclodextrin, diglucosyl-β-cyclodextrin, maltosyl-α-cyclodextrin, maltosyl-β-cyclodextrin, maltosyl-γ-cyclodextrin, maltotriosyl-β-cyclodextrin, maltotriosyl-γ-cyclodextrin, dimaltosyl-β-cyclodextrin, methyl-β-cyclodextrin, carboxyalkyl thioether, hydroxypropyl methylcellulose, hydroxypropylcellulose, polyvinylpyrrolidone, vinyl acetate copolymer, vinylpyrrolidone, sodium lauryl sulfate, sodium dioctyl sulfosuccinate, or any combination thereof.
[0193] The pharmaceutical composition is based on techniques known to those skilled in the art, for example, “Remington: The Science and Practice of Pharmacy”, Pharmaceutical Press, 22 ndPharmaceutical compositions can be formulated using the technologies published in this edition. The pharmaceutical compositions can be formulated as dosage forms for oral, parenteral administration, such as intramuscular, intravenous, subcutaneous, intradermal, intraarterial, intracardiac, rectal, intranasal, topical, aerosol, or vaginal administration. Oral dosage forms include coated and uncoated tablets, soft gelatin capsules, hard gelatin capsules, lozenges, troches, liquids, emulsions, suspensions, syrups, elixirs, reconstituted powders and granules, dispersible powders and granules, medicinal gums, chewing tablets, and effervescent tablets. Parenteral dosage forms include liquids, emulsions, suspensions, dispersants, and reconstituted powders and granules. Emulsions are a preferred dosage form for parenteral administration. Rectal and vaginal dosage forms include suppositories and ovula. Dosage forms for intranasal administration can be administered, for example, by inhalation and blowing using a metered-dose inhaler. Dosage forms for topical administration include creams, gels, ointments, patches, and transdermal delivery systems.
[0194] The compounds provided herein, in particular the compounds of formulas (I), (II), (III), (IV), and (V), or the pharmaceutical compositions comprising such compounds, may be administered to a subject by any convenient route, whether systemic / peripheral or to the desired site of action, orally (e.g., as tablets, capsules, or ingestible liquids), topically (e.g., transdermally, intranasally, intraocularly, buccally, and sublingually), parenterally (e.g., using injection or infusion techniques, and, for example) This includes, but is not limited to, one or more of the following methods of administration: subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subepidermal, intraarticular, subarachnoid, or intrasternal injection (including, for example, implantation of a depot subcutaneously or intramuscularly), lung (e.g., through the mouth or nose, e.g., inhalation or inhalation therapy using aerosols), gastrointestinal, intrauterine, intraocular, subcutaneous, ocular (including intraorbital or anterior chamber), rectal, or vaginal administration.
[0195] When the compound or pharmaceutical composition is administered parenterally, examples of such administration include administering the compound or pharmaceutical composition intravenously, intra-arterially, intraperitoneally, intrathecally, intraventricularly, intraurethrally, intrasternally, intracardiacly, intracranially, intramuscularly, or subcutaneously, and / or by the use of infusion techniques. In the case of parenteral administration, the compound is best used in the form of a sterile aqueous solution that can contain other substances, such as salts or glucose sufficient to make the solution isotonic with blood. The aqueous solution must be preferably buffered (preferably to pH 3-9) as needed. The preparation of suitable parenteral formulations under sterile conditions is readily achieved by standard pharmaceutical techniques well known to those skilled in the art.
[0196] Furthermore, the compound or pharmaceutical composition may be administered orally in the form of tablets, capsules, ovules, elixirs, liquids, or suspensions, which may contain flavoring agents or coloring agents, for immediate release, delayed release, regulated release, sustained release, pulsed release, or controlled release applications.
[0197] The tablets may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate, and glycine; disintegrants such as starch (preferably corn, potato, or tapioca starch), sodium starch glycolate, croscarmellose sodium, and certain complex silicates; and granulating binders such as polyvinylpyrrolidone, hydroxypropyl methylcellulose (HPMC), hydroxypropylcellulose (HPC), sucrose, gelatin, and acacia. Furthermore, lubricants such as magnesium stearate, stearic acid, glyceryl behenate, and talc may be included. Similar types of solid compositions may be used as fillers in gelatin capsules. Preferred excipients in this regard include lactose, starch, cellulose, or high molecular weight polyethylene glycol. In the case of aqueous suspensions and / or elixirs, the agent may be combined with various sweeteners or flavorings, colorants or dyes, emulsifiers and / or suspending agents, and diluents such as water, ethanol, propylene glycol, and glycerin, as well as combinations thereof.
[0198] Alternatively, the compound or pharmaceutical composition may be administered in the form of a suppository or vaginal suppository, or applied topically in the form of a gel, hydrogel, lotion, solution, cream, ointment, or powder. Furthermore, the compounds of the present invention may be administered skin-borne or transdermally, for example, by using a skin patch.
[0199] The compound or pharmaceutical composition may also be administered by a sustained-release system. Preferred examples of sustained-release compositions include semipermeable polymer matrices in the form of molded articles, such as films or microcapsules. The sustained-release matrix includes, for example, polylactide (see, e.g., US3,773,919), copolymer of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman, U. et al., Biopolymers 22:547-556 (1983)), poly(2-hydroxyethyl methacrylate) (R. Langer et al., J. Biomed.Mater.Res.15:167-277 (1981) and R. Langer, Chem. Tech. 12:98-105 (1982)), ethylene vinyl acetate (R. Langer et al., Id.), or poly-D-(-)-3-hydroxybutyric acid (EP133988). The sustained-release pharmaceutical composition also includes compounds encapsulated in liposomes. Liposomes containing the compounds of the present invention can be prepared by methods known in the art, for example, by any one of the following: DE3218121; Epstein et al., Proc. Natl. Acad. Sci. (USA) 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci. (USA) 77:4030-4034 (1980); EP0052322; EP0036676; EP088046; EP0143949; EP0142641; JP 83-118008; US4,485,045; US4,544,545; and EP0102324.
[0200] The compound or pharmaceutical composition may be administered via the pulmonary, rectal, or ocular routes. For ophthalmic use, the compound or pharmaceutical composition may be formulated as a finely powdered suspension in isotonic, pH-adjusted sterile saline solution, or preferably, optionally combined with a preservative such as benzylalkonium chloride, in an isotonic, pH-adjusted sterile saline solution. Alternatively, these may be formulated as ointments such as petrolatum.
[0201] Furthermore, it is conceivable that dried powder formulations of the compounds provided herein, particularly those of formulas (I), (II), (III), (IV), and (V), may be prepared for pulmonary administration, especially inhalation. Such dried powders may be prepared by spray drying under conditions that yield substantially amorphous, glassy, or substantially crystalline bioactive powders. Thus, dried powders of the compounds of the present invention can be prepared according to the emulsification / spray drying processes disclosed in WO99 / 16419 or WO01 / 85136. Spray drying of solution formulations of the compounds of the present invention can be carried out as generally described, for example, in “Spray Drying Handbook”, 5th ed., K. Masters, John Wiley & Sons, Inc., NY (1991), WO97 / 41833, or WO03 / 053411.
[0202] When applied topically to the skin, the compound or pharmaceutical composition may be formulated as a suitable ointment containing the active compound suspended or dissolved in a mixture of, for example, mineral oil, liquid petrolatum, white petrolatum, propylene glycol, emulsifying wax, and water. Alternatively, it may be formulated as a suitable lotion or cream suspended or dissolved in a mixture of, for example, mineral oil, sorbitan monostearate, polyethylene glycol, liquid paraffin, polysorbate 60, cetyl ester wax, 2-octyldodecanol, benzyl alcohol, and water.
[0203] Accordingly, the present invention relates to compounds or pharmaceutical compositions provided herein, wherein the corresponding compound or pharmaceutical composition is administered by any one of the following routes: oral route; local route including transdermal, intranasal, intraocular, buccal, or sublingual route; parenteral route using injection or infusion technique, including subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intravesical, subcapsular, intracapsular, intraorbital, intraperitoneal, intratracheal, subcutaneous, intraarticular, subarachnoid, intrasternal, intraventricular, urethral, or intracranial route; pulmonary route including inhalation or inhalation therapy; gastrointestinal route; intrauterine route; intraocular route; subcutaneous route; ocular route including intravitreous or anterior chamber route; rectal route; or vaginal route. Particularly preferred routes of administration are oral or parenteral administration.
[0204] Typically, a physician determines the most appropriate actual dosage for each individual patient. The specific dose level and frequency of administration for any particular individual patient can vary and depend on a variety of factors, including the activity of the particular compound employed, its metabolic stability and duration of action, age, weight, overall health, sex, diet, mode and timing of administration, elimination rate, drug combinations, severity of the particular condition, and the individual patient receiving treatment.
[0205] The proposed but non-limiting doses of the compounds according to the present invention for oral administration to humans (weighing approximately 70 kg) may be 0.05 to 8000 mg, preferably 0.1 mg to 4000 mg, of the active ingredient per unit dose. The unit dose may be administered, for example, once to three times a day. Alternatively, the unit dose may be administered once to seven times a week, for example, once a day or less. Further exemplary doses of the compounds of formulas (I), (II), (III), (IV), and (V) for oral administration to humans are 50 to 200 mg / kg body weight / day, particularly 100 mg / kg / day. It is understood that it may be necessary to routinely change the dosage depending on the age and weight of the patient / subject and the severity of the condition being treated. The exact dosage and route of administration are ultimately left to the discretion of the attending physician or veterinarian.
[0206] The compounds provided herein, in particular the compounds of formulas (I), (II), (III), (IV), and (V), or pharmaceutical compositions containing such compounds, may be administered as monotherapy (for example, without the simultaneous administration of any further treatment agents, or without the simultaneous administration of any further treatment agents for the same disease treated or prevented by the compounds of formulas (I), (II), (III), (IV), and (V)). However, the compounds of formulas (I), (II), (III), (IV), and (V), or pharmaceutical compositions containing the compounds of formulas (I), (II), (III), (IV), and (V), may be administered in combination with one or more further treatment agents. When the compounds of formulas (I), (II), (III), (IV), and (V) are used in combination with a second treatment agent active for the same disease or condition, the dose of each compound may differ from that when the corresponding compound is used alone, and in particular, lower doses of each compound may be used. The combination of compounds of formulas (I), (II), (III), (IV), and (V) with one or more further treatment agents (e.g., BRD4 inhibitors, preferably direct BRD4 inhibitors) may include simultaneous / combined administration of compounds of formulas (I), (II), (III), (IV), and (V) with one or more further treatment agents (in a single pharmaceutical formulation or in separate pharmaceutical formulations) or sequential / separate administration of compounds of formulas (I), (II), (III), (IV), and (V) with one or more further treatment agents. In the case of sequential administration, any of the compounds of formulas (I), (II), (III), (IV), and (V) or one or more further treatment agents according to the present invention may be administered first. In the case of simultaneous administration, one or more further treatment agents may be contained in the same pharmaceutical formulation as compounds of formulas (I), (II), (III), (IV), and (V), or they may be administered in one or more different (separate) pharmaceutical formulations.
