Non-embedded virus delivery systems and related methods
A non-integrated, transient viral delivery system with a defective integrase gene and inducible initiator proteins addresses issues of unpredictable integration and immune response, providing stable and controlled gene expression.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- AMERICAN GENE TECHNOLOGIES INTERNATIONAL INC
- Filing Date
- 2017-06-07
- Publication Date
- 2026-05-08
AI Technical Summary
Existing viral vectors face challenges such as unpredictable gene integration sites, unstable expression, and adverse immune responses, limiting their widespread therapeutic use.
A non-integrated, transient viral delivery system using a defective integrase gene and heterologous viral episomal DNA replication origin, with inducible initiator proteins, allows for controlled gene expression and reduced immune response.
Enables stable, controlled gene expression over time without chromosomal integration, reducing immune response and maintaining therapeutic efficacy.
Smart Images

Figure 0007855208000034 
Figure 0007855208000035 
Figure 0007855208000036
Abstract
Description
Technical Field
[0001] This application claims priority to U.S. Provisional Patent Application No. 62 / 347,552, filed Jun. 8, 2016, entitled “NON-INTEGRATING VIRAL DELIVERY SYSTEM AND METHODS OF USE THEREOF”; U.S. Provisional Patent Application No. 62 / 431,760, filed Dec. 8, 2016, entitled “NON-INTEGRATING VIRAL DELIVERY SYSTEM AND METHODS RELATED THERETO”; and PCT / US16 / ******85, filed Dec. 12, ********, entitled “NON-INTEGRATING VIRAL DELIVERY SYSTEM AND METHODS RELATED THERETO”, the disclosures of which are incorporated herein by reference.
[0002] The present disclosure generally relates to viral vectors, and systems for gene delivery, and fields of use for other therapeutic, diagnostic, or investigative purposes. More specifically, embodiments of the present disclosure relate to non-integrating viral vectors, and systems for gene delivery, and fields of use for other therapeutic, diagnostic, or investigative purposes.
Background Art
[0003] Viral vectors have been used to transduce genes and other therapeutic nucleic acid constructs into target cells due to their specific viral envelope-host cell receptor interactions and viral mechanisms for gene expression. As a result, viral vectors have been used as a vehicle for the transfer of genes into many different cell types, including, but not limited to, isolated tissue samples, tissue targets in situ, and cultured cell lines. The ability to introduce and express foreign genes is useful for the study of gene expression, as well as for elucidating cell lineages and pathways, and for providing the possibility of therapeutic interventions such as gene therapy and various types of immunotherapy.
[0004] Several viral systems, including lentiviruses, murine retroviruses, adenoviruses, and adeno-associated viruses, have been proposed as promising therapeutic gene transfer vectors. However, numerous hurdles have prevented their widespread use as approved therapeutic agents. These hurdles include, but are not limited to, expression stability and control, genome packaging ability, and construct-dependent vector stability. Furthermore, the in vivo application of viral vectors can be limited by the host's immune response to viral structural proteins and / or transduced gene products, which can lead to adverse anti-vector immunological effects.
[0005] Researchers have attempted to find stable expression systems as a way to overcome some of these hurdles. One approach is to utilize gene regulatory molecules, including recombinant polypeptides or small RNAs, in such expression systems. These systems employ chromosomal integration of the transduced retroviral genome or at least a portion of it, into the host cell's genome. A key limitation of these approaches is that the sites of gene integration are generally random, and the number and proportion of genes integrated at any given site are often unpredictable. Thus, vectors that rely on chromosomal integration result in the persistent maintenance of recombinant genes that can extend beyond the treatment interval, while plasmids or other non-replicating DNA are not well controlled and may collapse before the desired treatment interval is completed.
[0006] Another approach is the use of transient expression systems. Under transient expression systems, the expression of the gene of interest is based on a non-integrated plasmid, and therefore, expression is typically lost as the cell subsequently divides, or the plasmid vector is destroyed by an endogenous nuclease. Consequently, transient gene expression systems typically do not achieve sufficient expression over time and typically require repeated treatments, which is generally understood to be an undesirable characteristic. [Overview of the project] [Means for solving the problem]
[0007] A stable virus delivery system and method are provided. In various embodiments, the delivery system includes a transient expression system. According to one embodiment, the delivery system is non-integrated. In another embodiment, the delivery system is non-integrated and transient.
[0008] In various aspects and embodiments, the system comprises, in various ways, one or all, a viral carrier, wherein the viral carrier comprises a defective integrase gene, a heterologous viral episomal DNA replication origin, a sequence encoding at least one initiator protein specific to the heterologous viral episomal DNA replication origin, wherein the expression of the sequence encoding at least one initiator protein specific to the heterologous viral episomal DNA replication origin is inducible, and at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest. The viral carrier may be a lentivirus. The heterologous viral episomal DNA replication origin may be derived from a papillomavirus. The heterologous viral episomal DNA replication origin may be derived from human papillomavirus or bovine papillomavirus.
[0009] The heterologous viral episomal DNA replication origin may originate from human papillomavirus type 16 (HPV16). The heterologous viral episomal DNA replication origin may originate from the long control region (LCR) of HPV16. The heterologous viral episomal DNA replication origin may contain SEQ ID NO: 1. Optionally, the heterologous viral episomal DNA replication origin may contain a 5' truncation of SEQ ID NO: 1 of at least approximately 200 nucleotides, or at least approximately 300 nucleotides, or at least approximately 400 nucleotides, or at least approximately 500 nucleotides, or at least approximately 600 nucleotides, or at least approximately 700 nucleotides. The heterologous viral episomal DNA replication origin may contain at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity, or at least about 98% sequence identity, of the HPV16 LCR Frag1 (SEQ ID NO: 2), Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5).
[0010] At least one initiator protein specific to a heterologous viral episomal DNA replication origin may include E1 or an operable fragment thereof. At least one initiator protein specific to a heterologous viral episomal DNA replication origin may include E2 or an operable fragment thereof. At least one initiator protein specific to a heterologous viral episomal DNA replication origin may include EBNA-1 or an operable fragment thereof. Optionally, the system may include at least two initiator proteins specific to a heterologous viral episomal DNA replication origin. At least two initiator proteins specific to a heterologous viral episomal DNA replication origin may include either E1 or E2 individually or in combination, or operable fragments thereof. The sequence encoding at least one initiator protein may reside in a single distinct plasmid or a non-integrated viral vector. Optionally, the system may include at least two initiator proteins specific to heterologous viral episomal DNA replication origins, where the sequences encoding the at least two initiator proteins may reside in a single separate plasmid or a non-integrated viral vector. Optionally, the system may include at least two initiator proteins specific to heterologous viral episomal DNA replication origins, where the sequences for the first initiator protein and the sequences for the second initiator protein may reside in separate plasmids or a non-integrated viral vector.
[0011] With respect to the disclosed non-integrated viral delivery system, at least one gene product may include an antibody, an antibody fragment, or a growth factor. The antibody may include an anti-HER2 antibody or a fragment thereof. The growth factor may include vascular endothelial growth factor (VEGF) or a variant thereof. The miRNA may include CCR5 miRNA.
[0012] In another embodiment, a pharmaceutical composition is disclosed. The pharmaceutical composition comprises a non-embedded virus delivery system and at least one pharmaceutically acceptable carrier as disclosed herein.
[0013] In another embodiment, a method is provided for expressing at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA in a cell. The method comprises contacting a cell with an effective amount of a non-integrated viral delivery system, the system comprising a viral carrier, the viral carrier comprising one or all defective integrase genes, a heterologous viral episomal DNA replication origin, a sequence encoding at least one initiator protein specific to the heterologous viral episomal DNA replication origin, wherein the expression of the sequence encoding at least one initiator protein specific to the heterologous viral episomal DNA replication origin is inducible, and at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA.
[0014] In another embodiment, a method is provided for expressing at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA in a subject requiring it. The method comprises administering an effective amount of a non-integrated viral delivery system to a subject requiring it, wherein the system comprises a viral carrier, wherein the viral carrier comprises one or all defective integrase genes, a heterologous viral episomal DNA replication origin, a sequence encoding at least one initiator protein specific to the heterologous viral episomal DNA replication origin, wherein the expression of the sequence encoding at least one initiator protein specific to the heterologous viral episomal DNA replication origin is inducible, and at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA. The sequence encoding at least one initiator protein may reside in a single distinct plasmid, and the at least one initiator protein may comprise either E1 and E2 alone or in combination, or operable fragments thereof. The method may further include administering a first amount of a single, distinct plasmid to a subject in need of it, in order to initiate a first level of expression of at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest. The method may further include administering a second amount of a single, distinct plasmid to a subject in need of it, in order to initiate a second level of expression of at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest. In situations where the second amount is lower than the first amount, the level of expression of at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest may decrease. In situations where the second amount is higher than the first amount, the level of expression of at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest may increase.
[0015] In another embodiment, the non-embedded viral delivery systems disclosed herein are optimized to produce low levels of basal expression of at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA. The heterologous viral episomal DNA replication origin may include at least about 80% sequence identity with SEQ ID NO: 1 or Frag1 of the HPV16 LCR (SEQ ID NO: 2), or at least about 85%, or at least about 90%, or at least about 95%, or at least about 98%.
[0016] In another embodiment, the non-embedded viral delivery system disclosed herein is optimized to produce low levels of basal expression of at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA, and the heterologous viral episomal DNA replication origin may include SEQ ID NO: 1 or Frag1 of the HPV16 LCR (SEQ ID NO: 2).
[0017] In another embodiment, the non-embedded viral delivery system disclosed herein is optimized to produce a moderate level of basal expression of at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA, and the heterologous viral episomal DNA replication origin may include at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity, of the HPV16 LCR Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5).
[0018] In another embodiment, a method for selecting an optimized non-embedded viral delivery system is disclosed. The method includes selecting a basal expression level. Thereafter, when level X is selected, a corresponding Y is selected, where Y corresponds to a heterologous viral episomal DNA replication origin selected to be incorporated into the non-embedded viral delivery system, where if X = a first defined level of basal expression of the cargo, Y includes LCR (SEQ ID NO: 1) or Frag1 (SEQ ID NO: 2), and if X = a second defined level of basal expression of the cargo, Y includes Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the HPV16 LCR. In some embodiments, the first defined level includes fewer than 0.020 episomal copies of the cargo per cell. In some embodiments, the second defined level includes 0.020 or more episomal copies of the cargo per cell.
[0019] Further embodiments include, for example, methods for treating infectious diseases. Further embodiments include methods for preventing infectious diseases. Another embodiment discloses a method for enhancing wound healing. Another embodiment discloses a method for treating bone injuries. Further embodiments include a method for treating genetic diseases using a system detailed herein.
[0020] The above general description and the following detailed description are illustrative and explanatory, and are intended to further illustrate the invention as described in the claims. Other purposes, advantages, and novel features will be readily apparent to those skilled in the art from the following brief description of the drawings and the detailed description of the invention. [Brief explanation of the drawing]
[0021] [Figure 1] Figure 1 shows an exemplary vector-in-vector (VIV) embodiment. Figure 1(A) shows a linear vector, and Figure 1(B) shows a circular vector.
[0022] [Figure 2]Figure 2 shows an exemplary vector-in-vector (VIV) embodiment (also referred to herein as Vector 1) containing the E1 initiator protein.
[0023] [Figure 3] Figure 3 shows the results of transduction in 293T cells from three separate experiments using Vector 1.
[0024] [Figure 4] Figure 4 shows an exemplary vector-in-vector (VIV) embodiment (also referred to herein as Vector 19) containing both the E1 and E2 initiator proteins.
[0025] [Figure 5] Figure 5 shows exemplary vector-in-vector (VIV) embodiments expressing (A) mCherry and (B) VEGF, respectively.
[0026] [Figure 6] Figure 6 shows the expression of mCherry-positive cells for the various constructs described herein when E1 and E2 are provided by plasmid (A) or lentivirus (B), respectively.
[0027] [Figure 7] Figure 7 shows an exemplary vector-in-vector (VIV) embodiment used in combination with the examples detailed herein.
[0028] [Figure 8] Figure 8 shows the expression levels of VEGF for the various constructs containing fragment 1 of the HPV16 long control region (LCR).
[0029] [Figure 9]Figure 9 shows an exemplary vector-in-vector (VIV) embodiment used in combination with the embodiments described in detail herein.
[0030] [Figure 10] Figure 10 is a diagram illustrating an example of the episomal morphology of a non-embedded lentiviral vector.
[0031] [Figure 11] Figure 11 shows the genomic relationships between Frag1, Frag2, Frag3, and Frag4 of the HPV16 LCR.
[0032] [Figure 12] Figure 12 shows the analysis of the episomal copy number of HPV16ori in the integrase-deficient lentiviral vector described herein.
[0033] [Figure 13] Figure 13 shows the analysis of mCherry expression from (A) integrase-deficient lentiviral vectors containing HPV LCR and 3' fragments, and (B) mCherry expression from integrase-deficient vectors expressing or not expressing HPV16 E1-T2A-E2 from a single vector.
[0034] [Figure 14] Figure 14 shows the analysis of mCherry expression from integrase-deficient lentiviral vectors containing HPV LCR after the addition of E1, E1-C, and E2-11.
[0035] [Figure 15] Figure 15 shows the expression of an anti-HER2 antibody using an integrase-deficient lentiviral vector containing HPV LCR, as determined by (A) immunoblotting and (B) IgG concentration.
[0036] [Figure 16]Figure 16 shows the expression of an anti-EGFR antibody using an integrase-deficient lentiviral vector containing an HPV ori sequence.
[0037] [Figure 17] Figure 17 shows the knockdown of CCR5 expression using a lentiviral vector containing the full-length LCR of HPV16.
[0038] [Figure 18] Figure 18 shows the knockdown of CCR5 expression using a lentiviral vector containing the LCR Frag2 of HPV16.
[0039] [Figure 19] Figure 19 shows the expression of GFP in cells transduced with a D64V integrase-deficient lentiviral vector using the Epstein-Barr virus (EBV) oriP sequence.
[0040] [Figure 20] Figure 20 is a diagram illustrating the basal and E1-E2-induced episome copy numbers for Frag1, Frag2, Frag3, Frag4 and full-length LCR of HPV16.
[0041] [Figure 21] Figure 21 shows one embodiment for LCR fragment selection based on relative structural-functional activity findings, which is further described in the examples detailed herein. [Modes for carrying out the invention]
[0042] Disclosed herein are stable virus delivery systems and methods. In various embodiments, the delivery system includes a transient expression system. According to one embodiment, the delivery system is non-integrated. In another embodiment, the delivery system is non-integrated and transient.
[0043] In further embodiments, non-integrated, episomal replicating viral vectors (e.g., lentiviral vectors) and methods of using the same are provided. The episomal replicating vectors of this disclosure may contain viral components of virus-like Papovaviridae (e.g., bovine papillomavirus or BPV), Herpesviridae (e.g., Epstein-Barr virus or EBV), or Hepadnaviridae (e.g., hepatitis B virus or HBV). Episomal replicating vectors derived from these viruses may contain a replication origin and at least one viral trans-activator, such as an initiator protein like E1 for BPV polymerase and EBNA-1 for EBV or HBV polymerase, or an adenovirus terminal-binding protein. The episomal replication process typically incorporates both the host cell's replication mechanism and the viral trans-activator.
[0044] By using a heterologous viral replication origin, a novel vector can be manipulated by "off-switching" the expression of viral proteins necessary to recognize the replication origin. Switching off DNA replication dramatically reduces the level of therapeutic DNA over time. While not limited to any particular theory, it is thought that non-replicating DNA simply degrades over time, for example, by nuclease activity and as the host cell undergoes a natural apoptosis (programmed cell death) event. Eventually, such non-replicating DNA may become undetectable and disappear completely or almost completely from the patient over time.
