Nucleic acid artificial miniproteome library

By enriching in-frame coding regions from RNA transcripts using puromycin-tagged RNA complexes, the method addresses the inefficiencies of fragmented mRNA in cancer vaccines, facilitating the production of effective personalized tumor vaccines.

JP7854946B2Active Publication Date: 2026-05-07DIONIS THERAPEUTICS INC
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
DIONIS THERAPEUTICS INC
Filing Date
2021-05-26
Publication Date
2026-05-07

AI Technical Summary

Technical Problem

Existing cancer vaccines face inefficiencies due to the use of fragmented mRNA from tumor cells that are not in the proper reading frame for translation, necessitating an improved nucleic acid mini-proteome library enriched in open reading frames for personalized vaccines.

Method used

A method to enrich a library of in-frame coding region fragments from RNA transcripts by generating puromycin-tagged RNA transcripts, performing in vitro translation, and separating polypeptide-bound RNA complexes to create a nucleic acid library suitable for expressing the mini-proteome, which can be used in tumor vaccines.

Benefits of technology

The method effectively enriches in-frame coding regions from fragmented RNA, enabling the production of personalized tumor vaccines with improved translation efficiency and immune recognition.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007854946000001
    Figure 0007854946000001
  • Figure 0007854946000002
    Figure 0007854946000002
  • Figure 0007854946000003
    Figure 0007854946000003
Patent Text Reader

Abstract

Provided herein are nucleic acid artificial miniproteome libraries, as well as methods for making and using such libraries. Provided herein are compositions and methods for preparing nucleic acid libraries enriched for sequences containing in-frame coding regions from fragmented cellular RNA. Such libraries represent the miniproteome of a cell, such that the nucleic acids in the library can be transferred into suitable host cells to express the miniproteome. In certain embodiments, such miniproteome nucleic acid libraries are useful as tumor vaccines and / or for the preparation of tumor vaccines, particularly personalized tumor vaccines prepared from an individual's tumor RNA.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Related applications This application claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 030,056, filed May 26, 2020, which is incorporated herein by reference in its entirety. [Background technology]

[0002] The availability of nucleic acid artificial miniproteome libraries enriched with sequences encoding open reading frames would have many different potential applications. For example, such libraries would be valuable in the production of vaccines, particularly cancer vaccines.

[0003] Vaccines have a long history in cancer treatment. Cancer vaccines typically consist of tumor antigens and immunostimulatory molecules (e.g., cytokines or TLR ligands) that work together to activate antigen-specific cytotoxic T cells (CTLs) that recognize and lyse tumor cells. Such vaccines often contain either co-represented or patient-specific tumor antigens or whole tumor cell preparations. Co-represented tumor antigens are immunogenic proteins that are selectively expressed in tumors across many individuals and are generally delivered to patients as synthetic peptides, recombinant proteins, RNA, or DNA vectors. Patient-specific tumor antigens used in vaccines consist of proteins with tumor-specific mutations that result in changes in the amino acid sequence. Such mutated proteins have the potential to (a) uniquely mark tumors (compared to non-tumor cells) for recognition and destruction by the immune system, and (b) evade central, and occasionally peripheral, T cell resistance, and thus be recognized by more effective high-avidity T cell receptors. Whole tumor cell preparations contain all potential antigens in tumor cells and can be delivered to the patient as autoirradiated cells, cell lysates, cell fusions, heat shock protein preparations, or total mRNA (or a cDNA / DNA vector corresponding to total mRNA). When whole tumor cells are isolated from an autologous patient, the cells express patient-specific tumor antigens as well as co-existing tumor antigens.

[0004] To prepare a cancer vaccine based on the total cellular proteome, total mRNA from cells is used. However, such mRNA samples are often fragmented, especially when obtained from paraffin-embedded (FFPE) samples. The problem with using fragmented mRNA from tumor cells as a cancer vaccine is that most of the RNA fragments are not in the proper reading frame for efficient translation. Thus, there remains a need for an improved nucleic acid mini-proteome library enriched in open reading frame fragments that are useful for generating cancer vaccines. In particular, there remains a need for the preparation of an improved nucleic acid mini-proteome library for the preparation of personalized vaccines based on the proteome composition in each individual.

Summary of the Invention

Means for Solving the Problems

[0005] Provided herein are compositions and methods for preparing a nucleic acid library enriched in sequences containing in-frame coding regions from fragmented RNA of cells. Such a library corresponds to the mini-proteome of the cells such that the nucleic acids within the library can be transferred to a suitable host cell to express the mini-proteome. In certain embodiments, such a mini-proteome nucleic acid library is useful as a tumor vaccine and / or for the preparation of tumor vaccines, particularly personalized tumor vaccines prepared from the tumor RNA of an individual.

[0006] In certain embodiments, provided herein is a method of enriching a library of in-frame coding region fragments from a population of RNA transcripts or from a population of cellular RNA fragments (e.g., from a tumor). In some embodiments, provided herein is a method of generating a tumor vaccine or a method of treating a patient having a tumor using the generated tumor vaccine. In certain embodiments, the disclosure relates to vectors comprising libraries of RNA complexes bound to purified polypeptides, amplification products, and enriched in-frame coding fragment sequences, tumor vaccines, and pharmaceutical compositions thereof.

[0007] In a particular embodiment, provided herein is a method for enriching a library of in-frame coding region fragments from a population of RNA transcripts, the method comprising (a) generating a population of puromycin-tagged RNA transcripts, where each RNA transcript in the population of puromycin-tagged RNA transcripts comprises, in 5' to 3' order: (i) a translation start site followed by any multiple of 3 nucleotides that do not code for a stop codon; (ii) an RNA sequence transcribed from a cDNA fragment sequence from a library of cDNA sequences (e.g., from a tumor); (iii) a nucleotide sequence coding a polypeptide, having a length of a multiple of 3 nucleotides, and being coded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, the reading frame lacking an in-frame stop codon, but each of the other two reading frames containing a stop codon, and the 3' end of each RNA transcript is tagged with puromycin-tagged (b) a method comprising: (a) generating a population of puromycin-tagged RNA transcripts to be bound to the 5' end of a DNA linker; (b) carrying out an in vitro translation reaction on the puromycin-tagged RNA transcripts, wherein for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in the frame together with the translation start site, does not have a stop codon in the reading frame, and is in the frame together with the nucleotide sequence encoding the polypeptide, the puromycin covalently binds the translated polypeptide to the puromycin-tagged RNA transcript, forming a polypeptide-bound RNA complex; and (c) separating the polypeptide-bound RNA complex from RNA transcripts that are not in such a complex state, thereby enriching a library of in-frame coding region fragments from the population of RNA transcripts.

[0008] In a particular embodiment, a population of puromycin-tagged RNA transcripts is produced by (a) contacting the RNA transcripts with a sprint polynucleotide and a puromycin-tagged DNA linker, wherein the sprint polynucleotide each comprises, in 3' to 5' order, (I) a sequence complementary to the 3' end of the polypeptide-encoding nucleotide sequence and (II) a poly-T sequence, and the puromycin-tagged DNA linker each comprises, in 5' to 3' order, (1) a poly-dA sequence and (2) a puromycin molecule, wherein the polypeptide-encoding nucleotide sequence of the RNA transcript is hybridized to a sequence complementary to the 3' end of the polypeptide-encoding nucleotide sequence of the sprint polynucleotide, and the poly-dA sequence of the linker polynucleotide is hybridized to the poly-T sequence of the sprint polynucleotide; and (b) carrying out a ligation reaction to ligate the 3' end of the RNA transcript to the 5' end of the puromycin-tagged DNA linker to produce puromycin-tagged RNA transcripts.

[0009] In a particular embodiment, provided herein is a method for enriching a library of in-frame coding region fragments from a population of RNA transcripts, the method comprising: (a) generating a population of puromycin-tagged RNA transcripts, where each RNA transcript in the library of puromycin-tagged RNA transcripts comprises, in 5' to 3' order: (i) a translation start site followed by any multiple of 3 nucleotides that do not code for a stop codon; (ii) a nucleotide sequence coding for a polypeptide, having a length of a multiple of 3 nucleotides, and coded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within that reading frame; (iii) an RNA sequence transcribed from a cDNA fragment sequence from a library of cDNA sequences (e.g., from a tumor); and (iv) an adapter sequence, having a length of a multiple of 3 nucleotides, and lacking a stop codon within the reading frame beginning at the first 5' nucleotide of the adapter sequence, but having a stop codon within the other two reading frames. (b) a method comprising: (a) generating a population of puromycin-tagged RNA transcripts, each containing an adapter sequence including a codon, and linking the 3' end of each RNA transcript to the 5' end of a puromycin-tagged DNA linker; (b) performing an in vitro translation reaction on the puromycin-tagged RNA transcripts, wherein, for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in the frame together with the translation start site, does not contain a stop codon in the reading frame, and is in the frame together with the nucleotide sequence encoding the polypeptide, the puromycin covalently binds the translated polypeptide to the puromycin-tagged RNA transcript, forming a polypeptide-bound RNA complex; and (c) separating the polypeptide-bound RNA complex from RNA transcripts that are not in such a complex state, thereby enriching the population of RNA transcripts with a library of in-frame coding region fragments.

[0010] In a particular embodiment, a population of puromycin-tagged RNA transcripts is produced by (a) contacting the RNA transcripts with a sprint polynucleotide and a puromycin-tagged DNA linker, wherein the sprint polynucleotide each comprises, in 3' to 5' order, (I) a sequence complementary to the adapter sequence and (II) a poly-T sequence, and the puromycin-tagged DNA linker each comprises, in 5' to 3' order, (1) a poly-dA sequence and (2) a puromycin molecule, wherein the nucleotide sequence encoding the polypeptide of the RNA transcript is hybridized to the sequence complementary to the adapter sequence of the sprint polynucleotide, and the poly-dA sequence of the linker polynucleotide is hybridized to the poly-T sequence of the sprint polynucleotide; and (b) carrying out a ligation reaction to ligate the 3' end of the RNA transcript to the 5' end of the puromycin-tagged DNA linker to produce puromycin-tagged RNA transcripts.

[0011] In some embodiments, the method described herein further comprises the step of generating a library of RNA transcripts by carrying out a transcription reaction on a library of RNA expression constructs prior to step (a), wherein each RNA expression construct comprises (i) a transcription promoter, (ii) a translation initiation site followed by any multiple of 3 nucleotides that do not encode a stop codon, (iii) a cDNA fragment sequence from a library of cDNA fragment sequences, and (iv) a nucleotide sequence encoding a polypeptide, wherein the nucleotide sequence is a multiple of 3 nucleotides in length and is encoded by a reading frame that begins at the first 5' nucleotide of the nucleotide sequence, and which lacks an in-frame stop codon within that reading frame but contains a stop codon in each of the other two reading frames. In certain embodiments, the translation initiation site comprises a Shine-Dalgano sequence.

[0012] In certain embodiments, each RNA expression construct further comprises an adapter sequence having a length of a multiple of 3 nucleotides, lacking a stop codon within a reading frame that begins at the first 5' nucleotide of the adapter sequence, but containing stop codons within the other two reading frames. In some embodiments, the library of cDNA fragment sequences is enriched with cDNA fragments containing exomes. In some embodiments, the library of cDNA fragment sequences is enriched with cDNA fragment sequences containing mismatches.

[0013] In a particular embodiment, provided herein is a method for enriching a library of in-frame coding region fragments from a population of cellular RNA fragments (e.g., from a tumor), the method comprising: (a) performing a strand-specific random priming nucleic acid amplification reaction on the population of cellular RNA fragments to generate a population of cDNA fragments; (b) contacting the population of cDNA fragments with an exome capture probe to thereby enrich the population of cDNA fragments with cDNA fragments encoding exomes to generate a library of exome-enriched cDNA fragments; and (c) (i) a transcription promoter, (ii) a translation start site followed by any multiple of 3 nucleotides that do not encode a stop codon, (iii) one of the exome-enriched cDNA fragments from the library of exome-enriched cDNA fragments, and (iv) a nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, lacking an in-frame stop codon within that reading frame, but having within the other two reading frames (d) generating an RNA expression construct comprising a polypeptide-coding nucleotide sequence containing a stop codon, and (f) carrying out a transcription reaction using the RNA expression construct to generate a library of RNA transcripts, wherein each RNA transcript comprises, in 5' to 3' order, (i) a translation start site followed by any multiple of 3 nucleotides that do not encode a stop codon, (ii) an RNA sequence transcribed from a cDNA fragment sequence from a library of exome-enriched cDNA fragments, (iii) a polypeptide-coding nucleotide sequence having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, lacking an in-frame stop codon within the reading frame, but containing a stop codon in each of the other two reading frames, and (e) generating a population of puromycin-tagged RNA transcripts by ligating the 3' end of each RNA transcript to the 5' end of a puromycin-tagged DNA linker.(f) A method comprising: (f) performing an in vitro translation reaction on puromycin-tagged RNA transcripts, wherein for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in the frame together with the translation initiation site, does not have a stop codon in the reading frame, and is in the frame together with the nucleotide sequence encoding the polypeptide, the puromycin covalently binds the translated polypeptide to the puromycin-tagged RNA transcript, thereby forming a polypeptide-bound RNA complex; and (g) separating the polypeptide-bound RNA complex from RNA transcripts that are not in such a complex state, thereby enriching a library of in-frame coding region fragments from a population of cellular RNA fragments. In certain embodiments, the translation initiation site includes a Shine-Dalgano sequence.

[0014] In a particular embodiment, a population of puromycin-tagged RNA transcripts is produced by (a) contacting the RNA transcripts with a sprint polynucleotide and a puromycin-tagged DNA linker, wherein the sprint polynucleotide each comprises, in 3' to 5' order, (I) a sequence complementary to the 3' end of the polypeptide-encoding nucleotide sequence and (II) a poly-T sequence, and the puromycin-tagged DNA linker each comprises, in 5' to 3' order, (1) a poly-dA sequence and (2) a puromycin molecule, wherein the polypeptide-encoding nucleotide sequence of the RNA transcript is hybridized to a sequence complementary to the 3' end of the polypeptide-encoding nucleotide sequence of the sprint polynucleotide, and the poly-dA sequence of the linker polynucleotide is hybridized to the poly-T sequence of the sprint polynucleotide; and (b) carrying out a ligation reaction to ligate the 3' end of the RNA transcript to the 5' end of the puromycin-tagged DNA linker to produce puromycin-tagged RNA transcripts.

[0015] In a particular embodiment, provided herein is a method for enriching a library of in-frame coding region fragments from a population of cellular RNA fragments (e.g., from a tumor), the method comprising: (a) performing a strand-specific random priming nucleic acid amplification reaction on the population of cellular RNA fragments to generate a population of cDNA fragments; (b) contacting the population of cDNA fragments with an exome capture probe to thereby enrich the population of cDNA fragments with exome-enriching cDNA fragments to generate a library of exome-enriched cDNA fragments; and (c) a nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides that does not encode a stop codon, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within the reading frame; and (iv) an exome-enriched cDNA fragment from the library of exome-enriched cDNA fragments. (v) an adapter sequence having a length of a multiple of 3 nucleotides, wherein the adapter sequence contains no stop codon in a reading frame beginning at the first 5' nucleotide of the adapter sequence, and each of the other reading frames contains a stop codon; and (d) a transcription reaction using the RNA expression construct to produce a library of RNA transcripts, wherein each RNA transcript comprises, in 5' to 3' order: (i) a translation start site followed by any multiple of 3 nucleotides that do not encode a stop codon; (ii) a nucleotide sequence encoding a polypeptide having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon in the reading frame; (iii) an RNA sequence transcribed from the cDNA sequence of the library of exome-enriched cDNA fragments; and (iv) an adapter sequence having a length of a multiple of 3 nucleotides.(a) generating a library of RNA transcripts containing an adapter sequence, wherein the reading frame starting at the first 5' nucleotide of the adapter sequence does not contain a stop codon, but each of the other reading frames contains a stop codon; (e) generating a population of puromycin-tagged RNA transcripts, wherein the 3' end of each RNA transcript is attached to the 5' end of a puromycin-tagged DNA linker; and (f) performing an in vitro translation reaction on the puromycin-tagged RNA transcripts, wherein for each puromycin-tagged RNA fragment, the cDNA fragment sequence of the puromycin-tagged RNA transcript is obtained. A method comprising: (g) performing an in vitro translation reaction in which puromycin covalently binds the translated polypeptide to the puromycin-tagged RNA transcript, thereby forming a polypeptide-bound RNA complex, provided that the RNA sequence transcribed from is in a frame with a translation initiation site, does not have a stop codon in the reading frame, and is in a frame with a polypeptide-coding nucleotide sequence; and (g) separating the polypeptide-bound RNA complex from RNA transcripts that are not in such a complex state, thereby enriching a library of in-frame coding region fragments from a population of cellular RNA fragments. In certain embodiments, the translation initiation site includes a Shine-Dalgano sequence.

[0016] In a particular embodiment, a population of puromycin-tagged RNA transcripts is produced by (a) contacting the RNA transcripts with a sprint polynucleotide and a puromycin-tagged DNA linker, wherein the sprint polynucleotide each comprises, in 3' to 5' order, (I) a sequence complementary to the adapter sequence and (II) a poly-T sequence, and the puromycin-tagged DNA linker each comprises, in 5' to 3' order, (1) a poly-dA sequence and (2) a puromycin molecule, wherein the nucleotide sequence encoding the polypeptide of the RNA transcript is hybridized to the sequence complementary to the adapter sequence of the sprint polynucleotide, and the poly-dA sequence of the linker polynucleotide is hybridized to the poly-T sequence of the sprint polynucleotide; and (b) carrying out a ligation reaction to ligate the 3' end of the RNA transcript to the 5' end of the puromycin-tagged DNA linker to produce puromycin-tagged RNA transcripts.

[0017] In some embodiments, step (b) of the method for enriching a library of in-frame coding region fragments from a population of cellular RNA fragments described herein further comprises contacting a population of cDNA fragments with a MutS protein to thereby enrich the population of cDNA fragments with cDNA fragments containing mismatches resulting from either mutations or single nucleotide polymorphisms. In some embodiments, step (b) of the method for enriching a library of in-frame coding region fragments from a population of cellular RNA fragments described herein further comprises contacting an exome-enriched library of cDNA fragments with a MutS protein to thereby enrich the exome-enriched library of cDNA fragments with cDNA fragments containing mismatches resulting from either mutations or single nucleotide polymorphisms.

[0018] In some embodiments, the method for enriching a library of in-frame coding region fragments from a population of cellular RNA fragments described herein further includes the step of preparing a population of cellular RNA fragments from a sample. In some embodiments, the sample is a tumor sample, a normal tissue sample, a diseased tissue sample, a fresh sample, a frozen sample, and / or a paraffin-embedded (FFPE) sample. In certain embodiments, the sample is a paraffin-embedded (FFPE) tissue or tumor sample. In some embodiments, the method for enriching a library of in-frame coding region fragments from a population of cellular RNA fragments described herein further includes obtaining a sample from a subject (e.g., a cancer patient). In some embodiments, the cellular RNA fragments in the population of cellular RNA fragments are 150–250 nt in length (e.g., about 200 nt in length).

[0019] In some embodiments, the polypeptide-bound RNA complex is separated from the RNA transcript, which is not in the state of such a complex, by affinity purification of the polypeptide-bound RNA complex using a reagent that binds to the polypeptide encoded by the nucleotide sequence encoding the polypeptide. In some embodiments, the method herein further comprises performing an RT-PCR amplification reaction on the purified, protein-bound RNA complex to produce an amplification product containing an amplified DNA copy of the cDNA fragment sequence. In some embodiments, the method herein further comprises inserting the amplification product into a vector (e.g., a cloning vector, an expression vector, or a vaccine-coding vector) to produce a vector containing the sequence of the cDNA fragment. In certain embodiments, the method herein further comprises contacting the amplification product with a MutS protein to thereby enrich the amplification product with cDNA fragments containing mismatches resulting from either mutations or single nucleotide polymorphisms.

[0020] In some embodiments, the method herein further includes inserting a vaccine-encoding vector into bacteria and incubating the bacteria under conditions such that the bacteria express the vaccine encoded by the vaccine-encoding vector. In some embodiments, the method herein further includes introducing a vaccine-encoding vector into yeast and incubating the yeast under conditions such that the yeast expresses the vaccine encoded by the vaccine-encoding vector. In some embodiments, the method herein further includes subjecting the vaccine-encoding vector to an in vitro translation reaction to produce the vaccine encoded by the vaccine-encoding vector. In some embodiments, the method herein further includes transfecting or transducing the vector into mammalian cells (e.g., human cells) and incubating the mammalian cells under conditions such that the mammalian cells express the vaccine encoded by the vector. In some embodiments, the method herein further includes transfecting or transducing the vector into mammalian cells (e.g., human cells) ex vivo and delivering the mammalian cells to a subject (e.g., a human, preferably a cancer patient). In certain embodiments, the mammalian cells (e.g., human cells) are primary T cells or antigen-presenting cells isolated from the same or different subjects. In some embodiments, the methods described herein further include delivering a vector to a subject (e.g., a human, preferably a cancer patient) so that the subject expresses the vaccine encoded by the vector.

[0021] In certain embodiments, what is provided herein is a library of RNA complexes conjugated to purified polypeptides, produced according to the method described herein.

[0022] In certain embodiments, what is provided herein are amplification products produced according to the methods described herein.

[0023] In certain embodiments, what is provided herein is a vector (e.g., a cloning vector, an expression vector, or a vaccine encoding vector) produced according to the method described herein.

[0024] In certain embodiments, provided herein is a pharmaceutical composition comprising an amplification product produced according to the method described herein and a pharmaceutically acceptable carrier.

[0025] In certain embodiments, provided herein is a pharmaceutical composition comprising a vector produced according to the method described herein and a pharmaceutically acceptable carrier.

[0026] In a particular embodiment, the present invention provides a method for producing a tumor vaccine, (a) generating cellular RNA fragments from a target tumor sample; (b) performing a strand-specific random priming nucleic acid amplification reaction on the RNA fragments to generate cDNA fragments; (c) contacting the cDNA fragments with an exome capture probe to enrich the cDNA fragments with exome-enriching cDNA fragments to generate a library of exome-enriched cDNA fragments; (d) generating an RNA expression construct comprising (i) a transcription promoter; (ii) a translation start site followed by any multiple of 3 nucleotides that do not encode a stop codon; (iii) one of the exome-enriched cDNA fragments from the library of exome-enriched cDNA fragments; (iv) a polypeptide-enriching nucleotide sequence having a length of a multiple of 3 nucleotides, encoded by a reading frame that begins at the first 5' nucleotide of the nucleotide sequence, lacking an in-frame stop codon within that reading frame, but containing a stop codon in each of the other two reading frames; and (e) R The present invention provides a library of RNA transcripts, each RNA transcript comprising: (i) a translation initiation site followed by any multiple of three nucleotides that do not encode a stop codon, in 5' to 3' order; (ii) an RNA sequence transcribed from a cDNA fragment sequence from a library of exome-enriched cDNA fragments; (iii) a polypeptide encoding nucleotide sequence having a length of multiples of three nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, lacking an in-frame stop codon within the reading frame, but containing a stop codon in each of the other two reading frames; (f) a population of puromycin-tagged RNA transcripts, each RNA transcript having its 3' end ligated to the 5' end of a puromycin-tagged DNA linker; and (g) an in vitro translation reaction performed on the puromycin-tagged RNA transcripts.The method comprises: (h) performing an in vitro translation reaction in which, for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in a frame with a translation initiation site, does not contain a stop codon in the reading frame, and is in a frame with a nucleotide sequence encoding a polypeptide, the puromycin covalently binds the translated polypeptide to the puromycin-tagged RNA transcript, forming a polypeptide-bound RNA complex; (h) affinity purifying the polypeptide-bound RNA complex using a reagent that binds to the polypeptide encoded by the nucleotide sequence encoding the polypeptide, thereby generating a library of purified polypeptide-bound RNA complexes; (i) performing an amplification reaction on the purified library of polypeptide-bound RNA complexes to generate an amplification product containing the cDNA fragment sequence; and (j) generating a tumor vaccine from one or more of the amplification products from step (i). In certain embodiments, the translation initiation site includes a Shine-Dalgano sequence.

[0027] In a particular embodiment, a population of puromycin-tagged RNA transcripts is produced by (a) contacting the RNA transcripts with a sprint polynucleotide and a puromycin-tagged DNA linker, wherein the sprint polynucleotide each comprises, in 3' to 5' order, (I) a sequence complementary to the 3' end of the polypeptide-encoding nucleotide sequence and (II) a poly-T sequence, and the puromycin-tagged DNA linker each comprises, in 5' to 3' order, (1) a poly-dA sequence and (2) a puromycin molecule, wherein the polypeptide-encoding nucleotide sequence of the RNA transcript is hybridized to a sequence complementary to the 3' end of the polypeptide-encoding nucleotide sequence of the sprint polynucleotide, and the poly-dA sequence of the linker polynucleotide is hybridized to the poly-T sequence of the sprint polynucleotide; and (b) carrying out a ligation reaction to ligate the 3' end of the RNA transcript to the 5' end of the puromycin-tagged DNA linker to produce puromycin-tagged RNA transcripts.

[0028] In a particular embodiment, the present invention provides a method for producing a tumor vaccine, comprising: (a) generating a cellular RNA fragment from a tumor cell of interest; (b) performing a strand-specific random priming nucleic acid amplification reaction on the cellular RNA fragment to generate a cDNA fragment; (c) contacting the cDNA fragment with an exome capture probe to enrich the cDNA fragment with exome-enriching cDNA fragments to produce a library of exome-enriched cDNA fragments; (d) (i) a transcription promoter; (ii) a translation initiation site followed by any multiple of 3 nucleotides that do not encode a stop codon; (iii) a nucleotide sequence encoding a polypeptide, having a length of multiples of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within the reading frame; (iv) one of the exome-enriched cDNA fragments from the library of exome-enriched cDNA fragments; and (v) multiples of 3 (e) Producing an RNA expression construct having a nucleotide length and containing no stop codon in a reading frame beginning with the first 5' nucleotide of the adapter sequence, and containing a stop codon in each of the other reading frames; and (f) Producing a library of RNA transcripts by carrying out a transcription reaction using the RNA expression construct, wherein each RNA transcript comprises, in 5' to 3' order: (i) a translation start site followed by any multiple of 3 nucleotides that do not encode a stop codon; (ii) a nucleotide sequence encoding a polypeptide, having a nucleotide length of a multiple of 3 nucleotides, encoded by a reading frame beginning with the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon in the reading frame; (iii) an RNA sequence transcribed from cDNA fragment sequences of a library of exome-enriched cDNA fragments; and (iv) an adapter sequence having a nucleotide length of a multiple of 3 nucleotides and containing no stop codon in a reading frame beginning with the first 5' nucleotide of the adapter sequence.(f) generating a library of RNA transcripts containing adapter sequences, each of which contains a stop codon in each of the other reading frames; (g) generating a population of puromycin-tagged RNA transcripts, each of which has its 3' end attached to the 5' end of a puromycin-tagged DNA linker; and (g) performing an in vitro translation reaction on the puromycin-tagged RNA transcripts, wherein for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is located within the frame along with the translation start site, and the reading frame does not contain a stop codon, and is located within the frame along with a nucleotide sequence encoding a polypeptide. In the case of puromycin, the method comprises: (h) performing an in vitro translation reaction in which puromycin covalently binds a translated polypeptide to a puromycin-tagged RNA transcript to form a polypeptide-bound RNA complex; (i) affinity purifying the polypeptide-bound RNA complex using a reagent that binds to the polypeptide encoded by the polypeptide-coding nucleotide sequence to produce a library of purified polypeptide-bound RNA complexes; (j) performing an amplification reaction on the purified library of polypeptide-bound RNA complexes to produce an amplification product containing a cDNA fragment sequence; and (i) producing a tumor vaccine from one or more of the amplification products of step (i). In certain embodiments, the translation initiation site includes a Shine-Dalgano sequence.