[0207] Preferably, one or more further treatment agents administered in combination with the compound of the present invention are anticancer drugs. The anticancer agents (one or more) administered in combination with compounds of formulas (I), (II), (III), (IV), and (V) according to the present invention include, for example, tumor angiogenesis inhibitors (e.g., protease inhibitors, epidermal growth factor receptor kinase inhibitors, or vascular endothelial growth factor receptor kinase inhibitors); cytotoxic agents (e.g., antimetabolites such as purine and pyrimidine analogs); mitotic inhibitors (e.g., microtubule stabilizers or mitotic inhibitor alkaloids); platinum coordination complexes; antitumor antibiotics; alkylating agents (e.g., nitrogen mustard or nitrosourea); endocrine agents (e.g., corticosteroids, androgens, antiandrogens, estrogens, antiestrogens, aromatase inhibitors, gonadotropin-releasing hormone agonists, or somatostatin analogs); or compounds that target enzymes or receptors that are overexpressed and / or otherwise involved in specific metabolic pathways that are misregulated in tumor cells (e.g., The following may be selected: ATP and GTP phosphodiesterase inhibitors, histone deacetylase inhibitors, protein kinase inhibitors (serine, threonine, and tyrosine kinase inhibitors, e.g., Abelson protein tyrosine kinase inhibitors), and various growth factors, their receptors, and corresponding kinase inhibitors (e.g., epidermal growth factor receptor kinase inhibitors, vascular endothelial growth factor receptor kinase inhibitors, fibroblast growth factor inhibitors, insulin-like growth factor receptor inhibitors, and platelet-derived growth factor receptor kinase inhibitors); methionine, aminopeptidase inhibitors, proteasome inhibitors, cyclooxygenase inhibitors (e.g., cyclooxygenase-1 or cyclooxygenase-2 inhibitors), topoisomerase inhibitors (e.g., topoisomerase I inhibitors or topoisomerase II inhibitors), poly-ADP-ribose polymerase inhibitors (PARP inhibitors), and epidermal growth factor receptor (EGFR) inhibitors / antagonists.
[0208] Alkylating agents that can be used as anticancer drugs in combination with the compounds of the present invention include, for example, nitrogen mustard (cyclophosphamide, mechloretamine (chlormethine), uramustine, melphalan, chlorambucil, ifosfamide, bendamustine, or trophosfamide, etc.), nitrosourea (carmustine, streptozocin, fotemustine, lomustine, nimustine, prednimustine, ranimustine, or semustine, etc.), alkyl sulfonates (busulfan, mannosulfan, or treosulfan, etc.), aziridines (hexamethylmelamine (altretamine), triethylenemelamine, thioTEPA (N,N'N'-triethylenethiophosphoramide), carbocon, or triadicone, etc.), hydrazines (procarbazine, etc.), triazeneses (dacarbazine, etc.), or imidazotetrazine (temozolomide, etc.).
[0209] Platinum coordination complexes that can be used as anticancer drugs in combination with the compounds of the present invention may be, for example, cisplatin, carboplatin, nedaplatin, oxaliplatin, satraplatin, or triplatin tetranitrate.
[0210] Cytotoxic agents that can be used as anticancer drugs in combination with the compounds of the present invention may include, for example, folate analog antimetabolites (such as aminopterin, methotrexate, pemetrexed, or larcitrexed), purine analog antimetabolites (such as cladribine, clofarabine, fludarabine, 6-mercaptopurine (including its prodrug form azathioprine), pentostatin, or 6-thioguanine), and pyrimidine analog antimetabolites (such as cytarabine, decitabine, 5-fluorouracil (including its prodrug forms capecitabine and tegafur), phloxuridine, gemcitabine, enocitabine, or sapacitabine).
[0211] Mitotic inhibitors that can be used as anticancer drugs in combination with the compounds of the present invention may include, for example, taxanes (docetaxel, larotaxel, ortataxel, paclitaxel / taxol, tesetaxel, or nab-paclitaxel (e.g., Abraxane®)), vinca alkaloids (vinblastine, vincristine, vinflunin, vindesine, or vinorelbine), epotilones (epotilone A, epotilone B, epotilone C, epotilone D, epotilone E, or epotilone F), or epotilone B analogs (ixabepylone / azaepotilone B).
[0212] Antitumor antibiotics that can be used as anticancer drugs in combination with the compounds of the present invention may include, for example, anthracyclines (e.g., acralubicin, daunorubicin, doxorubicin, epirubicin, idarubicin, amrubicin, pirarubicin, barrubicin, or zolubicin), anthracendions (e.g., mitoxantrone or pixantrone), or antitumor antibiotics isolated from the genus Streptomyces (e.g., actinomycin (including actinomycin D), bleomycin, mitomycin (including mitomycin C), or plicamycin).
[0213] Examples of tyrosine kinase inhibitors that can be used as anticancer drugs in combination with the compounds of the present invention include axitinib, bosutinib, cediranib, dasatinib, erlotinib, gefitinib, imatinib, lapatinib, restaurtinib, nilotinib, semaxanib, sorafenib, sunitinib, axitinib, nintedanib, ponatinib, or vandetanib.
[0214] Topoisomerase inhibitors that can be used as anticancer drugs in combination with the compounds of the present invention may be, for example, topoisomerase I inhibitors (irinotecan, topotecan, camptothecin, berotecan, rubitecan, or lamellarin D, etc.) or topoisomerase II inhibitors (amsacrin, etoposide, etoposide phosphate, teniposide, or doxorubicin, etc.).
[0215] PARP inhibitors that can be used as anticancer drugs in combination with the compounds of the present invention may be, for example, BMN-673, olaparib, lucaparib, veliparib, CEP 9722, MK 4827, BGB-290, or 3-aminobenzamide.
[0216] EGFR inhibitors / antagonists that can be used as anticancer drugs in combination with the compounds of the present invention may include, for example, gefitinib, erlotinib, lapatinib, afatinib, neratinib, ABT-414, dacomitinib, AV-412, PD 153035, vandetanib, PKI-166, peritinib, canertinib, icotinib, poziotinib, BMS-690514, CUDC-101, AP26113, XL647, cetuximab, panitumab, zaltumumab, nimotuzumab, or matuzumab.
[0217] Furthermore, additional anticancer drugs may be used in combination with the compounds of the present invention. Anticancer drugs include TNF-related apoptosis-inducing ligand (TRAIL), tamoxifen, amsacrin, bexarotene, estramustine, ilofluben, trabectedin, cetuximab, panitumumab, tocitumomab, alemtuzumab, bevacizumab, edecolomab, gemtuzumab, arbocidib, sericiclib, aminolevulinic acid, methyl aminolevulinic acid, efapoxial, porfimer sodium, talaporfin, temoporfin, verteporfin, alitretinoin, It may contain biological or chemical molecules such as tretinoin, anagrelide, arsenic trioxide, atracentane, bortezomib, carmofur, celecoxib, demecoltin, elethcromol, erusamitrusine, etogluside, ronidamine, lucanton, masopropyl, mitobronitol, mitogluzone, mitotane, oblimersen, omasetaxin, citimazine, seladenovec, tegafur, testactone, thiazofrine, tipifarnib, vorinostat, or iniparib.
[0218] Furthermore, biological agents such as antibodies, antibody fragments, antibody constructs (e.g., single-chain constructs), and / or modified antibodies (such as CDR-grafted antibodies, humanized antibodies, or "fully humanized" antibodies) against cancer or tumor markers / factors / cytokines involved in proliferative disorders can also be used in combination therapy approaches using the compounds of the present invention. Examples of such biological molecules include anti-HER2 antibodies (e.g., trastuzumab, Herceptin®), anti-CD20 antibodies (e.g., rituximab, Rituxan®, MabThera®, Reddux®), anti-CD19 / CD3 constructs (e.g., see EP1071752), and anti-TNF antibodies (e.g., see Taylor PC. Antibody therapy for rheumatoid arthritis. Curr Opin Pharmacol. 2003.3(3):323-328). Further antibodies, antibody fragments, antibody constructs, and / or modified antibodies used in combination therapy approaches using the compounds of the present invention can be found, for example, in Taylor PC. Curr Opin Pharmacol. 2003.3(3):323-328; or Roxana A. Maedica. 2006.1(1):63-65.
[0219] Anticancer drugs that can be used in combination with the compounds of the present invention may, in particular, be cancer immunotherapy agents (e.g., antibodies (e.g., monoclonal antibodies or polyclonal antibodies), antibody fragments, antibody constructs (e.g., single-chain constructs), or modified antibodies targeting any one of CTLA-4, PD-1 / PD-L1, TIM3, LAG3, OX4, CSF1R, IDO, or CD40 (e.g., CDR grafted antibodies, humanized antibodies, or "fully humanized" antibodies). Such cancer immunotherapy agents may, for example, be anti-CTLA-4 antibodies (especially antagonistic or pathway-blocking anti-CTLA-4 antibodies; e.g., ipilimumab or tremelimumab), anti-PD-1 antibodies (especially antagonistic or pathway-blocking anti-PD-1 antibodies; e.g., nivolumab (BMS-936558), pembrolizumab (MK-3475), pizilizu Mab (CT-011, AMP-224, or APE02058), anti-PD-L1 antibodies (especially pathway-blocking anti-PD-L1 antibodies; e.g., BMS-936559, MEDI4736, MPDL3280A (RG7446), MDX-1105, or MEDI6469), anti-TIM3 antibodies (especially pathway-blocking anti-TIM3 antibodies), anti-LAG3 antibodies (especially antagonistic or pathway-blocking anti-LAG3 antibodies; e.g. The formulation includes, for example, BMS-986016, IMP701, or IMP731), an anti-OX4 antibody (especially an antagonistic anti-OX4 antibody; e.g., MEDI0562), an anti-CSF1R antibody (especially a pathway-blocking anti-CSF1R antibody; e.g., IMC-CS4 or RG7155), an anti-IDO antibody (especially a pathway-blocking anti-IDO antibody), or an anti-CD40 antibody (especially an agonist anti-CD40 antibody; e.g., CP-870, 893, or Chi Lob 7 / 4).Further cancer immunotherapies are known in the art and are described, for example, Kyi C et al., FEBS Lett, 2014, 588(2):368-76; Intlekofer AM et al., J Leukoc Biol, 2013, 94(1):25-39; Callahan MK et al., J Leukoc Biol, 2013, 94(1):41-53; Ngiow SF et al., Cancer Res, 2011, 71(21):6567-71; and Blattman JN et al., Science, 2004, 305(5681):200-5.