[0045] The disclosed systems and methods include the ability to reduce or prevent any toxic effects resulting from toxicity and overexpression or prolonged expression of transduced genes. By eliminating genes whose DNA replication has stopped, subsequent undesirable gene expression or knockdown of host gene expression is prevented. Similarly, by combining the beneficial aspects of episomal replication with heterologous viral systems, a platform is provided for safely and efficiently transducing target genes into various cell types. Papillomavirus
[0046] Papillomaviruses primarily replicate as episomes in mammalian cells. The action of the viral E1 protein, which functions as a DNA helicase, on viral DNA origins (oris) drives the production of hundreds to thousands of DNA copies per cell, depending on the differentiation state of the infected epithelial cell. Attempts were made to develop papillomavirus-based gene delivery systems using what are known as "shuttle plasmids." Many studies have been conducted to demonstrate the safety and durability of gene expression using bacterial DNA origins to enable DNA production in E. coli and papillomavirus oris to enable episodic replication in mammalian cells. In most cases, the oris were derived from bovine papillomavirus.
[0047] Papillomaviruses have evolved to infect epidermal and epithelial cells. As infected cells differentiate from the basal surface to the luminal surface, papillomaviruses increase their DNA replication, and their copy number increases dramatically until a large amount of virus is released onto the luminal surface. This makes papillomaviruses highly contagious, as is evident with human papillomaviruses. The rapid increase in copy number is primarily due to host factors. However, this characteristic of papillomaviruses can be utilized for transient gene therapy targeting the epidermal and epithelial surfaces.
[0048] Specific characteristics of papillomaviruses are used according to various aspects and embodiments of this disclosure to enable the expression and replication of episomal vectors, and to target the expression of the vectors to specific cell types. Epstein-Barr virus (EBV)
[0049] Epstein-Barr virus (EBV), also known as human herpesvirus 4, is a member of the herpesvirus family. It is one of the most common human viruses, and most people are infected with EBV several times in their lifetime.
[0050] EBV is a double-stranded DNA virus containing approximately 85 genes and is known to infect B cells and epithelial cells. EBV is capable of both lytic and latent replication. Latent replication results in the translocation of a circularized EBV genome into the host cell nucleus, where EBV can be replicated by host cell DNA polymerase.
[0051] EBV can replicate latently via at least three different pathways, each involving the expression of Epstein-Barr virus nuclear antigen 1 (EBNA-1), a protein that binds to episomal replication origins and mediates episome partitioning during host cell division. EBNA-1 plays an essential role in the regulation, replication, and maintenance of the EBV gene and episomes.
[0052] Certain features of the EBV are used in accordance with various aspects and embodiments of this disclosure. Hepatitis B virus (HBV)
[0053] Hepatitis B virus (HBV) is a member of the hepadnavirus family. It is a common human virus associated with progressive liver fibrosis, hepatitis, and hepatocellular carcinoma.
[0054] HBV is a double-stranded DNA virus that replicates via an RNA intermediate and in a manner dependent on viral polymerase. The stable maintenance of HBV in hepatocytes is due to the presence of a covalently bound, ring-closed viral DNA morphology, which makes eradication difficult.
[0055] Therefore, the specific features of HBV are used in accordance with various aspects and embodiments of this disclosure. Retrovirus
[0056] Retroviruses are a family of viruses characterized by encoding a reverse transcriptase capable of generating DNA copies from an RNA template and by the integration of the provirus into the host cell chromosome. Lentiviruses are a genus of retroviruses capable of delivering large amounts of viral nucleic acid into host cells. Lentiviruses are characterized by their intrinsic ability to infect / transduce non-dividing cells, and after transduction, the lentivirus integrates its own nucleic acid into the host cell's chromosome.
[0057] Infectious lentiviruses possess three major genes encoding the pathogenic proteins gag, pol, and env, as well as two regulatory genes, including tat and rev. Depending on the specific serotype and virus, there may be additional accessory genes encoding proteins involved in the regulation, synthesis, and / or processing of viral nucleic acids, as well as other replication functions, including counteracting innate cellular defenses against lentiviral infection.
[0058] Lentiviruses contain long terminal repeat (LTR) regions, which can be approximately 600 nt in length. LTRs can be segmented into U3, R, and U5 regions. LTRs can mediate the integration of retroviral DNA into host chromosomes via the action of integrase. Alternatively, without activating integrase, LTRs can be used to circularize viral nucleic acids.
[0059] Viral proteins involved in the early stages of lentiviral replication include reverse transcriptase and integrase. Reverse transcriptase is an RNA-dependent DNA polymerase encoded by the virus. This enzyme uses the viral RNA genome as a template for the synthesis of a complementary DNA copy. Reverse transcriptase also possesses RNaseH activity for disrupting the RNA template necessary for DNA second strand synthesis to complete the production of a double-stranded DNA ready for integration. Integrase processes the LTR before inserting the viral genome into host DNA. tat acts as a transactivator during transcription to enhance the initiation and elongation of the RNA copy produced from viral DNA. The rev-responsive element acts post-transcriptionally to regulate mRNA splicing and transport into the cytoplasm.
[0060] Certain features of retroviruses, including lentiviruses, are used in accordance with various aspects and embodiments of this disclosure. Vector-in-vector system
[0061] A novel vector-in-vector (VIV) system is provided that allows for precise regulation of gene delivery and expression by combining desired characteristics of various viral species. Many viral vectors, including lentivirus (LV) platforms, can be used. Lentiviral transduction, like most other forms of stable transduction, results in chromosomal incorporation of the LV payload (e.g., the gene of interest). According to various embodiments, chromosomal incorporation is invalidated via selective mutation that inactivates the viral integrase gene. Papillomavirus ori plus E1 protein, or EBV ori plus EBNA-1, or hepadnavirus terminal plus viral polymerase are used herein as part of a heterologous viral gene cargo that would not normally be maintained in the episome. By incorporating this heterologous viral replication mechanism into a lentiviral vector, approximately 5 kb of additional cargo space remains that can accommodate the therapeutic gene of interest.
[0062] In other embodiments, other regulatory elements may be incorporated into the disclosed VIV system. As a non-limiting example, the expression of E1 or E2 or EBNA-1 or HBV polymerase can be driven by an inducible promoter. Furthermore, as a non-limiting example, E1 and / or E2 or their variants can be expressed using plasmids or non-integrated viral vectors. Many types of inducible promoters are known in the art, and for the purposes of this disclosure, inducible promoters may include, but are not limited to, promoters that respond to antibiotics (i.e., tetracyclines, aminoglycosides, penicillins, cephalosporins, polymyxins, etc.) or other drugs, copper and other metals, alcohols, steroids, light, oxygen, heat, cold, or other physical or chemical stimuli. For example, a method using the disclosed viral system involves employing tetracycline-inducible gene expression that depends on a constant supply of a drug for the expression of a cargo gene. The compound used to induce the inducible promoter may be added once or repeatedly, depending on the duration of episomal replication and the timing of the desired cargo delivery. DNA replication and episome maintenance are diversely dependent on the induction of E1, E2, and / or EBNA-1, which in turn depends on gene expression inducers (i.e., tetracyclines).
[0063] An exemplary VIV system is shown in Figure 1. The disclosed VIVs include at least one gene or nucleotide sequence of interest (e.g., the cargo shown in Figure 1A). The gene or sequence incorporated into the VIV depends on the purpose of the VIV. Referring generally to Figure 1, a lentivirus is packaged in an integrase-deficient system, or transduction is performed in the presence of a clinical drug (e.g., dolutegravir or raltegravir) used to block integrase activity. If incorporation fails, the linear double-stranded vector DNA is generally circularized using the host's enzymatic mechanism (e.g., Figure 1B). If necessary, a drug-inducible promoter may be activated to express E1 and / or E2 proteins as necessary, thereby driving DNA replication. The therapeutic cargo is expressed from the incorporated cassette. In various embodiments, a compound that induces the inducible promoter (also referred to herein as an "inducer") is terminated or stopped. Termination of the inducer downregulates the synthesis of E1 and / or E2. In further embodiments, production of E1 and / or E2 is effectively halted. In either case, this reduces the level of episomal DNA and ultimately eliminates the vector construct.
[0064] A further illustrative diagram of the VIV system is shown in Figure 2. The E1 initiator protein is present, and the cargo is GFP under the EF1-HTLV promoter. Figures 1 and 2 show VIV systems containing E1, while Figure 4, as shown herein, shows a VIV system containing both E1 and E2 on a single viral vector. In further embodiments, an internal ribosome entry site (IRES) is added to express both E1 and E2 from the same mRNA, enabling the resumption of protein translation. Initiator proteins such as E1 and E2 can also be expressed in separate plasmids or non-integrated lentiviral vectors.
[0065] A further illustrative diagram of the VIV system is shown in Figure 4. The gene cargo is represented by a CMV / GFP cassette. The cargo gene sequence can be amplified by polymerase chain reaction (PCR). For example, synthetic oligonucleotide primers can be used, such as primers identical to the 5' end of the cargo gene and / or complementary to the 3' end of the cargo gene. The 5' primer can be extended from its 5' end, which has a recognition site for the endonuclease. The 3' primer can also be extended at its 3' end, which has a complement for endonuclease recognition. The resulting amplified cargo gene sequence can be annealed to a suitable vector, such as a lentiviral vector. Non-limiting examples of gene cargo include CMV / VEGF, CMV / anti-epidermal growth factor receptor (EGFR), anti-HER2 antibody, or miRNA-suppressive CC chemokine receptor type 5 (CCR5).
[0066] Proper expression of cargo can be determined by appropriate assays. For example, the copy number of DNA can be measured by quantitative PCR. Protein products translated from non-exclusive examples such as vector 1 or vector 19 (described herein) can be measured, for example, by analytical flow cytometry. ELISA assays can be used to detect the presence of specific cargo, such as secreted proteins like VEGF. Western blotting techniques can also be used to detect specific cargo, such as antibodies like anti-EGFR. Furthermore, monitoring the reduced cell surface expression of cargo proteins, such as chemokine receptors like CCR5, can also be employed.
[0067] With regard to cargo, and as a non-limiting example, a gene encoding platelet-derived growth factor (PDGF), along with the shRNA, siRNA, miRNA, and / or other gene-suppressing RNA of interest, can be incorporated as a gene into a VIV used to promote wound healing. The disclosed VIV systems are not limited to specific types of genes or sequences that may be expressed.
[0068] The disclosed VIVs include, for example, antibodies against antigens associated with infectious diseases or cancer (including antigens on replicating pathogens, and antigens that are exogenous toxins, and antigens on tumor cells), platelet-derived growth factor, vascular endothelial growth factor, brain-derived growth factor, nerve growth factor, human growth factor, human chorionic gonadotropin, transmembrane conductance regulator (CFTR) of cystic fibrosis, dystrophin or dystrophin-related complexes, phenylalanine hydroxylase, lipoprotein lipase, α- and / or β-thalassemia, factor VIII, bone morphogenetic proteins 1-4, cyclooxygenase 2, vascular endothelial growth factor, chemokine receptor CCR5, chemokine receptor CXCR4, chemokine receptor CXCR5, antisense DNA or RNA against autoimmune antigens involved in colitis, inflammatory bowel disease, or Crohn's disease, opium Many therapeutic or prophylactic genes or sequences may be incorporated, including small interfering RNAs involved in addiction, including miRNAs that modulate neurasthenia to drugs or alcohol; tumor suppressor genes; genes that regulate cell survival, including pro-apoptotic or anti-apoptotic genes and pro-autophagy or anti-autophagy genes; genes encoding radiation resistance factors; genes encoding luminescent proteins used to track tumor cell metastasis or other cell transport phenomena; or sequences encoding various other therapeutically useful sequences that can be used to modify host tissue or graft tissue to improve organ transplantation or suppress hyperreactivity, particularly in the airways, by equipping the body to obtain the maximum effect of radiation, surgery, or chemotherapy, or to protect tissue from radiation, surgery, or chemotherapy.
[0069] Without limiting any of the foregoing, the cargo may include diagnostic proteins such as GFP and mCherry, as well as cDNA, microRNA, shRNA, and antibodies. Furthermore, the cargo may include certain cargoes such as VEGF and BMP as described herein.
[0070] In a further embodiment, it is desirable to maintain the gene in the VIV system's episomal form as a "safety switch." For example, if a particular gene product is toxic, the termination of the inductive molecule reduces or stops DNA replication. Subsequently, the number of episomes decreases, and the gene and vector eventually disappear. Unlike conventional regulatory gene expression, the disclosed expression construct is degraded by endogenous nucleases and diluted by cell division until it is effectively eliminated, thereby preventing any short-term or long-term breakthrough expression.
[0071] In a further embodiment, by maintaining the target gene, gene product, shRNA, siRNA, miRNA, and / or other gene suppressor RNA in episomal form, it becomes possible to regulate the copy number over a wide range and at a much higher level than that achieved by conventional lentiviral transduction.
[0072] The disclosed VIV system exhibits several advantages. For example, episomal DNA is less sensitive to chromosomal alteration, which can lead to gene silencing in conventional transduction vectors. Similarly, VIV episomal DNA vectors support active gene delivery for short to medium periods of at least about 1 to about 4 months, and possibly longer. In other embodiments, episomal DNA vectors support active gene delivery for periods of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, or about 12 weeks or longer. In other embodiments, episomal DNA vectors support active gene delivery for periods of about 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or longer. Any combination of these periods, for example, 1 month and 1 week, or 3 months and 2 weeks, can also be used in the methods disclosed herein.
[0073] While there are advantages specifically related to the use of lentiviral carriers for incorporating the disclosed VIV systems, the disclosed systems are not limited to a single type of viral vector. However, any DNA virus or virus using a DNA intermediate, including lentiviruses, adeno-associated viruses (AAVs), adenoviruses, vaccinia, herpesviruses, measles viruses, hepadnaviruses, parvoviruses, and murine viruses, can be used as a carrier for incorporating the VIV systems herein.
[0074] Without limiting any of the foregoing, one aspect of the present disclosure discloses a non-embedded viral delivery system. The system comprises a viral carrier, the viral carrier comprising one or more defective integrase genes, a heterologous viral episomal origin, a sequence encoding at least one initiator protein specific to the heterologous viral episomal origin, wherein the expression of the sequence encoding at least one initiator protein specific to the heterologous viral episomal DNA origin is inducible, and at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA. The viral carrier may be a lentivirus. The heterologous viral episomal DNA origin may be derived from a papillomavirus. The heterologous viral episomal DNA origin may be derived from human papillomavirus or bovine papillomavirus.
[0075] The heterologous viral episomal DNA replication origin may originate from human papillomavirus type 16 (HPV16). The heterologous viral episomal DNA replication origin may originate from the long regulatory region (LCR) of HPV16. The heterologous viral episomal DNA replication origin may contain Sequence ID No. 1. Optionally, the heterologous viral episomal DNA replication origin may contain a 5' truncation of Sequence ID No. 1 of at least approximately 200 nucleotides, or at least approximately 300 nucleotides, or at least approximately 400 nucleotides, or at least approximately 500 nucleotides, or at least approximately 600 nucleotides, or at least approximately 700 nucleotides. The heterologous viral episomal DNA replication origin may contain at least approximately 80% sequence identity, or at least approximately 85% sequence identity, or at least approximately 90% sequence identity, or at least approximately 95% sequence identity, or at least approximately 98% sequence identity, of the HPV16 LCR. The heterologous viral episomal DNA replication origin may contain at least approximately 2, or 3, or 4, or 5, of the HPV16 LCR. Without limiting ourselves to any of the foregoing or the examples detailed herein, the genomic structure of the LCR is shown in Figure 11. In addition to the fragments detailed herein, further fragments can be created by deletions of the 5' and 3' regions of the LCR. Furthermore, mutations, substitutions, additions and / or deletions can be made to the full-length LCR or related fragments. Furthermore, without limiting the examples described above or herein, it is understood that the vector components described herein may be interchangeably used to develop new and / or modified vectors, which is within the scope of the embodiments of this disclosure. Adjustability of vector-in-vector systems
[0076] In one aspect of this disclosure, the viral vector system is modifiable or optimized by modifying a sequence, or one or more of the following: a viral carrier, a heterologous viral episomal DNA replication origin, a sequence encoding at least one initiator protein specific to the heterologous viral episomal DNA replication origin, the expression of which the sequence encoding at least one initiator protein specific to the heterologous viral episomal DNA replication origin is regulated, or one or more of the gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA. The modifications are made to control the maximum dose of at least one gene product, to affect the persistence of expression in target cells or tissues, and to treat a disease or injury using the same biological molecule to prevent toxicity or side effects when a temporarily needed biological molecule is delivered in the wrong dose and when expression continues after such biological molecule is no longer needed or may become toxic.