[0029] In a particular embodiment, a population of puromycin-tagged RNA transcripts is produced by (a) contacting the RNA transcripts with a sprint polynucleotide and a puromycin-tagged DNA linker, wherein the sprint polynucleotide each comprises, in 3' to 5' order, (I) a sequence complementary to the adapter sequence and (II) a poly-T sequence, and the puromycin-tagged DNA linker each comprises, in 5' to 3' order, (1) a poly-dA sequence and (2) a puromycin molecule, wherein the nucleotide sequence encoding the polypeptide of the RNA transcript is hybridized to the sequence complementary to the adapter sequence of the sprint polynucleotide, and the poly-dA sequence of the linker polynucleotide is hybridized to the poly-T sequence of the sprint polynucleotide; and (b) carrying out a ligation reaction to ligate the 3' end of the RNA transcript to the 5' end of the puromycin-tagged DNA linker to produce puromycin-tagged RNA transcripts.

[0030] In some embodiments, the sample is a tumor sample, a normal tissue sample, a diseased tissue sample, a fresh sample, a frozen sample, and / or a paraffin-embedded (FFPE) sample. In certain embodiments, the sample is a paraffin-embedded (FFPE) tissue or tumor sample. In some embodiments, the method for producing the tumor vaccine described herein further includes obtaining a sample from a subject (e.g., a cancer patient). In some embodiments, the cellular RNA fragments in a population of cellular RNA fragments are 150–250 nt in length (e.g., about 200 nt in length).

[0031] In some embodiments, the method for generating a tumor vaccine described herein further includes, prior to step (j), inserting the amplification product into a vaccine-encoding vector to generate a vaccine-encoding vector containing a sequence of cDNA fragments.

[0032] In some embodiments, step (j) of a method for producing a tumor vaccine includes inserting a vaccine-encoding vector into a bacterium and incubating the bacterium under conditions such that the bacterium expresses the vaccine encoded by the vaccine-encoding vector.

[0033] In some embodiments, step (j) of a method for producing a tumor vaccine includes inserting a vaccine-encoding vector into yeast and incubating the yeast under conditions such that the yeast expresses the vaccine encoded by the vaccine-encoding vector.

[0034] In some embodiments, step (j) of a method for producing a tumor vaccine includes subjecting a vaccine encoding vector to an in vitro translation reaction to produce a vaccine encoded by the vaccine encoding vector.

[0035] In some embodiments, step (j) of a method for generating a tumor vaccine includes inserting a vaccine-encoding vector into mammalian cells (e.g., human cells) and incubating the mammalian cells under conditions such that the mammalian cells express the vaccine encoded by the vaccine-encoding vector.

[0036] In some embodiments, step (j) of a method for producing a tumor vaccine includes delivering a vaccine-encoding vector to a subject (e.g., a human, preferably a cancer patient) so that the subject expresses the vaccine encoded by the vaccine-encoding vector.

[0037] In some embodiments, step (j) of a method for generating a tumor vaccine includes transfecting or transducing a vaccine-encoding vector into human cells ex vivo and delivering the human cells to a target. In certain embodiments, the human cells are primary T cells or antigen-presenting cells isolated from the same or different target.

[0038] In some embodiments, the method for producing the tumor vaccine described herein further includes administering the tumor vaccine or cells containing the tumor vaccine to a subject (e.g., a human, preferably a cancer patient).

[0039] In certain embodiments, provided herein are methods for treating a tumor, the method comprising administering a tumor vaccine produced according to the method herein to a subject in need of treatment (e.g., a human, preferably a cancer patient).

[0040] In certain embodiments, provided herein is a method for identifying a drug target, comprising transfecting or transducing a vector produced according to the method herein into cells and identifying an in-frame coding region fragment that results in a selectable phenotype. In some embodiments, the vector is transfected or transduced into cells in vitro or in vivo. In certain embodiments, the in-frame coding region fragment is either enriched or depleted in cells having a selectable phenotype. In certain embodiments, the in-frame coding region fragment alters an intracellular pathway positively or negatively. In certain embodiments, the cells are normal cells, and the selectable phenotype is a disease phenotype.

[0041] In a particular embodiment, provided herein is a method for enriching a library of in-frame coding region fragments from a population of cellular RNA fragments, the method comprising: (a) performing a strand-specific random priming nucleic acid amplification reaction on a population of cellular RNA fragments to generate a population of cDNA fragments; and (b) inserting the population of cDNA fragments into a cloning vector to generate a library of DNA constructs, each DNA construct comprising, in 5' to 3' order: (i) a promoter, (ii) a translation initiation site followed by any multiple of 3 nucleotides that do not code for a stop codon, (iii) a nucleotide sequence coding for a polypeptide having a length of multiples of 3 nucleotides, coded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within the reading frame, and (iv) a cDN A method comprising: generating a library of DNA constructs comprising (v) a cDNA fragment from a population of fragments, and (c) a sequence encoding a membrane-presenting protein; (d) transforming cells with the library of DNA constructs; (e) incubating the cells under conditions that allow the cells to express the DNA constructs; (e) purifying cells expressing a complete fusion protein comprising a polypeptide encoded by a polypeptide-encoding nucleotide sequence, a polypeptide encoded by a cDNA fragment, and a membrane-presenting protein using a reagent that binds to the polypeptide encoded by the polypeptide-encoding nucleotide sequence (e.g., affinity purification of the cells); and (f) recovering in-frame cDNA fragment sequences from the purified cells (e.g., by PCR amplification), thereby enriching a library of in-frame coding region fragments from a population of cellular RNA fragments.

[0042] In a particular embodiment, the present invention provides a method for producing a tumor vaccine, comprising: (a) generating a cellular RNA fragment from a tumor sample of interest; (b) performing a strand-specific random priming nucleic acid amplification reaction on the RNA fragment to generate a cDNA fragment; and (c) inserting a population of cDNA fragments into a cloning vector to produce a library of DNA constructs, each DNA construct comprising, in 5' to 3' order: (i) a promoter; (ii) a translation initiation site followed by any multiple of 3 nucleotides that do not encode a stop codon; (iii) a nucleotide sequence encoding a polypeptide, having a length of multiples of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within the reading frame; and (iv) a cDNA fragment. The method comprises: generating a library of DNA constructs comprising (v) a single cDNA fragment from a population of fragments, and (d) a sequence encoding a membrane-presenting protein; (e) transforming cells with the library of DNA constructs; (f) incubating the cells under conditions such that the cells express the DNA constructs; (g) purifying (e.g., affinity purification) cells expressing a complete fusion protein comprising a polypeptide encoded by a polypeptide-encoding nucleotide sequence, a polypeptide encoded by a cDNA fragment, and a membrane-presenting protein, using a reagent that binds to the polypeptide encoded by the polypeptide-encoding nucleotide sequence; (g) recovering the in-frame cDNA fragment sequence from the purified cells (e.g., by PCR amplification); and (h) generating a tumor vaccine from one or more of the amplification products of step (g). In embodiments of the present invention, for example, the following items are provided. (Item 1) A method for enriching a library of in-frame coding region fragments from a population of RNA transcripts, wherein the method is (a) attaching a group of RNA transcripts to a puromycin-tagged linker polynucleotide, In the population of RNA transcripts, each RNA transcript is arranged in the order from 5' to 3'. (i) A translation initiation site followed by any multiple of 3 nucleotides that do not code for a stop codon, (ii) RNA sequences transcribed from cDNA fragment sequences from a library of cDNA sequences from tumors, (iii) A nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, and encoded by a reading frame beginning with the first 5' nucleotide of the nucleotide sequence, the reading frame lacking an in-frame stop codon, but each of the other two reading frames containing a stop codon, comprising: Each of the puromycin-tagged linker polynucleotides contains a 3' puromycin molecule. The 3' end of the RNA transcript is bound to the 5' end of the puromycin-tagged linker polynucleotide to generate a puromycin-tagged RNA transcript. (b) Performing an in vitro translation reaction on the puromycin-tagged RNA transcript, wherein for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in the frame together with the translation start site, does not have a stop codon in the reading frame, and is in the frame together with the nucleotide sequence encoding the polypeptide, the puromycin performs an in vitro translation reaction to covalently bind the translated polypeptide to the puromycin-tagged RNA transcript, thereby forming an RNA complex bound to the polypeptide. (c) A method comprising separating the RNA complex bound to the polypeptide from the RNA transcript which is not in such a complex state, thereby enriching a library of in-frame coding region fragments from the population of RNA transcripts. (Item 2) A method for enriching a library of in-frame coding region fragments from a population of RNA transcripts, wherein the method is (a) attaching a group of RNA transcripts to a puromycin-tagged linker polynucleotide, In the population of RNA transcripts, each RNA transcript is arranged in the order from 5' to 3'. (i) A translation initiation site followed by any multiple of 3 nucleotides that do not code for a stop codon, (ii) A nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within the reading frame, (iii) RNA sequences transcribed from cDNA fragment sequences from a library of cDNA sequences from tumors, (iv) an adapter sequence having a length of a multiple of 3 nucleotides, and comprising an adapter sequence which lacks a stop codon in the reading frame beginning at the first 5' nucleotide of the adapter sequence, but includes a stop codon in the other two reading frames, Each of the puromycin-tagged linker polynucleotides contains a 3' puromycin molecule. The 3' end of the RNA transcript is bound to the 5' end of the puromycin-tagged linker polynucleotide to generate a puromycin-tagged RNA transcript. (b) Performing an in vitro translation reaction on the puromycin-tagged RNA transcript, wherein for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in the frame together with the translation start site, does not have a stop codon in the reading frame, and is in the frame together with the nucleotide sequence encoding the polypeptide, the puromycin performs an in vitro translation reaction to covalently bind the translated polypeptide to the puromycin-tagged RNA transcript, thereby forming an RNA complex bound to the polypeptide. (c) A method comprising separating the RNA complex bound to the polypeptide from the RNA transcript which is not in such a complex state, thereby enriching a library of in-frame coding region fragments from the population of RNA transcripts. (Item 3) (a) Contacting the RNA transcript with a sprint polynucleotide and the puromycin-tagged linker polynucleotide, The aforementioned sprint polynucleotides are arranged in the order from 3' to 5', (I) A sequence complementary to the 3' end of the nucleotide sequence encoding the polypeptide, and (II) Linker target sequence, The linker polynucleotides tagged with puromycin are arranged in the order from 5' to 3', (1) A sequence complementary to the linker target sequence, and (2) Contains a puromycin molecule, The nucleotide sequence encoding the polypeptide of the RNA transcript is hybridized to a sequence complementary to the 3' end of the nucleotide sequence encoding the polypeptide of the sprint polynucleotide, and the sequence complementary to the linker target sequence of the linker polynucleotide is hybridized to the linker target sequence of the sprint polynucleotide, by contact. (b) The method according to item 1 or 2, wherein a ligation reaction is carried out to ligate the 3' end of the RNA transcript to the 5' end of the puromycin-tagged DNA linker to produce a puromycin-tagged RNA transcript, thereby conjugating the group of RNA transcripts to the puromycin-tagged linker polynucleotide. (Item 4) (i) The sprint target sequence is a polydT sequence, and the sequence complementary to the sprint target sequence is a polydA sequence, or (ii) The method according to item 3, wherein the sprint target sequence is a polydA sequence and the sequence complementary to the sprint target sequence is a polydT sequence. (Item 5) The method according to any one of items 1 to 4, wherein the RNA complex bound to the polypeptide is separated from the RNA transcript that is not in the form of such complex by affinity purification of the RNA complex bound to the polypeptide using a reagent that binds to the polypeptide encoded by the nucleotide sequence encoding the polypeptide. (Item 6) The method according to item 5, further comprising performing an RT-PCR amplification reaction on the RNA complex bound to the purified polypeptide to produce an amplification product containing an amplified DNA copy of the cDNA fragment sequence. (Item 7) The method according to item 6, further comprising inserting the amplification product into a cloning vector. (Item 8) The process further includes the step of generating a library of RNA transcripts by performing a transcription reaction on a library of RNA expression constructs prior to step (a), wherein each RNA expression construct is (i) Transcription promoter, (ii) A translation initiation site followed by any multiple of 3 nucleotides that do not code for a stop codon, (iii) cDNA fragment sequences from a library of cDNA fragment sequences, and (iv) The method according to any one of items 1 to 7, comprising a nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, and encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, the reading frame lacking an in-frame stop codon, but each of the other two reading frames containing a stop codon. (Item 9) The method according to item 8, wherein each RNA expression construct further comprises an adapter sequence having a length of a multiple of 3 nucleotides, lacking a stop codon in a reading frame beginning at the first 5' nucleotide of the adapter sequence, but containing stop codons in the other two reading frames. (Item 10) The library of cDNA fragment sequences is enriched with cDNA fragments containing exomes, as described in item 8 or 9. (Item 11) The library of cDNA fragment sequences is enriched with cDNA fragment sequences containing mismatches, as described in any one of items 8 to 10. (Item 12) The method according to any one of items 8 to 11, wherein the translation initiation site includes a Shine-Dalgano sequence. (Item 13) A method for enriching a library of in-frame coding region fragments from a population of cellular RNA fragments from a tumor, wherein the method is (a) A population of cDNA fragments is generated by performing a strand-specific random priming nucleic acid amplification reaction on a population of cellular RNA fragments, (b) Contacting the collection of cDNA fragments with an exome capture probe, thereby enriching the collection of cDNA fragments with cDNA fragments that encode exomes, to generate a library of exome-enriched cDNA fragments, (c)(i) a transcription promoter, (ii) a translation start site followed by any multiple of 3 nucleotides that do not encode a stop codon, (iii) one of the exome-enriched cDNA fragments from a library of the exome-enriched cDNA fragments, and (v) a nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, lacking an in-frame stop codon within that reading frame, but containing stop codons within the other two reading frames, to generate an RNA expression construct comprising: (c)(i) a transcription promoter, (ii) a translation start site followed by any multiple of 3 nucleotides that do not encode a stop codon, (iii) one of the exome-enriched cDNA fragments from a library of the exome-enriched cDNA fragments, and (v) a nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, encoded by a reading frame that begins at the first 5' nucleotide of the nucleotide sequence, lacking an in-frame stop codon within that reading frame, but containing stop codons within the other two reading frames. (d) Performing a transcription reaction using the RNA expression construct to produce a library of RNA transcripts, wherein each RNA transcript is in the order from 5' to 3', (i) A translation initiation site followed by any multiple of 3 nucleotides that do not code for a stop codon, (ii) RNA sequences transcribed from cDNA fragment sequences of the library of exome-enriched cDNA fragments, (iii) To generate a library of RNA transcripts comprising a polypeptide-coding nucleotide sequence having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, the reading frame lacking an in-frame stop codon, but each of the other two reading frames containing a stop codon; (e) Conjugating a group of RNA transcripts to a puromycin-tagged linker polynucleotide, wherein each puromycin-tagged linker polynucleotide contains a 3' puromycin molecule, and the 3' end of the RNA transcript is conjugated to the 5' end of the puromycin-tagged linker polynucleotide to produce a puromycin-tagged RNA transcript. (f) Performing an in vitro translation reaction on the puromycin-tagged RNA transcript, wherein for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in the frame together with the translation start site, does not have a stop codon in the reading frame, and is in the frame together with the nucleotide sequence encoding the polypeptide, the puromycin performs an in vitro translation reaction to covalently bind the translated polypeptide to the puromycin-tagged RNA transcript, thereby forming an RNA complex bound to the polypeptide. (g) A method comprising separating the RNA complex bound to the polypeptide from the RNA transcript which is not in such a complex state, thereby enriching a library of in-frame coding region fragments from a population of cellular RNA fragments. (Item 14) A method for enriching a library of in-frame coding region fragments from a population of cellular RNA fragments from a tumor, wherein the method is (a) A population of cDNA fragments is generated by performing a strand-specific random priming nucleic acid amplification reaction on a population of cellular RNA fragments, (b) Contacting the collection of cDNA fragments with an exome capture probe, thereby enriching the collection of cDNA fragments with cDNA fragments that encode exomes, to generate a library of exome-enriched cDNA fragments, (c) To generate an RNA expression construct comprising (i) a transcription promoter, (ii) a translation start site followed by any multiple of 3 nucleotides that do not encode a stop codon, (iii) a nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within the reading frame, (iv) one of the exome-enriched cDNA fragments from a library of the exome-enriched cDNA fragments, and (v) an adapter sequence having a length of a multiple of 3 nucleotides, lacking a stop codon within the reading frame beginning at the first 5' nucleotide of the adapter sequence, and each of the other reading frames containing a stop codon, (d) Performing a transcription reaction using the RNA expression construct to produce a library of RNA transcripts, wherein each RNA transcript is in the order from 5' to 3', (i) A translation initiation site followed by any multiple of 3 nucleotides that do not code for a stop codon, (ii) A nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within the reading frame, (iii) RNA sequences transcribed from cDNA fragment sequences of the exome-enriched cDNA fragment library, and (iv) To generate a library of RNA transcripts comprising an adapter sequence having a length of a multiple of 3 nucleotides, wherein the reading frame beginning at the first 5' nucleotide of the adapter sequence does not contain a stop codon, and each of the other reading frames contains a stop codon; (e) Conjugating a group of RNA transcripts to a puromycin-tagged linker polynucleotide, wherein each puromycin-tagged linker polynucleotide contains a 3' puromycin molecule, and the 3' end of the RNA transcript is conjugated to the 5' end of the puromycin-tagged linker polynucleotide to produce a puromycin-tagged RNA transcript. (f) Performing an in vitro translation reaction on the puromycin-tagged RNA transcript, wherein for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in the frame together with the translation start site, does not have a stop codon in the reading frame, and is in the frame together with the nucleotide sequence encoding the polypeptide, the puromycin performs an in vitro translation reaction to covalently bind the translated polypeptide to the puromycin-tagged RNA transcript, thereby forming an RNA complex bound to the polypeptide. (g) A method comprising separating the RNA complex bound to the polypeptide from the RNA transcript which is not in such a complex state, thereby enriching a library of in-frame coding region fragments from a population of cellular RNA fragments. (Item 15) (a) Contacting the RNA transcript with a sprint polynucleotide and the puromycin-tagged linker polynucleotide, The aforementioned sprint polynucleotides are arranged in the order from 3' to 5', (I) A sequence complementary to the 3' end of the nucleotide sequence encoding the polypeptide, and (II) Linker target sequence, The linker polynucleotides tagged with puromycin are arranged in the order from 5' to 3', (1) A sequence complementary to the linker target sequence, and (2) Contains a puromycin molecule, The nucleotide sequence encoding the polypeptide of the RNA transcript is hybridized to a sequence complementary to the 3' end of the nucleotide sequence encoding the polypeptide of the sprint polynucleotide, and the sequence complementary to the linker target sequence of the linker polynucleotide is hybridized to the linker target sequence of the sprint polynucleotide, by contact. (b) The method of item 13 or 14, wherein a ligation reaction is carried out to ligate the 3' end of the RNA transcript to the 5' end of the puromycin-tagged DNA linker to produce a puromycin-tagged RNA transcript, thereby conjugating the group of RNA transcripts to the puromycin-tagged linker polynucleotide. (Item 16) (i) The sprint target sequence is a polydT sequence, and the sequence complementary to the sprint target sequence is a polydA sequence, or (ii) The method according to item 15, wherein the sprint target sequence is a polydA sequence and the sequence complementary to the sprint target sequence is a polydT sequence. (Item 17) The method according to any one of items 13 to 16, further comprising step (b) contacting the collection of cDNA fragments with a MutS protein to thereby enrich the collection of cDNA fragments with cDNA fragments containing mismatches resulting from either mutations or single nucleotide polymorphisms. (Item 18) The method according to any one of items 13 to 16, further comprising step (b) contacting the library of exome-enriched cDNA fragments with a MutS protein, thereby enriching the library of exome-enriched cDNA fragments with cDNA fragments containing mismatches resulting from either mutations or single nucleotide polymorphisms. (Item 19) The method according to any one of items 13 to 18, further comprising the step of preparing a population of cellular RNA fragments from a sample. (Item 20) The method according to item 19, wherein the sample is a tumor sample, a normal tissue sample, a diseased tissue sample, a fresh sample, a frozen sample, and / or a paraffin-embedded (FFPE) sample. (Item 21) The method according to item 20, wherein the sample is paraffin-embedded (FFPE) tissue or tumor sample. (Item 22) The method according to any one of items 17 to 20, further comprising obtaining the sample from the subject. (Item 23) The method according to any one of items 13 to 22, wherein the cellular RNA fragments in the population of cellular RNA fragments are 150 to 250 nt in length. (Item 24) The method according to item 23, wherein the cellular RNA fragments in the population of cellular RNA fragments are approximately 200 nt in length. (Item 25) The method according to any one of items 13 to 24, wherein the translation initiation site includes a Shine-Dalgano sequence. (Item 26) The method according to any one of items 1 to 25, wherein the RNA complex bound to the polypeptide is separated from the RNA transcript that is not in the form of such complex by affinity purification of the RNA complex bound to the polypeptide using a reagent that binds to the polypeptide encoded by the nucleotide sequence encoding the polypeptide. (Item 27) The method according to item 26, further comprising performing an RT-PCR amplification reaction on a library of RNA complexes bound to the purified polypeptide to produce an amplification product containing the sequence of the cDNA fragment. (Item 28) The method according to item 27, further comprising contacting the amplification product with a MutS protein to thereby enrich the amplification product with respect to a cDNA fragment containing a mismatch resulting from either a mutation or a single nucleotide polymorphism. (Item 29) The method according to item 27 or 28, further comprising inserting the amplification product into a vector to generate a vector containing the sequence of the cDNA fragment. (Item 30) The method according to item 29, wherein the vector is a cloning vector. (Item 31) The method according to item 29, wherein the vector is an expression vector. (Item 32) The method according to item 29, wherein the vector is a vector encoding a vaccine. (Item 33) The method according to item 32, further comprising inserting a vector encoding the vaccine into a bacterium and incubating the bacterium under conditions such that the bacterium expresses the vaccine encoded by the vector encoding the vaccine. (Item 34) The method according to item 32, further comprising inserting a vector encoding the vaccine into yeast and incubating the yeast under conditions such that the yeast expresses the vaccine encoded by the vector encoding the vaccine. (Item 35) The method according to item 32, further comprising subjecting the vector encoding the vaccine to an in vitro translation reaction to produce the vaccine encoded by the vector encoding the vaccine. (Item 36) The method according to item 29, further comprising transfecting or transducing the vector into mammalian cells and incubating the mammalian cells under conditions such that the vaccine encoded by the vector is expressed in the mammalian cells. (Item 37) The method according to item 36, wherein the mammalian cells are human cells. (Item 38) The method according to item 29, further comprising transfecting or transfecting human cells ex vivo with the vector and delivering the human cells as the target. (Item 39) The method according to item 38, wherein the human cells are primary T cells or antigen-presenting cells isolated from the same or different subject. (Item 40) The method according to item 29, further comprising delivering the vector to the target so that the target expresses the vaccine encoded by the vector. (Item 41) The method described in any one of items 38 to 40, wherein the subject is a human. (Item 42) A library of RNA complexes bound to purified polypeptides, produced according to the method described in item 26. (Item 43) Amplified product produced according to the method described in item 27 or 28. (Item 44) A vector generated according to the method described in item 29. (Item 45) The vector described in item 44 is a cloning vector. (Item 46) The vector described above is an expression vector, as described in item 44. (Item 47) The vector described in item 44, wherein the vector is a vector that codes for a vaccine. (Item 48) A pharmaceutical composition comprising the amplification product described in item 43 and a pharmaceutically acceptable carrier. (Item 49) A pharmaceutical composition comprising a vector described in any one of items 44 to 47 and a pharmaceutically acceptable carrier. (Item 50) A method for producing a tumor vaccine, (a) Generating cell RNA fragments from the target tumor sample, (b) A chain-specific random priming nucleic acid amplification reaction is performed on the RNA fragment to generate a cDNA fragment, (c) Contacting the cDNA fragment with an exome capture probe, thereby enriching the cDNA fragment with respect to the cDNA fragment encoding the exome, and generating a library of exome-enriched cDNA fragments. (d) To generate an RNA expression construct comprising (i) a transcription promoter, (ii) a translation start site followed by any multiple of 3 nucleotides that do not encode a stop codon, (iii) one of the exome-enriched cDNA fragments from a library of the exome-enriched cDNA fragments, and (iv) a nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, lacking an in-frame stop codon within the reading frame, but containing a stop codon in each of the other two reading frames, (e) Performing a transcription reaction using the RNA expression construct to produce a library of RNA transcripts, wherein each RNA transcript is in the order of 5' to 3', (i) A translation initiation site followed by any multiple of 3 nucleotides that do not code for a stop codon, (ii) RNA sequences transcribed from cDNA fragment sequences of the library of exome-enriched cDNA fragments, (iii) generating a library of RNA transcripts comprising a polypeptide-coding nucleotide sequence having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, lacking an in-frame stop codon within the reading frame, but containing a stop codon in each of the other two reading frames, (f) Binding the RNA transcript to a puromycin-tagged linker polynucleotide, wherein each puromycin-tagged linker polynucleotide contains a 3' puromycin molecule, and the 3' end of the RNA transcript is bound to the 5' end of the puromycin-tagged linker polynucleotide to produce a puromycin-tagged RNA transcript. (g) Performing an in vitro translation reaction on the puromycin-tagged RNA transcript, wherein, for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in the frame together with the translation start site, does not have a stop codon in the reading frame, and is in the frame together with the nucleotide sequence encoding the polypeptide, the puromycin is used to covalently bind the translated polypeptide to the puromycin-tagged RNA transcript, thereby forming an RNA complex bound to the polypeptide, in an in vitro translation reaction. (h) Purifying the RNA complex bound to the polypeptide with affinity using a reagent that binds to the polypeptide encoded by the nucleotide sequence encoding the polypeptide, thereby generating a library of the purified polypeptide-bound RNA complex, (i) An amplification reaction is carried out on the library of RNA complexes bound to the purified polypeptide to produce an amplified product containing the sequence of the cDNA fragment, (j) A method comprising generating a tumor vaccine from one or more of the amplification products of step (i). (Item 51) A method for producing a tumor vaccine, (a) Generating cell RNA fragments from the target tumor sample, (b) A chain-specific random priming nucleic acid amplification reaction is performed on the cell RNA fragment to generate a cDNA fragment, (c) Contacting the cDNA fragment with an exome capture probe, thereby enriching the cDNA fragment with respect to the cDNA fragment encoding the exome, and generating a library of exome-enriched cDNA fragments. (d) To generate an RNA expression construct comprising (i) a transcription promoter, (ii) a translation start site followed by any multiple of 3 nucleotides that do not encode a stop codon, (iii) a nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within the reading frame, (iv) one of the exome-enriched cDNA fragments from a library of the exome-enriched cDNA fragments, and (v) an adapter sequence having a length of a multiple of 3 nucleotides, lacking a stop codon within the reading frame beginning at the first 5' nucleotide of the adapter sequence, and each of the other reading frames containing a stop codon, (e) Performing a transcription reaction using the RNA expression construct to produce a library of RNA transcripts, wherein each RNA transcript is in the order of 5' to 3', (i) A translation initiation site followed by any multiple of 3 nucleotides that do not code for a stop codon, (ii) A nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within the reading frame, (iii) RNA sequences transcribed from cDNA fragment sequences of the exome-enriched cDNA fragment library, and (iv) To generate a library of RNA transcripts comprising an adapter sequence having a length of a multiple of 3 nucleotides, wherein the reading frame beginning at the first 5' nucleotide of the adapter sequence does not contain a stop codon, and each of the other reading frames contains a stop codon; (f) Binding the RNA transcript to a puromycin-tagged linker polynucleotide, wherein each puromycin-tagged linker polynucleotide contains a 3' puromycin molecule, and the 3' end of the RNA transcript is bound to the 5' end of the puromycin-tagged linker polynucleotide to produce a puromycin-tagged RNA transcript. (g) Performing an in vitro translation reaction on the puromycin-tagged RNA transcript, wherein, for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in the frame together with the translation start site, does not have a stop codon in the reading frame, and is in the frame together with the nucleotide sequence encoding the polypeptide, the puromycin is used to covalently bind the translated polypeptide to the puromycin-tagged RNA transcript, thereby forming an RNA complex bound to the polypeptide, in an in vitro translation reaction. (h) Purifying the RNA complex bound to the polypeptide with affinity using a reagent that binds to the polypeptide encoded by the nucleotide sequence encoding the polypeptide, thereby generating a library of the purified polypeptide-bound RNA complex, (i) An amplification reaction is carried out on the library of RNA complexes bound to the purified polypeptide to produce an amplified product containing the sequence of the cDNA fragment, (j) A method comprising generating a tumor vaccine from one or more of the amplification products of step (i). (Item 52) (a) Contacting the RNA transcript with a sprint polynucleotide and the puromycin-tagged linker polynucleotide, The aforementioned sprint polynucleotides are arranged in the order from 3' to 5', (I) A sequence complementary to the 3' end of the nucleotide sequence encoding the polypeptide, and (II) Linker target sequence, The linker polynucleotides tagged with puromycin are arranged in the order from 5' to 3', (1) A sequence complementary to the linker target sequence, and (2) Contains a puromycin molecule, The nucleotide sequence encoding the polypeptide of the RNA transcript is hybridized to a sequence complementary to the 3' end of the nucleotide sequence encoding the polypeptide of the sprint polynucleotide, and the sequence complementary to the linker target sequence of the linker polynucleotide is hybridized to the linker target sequence of the sprint polynucleotide, by contact. (b) The method according to item 50 or 51, wherein a ligation reaction is carried out to ligate the 3' end of the RNA transcript to the 5' end of the puromycin-tagged DNA linker to produce a puromycin-tagged RNA transcript, thereby conjugating the group of RNA transcripts to the puromycin-tagged linker polynucleotide. (Item 53) (i) The sprint target sequence is a polydT sequence, and the sequence complementary to the sprint target sequence is a polydA sequence, or (ii) The method according to item 52, wherein the sprint target sequence is a polydA sequence and the sequence complementary to the sprint target sequence is a polydT sequence. (Item 54) The method according to any one of items 50 to 53, wherein the tumor sample is a fresh sample, a frozen sample, and / or a paraffin-embedded (FFPE) sample. (Item 55) The method according to item 54, wherein the sample is a paraffin-embedded (FFPE) tumor sample. (Item 56) The method according to any one of items 50 to 55, further comprising obtaining the tumor sample from the subject. (Item 57) The method according to any one of items 50 to 56, wherein the cellular RNA fragment is 150 to 250 nt in length. (Item 58) The method according to item 57, wherein the cellular RNA fragment is approximately 200 nt in length. (Item 59) The method according to any one of items 50 to 58, wherein the translation initiation site includes a Shine-Dalgano sequence. (Item 60) The method according to any one of items 50 to 59, further comprising, prior to step (j), inserting the amplification product into a vaccine-encoding vector to generate a vaccine-encoding vector containing the sequence of the cDNA fragment. (Item 61) The method according to item 60, wherein step (j) includes inserting a vector encoding the vaccine into a bacterium and incubating the bacterium under conditions such that the bacterium expresses the vaccine encoded by the vector encoding the vaccine. (Item 62) The method according to item 60, wherein step (j) includes inserting a vector encoding the vaccine into yeast and incubating the yeast under conditions such that the yeast expresses the vaccine encoded by the vector encoding the vaccine. (Item 63) The method according to item 60, wherein step (j) comprises subjecting the vector encoding the vaccine to an in vitro translation reaction to produce the vaccine encoded by the vector encoding the vaccine. (Item 64) The method according to item 60, wherein step (j) includes transfecting or transducing a mammalian cell with a vector encoding the vaccine, and incubating the mammalian cell under conditions such that the mammalian cell expresses the vaccine encoded by the vector encoding the vaccine. (Item 65) The method according to item 64, wherein the mammalian cells are human cells. (Item 66) The method according to any one of items 50 to 65, further comprising administering the tumor vaccine to the target of the tumor vaccine. (Item 67) The method according to item 60, wherein step (j) comprises transfecting or transducing a vector encoding the vaccine into human cells and delivering the human cells to the target. (Item 68) The method according to item 67, wherein the human cells are antigen-presenting cells isolated from the same or different subjects. (Item 69) The method of item 60, wherein step (j) includes delivering the vector encoding the vaccine to the subject so that the subject expresses the vaccine encoded by the vector encoding the vaccine. (Item 70) The method according to any one of items 66 to 69, wherein the subject is a human. (Item 71) A method for treating a tumor, comprising administering the tumor vaccine, which is produced according to the method described in any one of items 50 to 65, to a subject in need of treatment. (Item 72) A method for identifying a drug target, comprising transfecting or transducing a vector produced according to the method described in item 29 into cells and identifying an in-frame coding region fragment that results in a selectable phenotype. (Item 73) The method according to item 72, wherein the vector is transfected or transduced into cells in vitro or in vivo. (Item 74) The method according to item 72 or 73, wherein the in-frame coding region fragment is either enriched or depleted in the cell having the selectable phenotype. (Item 75) The method according to any one of items 72 to 74, wherein the in-frame coding region fragment causes a positive or negative change in an intracellular pathway. (Item 76) The method according to any one of items 72 to 75, wherein the cells are normal cells and the selectable phenotype is a disease phenotype. (Item 77) A method for enriching a library of in-frame coding region fragments from a collection of cellular RNA fragments, wherein the method is (a) A population of cDNA fragments is generated by performing a strand-specific random priming nucleic acid amplification reaction on a population of cellular RNA fragments, (b) Contacting the collection of cDNA fragments with an exome capture probe, thereby enriching the collection of cDNA fragments with cDNA fragments that encode exomes, to generate a library of exome-enriched cDNA fragments, The library of exome-enriched cDNA fragments is brought into contact with the MutS protein, thereby enriching the library of exome-enriched cDNA fragments with cDNA fragments containing mismatches resulting from either mutations or single nucleotide polymorphisms. (d) To generate an RNA expression construct comprising (i) a transcription promoter, (ii) a translation start site followed by any multiple of 3 nucleotides that do not encode a stop codon, (iii) one of the exome-enriched cDNA fragments from a library of the exome-enriched cDNA fragments, and (v) a nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, lacking an in-frame stop codon within that reading frame, but containing stop codons within the other two reading frames, (e) Performing a transcription reaction using the RNA expression construct to produce a library of RNA transcripts, wherein each RNA transcript is in the order of 5' to 3', (i) A translation initiation site followed by any multiple of 3 nucleotides that do not code for a stop codon, (ii) RNA sequences transcribed from cDNA fragment sequences of the library of exome-enriched cDNA fragments, (iii) generating a library of RNA transcripts comprising a polypeptide-coding nucleotide sequence having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, lacking an in-frame stop codon within the reading frame, but containing a stop codon in each of the other two reading frames, (f) Binding the RNA transcript to a puromycin-tagged linker polynucleotide, wherein each puromycin-tagged linker polynucleotide contains a 3' puromycin molecule, and the 3' end of the RNA transcript is bound to the 5' end of the puromycin-tagged linker polynucleotide to produce a puromycin-tagged RNA transcript. (g) Performing an in vitro translation reaction on the puromycin-tagged RNA transcript, wherein, for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in the frame together with the translation start site, does not have a stop codon in the reading frame, and is in the frame together with the nucleotide sequence encoding the polypeptide, the puromycin is used to covalently bind the translated polypeptide to the puromycin-tagged RNA transcript, thereby forming an RNA complex bound to the polypeptide, in an in vitro translation reaction. (h) A method comprising separating the RNA complex bound to the polypeptide from the RNA transcript which is not in such a complex state, thereby enriching a library of in-frame coding region fragments from the population of RNA transcripts. (Item 78) A method for enriching a library of in-frame coding region fragments from a collection of cellular RNA fragments, wherein the method is (a) A population of cDNA fragments is generated by performing a strand-specific random priming nucleic acid amplification reaction on a population of cellular RNA fragments, (b) Contacting the collection of cDNA fragments with an exome capture probe, thereby enriching the collection of cDNA fragments with cDNA fragments that encode exomes, to generate a library of exome-enriched cDNA fragments, The library of exome-enriched cDNA fragments is brought into contact with the MutS protein, thereby enriching the library of exome-enriched cDNA fragments with cDNA fragments containing mismatches resulting from either mutations or single nucleotide polymorphisms. (d) To generate an RNA expression construct comprising (i) a transcription promoter, (ii) a translation start site followed by any multiple of 3 nucleotides that do not encode a stop codon, (iii) a nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within the reading frame, (iv) one of the exome-enriched cDNA fragments from a library of the exome-enriched cDNA fragments, and (v) an adapter sequence having a length of a multiple of 3 nucleotides, lacking a stop codon within the reading frame beginning at the first 5' nucleotide of the adapter sequence, and each of the other reading frames containing a stop codon, (e) Performing a transcription reaction using the RNA expression construct to produce a library of RNA transcripts, wherein each RNA transcript is in the order of 5' to 3', (i) A translation initiation site followed by any multiple of 3 nucleotides that do not code for a stop codon, (ii) A nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within the reading frame, (iii) RNA sequences transcribed from cDNA fragment sequences of the exome-enriched cDNA fragment library, and (iv) To generate a library of RNA transcripts comprising an adapter sequence having a length of a multiple of 3 nucleotides, wherein the reading frame beginning at the first 5' nucleotide of the adapter sequence does not contain a stop codon, and each of the other reading frames contains a stop codon; (f) Binding the RNA transcript to a puromycin-tagged linker polynucleotide, wherein each puromycin-tagged linker polynucleotide contains a 3' puromycin molecule, and the 3' end of the RNA transcript is bound to the 5' end of the puromycin-tagged linker polynucleotide to produce a puromycin-tagged RNA transcript. (g) Performing an in vitro translation reaction on the puromycin-tagged RNA transcript, wherein, for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in the frame together with the translation start site, does not have a stop codon in the reading frame, and is in the frame together with the nucleotide sequence encoding the polypeptide, the puromycin is used to covalently bind the translated polypeptide to the puromycin-tagged RNA transcript, thereby forming an RNA complex bound to the polypeptide, in an in vitro translation reaction. (h) A method comprising separating the RNA complex bound to the polypeptide from the RNA transcript which is not in such a complex state, thereby enriching a library of in-frame coding region fragments from the population of RNA transcripts. (Item 79) (a) Contacting the RNA transcript with a sprint polynucleotide and the puromycin-tagged linker polynucleotide, The aforementioned sprint polynucleotides are arranged in the order from 3' to 5', (I) A sequence complementary to the 3' end of the nucleotide sequence encoding the polypeptide, and (II) Linker target sequence, The linker polynucleotides tagged with puromycin are arranged in the order from 5' to 3', (1) A sequence complementary to the linker target sequence, and (2) Contains a puromycin molecule, The nucleotide sequence encoding the polypeptide of the RNA transcript is hybridized to a sequence complementary to the 3' end of the nucleotide sequence encoding the polypeptide of the sprint polynucleotide, and the sequence complementary to the linker target sequence of the linker polynucleotide is hybridized to the linker target sequence of the sprint polynucleotide, by contact. (b) The method according to item 77 or 78, wherein a ligation reaction is carried out to ligate the 3' end of the RNA transcript to the 5' end of the puromycin-tagged DNA linker to produce a puromycin-tagged RNA transcript, thereby conjugating the group of RNA transcripts to the puromycin-tagged linker polynucleotide. (Item 80) (i) The sprint target sequence is a polydT sequence, and the sequence complementary to the sprint target sequence is a polydA sequence, or (ii) The method according to item 79, wherein the sprint target sequence is a polydA sequence and the sequence complementary to the sprint target sequence is a polydT sequence. (Item 81) A method for enriching a library of in-frame coding region fragments from a collection of cellular RNA fragments, wherein the method is (a) A population of cDNA fragments is generated by performing a strand-specific random priming nucleic acid amplification reaction on a population of cellular RNA fragments, (b) Inserting the collection of cDNA fragments into a cloning vector to generate a library of DNA constructs, wherein each DNA construct is arranged in the order from 5' to 3', (i) promoter, (ii) A translation initiation site followed by any multiple of 3 nucleotides that do not code for a stop codon, (iii) A nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within the reading frame, (iv) One cDNA fragment from the aforementioned population of cDNA fragments, (v) Generating a library of DNA constructs including sequences encoding membrane-presented proteins, (c) Transforming cells with the aforementioned library of DNA constructs, (d) Incubating the cells under conditions in which the DNA construct is expressed, (e) Purifying cells expressing a complete fusion protein comprising the polypeptide encoded by the nucleotide sequence encoding the polypeptide, the polypeptide encoded by the cDNA fragment, and the membrane-presenting protein using a reagent that binds to the polypeptide encoded by the nucleotide sequence encoding the polypeptide, (f) A method comprising recovering in-frame cDNA fragment sequences from the purified cells by PCR amplification, thereby enriching a library of in-frame coding region fragments from a population of cellular RNA fragments. (Item 82) The method according to item 81, wherein the cell is a bacterium. (Item 83) The method according to item 81 or 82, wherein the expression of the DNA construct in the cells is inducible. (Item 84) The method according to any one of items 81 to 83, wherein the sequence encoding the membrane-presenting protein encodes AIDA. (Item 85) The method according to any one of items 81 to 84, further comprising step (a) contacting the collection of cDNA fragments with an exome capture probe to thereby enrich the collection of cDNA fragments with respect to cDNA fragments encoding exomes, thereby generating a library of exome-enriched cDNA fragments. (Item 86) The method according to any one of items 81 to 84, further comprising step (a) contacting the population of cDNA fragments with a MutS protein, thereby enriching the population of cDNA fragments with cDNA fragments containing mismatches resulting from either mutations or single nucleotide polymorphisms. (Item 87) The method according to item 85, further comprising step (a) contacting the library of cDNA fragments encoding the exome with a MutS protein, thereby enriching the library of cDNA fragments encoding the exome with cDNA fragments containing mismatches resulting from either mutations or single nucleotide polymorphisms. (Item 88) The method according to any one of items 81 to 85, further comprising contacting the amplification product with a MutS protein to thereby enrich the amplification product with respect to a cDNA fragment containing a mismatch resulting from either a mutation or a single nucleotide polymorphism. (Item 89) The method according to any one of items 81 to 88, further comprising the step of preparing a population of cellular RNA fragments from a sample. (Item 90) The method according to item 89, wherein the sample is a tumor sample, a normal tissue sample, a diseased tissue sample, a fresh sample, a frozen sample, and / or a paraffin-embedded (FFPE) sample. (Item 91) The method according to item 90, wherein the sample is paraffin-embedded (FFPE) tissue or tumor sample. (Item 92) The method according to any one of items 89 to 91, further comprising obtaining the sample from the subject. (Item 93) The method according to any one of items 81 to 92, wherein the cellular RNA fragments in the population of cellular RNA fragments are 150 to 250 nt in length. (Item 94) The method according to item 93, wherein the cellular RNA fragments in the population of cellular RNA fragments are approximately 200 nt in length. (Item 95) The method according to any one of items 81 to 94, wherein the translation initiation site comprises a Shine-Dalgano sequence. (Item 96) The method according to any one of items 81 to 95, further comprising inserting the amplification product into a vector to generate a vector containing the sequence of the cDNA fragment. (Item 97) The method according to item 96, wherein the vector is a cloning vector. (Item 98) The method according to item 96, wherein the vector is an expression vector. (Item 99) The method according to item 96, wherein the vector is a vector encoding a vaccine. (Item 100) The method according to item 99, further comprising inserting a vector encoding the vaccine into a bacterium and incubating the bacterium under conditions such that the bacterium expresses the vaccine encoded by the vector encoding the vaccine. (Item 101) The method according to item 99, further comprising inserting a vector encoding the vaccine into yeast and incubating the yeast under conditions such that the yeast expresses the vaccine encoded by the vector encoding the vaccine. (Item 102) The method according to item 99, further comprising subjecting the vector encoding the vaccine to an in vitro translation reaction to produce the vaccine encoded by the vector encoding the vaccine. (Item 103) The method according to item 96, further comprising transfecting or transducing the vector into mammalian cells and incubating the mammalian cells under conditions such that the vaccine encoded by the vector is expressed in the mammalian cells. (Item 104) The method according to item 103, wherein the mammalian cells are human cells. (Item 105) The method according to item 96, further comprising transfecting or transfecting human cells ex vivo with the vector and delivering the human cells as the target. (Item 106) The method according to item 105, wherein the human cells are primary T cells or antigen-presenting cells isolated from the same or different subject. (Item 107) The method of item 96, further comprising delivering the vector to the target so that the target expresses the vaccine encoded by the vector. (Item 108) The method described in any one of items 105 to 107, wherein the subject is a human. (Item 109) An amplification product produced according to the method described in any one of items 81-95. (Item 110) A vector generated according to the method described in item 96. (Item 111) The vector described in item 110 is a cloning vector. (Item 112) The vector described above is an expression vector, as described in item 110. (Item 113) The vector described in item 110, wherein the vector is a vector that codes for a vaccine. (Item 114) A pharmaceutical composition comprising the amplification product described in item 109 and a pharmaceutically acceptable carrier. (Item 115) A pharmaceutical composition comprising a vector described in any one of items 110 to 113 and a pharmaceutically acceptable carrier. (Item 116) A method for producing a tumor vaccine, (a) Generating cell RNA fragments from the target tumor sample, (b) A chain-specific random priming nucleic acid amplification reaction is performed on the RNA fragment to generate a cDNA fragment, (c) Inserting the collection of cDNA fragments into a cloning vector to generate a library of DNA constructs, wherein each DNA construct is arranged in the order from 5' to 3', (i) promoter, (ii) A translation initiation site followed by any multiple of 3 nucleotides that do not code for a stop codon, (iii) A nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within the reading frame, (iv) One cDNA fragment from the aforementioned population of cDNA fragments, (v) Generating a library of DNA constructs including sequences encoding membrane-presented proteins, (d) Transforming cells with the aforementioned library of DNA constructs, (e) Incubating the cells under conditions such that the DNA construct is expressed by the cells, (f) Purifying cells expressing a complete fusion protein comprising the polypeptide encoded by the nucleotide sequence encoding the polypeptide, the polypeptide encoded by the cDNA fragment, and the membrane-presenting protein using a reagent that binds to the polypeptide encoded by the nucleotide sequence encoding the polypeptide, (g) Recovering the in-frame cDNA fragment sequence from the purified cells by PCR amplification, A method comprising (h) generating a tumor vaccine from one or more of the amplification products of step (g). (Item 117) The method according to item 116, wherein the tumor sample is a fresh sample, a frozen sample, and / or a paraffin-embedded (FFPE) sample. (Item 118) The method according to item 117, wherein the sample is a paraffin-embedded (FFPE) tumor sample. (Item 119) The method according to any one of items 116 to 118, further comprising obtaining the tumor sample from the subject. (Item 120) The method according to any one of items 116 to 119, wherein the cellular RNA fragment is 150 to 250 nt in length. (Item 121) The method according to item 120, wherein the cellular RNA fragment is approximately 200 nt in length. (Item 122) The method according to any one of items 116 to 121, wherein the translation initiation site includes a Shine-Dalgano sequence. (Item 123) The method according to any one of items 116 to 122, further comprising, before step (h), inserting the amplification product into a vaccine-encoding vector to generate a vaccine-encoding vector containing the sequence of the cDNA fragment. (Item 124) The method according to item 123, wherein step (h) includes inserting a vector encoding the vaccine into a bacterium and incubating the bacterium under conditions such that the bacterium expresses the vaccine encoded by the vector encoding the vaccine. (Item 125) The method according to item 123, wherein step (h) includes inserting a vector encoding the vaccine into yeast and incubating the yeast under conditions such that the yeast expresses the vaccine encoded by the vector encoding the vaccine. (Item 126) The method according to item 123, wherein step (h) involves subjecting the vector encoding the vaccine to an in vitro translation reaction to produce the vaccine encoded by the vector encoding the vaccine. (Item 127) The method according to item 123, wherein step (h) includes transfecting or transfecting mammalian cells with a vector encoding the vaccine and incubating the mammalian cells under conditions such that the mammalian cells express the vaccine encoded by the vector encoding the vaccine. (Item 128) The method according to item 127, wherein the mammalian cells are human cells. (Item 129) The method according to any one of items 116 to 128, further comprising administering the tumor vaccine to the target of the tumor vaccine. (Item 130) The method according to item 123, wherein step (h) comprises transfecting or transducing a vector encoding the vaccine into human cells and delivering the human cells to the target. (Item 131) The method according to item 130, wherein the human cells are antigen-presenting cells isolated from the same or different subjects. (Item 132) The method according to item 123, wherein step (h) includes delivering the vector encoding the vaccine to the subject so that the subject expresses the vaccine encoded by the vector encoding the vaccine. (Item 133) The method described in any one of items 129 to 132, wherein the subject is a human. (Item 134) A method for treating a tumor, comprising administering the tumor vaccine, which is produced according to the method described in any one of items 116 to 128, to a subject in need of treatment. (Item 135) A method for identifying a drug target, comprising transfecting or transducing a vector produced according to the method described in item 96 into cells and identifying an in-frame coding region fragment that results in a selectable phenotype. (Item 136) The method according to item 135, wherein the vector is transfected or transduced into cells in vitro or in vivo. (Item 137) The method according to item 135 or 136, wherein the in-frame coding region fragment is either enriched or depleted in the cell having the selectable phenotype. (Item 138) The method according to any one of items 135 to 137, wherein the in-frame coding region fragment causes a positive or negative change in an intracellular pathway. (Item 139) The method according to any one of items 135 to 138, wherein the cells are normal cells and the selectable phenotype is a disease phenotype. (Item 140) A method, library, amplification product, vector, or pharmaceutical composition according to any one of items 1 to 139, wherein the nucleotide sequence encoding the polypeptide is at least 18 nucleotides long. [Brief explanation of the drawing]