[0220] Furthermore, BRD4 inhibitors such as CeMMEC2 (preferably direct BRD4 inhibitors) can be used as additional treatment agents in combination with compounds of formulas (I), (II), (III), (IV), and (V).
[0221] The combinations mentioned above can, conveniently, be presented for use in the form of pharmaceutical formulations. The individual components of such combinations may be administered sequentially or simultaneously / in combination in separate or combined pharmaceutical formulations via any convenient route. In the case of sequential administration, either the compounds of the present invention (in particular, compounds of formulas (I), (II), (III), (IV), and (V) or their pharmaceutically acceptable salts, solvates, or prodrugs) or further treatment agents (one or more) may be administered first. In the case of simultaneous administration, the combinations may be administered in the same pharmaceutical composition or in different pharmaceutical compositions. When combined in the same formulation, it is understood that the two or more compounds must be stable and compatible with each other and with other components of the formulation. When formulated separately, they can be provided in any convenient formulation.
[0222] The compounds provided herein, in particular the compounds of formulas (I), (II), (III), (IV), and (V), can also be administered in combination with physical therapies such as radiotherapy. Radiotherapy may be initiated before, after, or concurrently with the administration of the compounds of the present invention. For example, radiotherapy may be initiated 1 to 10 minutes, 1 to 10 hours, or 24 to 72 hours after the administration of the compounds. However, these timeframes are not to be construed as limiting. The subject is exposed to radiation, preferably gamma rays, and therefore the radiation may be delivered as a single dose or as multiple doses over several hours, several days, and / or several weeks. Gamma rays may be delivered according to standard radiotherapy protocols using standard doses and regimens.
[0223] Accordingly, the present invention relates to a pharmaceutical composition comprising any of the aforementioned entities, in combination with a pharmaceutically acceptable salt, solvate, or prodrug thereof, or in combination with a pharmaceutically acceptable excipient, for use in the treatment or prevention of cancer, administered in combination with one or more anticancer drugs and / or in combination with radiotherapy.
[0224] However, the compounds of formulas (I), (II), (III), (IV), and (V) can also be used in monotherapy, particularly in the treatment or prevention of cancer by monotherapy (i.e., no other anticancer agents are administered until treatment with one or more of the compounds of formulas (I), (II), (III), (IV), and (V) is completed). Accordingly, the present invention also relates to a pharmaceutical composition comprising any of the aforementioned entities, either the compounds of formulas (I), (II), (III), (IV), and (V) or their pharmaceutically acceptable salts, solvates, or prodrugs, or in combination with pharmaceutically acceptable excipients, for use in the treatment or prevention of cancer by monotherapy.
[0225] The subjects or patients treated according to the present invention may be animals (e.g., non-human animals), vertebrates, mammals, rodents (e.g., guinea pigs, hamsters, rats, or mice), dogs (e.g., dogs), cats (e.g., cats), pigs (e.g., pigs), horses (e.g., horses), primates or monkeys (e.g., marmosets, baboons, gorillas, chimpanzees, orangutans, or monkeys or apes such as gibbons), or humans. According to the present invention, it is envisioned that animals of economic, agricultural, or scientific importance will be treated. Scientifically important organisms include, but are not limited to, mice, rats, and rabbits. Lower organisms such as fruit flies (Drosophila melagonaster) and nematodes (Caenorhabditis elegans) may also be used in the scientific approach. Non-limiting examples of animals of agricultural importance include sheep, cattle, and pigs, while cats and dogs, for example, may be considered economically important animals. Preferably, the subject / patient is a mammal. More preferably, the subject / patient is a human or a non-human mammal (e.g., guinea pig, hamster, rat, mouse, rabbit, dog, cat, horse, monkey, ape, marmoset, baboon, gorilla, chimpanzee, orangutan, gibbon, sheep, cattle, or pig). Most preferably, the subject / patient is a human.
[0226] When used herein, the term “prevention” of a disorder or disease (e.g., “prevention” of cancer) is also well known in the art. For example, a patient / subject suspected of being susceptible to a disorder or disease may particularly benefit from the prevention of that disorder or disease. A subject / patient may have susceptibility or predisposition to a disorder or disease, including but not limited to hereditary predispositions. Such predispositions can be determined by standard methods or assays, for example, using genetic markers or phenotypic indicators. It is understood that the disorder or disease to be prevented according to the present invention has never been diagnosed or cannot be diagnosed in the patient / subject (e.g., the patient / subject does not exhibit any clinical or pathological symptoms). Therefore, the term “prevention” includes using the compounds of the present invention before any clinical and / or pathological symptoms are diagnosed or determined, or before they can be diagnosed or determined by the attending physician.
[0227] It is understood that the present invention preferably does not relate to any compound that is generally defined by the Marquardsch formulas described in EP 19 20 3702.6, EP 20 17 8833.8, EP 19 20 3697.8, and EP 20 17 8838.7, or any specific compound. In particular, the present invention preferably does not relate to any compound defined by formulas (I) and (II) in EP 19 20 3702.6 and EP 20 17 8833.8, or any compound defined by formula (I) in EP 19 20 3697.8 and EP 20 17 8838.7.
[0228] It is understood that the present invention specifically relates to each and all combinations of the features and embodiments described herein, including any combination of general and / or preferred features / embodiments. Specifically, the present invention relates to each combination of meanings (including general and / or preferred meanings) of the various bases and variables contained in formulas (I), (II), (III), (IV), and (V).
[0229] This specification cites numerous documents, including patent applications, scientific literature, and manufacturers' manuals. While the disclosures of these documents are not considered relevant to the patentability of the present invention, they are incorporated herein by reference in their entirety. More specifically, all referenced documents are incorporated by reference in the same manner as if each individual document were specifically and individually indicated to be incorporated by reference.
[0230] Cyclin-dependent kinases (CDKs) are a family of Ser / Thr kinases that integrate various signaling pathways and play crucial roles in several important cellular processes. CDK12 and its ortholog, CDK13, belong to the "transcriptional" CDK class. The transcription of protein-coding genes is regulated by RNA polymerase II. Phosphorylation of residues in its C-terminal domain (CTD) organizes the production of mature mRNA transcripts. Phosphorylation of Ser2, which promotes RNA Pol II elongation through the gene body, is a key mechanism of CDK12 transcription regulation (Genes & Development 2010, 24:2303-2316). CDK12 and CDK13, in association with their absolute partner cyclin K, regulate several cellular processes, including transcriptional elongation, premRNA splicing, and cell cycle progression. Furthermore, knockdown of CDK12 is associated with the downregulation of genes involved in homologous recombination and DNA damage response (DDR) (Genes & Development 2011, 25:2158-2172). Therefore, maintaining genomic stability is considered to be an important role of this protein.
[0231] CDK12 is an attractive treatment target because it is often dysregulated in human cancers. CDK12 mutations in severe ovarian cancer are associated with decreased expression of DDR genes such as BRCA1, FANCI, ATM, ATR, or FANCD2, and increased sensitivity to PARP inhibitors. (Cancer Res, 2016, 76(7) 1182; Nucleic Acids Research, 2015, Vol. 43, 2575-2589).
[0232] The frequency and distribution of CDK12 protein expression in an independent cohort of breast cancer were evaluated by immunohistochemical testing (IHC) and correlated with outcomes and genomic status. It was found that 21% of randomly selected primary breast cancers were high in CDK12, while 10.5% were absent. Overexpression of CDK12 in breast cancer cells has been shown to regulate DDR and premRNA splicing involved in tumorigenesis (Nucleic Acids Res., 2017, Jun 20;45(11):6698-6716). Disruption of cyclin-dependent kinase 12 (CDK12) is known to lead to defects in DNA repair and increased sensitivity to platinum salts and PARP1 / 2 inhibitors. Interestingly, the absence of the CDK12 protein is associated with decreased expression of many DDR proteins, including ATR, Ku70 / Ku80, PARP1, DNA-PK, and γH2AX, suggesting a novel mechanism of CDK12-related DDR dysregulation in breast cancer. This may have important therapeutic implications, particularly in triple-negative breast cancer. (Molecular Cancer Therapeutics (2018), 17(1), 306-315).
[0233] Human epidermal growth factor receptor 2 (HER2) is a member of the epidermal growth factor receptor family that possesses tyrosine kinase activity. HER2 amplification or overexpression is found in approximately 15–30% of breast cancers and 10–30% of gastric / esophageal cancers, thus serving as a prognostic and predictive biomarker. HER2 overexpression is also found in other cancers such as ovarian, endometrial, bladder, lung, rectal, and head and neck cancers. The introduction of HER2-targeted therapy has dramatically impacted outcomes in patients with HER2-positive breast and gastric / esophageal cancers (Mol Biol Int. 2014; 2014: 852748). In breast cancer, HER2 is part of the 17q12-q21 locus, which is frequently amplified and overexpressed. The 17q12-q21 amplicon generally contains several neighboring genes, including MED1, GRB7, MSL1, CASC3, and TOP2A. Furthermore, HER2 amplicons contain the CDK12 gene in 71% of cases (Cell Division, Volume 12, Article number: 7 (2017)). High expression of CDK12, caused by simultaneous amplification of CDK12 and HER2 in breast cancer patients, is associated with disease recurrence and low survival rates (EMBO Rep (2019)20:e48058).
[0234] The design of selective ATP competitive kinase inhibitors is challenging due to the similarity of ATP binding sites and the difficulty in overcoming the overwhelmingly high intracellular ATP concentration. To date, all CDK12 inhibitors in clinical trials are pan-CDK inhibitors (dinaciclib). Therefore, as an alternative to classical competitive inhibition, degradation of the target of interest becomes an attractive option if the degradation agent can overcome the common problems of ATP competitive kinase inhibitors, particularly low permeability, low oral availability, low penetration into the CNS, and high levels of efflux via P-gp and BCRP1.