[0077] In several embodiments, modifications to the disclosed system allow for tuning the expression levels and controlling the duration of expression of biological molecules to achieve undetectable or near-undetectable cargo expression, which may be required in placebo-controlled gene therapy trials. In several embodiments, this results in low-level expression that is statistically different from undetectable but does not meet the criteria for induced or high-level expression, which may be necessary to deliver gene-editing proteins and RNA that are safer when given at low levels and short intervals in attempts to remove or correct defective genes. In several embodiments, high or induced levels of cargo expression result, for example, including peak expression levels that are approximately five times higher compared to the same cargo's detectable but low baseline level. In several embodiments, this may be optimal when expressing therapeutic antibodies, including tumor-targeted biological agents, which need to be present at high levels and more effective when occurring at or near tumor sites, but must be disintegrated and removed from the blood to avoid off-site effects on normal tissue or to prevent the onset of autoimmunity.
[0078] In several embodiments, the disclosed system is tunable for treating cancer. The disclosed system is tunable to enable the expression of tumor-targeting antibodies such as cetuximab, rituximab, or trastuzumab at or near the tumor site; to produce antibodies at levels sufficient for effective tumor targeting by replicating episomal DNA to increase gene dose in target cells; and subsequently to terminate episomal DNA replication when E1 / E2 protein production ceases, leading to the breakdown of the episomal transgene molecule along with a decrease in antibody expression that fits the predicted breakdown curve of therapeutic antibodies known to improve the safety and efficacy of these and similar bioagents.
[0079] In several embodiments, the disclosed system is configurable to treat or prevent infectious diseases. The disclosed system is configurable to express therapeutic antibodies that can disrupt or neutralize pathogen replication; to direct local antibody production at or near the site of infection or to release antibodies into the blood and lymphatic circulation; to produce antibodies at levels sufficient for effective pathogen prevention or eradication by replicating episomal DNA to increase gene dose in target cells; and subsequently to terminate episomal DNA replication when E1 / E2 protein production ceases, leading to the breakdown of episomal transgene molecules along with a decrease in antibody expression that fits the predicted breakdown curve of therapeutic antibodies known to improve the safety and efficacy of these and similar biological agents.
[0080] In multiple embodiments, the disclosed system is tunable for treating trauma or regenerative diseases. In multiple embodiments, the disclosed system is tunable for expressing a bioactive molecule with therapeutic efficacy, for directing local antibody production at or near the site of injury or disease, for producing antibodies at levels sufficient for effective treatment by replicating episomal DNA to increase gene dose in target cells, and for terminating episomal DNA replication when E1 / E2 protein production stops, leading to the breakdown of the episomal transgene molecule with a decrease in the expression of the biotherapy drug, which reaches high levels of administration at peak transgene doses but avoids side effects or toxicity resulting from persistent or very long-term expression of the biotherapy drug required during a short treatment window.
[0081] In several embodiments, LCR fragments may be selected and used depending on the desired course of treatment or outcome. As shown in non-limiting examples provided in Figures 20-21, Table 1 and Examples 16-20, the virus delivery system may be configurable or optimized depending on the desired course of treatment or outcome. [Table 1-1] [Table 1-2]
[0082] In several aspects of this disclosure, the virus delivery system is tunable or optimized according to factors in the first, second, third, or fourth quadrants, based on a desired treatment course or outcome.
[0083] In several embodiments, the first quadrant factor comprises a viral delivery system in which the LCR is selected from full-length, Frag2, Frag3, Frag4, or variants thereof. The first quadrant factor provides transient basal expression of the gene cargo using the described vector system. In most cases, the DNA copy number is expected to be approximately 1 / 20th of the highest level achievable with this system. The flexibility and tissue specificity of this system can be further increased by carefully selecting the promoter that drives the cargo expression.
[0084] In several embodiments, the second quadrant factor comprises a viral delivery system in which the LCR is selected from Frag2, Frag3, Frag4, or variants thereof. The second quadrant factor also comprises E1 and / or E2 initiator proteins. In several embodiments, the E1 and / or E2 initiator proteins are provided via plasmids. In several embodiments, the E1 and / or E2 initiator proteins are provided via lentiviral vectors. The second quadrant factor, again depending on promoter selection, provides a high episomal DNA copy number with potentially very high gene expression levels. Furthermore, the use of shorter LCR fragments increases the size of the DNA insert that can be incorporated as cargo.
[0085] In several embodiments, the third quadrant factor comprises a viral delivery system in which LCR is selected from LCR, Frag1, or variants thereof. The third quadrant factor also comprises E1 and / or E2 initiator proteins. In several embodiments, the E1 and / or E2 initiator proteins are provided via plasmids. In several embodiments, the E1 and / or E2 initiator proteins are provided via lentiviral vectors. The third quadrant factor provides a high but slightly lower episomal copy number than can be obtained in the second quadrant. The advantage of the third quadrant is the very low basal level of episomal DNA, which allows for the creation of a highly controllable system by introducing or not introducing the E1 / E2 proteins.
[0086] In several embodiments, the fourth quadrant factor comprises a viral delivery system in which the LCR is selected from full-length LCR, Frag1, or variants thereof. The selection of the fourth quadrant factor results in very low expression, which may be required for placebo control or initial doses in dose escalation studies or dose trials to establish the maximum tolerable level or optimal level for a desired indication.
[0087] In several embodiments of this disclosure, when a very low basal level of cargo expression is desired, a factor from the fourth quadrant is introduced into the viral delivery system. In several embodiments, the factor from the fourth quadrant includes Frag1 or full-length LCR or variants thereof. In several embodiments, when a slightly higher basal level of cargo expression is desired, a factor from the first quadrant is introduced into the viral delivery system. In several embodiments, the factor from the first quadrant includes Frag2, Frag3, Frag4 or variants thereof.
[0088] In several embodiments, when a high induction level of cargo expression is desired, a factor from the second quadrant or a factor from the third quadrant is introduced into the viral delivery system. In several embodiments, the factor from the second quadrant includes Frag2, Frag3, Frag4, or their variants. In several embodiments, the factor from the second quadrant includes E1 and / or E2 initiator proteins. In several embodiments, the factor from the third quadrant includes LCR, Frag1, or their variants. In several embodiments, the factor from the third quadrant includes E1 and / or E2 initiator proteins. In several embodiments, when a high induction level of cargo expression is desired and a larger cargo size is intended, a factor from the second quadrant is introduced into the viral delivery system. In several embodiments, when a high induction level of cargo expression is desired and a smaller cargo size is intended, a factor from the third quadrant is introduced into the viral delivery system. Therefore, the adjustability or optimization of the current system allows for adjustability or optimization based on cargo size.
[0089] In several embodiments, a third-quadrant factor is introduced into the viral delivery system when a large multiplier increase between the basal and induced levels of cargo expression is desired. In several embodiments, the third-quadrant factor includes LCR, Frag1, or variants thereof. In several embodiments, the third-quadrant factor includes E1 and / or E2 initiator proteins.
[0090] In several embodiments, a second quadrant factor is introduced into the viral delivery system when a small fold change increase between the basal and induced levels of cargo expression is desired. In further embodiments, a second quadrant factor is introduced into the viral delivery system when a small fold change increase between the basal and induced levels of cargo expression is desired compared to the third quadrant profile shown in Figures 12 and 20. In several embodiments, the second quadrant factor includes Frag2, Frag3, Frag4, or variants thereof. In several embodiments, the second quadrant factor includes E1 and / or E2 initiator proteins.
[0091] In another embodiment, a method is provided for treating a subject for a first quadrant treatment course. The method comprises administering a viral delivery system containing a first quadrant factor to the subject. In some embodiments, the first quadrant factor comprises a viral delivery system in which the LCR is selected from full length, Frag2, Frag3, Frag4, or variants thereof.
[0092] In another embodiment, a method is provided for treating a subject for a second quadrant treatment course. The method comprises administering a viral delivery system containing a second quadrant factor to the subject. In some embodiments, the second quadrant factor includes Frag2, Frag3, Frag4, or variants thereof. In some embodiments, the second quadrant factor includes E1 and / or E2 initiator proteins.
[0093] In another embodiment, a method is provided for treating a subject for a third quadrant treatment course. The method comprises administering a viral delivery system containing a third quadrant factor to the subject. In some embodiments, the third quadrant factor includes LCR, Frag1, or variants thereof. In some embodiments, the third quadrant factor includes E1 and / or E2 initiator proteins.
[0094] In another embodiment, a method is provided for treating a subject for a fourth quadrant treatment course. The method comprises administering a viral delivery system containing a fourth quadrant factor to the subject. In some embodiments, the fourth quadrant factor includes LCR, Frag1, or variants thereof.
[0095] In another embodiment, at least one initiator protein specific to the heterologous viral episomal DNA replication origin is present in the viral system. In several embodiments, the at least one initiator protein specific to the heterologous viral episomal DNA replication origin includes E1 or an activatable fragment thereof. In several embodiments, the at least one initiator protein specific to the heterologous viral episomal DNA replication origin includes E2 or an activatable fragment thereof. In several embodiments, the at least one initiator protein specific to the heterologous viral episomal DNA replication origin includes EBNA-1 or an activatable fragment thereof. In several embodiments, the system includes at least two initiator proteins specific to the heterologous viral episomal DNA replication origin. In several embodiments, the at least two initiator proteins specific to the heterologous viral episomal DNA replication origin are E1 and E2 or activatable fragments thereof. In several embodiments, the sequence encoding at least one initiator protein is present in a single, distinct plasmid. In several embodiments, the system comprises at least two initiator proteins specific to heterologous viral episomal replication origins, and the sequences encoding the at least two initiator proteins may reside in a single, separate plasmid.
[0096] In several embodiments of this disclosure, at least one gene product is present. In several embodiments, the at least one gene product comprises an antibody, an antibody fragment, a growth factor, or a small RNA. In several embodiments, the antibody comprises an anti-HER2 antibody or a fragment thereof. In several embodiments, the growth factor comprises vascular endothelial growth factor (VEGF) or a variant thereof. In several embodiments, the small RNA comprises shRNA, siRNA, or miRNA. In several embodiments, the miRNA comprises CCR5 miRNA. method
[0097] Aspects of the present disclosure include methods for administering a VIV system to a patient in need thereof, wherein the VIV system encodes at least one, at least two, at least three, at least four, or at least five genes of interest. Given the versatility and therapeutic potential and the VIV systems disclosed, the VIV systems described in aspects of this disclosure include, but are not limited to, antibodies against antigens associated with toxins produced by infectious diseases or infectious pathogens, platelet-derived growth factor, vascular endothelial growth factor, brain-derived growth factor, nerve growth factor, human growth factor, human chorionic gonadotropin, transmembrane conductance regulator (CFTR) of cystic fibrosis, dystrophin or dystrophin-related complexes, lipoprotein lipase, α- and / or β-thalassemia, factor VIII, bone morphogenetic proteins 1-4, cyclooxygenase 2, vascular endothelial growth factor, chemokine receptor CCR5, chemokine receptor CXCR4, chemokine receptor CXCR5, antisense DNA against autoimmune antigens involved in colitis, inflammatory bowel disease, or Crohn's disease. Genes or nucleic acid sequences may encode RNA, small interfering RNAs involved in addiction, including miRNAs that modulate neurasthenia to opioids or alcohol, tumor suppressor genes, genes that regulate cell survival, including pro-apoptotic or anti-apoptotic genes and pro-autophagy or anti-autophagy genes, genes encoding radiation resistance factors, genes encoding luminescent proteins used to track tumor cell metastasis or other cell transport phenomena, or various other therapeutically useful sequences that can be used to modify host tissue or graft tissue to improve organ transplantation or suppress hyperreactivity, particularly in the airways, by equipping the body to obtain the maximum effect of radiation, surgery, or chemotherapy, or to protect tissue from radiation, surgery, or chemotherapy.
[0098] Furthermore, without limiting any of the foregoing, another embodiment provides a method for expressing at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA in a cell. The method comprises contacting a cell with an effective amount of a non-integrated viral delivery system, the system comprising a viral carrier, the viral carrier comprising a defective integrase gene, a heterologous viral episomal origin, a sequence encoding at least one initiator protein specific to the heterologous viral episomal origin, the sequence being inducible to express the sequence encoding at least one initiator protein specific to the heterologous viral episomal DNA origin, and at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA.
[0099] In another embodiment, a method is provided for expressing at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA in a subject requiring it. The method comprises administering an effective amount of a non-integrated viral delivery system to a subject requiring it, wherein the system comprises a viral carrier, the viral carrier comprising a defective integrase gene, a heterologous viral episomal origin, a sequence encoding at least one initiator protein specific to the heterologous viral episomal origin, the sequence being inducible to express the expression of the sequence encoding at least one initiator protein specific to the heterologous viral episomal DNA origin, and at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA. The sequence encoding at least one initiator protein may reside in a single distinct plasmid, and the at least one initiator protein may be either E1 and E2 alone or in combination, or fragments thereof. The method optionally includes administering a first amount of a single, distinct plasmid to a subject in need of it, in order to initiate a first expression level of at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA. The method optionally includes administering a second amount of a single, distinct plasmid to a subject in need of it, in order to initiate a second expression level of at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA. In situations where the second amount is lower than the first amount, the expression level of at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA may decrease. In situations where the second amount is higher than the first amount, the expression level of at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA may increase. infectious disease
[0100] Methods for treating or preventing infectious diseases are provided. Currently, prophylactic delivery of monoclonal antibodies is being implemented to high-risk individuals, such as those at high risk of exposure to infectious diseases due to their health status or geographical location. Prophylactic delivery includes, for example, the delivery of protective antibodies against deadly viral agents to protect individuals traveling within endemic disease areas (e.g., medics and rescue workers entering Ebola-infected areas). Vaccines have been largely untested for diseases such as Ebola or Lassa virus, or dengue fever, or chikungunya virus, or Plasmodium spp., which causes malaria, and chronic expression of prophylactic antibody genes via the use of embedded vectors carries unknown health risks. Therefore, effective antibody expression that must be high but transient is medically very much needed.
[0101] The disclosed VIV system and methods for delivering high copy number target genes, gene products, shRNAs, siRNAs, miRNAs, and / or other gene-silencing RNAs over a limited period of time satisfy this medical requirement. A non-limiting example of a gene product that can be delivered to treat an infectious disease is an antibody specific to the infectious disease in question.
[0102] In one embodiment, the disclosure relates to methods for treating, preventing, or minimizing conditions, symptoms, or side effects associated with infectious diseases. In certain embodiments, infectious diseases may be human immunodeficiency virus (HIV), human T-cell leukemia virus, Ebola virus, Lassa virus, dengue fever, Zika virus, malaria, tuberculosis, rabies, vaccinia virus, or other infectious diseases. In some embodiments, the VIV system may be administered prophylactically or after infection with an infectious disease.
[0103] In another embodiment, the VIV system can be used to prevent infectious diseases. Subjects suspected of being at increased risk of contact with a particular infectious disease may receive a prophylactic dose of VIV encoding antibodies that specifically target the infectious disease in question.
