CXCL8 binding nucleic acid

Abstract

To provide a nucleic acid molecule which specifically interacts with CXCL8 but does not specifically interact with other ELR-positive chemokines.SOLUTION: The present invention is related to an L-nucleic acid molecule capable of binding to human CXCL8, wherein the L-nucleic acid molecule comprises a central stretch of nucleotides, wherein the central stretch of nucleotides comprises the nucleotide sequence of 5'-GGAAGUACGUGGAAAGCCRA(XU)RAGUGUGUCCCG-3', wherein XU is U or absent.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to nucleic acid molecules capable of binding to CXCL8, nucleic acid molecules for use in methods for treating and / or preventing diseases, nucleic acid molecules for use in methods for detecting CXCL8, detection means, or nucleic acid molecules for manufacturing biosensors, pharmaceutical compositions comprising nucleic acid molecules, uses of nucleic acid molecules for manufacturing pharmaceuticals, diagnostic agents, diagnostic means, or uses of nucleic acid molecules for manufacturing biosensors, uses of nucleic acid molecules for detecting CXCL8, kits comprising nucleic acid molecules, methods for detecting CXCL8 using nucleic acid molecules, complexes comprising nucleic acid molecules, methods for screening antagonists of CXCL8-mediated activity using nucleic acid molecules, and methods for detecting nucleic acid molecules.

[0002] CXCL8 (UniProtKB / Swiss-Prot P10145, IL8_HUMAN; SEQ ID NO: 2) (also known as interleukin 8 (abbreviated as IL-8)), neutrophil-activating protein 1 (abbreviated as NAP-1), monocyte-derived neutrophil chemotactic factor (abbreviated as MDNCF), or granulocyte chemotactic protein 1 (abbreviated as GCP-1) are small basic proteins belonging to the subfamily of CXC chemokines, characterized by a glutamate-leucine-arginine (abbreviated as ELR) motif at the N-terminus and possessing pro-inflammatory and pro-angiogenic properties. ELR-positive chemokines CXCL1 (also known as growth regulatory alpha protein, Gro-alpha, melanoma growth stimulating activity, MGSA, or NAP-3), CXCL2 (also known as Gro-beta or macrophage inflammatory protein 2-alpha, MIP2-alpha), CXCL3 (also known as Gro-gamma or MIP2-beta), CXCL5 (also known as epithelial neutrophil-activating protein 78, ENA-78, or small inducible cytokine B5), CX CL6 (also known as chemokine alpha 3, CKA-3, granulocyte chemotactic protein 2, GCP-2, or small inducible cytokine B6), CXCL7 (also known as platelet basic protein, PBP, leukocyte-derived growth factor, LDGF, macrophage-derived growth factor, MDGF, or small inducible cytokine B7), and CXCL8 are agonists of the receptor CXCR2 (also known as IL8RB, IL8R type 2, CD182, CDw128b, or GRO / MGSA receptor). CXCL6, CXCL7, and CXCL8 are agonists of the receptor CXCR1 (also known as IL8RA, IL8R type 1, CD181, or CDw128a). CXCL8 binds to receptors CXCR1 and CXCR2 with similar affinity of approximately 4 nM. CXCL8, which binds to CXCR1 / 2, triggers a Gαi-dependent signaling pathway, inducing neutrophil migration, degranulation, and oxidative bursts, for example. Receptor sensitivity can be modulated by phosphorylation, beta-arrestin recruitment, and receptor internalization (Ha, Theranostics 2017). CXCL7 has the highest homology to CXCL8, having 33 identical amino acids.CXCL8 derived from non-human primates (rhesus macaques, cynomolgus macaques) shares 95% identity with human CXCL8 (73 out of 77 amino acids are identical). There are no orthologues of CXCL8 in mice or rats.

[0003] CXCL8 is secreted by various cell types, including monocytes, macrophages, fibroblasts, endothelial cells, and epithelial cells, in response to pathogen-associated molecular patterns (PAMP) molecules (e.g., LPS), pro-inflammatory mediators (e.g., IL-1, IL-6, and TNF-α), hypoxia, reactive oxygen species, or environmental stressors (e.g., cigarette smoke) (Ha, Theranostics 2017). CXCL8 functions as a chemotactic and activating cytokine in neutrophils and monocytes, playing a crucial physiological role in host defense.