[0235] This invention relates to a compound that induces the degradation of cyclin K via a "molecular glue" mechanism, thereby selectively inactivating CDK12 and CDK13. This is achieved through stabilization of the interaction between the CDK12 / cyclin K complex and the karin-RING E3 ligase (CRL). CRL is a multi-subunit complex composed of a karin scaffold (e.g., CUL1, CUL2, CUL3, CUL4A, CUL4B, CUL5, CUL7, CUL9) and a substrate receptor that confers target specificity to a complex (e.g., CRBN, VHL, DCAF15) mobilized via an adapter subunit (e.g., DDB1, SKP1, ELOB / C). Target proteins presented by SR are tagged for proteasomal degradation via ubiquitin transfer by the E2 enzyme mobilized to CRL. In this invention, CDK12 / cyclin K interacts with an RL complex comprising CUL4A or CUL4B and DDB1. CDK12 directly binds to DDB1 and acts as a surrogate SR, exposing cyclin K for ubiquitination.
[0236] Cyclin K degradation is a property described for some, but not all, CDK12 inhibitors. The interaction between CDK12 and DDB1 is partially driven by the interaction between the inhibitor and DDB1. Therefore, only CDK12 inhibitors that simultaneously occupy the kinase active site and fill the hydrophobic pocket of DDB1 can promote cyclin K degradation. For example, the pan-CDK inhibitor CR8 was found to induce cyclin K degradation by this mechanism, while the CDK12 selective covalent inhibitor THZ-531 did not. However, the prediction of the cyclin K degradation properties of CDK12 inhibitors or the design of cyclin K degraders remains unclear. Therefore, cyclin K degraders reported in the literature are often discovered unexpectedly.
[0237] Inhibitors of CDK12 catalytic activity require the drug to continuously occupy the kinase to maintain their inhibitory effect. In contrast, since only a transient interaction between CDK12 / cyclin K and CRL is sufficient to drive cyclin K degradation, the compounds of the present invention act via catalytic event-based pharmacology. Therefore, significant inactivation of CDK12 can be achieved at remarkably low drug concentrations. This is supported by the efficacy of these molecules in a cell viability assay of a leukemia cell line (KBM7). The inventors further profiled the compounds in the aforementioned CRL-impaired isogenic cell line (UBE2Mmut, Mayor-Ruiz et al, 2020) that exhibits reduced cyclin K degradation activity but unaffected inhibition of CDK12 catalytic activity. The 10- to 150-fold difference in sensitivity in these isogenic cancer cell line pairs highlights the significant contribution of cyclin K degradation to the treatment effect. Since the dose required for cyclin K degradation is orders of magnitude less than that required for ATP competitive inhibition of CDK12, these molecules are expected to have a significantly improved selectivity profile compared to classical inhibitors. Consistently, even compounds with similar inhibitory effects on CDK12 catalytic activity may exhibit significantly different cell efficacy due to the added effect of cyclin K degradation (e.g., comparing Examples 3-36 and 3-57).
[0238] CDK12 and CDK13 share a significantly overlapping target space (Liang et al, 2015), and therefore, CDK13 is thought to be able to compensate for the loss of enzymatic activity of CDK12. Cyclin K is an absolute partner of both CDK12 and CDK13 and is required for their activity. Therefore, cyclin K degraders may reduce the activity of both kinases and circumvent such compensatory signaling.
[0239] Restoring CDK12 activity after treatment with a cyclin K degrading agent requires the resynthesis of cyclin K. Cyclin K is a relatively long-lived protein with a reported half-life of >12 hours. Therefore, the compounds of this invention are expected to have therapeutic effects far exceeding molecular exposure in cells and tumors. This favorable discontinuity between pharmacokinetics and pharmacodynamics can be used to further optimize the selectivity profile of these molecules and shorten the administration schedule.
[0240] The emergence of drug resistance is a common pitfall in targeted cancer therapy. Resistance to kinase inhibitors, in particular, is often mediated by the accumulation of so-called "gatekeeper mutations" at the enzyme's active site, which reduce drug binding affinity and consequently decrease the occupancy rate of the target kinase. The cyclin K degrading agent of the present invention is assumed to circumvent these common resistance mutations through a more efficient binding mode and mechanism of action. Furthermore, based on the catalytic action of the degrading agent, it is assumed that a greater reduction in affinity is required compared to that of the inhibitor to render the degrading agent ineffective.
[0241] The resistance mechanisms of the described degradation agents involve the downregulation or mutation of the SR required for degradation, because the loss of its function does not usually result in a loss of adaptability to cancer cells. The cyclin K degradation agents described herein do not utilize classical SRs, but rather CDK12, which is directly recruited to DDB1 (as shown by nanoBRET ternary complex formation data) and is generally essential across all cell types, as a surrogate SR. Therefore, interference with the function of this CRL complex is likely to significantly reduce adaptability, and thus it is not a promising resistance mechanism.
[0242] The compounds of the present invention possess many excellent characteristics that are expected to make them particularly useful in the treatment of cancer. Their low molecular weight, optimal lipophilicity, and small number of hydrogen bond donors and acceptors are expected to result in reduced transporter-mediated efflux and better blood-brain barrier permeability than observed with other described CCNK degrading agents (Wager et al., ACS Chemical Neuroscience, 2010 (1), p.435). These characteristics make the compounds of the present invention particularly suitable for use in brain cancer and cancers that have metastasized to the brain. Since brain metastases are frequently observed in lung cancer, breast cancer, and skin cancer, the compounds of the present invention are expected to be particularly useful in such situations.
[0243] Furthermore, the compounds of the present invention exhibit extremely high water solubility, and this, combined with high levels of permeability and metabolic stability, is expected to result in very high oral availability. Additionally, due to their high solubility, intravenous formulations and parenteral delivery of the compounds of the present invention become possible for patients who cannot take medication orally.
[0244] The most preferred compounds of the present invention are distinguished by the presence of a hydrogen bond acceptor atom in the bicyclic ring system R1. Due to a specific interaction with the tyrosine residue 815 of Cdk12, such compounds are predicted to exhibit a high level of Cdk selectivity. This residue is not conserved across the entire Cdk family; in Cdk2, Cdk7, and Cdk9, it corresponds to phenylalanine, and in Cdk4, it corresponds to histidine. Such specific (or water-mediated) interactions between the ligand and the protein are predicted to result in a higher level of selectivity for binding to Cdk12, and consequently, lower off-target mediated toxicity.
[0245] Furthermore, since the compounds of the present invention are particularly potent degradants of CCNK, low clinical doses are likely to be acceptable, resulting in improved tolerability and reduced toxicity levels. Moreover, low protein binding levels lead to unbound (C) levels in vivo.max ) Higher drug concentrations are predicted, which is beneficial for predictive event-driven pharmacology.
[0246] The activity and mechanism of action have been elucidated using the following assays:
[0247] Cell Titer Glo (CTG) in KBM7 WT and UBE2Mmut: This is a cell viability assay to measure the desired treatment effect, i.e., cancer cell death. UBE2M mutant cell lines have impaired activity of the karin-RING ligase system due to lower-order morphological mutations in UBE2M, which are necessary for the activation of these E3 ligases. By comparing with WT cells, the contribution of cyclin K degradation (decreased in UBE2M mutant cells) can be estimated compared to CDK12 kinase inhibition (no effect in UBE2M mutant cells). Since the UBE2M mutation only reduces CRL function without completely suppressing it, degradation may still be observed at high compound concentrations, so this assay may slightly underestimate the effect of degradation.
[0248] CCNK-nanoluciferase degradation assay: This assay helps elucidate the mechanistic explanation of the cytotoxic effect of the compounds of the present invention. Cyclin K is fused to nanoluciferase, and luminescence is measured as a surrogate for the abundance of cyclin K. In contrast to the inhibition of CDK12 catalytic activity, the potency of cyclin K degradation and the cytotoxicity of KBM7 correlate very well, further supporting the idea that cyclin K degradation is the primary driving factor of cell killing.
[0249] nanoBRET assay for DDB1-CDK12 / cyclin K ternary complex formation: This assay measures the interaction / recruitment of CDK12 / cyclin K to DDB1, mechanistically verifying the pharmacology of molecular glue. Because the distance over which the interaction can be measured in this assay is very short (<10 nm), this assay further demonstrates that the interaction between CDK12 and DDB1 is direct and does not require a classical substrate receptor.
[0250] Recombinant CDK12 kinase inhibition assay: This assay against recombinant proteins allows for the assessment of the degree of inhibition of CDK12 kinase activity by compounds. This enables the estimation of the additional benefit of cyclin K degradation as opposed to CDK12 inhibition alone. The blockade observed between CDK12 inhibition and efficacy in the KBM7 cell viability assay supports the significant contribution of cyclin K degradation to the treatment effect. [Examples]
[0251] Examples All synthesis was carried out using commercially available base units from Enamine Ltd (Kyiv, Ukraine; https: / / www.enaminestore.com / catalog) or Chembridge (San Diego, CA; https: / / www.hit2lead.com / screening-compounds / 9083792).
[0252] Specifically, compounds "Z1-Z3, Z5-Z7, Z9-Z11, and Z14" were synthesized by Enamine Ltd: Product ID for compound "Z1": Z28172116; Product ID for compound "Z2": Z63439346; Product ID for compound "Z3": Z300783508; Product ID for compound "Z5": Z397749190; Product ID for compound "Z6": Z104866096; Product ID for compound "Z7": Z200170434; Product ID for compound "Z9": Z336658234; Product ID for compound "Z10": Z1419842998; Product ID for compound "Z11": Z27665843; Product ID for compound "Z14": Z381246898. Compound "Z13" was synthesized at Chembridge: Product ID of compound "Z13": 908379.
[0253] general law cell line KBM7 cells with specified genetic backgrounds were grown in IMDM supplemented with 10% FBS and 1% penicillin / strepmycin (pen / strep). AsPC1, HCT116, NCI-H446, and 293T cells were grown in DMEM 10% FBS and 1% pen / strep. MV4;11, Jurkat, and Be(2)C cells were grown in RPMI 10% FBS and 1% pen / strep. Cas9-expressing KBM7, AsPC1, and HCT116 cells were generated using the plasmid Lenti_Cas9_Blasti (Addgene#52962). The lentiviral plasmid lentiGuide-Puro (Addgene#52963) was used to express sgRNA for the UBE2M gene (in KBM7-Cas9, AsPC1-Cas9, and HCT116-Cas9 cells). The lentiviral plasmid lentiGuide-Puro-IRES-mCherry (modified from Addgene#52963) was used to express sgRNA for CUL4B (in KBM7-Cas9 cells). The lentiviral plasmid pLenti-PGK-Hygro-DEST-UBE2M was constructed by gateway cloning (empty destination vector Addgene#19066), and then UBE2M resc It was used to generate KBM7 cells.