[0043] [Figure 1] This is a schematic diagram illustrating the synthesis of chained, double-stranded (ds) cDNA. If necessary, the same library may be used to capture open reading frames (ORFs) from antisense RNA, but an exome capture mixture in the opposite direction is required, and the strand specificity of the primers is reversed in subsequent steps. [Figure 2] This is a schematic diagram illustrating the enrichment (arbitrary selection) and exome capture of MutS. [Figure 3] This is a schematic diagram illustrating the preparation of RNA for display. A small protein-coding sequence can be added to the 5' upstream or 3' downstream region of a cDNA fragment sequence from a cDNA library. [Figure 4] This is a schematic diagram illustrating RNA display. [Figure 5] This is a schematic diagram illustrating the capture and recovery of RNA bound to polypeptides (AMPL-NA library fragments). [Figure 6] This is a schematic diagram illustrating an exemplary cloning process for a film surface display. [Figure 7] This is a schematic diagram illustrating the transformation, proliferation, and surface presentation of an in-frame library member according to certain exemplary embodiments disclosed herein. [Figure 8] This is a schematic diagram illustrating affinity enrichment and DNA recovery of an in-frame library according to certain exemplary embodiments disclosed herein. [Figure 9]This is a schematic diagram showing the structure of an exemplary exome capture transcription library. RBS is the E. coli ribosome binding site, ATG is the start codon for protein translation, Read1 and Read2 are Illumina TruSeq sequences, Twin-Strep-tag is the coding sequence of a 28-amino acid peptide used for binding and purification, and peptide is the coding sequence of the peptide spacer segment. [Figure 10] The results of comparing the full-length insertions within the target reading frame of the construct with the complete ORF after exome capture ("before RNA display") and subsequent RNA display ("after RNA display") are shown. [Modes for carrying out the invention]

[0044] Overview In certain embodiments, the foregoing provides a method for enriching a library of in-frame coding region fragments from a population of RNA transcripts or from a population of cellular RNA fragments. In some embodiments, the foregoing provides a method for generating a tumor vaccine or for treating a patient with a tumor using the generated tumor vaccine. In certain embodiments, the foregoing relates to a library of RNA complexes conjugated to purified polypeptides, amplification products, and vectors comprising enriched in-frame coding fragment sequences, tumor vaccines, and pharmaceutically acceptable compositions thereof.

[0045] In certain embodiments, the Disclosure relates to a method for preparing a nucleic acid library from fragmented cellular RNA containing appropriate in-frame coding regions corresponding to the cellular miniproteome, so that the nucleic acids can be transferred to a suitable host cell to express the miniproteome (the miniproteome is defined herein as an aggregate of about 70 amino acid segments representing the potential to encode cellular RNA to be expressed).

[0046] Many challenges exist in relation to the preparation of such libraries. The difficulty in preparing such libraries stems from the lack of a mechanism to control (a) the translation of randomly fragmented RNA within a native reading frame encoding a native protein, since an exogenous translation initiation site is required, and (b) the absence of a mechanism to control the departure of fragmented RNA from the reading frame, which does not terminate rapidly and is therefore rapidly degraded by nonsense-mediated degradation upon insertion into a suitable host cell. Consequently, without the solutions provided herein, nearly 90% of library members would be unsuitable or non-functional.

[0047] The method provided by this disclosure enables enrichment from a complex mixture of RNA fragments of approximately 200 nt from cells, these fragments being successfully translated within a frame and entering downstream regions within a desired reading frame, thus eliminating 89% of the RNA that is unsuitable for construction of a miniproteome library.

[0048] Such libraries are useful for preparing nucleic acid antitumor vaccines when RNA is derived from tumor cells, or for identifying miniproteomic segments that positively or negatively alter intracellular (in vitro, i.e., in cell culture, or in vivo) pathways, resulting in selectable phenotypes that allow for the identification of novel or more highly improved targets for pharmaceutical product discovery.

[0049] definition For convenience, certain terms used in this specification, examples, and appended claims are summarized here.

[0050] The articles "a" and "an" are used herein to refer to one or more than one (e.g., at least one) of the grammatical objects of the article. For example, "element" means one element or more than one element.

[0051] The term "barcode primer" refers to a primer containing a unique nucleotide sequence. The minimum length of this nucleotide sequence depends on the total number of primers that need to be uniquely labeled. For example, a nucleotide sequence that is 4 nucleotides long may have 256 different sequences, which can uniquely label up to 256 primers. The term "barcode-labeled amplification product" refers to the product generated by a PCR amplification reaction using these "barcode primers."

[0052] The terms "binding" or "interacting" refer to a stable association between two molecules, such as an antibody and a target, resulting, for example, from electrostatic, hydrophobic, ionic, and / or hydrogen bonding interactions under physiological conditions.

[0053] As used herein, two nucleic acid sequences are "complementary" or "complementary" to each other if they form base pairs with each other at each of their positions or at all of their positions.

[0054] As used herein, two nucleic acid sequences are considered "corresponding" to each other if both are complementary to the same nucleic acid sequence.

[0055] The terms “regulation” or “to regulate,” when used in reference to functional properties or biological activity or processes (e.g., enzyme activity or receptor binding), refer to either upregulation (e.g., activation or stimulation), downregulation (e.g., inhibition or suppression), or the ability to alter the quality of such properties, activity, or processes. In certain cases, such regulation may depend on the occurrence of specific events, such as activation of signaling pathways, and / or may only be expressed in specific cell types.

[0056] The terms “polynucleotide” and “nucleic acid” are used synonymously herein. They refer to nucleotides in polymeric form of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure and may perform any known or unknown function. The following are non-limiting examples of polynucleotides: coding or non-coding regions of genes or gene fragments, loci (may be plural) defined by binding analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, synthetic polynucleotides, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotides may include modified nucleotides such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be conjugated before or after the assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. Polynucleotides may be further modified, such as by conjugation with labeling components.