[0104] In certain embodiments, the infectious disease may be human immunodeficiency virus (HIV), human T-cell leukemia virus, Ebola virus, Lassa virus, dengue fever, Zika virus, malaria, tuberculosis, rabies, vaccinia virus, or other infectious diseases. In certain embodiments, the VIV vector may be administered prophylactically or after infection with the infectious disease. wound healing
[0105] wound healing In another embodiment, the disclosure relates to methods for treating, preventing, or minimizing conditions, symptoms, or side effects associated with wound healing. The disclosed compositions may be administered systemically or directly to wounds following accidents, injuries, or surgery. In the case of surgery, the VIV system may be administered prophylactically to promote healing. In the case of wounds resulting from accidents, injuries, or surgery, the VIV system may be administered some time after wound formation. For example, the VIV system may be administered within about 1, 2, 3, 4, 5, 10, 12, 24, 36, 48, 60, 72, 84, 96, 108, 120, or 168 hours of wound formation.
[0106] Another application of the methods and compositions disclosed herein is the transient delivery of VIV constructs capable of expressing platelet growth factor to accelerate wound healing. High doses of platelet-derived growth factor (PDGF), related growth factors, their fragments, and associated nucleotide variants are required to be very rapid but transient. The systems and methods disclosed herein are ideal for this type of application.
[0107] Further short-term applications include the expression of brain-derived growth factors for the intermittent treatment of alcohol abuse, nerve growth factors for spinal cord regeneration, and topical applications for skin conditions.
[0108] Bone disease or injury In one embodiment, the disclosure relates to a method for enhancing bone healing, comprising the steps of identifying a subject having bone injury and administering a therapeutically effective amount of the viral delivery system disclosed herein to the subject. The viral delivery system comprises a viral carrier, a heterologous viral episomal origin, a sequence encoding an initiator protein specific to the heterologous viral episomal origin, and at least one gene, gene product, shRNA, siRNA, miRNA, and / or other gene-silencing RNA of interest, wherein the viral carrier has a defective integrase gene, and the expression of the sequence encoding an initiator protein specific to the heterologous viral episomal DNA origin is under the control of an inducible promoter. The bone injury may be due to an accident, injury, or surgery and may be nonunion of bone, acute fracture, or required spinal fusion. In some embodiments, the gene, gene product, shRNA, siRNA, miRNA, and / or other gene-silencing RNA of interest encodes osteomorphonectomy proteins 1-4 or cyclooxygenase-2 or vascular endothelial growth factor or fragments thereof. Furthermore, in certain embodiments, the above-described variants are preferred for treating bone injury or related diseases, and they are within the scope of this disclosure.
[0109] In one embodiment, the present disclosure relates to a method for enhancing bone healing, comprising the steps of identifying a subject having a bone disease and administering a therapeutically effective amount of a viral delivery system according to the present disclosure to the subject. The viral delivery system comprises a viral carrier, a heterologous viral episomal origin, a sequence encoding an initiator protein specific to the heterologous viral episomal origin, and at least one gene, gene product, shRNA, siRNA, miRNA, and / or other gene-silencing RNA of interest, wherein the viral carrier has a defective integrase gene, and the expression of the sequence encoding an initiator protein specific to the heterologous viral episomal DNA origin is under the control of an inducible promoter. Bone diseases may be, for example, due to accidents, injuries, or surgical procedures, and may be nonunion of bone or acute fracture or required spinal fusion. Furthermore, bone diseases may include low bone density, low blood flow to bone, aging, hereditary conditions, etc. In some embodiments, the gene of interest, gene product, shRNA, siRNA, miRNA, and / or other gene silencing RNA encode bone morphogenetic proteins 1-4 or cyclooxygenase-2 or vascular endothelial growth factor. Genetic disorders [Table 2]
[0110] In embodiments, this disclosure relates to methods for treating, preventing, or minimizing conditions, symptoms, or side effects associated with hereditary genetic disorders. Several examples of such hereditary genetic disorders are disclosed in Table 2 of this specification, along with the causative type of mutation and the chromosomes involved, using the following nomenclature. P-point mutations, or any insertion / deletion that is entirely within a single gene. Deletion of one or more D-1 genes C - Extra, missing, or both of the entire chromosome (see chromosomal abnormalities) T-trinucleotide repetition disorder: The gene is elongating.
[0111] Current gene therapies include attempts to edit genomic DNA through gene deletion, substitution, or resequencing. Various gene therapy systems known in the art include those that rely on the delivery of genetic material by lentiviral transduction, such as Talen, CRISPR-Cas9, zinc finger endonucleases, and TALEN. However, unlike in this disclosure, these systems can remain active in cells for extended periods because the active chromosome modification system may modify unexpected sites, potentially leading to unexpected consequences such as novel genetic diseases, including cancer. Truly practical systems for modifying host DNA require transient and well-regulated expression via methods such as those disclosed herein.
[0112] In one embodiment, the present disclosure relates to a method for treating a hereditary genetic disorder, comprising the steps of identifying a subject having a hereditary genetic disorder and administering a therapeutically effective dose of a viral delivery system according to the present disclosure to the subject. The viral delivery system comprises one or more of a viral carrier, a heterologous viral episomal origin, a sequence encoding an initiator protein specific to the heterologous viral episomal origin, and at least one gene of interest, gene product, shRNA, siRNA, miRNA, and / or other gene-silencing RNA, wherein the viral carrier has a defective integrase gene, and the expression of the sequence encoding an initiator protein specific to the heterologous viral episomal DNA origin is under the control of an inducible promoter. The hereditary genetic disorder may be, for example, one of the disorders listed in Table 2, and in some embodiments, the gene of interest, gene product, shRNA, siRNA, miRNA, and / or other gene-silencing RNA encodes a non-mutant form of one of the genes listed in Table 2. Without limiting the foregoing, certain hereditary genetic disorders may be CF, and treatment can be tracked by expressing a non-mutant form of CFTR, as detailed herein.
[0113] In another embodiment, a guide RNA target sequence is incorporated into the disclosed VIV system. The guide RNA sequence is a sequence used to direct a gene editing mechanism to a specific site in the host genome that is mutated or otherwise requires modification. By including the guide RNA in the cargo of the VIV system, modification of the chromosomal section requiring modification becomes possible, the same modification occurring within the VIV, and accelerating degradation and / or dilution by the host. In one embodiment, the disclosed viral delivery system comprises a viral carrier, a heterologous viral episomal origin of replication, one or more sequences encoding an initiator protein specific to the heterologous viral episomal origin of replication, at least one gene of interest, shRNA, siRNA, miRNA, and / or other gene silencing RNA, and at least one guide RNA, where the viral carrier has a defective integrase gene, and the expression of the sequence encoding an initiator protein specific to the heterologous viral episomal DNA origin of replication is under the control of an inducible promoter.
[0114] Ex vivo modification of cells or tissues In another embodiment, the VIV system may be used to modify cells or tissues used in the treatment of a disease. These cells may include, but are not limited to, primary cells such as lymphocytes, stem cells, epithelial cells, and nerve cells. For example, the VIV system may be used to modify lymphocytes to be redirected to certain diseases, including cancer, infectious diseases, or autoimmune diseases, where the long-term presence of genetically modified cells poses a health risk. For example, the VIV system may be used to program pluripotent stem cells requiring high levels of transcript factors over a specified interval, where the long-term presence of the incorporated viral vector is undesirable. Suitable epithelial cells include those that may be used in synthetic skin or other applications. These may require the expression of trophic factors or growth factors during the initial treatment that would be detrimental to the function of normal tissue after treatment and are best delivered by the VIV system disclosed herein.
[0115] Dosage and dosage form The disclosed VIV system enables short-term, medium-term, or long-term expression of the gene or sequence of interest, and maintenance of the disclosed vector in the episome. Therefore, the drug regimen may vary depending on the condition being treated and the method of administration.
[0116] In one embodiment, VIV can be administered to subjects requiring it in various doses. Specifically, the subjects are ≥10 6 It can be administered in an infectious dose (an average dose of 1 is required to transduce one target cell). More specifically, the subjects are ≥10 7 , ≥10 8 , ≥10 9 , or ≥10 10 It may be administered at an infectious dose. The upper limit for VIV dosing is determined for each disease indication and is based on the toxicity / safety profile for each product or product lot.
[0117] Furthermore, VIV may be administered once or twice daily. Alternatively, VIV may be administered to those who require it once a week, once every two weeks, once every three weeks, once a month, every month, every three months, every six months, every nine months, once a year, every eighteen months, every two years, every thirty-six months, or every three years or longer.
[0118] In various embodiments and designs, VIV is administered as a pharmaceutical composition. In some embodiments, a pharmaceutical composition containing VIV may be formulated for clinical use in a wide range of intranasal, pulmonary, oral, topical, or parenteral dosage forms. Each dosage form may contain various disintegrants, surfactants, fillers, thickeners, binders, wetting agents, diluents, or other pharmaceutically acceptable excipients. A pharmaceutical composition containing VIV may also be formulated for injection.
[0119] VIV compositions may be administered by any pharmaceutically acceptable method, including intranasal administration, buccal administration, sublingual administration, oral administration, rectal administration, ocular administration, parenteral administration (intravenous, intradermal, intramuscular, subcutaneous, cisterna magna, intraperitoneal), pulmonary administration, vaginal administration, topical administration, topical administration, post-scarring topical administration, and mucosal administration via aerosol or buccal or nasal spray formulations.
[0120] Furthermore, the VIV composition can be formulated into any pharmaceutically acceptable dosage form, such as solid dosage forms, tablets, pills, lozenges, capsules, liquid dispersants, gels, aerosols, pulmonary aerosols, nasal aerosols, ointments, creams, semi-solid dosage forms, and suspensions. Additionally, the composition may be a controlled-release formulation, a sustained-release formulation, an immediate-release formulation, or any combination thereof. Furthermore, the composition may be a transdermal delivery system.
[0121] In another embodiment, a pharmaceutical composition comprising VIV may be formulated into a solid dosage form for oral administration, which may be a powder, granules, capsule, tablet, or pill. In another embodiment, the solid dosage form may contain one or more excipients such as calcium carbonate, starch, sucrose, lactose, microcrystalline cellulose, or gelatin. Furthermore, in addition to the excipients, the solid dosage form may contain a lubricant such as talc or magnesium stearate. In the embodiment, the oral dosage form may be an immediate-release or modified-release form. Modified-release dosage forms include controlled or extended-release, enteric-coated release, and the like. Excipients used in modified-release dosage forms are generally known to those skilled in the art.
[0122] In embodiments, the pharmaceutical composition containing VIV may be formulated as a sublingual or buccal dosage form. Such dosage forms include sublingual tablets or solution compositions administered under the tongue, and buccal tablets placed between the cheek and gums.
[0123] In another embodiment, a pharmaceutical composition containing VIV may be formulated as a nasal dosage form. Such dosage forms of the present disclosure include solutions, suspensions, and gel compositions for nasal delivery.
[0124] In embodiments, the pharmaceutical composition may be formulated into a liquid dosage form for oral administration, such as a suspension, emulsion, or syrup. In embodiments, the liquid dosage form may contain various excipients, such as humectants, sweeteners, flavorings, or preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. In embodiments, the composition containing VIV or a pharmaceutically acceptable salt thereof may be formulated to be suitable for administration to pediatric patients.
[0125] In embodiments, the pharmaceutical composition may be formulated into dosage forms for parenteral administration, such as sterile aqueous solutions, suspensions, emulsions, non-aqueous solutions, or suppositories. In embodiments, non-aqueous solutions or suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, or injectable esters such as ethyl oleate. As a base for suppositories, vitepsol, macrogol, tween 61, cocoa oil, lauric oil, or glycerinated gelatin may be used.
[0126] The administration of pharmaceutical compositions may vary depending on the patient's weight, age, sex, time and manner of administration, elimination rate, and severity of the disease.
[0127] definition Terms not specifically defined herein are understood to have the same meaning as those understood by those skilled in the art.
[0128] Where used herein, the term “about” is to be understood by those skilled in the art and varies to some extent depending on the context in which it is used. Where a term is used that is not obvious to those skilled in the art even considering the context in which it is used, “about” means up to 10 percent plus or minus the specific term.
[0129] The terms “administering” or “giving” an active substance mean providing the active substance of this disclosure to an individual requiring treatment in a form that can be introduced into the body of the individual in a therapeutically useful form and therapeutically effective amount.
[0130] The term "basal level" refers to cargo expression when at least one initiator protein is not added.
[0131] The term "BMP" refers to bone morphogenetic proteins.
[0132] The term "cargo" refers to a gene or gene product expressed using the viral delivery system disclosed herein.
[0133] The term "CF" refers to cystic fibrosis, and the term "CFTR" refers to the transmembrane conductance regulatory protein of cystic fibrosis.
[0134] The terms “expression,” “expressed,” or “encode” refer to the process by which polynucleotides are transcribed into mRNA, and / or the process by which the transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Expression may include the splicing of mRNA in eukaryotic cells, or other forms of post-transcriptional or post-translational modification.
[0135] The term "Fragment 1" is synonymous with "F1" and "Frag1" and refers to the Fragment 1 truncation of the LCR detailed herein. The term "Fragment 2" is synonymous with "F2" and "Frag2" and refers to the Fragment 2 truncation of the LCR detailed herein. The term "Fragment 3" is synonymous with "F3" and "Frag3" and refers to the Fragment 3 truncation of the LCR detailed herein. The term "Fragment 4" is synonymous with "F4" and "Frag4" and refers to the Fragment 1 construct of the LCR detailed herein.
[0136] The terms “individual,” “host,” “subject,” and “patient” are used interchangeably in this specification.
[0137] The term "induction level" refers to the expression of cargo after the addition of at least one initiator protein.
[0138] The term "LCR" refers to, for example, the long control region of HPV16.
[0139] The term "PDGF" refers to platelet-derived growth factor.
[0140] The term “Quadrant 1 treatment course” includes references to treatment courses included in Quadrant 1 of Figure 21. Non-limiting examples include gene editing, safety studies, and the objectives outlined in Example 17. The term “Quadrant 2 treatment course” includes references to treatment courses included in Quadrant 2 of Figure 21. Non-limiting examples include cell reprogramming, checkpoint suppression, and the objectives outlined in Example 18. The term “Quadrant 3 treatment course” includes references to treatment courses included in Quadrant 3 of Figure 21. Non-limiting examples include passive immunization, immunostimulation, and the objectives outlined in Example 19. The term “Quadrant 4 treatment course” includes references to treatment courses included in Quadrant 4 of Figure 21. Non-limiting examples include placebo control and the objectives outlined in Example 20.
[0141] The term “Quadrant 1 Factor” refers to any biological factor that promotes a basal episome copy number profile, as shown in Quadrant 1 of Figure 20. Non-restrictive examples include the Frag2, Frag3, and Frag4 sequences. The term “Quadrant 2 Factor” refers to any biological factor that promotes an inducible episome copy number profile, as shown in Quadrant 2 of Figure 20. Non-restrictive examples include the Frag2, Frag3, and Frag4 sequences in combination with E1 and / or E2 initiator proteins. The term “Quadrant 3 Factor” refers to any biological factor that promotes an inducible episome copy number profile, as shown in Quadrant 3 of Figure 20. Non-restrictive examples include the LCR and Frag1 sequences in combination with E1 and / or E2 initiator proteins. The term "fourth quadrant factor" refers to any biological factor that promotes the basal episome copy number profile, as shown in the fourth quadrant of Figure 20. Non-restrictive examples of fourth quadrant factors include LCR and Frag1 sequences.
[0142] The term "shRNA" refers to short hairpin RNA; the term "siRNA" refers to small (or short) interfering RNA; and the term "miRNA" refers to microRNA.
[0143] The term “therapeutic dose” means a sufficient amount of the active substance of this disclosure in a suitable composition and dosage form to treat or prevent the symptoms, progression, or onset of complications observed in a patient suffering from a given disease, injury, illness, or condition. The therapeutic dose varies depending on the patient’s condition or its severity, and the age, weight, etc., of the subject being treated. The therapeutic dose may vary depending on any of many factors, including, for example, the route of administration, the subject’s condition, and other factors understood by those skilled in the art.
[0144] The term “treatment” or “to treat” generally refers to an intervention in an attempt to alter the natural course of the subject being treated, which may be done for preventive purposes or during the course of clinicopathology. Desired effects include, but are not limited to, preventing the onset or recurrence of the disease, reducing symptoms, suppressing, weakening, or inhibiting any direct or indirect pathological consequences of the disease, improving or mitigating the condition, and producing remission or an improved prognosis.