[0254] [Table 1]
[0255] Example 1: Identification of the quinoa ring ubiquitin ligase regulator. Research design All known small molecule degradation agents (heterobifunctional protacs and molecular glues) require the activity of the pan-CRL regulator UBE2M. Depending on the hijacked CRL ligase, the compounds also require the activity of a selected karin skeleton, e.g., CUL4B. In other words, cancer cells with UBE2M mutations via CRISPR / Cas9 technology are usually insensitive to the anti-cancer properties of these degradation products, while mutations in CUL4B inactivate a subset of degradation agents.
[0256] The cell viability assay method shown in Figures 1-11. KBM7 WT , UBE2M and CUL4B variant KBM7 clone (UBE2M mut and CUL4B mut The cells were seeded in triplicate in 96 wells at a cell density of 50,000 cells / mL with DMSO or degrading agents Z1-Z3, Z5-Z7, Z9-Z11, Z13, and Z14. After treating the cells for 3 days, cell viability assays (CellTiter Glo, Promega) were performed according to the manufacturer's protocol. Best-fit analysis of log10 drug concentrations against the scalar change of drug-treated cells compared to DMSO-treated cells was performed to obtain viability curves and ICs. 50 Value (LC 50 The value was calculated. All survival assays included a technical triplicate per experiment and per sample.
[0257] Compounds Z1-Z3, Z5-Z7, Z9-Z11, Z13, and Z14 were tested for their antiproliferative effects in human leukemia cells (KBM7). These cells were transduced with either a control sgRNA (KBM7_WT) or an sgRNA targeting UBE2M or CUL4B, inducing a lower-order morphology (deletion of 6 amino acids) accompanied by dysfunction (UBE2M_MUT). Thus, the proposed novel degradation agents potently inhibit the proliferation of KBM7_WT cells while preserving the UBE2Mmut isogenic counterpart.
[0258] In practice, 11 compounds, Z1-Z3, Z5-Z7, Z9-Z11, Z13, and Z14, were identified as meeting these criteria and being superior in terms of the significance of the magnification change; see, for example, Figure 1 and Table 1. KBM7_WT(KBM7 WT ) vs UBE2M_MUT and CUL4B_MUT cells (UBE2M mut and CUL4B mut The activity at these hits was compared to evaluate / verify the dose-variance difference effect. All compounds assayed were measured at the maximum half-dose inhibitory concentration (LC). 50 As observed by the shift in ), mutations in UBE2M or CUL4B resulted in a significant shift in their antiproliferative effect; see Table 1.
[0259] [Table 2]
[0260] Example 2: Identification of novel structurally different compounds that degrade cyclin K KBM7 cells used in Example 1 (KBM7 UBE2M mut and CUL4B mut The lower-order morphological phenotypes of the mutant UBE2M and CUL4B alleles in cells were evaluated. As shown in Figure 6, mutant cells were treated with compounds Z1-Z3, Z5-Z11, Z13, and Z14 and compared with wild-type KBM7 cells. It was revealed that these compounds cause cyclin K (CCNK) destabilization (Figure 12).
[0261] E3 ligase-mediated degradation of CCNK in KBM7_WT cells is a cause of reduced cancer cell viability after compound treatment. Based on the E3 ligase-dependent mode of action of the compounds disclosed above and shown in the attached examples below, it is expected that the degradation of CCNK by compounds Z1-Z3, Z5-Z11, Z13, and Z14 can also be induced by the binding of the compounds to CDK12. CDK12 then degrades CCNK associated with CDK12 via E3 ligase.
[0262] Western blot analysis Cell pellets washed with PBS were lysed in 50 mM Tris pH 7.9, 8 M urea, and 1% CHAPS, and incubated at 4°C for at least 30 minutes with shaking. 20 μg of the supernatant was run for detection and then transcribed. Antibodies used: CUL1 (Santa Cruz Biotechnology, sc-1276), CUL2 (Sigma-Aldrich, SAB2501565-100), CUL3 (Cell Signaling Technology, 2759), CUL4A (Cell Signaling Technology, 2699S), CUL4B (Proteintech, 12916-1-AP), CUL5 (Santa Cruz Biotechnology, sc-373822), UBE2M (Santa Cruz Biotechnology, sc-390064), DDB1 (Cell Signaling Technology, 5428S), CCNK (Bethyl, A301-939A), CDK12 (Cell Signaling Technology, 11973S), CDK13(Bethyl, A301-458A), RBM39(1:500, Santa Cruz Biotechnology sc-376531), V5 (Cell Signaling Technology, 13202), ubiquityl-histone H2A (K119) (Cell Signaling, 8240-20). ACTIN (Sigma-Aldrich, A5441), VINCULIN (Santa Cruz Biotechnology, sc-25336). Secondary antibodies anti-mouse / rabbit / goat (Jackson ImmunoResearch 115-035-003, 111-035-003, and 705-035-003).
[0263] Example 3: Further compound synthesis and testing Synthesis of Compounds - Method A [ka] Reagent 1 (1 equivalent), Reagent 2 (1.1 equivalents), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (1.1 equivalents), and 1-hydroxy-7-azabenzotriazole (HOAt) (1.05 equivalents) were mixed in dry N,N-dimethylformamide (DMF, approximately 0.5 mL per 100 mg of product). The reaction mixture was sealed and left at ambient temperature for 18 hours. The solvent was then evaporated under reduced pressure, and the residue was dissolved in DMSO (approximately 1 mL, less than 300 mg of product). The DMSO solution was filtered, analyzed by LC-MS, and transferred for HPLC purification.
[0264] * When using reagent 1 and / or reagent 2 as salts, an additional amount of triethylamine (Et3N) (1.1 equivalents) was added to the reaction mixture to convert the reagents into free forms.
[0265] * When using reagent 2 as a salt, an additional amount of triethylamine hydrochloride (TETAH) (1.1 equivalents) was added to the reaction mixture to convert the reagent into a base form.
[0266] Compound Synthesis - Method B [ka]
[0267] Reagent 2 (1.2 equivalents) and dried acetonitrile (MeCN) (1 mL) were placed in the vial. N,N-diisopropylethylamine (DIPEA * 3.2 equivalents of reagent 1 were added dropwise to the solution. A mixture of reagent 1 (1 equivalent) and 2-chloro-N-methylpyridinium iodide (1.44 equivalents) was added while stirring. The reaction vial was placed in a water bath and left at 100°C for 6 hours. The reaction mixture was cooled to room temperature, and water was added until the vial was full. The vial was then sonicated in an ultrasonic bath. The solvent was evaporated. The residue was dissolved in DMSO and filtered. The solution was subjected to HPLC purification.
[0268] * When using an amine salt, an additional amount of N,N-diisopropylethylamine (DIPEA) (1.1 equivalents) was added to the reaction mixture to convert the amine into its base form.
[0269] Synthesis of Compounds - Method C [ka] Reagent 2 (1.2 equivalents) and N-methylimidazole (NMI, 2 equivalents) were mixed in dry acetonitrile (MeCN, approximately 0.7 mL per 100 mg of product). Methanesulfonyl chloride (MeSO2Cl) (1 equivalent) was added dropwise while stirring for 5 minutes. The mixture was sealed and heated at 50°C with stirring for 1 hour, then cooled, and Reagent 1 (1 equivalent) was added all at once. The reaction mixture was then sealed and heated at 60°C for 16 hours. The mixture was cooled to ambient temperature, the solvent was evaporated under reduced pressure, and the residue was dissolved in DMSO (approximately 1 mL, less than 300 mg of product). The DMSO solution was filtered, analyzed by LC-MS, and transferred for HPLC purification.
[0270] Synthesis of Compounds - Method D [ka]
[0271] To a chilled (0°C) solution of acetic acid (1.62 mmol), amine (1.62 mmol), and triethylamine (0.68 mL, 4.87 mmol) in dichloromethane (15 mL), TBTU (2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium tetrafluoroborate) (625 mg, 1.95 mmol) was added. The resulting solution was stirred at room temperature for 22 hours. The reaction mixture was evaporated to dryness, and the residue was purified by flash chromatography or HPLC to obtain the final compound.
[0272] Synthesis of Compounds - Method E [ka]
[0273] Chemists in the art will understand that methods similar to those shown in methods A to E are suitable for the synthesis of the compounds of the present invention.
[0274] Compound identification: NMR NMR spectra of many compounds were recorded using either a Bruker DPX400 spectrometer with a 5 mm inverse triple resonance probe head operating at 400 MHz for protons and 100 MHz for carbon, or a Bruker DRX500 spectrometer with a 5 mm inverse triple resonance probe head operating at 500 MHz for protons and 125 MHz for carbon. The deuterated solvents were chloroform-d (deuterated chloroform, CDCl3) or d6-DMSO (deuterated DMSO, d6-dimethyl sulfoxide). Chemical shifts are reported in parts per million (ppm) relative to tetramethylsilane (TMS) used as an internal standard. Compound identification: HPLC / MS
[0275] The LC-MS spectra of many compounds were recorded using the following instruments and analytical methods.
[0276] Equipment specifications: Agilent 1100 series LC / MSD system equipped with DAD / ELSD Alltech 2000ES and Agilent LC / MSD VL (G1956B) and SL (G1956B) mass spectrometers.
[0277] Agilent 1200 series LC / MSD system equipped with DAD / ELSD Alltech 3300 and Agilent LC / MSD G6130A and G6120B spectrophotometers.
[0278] Agilent Technologies 1260 Infinity LC / MSD system equipped with DAD / ELSD Alltech 3300 and Agilent LC / MSD G6120B spectrophotometer.
[0279] Agilent Technologies 1260 Infinity II LC / MSD system equipped with DADELSD G7102A 1290 Infinity II and Agilent LC / MSD G6120B mass spectrometer.
[0280] Agilent 1260 series LC / MSD system equipped with DAD\ELSD and Agilent LC\MSD (G6120B) mass spectrophotometer.
[0281] Agilent 1290 series LC / MSD system equipped with DAD\ELSD and Agilent LC\MSD (G6125B) mass spectrophotometer.