[0057] The term "neoantigen" or "neoantigenic" refers to a class of tumor antigens that arise from tumor-specific mutations that alter the amino acid sequence of genome-encoded proteins.

[0058] The term "vaccine" should be understood as meaning a composition for generating immunity for the prevention and / or treatment of a disease (e.g., tumor). Therefore, a vaccine is a pharmaceutical product containing an antigen and intended for use in humans or animals to generate specific protective substances through vaccination.

[0059] As used herein, the term “administer” means to provide a pharmaceutical agent or composition to a subject, and includes, but is not limited to, administration by a healthcare professional and self-administration.

[0060] As used herein, the term “subject” means a human or non-human animal selected for treatment or therapy.

[0061] Unless otherwise indicated by context, “protein,” “polypeptide,” and “peptide” are used synonymously in this specification when referring to gene expression products, such as amino acid sequences encoded by coding sequences. “Protein” may also refer to associations of one or more proteins, such as antibodies. “Protein” may also refer to protein fragments. A protein can be a post-translationally modified protein, such as a glycosylated protein. “Genetic expression product” means a molecule produced as a result of the transcription of all or part of a gene. Gene products include RNA molecules transcribed from genes, as well as proteins translated from such transcripts. A protein can be a naturally occurring isolated protein, or a recombinant or chemically synthesized product. The term “protein fragment” refers to a protein that lacks amino acid residues compared to the reference protein itself, but whose remaining amino acid sequence is usually identical to at least a portion of that of the reference protein. Such deletions may occur at the amino-terminus or carboxyl-terminus of the reference protein, or at several internal positions of the reference protein, or more than one such position. The fragments are typically at least about 5, 6, 8, or 10 amino acid lengths, at least about 14 amino acid lengths, at least about 20, 30, 40, or 50 amino acid lengths, at least about 75 amino acid lengths, or at least about 100, 150, 200, 300, 500 or more amino acid lengths. The fragments can be obtained by fragmenting a larger protein using a protease, or by recombination methods such as the expression of only a portion of the protein-coding nucleotide sequence (either alone or fused with a nucleic acid sequence encoding another protein). In various embodiments, the fragments may include, for example, the enzymatic activity and / or interaction sites of the reference protein with respect to cell receptors. In another embodiment, the fragments may possess immunogenic properties. The proteins may include mutations introduced into specific loci by a variety of known techniques that do not adversely affect, but can enhance, their use in the methods provided herein. The fragments may retain one or more of the biological activities of the reference protein.

[0062] A “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it is bound. One preferred type of vector is an episome, i.e., a nucleic acid capable of extrachromosomal replication. Preferred vectors are those capable of autoreplication and / or expression of the nucleic acid to which they are bound. Vectors capable of directing the expression of a gene to which they are manipulably bound are referred to herein as “expression vectors.” Generally, expression vectors useful in recombinant DNA technology are often in the form of “plasmids,” which generally refer to a circular double-stranded DNA loop, and their vector form does not bind to a chromosome. Hereinafter, “plasmid” and “vector” are used synonymously, as plasmids are the most commonly used form of vectors. However, as will be understood by those skilled in the art, the present invention is intended to include other forms of expression vectors that perform equivalent functions and which will subsequently become known in the art.

[0063] Unless otherwise defined herein, scientific and technical terms used in this application have meanings that are generally understood by those skilled in the art. Generally, the nomenclature and techniques relating to chemistry, molecular biology, cell and cancer biology, immunology, microbiology, pharmacology, and protein and nucleic acid chemistry described herein are well known and commonly used in the art.

[0064] How to enrich libraries of in-frame code fragments In certain embodiments, what is provided herein is a method for enriching a library of in-frame coding region fragments from a population of RNA transcripts. In certain embodiments, such a method includes (a) generating a population of puromycin-tagged RNA transcripts; (b) carrying out an in vitro translation reaction on the puromycin-tagged RNA transcripts, wherein for each puromycin-tagged RNA fragment, if the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in the frame with a translation initiation site, does not have a stop codon in its reading frame, and is in the frame with a nucleotide sequence encoding a polypeptide, the puromycin carries out an in vitro translation reaction to covalently bind the translated polypeptide to the puromycin-tagged RNA transcript, thereby forming a polypeptide-bound RNA complex; and (c) separating the polypeptide-bound RNA complex from RNA transcripts that are not in such a complex state, thereby enriching a library of in-frame coding region fragments from the population of RNA transcripts.

[0065] In some embodiments, each RNA transcript in a population of RNA transcripts comprises, in 5' to 3' order, (i) a translation start site, (ii) an RNA sequence transcribed from a cDNA fragment sequence from a library of cDNA sequences, and (iii) a nucleotide sequence encoding a polypeptide, which lacks an in-frame stop codon in a reading frame that begins with the first 5' nucleotide of the nucleotide sequence, but contains a stop codon in each of the other two reading frames.

[0066] In a particular embodiment, a population of puromycin-tagged RNA transcripts is produced by (a) contacting the RNA transcripts with a sprint polynucleotide and a puromycin-tagged DNA linker, wherein the sprint polynucleotide each comprises, in 3' to 5' order, (I) a sequence complementary to the 3' end of the polypeptide-encoding nucleotide sequence and (II) a poly-T sequence, and the puromycin-tagged DNA linker each comprises, in 5' to 3' order, (1) a poly-dA sequence and (2) a puromycin molecule, wherein the polypeptide-encoding nucleotide sequence of the RNA transcript is hybridized to a sequence complementary to the 3' end of the polypeptide-encoding nucleotide sequence of the sprint polynucleotide, and the poly-dA sequence of the linker polynucleotide is hybridized to the poly-T sequence of the sprint polynucleotide; and (b) carrying out a ligation reaction to ligate the 3' end of the RNA transcript to the 5' end of the puromycin-tagged DNA linker to produce puromycin-tagged RNA transcripts.

[0067] In some embodiments, each RNA transcript in a library of RNA transcripts includes, in 5' to 3' order: (i) a translation start site, (ii) a nucleotide sequence encoding a polypeptide that lacks an in-frame stop codon in a reading frame beginning with the first 5' nucleotide of the nucleotide sequence, (iii) an RNA sequence transcribed from a cDNA fragment sequence from a library of cDNA sequences, and (iv) an adapter sequence that lacks a stop codon in a reading frame beginning with the first 5' nucleotide of the adapter sequence, but contains stop codons in the other two reading frames.

[0068] In a particular embodiment, a population of puromycin-tagged RNA transcripts is produced by (a) contacting the RNA transcripts with a sprint polynucleotide and a puromycin-tagged DNA linker, wherein the sprint polynucleotide each comprises, in 3' to 5' order, (I) a sequence complementary to the adapter sequence and (II) a poly-T sequence, and the puromycin-tagged DNA linker each comprises, in 5' to 3' order, (1) a poly-dA sequence and (2) a puromycin molecule, wherein the nucleotide sequence encoding the polypeptide of the RNA transcript is hybridized to the sequence complementary to the adapter sequence of the sprint polynucleotide, and the poly-dA sequence of the linker polynucleotide is hybridized to the poly-T sequence of the sprint polynucleotide; and (b) carrying out a ligation reaction to ligate the 3' end of the RNA transcript to the 5' end of the puromycin-tagged DNA linker to produce puromycin-tagged RNA transcripts.

[0069] The translation start site of an RNA transcript may include a start codon (e.g., AUG), a Shine-Dalgano (SD) sequence, and / or a translation enhancer. The Shine-Dalgano sequence is a ribosome-binding site commonly found in bacterial and archaeal messenger RNA and is generally located about eight bases upstream of the start codon AUG. The Shine-Dalgano sequence may include AGGAGG, AGGAGGU, GAGG, ACAGGAGGCA, or UAAGGAGGUG. The translation enhancer is an A / U rich enhancer, e.g., 5'-GCUCUUUAACAAUUUAUCA-3', 5'-ACAUGGAUUC-3', 5'-UUAACUUUAA-3', 5'-UUAACGGGAA-3', 5'-AAAAAAAAAA-3', 5'-UUAACUUUAA-(A)5-3', 5'-UUAACUUUAA-(A) 10 -3', 5'-UUAACUUUAA-(A) 20It may contain -3' or 5'-UUAACUUUAA-(ACAUGGAUUC)2-3'. The translation initiation site may contain a short (10-20 nucleotides) A ​​residue between the translation enhancer sequence and the Shine-Dalgano sequence to further improve translation efficiency.

[0070] In some embodiments, the translation start site of an RNA transcript is followed by any multiple of three nucleotides that do not code for a stop codon. For example, the translation start site may be followed by 0, 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, 90, 120, 150, 180, 210, 240, 270, 300, 450, 600, 750, 900, 1200, 1500, 1800, 2100, 2400, 2700, or 3000 nucleotides that do not code for a stop codon.

[0071] In some embodiments, the nucleotide sequence encoding the polypeptide has a length of at least 9, at least 12, at least 15, at least 18, at least 21, at least 24, at least 27, at least 30, at least 33, at least 36, at least 39, at least 42, at least 45, at least 48, at least 51, at least 54, at least 57, at least 60, at least 63, at least 66, at least 69, or at least 72 nucleotides, and is a length of a multiple of 3 nucleotides. For example, a polypeptide-encoding nucleotide sequence may have a length of 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, 90, 120, 150, 180, 210, 240, 270, 300, 450, 600, 750, 900, 1200, 1500, 1800, 2100, 2400, 2700, or 3000 nucleotides. In some embodiments, the polypeptide-encoding nucleotide sequence is 18 nucleotides long. The polypeptide-encoding nucleotide sequence may be 5' upstream or 3' downstream of an RNA sequence transcribed from a cDNA fragment sequence from a library of cDNA fragment sequences.

[0072] In certain embodiments, the nucleotide sequence encoding the polypeptide of the RNA transcript may encode a small soluble protein or a soluble domain of a protein, and the proteins include, but are not limited to, titin I27, ubiquitin, Stefin A, 10FN-III, Ig-L filamin A, tenascin, Darpin, fibronectin, thioredoxin, or any other small protein domain (derived from human or any other species), which are highly soluble when expressed by in vitro translation or in E. coli. In certain embodiments, the nucleotide sequence encoding the polypeptide may encode a polypeptide having an affinity tag. Examples of such affinity tags include, but are not limited to, hexa-histidine tags, hemagglutinin (HA) tags, calmodulin tags, FLAG tags, Myc tags, S tags, streptavidin tags, SBP tags, Softag1, Softag3, V5 tags, Xpress tags, isopeptin tags, SpyTag, biotin carboxyl carrier protein (BCCP) tags, GST tags, fluorescent protein tags (e.g., green fluorescent protein tags), maltose-binding protein tags, Nus tags, Strep- tags, thioredoxin tags, TC tags, and Ty tags. In certain embodiments, the nucleotide encoding the polypeptide encodes the polypeptide from a reading frame that begins at the first 5' nucleotide of the nucleotide sequence.

[0073] In some embodiments, the adapter sequence has a length of at least 9, at least 12, at least 15, at least 18, at least 21, at least 24, at least 27, at least 30, at least 33, at least 36, at least 39, at least 42, at least 45, at least 48, at least 51, at least 54, at least 57, at least 60, at least 63, at least 66, at least 69, or at least 72 nucleotides, and a length of a multiple of 3 nucleotides. For example, the adapter sequence may have a length of 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, 90, 120, 150, 180, 210, 240, 270, 300, 450, 600, 750, 900, 1200, 1500, 1800, 2100, 2400, 2700, or 3000 nucleotides. In certain embodiments, the adapter sequence is located 3' downstream of the RNA sequence transcribed from the cDNA fragment sequence from a library of cDNA fragment sequences.

[0074] The sprint polynucleotides described herein may include, in 3' to 5' order, a sequence complementary to the 3' end of a polypeptide-encoding nucleotide sequence or adapter sequence, and a poly-T sequence. In certain embodiments, the sprint polynucleotide may include a poly-T sequence of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or more than 20 nucleotides.

[0075] The linker polynucleotides described herein may comprise a polydA sequence and a puromycin molecule in 5' to 3' order. In certain embodiments, the linker polynucleotide may comprise a polydA sequence of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or more than 20 nucleotides.

[0076] In certain embodiments, the ligation reaction is carried out in the presence of T4 DNA ligase under conditions such that the 3' end of the RNA transcript is ligated to the 5' end of a linker polynucleotide to produce a puromycin-tagged RNA transcript. Other methods that can ligate the 5' end of the linker polynucleotide to the 3' end of the RNA transcript may also be used.

[0077] In a particular embodiment, the method for enriching a library of in-frame coding region fragments from a population of RNA transcripts described herein further comprises the step of generating a library of RNA transcripts by performing a transcription reaction on a library of RNA expression constructs prior to step (a).

[0078] In some embodiments, each RNA expression construct in a library of RNA expression constructs comprises (i) a transcription promoter, (ii) a translation initiation site, (iii) a cDNA fragment sequence from a library of cDNA fragment sequences, and (iv) a polypeptide encoding nucleotide sequence, the polypeptide encoding nucleotide sequence having no in-frame stop codon in a reading frame that begins at the first 5' nucleotide of the nucleotide sequence, but containing a stop codon in each of the other two reading frames. In certain embodiments, the translation initiation site comprises a Shine-Dalgano sequence.

[0079] The transcription promoter of an RNA expression construct can be any promoter capable of initiating RNA transcription from downstream DNA. Examples of such promoters include, but are not limited to, the T7 promoter.

[0080] The translation initiation site of an RNA expression construct may include a start codon (e.g., ATG), a Shine-Dalgano (SD) sequence, and / or a translation enhancer. The Shine-Dalgano sequence is a ribosome-binding site commonly found in bacterial and archaeal messenger RNAs and is generally located about eight bases upstream of the start codon AUG. The Shine-Dalgano sequence may include AGGAGG, AGGAGGU, GAGG, ACAGGAGGCA, and UAAGGAGGUG. The translation enhancer sequence is an upstream sequence of the Shine-Dalgano sequence that can further increase the amount of protein synthesis. The translation enhancer is an A / U rich enhancer, for example, 5'-GCUCUUUAACAAUUUAUCA-3', 5'-ACAUGGAUUC-3', 5'-UUAACUUUAA-3', 5'-UUAACGGGAA-3', 5'-AAAAAAAAAA-3', 5'-UUAACUUUAA-(A)5-3', 5'-UUAACUUUAA-(A) 10 -3', 5'-UUAACUUUAA-(A) 20 It may contain -3' or 5'-UUAACUUUAA-(ACAUGGAUUC)2-3'. The translation initiation site may contain a short (10-20 nucleotides) A ​​residue between the translation enhancer sequence and the Shine-Dalgano sequence to further improve translation efficiency.

[0081] In some embodiments, the translation start site of an RNA expression construct is followed by any multiple of 3 nucleotides that do not code for a stop codon. For example, the translation start site may be followed by 0, 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, 90, 120, 150, 180, 210, 240, 270, 300, 450, 600, 750, 900, 1200, 1500, 1800, 2100, 2400, 2700, or 3000 nucleotides that do not code for a stop codon.

[0082] In some embodiments, the nucleotide sequence encoding the polypeptide has a length of at least 9, at least 12, at least 15, at least 18, at least 21, at least 24, at least 27, at least 30, at least 33, at least 36, at least 39, at least 42, at least 45, at least 48, at least 51, at least 54, at least 57, at least 60, at least 63, at least 66, at least 69, or at least 72 nucleotides, and is a length of a multiple of 3 nucleotides. For example, a polypeptide-encoding nucleotide sequence can have a length of 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, 90, 120, 150, 180, 210, 240, 270, 300, 450, 600, 750, 900, 1200, 1500, 1800, 2100, 2400, 2700, or 3000 nucleotides. The polypeptide-encoding nucleotide sequence can be 5' upstream or 3' downstream of a cDNA fragment sequence from a library of cDNA fragment sequences.

[0083] In certain embodiments, the nucleotide sequence encoding the polypeptide of the RNA expression construct may encode a small soluble protein or a soluble domain of a protein, and the proteins include, but are not limited to, titin I27, ubiquitin, Stefin A, 10FN-III, Ig-L filamin A, Darpin, tenascin, fibronectin, thioredoxin, or any other small protein domain (derived from human or any other species), which are highly soluble when expressed by in vitro translation or in E. coli. In certain embodiments, the nucleotide sequence encoding the polypeptide may encode a polypeptide having an affinity tag. Examples of such affinity tags include, but are not limited to, hexa-histidine tags, hemagglutinin (HA) tags, calmodulin tags, FLAG tags, Myc tags, S tags, Strep tags, SBP tags, Softag1, Softag3, V5 tags, Xpress tags, isopeptin tags, SpyTag, biotin carboxyl carrier protein (BCCP) tags, GST tags, fluorescent protein tags (e.g., green fluorescent protein tags), maltose-binding protein tags, Nus tags, Strep- tags, thioredoxin tags, TC tags, and Ty tags. In certain embodiments, the nucleotide encoding the polypeptide encodes the polypeptide from a reading frame that begins at the first 5' nucleotide of the nucleotide sequence.

[0084] In some embodiments, each RNA expression construct further comprises an adapter sequence, the adapter sequence lacking a stop codon in a reading frame that begins at the first 5' nucleotide of the adapter sequence, but containing stop codons in the other two reading frames.

[0085] In some embodiments, the adapter sequence has a length of at least 9, at least 12, at least 15, at least 18, at least 21, at least 24, at least 27, at least 30, at least 33, at least 36, at least 39, at least 42, at least 45, at least 48, at least 51, at least 54, at least 57, at least 60, at least 63, at least 66, at least 69, or at least 72 nucleotides, and a length of a multiple of 3 nucleotides. For example, the adapter sequence may have a length of 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, 90, 120, 150, 180, 210, 240, 270, 300, 450, 600, 750, 900, 1200, 1500, 1800, 2100, 2400, 2700, or 3000 nucleotides. In a particular embodiment, the adapter sequence is located 3' downstream of the cDNA fragment sequence from a library of cDNA fragment sequences.

[0086] In certain embodiments, the RNA expression construct is generated by PCR-based addition of a transcription promoter, a translation initiation site, a polypeptide-encoding nucleotide sequence, and optionally an adapter sequence, to a library of cDNA fragment sequences. The library of cDNA fragment sequences may be enriched with cDNA fragment sequences containing exomes and / or mismatches. In certain embodiments, transcription of the RNA expression construct is performed in vitro in the presence of T7 polymerase. In certain embodiments, the translation initiation site includes a Shine-Dalgano sequence.

[0087] In certain embodiments, what is provided herein is a method for enriching a library of in-frame coding region fragments from a population of cellular RNA fragments. Compared with the above-described method for enriching a library of in-frame coding region fragments from a population of RNA transcripts, the method for enriching a library of in-frame coding region fragments from a population of cellular RNA fragments further includes the step of generating a population of RNA transcripts described herein from a population of cellular RNA fragments.

[0088] Such additional steps for generating a population of RNA transcripts from a population of cellular RNA fragments may include: (a) performing a strand-specific random priming nucleic acid amplification reaction on the population of cellular RNA fragments to generate a population of cDNA fragments; (b) contacting the population of cDNA fragments with an exome capture probe to thereby enrich the population of cDNA fragments with cDNA fragments encoding exomes to generate a library of exome-enriched cDNA fragments; (c) generating an RNA expression construct from the library of exome-enriched cDNA fragments; and (d) performing a transcription reaction using the RNA expression construct to generate a library of RNA transcripts.

[0089] The RNA expression construct generated in step (c) and the library of RNA transcripts generated in step (d) may have the same structure as those described in the method for enriching a library of in-frame coding region fragments from a population of RNA transcripts. In certain embodiments, the RNA expression construct is generated by PCR-based addition of a transcription promoter, a translation initiation site, a polypeptide-encoding nucleotide sequence, and optionally an adapter sequence, to a library of exome-enriched cDNA fragments prepared from a population of cellular RNA fragments. In certain embodiments, the translation initiation site includes a Shine-Dalgano sequence.

[0090] In some embodiments, the method for enriching a library of in-frame coding region fragments from a population of RNA transcripts or cellular RNA fragments described herein further comprises affinity purification of protein-bound RNA complexes using a reagent that binds to a polypeptide encoded by a polypeptide-coding nucleotide sequence. The polypeptide-binding reagent may be an antibody that specifically binds to an affinity tag that binds to the polypeptide, or an antibody that specifically binds to the polypeptide itself. Antibodies that specifically bind to affinity tags are well known in the art and are commercially available. In some embodiments, what is provided herein is a library of purified polypeptide-bound RNA complexes produced according to the method described herein.

[0091] In some embodiments, the method for enriching a library of in-frame coding region fragments from a population of RNA transcripts or cellular RNA fragments described herein further comprises performing an RT-PCR amplification reaction on a purified protein-bound RNA complex to produce an amplification product containing an amplified DNA copy of the cDNA fragment sequence. In certain embodiments, the PCR reaction is performed using strand-specific cloning primers so that the amplification product can be easily cloned into a vector. In some embodiments, what is provided herein is the amplification product produced by the method described herein.

[0092] In a particular embodiment, provided herein is a method for enriching a library of in-frame coding region fragments from a population of cellular RNA fragments, the method comprising: (a) performing a strand-specific random priming nucleic acid amplification reaction on a population of cellular RNA fragments to generate a population of cDNA fragments; and (b) inserting the population of cDNA fragments into a cloning vector to generate a library of DNA constructs, each DNA construct comprising, in 5' to 3' order, (i) a promoter, (ii) a translation initiation site, (iii) a nucleotide sequence encoding a polypeptide having a length of a multiple of 3 nucleotides and lacking an in-frame stop codon within a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, (iv) one cDNA fragment from the population of cDNA fragments, and (v) A method comprising: (c) generating a library of DNA constructs containing sequences encoding membrane-presenting proteins; (d) transforming cells with the library of DNA constructs; (e) purifying (e.g., affinity purification) cells expressing a complete fusion protein comprising a polypeptide encoded by a polypeptide-encoding nucleotide sequence, a polypeptide encoded by a cDNA fragment, and a membrane-presenting protein, using a reagent that binds to the polypeptide encoded by the polypeptide-encoding nucleotide sequence; and (f) recovering in-frame cDNA fragment sequences from the purified cells (e.g., by PCR amplification), thereby enriching a library of in-frame coding region fragments from a population of RNA transcripts.

[0093] In some embodiments, step (a) further includes contacting a population of cDNA fragments with an exome capture probe to thereby enrich the population of cDNA fragments with cDNA fragments encoding exomes, thereby generating a library of exome-enriched cDNA fragments. The library of exome-enriched cDNA fragments can then be used in the following steps.

[0094] In some embodiments, the promoter of the DNA construct is a promoter capable of driving gene expression in bacteria (e.g., E. coli). Such promoters include, but are not limited to, the bacteriophage T7 promoter.

[0095] The translation start site of a DNA construct may include a start codon (e.g., ATG), a Shine-Dalgano (SD) sequence, and / or a translation enhancer. The Shine-Dalgano sequence is a ribosome-binding site commonly found in bacterial and archaeal messenger RNA and is generally located about eight bases upstream of the start codon AUG. The Shine-Dalgano sequence may include AGGAGG, AGGAGGU, GAGG, ACAGGAGGCA, and UAAGGAGGUG. The translation enhancer sequence is an upstream sequence of the Shine-Dalgano sequence that can further increase the amount of protein synthesis. The translation enhancer is an A / U rich enhancer, for example, 5'-GCUCUUUAACAAUUUAUCA-3', 5'-ACAUGGAUUC-3', 5'-UUAACUUUAA-3', 5'-UUAACGGGAA-3', 5'-AAAAAAAAAA-3', 5'-UUAACUUUAA-(A)5-3', 5'-UUAACUUUAA-(A) 10 -3', 5'-UUAACUUUAA-(A) 20 It may contain -3' or 5'-UUAACUUUAA-(ACAUGGAUUC)2-3'. The translation initiation site may contain a short (10-20 nucleotides) A ​​residue between the translation enhancer sequence and the Shine-Dalgano sequence to further improve translation efficiency.

[0096] In some embodiments, the translation start site of the DNA construct is followed by any multiple of 3 nucleotides that do not code for a stop codon. For example, the translation start site may be followed by 0, 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, 90, 120, 150, 180, 210, 240, 270, 300, 450, 600, 750, 900, 1200, 1500, 1800, 2100, 2400, 2700, or 3000 nucleotides that do not code for a stop codon.

[0097] In some embodiments, the nucleotide sequence encoding the polypeptide has a length of at least 9, at least 12, at least 15, at least 18, at least 21, at least 24, at least 27, at least 30, at least 33, at least 36, at least 39, at least 42, at least 45, at least 48, at least 51, at least 54, at least 57, at least 60, at least 63, at least 66, at least 69, or at least 72 nucleotides, and is a length of a multiple of 3 nucleotides. For example, a nucleotide sequence encoding a polypeptide can have lengths of 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, 90, 120, 150, 180, 210, 240, 270, 300, 450, 600, 750, 900, 1200, 1500, 1800, 2100, 2400, 2700, or 3000 nucleotides.

[0098] In certain embodiments, the nucleotide sequence encoding the polypeptide of the DNA construct may encode a small soluble protein or a soluble domain of a protein, and the proteins include, but are not limited to, titin I27, ubiquitin, Stefin A, 10FN-III, Ig-L filamin A, Darpin, tenascin, fibronectin, thioredoxin, or any other small protein domain (derived from human or any other species), which are highly soluble when expressed by in vitro translation or in E. coli. In certain embodiments, the nucleotide sequence encoding the polypeptide may encode a polypeptide having an affinity tag. Examples of such affinity tags include, but are not limited to, hexa-histidine tags, hemagglutinin (HA) tags, calmodulin tags, FLAG tags, Myc tags, S tags, Strep tags, SBP tags, Softag1, Softag3, V5 tags, Xpress tags, isopeptin tags, SpyTag, biotin carboxyl carrier protein (BCCP) tags, GST tags, fluorescent protein tags (e.g., green fluorescent protein tags), maltose-binding protein tags, Nus tags, Strep- tags, thioredoxin tags, TC tags, and Ty tags. In certain embodiments, the nucleotide encoding the polypeptide encodes the polypeptide from a reading frame that begins at the first 5' nucleotide of the nucleotide sequence.

[0099] In certain embodiments, the sequence encoding a membrane-presenting protein may encode any membrane-presenting protein that enables the translated protein to be inserted into the extracellular membrane and the polypeptide encoded by the polypeptide-encoding nucleotide sequence to be exposed on the outer surface of the cell. In certain embodiments, the sequence encoding a membrane-presenting protein encodes a bacterial membrane-presenting protein such as the adhesion-involved-in-diffuse-adherence (AIDA-I) autotransporter, which enables the translated protein to be inserted into the bacterial extracellular membrane and the peptide sequence encoded by the polypeptide-encoding nucleotide sequence to be exposed on the outer surface of the bacterial cell.

[0100] In some embodiments, the cells are eukaryotic cells (e.g., mammalian cells). In some embodiments, the cells are prokaryotic cells (e.g., bacteria). In certain embodiments, the bacterial cells (e.g., E. coli) are from strains capable of specifically controlling the expression of T7 RNA polymerase. Such bacterial strains include, but are not limited to, strains carrying the T7 RNA polymerase gene under the control of the araBAD promoter, to which T7 RNA polymerase expression can be induced by adding a small molecule (e.g., arabinose) to a bacterial (e.g., E. coli) culture. The T7 RNA polymerase can then induce the expression of a DNA construct containing a population of cDNA fragments, and the insertion of the translated protein into the outer membrane of the bacterial (e.g., E. coli).

[0101] In a particular embodiment, cells are transfected or transformed with DNA constructs in such a ratio that each cell has one or fewer (e.g., 0 or 1) DNA constructs.