[0145] The term “very low,” when used in the context of basal expression levels, refers to very low expression levels and / or episome copy numbers (if applicable), and may include undetectable expression and / or episome copy numbers. As a non-limiting example, very low expression levels include less than 0.020 episome copies per cell. The term “very low,” when used in the context of basal expression levels, may also be referred to herein as the “first defined level.” The term “slightly high,” when used in the context of basal expression levels, refers to low expression and / or episome copy number levels, but slightly higher than the “very low” criterion. As a non-limiting example, slightly high expression levels include 0.020 or more episome copies per cell, and less than 0.2 episome copies per cell. The term “slightly high,” when used in the context of basal expression levels, may also be referred to herein as the “second defined level.”
[0146] As used herein, the term "VIV" refers to a vector-in-vector system for expressing at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA. As used herein, the term "VIV" is used synonymously with viral delivery systems and transient vectors.
[0147] The following embodiments are provided to illustrate aspects of the present invention. However, the present invention is not limited to the specific conditions or details described in these embodiments. All published publications referenced herein are specifically incorporated by reference. [Examples]
[0148] Example 1 VIV for treating infectious diseases This embodiment demonstrates an exemplary VIV construct for treating infectious diseases.
[0149] In this embodiment, Figure 1A represents an exemplary linear VIV construct for treating Ebola virus infectious disease. Here, at least one of the “cargo” portions shown in Figure 1A encodes an antibody that specifically targets the Ebola virus. As shown in Figure 1B, the long-term repeat (LTR) portion of the exemplary VIV construct can be used to circularize the viral nucleic acid.
[0150] Subjects suspected of having or diagnosed with the Ebola virus may be administered a therapeutically effective dose of VIV encoding antibodies that specifically target the Ebola virus, either alone or in combination with one or more additional agents for treating or preventing Ebola. VIV and / or additional agents encoding antibodies that specifically target the Ebola virus may be administered orally, intranasally, intrathecally, intraocularly, intradermally, transmucosally, ionophorically, topically, systemically, intravenously, subcutaneously, intraperitoneally, or intramuscularly, according to methods known in the art or described herein. Subjects are then evaluated daily for the presence and / or severity of signs and symptoms associated with the Ebola virus, including, but not limited to, fever, fatigue, malaise, weakness, redness of the eyes, joint and muscle pain, headache, nausea, vomiting, bleeding, and death. Treatment is maintained until one or more signs or symptoms of Ebola virus infection improve or disappear.
[0151] It is reasonably predictable that subjects suspected of being infected with or diagnosed with the Ebola virus and receiving a therapeutically effective dose of VIV encoding antibodies that specifically target the Ebola virus will show reduced severity or elimination of one or more symptoms associated with Ebola virus infection. Furthermore, it is highly anticipated that administering VIV encoding antibodies that specifically target the Ebola virus in combination with one or more additional agents will have a synergistic effect.
[0152] These results indicate that VIV, which encodes antibodies that specifically target the Ebola virus, is useful in the treatment of Ebola virus. Example 2 VIV for the prevention of infectious diseases
[0153] This embodiment demonstrates an exemplary VIV construct for preventing infectious diseases. In this embodiment, Figure 1A represents an exemplary linear VIV construct for preventing infection with Ebola virus infectious disease. Here, at least one of the “cargo” portions shown in Figure 1A encodes an antibody that specifically targets the Ebola virus. As shown in Figure 1B, the long-term repeat (LTR) portion of the exemplary VIV construct can be used to circularize the viral nucleic acid.
[0154] Subjects suspected of being at increased risk of contracting the Ebola virus may be administered a prophylactic dose of VIV encoding antibodies specifically targeting the Ebola virus, either alone or in combination with one or more additional agents for treating or preventing Ebola, before entering an area at increased risk of contracting Ebola. VIV and / or additional agents encoding antibodies specifically targeting the Ebola virus may be administered orally, intranasally, intrathecally, intraocularly, intradermally, transmucosally, ionophorically, topically, systemically, intravenously, subcutaneously, intraperitoneally, or intramuscularly, according to methods known in the art or described herein. Subjects are then evaluated daily for the presence and / or severity of signs and symptoms associated with the Ebola virus, including, but not limited to, fever, fatigue, malaise, weakness, redness of the eyes, joint and muscle pain, headache, nausea, vomiting, bleeding, and death. The treatment should be maintained for a period of time that prevents one or more signs or symptoms of Ebola.
[0155] It is reasonably predicted that individuals suspected of or diagnosed with Ebola virus exposure and administered a prophylactic dose of VIV encoding antibodies specifically targeting Ebola virus will have a reduced risk of contact with Ebola. Furthermore, it is reasonably predicted that the combined administration of VIV encoding antibodies specifically targeting Ebola virus with one or more additional agents will have a synergistic effect. These results demonstrate that VIV encoding antibodies specifically targeting Ebola virus is useful in the prevention of Ebola virus infection. Example 3 VIV for enhancing wound healing
[0156] This embodiment demonstrates an exemplary VIV construct for enhancing wound healing. In this embodiment, Figure 1A represents an exemplary linear VIV construct for enhancing wound healing, where at least one of the “cargo” portions shown in Figure 1A encodes platelet-derived growth factor (PDGF) (SEQ ID NO: 17). As shown in Figure 1B, the long-term repeat (LTR) portion of the exemplary VIV construct can be used to circularize viral nucleic acids.
[0157] Subjects with wounds (e.g., resulting from accidents, injuries, or surgery) may be administered a therapeutically effective dose of VIV encoding platelet-derived growth factor (PDGF) alone or in combination with one or more additional active agents for treating or sterilizing the wound. VIV PDGF and / or additional active agents are administered orally, intranasally, intrathecally, intraocularly, intradermally, transmucosally, ionophorically, topically, systemically, intravenously, subcutaneously, intraperitoneally, or intramuscularly, according to methods known in the art or described herein. Subjects are then evaluated daily to determine the state of the wound. Treatment is maintained for a time that allows the wound to heal and scarring to be minimized.
[0158] It is reasonably predictable that subjects with wounds receiving a therapeutically effective dose of VIV PDGF will show enhanced wound healing. Furthermore, it is reasonably predictable that administering VIV encoding PDGF in combination with one or more additional active ingredients will have a synergistic effect. These results indicate that VIV encoding PDGF is useful in enhancing wound healing. Example 4 VIV for treating bone injuries
[0159] This embodiment demonstrates an exemplary VIV construct for treating bone injury. In this embodiment, Figure 1A represents an exemplary linear VIV construct for treating bone injury, where at least one of the “cargo” portions shown in Figure 1A encodes bone morphogenetic protein (BMP) (SEQ ID NO: 18). As shown in Figure 1B, the long-term repeat (LTR) portion of the exemplary VIV construct can be used to circularize viral nucleic acids.
[0160] Subjects suspected of having or diagnosed with bone injury are administered a therapeutically effective dose of VIV encoding bone morphogenetic protein (BMP), either alone or in combination with one or more additional agents for treating the bone injury. VIV encoding BMP and / or additional agents are administered orally, intranasally, intrathecally, intraocularly, intradermally, transmucosally, iontophoretically, topically, systemically, intravenously, subcutaneously, intraperitoneally, or intramuscularly, according to methods known in the art or described herein. Subjects are then evaluated weekly for the presence and / or severity of signs and symptoms associated with bone injury to determine the rate and intensity of healing. Treatment is maintained for a time sufficient for the bone to heal.
[0161] It is reasonably expected that subjects suspected of having or diagnosed with bone injury and receiving a therapeutically effective dose of VIV encoding BMP will show reduced injury severity and enhanced healing. Furthermore, it is reasonably expected that administering VIV encoding BMP in combination with one or more additional active ingredients will have a synergistic effect. These results indicate that VIV encoding BMP is useful in the treatment of bone injury or disease. Example 5 VIV for treating hereditary diseases
[0162] This embodiment demonstrates an exemplary VIV construct for treating cystic fibrosis (CF). In this embodiment, Figure 1A represents an exemplary linear VIV construct for treating CF, a genetic disorder. Here, at least one of the “cargo” portions shown in Figure 1A encodes a transmembrane conductance regulator (CFTR) of cystic fibrosis (NM_000492). As shown in Figure 1B, the long-terminal repeat (LTR) portion of the exemplary VIV construct can be used to circularize viral nucleic acids.
[0163] Subjects suspected of having (CF) or diagnosed with (CF) may be administered a therapeutically effective dose of VIV encoding the transmembrane conductance regulator (CFTR) of cystic fibrosis, either alone or in combination with one or more additional agents for treating CF. VIV encoding CFTR and / or additional agents are administered orally, intranasally, intrathecally, intraocularly, intradermally, transmucosally, ionophorically, topically, systemically, intravenously, subcutaneously, intraperitoneally, or intramuscularly, according to methods known in the art or described herein. Subjects are then evaluated weekly for the presence and / or severity of signs and symptoms associated with CF, including, but not limited to, poor growth, persistent cough, thick sputum and mucus, wheezing, shortness of breath, reduced exercise capacity, recurrent lung infections, nasal inflammation, oily stools, bowel obstruction, and poor weight gain. Treatment is maintained until one or more signs or symptoms of CF improve or disappear.
[0164] It is reasonably predictable that subjects suspected of having CF or diagnosed with CF and receiving a therapeutically effective dose of VIV encoding CFTR will show reduced severity or elimination of one or more CF-related symptoms. Furthermore, it is reasonably predictable that administering VIV encoding CFTR in combination with one or more additional agents will have a synergistic effect. These results demonstrate that VIV encoding CFTR is useful in the treatment of CF. Example 6 VIV containing E1 for cargo expression
[0165] A vector containing the green fluorescent protein (GFP) gene as cargo was constructed according to Figure 2. DNA containing the complete locus regulatory region and E1 protein of human papillomavirus type 16 (NCBI accession number U89348, SEQ ID NO: 19) was chemically synthesized. Individual segments and / or coding sequences were synthesized first. These were amplified by polymerase chain reaction (PCR) using synthetic oligonucleotide primers identical to the 5' end of the green fluorescent protein gene and synthetic oligonucleotide primers complementary to the 3' end of the green fluorescent protein. The 5' primer (SEQ ID NO: 20) was extended from its 5' end, which contains the recognition site for BamHI or EcoRI endonuclease. The 3' primer (SEQ ID NO: 21) was extended at its 3' end, which contains the complement of the BamHI or EcoRI endonuclease recognition site. The resulting amplified green fluorescent protein gene sequences were then digested with BamHI and EcoRI restriction endonucleases.
[0166] The lentiviral vector was obtained from System Biosciences, Inc. Plasmids were cleaved with BamHI and EcoRI enzymes, and the overamplified green fluorescent protein gene sequence was mixed with the insert-to-vector in a 1:3 ratio.
[0167] Next, the enzyme activity was stopped by thermal inactivation at 70 degrees Celsius for 20 minutes. The mixture was then cooled to room temperature to enable annealing.
[0168] The annealing reaction was performed at room temperature for 30 minutes using bacteriophage T4 DNA ligase. 2.5 microliters of the resulting ligation mixture was added to 25 microliters of STBL3 competent bacterial cells.
[0169] Next, transfection was performed by a simple (1 minute) heat shock at 42 degrees Celsius.
[0170] Bacterial cells were streaked onto agar plates containing ampicillin to obtain bacterial cultures. These cultures were then grown in Luria culture medium.
[0171] To confirm the insertion of the amplified green fluorescent protein gene sequence into the lentiviral vector packaging plasmid, DNA was extracted from the bacterial culture described above and purified using standard methods. The purified DNA was digested with the same endonuclease used to construct the construct. The fragment lengths were analyzed by agarose gel electrophoresis, and the amplified green fluorescent protein gene sequence was validated by DNA sequencing using specific primers obtained from Eurofins MWG Operon LLC.
[0172] Lentiviral vector stocks were prepared as follows: At least two lentiviral packaging plasmids plus cargo plasmids were cotransfected into HEK cells expressing viral genes and genomic RNA, assembled into integrase-deficient lentiviral particles, and released into culture medium. Cell-free supernatants were generated and collected at intervals of 3 to 10 days after transfection. Lentiviral particles were purified by standard procedures including a combination of methods such as centrifugation, transient flow filtration, size exclusion chromatography, size exclusion filtration, or ion exchange chromatography. The concentration and biological activity (transduction units per ml) of each stock were determined.
[0173] Mammalian cells, including 293T cells, were used to test the formation, copy number, and expression of lentivirus-derived episomes. 293T cells were transduced with integrase-deficient lentivirus particles in the presence of polybrene at infection multiplicities ranging from 1 to 10. Unabsorbed viruses were removed by washing the cells 3 hours after application, and the cells were cultured for 3 days. Cells were observed under a fluorescence microscope, and cells expressing GFP were counted. Untransduced 293T cells were used as a negative control. Data were reported as GFP-positive cells per 100 viable cells in the culture. A minimum of 300 cells were counted per microscopic field of view, with 5–10 fields of view counted in each replication experiment. Four independent transduction experiments were performed, including one negative control (leftmost data column) and three replication experiments (i.e., data columns designated as Experiment 1, Experiment 2, and Experiment 3), to determine the frequency of transduced cells. Data are shown in Figure 3, showing GFP expression across the three replication experiments. Example 7 VIV containing E1 and E2 for cargo expression
[0174] Referring to Figure 4, vector 19 can be constructed to contain both E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7) initiator proteins. Here, the gene cargo is a CMV / GFP expression cassette under the control of an inducible promoter.
[0175] Vector 19 can be transduced into 293T cells with an infection multiplicity of transduction units ranging from 1 to 20 per cell. After 3 hours, the cells are washed in medium to remove unadsorbed virions and returned to the culture. 12–24 hours after transduction, the cells are treated with at least one dose of a compound capable of inducing an inducible promoter. Upon addition of the compound capable of inducing an inducible promoter, E1 and E2 mRNAs are transcribed from the episome, combined into locus regulatory region fragment 2 (LCR / F2) (SEQ ID NO: 3), and assembled, triggering DNA replication. Lentivirus-derived episomes begin to disintegrate approximately 24–36 hours after the cessation of promoter induction. Protein products from the cargo within vector 19 are measured by analytical flow cytometry. Example 8 Introduction of E1 and E2 for cargo expression
[0176] To determine the effects of E1 and E2 expressing cargo, 293T cells were transduced with a D64V integrase-deficient lentiviral vector (i.e., the vector in Figure 5A) expressing mCherry and either the full-length HPV16 (SEQ ID NO: 1) long regulatory region (LCR) or the 3' fragment as described herein in fragment 1 (SEQ ID NO: 2), fragment 2 (SEQ ID NO: 3), fragment 3 (SEQ ID NO: 4), and fragment 4 (SEQ ID NO: 5).
[0177] Referring to Figure 5A, the full-length LCR or 3' fragment was used in the LCR region shown in Figure 5A. More specifically, the design of the constructed structures is demonstrated in Figure 7 of this specification as vectors 9-13. The additional elements shown in Figure 7 refer to the psi packaging element (SEQ ID NO: 22); the rev element (SEQ ID NO: 23); the cPPT (central polypurine sequence) element (SEQ ID NO: 24); and the post-transcriptional regulatory element (WPRE) of woodchuck hepatitis virus (SEQ ID NO: 25).
[0178] After 24 hours, the cells were transfected with plasmids containing HPV16 E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7) using lipofectamine 2000. Two days later, mCherry expression was analyzed by FACS. These experimental results are shown in Figure 6A of this specification.