[0282] Method A Column: Agilent Poroshell 120 SB-C18 4.6×30mm 2.7μm with UHPLC Guard Infinity Lab Poroshell 120 SB-C18 4.6×5mm 2.7μm Temperature: 60℃ Mobile phase A: Acetonitrile:Water (99:1%), 0.1% Formic acid Mobile phase B: Water (0.1% formic acid) Flow rate: 3mL / min Dissolution gradient: 0.01 min - 99% B, 1.5 min - 0% B, 2.2 min - 0% B, 2.21 min - 99% B Injection volume: 0.5 μL Ionization mode: Electrospray ionization (ESI) Scan range: m / z 83-1000 DAD: 215nm, 254nm, 280nm
[0283] Method B Column: Agilent Poroshell HPH-C18, 4.6 x 100 mm, 4 μm Temperature: 35℃ Mobile phase A: water, 0.1% TFA Mobile phase B: Acetonitrile Flow rate: 1mL / min Dissolution gradient: 0.01 min - 90% A, 1 min - 90% A, 17 min - 100% B, 18 min - 100% B Injection volume: 5 μL Ionization mode: Electrospray ionization (ESI) Scan range: m / z 83-1000
[0284] Example 3-1: 2-(6,7-dimethylbenzofuran-3-yl)-N-(5-methylthiazole-2-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (Method A): 1.427 min; m / z 301.2 (M+H) +
[0285] Example 3-2: 2-(6,7-dimethylbenzofuran-3-yl)-N-(5-isopropylthiazole-2-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (Method A): 1.356 min; m / z 329.2(M+H) +
[0286] Example 3-3: N-(5-chlorothiazol-2-yl)-2-(6,7-dimethylbenzofuran-3-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (Method A): 1.468 min; m / z 321.0 / 323.1(M+H) +
[0287] Examples 3-4: 2-(6-fluoroimidazo[1,2-a]pyridine-2-yl)-N-(5-isopropylthiazole-2-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (Method A): 0.727 min; m / z 319.0(M+H) +
[0288] Examples 3-5: 2-(6-fluoroimidazo[1,2-a]pyridine-2-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 0.989 min; m / z 345.0(M+H) +
[0289] Examples 3-6: 2-(8-methylimidazo[1,2-a]pyridine-3-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 0.983 min; m / z 341.0(M+H) +
[0290] Example 3-7: 2-(8-methylimidazo[1,2-a]pyridine-2-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.007 min; m / z 341.1(M+H) +
[0291] Example 3-8: 2-(6,8-dichloroimidazo[1,2-a]pyridine-2-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.369 min; m / z 394.8 / 396.8(M+H) +
[0292] Example 3-9: 2-(6-bromo-8-methoxyimidazo[1,2-a]pyridine-2-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method C. LCMS retention time (Method A): 0.974 min; m / z 435.0(M+H) +
[0293] Example 3-10: 2-(benzo[b]thiophen-2-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.523 min; m / z 343.0(M+H) +
[0294] Example 3-11: 2-(benzo[b]thiophen-2-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)propanamide [ka] It was prepared according to Method C. LCMS retention time (Method A): 1.423 min; m / z 357.0(M+H) +
[0295] Example 3-12: 2-(3-methylbenzo[b]thiophen-2-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.488 min; m / z 357.0(M+H) +
[0296] Example 3-13: 2-(quinoline-5-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 0.816 min; m / z 338.0(M+H) +
[0297] Example 3-14: 2-(quinoline-6-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 0.979 min; m / z 338.2 (M+H) +
[0298] Example 3-15: 2-(6-methyl-1H-benzo[d]imidazole-1-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 0.926 min; m / z 341.2(M+H) +
[0299] Example 3-16: 5-oxo-1-(p-tolyl)-N-(5-(trifluoromethyl)thiazole-2-yl)pyrrolidine-3-carboxamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.353 min; m / z 370.0(M+H) +
[0300] Example 3-17: 1-(4-fluoro-3-methylphenyl)-5-oxo-N-(5-(trifluoromethyl)thiazole-2-yl)pyrrolidine-3-carboxamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.231 min; m / z 388.2 (M+H) +
[0301] Example 3-18: 1-(4-chlorophenyl)-5-oxo-N-(5-(trifluoromethyl)thiazole-2-yl)pyrrolidine-3-carboxamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.465 min; m / z 390.0 / 392.0(M+H) +
[0302] Example 3-19: 1-(3-chlorophenyl)-5-oxo-N-(5-(trifluoromethyl)thiazole-2-yl)pyrrolidine-3-carboxamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.475 min; m / z 389.8 / 392.0(M+H) +
[0303] Example 3-20: 1-(2-chlorophenyl)-5-oxo-N-(5-(trifluoromethyl)thiazole-2-yl)pyrrolidine-3-carboxamide [ka] It was prepared according to Method B. LCMS retention time (method A): 1.328 min; m / z 390.0 / 392.0(M+H) +
[0304] Example 3-21: 1-(3,5-difluorophenyl)-5-oxo-N-(5-(trifluoromethyl)thiazole-2-yl)pyrrolidine-3-carboxamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.428 min; m / z 392.1(M+H) +
[0305] Example 3-22: 1-(2,5-difluorophenyl)-5-oxo-N-(5-(trifluoromethyl)thiazole-2-yl)pyrrolidine-3-carboxamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.067 min; m / z 392.0(M+H) +
[0306] Example 3-23: 1-(3,4-difluorophenyl)-5-oxo-N-(5-(trifluoromethyl)thiazole-2-yl)pyrrolidine-3-carboxamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.401 min; m / z 392.1(M+H) +
[0307] Example 3-24: 1-(2,3-dihydro-1H-inden-5-yl)-5-oxo-N-(5-(trifluoromethyl)thiazole-2-yl)pyrrolidine-3-carboxamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.510 min; m / z 396.0 (M+H) +
[0308] Example 3-25: 1-(benzo[d][1,3]dioxol-5-yl)-5-oxo-N-(5-(trifluoromethyl)thiazole-2-yl)pyrrolidine-3-carboxamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.317 min; m / z 400.0(M+H) +
[0309] Example 3-26: 1-(4-fluorophenyl)-5-oxo-N-(5-(trifluoromethyl)thiazole-2-yl)pyrrolidine-3-carboxamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.124 min; m / z 374.0(M+H) +
[0310] Example 3-27: 1-benzyl-5-oxo-N-(5-(trifluoromethyl)thiazole-2-yl)pyrrolidine-3-carboxamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.146 min; m / z 370.0(M+H) +
[0311] Example 3-28: 1-(4-chlorobenzyl)-5-oxo-N-(5-(trifluoromethyl)thiazole-2-yl)pyrrolidine-3-carboxamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.393 min; m / z 404.0 / 406.0(M+H) +
[0312] Example 3-29: 1-(4-methylbenzyl)-5-oxo-N-(5-(trifluoromethyl)thiazole-2-yl)pyrrolidine-3-carboxamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.397 min; m / z 384.1(M+H)+
[0313] Example 3-30: 2-(isoquinoline-5-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.066 min; m / z 338.1(M+H) +
[0314] Example 3-31: 2-(isoquinoline-6-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.027 min; m / z 338.0(M+H) +
[0315] Example 3-32: 2-(isoquinoline-7-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method C. LCMS retention time (Method A): 0.729 min; m / z 338.0(M+H) +
[0316] Example 3-33: 2-(isoquinoline-8-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.068 min; m / z 338.1(M+H)+
[0317] Examples 3-34: 2-(isoquinoline-4-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method C. LCMS retention time (Method A): 1.074 min; m / z 338.0(M+H) +
[0318] Example 3-35: 2-(quinoline-3-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)propanamide [ka] It was prepared according to Method C. LCMS retention time (Method A): 1.287 min; m / z 352.0(M+H) +
[0319] Example 3-36: 2-(quinoline-3-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.226 min; m / z 338.0(M+H) +
[0320] Example 3-37: 2-(5-methyl-1H-indole-1-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.320 min; m / z 340.0(M+H) +
[0321] Example 3-38: 2-(1H-pyrrolo[2,3-b]pyridine-3-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.143 min; m / z 327.1(M+H) +
[0322] Example 3-39: 2-(4-chloro-1H-pyrrolo[2,3-b]pyridine-3-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method C. LCMS retention time (Method A): 1.166 min; m / z 360.8 / 362.8(M+H) +
[0323] Examples 3-40: 2-(1H-pyrrolo[3,2-b]pyridine-3-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 0.898 min; m / z 327.9(M+H) +
[0324] Example 3-41: 2-(benzofuran-2-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.459 min; m / z 327.0 (M+H) +
[0325] Example 3-42: N-(5-cyclopropylthiazole-2-yl)-2-(6,7-dimethylbenzofuran-3-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (Method A): 1.563 min; m / z 327.0(M+H) +
[0326] Example 3-43: N-(5-cyclopropylthiazole-2-yl)-2-(6-fluoroimidazo[1,2-a]pyridine-2-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (method A): 0.873 min; m / z 317.2(M+H) +
[0327] Example 3-44: 2-(6,7-dimethylbenzofuran-3-yl)-N-(5-methyl-1H-pyrazole-3-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (Method A): 1.284 min; m / z 284.2 (M+H) +
[0328] Example 3-45: 2-(6,7-dimethylbenzofuran-3-yl)-N-(5-isopropyl-1H-pyrazole-3-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (Method A): 1.331 min; m / z 312.1(M+H) +
[0329] Example 3-46: N-(5-cyclopropyl-1H-pyrazole-3-yl)-2-(6,7-dimethylbenzofuran-3-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (Method A): 1.558 min; m / z 310.2 (M+H) +
[0330] Example 3-47: N-(5-bromo-1H-pyrazole-3-yl)-2-(6,7-dimethylbenzofuran-3-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.354 min; m / z 348 / 350.0(M+H) +
[0331] Example 3-48: 2-(6,7-dimethylbenzofuran-3-yl)-N-(5-(trifluoromethyl)-1H-pyrazole-3-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (Method A): 1.278 min; m / z 338.0 (M+H) +
[0332] Example 3-49: N-(5-chloro-1H-pyrazole-3-yl)-2-(6,7-dimethylbenzofuran-3-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (Method A): 1.293 min; m / z 304.0(M+H) +
[0333] Example 3-50: 2-(6,7-dimethylbenzofuran-3-yl)-N-(5-methylpyridine-2-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (Method A): 1.337 min; m / z 295.2(M+H) +
[0334] Example 3-51: 2-(6,7-dimethylbenzofuran-3-yl)-N-(5-isopropylpyridine-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.449 min; m / z 323.1(M+H) +
[0335] Example 3-52: N-(5-cyclopropylpyridine-2-yl)-2-(6,7-dimethylbenzofuran-3-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (Method A): 1.531 min; m / z 321.2(M+H) +