[0102] In certain embodiments, the reagent used for affinity purification binds to a polypeptide encoded by a polypeptide-coding sequence. The reagent that binds to the polypeptide may be an antibody that specifically binds to an affinity tag that binds to the polypeptide, or an antibody that specifically binds to the polypeptide itself.

[0103] In certain embodiments, the sequence encoding the membrane-presented protein encodes a membrane-presented protein that is not endogenously expressed by the cell. In such cases, the DNA construct does not need to contain the nucleotide sequence encoding the polypeptide, and affinity purification can be performed using reagents that bind to the membrane-presented protein.

[0104] In some embodiments, methods other than affinity purification may be used to enrich cells expressing a complete fusion protein containing a polypeptide encoded by an in-frame cDNA fragment. For example, in some embodiments, the nucleotide sequence encoding the polypeptide encodes a c-terminal selection marker. In some embodiments, the c-terminal selection marker is a drug resistance gene (e.g., an antibiotic resistance gene), and cells expressing a complete fusion protein containing the polypeptide encoded by the in-frame cDNA fragment and the drug resistance gene can be enriched by adding the drug to the cell culture. In certain embodiments, the c-terminal selection marker is a protein that enables cell survival in the absence of a cell culture medium component, and cells expressing a complete fusion protein containing the polypeptide encoded by the in-frame cDNA fragment and the c-terminal selection marker can be enriched by drawing the component from the cell culture medium. In some embodiments, the c-terminal selection marker is a fluorescent protein, and cells expressing a complete fusion protein containing the polypeptide encoded by the in-frame cDNA fragment and the drug resistance gene can be enriched by FACS.

[0105] In certain embodiments, the PCR amplification reaction in step (f) is carried out using a chain-specific cloning primer so that the amplified product can be easily cloned into a vector. In some embodiments, what is provided herein is the amplified product produced by the method described herein.

[0106] Populations of cellular RNA fragments may be prepared from samples such as tumor samples, normal tissue samples, diseased tissue samples; fresh samples, frozen samples, and / or paraffin-embedded (FFPE) samples. In certain embodiments, the sample is a paraffin-embedded (FFPE) tissue or tumor sample. Samples may be obtained from subjects (e.g., humans, preferably cancer patients) and will be prepared specifically for each subject. Samples may also be prepared for one subject and used for a different subject. Total RNA or mRNA from these samples may be isolated and fragmented to appropriate sizes. Cellular RNA fragments in a population of cellular RNA fragments may be 150–250 nt in length. For example, cellular RNA fragments in a population of cellular RNA fragments may be about 150 nt, about 160 nt, about 170 nt, about 180 nt, about 190 nt, about 200 nt, about 210 nt, about 220 nt, about 230 nt, about 240 nt, and about 250 nt in length. In a particular embodiment, the cellular RNA fragments in a population of cellular RNA fragments are approximately 200 nt in length.

[0107] Strand-specific random priming nucleic acid amplification reactions for generating a population of cDNA fragments can be carried out using any standard protocol, such as the Illiumina TruSeq Stranded Total RNA protocol.

[0108] In some embodiments, the method for enriching a library of in-frame coding region fragments described herein further includes contacting a population of cDNA fragments with a MutS protein, recovering those cDNA fragments bound to the MutS protein, and thereby enriching the population of cDNA fragments with cDNA fragments containing mismatches resulting from either mutations or single nucleotide polymorphisms.

[0109] In some embodiments, the method for enriching a library of in-frame coding region fragments described herein further comprises contacting a library of exome-enriched cDNA fragments with a MutS protein, recovering the cDNA fragments bound to the MutS protein, thereby enriching the library of exome-enriched cDNA fragments with exomes for cDNA fragments containing mismatches resulting from either mutations or single nucleotide polymorphisms.

[0110] In some embodiments, the method for enriching a library of in-frame coding region fragments described herein further comprises contacting the in-frame enriched amplification product with MutS proteins to recover the in-frame cDNA fragments bound to the MutS proteins, thereby enriching the in-frame enriched amplification product with cDNA fragments containing mismatches resulting from either mutations or single nucleotide polymorphisms.

[0111] Exome capture probes used to generate libraries of exome-enriched cDNA fragments may be standard exome capture probes designed based on a reference genome sequence and therefore primarily capture coding exons from all known CDSs. Alternatively, exome capture probes may be designed based on the known locations and frequencies of SNPs, such that these exome capture probes are designed around the locations of those SNPs to reduce MutS enrichment of the SNPs. Additional considerations for designing exome capture probes are described herein in Example 1.

[0112] The term "exome" refers to a complete exome or any desired portion of a complete exome, based on the cell type, tissue, and disease being studied, as well as the desired RNA transcription level.

[0113] How to make a tumor vaccine In certain embodiments, what is provided herein is a method for producing a tumor vaccine using one or more amplification products produced by the method described herein. Those skilled in the art will understand from this disclosure and knowledge of the art that a variety of methods exist for producing such tumor vaccines. Generally, such tumor vaccines can be produced either in vitro or in vivo. One or more amplification products containing in-frame cDNA fragment sequences can be expressed in vitro to produce one or more tumor-specific peptides or polypeptides, which can then be formulated into a personalized tumor vaccine or immunogenic composition and administered to a subject. As further detailed herein, such in vitro production can be carried out by a variety of methods known to those skilled in the art, such as the expression of one or more amplification products in any of a variety of bacterial, eukaryotic, or viral recombinant expression systems, followed by the purification of the expressed peptides / polypeptides. Alternatively, a tumor vaccine can be produced in vivo by inserting one or more amplification products into an expression vector, then introducing such expression vector into a subject, thereby expressing the encoded tumor vaccine. Methods for producing tumor vaccines in vitro and in vivo, as well as pharmaceutical compositions and methods for delivery, are also described herein.

[0114] In certain embodiments, to produce a tumor vaccine, the amplification product generated by the method described herein is inserted into a vector to generate a vector containing a sequence of in-frame cDNA fragments. These vectors may be cloning vectors, expression vectors, or vectors encoding vaccines.

[0115] Expression vectors for different cell types are well known in the art and can be selected without excessive experimentation. Generally, the amplification product is inserted into an expression vector, such as a plasmid, in the correct orientation and with the correct reading frame for expression. If necessary, the amplification product may be bound to appropriate transcriptional and translational regulatory nucleotide sequences recognized by the desired host (e.g., bacteria), but such controls are generally available in the expression vector. The vector is then introduced into the host bacteria for cloning using standard techniques (see, for example, Sambrook et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY).

[0116] Expression vectors containing amplification products, as well as host cells containing expression vectors, are also envisioned. One or more amplification products of the present invention may be encoded by a single expression vector.

[0117] In some embodiments, the amplification product is inserted into an expression vector and optionally operably linked to an expression regulatory sequence suitable for protein expression in a desired host. Appropriate assembly can be confirmed by nucleotide sequencing, restriction mapping, and expression of a biologically active polypeptide in a suitable host. As is well known in the art, to obtain high expression levels of a transfected gene in a host, the gene can be operably linked to transcriptional and translational expression regulatory sequences that function within a selected expression host.

[0118] Recombinant expression vectors can be used to amplify and express cDNA fragment sequences encoding tumor-specific neoantigenic peptides. A recombinant expression vector is a replicable DNA construct having a synthetic or cDNA-derived DNA fragment encoding a tumor-specific neoantigenic peptide or a biologically equivalent analog, operably bound to a suitable transcriptional or translational regulatory element derived from a mammalian, microorganism, virus, or insect gene. A transcriptional unit generally includes (1) a gene element(s) having a regulatory role in gene expression, e.g., a transcription promoter or enhancer; (2) a structure or coding sequence transcribed to mRNA and translated to a protein; and (3) an assembly of appropriate transcriptional and translational start and termination sequences, as described in detail herein. Such regulatory elements may include operator sequences for controlling transcription.

[0119] Typically, replication ability in the host, conferred by the origin of replication, and select genes to facilitate recognition of the transformant may be additionally incorporated. DNA regions are operably ligated if they are functionally related to each other. For example, the DNA for a signal peptide (secretion leader) is operably ligated to the polypeptide DNA when expressed as a precursor involved in polypeptide secretion; promoters are operably ligated to the coding sequence when they control the transcription of the sequence; and ribosome binding sites are operably ligated to the coding sequence when they are positioned to enable translation. Generally, operably ligated means contiguous, and in the case of secretion leaders, it means contiguous and within the reading frame. Structural elements intended for use in yeast expression systems include leader sequences that enable extracellular secretion of translated proteins by host cells. Alternatively, if the recombinant protein is expressed without a leader or transport sequence, this may include an N-terminal methionine residue. This residue can be optionally cleaved from the subsequently expressed recombinant protein to provide the final product.

[0120] Useful expression vectors for eukaryotic hosts, particularly mammals or humans, include, for example, vectors containing expression regulatory sequences from SV40, bovine papillomavirus, adenovirus, and cytomegalovirus. Useful expression vectors for bacterial hosts include known bacterial plasmids such as plasmids from Escherichia coli containing pCR1, pBR322, pMB9, and their derivatives, as well as a broader range of host plasmids such as M13 and filamentous single-stranded DNA phages.

[0121] Suitable host cells for polypeptide expression include prokaryotes, yeasts, insects, or higher eukaryotic cells under the control of an appropriate promoter. Prokaryotes include Gram-negative or Gram-positive organisms, such as E. coli or bacilli. Higher eukaryotic cells include established cell lines of mammalian origin. Cell-free translation systems can also be used. Appropriate cloning and expression vectors for use with bacterial, fungal, yeast, and mammalian cell hosts are well known in the art (see Pouwels et al., Cloning Vectors: A Laboratory Manual, Elsevier, NY, 1985).

[0122] Various mammalian or insect cell culture systems are also advantageously used for the expression of recombinant proteins. Recombinant protein expression in mammalian cells can be performed to ensure that such proteins are generally correctly folded, appropriately modified, and fully functional. Examples of suitable mammalian host cell lines include the COS-7 line of monkey kidney cells, described by Gluzman (Cell 23:175, 1981), as well as other cell lines capable of expressing suitable vectors, such as L cells, C127, 3T3, Chinese hamster ovary (CHO), 293, HeLa, and BHK cell lines. Mammalian expression vectors may include non-transcription elements, such as origins of replication, suitable promoters and enhancers linked to the gene being expressed, and other 5' or 3' flanking non-transcription sequences, as well as 5' or 3' untranslated sequences such as necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, and transcription termination sequences. Baculovirus systems for the synthesis of heterologous proteins in insect cells were outlined by Luckow and Summers, Bio / Technology 6:47 (1988).

[0123] Proteins produced by transformed hosts can be purified according to any preferred method. Such standard methods include chromatography (e.g., ion exchange, affinity, and size-determining column chromatography), centrifugation, differential solubility, or any other standard technique for protein purification. Affinity tags, such as hexahistidine, maltose-binding domains, influenza coat sequences, and glutathione-S-transferases, can be attached to proteins to facilitate purification by passing them through a suitable affinity column. Isolated proteins can also be physically characterized using techniques such as proteolysis, nuclear magnetic resonance, and X-ray crystallography.

[0124] For example, the supernatant from a system secreting recombinant protein into culture medium can first be concentrated using a commercially available protein concentration filter, such as an Amicon or Millipore Pellicon ultrafiltration unit. Following the concentration step, the concentrate can be applied to a suitable purification matrix. Alternatively, an anion exchange resin, such as a matrix or substrate having pendant diethylaminoethyl (DEAE) groups, can be used. The matrix may be acrylamide, agarose, dextran, cellulose, or other types commonly used in protein purification. Alternatively, a cation exchange step can be used. Suitable cation exchange agents include various insoluble matrices containing sulfopropyl or carboxymethyl groups. Finally, the cancer stem cell protein-Fc composition can be further purified using one or more reversed-phase high-performance liquid chromatography (RP-HPLC) steps using a hydrophobic RP-HPLC medium, such as silica gel having pendant methyl or other aliphatic groups. Furthermore, some or all of the above purification steps can be used in various combinations to provide homogeneous recombinant protein.

[0125] Recombinant proteins produced in bacterial cultures can be isolated, for example, by initial extraction from a cell pellet, followed by one or more concentration, salting-out, aqueous ion exchange, or size exclusion chromatography steps. High-performance liquid chromatography (HPLC) may be used for the final purification step. Microbial cells used for recombinant protein expression can be destroyed by any convenient method, including freeze-thaw cycles, sonication, mechanical disruption, or the use of cell lysis agents.

[0126] In some embodiments, tumor vaccines can be produced by subjecting a vector to an in vitro translation reaction. Many exemplary systems exist that are available to those skilled in the art (e.g., Retic Lysate IVT Kit, Life Technologies, Waltham, MA).

[0127] The present invention also envisions the use of nucleic acid molecules as vehicles for delivering neoantigenic peptides / polypeptides to subjects in need of treatment, either in vivo or ex vivo, for example, in the form of DNA / RNA vaccines (see, for example, WO2012 / 159643 and WO2012 / 159754, which are incorporated herein by reference in their entirety).

[0128] In one embodiment, a vector containing an in-frame cDNA fragment sequence (e.g., an expression vector) can be administered to a patient in need of treatment to generate an in vivo tumor vaccine. These are typically vectors consisting of a potent viral promoter that drives in vivo transcription and translation of the gene (or complementary DNA) of interest (Mor, et al., (1995). The Journal of Immunology 155(4):2039-2046). Occasionally, intron A may be included to improve mRNA stability and thus increase protein expression (Leitner et al., (1997). The Journal of Immunology 159(12):6112-6119). Plasmids also contain potent polyadenylation / transcription termination signals, such as bovine growth hormone or rabbit beta-globulin polyadenylation sequences (Alarcon et al., (1999). Adv. Parasitol. Advances in Parasitology 42:343-410; Robinson et al., (2000). Adv. Virus Res. Advances in Virus Research 55:1-74; Bohmet al., (1996). Journal of Immunological Methods 193(1):29-40). Occasionally, multicistron vectors are constructed to express two or more immunogens, or to express an immunogen and an immunostimulatory protein (Lewis et al., (1999). Advances in Virus Research (Academic Press) 54:129-88).

[0129] Since the vector is the "vehicle" on which the tumor vaccine is expressed, optimizing the vector design is essential for maximum protein expression (Lewis et al., (1999). Advances in Virus Research (Academic Press) 54:129-88). Another consideration is the choice of promoter. Such promoters may be the SV40 promoter or Roussarcoma virus (RSV).

[0130] Vectors may be introduced into animal tissues by several different methods. The two most common approaches are injection of DNA in saline using a standard subcutaneous needle, and gene gun delivery. An outline of the construction of DNA vaccine vectors and their subsequent delivery to the host by these two methods is presented in Scientific American (Weiner et al., (1999) Scientific American 281(1):34-41). Injection in saline is usually performed intramuscularly (IM) or intradermally (ID) in skeletal muscle, and the DNA is delivered into the extracellular space. This can be assisted by electroporation by transiently damaging muscle fibers with a myotoxin such as bupivacaine, or by using a hypertonic solution of saline or sucrose (Alarcon et al., (1999). Adv. Parasitol. Advances in Parasitology 42:343-410). The immune response to this delivery method can be influenced by many factors, including the type of needle, needle alignment, injection speed, injection volume, muscle type, and the age, sex, and physiological state of the animal being injected (Alarcon et al., (1999). Adv. Parasitol. Advances in Parasitology 42:343-410).

[0131] Another commonly used delivery method, gene gun delivery, uses compressed helium as an accelerator to ballistically accelerate plasmid DNA (pDNA) adsorbed onto gold or tungsten microparticles into target cells (Alarcon et al., (1999). Adv. Parasitol. Advances in Parasitology 42:343-410, Lewis et al., (1999). Advances in Virus Research (Academic Press) 54:129-88).

[0132] Alternative delivery methods include aerosol administration of naked DNA onto mucosal surfaces such as the nasal and lung mucosa (Lewis et al., (1999). Advances in Virus Research (Academic Press) 54:129-88), and topical administration of pDNA to the ocular and vaginal mucosa (Lewis et al., (1999) Advances in Virus Research (Academic Press) 54:129-88). Mucosal surface delivery can also be achieved using cationic liposomal DNA preparations, biodegradable microspheres, attenuated Shigella or Listeria vectors, and recombinant adenovirus vectors for oral administration to the intestinal mucosa.

[0133] The amount of DNA required to elevate an effective immune response is determined by the delivery method. While saline injection requires a variable amount of DNA (10 μg to 1 mg) to achieve an effective immune response, gene gun delivery requires 100 to 1000 times less DNA than intramuscular saline injection. Generally, 0.2 μg to 20 μg is required, although amounts as low as 16 ng have been reported. These amounts vary by species; for example, mice require approximately 10 times less DNA than primates. Saline injection requires more DNA because the DNA is delivered to the extracellular space of the target tissue (usually muscle) and must overcome physical barriers (to some extent, the basal layer and a large amount of connective tissue) before being taken up by the cell, whereas gene delivery bombards the cell directly with DNA, resulting in less "waste" (e.g., Sedegah et al., (1994). Proceedings of the National Academy of Sciences of the United States of America 91(21):9866-9870, Daheshia et al., (1997). The Journal of Immunology 159(4):1945-1952, Chen et al., (1998). The Journal of Immunology 160(5):2425-2432, Sizemore (1995) Science 270(5234):299-302, Fynan et al. See al., (1993) Proc. Natl. Acad. Sci. USA 90(24):11478-82.

[0134] In certain embodiments, the vaccine encoding vector disclosed herein may be used in ex vivo immunotherapy. For example, in some embodiments, the vaccine encoding vector may be transfected or transduced into antigen-presenting cells (e.g., dendritic cells). In certain embodiments, these antigen-presenting cells are then administered to a subject. In some embodiments, these antigen-presenting cells are used to activate T cells (e.g., autologous T cells, syngeneic T cells) in vitro, which are then administered to a subject.

[0135] In one embodiment, the tumor vaccine or immunogenic composition may comprise, for example, a separate DNA plasmid encoding one or more neoantigenic peptides / polypeptides identified according to the present invention. As discussed herein, the precise selection of the expression vector may depend on the peptide / polypeptide being expressed and is well within the scope of the art of the art. The expected persistence of the DNA construct (e.g., in episomal, non-replicating, non-integrated forms in muscle cells) is expected to provide an increased protection period.

[0136] Alternatively, an in-frame enriched RNA library can be transfected or electroporated into cells in vitro, or delivered directly to a target in vivo. RNA vaccines can be produced using self-replicating RNA. RNA vaccines can be delivered to a target using several methods, for example, subcutaneous, intramuscular, or intravenous injection, topical application to the skin, or nasal spray. RNA vaccines can also be delivered using lipid nanoparticles or RNA viruses. Typical RNA viruses used as vectors include, but are not limited to, retroviruses, lentiviruses, alphaviruses, and rhabdoviruses.

[0137] The tumor vaccine of the present invention may be encoded and expressed in vivo using a virus-based system (e.g., an adenovirus system, an adeno-associated virus (AAV) vector, a poxvirus, or a lentivirus). In one embodiment, the tumor vaccine or immunogenic composition may include a virus-based vector for use in human patients requiring treatment, such as an adenovirus (see, for example, Baden et al. First-in-human evaluation of the safety and immunogenicity of a recombinant adenovirus serotype26 HIV-1 Env vaccine (IPCAVD001). J Infect Dis. 2013 Jan15;207(2):240-7, which are incorporated herein by reference in their entirety). Plasmids that can be used for the delivery of adeno-associated viruses, adenoviruses, and lentiviruses have been previously described (see, for example, U.S. Patent Nos. 6,955,808 and 6,943,019, and U.S. Patent Application No. 2008 / 0254008, which are incorporated herein by reference).

[0138] Among the vectors that can be used in carrying out the present invention, integration into the host genome of cells is possible using retroviral gene transfer methods, often resulting in long-term expression of the inserted transgene. In preferred embodiments, the retrovirus is a lentivirus. Furthermore, high transduction efficiency has been observed in many different cell types and target tissues. The tropism of retrovirals can be altered by incorporating foreign envelope proteins and expanding the potential target population of target cells. Retroviruses can also be manipulated to enable conditional expression of the inserted transgene, such that only specific cell types are infected by the lentivirus. Expression in specific cell types can be targeted using cell type-specific promoters. Lentiviral vectors are retroviral vectors (therefore, both lentiviral vectors and retroviral vectors can be used in carrying out the present invention). Furthermore, lentiviral vectors are preferred because they can transduce or infect non-dividing cells and typically generate high viral titers. Therefore, the selection of retroviral gene transfer systems may depend on the target tissue. Retroviral vectors consist of cis-acting long terminal repeats with the ability to package foreign sequences up to 6-10 kb. A minimal cis-acting LTR is sufficient for vector replication and packaging, and the vector is then incorporated into target cells using the desired nucleic acid to provide persistent expression.Widely used retroviral vectors that may be used in the implementation of the present invention include those based on mouse leukemia virus (MuLV), gibbon leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, for example, Buchscher et al., (1992) J.Virol.66:2731-2739, Johann et al., (1992) J.Virol.66:1635-1640, Sommnerfelt et al., (1990) Virol.176:58-59, Wilson et al., (1998) J.Virol.63:2374-2378, Miller et al., (1991) J.Virol.65:2220-2224, PCT / US94 / 05700). Zou et al. reported that 1 × 10⁻⁶ was detected by intrathecal catheter. 9 Approximately 10 μl of recombinant lentivirus having a titer of transduction units (TU) / ml was administered. These types of dosages can be adapted to or extrapolated to the use of retroviruses or lentiviral vectors in the present invention.

[0139] Furthermore, useful in carrying out the present invention are minimal non-primate lentiviral vectors, such as lentiviral vectors based on equine infectious anemia virus (EIAV) (see, for example, Balagaan, (2006) J Gene Med;8:275-285 DOI:10.1002 / jgm.845, published online on November 21, 2005). The vector may have a cytomegalovirus (CMV) promoter that drives the expression of a target gene. Therefore, the present invention aims to provide viral vectors, including retroviral vectors and lentiviral vectors, among the vectors useful in carrying out the present invention.

[0140] Also useful in the practice of the present invention is an adenovirus vector. One advantage is the ability of recombinant adenoviruses to efficiently transcribe and express recombinant genes in vitro and in vivo in a variety of mammalian cells and tissues, resulting in high expression of the transcribed nucleic acid. Furthermore, the ability to infect quiescent cells productively extends the utility of recombinant adenovirus vectors. In addition, the high expression levels ensure that the nucleic acid product is expressed to levels sufficient to generate an immune response (see, e.g., U.S. Patent No. 7,029,848, which is incorporated herein by reference).

[0141] In embodiments herein, delivery is via an adenovirus, which can be a single booster dose containing at least 1×10 5 particles (also referred to as particle units, pu) of an adenovirus vector. In one embodiment herein, the dose is preferably at least about 1×10 6 particles (e.g., about 1×10 6 to 1×10 12 particles), more preferably at least about 1×10 7 particles, even more preferably at least about 1×10 8 particles (e.g., about 1×10 8 to 1×10 11 particles, or about 1×10 8 to 1×10 12 particles), most preferably at least about 1×10 9 particles (e.g., about 1×10 9 to 1×10 10 particles, or about 1×10 9 to 1×10 12 particles), or even further at least about 1×10 10 particles (e.g., about 1×10 10 to 1×10 12 particles) of an adenovirus vector. Alternatively, the dose is about 1×10 14 particles or less, preferably about 1×10 13 particles or less, even more preferably about 1×10 12 particles or less, even more preferably about 1×1011 Particles of a certain size or less, most preferably about 1 × 10⁶ 10 Particles of a certain size or less (for example, about 1 × 10⁻¹⁶) 9 It includes (items of 1 or less). Therefore, the dosage is, for example, about 1 × 10 6 A single particle unit (pu), approximately 2 × 10⁻¹⁶ 6 pu, approx. 4×10 6 pu, about 1×10 7 pu, about 2×10 7 pu, approx. 4×10 7 pu, about 1×10 8 pu, about 2×10 8 pu, approx. 4×10 8 pu, about 1×10 9 pu, about 2×10 9 pu, approx. 4×10 9 pu, about 1×10 10 pu, about 2×10 10 pu, approx. 4×10 10 pu, about 1×10 11 pu, about 2×10 11 pu, approx. 4×10 11 pu, about 1×10 12 pu, about 2×10 12 PU, or approximately 4 x 10 12 The present invention may contain a single-dose adenovirus vector, including a pu adenovirus vector. For example, see the adenovirus vector in U.S. Patent No. 8,454,972 B2, granted to Nabel et al. on June 4, 2013, which is incorporated herein by reference, and the dosage in paragraphs 29, 36-58. In one embodiment herein, the adenovirus is delivered via multiple doses.

[0142] In terms of in vivo delivery, AAV has an advantage over other viral vectors due to its low toxicity and low likelihood of causing insertional mutagenesis, as it is not integrated into the host genome. AAV has a packaging limit of 4.5 or 4.75 Kb. Constructs larger than 4.5 or 4.75 Kb significantly reduce viral production. Many promoters exist that can be used to drive nucleic acid molecule expression. AAV ITR can act as a promoter, which is advantageous in that it eliminates the need for additional promoter elements. For ubiquitous expression, the following promoters can be used: CMV, CAG, CBh, PGK, SV40, ferritin heavy chain or light chain, etc. For brain expression, the following promoters may be used: Synapsin I for all neurons, CaMKIIalpha for excitatory neurons, GAD67 or GAD65 or VGAT for GABAergic neurons, etc. Promoters that can be used to drive RNA synthesis include: Pol III promoters such as U6 or H1. The Pol II promoter and intron cassette can be used to express guide RNA (gRNA).

[0143] Regarding AAV, AAV may be AAV1, AAV2, AAV5, or any combination thereof. AAV may be selected with respect to the target cells; for example, AAV serotypes 1, 2, 5, or hybrid capsid AAV1, AAV2, AAV5, or any combination thereof may be selected to target brain or nerve cells, and AAV4 may be selected to target cardiac tissue. AAV8 is useful for delivery to the liver. The promoters and vectors listed above are individually preferred.

[0144] In one embodiment of this specification, delivery is via AAV. The therapeutically effective dose for in vivo delivery of AAV to humans is approximately 1 × 10⁻⁶. 10 ~Approx. 1×10 14This is considered to be a saline solution in the range of about 20 to about 50 ml containing 1 x 10⁶ functional AAV / ml solution. The dosage may be adjusted to balance the therapeutic benefit with respect to any side effects. In one embodiment of this specification, the AAV dose is generally about 1 × 10⁶. 5 ~1 × 10 14 Genome AAV, approximately 1 × 10⁻⁶ 8 ~1 × 10 14 Genome AAV, approximately 1 × 10⁻⁶ 10 ~Approx. 5×10 13 Genome, or approximately 1 × 10⁻⁶ 11 ~Approx. 1×10 13 It falls within the range of genomic AAV concentrations. The human dosage is approximately 1 x 10⁻⁶. 13 This may be genomic AAV. Such concentrations can be delivered in a carrier solution of about 0.001 ml to about 100 ml, about 0.05 to about 50 ml, or about 10 to about 25 ml. In a preferred embodiment, the AAV is about 2 × 10 13 Used in titers of viral genome / milliliter, each of the mouse striatal hemispheres receives a single injection of 500 nanoliters. Other effective dosages can be readily established by those skilled in the art through standard tests to establish dose-response curves. See, for example, U.S. Patent No. 8,404,658 B2, granted to Hajjar, et al. on March 26, 2013, paragraph 27, lines 45-60.

[0145] In another embodiment, effectively activating the cellular immune response of a tumor vaccine or immunogenic composition can be achieved by expressing the relevant antigen in the vaccine or immunogenic composition in a non-pathogenic microorganism. Well-known examples of such microorganisms include Mycobacterium species such as bovine BCG, Salmonella, and Pseudomona (see U.S. Patent No. 6,991,797, which is incorporated herein by reference in its entirety).