[0179] To contrast with the above experiments in which E1 and E2 were introduced via plasmids, a second set of experiments was performed as described below. Briefly, 293T cells were transduced with a D64V integrase-deficient lentiviral vector expressing mCherry and the full-length HPV16 long regulatory region (LCR) (SEQ ID NO: 1) or the shorter fragment 1 (SEQ ID NO: 2), based on the generalized vector shown in Figure 5A herein. Simultaneously, the cells were transduced with lentiviruses expressing HPV16 E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7). Two days later, mCherry expression was analyzed by FACS as shown in Figure 6B herein. A larger percentage of mCherry cells was achieved when E1 and E2 were introduced with a D64V integrase-deficient lentiviral vector expressing mCherry and the full-length LCR (SEQ ID NO: 1) or the shorter fragment 1 (also referred to herein as fragment 1 and also as SEQ ID NO: 2), as shown in Figure 6B herein.
[0180] The data detailed in this example demonstrate that when E1 and E2 are expressed via lentiviral-mediated expression, there is stronger expression of full-length and fragmented HPV ori (LCR), and therefore greater activation.
[0181] Secondly, the data from this example demonstrate that HPV ori activation differs depending on the size of the LCR region. For example, referring to Figure 6, when using the full-length LCR (SEQ ID NO: 1) and fragment 1 (SEQ ID NO: 2), there was a more significant change in mCherry expression compared to when using fragments 2 (SEQ ID NO: 3), 3 (SEQ ID NO: 4), and 4 (SEQ ID NO: 5). Example 9 VEGF expression
[0182] As described herein, VEGF can be selected, among other things, as a “cargo” region for treating bone injury. To further analyze VEGF expression levels, 293T cells were transduced with a D64V integrase-deficient lentiviral vector containing human cDNA for VEGF (SEQ ID NO: 26) and fragment 1 of the HPV16 long regulatory region (LCR) (SEQ ID NO: 2) (see Figure 5B for a general description of VEGF-containing vectors). Simultaneously, cells were transduced with lentiviral vectors containing HPV16 E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7). After 2 days, the cell culture medium was collected and analyzed using a VEGF ELISA kit (Thermo Scientific). As shown in Figure 8, there was an increase in VEGF levels with the VEGF expression vector (3594 pg / ml), and a further increase with the use of E1 and E2 (11856 pg / ml).
[0183] In a manner similar to the results from mCherry in Example 8 above, the results demonstrate that there were differences in HPVori activation depending on the size of the LCR region. As shown in Figure 8, there was an approximately threefold change in VEGF levels after the addition of E1 / E2. Therefore, the full-length LCR (SEQ ID NO: 1) or fragment 1 (SEQ ID NO: 2) expressed the target gene (i.e., VEGF) at low levels, but when E1 / E2 was introduced, there was a strong induction of expression. In contrast, the other fragments tested were expressed at higher initial levels, and the difference when E1 / E2 was introduced was reduced. Example 10 Development of E1-E2-containing vectors
[0184] Using standard molecular biological techniques (e.g., Sambrook; Molecular Cloning: A Laboratory Manual, 4th edition) and the techniques described herein, a series of lentiviral vectors containing HPV LCR and E1 and E2 were developed as described in more detail below. These vectors are also shown in Figure 9 herein.
[0185] Referring to Figure 9, we developed vector 20, which is a general lentiviral vector for expressing cDNA, microRNA, or shRNA. Referring to vector 20, from left to right, the key components of the developed vector are as follows: long-terminal repeat (SEQ ID NO: 27); psi packaging element (SEQ ID NO: 22); rev-responsive element (RRE) (SEQ ID NO: 23); promoter; cDNA, microRNA, shRNA, or other cargo element; post-transcriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NO: 25), LCR moiety which may contain the LCR fragment detailed herein; and long-terminal repeat (SEQ ID NO: 28).
[0186] Referring to Figure 9, we developed vector 21, which is a lentiviral vector for expressing E1. Referring to vector 21, from left to right, the key components of the developed vector are as follows: long-terminal repeat (SEQ ID NO: 27); psi packaging element (SEQ ID NO: 22); rev-responsive element (RRE) (SEQ ID NO: 23); CMV promoter (SEQ ID NO: 29); E1 (SEQ ID NO: 6) woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (SEQ ID NO: 25); and long-terminal repeat (SEQ ID NO: 28).
[0187] Referring to Figure 9, we developed vector 22, which is a lentiviral vector for expressing E1-C (carboxy-terminus) (SEQ ID NO: 8). Referring to vector 22, from left to right, the key components of the developed vector are as follows: long-terminal repeat (SEQ ID NO: 27); psi packaging element (SEQ ID NO: 22); rev-responsive element (RRE) (SEQ ID NO: 23); CMV promoter (SEQ ID NO: 29); E1-C (SEQ ID NO: 8); post-transcriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NO: 25); and long-terminal repeat (SEQ ID NO: 28).
[0188] Referring to Figure 9, we developed vector 23, which is a lentiviral vector for expressing E2(HPV16) (SEQ ID NO: 7). Referring to vector 23, from left to right, the key components of the developed vector are as follows: long-terminal repeat (SEQ ID NO: 27); psi packaging element (SEQ ID NO: 22); rev-responsive element (RRE) (SEQ ID NO: 23); UbiC promoter (SEQ ID NO: 30); E2(HPV16) (SEQ ID NO: 7); post-transcriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NO: 25); and long-terminal repeat (SEQ ID NO: 28).
[0189] Referring to Figure 9, we developed vector 24, which is a lentiviral vector for expressing E2-11(HPV11)(SEQ ID NO: 9). Referring to vector 24, from left to right, the key components of the developed vector are as follows: long-terminal repeat (SEQ ID NO: 27); psi packaging element (SEQ ID NO: 22); rev-responsive element (RRE) (SEQ ID NO: 23); UbiC promoter (SEQ ID NO: 30); E2-11(HPV11)(SEQ ID NO: 9); post-transcriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NO: 25); and long-terminal repeat element (SEQ ID NO: 28).
[0190] Referring to Figure 9, we developed vector 25, which is a lentiviral vector for expressing E1-T2A-E2 (SEQ ID NO: 10). Referring to vector 25, from left to right, the key components of the developed vector are as follows: long-terminal repeat (SEQ ID NO: 27); psi packaging element (SEQ ID NO: 22); rev-responsive element (RRE) (SEQ ID NO: 23); CMV promoter (SEQ ID NO: 29); E1-T2A-E2 (SEQ ID NO: 10); post-transcriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NO: 25); and long-terminal repeat (SEQ ID NO: 28).
[0191] Referring to Figure 9, we developed vector 26, which is a lentiviral vector for expressing E1-T2A-E2 (SEQ ID NO: 10) and the full-length LCR (SEQ ID NO: 1) or fragments thereof (e.g., SEQ ID NOs: 2-5). Referring to vector 26, from left to right, the key components of the developed vector are as follows: long-terminal repeat (SEQ ID NO: 27); psi packaging element (SEQ ID NO: 22); rev-responsive element (RRE) (SEQ ID NO: 23); CMV promoter (SEQ ID NO: 29); E1-T2A-E2 (SEQ ID NO: 10); post-transcriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NO: 25), LCR portion; and long-terminal repeat (SEQ ID NO: 28).
[0192] Referring to Figure 9, vector 27 is a typical lentiviral vector for expressing, for example, cDNA, antibodies, microRNA, or shRNA. Referring to vector 27, from left to right, the key components of the developed vector are as follows: long-terminal repeat (SEQ ID NO: 27); psi packaging element (SEQ ID NO: 22); rev-responsive element (RRE) (SEQ ID NO: 23); promoter; cDNA, microRNA, shRNA, or other cargo element; post-transcriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NO: 25), EBVori (SEQ ID NO: 31); and long-terminal repeat (SEQ ID NO: 28).
[0193] The linear vectors detailed herein are circulated intracellularly, for example, as shown in Figure 10, which illustrates the circulation of vector 20 (shown in Figure 9). For the purposes of the experiments detailed herein, Figure 10 details a primer set as arrows located at the 3' and 5' long-term repeats (LTRs). This primer set is designed to amplify lentiviral vectors in episomal form, but not vectors in incorporated form. Primers suitable for detecting lentiviral episomes contain the following sequences: 3'LTR forward CTAATTCACTCCCAACGAAG(sequence number 11); and 5'LTR reverse GCCGAGTCCTGCGTCGAGAG (Sequence ID 12).
[0194] In the experiments detailed here, the copy number of integrase-deficient lentiviral vectors was controlled by combinations of vector 20 with vectors 21, 22, 23, or 24. Alternatively, the copy number of integrase-deficient lentiviral vectors was controlled by combinations of vector 20 with vectors 25 or 26. Example 11 Development of LCR fragments and related vectors
[0195] As discussed herein, the LCR portion of the vectors detailed herein may be fragments such as fragment 1 (sequence number 2), fragment 2 (sequence number 3), fragment 3 (sequence number 4), and fragment 4 (sequence number 5), which are modified through their use.
[0196] Figure 11 shows the genomic structure of the LCR and the fragments described herein. In the figure, the full-length LCR (upper part) contains a series of AP1, YY1, E1, and E2 binding sites. For example, as shown in Figure 11, fragment 1 (SEQ ID NO: 2), fragment 2 (SEQ ID NO: 3), fragment 3 (SEQ ID NO: 4), and fragment 4 (SEQ ID NO: 5) represent an increase in LCR with increasing 5' truncation, which reduces the series of AP1, YY1, and E2 binding sites. Lentiviral vectors utilizing LCR fragments are described in detail herein (e.g., Figure 7 and related examples herein). Example 12 Testing of vectors containing LCR fragments and E1 / E2 variants
[0197] To test vectors containing the various LCR fragments detailed herein, 293T cells were transduced with D64V integrase-deficient lentiviral vectors containing either the full-length HPV16 long regulatory region (LCR) or any of the fragments described herein (see, for example, Figure 7 and relevant examples herein).
[0198] After 24 hours, cells were transfected with plasmids containing HPV16 E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7) using lipofectamine 2000. After 2 days, DNA was extracted for analysis by qPCR. Episome copy number was determined using primers represented by SEQ ID NOs: 11 and 12, which are specific to the episome morphology of the lentiviral vector. This primer set amplified only 1- and 2-LTR episomes. The data for this example are shown in Figure 12. In this figure, the numbers associated with LCRs and their fragments reflect the increase in magnification changes for each condition after the addition of E1 and E2, respectively.
[0199] As shown in Figure 12, the basal episome copy number for full-length LCR and Frag1 was very low. For example, for these two conditions (i.e., full-length LCR and Frag1), the basal episome copy number was less than 0.020 episome copies per cell. The basal episome copy number was slightly higher for the Frag2, Frag3, and Frag4 constructs. For example, for these three conditions (i.e., Frag2, Frag3, and Frag4), the basal episome copy number was 0.020 or higher episome copies per cell. The basal episome copy number data influenced the relative magnification change for each of the conditions tested. As shown in Figure 12, when E1 / E2 was introduced into the system, the full-length LCR construct resulted in a 267-fold increase in episome copy number. When E1 / E2 was introduced into the system, the Frag1 construct resulted in a 362-fold increase in episome copy number. When E1 / E2 was introduced into the system, the Frag2 construct resulted in a 6-fold increase in episomal copy number. When E1 / E2 was introduced into the system, the Frag3 construct resulted in a 61-fold increase in episomal copy number. When E1 / E2 was introduced into the system, the Frag4 construct resulted in a 7-fold increase in episomal copy number. The data detailed in Figure 12 are also recalculated in a separate format in Figure 20 of this specification.
[0200] In a related experiment with a separate set of experiments, mCherry expression from integrase-deficient lentiviral vectors containing HPV LCR and its 3' fragment was analyzed. Briefly, 293T cells were transduced with the D64V integrase-deficient lentiviral vector expressing mCherry and either the full-length HPV16 long regulatory region (LCR) or one of fragments 1 (SEQ ID NO: 2), 2 (SEQ ID NO: 3), 3 (SEQ ID NO: 4), or 4 (SEQ ID NO: 5). Simultaneously, the cells were transduced with lentiviruses expressing HPV16 E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7). After two days, mCherry expression was analyzed by FACS.
[0201] As shown in Figure 13A, the percentage of mCherry cells was identified for each of the tested conditions. The number associated with LCRs and their fragments reflects the increasing fold change for each condition after E1 and E2 addition.
[0202] In another related experiment, 293T cells were transduced with a D64V integrase-deficient lentiviral vector expressing mCherry and the full-length HPV16 regulatory region previously identified as SEQ ID NO: 1. Simultaneously, the cells were transduced with a lentivirus expressing HPV16 E1-T2A-E2 (SEQ ID NO: 10) from a single vector (see vector 25 in Figure 9). Two days later, mCherry expression was analyzed by FACS. The data are shown in Figure 13B. As shown in the figure, transduction with HPV16 E1-T2A-E2 (SEQ ID NO: 10) resulted in a significant increase in positive mCherry cells.
[0203] In another set of related experiments, mCherry expression was analyzed using integrase-deficient lentiviral vectors containing HPV LCR after the addition of E1, E1-C, and E2-11. Briefly, 293T cells were transduced with the D64V integrase-deficient lentiviral vector expressing mCherry and HPV16LCR (SEQ ID NO: 1) or fragment 1 (SEQ ID NO: 2). Simultaneously, cells were transduced with HPV16 E1 (i.e., vector 21 in Figure 9; and SEQ ID NO: 6) or E1 carboxy(C) terminal fragment (i.e., vector 22 in Figure 9; and SEQ ID NO: 8) and HPV16 E2 (i.e., vector 23 in Figure 9; and SEQ ID NO: 7) or HPV11 E2 (i.e., vector 24 in Figure 9; and SEQ ID NO: 9). After two days, mCherry expression was analyzed by FACS. The percentage of mCherry cells was identified for each condition tested, as shown in Figure 14. The numbers associated with the tested conditions reflect the increase in the magnification change for each condition after the addition of E1 and E2. Example 13 Antibody expression
[0204] As described herein, one of the features of the disclosed system is its usefulness for expressing antibodies. In a series of representative experiments detailed herein, anti-HER2 antibodies were expressed using a lentiviral vector system. Briefly, 293T cells were infected with a D64 integrase-deficient lentiviral vector (i.e., vector 20) containing an antibody sequence against HER2 (sequence number 13) and an HPV LCR sequence (sequence number 1).
[0205] Simultaneously, cells were infected with lentiviral vectors containing E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7). After 3 days, the cell culture medium was collected. Antibodies were purified from the medium using protein A / G agarose beads. Immunoblotting was performed using sheep anti-human antibody (Thermo Scientific). Antibody production increased with the addition of E1 and E2, as shown in Figure 15A. Furthermore, anti-HER2 IgG concentrations were determined using the EasyTiter IgG kit (Thermo Scientific), as shown in Figure 15B.
[0206] Furthermore, additional antibodies can be expressed using the systems disclosed herein, as shown in Figure 16 of this specification. Figure 16 shows an immunoblot demonstrating the expression of an anti-EGFR antibody (SEQ ID NO: 14). Briefly, 293T cells were infected with a D64 integrase-deficient lentiviral vector containing an antibody sequence against EGFR (see SEQ ID NO: 14 below) and HPV fragment 2 (SEQ ID NO: 3).
[0207] After 24 hours, cells were infected with lentiviral vectors containing E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7). After 3 days, cell lysates and cell culture media were collected. Antibodies were purified from the media using protein A / G agarose beads and extracted from the cells by cell lysis. Immunoblotting was performed using sheep anti-human antibody (Thermo Scientific) and anti-actin (Sigma) antibody as a protein loading control for cell lysates. Antibody production increased in both cell lysates and culture media supplemented with E1 and E2, as shown in Figure 16. Example 14 MicroRNA expression and knockdown
[0208] As described herein, one of the features of the disclosed system is its usefulness for expressing microRNAs. As a non-limiting example, a construct was designed to express microRNAs for CCR5 based on SEQ ID NO: 15.