[0336] Example 3-53: N-(5-bromopyridine-2-yl)-2-(6,7-dimethylbenzofuran-3-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.317 min; m / z 359.0 / 361(M+H) +
[0337] Example 3-54: 2-(6,7-dimethylbenzofuran-3-yl)-N-(5-(trifluoromethyl)pyridine-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.512 min; m / z 349.0(M+H) +
[0338] Example 3-55: N-(5-chloropyridine-2-yl)-2-(6,7-dimethylbenzofuran-3-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (Method A): 1.528 min; m / z 315.0(M+H) +
[0339] Example 3-56: 2-(6-fluoroimidazo[1,2-a]pyridine-2-yl)-N-(5-methyl-1H-pyrazole-3-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (Method A): 0.639 min; m / z 274.2(M+H) +
[0340] Example 3-57: 2-(6-fluoroimidazo[1,2-a]pyridine-2-yl)-N-(5-isopropyl-1H-pyrazole-3-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (Method A): 0.813 min; m / z 302.2(M+H) +
[0341] Example 3-58: N-(5-bromo-1H-pyrazole-3-yl)-2-(6-fluoroimidazo[1,2-a]pyridine-2-yl)acetamide [ka] It was prepared according to Method C. LCMS retention time (Method A): 0.507 min; m / z 338.0 / 340.0(M+H) +
[0342] Example 3-59: 2-(6-fluoroimidazo[1,2-a]pyridine-2-yl)-N-(5-(trifluoromethyl)-1H-pyrazole-3-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (Method A): 0.837 min; m / z 328.0(M+H) +
[0343] Example 3-60: N-(5-chloro-1H-pyrazole-3-yl)-2-(6-fluoroimidazo[1,2-a]pyridine-2-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (Method A): 0.526 min; m / z 294.0(M+H) +
[0344] Example 3-61: 2-(6-fluoroimidazo[1,2-a]pyridine-2-yl)-N-(5-isopropylthiazole-2-yl)acetamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 0.907 min; m / z 313.2(M+H) +
[0345] Example 3-62: N-(5-cyclopropylpyridine-2-yl)-2-(6-fluoroimidazo[1,2-a]pyridine-2-yl)acetamide [ka] It was prepared according to Method A. LCMS retention time (Method A): 0.873 min; m / z 311.1(M+H) +
[0346] Example 3-63: 3-(4-oxoquinazoline-3(4H)-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)propanamide [ka] It was prepared according to Method C. LCMS retention time (Method A): 1.050 min; m / z 369.0(M+H) +
[0347] Example 3-64: 3-(6,7-dimethoxy-4-oxoquinazoline-3(4H)-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)propanamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.205 min; m / z 429.0(M+H) +
[0348] Example 3-65: 3-(6-bromo-4-oxoquinazoline-3(4H)-yl)-N-(5-(trifluoromethyl)thiazole-2-yl)propanamide [ka] It was prepared according to Method B. LCMS retention time (Method A): 1.384 min; m / z 448.8(M+H) +
[0349] Example 3-66: N-(5-cyclopropyl-1H-pyrazole-3-yl)-2-(6-chloroimidazo[1,2-a]pyridine-2-yl)acetamide [ka] It was prepared according to Method E. [ka]
[0350] To a suspension of 5-chloropyridine-2-amine (2 g, 15.56 mmol) in EtOH (20 mL), ethyl 4-chloro-3-oxobutanoate (2.56 g, 15.56 mmol) was added at room temperature. The mixture was then stirred at 90°C for 16 hours. After cooling to room temperature, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (petroleum ether: siRNA, 10:1, v / v) to obtain intermediate 2 as a white solid (2.5 g). [ka]
[0351] To a suspension of intermediate 2 (2.5 g, 10.47 mmol) in THF / H2O (18 mL / 6 mL), NaOH (628.43 mg, 15.71 mmol) was added by RT. The mixture was stirred overnight by RT. The filtrate was concentrated to dryness to obtain intermediate 3 (2.0 g) as a white solid, which was confirmed by LC-MS and used directly in the next step without further purification. [ka]
[0352] To a solution of intermediate 3 (200 mg, 949.59 mmol) in DMF (2.5 mL), EDCI (546.10 mg, 2.848 mol) and DMAP (348.03 mg, 2.848 mol) were added by RT. The mixture was stirred by RT for 5 minutes. 5-cyclopropyl-1H-pyrazole-3-amine (140.34 mg, 1.14 mmol) was added to the mixture, and it was stirred for 1.5 hours. The resulting mixture was purified by prep-HPLC (ACN / 0.1% CH2O2 in water, v / v=0 → 40%) to give Example 3-66 (25.1 mg) as a white solid.
[0353] LCMS retention time (Method B) 7.44 min; m / z 316.10 (M+H)
[0354] Setup for NanoBRET magnification change experiment: HEK293T wild-type cells were seeded in 6-well plates at 800k cells / well (DMEM + 10% FBS + 1% PS), and after adhesion for approximately 7 hours, 1.5 μg of HaloTag_CDK12 plasmid [Table 1] and 0.15 μg of NanoLuc_DDB1 plasmid [Table 1] per well were transiently transfected using PEI. Cells were incubated at 37°C in 5% CO2, collected after 24 hours, and resuspended in assay medium (Opti-MEM Reduced serum medium, without phenol red, 4% FBS, 1% PS). Cell size was 2.3 × 10⁶. 5Prepare the solution to cells / mL and treat with 100 nM HaloTag 618 Ligand or DMSO. Seed 8000 cells per well in a white 384-well plate, triplicating one negative control treated with DMSO instead of HaloTag 618 Ligand, and then seed the 384-well plate overnight at 37°C and 5% CO2. Prepare the stock solution of the compound in Opti-MEM- / - (Opti-MEM I Reduced serum medium, without phenol red) at 8× and use it to treat the cells at a final concentration of 10 μM at 1×. After incubating the cells and compound at room temperature for 10 minutes, add the NanoBRET Nano-Glo substrate according to the manufacturer's protocol. Shake the plate for 30 seconds, then immediately measure donor emission (NanoBRET Blue at 460 nm) and receptor emission (BRET Deep Red at 647 nm) for 0.5 seconds.
[0355] [Table 3]
[0356] NanoBRET EC 50 Experiment setup: The assay setup is the same as for the "NanoBRET Dilution Change Experiment Setup". Instead of duplicating cells with a 10 μM compound, perform 10 titrations starting from 20 μM at a 1:4 dilution ratio, covering the range from 20,000 nM to 0.076 nM.
[0357] CTG assay KBM7 cells (wild-type or carrying the lower-order morphological UBE2M mutation (Mayor-Ruiz et al., 2019)) were duplicated and seeded at a density of 1000 cells per well in complete medium (IMDM + 10% FBS + 1% penicillin-streptomycin) in a white opaque 384-well plate. The cells were treated with a compound in a 10-stop titration (range: 0-20 μM) at a dilution ratio of 1:4. After incubation for 72 hours, cell viability was determined using CellTiter-Glo® 2.0 reaction product (Promega) pre-diluted 1:4 with mQ water. Luminescence signals were measured using a multimode plate reader EnVision 2105 (Perkin Elmer).
[0358] Generation of Nluc-tagged HEK293T cells HEK293T_Nluc_CCNK-tagged cells were manipulated by incorporating a nanoluciferase tag into the N-terminus of the endogenous CCNK locus using CRISPR-Cas9 technology. Briefly, 5.5 million HEK293T cells were cotransfected by PEI with a 1:1 ratio cleavage vector (sgRNA: AAGCCTACTTCAATAAATGA) and repair template (whole plasmid 4 μg) as described previously (Brand and Winter, 2019). The repair sequence contained a cassette of puromycin R-P2A-HA-Nluc-(G4S)3 (P2A: self-cleavage peptide 2A, HA: HA-tag, (G4S)3: flexible linker) surrounded by a 20-nucleotide microhomology matching the genomic locus. After incubation for 3 days, recombinant populations were selected by puromycin treatment (2 μg / mL, 5 days). A monoclonal population was obtained by limiting dilution, and the incorporation of the cassette was verified by Sanger sequencing.
[0359] Nluc decomposition (DC50) HEK293T_Nluc_CCNK-tagged cells were duplicated and seeded in complete medium (Opti-MEM I + 4% FBS + 1% PS) in a white opaque 384-well plate at a density of 8000 cells per well. The cells were treated with a compound in 10 titrations (range: 0-10 μM, 1:4 dilution). After incubation for 4 hours, Nano-Glo substrate (Promega), pre-diluted in serum-free medium (Opti-MEM I), was added to the cells (final dilution: 1:500). The luminescence signal was directly measured using a multimode plate reader EnVision 2105 (Perkin Elmer).
[0360] Western blot analysis of CCNK degradation. HEK293T cells were seeded (0.8 × 10⁶ cells per well in a 6-well plate). 6 Cells were treated with 10 μM compound and vehicle control (DMSO) for 4 hours before cell lysis and analysis of protein levels. In short, the PBS-washed cell pellet was lysed in 50 mM Tris pH 7.9, 8 M urea, 1% CHAPS supplemented with 1% protease inhibitor (Protease Inhibitor Cocktail Halt® (100×), catalog no. 78429, Thermo Fisher) and 0.1% benzonase (Benzonase Nuclease 1000×, Sigma, catalog no. E1014-25KU), and incubated at 10°C for at least 30 minutes with shaking at 1400 RPM. The lysates were spun down at 14,000 g for 30 minutes at 4°C. Then, 18 μg of the supernatant was run and transcribed for detection. The antibodies used were CCNK (1:500, Bethyl, A301-939A) and actin (1:5,000, Sigma-Aldrich, A5441). The secondary antibodies used were anti-mouse and anti-rabbit (1:10,000, Jackson ImmunoResearch 115-035-003 and 111-035-003). Changes in CCNK levels were evaluated using densitometry values normalized to actin levels with ImageJ.
[0361] Cdk12 [High ATP] In Vitro Kinase Activity Assay A kinase reaction (50 μL) was performed using recombinant, highly purified protein. The Cdk12(696-1,082) / CycK(1-267) protein complex (0.5 μM) was pre-incubated at room temperature for 10 minutes in kinase buffer (40 mM Tris pH 7.5, 20 mM MgCl2, 0.1 mg / mL BSA) with 50 μM compound and vehicle control (DMSO). Then, pS7-CTD substrate peptide (Ac-YSPTSP-pS-YSPTSP-pS-Y-PEG2-RR-amide, 95% purity, Biosyntan, Germany) (100 μM) was added, and the mixture was incubated further at room temperature for 10 minutes. Cold ATP was added (to a final concentration of 1 mM), and the reaction mixture was incubated at 30°C for 60 minutes at 500 rpm. Kinase activity was determined using the ADP-Glo® kinase assay (Promega). The emission signal was measured using a multimode plate reader, EnVision 2105 (Perkin Elmer).