[0146] In another embodiment, poxviruses are used in tumor vaccines or immunogenic compositions. These include orthopoxvirus, fowlpox, vaccinia, MVA, NYVAC, canarypox, ALVAC, chickenpox, and TROVAC (see, for example, Verardiet al., Hum Vaccin Immunother. 2012 Jul;8(7):961-70, and Moss, Vaccine. 2013;31(39):4220-4222). Poxvirus expression vectors were described in 1982 and quickly became widely used in vaccine development and research in numerous fields. The advantages of these vectors include simple construction, the ability to handle large amounts of foreign DNA, and high expression levels.

[0147] In another embodiment, vaccinia virus is used in tumor vaccines or immunogenic compositions to express a neoantigen. (See Rolph et al., Recombinant viruses as vaccines and immunological tools. Curr Opin Immunol 9:517-524, 1997). Recombinant vaccinia virus can replicate in the cytoplasm of infected host cells, and thus the polypeptide of interest can induce an immune response. Furthermore, poxviruses have been widely used as vaccine or immunogenic composition vectors because they have the ability to target the antigen encoded by the major histocompatibility complex class I pathway for processing by directly infecting immune cells, particularly antigen-presenting cells, but also because they have the ability to act as auto-adjuvants.

[0148] In another embodiment, ALVAC is used as a vector in a tumor vaccine or immunogenic composition. ALVAC is a canarypox virus that can be modified to express foreign transgenes and is used as a method for vaccination against both prokaryotic and eukaryotic antigens (Horig H, Lee DS, Conkright W, et al. Phase I clinical trial of a recombinant canarypoxvirus (ALVAC) vaccine expressing human carcinoembryonic antigen and the B7.1 co-stimulatory molecule. Cancer Immunol Immunother 2000;49:504-14; von Mehren M, Arlen P, Tsang KY, et al. Pilot study of a dual gene recombinant avipox vaccine containing both carcinoembryonic antigen (CEA) and B7.1 transgenes in patients with recurrent CEA-expressing adenocarcinomas. Clin Cancer Res 2000;6:2219-28; Musey L, Ding Y, Elizaga M, et al. HIV-1 vaccination administered intramuscularly can induce both systemic and eukaryotic antigens). mucosal T cell immunity in HIV-1-uninfected individuals.J Immunol2003;171:1094-101, Paoletti E. Applications of pox virus vectors to vaccination: an update.Proc Natl Acad Sci USA1996;93:11349-53, US Patent No. 7,255,862).In a Phase I clinical trial, the ALVAC virus expressing the tumor antigen CEA demonstrated a superior safety profile and resulted in an increased CEA-specific T cell response in selected patients; however, no objective clinical response was observed (Marshall JL, Hawkins MJ, Tsang KY, et al. Phase I study in cancer patients of a replication-defective avipox recombinant vaccine that expresses human carcinoembryonic antigen. J Clin Oncol 1999;17:332-7).

[0149] In another embodiment, modified vaccinia ankara (MVA) virus may be used as a viral vector for tumor vaccines or immunogenic compositions. MVA is a member of the orthopox family and is produced by approximately 570 sequential pathways on bird embryo fibroblasts of the Ankara strain of vaccinia virus (CVA) (see Mayer, A., et al. Infection 3, 6-14, 1975 for an overview). As a result of these pathways, the resulting MVA virus contains 31 kilobases less genomic information compared to CVA and is highly restricted to host cells (Meyer, H. et al., J. Gen. Virol. 72, 1031-1038, 1991). MVA is characterized by its extreme attenuation, i.e., reduced toxicity or infectivity, but still possesses excellent immunogenicity. Testing in various animal models has demonstrated that MVA is nonpathogenic even in immunosuppressed individuals. Furthermore, MVA-BN(registered trademark)-HER2 is a candidate immunotherapy designed for the treatment of HER-2-positive breast cancer and is currently in clinical trials. (Mandl et al., Cancer Immunol Immunother. Jan 2012;61(1):19-29). Methods for preparing and using recombinant MVA are described (see, for example, U.S. Patents 8,309,098 and 5,185,146, which are incorporated herein by reference in their entirety).

[0150] In another embodiment, vaccinia virus, NYVAC, and modified Copenhagen strains of NYVAC mutations are used as vectors (see U.S. Patent No. 7,255,862, PCT WO95 / 30018, U.S. Patent No. 5,364,773, and U.S. Patent No. 5,494,807, all of which are incorporated herein by reference).

[0151] In one embodiment, recombinant viral particles of a vaccine or immunogenic composition are administered to a patient in need of treatment. The vaccine or immunogenic composition may be administered in any suitable amount to achieve expression at these dosage levels. The viral particles are at least about 10 3.5 The amount of pfu can be administered to patients in need of treatment or transfected into cells, and therefore the viral particles can be at least about 10 4 pfu~about 10 6 PFU may be administered to patients requiring treatment, or it may infect or transfect cells, however, patients requiring treatment may have a more preferred dose of at least about 10 7 pfu~about 10 9 So that it can be pfu, at least about 10 8 It can be administered as pfu. Dosage for NYVAC is applicable depending on ALVAC, MVA, MVA-BN, and flu pox such as canarypox and fowlpox.

[0152] Pharmaceutical composition / method of delivery In certain embodiments, the herein provides a pharmaceutical composition comprising an amplification product comprising an in-frame cDNA fragment sequence produced by the method herein. In certain embodiments, the herein provides a pharmaceutical composition comprising a vector comprising an in-frame cDNA fragment sequence produced by the method herein. In some embodiments, the pharmaceutical composition provided by the present invention further comprises a pharmaceutically acceptable carrier.

[0153] In certain embodiments, the pharmaceutical composition is intended for use in the production of a tumor vaccine. In certain embodiments, the pharmaceutical composition is intended for use in the treatment of cancer.

[0154] The present invention also relates to a pharmaceutical composition comprising an effective amount of tumor vaccine produced by the method herein, optionally combined with a pharmaceutically acceptable carrier, excipient, or additive.

[0155] "Pharmacopoeia-acceptable carriers" refer to substances that assist in the administration of activators to a subject and their absorption by the subject, and may be included in the compositions described herein without causing significantly harmful toxic effects to the patient. Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, ordinary saline, Ringer's lactate, ordinary sucrose, ordinary glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavorings, salt solutions (such as Ringer's solution), alcohols, oils, gelatin, carbohydrates such as lactose, amylase, or starch, fatty acid esters, hydroxymethylcellulose, polyvinylpyrrolidine, and colorants. Such preparations may be sterilized and, if necessary, may be mixed with adjuvants such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts to affect osmotic pressure, buffers, colorants, and / or aromatics, which do not react harmfully with the compositions described herein. Those skilled in the art will recognize that other pharmaceutically acceptable excipients may be useful.

[0156] Tumor vaccines may be administered as the sole active pharmaceutical agent, or they may be used in combination with one or more other agents and / or adjuvants. When administered in combination, the therapeutic agents may be formulated as separate compositions that are given simultaneously or at different times, or the therapeutic agents may be given as a single composition.

[0157] The composition may be administered once daily, twice daily, every two days, every three days, every four days, every five days, every six days, every seven days, every two weeks, every three weeks, every four weeks, every two months, every six months, or once a year. The dosing interval may be adjusted according to the individual patient's needs. For longer dosing intervals, sustained-release formulations or depot formulations may be used.

[0158] The compositions of the present invention may be used to treat acute diseases and disease conditions, and may also be used to treat chronic conditions. In particular, the compositions of the present invention may be used in methods of treating or preventing tumors. In certain embodiments, the compounds of the present invention are administered for periods exceeding 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 1 year, 2 years, 3 years, 4 years, or 5 years, 10 years, or 15 years, or for any period of days, months, or years, for example, any period of any duration from 14 days to 15 years and any period of any duration from 15 days to 20 years (e.g., 4 weeks to 15 years, 6 months to 20 years). In some cases, it may be advantageous for the compounds of the present invention to be administered over the remainder of the patient's life. In preferred embodiments, the patient is monitored to check for progression of the disease or disability, and the dose is adjusted accordingly. In a preferred embodiment, the treatment according to the present invention is effective for at least two weeks, three weeks, one month, two months, three months, four months, five months, six months, one year, two years, three years, four years, or five years, ten years, fifteen years, twenty years, or for the remainder of the subject's life.

[0159] Tumor vaccines may be administered by injection, orally, parenterally, by inhalation spray, rectally, vaginally, or topically in a dosage unit formulation containing a conventional pharmaceutically acceptable carrier, adjuvant, and vehicle. As used herein, parenteral administration includes administration by lymph node(s), subcutaneous, intravenous, intramuscular, intrasternal, infusion technique, intraperitoneal, eye or ocular, intravitreous, intracheek, percutaneous, intranasal, intracranial and intradural, intraarticular (including ankle, knee, hip, shoulder, elbow, wrist), directly to the tumor, and in suppository form.

[0160] Surgical resection involves surgery to remove abnormal tissue in cancers such as mediastinal, neurogenic, or germ cell tumors, or thymoma. In certain embodiments, administration of the tumor vaccine or immunogenic composition is initiated 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks or more after tumor resection. Preferably, administration of the tumor vaccine or immunogenic composition is initiated 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 weeks after tumor resection. In some embodiments, the tumor may not be completely resected, and administration of the tumor vaccine is performed while the tumor is still present in the patient.

[0161] A prime / boost regimen refers to the sequential administration of a vaccine or immunogenic or immunological composition. In certain embodiments, the administration of a tumor vaccine or immunogenic composition is a prime / boost administration regimen, e.g., the administration of the tumor vaccine or immunogenic composition as the prime at weeks 1, 2, 3, or 4, and the administration of the tumor vaccine or immunogenic composition as the boost at months 2, 3, or 4. In another embodiment, a heterologous prime-boost strategy is used to induce a greater cytotoxic T cell response (Schneider et al., Induction of CD8+ T cells using heterologous prime-boost immunization strategies, Immunological Reviews Volume 170, Issue 1, pages 29-38, August 1999). In another embodiment, DNA encoding the tumor vaccine is used as prime, followed by a protein boost. In another embodiment, a protein is used as prime, followed by a boost with a virus encoding the tumor vaccine. In another embodiment, a virus encoding a tumor vaccine is used as a prime, and another virus is used as a boost. In yet another embodiment, a protein is used as a prime, and DNA is used as a boost. In a preferred embodiment, a DNA vaccine or immunogenic composition is used for the prime T cell response, and a recombinant viral vaccine or immunogenic composition is used to boost the response. In yet another preferred embodiment, the viral vaccine or immunogenic composition is administered co-administered with a protein or DNA vaccine or immunogenic composition to function as an adjuvant for the protein or DNA vaccine or immunogenic composition.Subsequently, the patient may be boosted with either a viral vaccine or immunogenic composition, a protein, or a DNA vaccine or immunogenic composition (see Hutchings et al., Combination of protein and viral vaccines induces potent cellular and humoral immune responses and enhanced protection from murine malaria challenge. Infect Immun. 2007 Dec;75(12):5819-26. Epub 2007 Oct 1).

[0162] Pharmaceutical compositions may be processed according to conventional pharmaceutical methods for producing medicinal drugs for administration to patients in need of treatment, including humans and other mammals.

[0163] The tumor vaccine produced by the method described herein may contain one or more neoantigens. In certain embodiments, the pharmaceutical composition further comprises an immunomodulator or adjuvant. In certain embodiments, the immunomodulator or adjuvant may be polyICLC, 1018 ISS, aluminum salt, Amplivax, AS15, BCG, CP-870, 893, CpG7909, CyaA, dSLIM, GM-CSF, IC30, IC31, imiquimod, ImuFact IMP321, IS The immunomodulator or adjuvant is selected from the group consisting of Patch, ISS, ISCOMATRIX, JuvImmune, LipoVac, MF59, monophosphoryl lipid A, montanaid IMS1312, montanaid ISA206, montanaid ISA50V, montanaid ISA-51, OK-432, OM-174, OM-197-MP-EC, ONTAK, PEPTEL, vector systems, PLGA microparticles, reciquimod, SRL172, virosoms, and other virus-like particles, YF-17D, VEGF trap, R848, beta-glucan, Pam3Cys, and Aquila's QS21 stimulon. In certain embodiments, the immunomodulator or adjuvant includes polyICLC.

[0164] For example, xanthenone derivatives such as badimezan or AsA404 (also known as 5,6-dimethylaxanthenone-4-acetic acid (DMXAA)) may also be used as adjuvants according to embodiments of the present invention. Alternatively, such derivatives may also be administered in parallel with the vaccine or immunogenic composition of the present invention, for example, via systemic delivery or intratumoral delivery, to stimulate immunity at the tumor site. While not bound by theory, such xanthenone derivatives are thought to act by stimulating interferon (IFN) production via the IFN gene stimulator, the STING receptor (see, for example, Conlon et al. (2013) Mouse, but not Human STING, Binds and Signals in Response to the Vascular Disrupting Agent 5,6-Dimethylxanthenone-4-Acetic Acid, Journal of Immunology, 190:5216-25, and Kim et al. (2013) Anticancer Flavonoids are Mouse-Selective STING Agonists, 8:1396-1401).

[0165] Tumor vaccines or immunological compositions may also include adjuvant compounds selected from acrylic or methacrylic polymers and copolymers of maleic anhydride and alkenyl derivatives. In particular, these may be polymers (carbomers) in which acrylic or methacrylic acid is crosslinked with a polyalkenyl ether of a sugar or polyalcohol, and especially polymers crosslinked with allyl clucrose or allyl pentaerythritol. Alternatively, for example, a copolymer of maleic anhydride crosslinked with divinyl ether and ethylene may also be used (see U.S. Patent No. 6,713,068, which is incorporated herein by reference in whole).

[0166] The pharmaceutical compositions include tumor vaccines as described herein, in therapeutically effective amounts for treating diseases and conditions described herein (e.g., tumors), optionally combined with pharmaceutically acceptable additives, carriers, and / or excipients. Those skilled in the art will recognize from this disclosure and knowledge of the art that one of the more compounds according to the present invention in therapeutically effective amounts may vary depending on the condition being treated, its severity, the treatment regimen used, the pharmacokinetics of the agent used, and the patient (animal or human) being treated.

[0167] To prepare a pharmaceutical composition according to the present invention, a dose is produced by closely mixing one or more of the compounds according to the present invention in a therapeutically effective amount with a pharmaceutically acceptable carrier, preferably according to conventional pharmaceutical formulation techniques. The carrier can take a wide variety of forms depending on the form of the preparation desired for ocular, oral, topical, or parenteral administration, including, among many others, for example, gels, creams, ointments, lotions, and implantable preparations that are released over time. Any of the usual pharmaceutical media can be used to prepare pharmaceutical compositions in oral dosage forms. Therefore, suitable carriers and additives, including water, glycols, oils, alcohols, flavoring agents, preservatives, colorants, etc., can be used for liquid oral preparations such as powders, tablets, capsules, and suppositories. Suitable carriers and additives, including sugar carriers such as starch, dextrose, mannitol, lactose, and related carriers, diluents, granulators, lubricants, binders, disintegrants, etc., can be used for solid oral preparations such as powders, tablets, capsules, and suppositories. If necessary, tablets or capsules may be enterically coated or sustained-release by standard techniques.

[0168] The active compound is contained in a pharmaceutically acceptable carrier or diluent in an amount sufficient to deliver a therapeutically effective dose to the patient for the desired indication without causing serious toxicity to the patient being treated.

[0169] Oral compositions generally contain an inert diluent or food carrier. They may be encapsulated in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound or its prodrug derivative may be incorporated with excipients and used in the form of tablets, lozenges, or capsules. Pharmaceutically compatible binders and / or adjuvant materials may be included as part of the composition.

[0170] Tablets, pills, capsules, lozenges, etc., may contain any of the following components or compounds of similar properties: binders such as microcrystalline cellulose, tragacanth gum, or gelatin; excipients such as starch or lactose; dispersants such as alginic acid or corn starch; lubricants such as magnesium stearate; lubricants such as colloidal silicon dioxide; sweeteners such as sucrose or saccharin; or flavoring agents such as peppermint, methyl salicylate, or orange flavoring agents. If the dosage unit form is a capsule, it may contain a liquid carrier such as fatty oil in addition to the materials discussed herein. In addition, the dosage unit form may contain various other materials that modify the physical form of the dosage unit, such as coatings of sugar, shellac, or enteric coatings.

[0171] Formulations of the present invention suitable for oral administration may be presented as separate units such as capsules, cachetes, or tablets, each containing a predetermined amount of the active ingredient; as powders or granules; as solutions or suspensions in aqueous or non-aqueous liquids; or as oil-in-water or water-in-oil emulsions; and as boluses, etc.

[0172] Tablets may be prepared by compression or molding with one or more adjuncts as optional. Compressed tablets may be prepared by compressing an active ingredient in a free-flowing form, such as a powder or granules, mixed with an active ingredient as optional in a suitable machine, along with a binder, lubricant, inert diluent, preservative, surfactant, or dispersant. Molded tablets may be prepared by molding a mixture of powder compounds moistened with an inert liquid diluent in a suitable machine. Tablets may be optionally coated or scored and formulated to provide sustained or controlled release of the active ingredient therein.

[0173] Methods for formulating such sustained-release or controlled-release compositions of pharmaceutically active ingredients are known in the art and are described in several issued U.S. patents, some of which include, but are not limited to, U.S. Patents 3,870,790, 4,226,859, 4,369,172, 4,842,866, and 5,705,190, the disclosures of which are incorporated herein by reference in their entirety. Coatings may be used to deliver compounds to the intestines (see, for example, U.S. Patents 6,638,534, 5,541,171, 5,217,720, and 6,569,457, and the references cited therein).

[0174] The active compound or a pharmaceutically acceptable salt thereof may also be administered as an ingredient in elixirs, suspensions, syrups, wafers, chewing gums, and the like. In addition to the active compound, the syrup may contain sucrose or fructose as a sweetener, as well as certain preservatives, pigments, colorants, and flavorings.

[0175] Solutions or suspensions used for ocular, parenteral, intradermal, subcutaneous, or topical application may include the following components: sterile diluents such as water for injection, physiological saline, non-volatile oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; antimicrobial agents such as benzyl alcohol or methylparaben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates, or phosphates; and agents for adjusting isotonicity such as sodium chloride or dextrose.

[0176] In certain embodiments, the pharmaceutically acceptable carrier is an aqueous solvent, i.e., a solvent containing water with optionally additional co-solvents. Examples of pharmaceutically acceptable carriers include water, buffer in water (phosphate-buffered saline (PBS), and 5% dextrose (D5W) in water, or 10% trehalose or 10% sucrose). In certain embodiments, the aqueous solvent further comprises, for example, about 1-4% or 1-3% dimethyl sulfoxide (DMSO). In certain embodiments, the pharmaceutically acceptable carrier is isotonic (i.e., has substantially the same osmotic pressure as body fluids such as plasma).

[0177] In one embodiment, the active compound is prepared with a carrier that protects the compound from rapid elimination from the body, such as a controlled-release formulation comprising a graft and a microencapsulated delivery system. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoester, polylactic acid, and polylactic acid-coglycolic acid (PLGA) may be used. Methods for preparing such formulations are within the scope of the art, taking into account the present disclosure and the knowledge in the art.

[0178] From this disclosure and knowledge of the art, those skilled in the art will recognize that, in addition to tablets, other dosage forms may be formulated to provide sustained-release or controlled release of the active ingredient. Such dosage forms include, but are not limited to, capsules, granules, and gel caps.

[0179] Liposome suspensions can also be pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art. For example, a liposome formulation can be prepared by dissolving a suitable lipid in an inorganic solvent, which then evaporates, leaving a thin film of dried lipid on the surface of the container. An aqueous solution of the active compound is then introduced into the container. The container is then swirled by hand to release the lipid material from the sides of the container, dispersing lipid aggregates and thereby forming a liposome suspension. Other preparation methods known to those skilled in the art can also be used in this aspect of the present invention.

[0180] Formulations may be presented in unit dosage forms if convenient and can be prepared by conventional pharmaceutical techniques. Such techniques involve the step of associating the active ingredient with a pharmaceutical carrier or excipient. Generally, formulations are prepared by homogeneously and closely associating the active ingredient with a liquid carrier, or a finely divided solid carrier, or both, and then, if necessary, shaping the product.

[0181] Suitable formulations and compositions for topical administration to the mouth include lozenges containing a flavored base, typically sucrose and acacia or tragacanth components; lozenges containing an active ingredient such as gelatin and glycerin, or sucrose and acacia, in an inert base; and mouthwashes containing components administered in a suitable liquid carrier.

[0182] Formulations suitable for topical administration to the skin may be presented as ointments, creams, gels, and pastes containing the administered component in a pharmaceutically acceptable carrier. A preferred topical delivery system is a transdermal patch containing the administered component.

[0183] Formulations for rectal administration may be presented as suppositories containing, for example, a suitable base including cocoa butter or salicylate.

[0184] Suitable formulations for nasal administration, where the carrier is solid, include, for example, a coarse powder having a particle size in the range of 20 to 500 microns, administered in the manner of an olfactory drug, i.e., by rapid inhalation through the nasal passages from a powder container held close to the nose. Suitable formulations for administration, where the carrier is liquid, for example, as a nasal spray or nasal drops, include aqueous or oily solutions of the active ingredient.

[0185] Formulations suitable for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams, or spray formulations, containing, in addition to the active ingredient, such carriers known to be suitable in the art.

[0186] Parenteral preparations may be sealed in glass or plastic ampoules, disposable syringes, or multi-dose vials. When administered intravenously, preferred carriers include, for example, physiological saline or phosphate-buffered saline (PBS).

[0187] In the case of parenteral formulations, the carrier usually contains sterile water or an aqueous sodium chloride solution, but may also contain other components that aid in dispersion. Of course, if sterile water is used and maintained as sterile, the composition and carrier are also sterilized. Furthermore, injectable suspensions may be prepared, in which case appropriate liquid carriers, suspensions, etc., may be used.

[0188] Suitable formulations for parenteral administration include aqueous and non-aqueous sterile injection solutions that may contain antioxidants, buffers, bacteriostatic agents, and solutes to make the formulation isotonic with the blood of the intended recipient; as well as aqueous and non-aqueous sterile suspensions that may contain suspending agents and thickeners. The formulations may be presented in unit-dose or multi-dose containers, such as sealed ampoules and vials, and may be stored in a freeze-dried state requiring only the addition of a sterile liquid carrier, such as sterile water for injection, immediately before use. Immediate injection solutions and suspensions may be prepared from the aforementioned types of sterile powders, granules, and tablets.

[0189] The administration of the active compound may range from continuous administration (intravenous infusion) to several oral administrations per day (e.g., QID), and may include oral, topical, ocular, parenteral, intramuscular, intravenous, subcutaneous, transdermal (may include permeability enhancers), buccal, and suppository administration, among other routes of administration, including via the eye or ocular route.

[0190] Tumor vaccines or immunogenic compositions may be administered by injection, orally, parenterally, by inhalation spray, rectally, vaginally, or topically in a conventional pharmaceutically acceptable carrier, adjuvant, and vehicle-containing dosage unit formulation. As used herein, parenteral administration includes, but is not limited to, lymph node(s), subcutaneous, intravenous, intramuscular, intrasternal, infusion techniques, intraperitoneal, intraocular, intraocular, intravitreous, intracheek, percutaneous, intranasal, intracranial and intradural, intraarticular, including ankle, knee, hip, shoulder, elbow, and wrist, and directly to the tumor, as well as in suppository form.

[0191] Various techniques may be used to deliver the target composition to the site of interest, including the use of injections, catheters, trocars, projectiles, Pluronic gels, stents, sustained drug-release polymers, or other devices that provide internal access. If an organ or tissue is accessible by removal from the patient, such organ or tissue may be immersed in a medium containing the target composition, and the target composition may be applied to the organ or applied in any convenient manner.

[0192] Tumor vaccines may be administered through devices suitable for controlled and sustained release of compositions effective in obtaining desired local or systemic physiological or pharmacological effects. This method involves positioning a sustained-release drug delivery system over a region where drug release is desired and enabling the drug to be delivered through the device to the desired therapeutic area.

[0193] Treatment method The present invention provides a method for treating and / or alleviating cancer symptoms in a subject by inducing a tumor-specific immune response in the subject, vaccinating the tumor, and administering to the subject a tumor vaccine or a vector encoding a tumor vaccine, which is produced according to the method described herein.

[0194] According to the present invention, the tumor vaccine or vector encoding the tumor vaccine described herein may be used in patients diagnosed with cancer or patients at risk of developing cancer.

[0195] Cancers that can be treated with this tumor vaccine or the vector encoding the tumor vaccine include, among others, cases that are refractory to treatment with other chemotherapy. As used herein, the term “refractory” refers to cancer (and / or its metastases) that show little to no antiproliferative response (e.g., little to no inhibition of tumor growth) after treatment with another chemotherapeutic agent. These are cancers that cannot be satisfactorily treated with other chemotherapy. Refractory cancers include not only (i) cancers in which one or more chemotherapy treatments have already failed during the patient’s treatment, but also (ii) cancers that may be shown to be refractory by other means, such as biopsy and culture in the presence of chemotherapy.

[0196] The tumor vaccines or vectors encoding tumor vaccines described herein are also applicable to the treatment of previously untreated patients in need of treatment.

[0197] The tumor vaccines or vectors encoding tumor vaccines described herein are also applicable when the subject does not have a detectable tumor but is at high risk of disease recurrence.

[0198] Furthermore, the treatment of patients requiring treatment after autologous hematopoietic stem cell transplantation (AHSCT), particularly those exhibiting residual disease after AHSCT, is a key focus. The post-AHSCT setting is characterized by a low level of residual disease, the infusion of immune cells into a state of persistent expansion, and the absence of any standard relapse-delaying therapy. These characteristics provide a unique opportunity to use the described neoplasm vaccine or immunogenic composition to delay disease relapse.

[0199] In certain embodiments, the pharmaceutical compositions, tumor vaccines, or vectors encoding tumor vaccines described herein may be administered in conjunction with any other conventional anti-cancer treatment, such as radiotherapy and surgical resection of tumors. These treatments may be applied as needed and / or as indicated, and may be performed before, concurrently with, or after the administration of the pharmaceutical compositions, tumor vaccines, vectors encoding tumor vaccines, dosage forms, and kits described herein.

[0200] The effective dose of a tumor vaccine or vector encoding a tumor vaccine described herein is the amount of tumor vaccine or vector encoding a tumor vaccine that is effective in achieving the desired therapeutic response for a particular patient, composition, and mode of administration, and that has the lowest toxicity to the patient. The effective dose level can be identified using the methods described herein and depends on a variety of pharmacokinetic factors, including the activity of the particular composition administered, the route of administration, the time of administration, the excretion rate of the particular compound used, the duration of treatment, other drugs, compounds, and / or materials used in combination with the particular composition used, the age, sex, weight, condition, overall health, and medical history of the patient being treated, as well as similar factors well known in the medical field. In general, the effective dose of cancer therapy is the amount of therapeutic agent that is the minimum dose effective in producing a therapeutic effect. Such an effective dose generally depends on the factors described above.