[0209] In short, HeLa cells expressing CCR5 were infected with a D64 integrase-deficient lentiviral vector (i.e., vector 20) containing a microRNA sequence for CCR5 (sequence number 15) and a full-length HPV LCR (sequence number 1) sequence. Simultaneously, the cells were infected with lentiviral vectors containing E1 and E2. After 3 days, the cells were harvested and CCR5 expression was analyzed by FACS analysis using an anti-CCR5 APC conjugate antibody. As shown in Figure 17, the percentage of CCR5-positive cells decreased from 92.6% to 70.9% using LV-LCR miR-CCR5 and to 44% using LV-LCR miR-CCR5 + E1 and E2.
[0210] In related experiments, a D64 integrase-deficient lentiviral vector containing a microRNA sequence for CCR5 and fragment 2 (sequence number 3) LCR sequence was used. As shown in Figure 18, a similar decrease in CCR5 expression was observed after the addition of miR-CCR5, and further decreases occurred with the addition of E1 and E2.
[0211] Referring to Figure 18 in more detail, the upper panel shows the distribution of cells, each represented by a single point based on the expression level of mCherry. The lower panel shows the corresponding changes in CCR5 expression, which relate to the levels of DNA replication and miRNA production for CCR5. CCR5 is detected by a fluorescent monoclonal antibody used to stain the cell surface. In the absence of any LV vector (left panel), there is no mCherry expression (all cells are in sector 1), and CCR5 expression is uniformly high at approximately 200 fluorescence intensity units. By adding LV-LCR containing miRCCR5 (fragment 2; SEQ ID NO: 3), we found a partial decrease in CCR5 expression (dashed line in the lower and middle panels) leading to cells with basal expression of mCherry (55% of cells were found here in sector 2) and a new population with fluorescence intensity units concentrated at approximately 30 intensity units. By adding both LV-LCR miRCCR5 and a non-integrated lentiviral vector expressing E1 and E2 replication proteins, we found 18.8% of cells with the highest mCherry expression (sector 3) and a new population with even lower CCR5 expression, with fluorescence intensity units less than 20 (curve 3, gray dashed line). These data demonstrate the ability of VIV containing LCR fragment 2 (SEQ ID NO: 3) to express basal levels of miRCCR5, which is biologically active in reducing cell surface expression of the CCR5 protein. Furthermore, the results show that the addition of E1 / E2 DNA replication proteins affects the vector copy number (related to mCherry expression), and that increased miRCCR5 expression leads to a further decrease in cell surface CCR5 expression. Example 15 EBV-based initiator protein
[0212] As described herein, initiator proteins such as E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7) can be used to enhance the efficacy of the system described herein. An alternative initiator protein used in the current system is EBNA-1 (SEQ ID NO: 32). Therefore, in a series of experiments, 293T cells were transduced with a D64V integrase-deficient lentiviral vector (i.e., vector 27) expressing GFP and the Epstein-Barr virus (EBV) OriP sequence (SEQ ID NO: 31).
[0213] After 24 hours, cells were transfected with a plasmid containing EBV EBNA-1 (SEQ ID NO: 32) using lipofectamine 2000. Two days later, GFP expression was analyzed by FACS. As shown in the representative data in Figure 19, EBV+EBNA resulted in enhanced GFP expression. Therefore, this data demonstrates that the initiator protein / ori interaction is not limited to E1 / E2 interactions but also includes Epstein-Barr virus components. Example 16 Selection of LCR fragments to configure an optimized virus delivery system.
[0214] LCR fragment lengths were selected according to desired expression levels in cells. Figure 20 shows the episome copy number data generated in Figure 12 as described herein. More specifically, Figure 20 illustrates a selection rubric according to one aspect of the present invention. Episome copies per cell (Y axis) was graphed against LCR fragment length (X axis). As shown in Figure 20, the variation in expression levels determined by episome copies per cell was attributable to the various LCR fragments tested herein. As shown in Figure 20, moving from right to left, data for full-length LCR (SEQ ID NO: 1), fragment 1 (SEQ ID NO: 2), fragment 2 (SEQ ID NO: 3), fragment 3 (SEQ ID NO: 4), and fragment 4 (SEQ ID NO: 5) are shown with and without E1 / E2 (black circles, data points). As shown in Figure 12, basal expression determined by episome copies per cell was lowest for LCR and Frag1 constructs. For example, under these two conditions (i.e., full-length LCR and Frag1), the basal episome copy number was less than 0.020 episome copies per cell. Basal expression was slightly higher under the Frag2, Frag3, and Frag4 conditions. For example, under these three conditions (i.e., Frag2, Frag3, and Frag4), the basal episome copy number was 0.020 or higher episome copies per cell.
[0215] Referring to both Figures 11 and 20, increased deletion from the 5' end of the LCR resulted in the removal of key functional elements. Basal expression was defined by the number of episomatic DNA copies measured by quantitative PCR assay when the LCR or LCR fragment was present in a lentiviral episomatic vector without the addition of E1 / E2 proteins (e.g., light gray data points). Inducible activity was measured by quantitative PCR assay after transfecting an expression plasmid containing E1 and E2 (e.g., black data points) and then introducing a lentiviral episomatic vector. Similar results were obtained when the E1 / E2 protein expression construct was delivered as a non-integrated lentiviral vector. As detailed herein, basal expression was determined to be highest for LCR fragments 2, 3, and 4. This indicates that basal expression was suppressed by the presence of the YY1 transcription factor binding site, which is present in both the LCR and fragment 1 but not in fragments 2-4, as shown in Figure 11. Of fragments 2-4, fragment 2 showed the highest basal expression and was the only fragment containing both AP1 transcription factor binding sites. Thus, basal transcription increased when the YY1 site was removed and both AP1 sites were preserved. As detailed herein, inductive activity was determined to be highest for fragments 1 and 3, lower for fragments 2 and 4, and lowest for the intact LCR. There was an unspecified element in the LCR that was not present in fragment 1, which acted to suppress inductive DNA replication. When YY1 and AP1 sites were present (fragment 1), episomal DNA levels were lower compared to when YY1 and all AP1 sites were removed (fragment 3). When the AP1 site was present without YY1 (fragment 2), or when YY1, AP1, and two of the four E2 binding sites were removed (fragment 4), inductive episomal DNA formation was moderate and similar to that of the LCR.
[0216] As summarized in Figure 20, the data detailed herein demonstrate discernible differences in the basal levels of expression and the ability to induce such expression. Based on this data, at least four quadrants of activity were defined as shown in Figure 20.
[0217] Referring to Figure 21, the four quadrants represent the degree of activity variation due to LCR and its associated fragments. As shown in Figure 21, the first quadrant reflects low activity but is 3 to 4 times higher than the fourth quadrant and has small LCR fragments. The second quadrant reflects high activity and again has small LCR fragments. The third quadrant reflects high activity but this time has relatively long LCR fragments. Finally, the fourth quadrant reflects very low activity and has relatively long LCR fragments.
[0218] As detailed in Figure 21, each quadrant is reasonably associated with a specific desired course of action or outcome. Typical examples include: when the desired course of action or outcome involves gene editing, an LCR is selected from the first quadrant; when the desired course of action or outcome involves cell reprogramming, an LCR is selected from the second quadrant; when the desired course of action or outcome is immunostimulation, an LCR is selected from the third quadrant; and when the desired course of action or outcome is a placebo effect, an LCR is selected from the fourth quadrant. Therefore, based on the desired course of action or outcome, various LCR fragments are employed using the current system. Example 17 Treatment of individuals in the first quadrant
[0219] The treatment is designed for sickle cell anemia. In this approach, CD34+ bone marrow-derived hematopoietic progenitor stem cells (HPSCs) are isolated, treated with gene modifications ex vivo, and transplanted as autologous cell therapy. This strategy involves expressing an inhibitory miRNA that reduces the expression of the Bcl11A protein, a potent repressor of fetal globin expression (Akinsheye et al., Blood, Vol. 118: p. 19, 2011). When Bcl11A levels decrease, fetal globin expression increases and is replaced by adult globin from the standpoint of normal cellular function.
[0220] The ability to express sufficient levels of inhibitory miRNA without dramatically increasing the viral vector dose raises safety concerns, as it may reduce the viability of transduced CD34+ HPSCs, decrease treatment efficiency, and increase treatment costs. To overcome the problem of increasing expression without increasing the amount of lentiviral vector, non-integrated vectors that can increase gene dose are considered the best option. First, it is necessary to test whether a low dose of extrachromosomal DNA expressing Bcl11A miRNA is sufficient to inhibit Bcl11A expression and increase fetal globin expression.
[0221] The lentiviral vector (LVmiRBcl11A) is constructed using a standard, generally acceptable, clinical-grade vector backbone and packaging system (with mutated integrase function) containing: a synthetic miRNA construct with a guide sequence that fits a sequence found in Bcl11A mRNA under the control of an appropriate promoter; a 200-nucleotide LCR fragment; and no accompanying expression of E1 and / or E2 replication proteins.
[0222] HPSCs are transduced using LVmiRBcl11A at an infection multiplicity equal to 5, the condition that maximizes the frequency of transduced cells and minimizes HPSC cell death. The transduced cells are then engrafted into the bone marrow of the original donor after appropriate cytoreducing conditioning. Participants are monitored to determine the frequency of transduced cells, the number of extrachromosomal DNA copies per cell, and the level of fetal globin expression. This first-quadrant approach is reasonably predicted to result in a low number of extrachromosomal DNA copies per cell, constituting a low therapeutic dose of LVmiRBcl11A. Example 18 Treatment of individuals in the second quadrant
[0223] The treatment is designed for cellular reprogramming associated with sickle cell anemia. In this approach, CD34+ bone marrow-derived hematopoietic progenitor stem cells (HPSCs) are isolated, treated with genetic modifications ex vivo, and transplanted as autologous cell therapy. This strategy involves expressing an inhibitory miRNA that reduces the expression of the Bcl11A protein, a potent repressor of fetal globin expression. When Bcl11A levels decrease, fetal globin expression increases and is replaced by adult globin from the standpoint of normal cellular function.
[0224] The ability to express sufficient levels of inhibitory miRNA without dramatically increasing the viral vector dose raises concerns that it could reduce the viability of transduced CD34+ HPSCs, decrease treatment efficiency, and increase treatment costs.
[0225] To overcome the challenge of increasing expression without increasing the amount of lentiviral vector, non-integrated vectors that allow for variable gene dose are deemed the best option. Following initial testing using the first quadrant condition (short LCR fragment without associated expression of E1 and / or E2 replication proteins) (i.e., Example 17), it is necessary to test whether high doses of extrachromosomal DNA expressing Bcl11A miRNA are sufficient to inhibit Bcl11A expression and increase fetal globin expression. Due to the inductive nature of gene doses using short LCRs and associated expression of E1 and / or E2 replication proteins, the same dose of LVmiRBcl11A can be delivered with a non-integrated lentiviral vector for transient expression of E1 and / or E2 proteins to increase gene dose by more than 5-fold without increasing the lentiviral vector dose that reduces CD34+ HPSC viability.
[0226] The lentiviral vector (LVmiRBcl11A) is constructed using a standard, generally acceptable, clinical-grade vector backbone and packaging system (with mutated, inactivated integrase function) containing: a synthetic miRNA construct with a guide sequence that fits a sequence found in Bcl11A mRNA under the control of an appropriate promoter; a 200-nucleotide LCR fragment; and, to control DNA replication, E1 and / or E2 replication proteins are expressed in a non-integrated lentiviral vector that does not contain the LCR.
[0227] HPSCs are transduced using LVmiRBcl11A at an infection multiplicity equal to 5, the condition that maximizes the frequency of transduced cells and minimizes HPSC cell death. Transduced cells are engrafted into the bone marrow of the original donor after appropriate cytopenia conditioning. Participants are monitored to determine the frequency of transduced cells, the number of extrachromosomal DNA copies per cell, and the level of fetal globin expression. The second quadrant approach is reasonably predicted to result in a high number of extrachromosomal DNA copies per cell, constituting a high therapeutic dose of LVmiRBcl11A.
[0228] By comparing the tests shown in Examples 17 and 18, the optimal conditions for transduction of CD34+ HPSC with LVmiRBcl11A are determined to maximize the efficiency and efficacy of the treatment. Example 19 Treatment of individuals in the third quadrant
[0229] A proposed passive immunization treatment for HIV disease involves the use of CRISPR-Cas9 gene editing to delete the cell surface integrin receptor alpha-4-beta-7, which facilitates viral attachment and entry of susceptible T cells. The treatment strategy involves isolating T cells from peripheral blood and then transducing them with a lentivirus possessing an anti-alpha-4-beta-7 CRISPR-Cas9 construct containing guide RNA specific to the alpha-4-beta-7 gene sequence. The isolated T cells are transduced with the therapeutic lentivirus to delete the alpha-4-beta-7 receptor. The cells are then returned to the body via injection. Upon return to circulation, these HIV-resistant cells may increase in number and begin to provide normal immune function, including the ability to resist HIV replication. High doses of CRISPR-Cas9 lentiviral vectors are predicted to be necessary to achieve uniform deletion of the alpha-4-beta-7 gene. One arm of the proposed clinical trial (i.e., Example 20) utilizes a non-integrated lentiviral vector with a long form of LCR, which expresses CRISPR-Cas9 alpha 4 beta 7 but does not contain E1 and / or E2 replication proteins, and is necessary to increase the copy number to barely detectable levels.
[0230] In this therapeutic arm of the trial, the same LVCRISPR-Cas9 alpha-4-beta-7 is delivered, accompanied by the delivery of a non-integrated lentivirus that expresses E1 and / or E2 replication proteins in a construct that does not contain LCR and cannot replicate DNA. This increases the gene dose without changing the amount of LV-CRISPR-Cas9 alpha-4-beta-7 needed to efficiently transduce T cells, and is considered the high-dose therapeutic arm of the trial.
[0231] A lentiviral vector is constructed and incorporated within a commonly used viral vector backbone the following elements: a 720-nucleotide LCR that is inducible when E1 and / or E2 replication proteins are provided; an expression cassette containing a suitable promoter for gene transcription of the CRISPR-Cas9 protein and alpha-4 beta-7 complementary guide RNA. The vector is packaged with mutations in the integrase gene to prevent normal viral DNA integration. A second non-integrated lentivirus is used to provide transient expression of E1 and / or E2 DNA replication proteins in a construct that does not contain the LCR and cannot replicate DNA.
[0232] Because the gene dose was increased by the addition of E1 and / or E2 proteins, T cells were ex vivo modified with a non-integrated lentiviral vector having high CRISPR-Cas9 and guide RNA expression. The cells were returned to the investigational subjects in the therapeutic arm of the study. Clinical outcomes were assessed based on an increased proportion of T cells carrying the alpha4beta7 gene deletion in the presence of HIV, and improvements in T cell function and the natural regulation of HIV replication in the absence of antiretroviral drugs. This third quadrant approach is reasonably predicted to result in an increased proportion of T cells carrying the alpha4beta7 gene deletion in the presence of HIV, and improvements in T cell function and the natural regulation of HIV replication in the absence of antiretroviral drugs. Example 20 Treatment of individuals in the fourth quadrant
[0233] Proposed treatments for HIV disease include the use of CRISPR-Cas9 gene editing to delete the cell surface integrin receptor alpha-4-beta-7, which facilitates viral attachment and entry of susceptible T cells. The treatment strategy involves isolating T cells from peripheral blood and then transducing them with a lentivirus possessing an anti-alpha-4-beta-7 CRISPR-Cas9 construct containing guide RNA specific to the alpha-4-beta-7 gene sequence. The isolated T cells are transduced with the therapeutic lentivirus to delete the alpha-4-beta-7 receptor, and then the cells are returned to the body via injection. Upon return to circulation, these HIV-resistant cells may increase in number and begin to provide normal immune function, including the ability to resist HIV replication.
[0234] Before initiating clinical trials of the treatment, it is crucial to confirm the safety and specificity of the vector. A major concern is whether the therapeutic gene cassette, containing alpha-4 beta-7 specific guide RNA, will cause genotoxicity. This concern stems from the fact that the guide RNA has direct homology to the human genome, and its action in incorporating constructs capable of long-term CRISPR-Cas9 expression could lead to unpredictable consequences, including cellular transformation and cancer.