[0362] Uniprot protein codes: (Cdk12)Q9NYV4, (CycK)O75909
[0363] References mentioned in the above description of the assay: [Table 4]
[0364] NanoBRET magnification change assay data Activity class: "A" - Increased by more than 4 times, "B" - Increased by 3 to 4 times, "C" - Increased by 2 to 3 times, "D" - Increased by 1 to 2 times [Table 5]
[0365] NanoBRET EC 50 Assay data Activity class: "A"-EC 50≦0.25μM, "B" 0.50μM≦EC 50 <0.25 μM, "C" 1.0 μM ≤ EC 50 <0.50 μM, "D" 10 μM ≤ EC 50 <1.0 μM, "E" > 10 μM [Table 6]
[0366] KBM7 CTG EC 50 Assay data (UBE2M wild type) Activity class: "A"-EC 50 ≦0.25μM, "B" 0.50μM≦EC 50 <0.25 μM, "C" 1.0 μM ≤ EC 50 <0.50 μM, "D" 10 μM ≤ EC 50 <1.0 μM, "E" > 10 μM [Table 7]
[0367] KBM7 CTG EC 50 Assay data (UBE2M knockout) Activity class: "A"-EC 50 ≦0.25μM, "B" 0.50μM≦EC 50 <0.25 μM, "C" 1.0 μM ≤ EC 50 <0.50 μM, "D" 10 μM ≤ EC 50 <1.0 μM, "E" > 10 μM [Table 8]
[0368] The calculated ratio of antiproliferative activity in KBM7 wild-type cells to antiproliferative activity in UBE2M knockout cells indicates that cytotoxicity depends on the mechanism of action of E3 ligase and glue-degrading agents. [Table 9]
[0369] NanoLuc-CCNK Degradation Assay "A"-DC 50 ≦0.10μM, "B" 0.50μM≦DC 50 <0.10 μM, "C" 1.0 μM ≤ DC 50 <0.50 μM, "D" 10 μM ≤ DC 50 <1.0 μM, "E" > 10 μM [Table 10]
[0370] Figures 16 and 17 show the results of the CCNK retention rate after treatment at a concentration of 10 micromoles for 4 hours, as evaluated by Western blot analysis of CCNK degradation and densitometry values normalized to actin levels using ImageJ.
[0371] Examples 3-66 contain a 6-chloroimidazo[1,2-a]pyridine-2-yl radical positioned toward the DDB1-Cdk12 interface, which is thought to provide particularly strong stabilizing interactions and therefore perform exceptionally well in CCNK degradation assays (NanoBRET and NanoLuc). Furthermore, the presence of a 5-cyclopropyl-1H-pyrazole-3-yl radical provides optimal hydrophobic interaction with the embedded portion of the ATP binding pocket. These interactions are thought to enhance CCNK degradation and kill cancer cells over a wider range (as observed in the KBM7 cytotoxicity assay). The strong dependence on degradation via UBE2M is evident from the significantly lower activity of the KBM7 UBE2M mutant cell line.
[0372] Similarly, Examples 3-9 are also particularly potent anticancer agents. The 6-bromo-8-methoxyimidazo[1,2-a]pyridine-2-yl radical promotes the formation of a ternary complex, as demonstrated by its exceptional activity in NanoLuc and NanoBRET CCNK degradation assays, resulting in extremely potent activity in the KBM7 cell assay. The 5-(trifluoromethyl)thiazole-2-yl) radical, like the aforementioned 5-cyclopropyl-1H-pyrazole-3-yl radical, forms optimal interaction with the hydrophobic ATP-binding pocket.
[0373] Examples 3-45 exhibit a very high dependence on UBE2M-dependent cytotoxicity, as indicated by the ratio of cytotoxicity data to that of the wild-type mutant of UBE2M. This is thought to be due to the increased separation of the direct inhibitory effect of Cdk12 from the degrading mechanism, due to the presence of the 5-isopropyl-1H-pyrazole-3-yl radical (not optimal for Cdk12 inhibition) compared to the presence of the 6-fluoroimidazo[1,2-a]pyridine-2-yl radical (preferred for interaction between Cdk12 and DDB1) (kinase activity measurement data).
[0374] Examples 3-36 exhibited extremely potent activity in the cytotoxicity assay (KBM7) and good activity in the ternary complex formation assay. In contrast to Examples 3-45, the 5-(trifluoromethyl)thiazole-2-yl) radical is optimal for Cdk12 binding, while the 2-(quinoline-3-yl) radical forms an optimal interaction at the glue interface (but is not optimal for Cdk12 inhibition), as indicated by weak Cdk12 inhibition (kinase activity measurement) at physiological ATP concentrations. Strong dependence on degradation via UBE2M is evident from the significantly (40-fold) lower activity in the KBM7 UBE2M mutant cell line.
[0375] Examples 3-14 exhibited extremely potent activity in the cytotoxicity assay (KBM7) and extremely high activity in the ternary complex formation assay (NanoLuc and NanoBRET assays). The 5-(trifluoromethyl)thiazole-2-yl) radical is optimal for Cdk12 binding, while the 2-(quinoline-6-yl) radical forms an excellent interaction to stabilize binding at the DDB1-Cdk12 interface. The strong dependence on degradation via UBE2M is evident from the significantly (approximately 50-fold) lower activity of the KBM7 UBE2M mutant cell line.
[0376] Examples 3-5 are particularly excellent in CCNK degradation assays (NanoBRET and NanoLuc assays) due to a preferred 6-chloroimidazo[1,2-a]pyridine-2-yl radical positioned toward the DDB1-Cdk12 interface (similar to Examples 3-45). This results in a particularly strong stabilizing interaction. Furthermore, the presence of a 5-(trifluoromethyl)thiazole-2-yl) radical provides optimal hydrophobic interaction with the embedded portion of the ATP binding pocket. These interactions are thought to enhance CCNK degradation and kill cancer cells over a wider range (as observed in the KBM7 cytotoxicity assay). The strong dependence on degradation via UBE2M is evident from the significantly lower activity of the KBM7 UBE2M mutant cell line (ratio 142).
[0377] Examples 3-43 contain a 6-fluoroimidazo[1,2-a]pyridine-2-yl radical positioned toward the DDB1-Cdk12 interface, resulting in particularly strong stabilizing interactions and thus excelling in CCNK degradation assays (NanoBRET and NanoLuc). Furthermore, the presence of a 5-cyclopropylthiazole-2-yl radical provides optimal hydrophobic interaction with the embedded portion of the ATP binding pocket. Combining these features yields extremely potent activity in cell proliferation assays (KBM7 wild-type vs. mutant), strongly dependent on UBE2M-dependent CCNK degradation (activity ratio approximately 40).
Claims
1. Compounds of the following formula (I), or their stereoisomers, tautomers, pharmaceutically acceptable salts, or solvates: 【Chemistry 1】 (In the formula, R 1 It is sometimes replaced. 【Chemistry 2】 A bicyclic heteroaryl selected from the group consisting of the following: In the aforementioned cases, one or more substituents on the bicyclic heteroaryl are independently selected from halogens, alkyls, haloalkyls, haloalkoxys, and heteroalkyls. R 2 It is selected from hydrogen, methyl and ethyl, A 1 These are, in some cases, substituted five-membered or six-membered monocyclic heteroaryl compounds. In the aforementioned cases, one or more substituents on the five-membered or six-membered monocyclic heteroaryl are independently selected from cyclopropyl, trifluoromethyl, and isopropyl. G is a ring atom selected from oxygen, sulfur, carbon, and nitrogen.
2. One or more substituents of the bicyclic heteroaryl substituted in the above case are, independently, halogen, methyl, and -CF 3 ,-CHF 2 ien-CH 2 A compound according to claim 1, selected from F and methoxy.
3. R 2 The compound according to claim 1 or 2, wherein hydrogen and methyl are selected.
4. A 1 A compound according to any one of claims 1 to 3, which may be substituted in some cases, selected from thiazolyl, pyrazolyl, and pyridinyl.
5. The compound according to any one of claims 1 to 4, wherein G is selected from O, S, CH, N, NH, and N (alkyl).
6. A 1 The compound according to any one of claims 1 to 5, wherein A is selected from pyrazolyl and pyridinyl, which may be optionally substituted.
7. The compound of formula (I) is of the following formula (B-Ia) or formula (BII-a): 【Transformation 3】 (In the formula, R N (Each of these is independently selected from cyclopropyl, trifluoromethyl, and isopropyl.) A compound according to any one of claims 1 to 6, which is a compound of the above.
8. A pharmaceutical composition comprising the compound described in any one of claims 1 to 7.
9. The pharmaceutical composition according to claim 8, further comprising a pharmaceutically acceptable diluent, excipient, or carrier.
10. A pharmaceutical composition according to claim 8 or 9 for use as a pharmaceutical.
11. A pharmaceutical composition according to claim 8 or 9 for use in the treatment or prevention of cancer, metabolic disorders, neurological disorders, or infectious diseases.
12. A pharmaceutical composition according to claim 8 or 9 for use in the treatment or prevention of cancer.
13. The pharmaceutical composition according to claim 12, wherein the cancer is selected from the group consisting of leukemia, chronic leukemia, adenoid cystic carcinoma, osteosarcoma, ovarian cancer, Ewing's sarcoma, lung adenocarcinoma, prostate cancer, lymphoma, neuroblastoma, gastrointestinal cancer, endometrial cancer, medulloblastoma, prostate cancer, esophageal cancer, breast cancer, thyroid cancer, meningioma, liver cancer, colorectal cancer, pancreatic cancer, chondrosarcoma, osteosarcoma, and kidney cancer.
Citation Information
Patent Citations
Aminothiazole inhibitors of cyclin-dependent kinases
JP2001522842A
Thiazole derivative
JP2002338556A
2-Amino-thiazole derivatives, processes for their preparation and their use as anticancer agents
JP2002528537A
3(5)-amino-pyrazole derivatives, processes for their preparation and their use as antitumor agents
JP2003507329A
Aminothiazole inhibitors of cyclin-dependent kinases
JP2003516981A