[0201] Examples of administration routes include oral administration, rectal administration, topical administration, inhalation (intranasal), or injection. Administration by injection includes intravenous (IV), intralesional, peritumoral, intramuscular (IM), and subcutaneous (SC) administration. The compositions described herein may be administered in any form by any effective route, including, but not limited to, oral, parenteral, enteral, intravenous, intratumoral, intraperitoneal, topical, percutaneous (e.g., using any standard patch), intradermal, ocular, (intranasal), topical, parenteral, aerosol, inhalation, subcutaneous, intramuscular, buccal, sublingual, (trans)rectal, vaginal, intra-arterial, and intrathecal, transmucosal (e.g., sublingual, tongue, (trans)chuccal, (trans)urethral, ​​vagina (e.g., transvaginal and perivaginal), implantation, intravesical, intrapulmonary, duodenal, intragastric, and intrabronchial. In some embodiments, the pharmaceutical compositions, tumor vaccines, or vectors encoding vaccines described herein are administered orally, rectally, topically, intravesically, intra-lymphatic, intravesical, intravesical, intravesical, intra-urethral, ​​intra-vaginal

[0202] The drug regimen can be any of a variety of methods and amounts and can be determined by those skilled in the art according to known clinical factors. As is known in the medical field, the dosage for any one patient can depend on many factors, including the species, size, body surface area, age, sex, immune capacity, tumor size, and overall health status of the subject, the specific microorganism being administered, the duration and route of administration, the type and stage of the disease, for example, tumor size, and other compounds such as drugs administered concurrently.

[0203] The therapeutic methods described herein may be suitable for the treatment of primary tumors, secondary tumors, or metastases, as well as recurrent tumors or cancer. The dosages of the pharmaceutical compositions described herein may be appropriately determined or adjusted depending on the form of administration, route of administration, the severity or stage of the target disease, etc.

[0204] In some embodiments, the dose administered to a subject is sufficient to prevent cancer, delay its onset, slow or halt its progression, prevent cancer recurrence, or contribute to the subject's overall survival rate. Those skilled in the art will recognize that the dosage will depend on a variety of factors, including the potency of the particular compound used, as well as the subject's age, species, condition, and weight. The size of the dose will also be determined by the route, timing, and frequency of administration, as well as the presence, nature, and extent of any adverse side effects that may accompany the administration of the particular compound and the desired physiological effect.

[0205] Suitable doses and drug regimens can be determined by conventional range-finding techniques known to those skilled in the art. Generally, treatment is initiated with a smaller dose than the optimal dose of the compound. The dose is then gradually increased until the optimal effect under the given conditions is achieved. Effective doses and treatment protocols can be determined by conventional means, for example, by starting with a low dose in experimental animals, then increasing the dose while monitoring the effect, and similarly varying the drug regimen systematically. Animal studies are commonly used to determine the maximum tolerated dose ("MTD") of a bioactive agent per kilogram of body weight. Those skilled in the art periodically estimate doses for efficacy in other species, including humans, while avoiding toxicity.

[0206] Accordingly, in therapeutic use, the dosage of the tumor vaccine or vector encoding the tumor vaccine provided herein may vary depending on the specific tumor vaccine or vector encoding the tumor vaccine being administered, the age, weight, and clinical condition of the recipient patient, and the experience and judgment of the clinician or practitioner administering the treatment, among other factors that may influence the selected dosage. Generally, the dose should be sufficient to cause delay in tumor growth, preferably regression, and most preferably complete regression of the cancer.

[0207] Examples of cancers that can be treated by the methods described herein include, but are not limited to, hematological malignancies, acute nonlymphocytic leukemia, chronic lymphocytic leukemia, acute granulocytic leukemia, chronic granulocytic leukemia, acute promyelocytic leukemia, adult T-cell leukemia, nonleukemia, leukemia, basophilic leukemia, blastic leukemia, bovine leukemia, chronic myeloid leukemia, cutaneous leukemia, fetal leukemia, eosinophilic leukemia, Gross leukemia, Rieder cell leukemia, Schilling's leukemia, stem cell leukemia, subleukemia, and undifferentiated cell leukemia. Leukemia, hairy cell leukemia, hemocytoblastic leukemia, histiocytic leukemia, stem cell leukemia, acute monocytic leukemia, leukopenic leukemia, lymphoid leukemia, lymphoblastic leukemia, lymphoid leukemia, lymphosarcoma, mast cell leukemia, megakaryocytic leukemia, micromyeloblastic leukemia, monocytic leukemia, myeloblastic leukemia, myeloid leukemia, myelogranulocytic leukemia, myelomonocytic leukemia, Naegeli leukemia, plasmacytic leukemia, promyelocytic leukemia, acinous carcinoma, adenoid cystic carcinoma, adenomatous carcinoma Adenomatosum, adrenal cortical cancer, alveolar carcinoma, alveolar cell carcinoma, basal cell carcinoma, basocellulare carcinoma, basosquamous cell carcinoma, bronchioloalveolar carcinoma, bronchiolar carcinoma, bronchial carcinoma, gyrus carcinoma, cholangiocarcinoma, choriocarcinoma, mucinous carcinoma, comedone carcinoma, endometrial carcinoma, cribriform carcinoma, armory carcinoma, skin carcinoma (carcinoma cutaneum), columnar carcinoma, columnar cell carcinoma, duct carcinoma, compact carcinoma, fetal carcinoma, cerebral carcinoma, epidennoid carcinoma, epithelial carcinoma (carcinoma epitheliale adenoides), exophytic carcinoma, ex ulcere carcinoma, fibrous carcinoma (carcinoma fibrosum), gelatinous carcinoma (carcinoma fibrosum) carcinoma, gelatinous carcinomaCarcinoma, giant cell carcinoma, signet ring cell carcinoma, simple carcinoma, small cell carcinoma, solanoid carcinoma, spheroid cell carcinoma, spindle cell carcinoma, urethral sponge carcinoma, squamous cell carcinoma, squamous cell carcinoma, string carcinoma, telangiectatic carcinoma, telangiectatic carcinoma, transitional cell carcinoma, nodular carcinoma (carcinoma tuberosum), nodular carcinoma, verrucous carcinoma, choriocarcinoma, giant cell carcinoma, adenocarcinoma, granulosa cell carcinoma, hair matrix carcinoma, hematological carcinoma, hepatocellular carcinoma, Haasle cell carcinoma, hyaline carcinoma, adrenal carcinoma, pediatric embryonic carcinoma, carcinoma in situ, intraepidermal carcinoma, intraepithelial Carcinoma, Krompecher carcinoma, Kulchitzky cell carcinoma, large cell carcinoma, lenticular carcinoma, carcinoma lenticulare, lipomatous carcinoma, lymphoepithelial carcinoma, medullary carcinoma, medullary carcinoma, black carcinoma, soft carcinoma (carcinoma molle), mucinous carcinoma (mucinous carcinoma), mucinous carcinoma (carcinoma muciparum), mucoepidermoid carcinoma, mucosal carcinoma (carcinoma mucosum), mucinous carcinoma (mucous carcinoma), myxoma carcinoma, nasopharyngeal carcinoma, oat cell carcinoma, ossifying carcinoma, osteoid carcinoma, papillary carcinoma, periportal carcinoma, preinvasive carcinoma, squamous cell carcinoma, medullary carcinoma, renal cell carcinoma of the kidney, reserve cell carcinoma, sarcomatoid carcinoma, Schneiderian membrane carcinoma, scirrhous carcinoma, scrotal carcinoma Scroti), chondrosarcoma, fibrosarcoma, lymphosarcoma, malignant melanoma, myxosarcoma, osteosarcoma, endometrial sarcoma, stromal sarcoma, Ewing's sarcoma, fasciosarcoma, fibroblastic sarcoma, giant cell sarcoma, Abemethy's sarcoma, adipose sarcoma, liposarcoma, alveolar soft part sarcoma, ameloblastic sarcomaSarcoma, staphyloid sarcoma, green sarcoma, choriosarcoma, embryonal sarcoma, Wilms tumor sarcoma, granulocytic sarcoma, Hodgkin's sarcoma, idiopathic multiple pigmented hemorrhagic sarcoma, B-cell immunoblastic sarcoma, lymphoma, T-cell immunoblastic sarcoma, Jensen sarcoma, Kaposi's sarcoma, Kupffer cell sarcoma, angiosarcoma, leukosarcoma, malignant mesenchymal sarcoma, paraosteal osteosarcoma, reticulocytic sarcoma, rhabdosarcoma, serous cystic sarcoma, synovial sarcoma, telangiectatic sarcoma Sarcoma, Hodgkin's disease, non-Hodgkin lymphoma, multiple myeloma, neuroblastoma, bladder cancer, breast cancer, ovarian cancer, lung cancer, colorectal cancer, rhabdomyosarcoma, essential thrombocythemia, primary macroglobulinemia, small cell lung tumor, primary brain tumor, gastric cancer, colon cancer, malignant pancreatic insulinoma, malignant carcinoid, precancerous skin lesions, testicular cancer, lymphoma, thyroid cancer, neuroblastoma, esophageal cancer, urogenital tract cancer, malignant hypercalcemia, cervical cancer, endometrial cancer, adrenal cortical carcinoma, Harding-Passey melanoma, juvenile melanoma, lentigo malignant melanoma, malignant melanoma, acral lentiginous melanoma, achromatic melanoma, benign juvenile melanoma, Cloudman melanoma, S91 melanoma, nodular subungual melanoma Examples include melanoma, superficial spreading melanoma, plasmacytoma, colorectal cancer, and rectal cancer.

[0208] In some embodiments, the methods and compositions provided in the present invention relate to the treatment of sarcomas. The term "sarcoma" generally refers to a tumor composed of tightly packed cells embedded in a fibrous, heterogeneous or homogeneous material, and generally composed of a substance such as embryonic connective tissue. Sarcomas include, but are not limited to, chondrosarcoma, fibrosarcoma, lymphosarcoma, melanosarcoma, myxosarcoma, osteosarcoma, endometrial sarcoma, stromal sarcoma, Ewing's sarcoma, fasciosarcoma, fibroblastic sarcoma, giant cell sarcoma, Abemethysarcoma, and liposarcoma (adipose). Examples include sarcomas, liposarcoma, alveolar soft part sarcoma, ameloblastic sarcoma, staphyloid sarcoma, pleosoma, choriocarcinoma, embryonal sarcoma, Wilms tumor sarcoma, granulocytic sarcoma, Hodgkin's sarcoma, idiopathic multiple pigmented hemorrhagic sarcoma, B-cell immunoblastic sarcoma, lymphoma, T-cell immunoblastic sarcoma, Jensen sarcoma, Kaposi's sarcoma, Kupffer cell sarcoma, angiosarcoma, leukemosarcoma, malignant mesenchymal sarcoma, paraosteal osteosarcoma, reticulocyte sarcoma, Rous sarcoma, serous cystic sarcoma, synovial sarcoma, and pyogenic sarcoma.

[0209] Additional exemplary tumors that can be treated using the methods and compositions described herein include Hodgkin's disease, non-Hodgkin lymphoma, multiple myeloma, neuroblastoma, breast cancer, ovarian cancer, lung cancer, rhabdomyosarcoma, essential thrombocythemia, primary macroglobulinemia, small cell lung tumor, primary brain tumor, gastric cancer, colon cancer, malignant pancreatic insulinoma, malignant carcinoid, precancerous skin lesions, testicular cancer, lymphoma, thyroid cancer, neuroblastoma, esophageal cancer, urogenital tract cancer, malignant hypercalcemia, cervical cancer, endometrial cancer, and adrenocortical carcinoma.

[0210] In some embodiments, the cancer being treated is melanoma. The term “melanoma” is interpreted to mean tumors arising from the melanocyte system of the skin and other organs. Non-exclusive examples of melanoma include Harding-Passey melanoma, juvenile melanoma, lentigo malignant melanoma, malignant melanoma, acral lentiginous melanoma, achromatic melanoma, benign juvenile melanoma, Cloudman melanoma, S91 melanoma, nodular subungual melanoma, and superficial spreading melanoma.

[0211] Certain categories of tumors that can be treated using the methods and compositions described herein include lymphoproliferative disorders, breast cancer, ovarian cancer, prostate cancer, cervical cancer, endometrial cancer, bone cancer, liver cancer, gastric cancer, colon cancer, colorectal cancer, pancreatic cancer, thyroid cancer, head and neck cancer, central nervous system cancer, peripheral nervous system cancer, skin cancer, kidney cancer, and all metastases of the above. Specific types of tumors include hepatocellular carcinoma, hepatocellular tumor, hepatoblastoma, rhabdomyosarcoma, esophageal cancer, thyroid cancer, gangliblastoma, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endosarcoma, Ewing's tumor, leiomyosarcoma, rhabdotheliosarcoma, invasive ductal carcinoma, papillary adenocarcinoma, melanoma, pulmonary squamous cell carcinoma, basal cell carcinoma, adenocarcinoma (well differentiated, moderately differentiated, divided Examples include poorly differentiated or undifferentiated carcinomas, bronchioloalveolar carcinomas, renal cell carcinomas, adrenal tumors, adrenal adenocarcinomas, cholangiocarcinomas, choriocarcinomas, seminomas, embryonal carcinomas, Wilms' tumors, testicular cancers, lung cancers including small cell, non-small cell, and large cell lung cancers, bladder cancers, gliomas, astrocytomas, medulloblastomas, craniopharyngiomas, ependymomas, pineal glandomas, retinoblastomas, neuroblastomas, colon cancers, rectal cancers, hematopoietic malignancies including all types of leukemia, and lymphomas including acute myeloid leukemia, acute myelocytic leukemia, acute lymphoblastic leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, mast cell leukemia, multiple myeloma, myeloid lymphoma, Hodgkin lymphoma, and non-Hodgkin lymphoma.

[0212] Furthermore, cancers treated in certain embodiments include precancerous lesions such as actinic keratosis (solar keratosis), lentigo (dysplastic nevi), farmer's lip, cutaneous horns, Barrett's esophagus, atrophic gastritis, congenital dyskeratosis, iron deficiency dysphagia, lichen planus, oral submucous fibrosis, photoelastic fibrosis, and cervical dysplasia.

[0213] Cancers treated in some embodiments include, but are not limited to, cholangiomas, colon polyps, adenomas, papillomas, cystadenomas, hepatocyte adenomas, hydatidiform moles, tubular adenomas, squamous cell papillomas, gastric polyps, hemangiomas, osteomas, chondromos, lipomas, fibromas, lymphangiomas, leiomyomas, rhabdomyomas, astrocytomas, nevi, meningiomas, and gangliocytomas, which are non-cancerous or benign tumors of endoderm, ectoderm, or mesenchymal origin.

[0214] The primary targets are the treatment of melanoma, breast cancer, prostate cancer, pancreatic cancer, glioblastoma, renal cell carcinoma, and colorectal cancer. [Examples]

[0215] The present invention will be described in general below, but will be more readily understood by referring to the following examples, which are included solely for illustrative purposes of certain aspects and embodiments of the invention and are not intended to limit the invention. Thus, it will be readily apparent that any of the beneficial substances and therapies of the disclosure can be substituted within the scope of this disclosure.

[0216] Example 1 As shown in Figures 1 and 2, an assembly of exome-selected strand-specific cDNA fragments is prepared from slices of fresh-frozen, paraffin-embedded (FFPE) tissue from the patient, encoding RNA from the cells, or whole or selected fragments of proteins expressed by the cells. In some cases, the FFPE is enriched with regions containing high concentrations of tumor cells by visual techniques or by magnification (laser capture). If the cells are tumor cells, the library includes all or almost all neoantigens, as well as tumor-associated antigens, and additional genomic regions of untranslated areas that may contain neoantigen translation products near introns and that are not readily determinable by the use of nucleic acid sequencing and antigen prediction algorithms.

[0217] Selectively, as shown in Figure 2, exome capture fragments from tumor cells can first selectively bind to mismatched double-stranded oligonucleotides and double-stranded fragments that do not perfectly match, thus enabling the physical separation and enrichment of mismatched double-stranded oligonucleotides, as well as the enrichment of fragments containing mutations, through incubation with the protein MutS from bacterial species such as E. coli or D. radionurans, but not limited to, mismatched hetero-double-stranded fragments.

[0218] Several approaches exist for designing exome capture probes. Standard exome capture probes, based on a reference genome sequence, primarily capture coding region exons from all known CDSs. This has three implications: (1) SNPs between the reference genome and the patient genome are also consequently enriched by MutS; (2) the 5' and 3' UTRs are deleted, limiting the length across the 5' and 3' exon-intron junctions; and (3) since any given tumor histology typically expresses a more restricted set of genes than a complete CDS, it is possible to design histologically specific capture probes. This can be obtained based on sequence analysis of multiple "pure" tumor samples and may include only genes expressed above certain baseline thresholds. This may exclude some abnormally expressed genes in some patient tumors. When a histologically specific capture set is used, some potential "stromal-related" genes (e.g., fibroblast-activating proteins (FAPs) from cancer-associated fibroblasts, which may contain useful epitope targets) may be excluded. These can, of course, be included separately.

[0219] Alternatively, to reduce SNP MutS enrichment (under normal circumstances, excluding transplantation applications), exome capture probe sets are designed based on known SNP locations and frequencies. These probe sets are designed around the locations of these SNPs to avoid SNP mismatch regions. The depth of the SNP frequencies designed around these locations is analyzed. Capture probes are designed to include the 5' and 3' UTRs, as well as broader intron regions. A defined set of relevant stroma-associated target genes may be included in all histologically specific sets.

[0220] As shown in Figure 3, the chain-specific fragment is inserted in the appropriate orientation by PCR or cloning between an upstream region containing a promoter for T7 RNA polymerase initiation, followed by a translation initiation site (Shine-Dalganor ribosome binding site or equivalent), an ATG (start) codon, and a coding sequence without a terminal stop codon for a domain encoding a small soluble protein (the domain encoding the small protein contains the translation termination sequence in both out-of-frame reading frames), and a downstream region containing a defined adapter sequence that can be used to enhance subsequent RNA / DNA ligation. The coding sequence without a terminal stop codon for a domain encoding a small soluble protein (the domain encoding the small protein contains the translation termination sequence in both out-of-frame reading frames) may also be located downstream of the chain-specific fragment. In this alternative design, the 3' end of the small protein encoding sequence can be used to enhance subsequent RNA / DNA ligation, and the adapter sequence is optional.

[0221] As illustrated in Figure 3, the PCR / cloning product is used to generate RNA from the T7 start site. The RNA product is then ligated to a DNA oligonucleotide containing a puromycin molecule at its 3' end (exemplary sequence dA21dCdC-puromycin[5' to 3']) in the presence of a sprint DNA oligonucleotide that crosslinks the RNA with the puromycin-containing DNA oligonucleotide, and then purified from excess linker and other reaction components.

[0222] As shown in Figure 4, RNA is used in an in vitro translation reaction (rabbit reticulocyte lysate, wheat germ, E. coli, or equivalent), and any transcription that is completely read through a small protein domain and reaches the ligated DNA oligonucleotide without encountering an out-of-frame translation termination codon pauses at the DNA sequence, allowing puromycin to enter the A site of the ribosome and bind to the nascent polypeptide chain via normal peptidyltransferase activity, enabling the binding of the normally translated RNA to the polypeptide chain.

[0223] As shown in Figure 5, any normally bound mRNA / polypeptide chain molecule is enriched by binding to a column containing affinity reagents for small protein domains, generating a library of RNA with in-frame translation capability. If the RNA is derived from tumor cells, the library can be used as a “whole tumor cell” vaccine that can be prepared from stored small biopsy samples without requiring large amounts of fresh tissue collection, sequencing or bioinformatics, or the synthesis of multiple defined sequence oligonucleotides, and can therefore be prepared rapidly and inexpensively. Reverse transcription and PCR are used in a chain-specific manner to amplify normal RNA insertions, and the amplified products are cloned into a cloning vector to generate an RNA library containing the miniproteome (AMPL-NA).

[0224] Example 2 Total RNA is prepared from whole exome sequencing data and human tumor cell lines with a substantial amount of confirmed mutational load. An Illumina TruSeq RNA exome library (chain-like) is prepared. Exome capture is performed. Samples from the library after exome sequencing are stored for pre-enriched sequencing.

[0225] A single RNA display is performed, and a PCR-amplified and enriched library is obtained. The pre-enriched and enriched libraries are sequenced and analyzed.

[0226] We analyze fragment enrichment that facilitates full-frame readthrough by entering and exiting the appropriate reading frame. Similar analyses are also performed focusing on regions containing known mutations or SNPs identified by comparison of exome capture probe sequences with cell line sequences.

[0227] Example 3 Total RNA is prepared from whole exome sequencing data and human tumor cell lines with a substantial amount of confirmed mutagenesis. An Illumina TruSeq RNA exome library (chain form) is prepared. The RNA exome library (chain form) is then hybridized with an exome capture probe. Half of the sample (or another determined portion) is then processed for exome capture and used as the unenriched sample. The other half or the remainder of the sample is then bound to MutS tagged with His (ideally using D. radiodurans) and conjugated to a nickel-coated ELISA plate. The library is then washed, digested with subtilisin, processed for exome capture, and the mutation-enriched exome capture sample is PCR amplified. The pre-enriched and enriched libraries are sequenced and analyzed. Sequence enrichment (read count per total read) containing known mutations is analyzed. Similar analyses focusing on SNPs identified by comparison of exome capture probe sequences with cell line sequences are also performed.

[0228] Example 4 To perform standard whole-exome sequencing (WES) in parallel, total RNA is prepared from FFPE blocks. An Illumina TruSeq RNA exome library (chain-like) is prepared. Exome capture is performed. Samples from the library after exome sequencing are stored for pre-enriched sequencing. A single RNA display is performed to obtain a PCR-amplified and enriched library. The pre-enriched and enriched libraries are sequenced and analyzed.

[0229] We analyze fragment enrichment that facilitates full-frame readthrough by entering and exiting the appropriate reading frame. Similar analyses are also performed focusing on regions containing known mutations or SNPs identified by comparison of exome capture probe sequences with cell line sequences.

[0230] Example 5 Figures 6, 87, and 8 present alternative approaches for enriching in-frame members of a library of cDNA fragments. In these figures, a bacterial surface display method is used to enrich the frame library members. Using similar steps and gene constructs, phage displays can be performed to enrich in-frame library members with certain modifications known to those skilled in the art, such as those described in U.S. Patents 8710017, 8685893, and 8372954, all of which are incorporated herein by reference.

[0231] As shown in Figure 6, the strand-specific fragment is extended by PCR and the cloning site is added in the appropriate orientation. The library DNA fragment is then inserted into the cloning vector using the cloning site so that the library DNA is positioned between the upstream promoter, Shine-Dalgano (SD) sequence, ATG start codon, and polypeptide-encoding nucleotide sequence of the library DNA and the downstream membrane-presented protein-encoding sequence (e.g., AIDA) of the library DNA.

[0232] As shown in Figure 7, when a plasmid is transformed into a bacterial strain such as E. coli, followed by promoter-induced growth and expression, the library is presented on the bacterial outer membrane if it is in-frame with the nucleotide sequence encoding the polypeptide and the sequence encoding the membrane-presented protein. If translation begins at ATG and remains in-frame until the end of the sequence encoding the membrane-presented protein (in-frame), the membrane-presented protein is inserted into the membrane and the polypeptide sequence is presented on the bacterial surface. If the membrane-presented protein encounters a stop codon before translation, or if the translation of the sequence encoding the membrane-presented protein is in the wrong reading frame, the membrane protein is not produced and is not presented on the cell surface.

[0233] As shown in Figure 8, bacterial aggregates containing in-frame and out-of-frame coded plasmids are exposed to affinity reagents that bind to polypeptides encoded by nucleotide sequences encoding the polypeptides. Cells that bind to the affinity reagent are out-of-frame and are therefore isolated from cells containing plasmids that do not bind to the affinity reagent. In some embodiments, magnetic beads can be attached to the affinity reagent to enable magnetic separation for separating cells bound to the affinity reagent from cells that do not. DNA is recovered from cells bound to the affinity reagent, and then the DNA is PCR-amplified to prepare enriched linear library fragments that form an enriched library construct.

[0234] Example 6 Library preparation Total RNA was extracted from melanoma cell line 13240-011 using the RNeasy Mini Kit (Qiagen74104). After depleting ribosomal RNA using the NEBNext rRNA Depletion Kit v2 (New England BioLabs E7405), an RNA-seq library was prepared using the SEQuoia Complete Stranded RNA Library Prep Kit (Bio-Rad17005726). Exome-containing fragments of the library were enriched using the Twist Comprehensive Exome Kit (Twist Bioscience102031) with a bait based on the Consensus Coding Sequence (CCDS) database [Pujar et al., Nucleic Acids Res.46(D1):D221-D228,2018,doi:10.1093 / nar / gkx1031]. To construct a library having the structure shown in Figure 9, 5' and 3' extensions were added to the library fragments using PCR with tail primers.

[0235] In vitro transfer RNA was synthesized using the HiScribe T7 High Yield RNA Synthesis Kit (New England BioLabs E2040S) with a transcription library as a template. Specifically, 8 μL of a 74 ng / μL exome capture transcription library was mixed with 2 μL of 10x reaction buffer, 2 μL of 100 mM ATP, 2 μL of 100 mM GTP, 2 μL of 100 mM UTP, 2 μL of 100 mM CTP, and 2 μL of T7 RNA polymerase mix, and then incubated at 37°C for 2 hours. RNA was purified using the Monarch RNA Cleanup Kit (New England BioLabs T2030S) and recovered in 20 μL of water. Dilutions were prepared using 1 μL aliquots and analyzed by Bioanalyzer (RNA6000 Pico Kit, Agilent 5067-1513), and the remainder was stored at -80°C.

[0236] RNA ligation to puromycin oligonucleotides The following two DNA oligos obtained from Integrated DNA Technologies (IDT) were used to add puromycin to the 3' end of in vitro transcribed RNA: A27.C2.Puro(AAAAAAAAAAAAAAAAAAAAAAAAAAACC / 3Puro / ) and T10.ExPepSplint(TTTTTTTTTTCCAGTCGCTATAG). The 13 nucleotide sequences at the 3' end of T10.ExPepSplint are complementary to the 13 nucleotide sequences at the 3' end of in vitro transcribed RNA. Oligo A27.C2.Puro was phosphorylated by mixing 5 μL of water, 2 μL of 20 μM A27.C2.Puro, 1 μL of 10x T4 polynucleotide kinase reaction buffer, 1 μL of 10 mM ATP, and 1 μL of 10 units / μL T4 polynucleotide kinase (New England BioLabs M0201S), incubating at 37°C for 30 minutes, and transferring to ice. The following components were added: 7 μL of water, 50 μL of polyethylene glycol 8000 (from T4 RNA ligase 2 kit, New England BioLabs M0373L), 2 μL of 20 μM T10.ExPepSplint, 4 μL of 20 units / μL SUPERase·In RNase inhibitor (Thermo Fisher, AM2696), and 8 μL of 1.8 μg / μL in vitro transcribed RNA. After thoroughly mixing by pipetting up and down, the mixture was incubated at 65°C for 2 minutes. While still warm, 10 μL of 10x T4 RNA ligase reaction buffer (from T4 RNA ligase kit 2) was added, then the solution was thoroughly mixed by pipetting up and down, and the mixture was left on ice for 10 minutes. After incubation at room temperature for 5 minutes, 9 μL of 25 units / μL Splint® Ligase (New England BioLabs M0375S) was added, then the solution was thoroughly mixed by pipetting up and down, and the mixture was incubated at room temperature for 2 hours. The reaction was stopped by adding 2.5 μL of 500 mM EDTA, pH 8.0 and mixing thoroughly.RNA-puromycin products were purified using a Poly(A) mRNA Magnetic Isolation Module (New England BioLabs E7490L) according to the protocol provided with the module. 100 μL of well-resuspended NEBNext Magnetic Oligo d(T)25 Beads were used to purify 100 μL of the ligation reaction product. After following the protocol for bead binding and washing, the RNA-puromycin products were eluted with 20 μL of nuclease-free water and transferred to fresh tubes. Dilutions were prepared using 1 μL aliquots and analyzed by a Bioanalyzer (RNA6000 Pico kit, Agilent 5067-1513), with the remainder stored at -80°C. The yield of the ligation product was 51.4%.