[0235] To demonstrate that vector integration into the alpha4beta7 gene is not a high-probability event, the control trial is designed to include one arm that modifies T cells ex vivo before injection using a non-integrating transient vector. In vitro studies are not sufficient to assess risk because the number of events analyzed in vivo is much larger than what can be simulated in in vitro or ex vivo studies.
[0236] A lentiviral vector is constructed containing the following elements within a commonly used viral vector skeleton: a 720-nucleotide LCR without accompanying expression of E1 and E2 proteins; an expression cassette containing a suitable promoter for gene transcription of the CRISPR-Cas9 protein and alpha-4 beta-7 complementary guide RNA. The vector is packaged with mutations in the integrase gene to prevent normal viral DNA integration.
[0237] Since gene dose does not increase without E1 and / or E2 proteins, T cells are ex vivo modified with a non-integrated lentiviral vector having minimal CRISPR-Cas9 or guide RNA expression. The cells are returned to the control arm of the study, and the pattern of viral DNA integration is measured by extracting chromosomal DNA and performing appropriate PCR-based testing to identify the recombinant viral DNA from the chromosomal DNA. Recombination sites of any integrated DNA are determined by high-throughput DNA sequencing and reported as potential genotoxic events indicating a potential adverse event. This fourth-quadrant approach is reasonably predicted to serve as an effective control for monitoring recombination events. array The following sequences are referenced herein. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] Table 3-7 Table 3-8 Table 3-9 Table 3-10 Table 3-11 Table 3-12 Table 3-13 Table 3-14 Table 3-15 Table 3-16 Table 3-17 Table 3-18 Table 3-19 Table 3-20 Table 3-21 Table 3-22 Table 3-23
Table 3-24
Table 3-25
Table 3-26
Table 3-27
Table 3-28
Table 3-29
Table 3-30
[0238] Although certain preferred embodiments of the present invention have been described and specifically illustrated herein, the present invention is not intended to be limited to such embodiments. Various modifications may be made without departing from the scope and spirit of the present invention. The present invention provides, for example, the following items: (Item 1) a. A virus carrier containing a defective integrase gene, b. Origin of heterologous episomal DNA replication, c. A sequence encoding at least one initiator protein specific to the heterologous viral episomal DNA replication origin, wherein the expression of the sequence encoding at least one initiator protein specific to the heterologous viral episomal DNA replication origin is inducible, and d. At least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA Non-embedded virus delivery systems, including those mentioned above. (Item 2) The non-embedded virus delivery system described in item 1, wherein the virus carrier is a lentivirus. (Item 3) The non-integrated viral delivery system described in item 1, wherein the heterologous viral episomal DNA replication origin is derived from a papillomavirus. (Item 4) The non-embedded viral delivery system described in item 3, wherein the heterologous viral episomal DNA replication origin is derived from human papillomavirus or bovine papillomavirus. (Item 5) The non-embedded viral delivery system described in item 4, wherein the heterologous viral episomal DNA replication origin is derived from human papillomavirus type 16 (HPV16). (Item 6) The non-embedded virus delivery system described in item 5, wherein the heterologous viral episomal DNA replication origin is derived from the long regulatory region (LCR) of HPV16. (Item 7) The non-embedded viral delivery system described in item 6, wherein the heterologous viral episomal DNA replication origin includes Sequence ID No. 1. (Item 8) The non-embedded viral delivery system described in item 6, wherein the heterologous viral episomal DNA replication origin includes the 5' truncation of SEQ ID NO: 1. (Item 9) The non-embedded viral delivery system according to item 6, wherein the heterologous viral episomal DNA replication origin includes a 5' truncation of at least about 200 nucleotides, or at least about 300 nucleotides, or at least about 400 nucleotides, or at least about 500 nucleotides, or at least about 600 nucleotides, or at least about 700 nucleotides of SEQ ID NO: 1. (Item 10) The non-embedded virus delivery system according to item 6, wherein the heterologous viral episomal DNA replication origin has at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity, of the LCR of HPV16. (Item 11) The non-embedded virus delivery system according to item 6, wherein the heterologous viral episomal DNA replication origin includes Frag1 (SEQ ID NO: 2), Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the LCR of HPV16. (Item 12) The non-integrated viral delivery system according to item 1, wherein the at least one initiator protein specific to the heterologous viral episomal DNA replication origin comprises E1 or an operable fragment thereof. (Item 13) The non-integrated viral delivery system according to item 1, wherein the at least one initiator protein specific to the heterologous viral episomal DNA replication origin comprises E2 or an operable fragment thereof. (Item 14) The non-integrated viral delivery system according to item 1, wherein the at least one initiator protein specific to the heterologous viral episomal DNA replication origin comprises EBNA-1 or an activatable fragment thereof. (Item 15) The non-integrated viral delivery system described in item 1, comprising at least two initiator proteins specific to the heterologous viral episomal DNA replication origin. (Item 16) The non-integrated viral delivery system according to item 15, wherein at least two initiator proteins specific to the heterologous viral episomal DNA replication origin are E1 and E2 or activatable fragments thereof. (Item 17) The non-embedded viral delivery system described in item 1, wherein the sequence encoding at least one initiator protein is located on a single separate plasmid or non-embedded viral vector. (Item 18) The non-embedded viral delivery system according to item 1, wherein the system comprises at least two initiator proteins specific to the heterologous viral episomal DNA replication origin, and the sequences encoding the at least two initiator proteins are present in a single separate plasmid or non-embedded viral vector. (Item 19) The non-embedded viral delivery system according to item 1, wherein the system comprises at least two initiator proteins specific to the heterologous viral episomal DNA replication origin, wherein the sequences for the first initiator protein and the sequences for the second initiator protein are located in separate plasmids or non-embedded viral vectors. (Item 20) The non-integrated viral delivery system according to item 1, wherein the at least one gene product comprises an antibody, an antibody fragment, or a growth factor. (Item 21) The non-embedded viral delivery system according to item 20, wherein the antibody comprises an anti-HER2 antibody or a fragment thereof. (Item 22) The non-embedded viral delivery system according to item 20, wherein the growth factor comprises vascular endothelial growth factor (VEGF) or a variant thereof. (Item 23) The non-integrated virus delivery system described in item 1, wherein the miRNA includes CCR5 miRNA. (Item 24) A pharmaceutical composition comprising the non-embedded virus delivery system described in item 1 and at least one pharmaceutically acceptable carrier. (Item 25) A method for expressing at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA in a cell, The cells are brought into contact with an effective amount of non-integrated virus delivery system. This includes, where the system is i. A viral carrier containing a defective integrase gene, ii. Origin of heterologous virus episomal DNA replication, iii. A sequence encoding at least one initiator protein specific to the heterologous viral episomal DNA replication origin, wherein the expression of the sequence encoding at least one initiator protein specific to the heterologous viral episomal DNA replication origin is inducible, and iv. At least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA Methods that include... (Item 26) A method for expressing at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA in an object that requires it, The procedure includes administering an effective amount of a non-embedded virus delivery system to the subject, wherein the system is i. A viral carrier containing a defective integrase gene, ii. Origin of heterologous virus episome replication, iii. A sequence encoding at least one initiator protein specific to a heterologous viral episomal DNA replication origin, wherein the expression of the sequence encoding the at least one initiator protein specific to the heterologous viral episomal DNA replication origin is inducible, and iv. At least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA Methods that include... (Item 27) The method according to item 26, wherein the sequence encoding the at least one initiator protein is present in a single distinct plasmid, and the at least one initiator protein is E1 or E2. (Item 28) The method according to item 27, further comprising administering a first amount of the single, distinct plasmid to a subject requiring it, in order to initiate a first level of expression of the at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA. (Item 29) The method according to item 28, further comprising administering a second amount of the single, distinct plasmid to a subject in need of it, in order to initiate a second level of expression of at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA. (Item 30) The method according to item 29, wherein when the second amount is lower than the first amount, the expression level of the at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA is reduced. (Item 31) The method according to item 29, wherein when the second amount is higher than the first amount, the expression level of the at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA increases. (Item 32) The non-embedded virus delivery system according to item 1, wherein the system is optimized to produce low levels of basal expression of the at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA, wherein the heterologous viral episomal DNA replication origin has at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity with SEQ ID NO: 1 or Frag1 of the HPV16 LCR (SEQ ID NO: 2). (Item 33) The non-embedded viral delivery system according to item 1, wherein the system is optimized to produce low levels of basal expression of the at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA, and the heterologous viral episomal DNA replication origin includes SEQ ID NO: 1 or Frag1 of the HPV16 LCR (SEQ ID NO: 2). (Item 34) The non-embedded virus delivery system according to item 1, wherein the system is optimized to produce a moderate level of basal expression of at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA, wherein the heterologous viral episomal DNA replication origin includes at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity, of the HPV16 LCR. (Item 35) The non-embedded viral delivery system according to item 1, wherein the system is optimized to produce a moderate level of basal expression of at least one target gene, gene product, shRNA, siRNA, miRNA, or other RNA, and the heterologous viral episomal DNA replication origin includes Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the HPV16 LCR. (Item 36) A method for selecting an optimized non-embedded virus delivery system, Selecting the basal expression level This includes, where, when level X is selected, a corresponding Y is selected, where Y corresponds to a heterologous viral episomal DNA replication origin selected to be incorporated into the non-integrated viral delivery system. If X = the first defined level of basal expression of cargo, then Y includes LCR (SEQ ID NO: 1) or Frag1 (SEQ ID NO: 2). In the case where X = a second defined level of basal expression of cargo, Y includes Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the HPV16 LCR. (Item 37) The method according to item 36, wherein the first defined level includes episomal copies of cargo less than 0.020 per cell. (Item 38) The method according to item 36, wherein the second specified level includes episomal copies of cargo higher than 0.020 per cell.
Claims
1. A combination comprising a first virus delivery system, a second virus delivery system, a third virus delivery system, and a fourth virus delivery system for use in the course of treatment, Each virus delivery system is a non-integrated virus delivery system that includes a virus carrier containing a defective integrase gene, The aforementioned course of action is included in the course of action in the first quadrant, the course of action in the second quadrant, the course of action in the third quadrant, or the course of action in the fourth quadrant. If the aforementioned treatment sequence is included in the treatment sequence of the first quadrant, the first virus delivery system is selected, and the first virus delivery system includes a heterologous human papillomavirus (HPV) viral episomal DNA replication origin containing a first 5' cleaved human papillomavirus (HPV) LCR fragment, and does not include an initiator protein. If the aforementioned treatment sequence is included in the treatment sequence of the second quadrant, the second virus delivery system is selected, and the second virus delivery system includes a heterologous human papillomavirus (HPV) viral episomal DNA replication origin comprising at least one initiator protein and a second 5' cleaved HPV LCR fragment. If the aforementioned treatment sequence is included in the treatment sequence of the third quadrant, the third viral delivery system is selected, and the third viral delivery system includes a heterologous human papillomavirus (HPV) viral episomal DNA replication origin comprising at least one initiator protein and a third 5' cleaved HPV LCR fragment. If the aforementioned treatment sequence is included in the treatment sequence of the fourth quadrant, the fourth viral delivery system is selected, and the fourth viral delivery system includes a heterologous human papillomavirus (HPV) viral episomal DNA replication origin containing a fourth 5'-cleaved HPV LCR fragment, and does not include an initiator protein. The HPV LCR is HPV16 LCR, and is a nucleic acid containing a sequence encoding one YYI binding site, three AP1 binding sites, four E2 binding sites, and one E1 binding site. The first 5'-cleaved HPV LCR fragment and the second 5'-cleaved HPV LCR fragment are nucleic acid fragments of HPV LCR having a truncation in their 5' region and including an E1 binding site and an E2 binding site, wherein the E1 binding site and the E2 binding site are as follows: a) One E1 binding site and two E2 binding sites, wherein two of the four E2 binding sites are removed from the HPV LCR; or, b) One E1 binding site and three E2 binding sites, wherein one of the four E2 binding sites is removed from the HPV LCR; It consists of, The third 5'-cleaved HPV LCR fragment and the fourth 5'-cleaved HPV LCR fragment are nucleic acid fragments of HPV LCR having truncations in their 5' region, and are nucleic acids comprising three AP1 binding sites, YY1 binding sites, and E1 binding sites and E2 binding sites, wherein the E1 binding sites and E2 binding sites consist of one E1 binding site and four E2 binding sites. The at least one initiator protein is specific to the first 5'-cleaved HPV LCR fragment, the second 5'-cleaved HPV LCR fragment, the third 5'-cleaved HPV LCR fragment, or the fourth 5'-cleaved HPV LCR fragment, The aforementioned at least one initiator protein comprises at least one of E1, E1-C, E2, or E1-T2A-E2, The treatment process in the first quadrant includes at least one of gene editing or safety testing. The treatment process in the second quadrant includes at least one of the following: cell reprogramming, expression of long-acting growth factors, or checkpoint suppression. The treatment course in the third quadrant includes at least one of the following: passive immunity, immune stimulation, or expression of transcription / differentiation factors. The course of treatment in the fourth quadrant includes at least one of placebo control or use for dose escalation. A combination of items.
2. The combination according to claim 1, wherein at least one of the first 5'-cleaved HPV LCR fragment and the second 5'-cleaved HPV LCR fragment lacks an AP1 transcription factor binding site or any portion thereof.
3. The combination according to claim 1, wherein at least one of the first 5'-cleaved HPV LCR fragment and the second 5'-cleaved HPV LCR fragment comprises two or fewer AP1 transcription factor binding sites or portions thereof.
4. The combination according to claim 1, wherein at least one of the third 5'-cleaved HPV LCR fragment and the fourth 5'-cleaved HPV LCR fragment comprises at least three AP1 transcription factor binding sites.
5. The combination according to claim 1, wherein at least one of the first 5'-cut HPV LCR fragment and the second 5'-cut HPV LCR fragment has a length of less than about 200 base pairs.
6. The combination according to claim 1, wherein at least one of the first 5'-cut HPV LCR fragment and the second 5'-cut HPV LCR fragment has a length of about 200 base pairs to about 300 base pairs.
7. The combination according to claim 1, wherein at least one of the first 5'-cut HPV LCR fragment and the second 5'-cut HPV LCR fragment comprises a length of about 300 base pairs to about 550 base pairs.
8. The combination according to claim 1, wherein at least one of the third 5'-cut HPV LCR fragment and the fourth 5'-cut HPV LCR fragment has a length of about 550 base pairs to about 750 base pairs.
9. The combination according to any one of claims 1 to 4, wherein at least one of the first 5'-cut HPV LCR fragment and the second 5'-cut HPV LCR fragment has at least 90% sequence identity with any one of sequence numbers 3, 4, and 5.
10. The combination according to any one of claims 1 to 4, wherein at least one of the third 5'-cut HPV LCR fragment or the fourth 5'-cut HPV LCR fragment has at least 90% sequence identity with either one of sequence numbers 1 and 2.
11. The combination according to any one of claims 1 to 10, characterized in that the cells are brought into contact with the first virus delivery system, the second virus delivery system, the third virus delivery system, or the fourth virus delivery system.
12. The combination according to claim 11, wherein the first virus delivery system and the second virus delivery system further comprise the first gene cargo, and the third virus delivery system and the fourth virus delivery system further comprise the second gene cargo.
13. The combination according to claim 12, wherein contact between the cells and the first virus delivery system results in more than approximately 0.02 basal episomal copies of the first gene cargo per cell.
14. The combination according to claim 12, wherein contact between the cells and the fourth virus delivery system results in a basal episomal copy of the second gene cargo of less than approximately 0.02 per cell.
Citation Information
Patent Citations
Compositions and methods for the manufacture of recombinant adeno-associated virus without helper viruses
JP2002506652A
Adenoviral amplicons and producer cells for the production of replication-deficient adenoviral vectors, production methods and uses thereof
JP2008518591A
Compositions and methods for manipulating cells
JP2012508591A
Episomally replicating lentiviral vectors
US20030013196A1
Retrovirus and viral vectors
US6635472B1