[0237] RNA display In vitro translation was performed using components of the PURExpress In Vitro Protein Synthesis Kit (New England BioLabs E6800L). The reaction was assembled by mixing 10 μL of Solution A, 7.5 μL of Solution B, 1 μL of 20 units / μL of SUPERase·In RNase inhibitor (Thermo Fisher, AM2696), and 6.5 μL of 375 ng / μL of RNA-puromycin product. Following incubation at 37°C for 30 minutes, 3.1 μL of 1 M MgCl2 and 34.4 μL of 1 M KCl were added to promote covalent bonding between the translated peptide and puromycin. The reaction was incubated at room temperature for 30 minutes, then overnight at -20°C. The peptide-RNA fusion product was purified using the NEBNext Poly(A)mRNA Magnetic Isolation Module (New England BioLabs E7490L) according to the protocol provided with the module. For the purification of 62.5 μL of the translation reaction product, 40 μL of well-resuspended NEBNext Magnetic Oligo d(T)25 Beads was used. After following the protocol for binding to the beads and washing, the peptide-RNA product was eluted with 20 μL of 1 mM dithiothreitol (Teknova D9750) and transferred to a fresh tube. cDNA was synthesized using the RNA portion of the peptide-RNA product as a template, with DNA oligo ExPep RT primers (CCAGTCGCTATAGCTGGCGTA) obtained from IDT and 5x RT buffer (75 mM Tris-HCl, pH 8.4, 375 mM KCl, 50 mM MgCl2) and 25% (v / v) glycerol. For the cDNA reaction, a hybridization mixture was prepared by mixing 15.4 μL of water, 2 μL of 10% NP-40 (Thermo Fisher 28324), 1.6 μL of 25 mM dNTPs (Thermo Fisher FERR1121), and 1 μL of 10 μM ExPep RT primer.A 10 μL aliquot of the peptide-RNA fusion sample was mixed with 10 μL of the hybridization mixture and incubated at 65°C for 1 minute, followed by retention at 4°C. The RT mixture was prepared by mixing 26.5 μL of water, 20 μL of 5x RT buffer, 1 μL of 1 M dithiothreitol (Teknova D9750), 2 μL of 40 U / μL of RNaseOUT RNase inhibitor (Thermo Fisher 10777019), and 0.5 μL of 200 U / μL of SuperScript II Reverse Transcriptase (Thermo Fisher 18064014). After mixing 20 μL of the peptide-RNA / hybridization mixture sample with 20 μL of the RT mixture, the reaction was incubated at 42°C for 60 minutes and at 85°C for 5 minutes, followed by retention at 4°C. For specific selection of peptide RNA-cDNA products, the Twin-Strep-Tag portion of the peptide was immobilized using MagStrep "type3" XT Beads (Strep-Tactin XT coated magnetic beads, IBA LifeSciences 24090002). 25 μL of well-suspended beads were transferred to a tube, placed on a magnetic stand, and the supernatant was discarded. The beads were washed twice by resuspending them in 200 μL of washing buffer (100 mM 1 M Tris-HCl, pH 8.0, 150 mM NaCl, 1 mM EDTA), placed on a magnetic stand, and the supernatant was discarded. 40 μL of reverse transcriptase reaction mixture was added to the beads and incubated on ice for 30 minutes, with the tube gently flicked periodically to resuspend the beads. The sample was placed on a magnetic stand and the supernatant was discarded. The beads were washed three times by resuspending them in 100 μL of washing buffer, placed on a magnetic stand, and the supernatant was discarded. The beads were resuspended in 20 μL of water and kept on ice. The selected peptide-RNA-cDNA products were sequenced using rhPCR amplification [Dobosy et al., BMC Biotechnol. 11:80, 2011, doi: 10.1186 / 1472-6750-11-80] and stored as a sequencing library.This amplification was performed using the following two oligonucleotides obtained from IDT: P5.IDT312.Rd1x.x1 primer (AATGATACGGCGACCACCGAGATCTACACCTGACACAACACTCTTTCCCTACrACGACa / 3SpC3 / , where rA is riboA) and P7.IDT024.Rd2x.x1 primer (CAAGCAGAAGACGGCATACGAGATAAGCACTGGTGACTGGAGTTCAGArCGTGTa / 3SpC3 / , where rC is riboC). The 3' ends of these oligoprime DNA synthesizers within the Read1 and Read2 segments from the cDNA were found in the peptide-RNA-cDNA product (see Figure 9). The primers added the P5 and P7 segments required for Illumina sequencing of the PCR product, respectively. Amplification was also performed using a 20-fold rhPCR buffer (300 mM Tris-HCl, pH 8.4, 500 mM KCl, 80 mM MgCl2) and an RNase H2 enzyme kit (IDT11-02-12-01) containing RNase H2 enzyme and RNase H2 dilution buffer. RNase H2 was diluted to 20 mU / μL by mixing 1 μL of 2 units / μL RNase H2 enzyme with 99 μL of H2 dilution buffer and then kept on ice. Aliquots of 10 μL of MagStrep bead suspension containing the peptide-RNA-cDNA product were mixed with 2.5 μL each of 6 μM P5.IDT312.Rd1x.x1 / P7.IDT024.Rd2x.x1 primers. An rhPCR mixture was prepared by combining 59.1 μL of water, 4 μL of 20x rhPCR buffer, 1.3 μL of 25 mM dNTPs (Thermo Fisher FERR1121), 2 μL of 20 mU / μL RNase H2, and 1.6 μL of 5 units / μL Hot Start Taq DNA Polymerase (New England BioLabs M0495L). 37.5 μL of this rhPCR mixture was then added to the bead suspension / primer sample. PCR amplification was performed using a thermal protocol: 95°C for 30 seconds (96°C for 20 seconds, 62°C for 1 minute, 72°C for 1 minute) for 18 cycles, followed by holding at 4°C.The reaction tubes were placed on a magnetic stand, and the supernatant was transferred to a fresh tube. The PCR product was purified using a ProNex Size-Selective Purification System (Promega NG2003). 50 μL of the amplified reaction was mixed with 70 μL (1.4x) of ProNex beads and processed according to the ProNex protocol. The RNA display sequencing library resulting from PCR was eluted with 20 μL of ProNex Elution Buffer. A 1 μL aliquot was analyzed using a Bioanalyzer (High Sensitivity DNA Kit, Agilent 5067-4626), and the remainder was stored at -20°C. The library was sequenced using an Illumina MiSeq with a 300-cycle MiSeq Reagent Kit v2 (Illumina MS-102-2022) as instructed by the manufacturer. The sequencing parameters were 150 cycles for read1, 8 cycles for index1, 8 cycles for index2, and 150 cycles for read2. The sequencing results were analyzed to detect whether the library inserts had complete open reading frames (ORFs). Figure 10 shows a comparison of the detection of full-length inserts and complete ORFs within the target reading frame of the constructs after exome capture ("before RNA display") and after RNA display ("after RNA display").

[0238] The proportion of library insertions without stop codons ("stop-free") increased from 28% before RNA display to 37% after RNA display (p<0.001). These results demonstrate that RNA display can enrich human cDNA fragments in open reading frames in exome-captured RNASeq libraries prepared from patients with cancer.

[0239] Embedding by reference All publications, patents, and patent applications referenced herein are incorporated herein by reference in whole, as if each individual publication, patent, or patent application were specifically and individually indicated to be incorporated by reference. In case of any conflict, the application containing any definition herein shall prevail.

[0240] Equal portions Those skilled in the art will be able to recognize or confirm, by conventional experimentation alone, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

1. A method for enriching a library of in-frame coding region fragments from a collection of RNA transcripts, wherein the method is (a) Attaching a group of RNA transcripts to a puromycin-tagged linker polynucleotide, In the population of RNA transcripts, each RNA transcript is arranged in the order from 5' to 3', (i) A translation initiation site followed by any multiple of three nucleotides that do not code for a stop codon, (ii) RNA sequences transcribed from cDNA fragment sequences from a library of cDNA sequences from tumors, (iii) A nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, and encoded by a reading frame beginning with the first 5' nucleotide of the nucleotide sequence, the reading frame lacking an in-frame stop codon, but each of the other two reading frames containing a stop codon, comprising: Each of the linker polynucleotides tagged with puromycin contains puromycin, The 3' end of the RNA transcript is bound to the puromycin-tagged linker polynucleotide to generate a puromycin-tagged RNA transcript; this involves binding. (b) Performing an in vitro translation reaction on the puromycin-tagged RNA transcript, wherein for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in the frame together with the translation start site, does not have a stop codon in the reading frame, and is in the frame together with the nucleotide sequence encoding the polypeptide, the puromycin is used to covalently bind the translated polypeptide to the puromycin-tagged RNA transcript, thereby forming an RNA complex bound to the polypeptide. (c) A method comprising separating the RNA complex bound to the polypeptide from the RNA transcript which is not in such complex state, thereby enriching a library of in-frame coding region fragments from the population of RNA transcripts.

2. A method for enriching a library of in-frame coding region fragments from a collection of RNA transcripts, wherein the method is (a) Attaching a group of RNA transcripts to a puromycin-tagged linker polynucleotide, In the population of RNA transcripts, each RNA transcript is arranged in the order from 5' to 3', (i) A translation initiation site followed by any multiple of three nucleotides that do not code for a stop codon, (ii) A nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning with the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within the reading frame, (iii) RNA sequences transcribed from cDNA fragment sequences from a library of cDNA sequences from tumors, (iv) an adapter sequence having a length of a multiple of 3 nucleotides, and comprising an adapter sequence which lacks a stop codon in the reading frame beginning at the first 5' nucleotide of the adapter sequence, but contains a stop codon in the other two reading frames, Each of the linker polynucleotides tagged with puromycin contains puromycin, The 3' end of the RNA transcript is bound to the puromycin-tagged linker polynucleotide to generate a puromycin-tagged RNA transcript; this involves binding. (b) Performing an in vitro translation reaction on the puromycin-tagged RNA transcript, wherein for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in the frame together with the translation start site, does not have a stop codon in the reading frame, and is in the frame together with the nucleotide sequence encoding the polypeptide, the puromycin is used to covalently bind the translated polypeptide to the puromycin-tagged RNA transcript, thereby forming an RNA complex bound to the polypeptide. (c) A method comprising separating the RNA complex bound to the polypeptide from the RNA transcript which is not in such complex state, thereby enriching a library of in-frame coding region fragments from the population of RNA transcripts.

3. The step further includes generating a library of RNA transcripts by performing a transcription reaction on a library of RNA expression constructs prior to step (a), wherein each RNA expression construct is (i) Transcription promoter, (ii) A translation initiation site followed by any multiple of three nucleotides that do not code for a stop codon, (iii) cDNA fragment sequences from a library of cDNA fragment sequences, and (iv) A nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, and encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, the reading frame lacking an in-frame stop codon, but each of the other two reading frames containing a stop codon, comprising: The method according to claim 1 or 2.

4. The method according to claim 3, wherein each RNA expression construct further comprises an adapter sequence having a length of a multiple of 3 nucleotides, lacking a stop codon in a reading frame beginning at the first 5' nucleotide of the adapter sequence, but containing stop codons in the other two reading frames.

5. The method according to claim 3 or 4, wherein the library of cDNA fragment sequences is enriched with cDNA fragment sequences containing exomes and / or mismatches.

6. In step (a), (A) Contacting the RNA transcript with a sprint polynucleotide and the puromycin-tagged linker polynucleotide, The aforementioned sprint polynucleotides are arranged in the order from 3' to 5', (I) A sequence complementary to the 3' end of the nucleotide sequence encoding the polypeptide, and (II) Linker target sequence, Each of the puromycin-tagged linker polynucleotides is arranged in the order from 5' to 3', (1) A sequence complementary to the linker target sequence, and (2) comprising the above-mentioned puromycin, The nucleotide sequence encoding the polypeptide of the RNA transcript is hybridized to a sequence complementary to the 3' end of the nucleotide sequence encoding the polypeptide of the sprint polynucleotide, and the sequence complementary to the linker target sequence of the linker polynucleotide is hybridized to the linker target sequence of the sprint polynucleotide, by contact. (B) The method according to any one of claims 1 to 5, wherein a ligation reaction is carried out to ligate the 3' end of the RNA transcript to the 5' end of the puromycin-tagged DNA linker to produce a puromycin-tagged RNA transcript, thereby binding the group of RNA transcripts to the puromycin-tagged linker polynucleotide.

7. A method for enriching a library of in-frame coding region fragments from a population of cellular RNA fragments from a tumor, wherein the method is (a) A population of tumor-derived cDNA fragments is generated by performing a strand-specific random priming nucleic acid amplification reaction on a population of cellular RNA fragments, (b) Contacting the collection of cDNA fragments with an exome capture probe, thereby enriching the collection of cDNA fragments with respect to cDNA fragments encoding exomes, to generate a library of exome-enriched cDNA fragments, (c) To generate an RNA expression construct comprising: (i) a transcription promoter; (ii) a translation start site followed by any multiple of three nucleotides that do not encode a stop codon; (iii) one of the exome-enriched cDNA fragments from a library of the exome-enriched cDNA fragments; and (v) a nucleotide sequence encoding a polypeptide, having a length of a multiple of three nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, lacking an in-frame stop codon within that reading frame, but containing stop codons within the other two reading frames. (d) Performing a transcription reaction using the RNA expression construct to produce a library of RNA transcripts, wherein each RNA transcript is in the order of 5' to 3', (i) A translation initiation site followed by any multiple of three nucleotides that do not code for a stop codon, (ii) RNA sequences transcribed from cDNA fragment sequences of the exome-enriched cDNA fragment library, (iii) To generate a library of RNA transcripts comprising a nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, lacking an in-frame stop codon within that reading frame, but containing a stop codon in each of the other two reading frames, (e) Attaching a group of RNA transcripts to a puromycin-tagged linker polynucleotide, wherein each of the puromycin-tagged linker polynucleotides contains the puromycin, and the 3' end of the RNA transcript is attached to the puromycin-tagged linker polynucleotide to produce a puromycin-tagged RNA transcript. (f) Performing an in vitro translation reaction on the puromycin-tagged RNA transcript, wherein, for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in the frame together with the translation start site, does not have a stop codon in the reading frame, and is in the frame together with the nucleotide sequence encoding the polypeptide, the puromycin performs an in vitro translation reaction to covalently bind the translated polypeptide to the puromycin-tagged RNA transcript, thereby forming an RNA complex bound to the polypeptide. (g) A method comprising separating the RNA complex bound to the polypeptide from the RNA transcript which is not in such complex state, thereby enriching a library of in-frame coding region fragments from a population of cellular RNA fragments.

8. A method for enriching a library of in-frame coding region fragments from a population of cellular RNA fragments from a tumor, wherein the method is (a) A population of cDNA fragments is generated by performing a strand-specific random priming nucleic acid amplification reaction on a population of tumor-derived cell RNA fragments, (b) Contacting the collection of cDNA fragments with an exome capture probe, thereby enriching the collection of cDNA fragments with respect to cDNA fragments encoding exomes, to generate a library of exome-enriched cDNA fragments, (c) To generate an RNA expression construct comprising (i) a transcription promoter, (ii) a translation start site followed by any multiple of three nucleotides that do not encode a stop codon, (iii) a nucleotide sequence encoding a polypeptide, having a length of a multiple of three nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within the reading frame, (iv) one of the exome-enriched cDNA fragments from a library of the exome-enriched cDNA fragments, and (v) an adapter sequence having a length of a multiple of three nucleotides, lacking a stop codon within the reading frame beginning at the first 5' nucleotide of the adapter sequence, and each of the other reading frames containing a stop codon, (d) Performing a transcription reaction using the RNA expression construct to produce a library of RNA transcripts, wherein each RNA transcript is in the order of 5' to 3', (i) A translation initiation site followed by any multiple of three nucleotides that do not code for a stop codon, (ii) A nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within the reading frame, (iii) RNA sequences transcribed from cDNA fragment sequences of the exome-enriched cDNA fragment library, and (iv) To generate a library of RNA transcripts comprising an adapter sequence having a length of a multiple of 3 nucleotides, wherein the reading frame beginning at the first 5' nucleotide of the adapter sequence does not contain a stop codon, and each of the other reading frames contains a stop codon, (e) Attaching a group of RNA transcripts to a puromycin-tagged linker polynucleotide, wherein each of the puromycin-tagged linker polynucleotides contains the puromycin, and the 3' end of the RNA transcript is attached to the puromycin-tagged linker polynucleotide to produce a puromycin-tagged RNA transcript. (f) Performing an in vitro translation reaction on the puromycin-tagged RNA transcript, wherein, for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in the frame together with the translation start site, does not have a stop codon in the reading frame, and is in the frame together with the nucleotide sequence encoding the polypeptide, the puromycin performs an in vitro translation reaction to covalently bind the translated polypeptide to the puromycin-tagged RNA transcript, thereby forming an RNA complex bound to the polypeptide. (g) A method comprising separating the RNA complex bound to the polypeptide from the RNA transcript which is not in such complex state, thereby enriching a library of in-frame coding region fragments from a population of cellular RNA fragments.

9. The method according to claim 7 or 8, wherein step (b) further comprises (1) contacting the collection of cDNA fragments with MutS protein to enrich the collection of cDNA fragments with cDNA fragments containing mismatches resulting from either mutation or single nucleotide polymorphism, or (2) contacting the library of exome-enriched cDNA fragments with MutS protein to enrich the library of exome-enriched cDNA fragments with cDNA fragments containing mismatches resulting from either mutation or single nucleotide polymorphism.

10. In step (e), (A) Contacting the RNA transcript with a sprint polynucleotide and the puromycin-tagged linker polynucleotide, The aforementioned sprint polynucleotides are arranged in the order from 3' to 5', (I) A sequence complementary to the 3' end of the nucleotide sequence encoding the polypeptide, and (II) Linker target sequence, Each of the puromycin-tagged linker polynucleotides is arranged in the order from 5' to 3', (1) A sequence complementary to the linker target sequence, and (2) comprising the above-mentioned puromycin, The nucleotide sequence encoding the polypeptide of the RNA transcript is hybridized to a sequence complementary to the 3' end of the nucleotide sequence encoding the polypeptide of the sprint polynucleotide, and the sequence complementary to the linker target sequence of the linker polynucleotide is hybridized to the linker target sequence of the sprint polynucleotide, by contact. (B) The method according to any one of claims 7 to 9, wherein a ligation reaction is carried out to ligate the 3' end of the RNA transcript to the 5' end of the puromycin-tagged DNA linker to produce a puromycin-tagged RNA transcript, thereby binding the group of RNA transcripts to the puromycin-tagged linker polynucleotide.

11. The method according to any one of claims 1 to 10, wherein the RNA complex bound to the polypeptide is separated from the RNA transcript that is not in the form of such a complex by affinity purification of the RNA complex bound to the polypeptide using a reagent that binds to the polypeptide encoded by the nucleotide sequence encoding the polypeptide.

12. The method according to claim 11, further comprising performing an RT-PCR amplification reaction on a library of RNA complexes bound to the purified polypeptide to produce an amplified product containing the sequence of the cDNA fragment.

13. The method according to claim 12, further comprising contacting the amplification product with a MutS protein to enrich the amplification product with respect to a cDNA fragment containing a mismatch resulting from either a mutation or a single nucleotide polymorphism.

14. The method according to claim 12 or 13, further comprising inserting the amplification product into a vector to generate a vector containing the sequence of the cDNA fragment.

15. The method according to claim 14, wherein the vector is a cloning vector, an expression vector, or a vector encoding a vaccine, and the vaccine encoded by the vaccine encoding vector is produced from the amplification product.

16. The method according to claim 14 or 15, wherein the vector is a vector encoding a vaccine, and the method further comprises (1) inserting the vaccine-encoding vector into a bacterium or yeast and incubating the bacterium or yeast under conditions such that the bacterium or yeast expresses the vaccine encoded by the vaccine-encoding vector, or (2) subjecting the vaccine-encoding vector to an in vitro translation reaction to produce the vaccine encoded by the vaccine-encoding vector.

17. The method described above is (1) Transfect or transduce the vector into mammalian cells and incubate the mammalian cells under conditions such that the vaccine encoded by the vector is expressed in the mammalian cells. (2) The method according to claim 14 or 15, further comprising transfecting or transfecting human cells with the vector ex vivo.

18. The method according to claim 17, wherein the mammalian cell is a human cell.

19. A pharmaceutical composition comprising a vector or its translation product produced by the method of claim 14 or 15, and a pharmaceutically acceptable carrier.

20. A method for producing a tumor vaccine, (a) Generating cell RNA fragments from the target tumor sample, (b) A cDNA fragment is generated by performing a strand-specific random priming nucleic acid amplification reaction on the RNA fragment, (c) Contacting the cDNA fragment with an exome capture probe, thereby enriching the cDNA fragment with respect to the cDNA fragment encoding the exome, and generating a library of exome-enriched cDNA fragments. (d) To generate an RNA expression construct comprising: (i) a transcription promoter; (ii) a translation start site followed by any multiple of three nucleotides that do not encode a stop codon; (iii) one of the exome-enriched cDNA fragments from a library of the exome-enriched cDNA fragments; and (iv) a nucleotide sequence encoding a polypeptide, having a length of a multiple of three nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, lacking an in-frame stop codon within the reading frame, but containing a stop codon in each of the other two reading frames. (e) Performing a transcription reaction using the RNA expression construct to produce a library of RNA transcripts, wherein each RNA transcript is in the order of 5' to 3', (i) A translation initiation site followed by any multiple of three nucleotides that do not code for a stop codon, (ii) RNA sequences transcribed from cDNA fragment sequences of the exome-enriched cDNA fragment library, (iii) Generating a library of RNA transcripts comprising a polypeptide encoding nucleotide sequence having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, lacking an in-frame stop codon within that reading frame, but containing a stop codon in each of the other two reading frames, (f) Binding the RNA transcript to a puromycin-tagged linker polynucleotide, wherein each of the puromycin-tagged linker polynucleotides contains puromycin, and the 3' end of the RNA transcript is bound to the puromycin-tagged linker polynucleotide to produce a puromycin-tagged RNA transcript. (g) Performing an in vitro translation reaction on the puromycin-tagged RNA transcript, wherein, for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in the frame together with the translation start site, does not have a stop codon in the reading frame, and is in the frame together with the nucleotide sequence encoding the polypeptide, the puromycin is used to covalently bind the translated polypeptide to the puromycin-tagged RNA transcript, thereby forming an RNA complex bound to the polypeptide, in an in vitro translation reaction. (h) Purifying the RNA complex bound to the polypeptide with affinity using a reagent that binds to the polypeptide encoded by the nucleotide sequence encoding the polypeptide, thereby generating a library of the purified polypeptide-bound RNA complex, (i) An amplification reaction is carried out on the library of RNA complexes bound to the purified polypeptide to produce an amplified product containing the sequence of the cDNA fragment, (j) A method comprising generating a tumor vaccine from one or more of the amplification products of step (i).

21. A method for producing a tumor vaccine, (a) Generating cell RNA fragments from the target tumor sample, (b) A chain-specific random priming nucleic acid amplification reaction is performed on the cell RNA fragment to generate a cDNA fragment, (c) Contacting the cDNA fragment with an exome capture probe, thereby enriching the cDNA fragment with respect to the cDNA fragment encoding the exome, and generating a library of exome-enriched cDNA fragments. (d) Generating an RNA expression construct comprising (i) a transcription promoter, (ii) a translation start site followed by any multiple of three nucleotides that do not encode a stop codon, (iii) a nucleotide sequence encoding a polypeptide, having a length of a multiple of three nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within the reading frame, (iv) one of the exome-enriched cDNA fragments from a library of the exome-enriched cDNA fragments, and (v) an adapter sequence having a length of a multiple of three nucleotides, lacking a stop codon within the reading frame beginning at the first 5' nucleotide of the adapter sequence, and each of the other reading frames containing a stop codon, (e) Performing a transcription reaction using the RNA expression construct to produce a library of RNA transcripts, wherein each RNA transcript is in the order of 5' to 3', (i) A translation initiation site followed by any multiple of three nucleotides that do not code for a stop codon, (ii) A nucleotide sequence encoding a polypeptide, having a length of a multiple of 3 nucleotides, encoded by a reading frame beginning at the first 5' nucleotide of the nucleotide sequence, and lacking an in-frame stop codon within the reading frame, (iii) RNA sequences transcribed from cDNA fragment sequences of the exome-enriched cDNA fragment library, and (iv) To generate a library of RNA transcripts comprising an adapter sequence having a length of a multiple of 3 nucleotides, wherein the reading frame beginning at the first 5' nucleotide of the adapter sequence does not contain a stop codon, and each of the other reading frames contains a stop codon, (f) Binding the RNA transcript to a puromycin-tagged linker polynucleotide, wherein each of the puromycin-tagged linker polynucleotides contains puromycin, and the 3' end of the RNA transcript is bound to the puromycin-tagged linker polynucleotide to produce a puromycin-tagged RNA transcript. (g) Performing an in vitro translation reaction on the puromycin-tagged RNA transcript, wherein, for each puromycin-tagged RNA fragment, the RNA sequence transcribed from the cDNA fragment sequence of the puromycin-tagged RNA transcript is in the frame together with the translation start site, does not have a stop codon in the reading frame, and is in the frame together with the nucleotide sequence encoding the polypeptide, the puromycin is used to covalently bind the translated polypeptide to the puromycin-tagged RNA transcript, thereby forming an RNA complex bound to the polypeptide, in an in vitro translation reaction. (h) Purifying the RNA complex bound to the polypeptide with affinity using a reagent that binds to the polypeptide encoded by the nucleotide sequence encoding the polypeptide, thereby generating a library of the purified polypeptide-bound RNA complex, (i) An amplification reaction is carried out on the library of RNA complexes bound to the purified polypeptide to produce an amplified product containing the sequence of the cDNA fragment, (j) A method comprising generating a tumor vaccine from one or more of the amplification products of step (i).

22. The method according to claim 20 or 21, wherein the tumor sample is a fresh sample, a frozen sample, and / or a paraffin-embedded (FFPE) sample.

23. The method according to claim 22, wherein the sample is a tumor sample embedded in paraffin (FFPE).

24. The method according to any one of claims 20 to 23, wherein the cell RNA fragment is 150 to 250 nt in length.

25. The method according to claim 24, wherein the cell RNA fragment is about 200 nt in length.

26. In step (f), (A) Contacting the RNA transcript with a sprint polynucleotide and the puromycin-tagged linker polynucleotide, The aforementioned sprint polynucleotides are arranged in the order from 3' to 5', (I) A sequence complementary to the 3' end of the nucleotide sequence encoding the polypeptide, and (II) Linker target sequence, Each of the puromycin-tagged linker polynucleotides is arranged in the order from 5' to 3', (1) A sequence complementary to the linker target sequence, and (2) comprising the above-mentioned puromycin, The nucleotide sequence encoding the polypeptide of the RNA transcript is hybridized to a sequence complementary to the 3' end of the nucleotide sequence encoding the polypeptide of the sprint polynucleotide, and the sequence complementary to the linker target sequence of the linker polynucleotide is hybridized to the linker target sequence of the sprint polynucleotide, by contact. (B) The method according to any one of claims 20 to 25, wherein a ligation reaction is carried out to ligate the 3' end of the RNA transcript to the 5' end of the puromycin-tagged DNA linker to produce a puromycin-tagged RNA transcript, thereby binding the group of RNA transcripts to the puromycin-tagged linker polynucleotide.

27. (i) The sprint target sequence is a polydT sequence, and the sequence complementary to the sprint target sequence is a polydA sequence, or (ii) The sprint target sequence is a polydA sequence, and the sequence complementary to the sprint target sequence is a polydT sequence. The method according to claim 6, 10, or 26.

Citation Information

Patent Citations

  • Methods for Generating Nucleic Acids Lacking 3' Untranslated Regions to Optimize Cellular RNA-Protein Fusion Formation

    JP2002522091A

  • Method of quickly and efficiently selecting high-functioning protein, high-functioning protein thus obtained, method of producing the same and method of using the same

    WO2005035751A1