[0004] CXCL8 is used as a biomarker for the diagnosis, disease status, prognosis, and therapeutic efficacy of infections accompanied by elevated CXCL8 levels, as described in viral infections (e.g., respiratory syncytial virus, herpes simplex virus, hepatitis viruses B and C, human cytomegalovirus), bacterial infections (e.g., Streptococcus pneumoniae and Mycobacterium tuberculosis), and fungal infections (e.g., Candida albicans and Aspergillus fumigatus). In pediatric respiratory syncytial virus (RSV) infection, CXCL8 plasma levels correlate with disease severity. Therefore, CXCL8 can function as a biomarker to assess the severity of RSV infection and guide clinical management. The accuracy of CXCL8 can be improved by combining it with other immunological biomarkers, namely lymphocyte count and CCL5 plasma levels (Brand, Pediatr Res 2013). Further examples of using CXCL8 as a biomarker for infection include neonatal sepsis (Zhou, PLoS One 2015), bacterial meningitis (Yao, Int J Clin Exp Med 2015), pneumonia (Morris, Thorax 2009), and neurosyphilis (Wang, Sci Rep 2016). CXCL8 can also be used as a biomarker for inflammatory diseases such as chronic prostatitis, acute pyelonephritis, cystic fibrosis, and various autoimmune diseases (Shahzad, Int Arch Med 2010). In cancer patients, CXCL8 levels have correlated with tumor burden and worsening outcomes (Sanmamed, Clin Cancer Res 2014). For example, CXCL8 has been associated with shorter survival times in breast cancer (Fang, Anticancer Res 2017), pancreatic cancer (Chen, World J Gastroenterol 2012), and pediatric sarcoma (Highfill, Sci Transl Med 2014).In melanoma, elevated baseline CXCL8 levels are associated with unresponsiveness to anti-CTLA4 / chemotherapy combination therapy and worse patient outcomes (Jamal, J Immunother Cancer 2017).

[0005] CXCL8 and its receptor are involved in the pathogenesis of several inflammatory diseases, including respiratory inflammatory diseases (e.g., chronic obstructive pulmonary disease, acute respiratory distress syndrome, asthma, cystic fibrosis, pulmonary fibrosis), skin inflammatory diseases (e.g., neutrophilic dermatosis, psoriasis, bullous pemphigoid), autoimmune diseases (e.g., inflammatory bowel disease, ulcerative colitis, multiple sclerosis, rheumatoid arthritis), inflammatory neurological diseases (e.g., Neurosweet's disease, Alzheimer's disease), ischemic diseases (e.g., stroke, myocardial infarction, cerebral ischemia and infarction), and other inflammatory diseases (e.g., atherosclerosis) (Ha, Theranostics 2017; Russo, Expert Rev Clin Immunol 2014). The potential of inhibiting CXCL8 for the treatment of such inflammatory diseases has been supported by animal disease models. For example, in rabbits, administration of anti-CXCL8 antibody improved LPS-induced dermatitis, LPS-induced pleurisy, LPS / IL-1-induced arthritis, IC-type glomerulonephritis, acute lung injury, and pulmonary reperfusion injury (Bao, Int Immunopharmacol 2010; Harada, J Leukoc Biol 1994). CXCR1 / 2 blockade reduced ischemic brain injury in a rat model (Garau, Cytokine 2005).

[0006] CXCL8 is involved in the development, progression, and treatment resistance of human cancers such as lung cancer, colorectal cancer, prostate cancer, pancreatic cancer, breast cancer, ovarian cancer, and melanoma, and promotes tumor growth and metastasis (Brat, Neuro Oncol 2005; Ha, Theranostics 2017; Koch, Science 1992; Li, Angiogenesis 2005; Liu, Cytokine Growth Factor Rev 2016; Xu, Oncol Res 2000). The mechanisms of cancer promotion by CXCL8 include stimulation of angiogenesis, self-renewal of cancer stem cells, epithelial-mesenchymal transition, and generation of an immunosuppressive tumor microenvironment (Ginestier, J Clin Invest 2010; Visvader, Nat Rev Cancer 2008; David, Vaccines 2016). The possibility of inhibiting CXCL8 for the treatment of human cancers is supported by animal disease models. For example, CXCL8 knockdown reduces the growth of chemotherapy-resistant ovarian cancer cells (Merritt, J Natl Cancer Inst 2008). In ovarian cancer and prostate cancer models, inhibition of CXCL8 enhances the anti-angiogenic response induced by docetaxel (Campbell, Pharmaceuticals 2013). Overexpression of CXCL8 in tumors with insufficient phosphatase and tensin homolog (PTEN) increases the survival rate of cancer cells and contributes to the development of treatment-resistant tumors (Campbell, Pharmaceuticals 2013; Maxwell, Eur Urol 2013; Maxwell, Oncotarget 2014). By inhibiting CXCL8 signaling, PTEN-deficient and p53-mutated cancer cells can be sensitized to DNA-damaging agents, antimetabolites, or androgen receptor-targeted strategies (Campbell, Pharmaceuticals 2013). Blockade of CXCR2 enhanced the effect of the immune checkpoint inhibitor anti-PD-1 in mouse models of rhabdomyosarcoma and pancreatic ductal adenocarcinoma (Highfill, Sci Transl Med 2014; Steele, Cancer Cell 2016).

[0007] Several compounds targeting CXCL8 or one or both of its respective receptors, CXCR1 and CXCR2, are known and have been successfully tested in in vivo models. Some of these have further tested in clinical trials. CXCR1 and / or CXCR2 antagonists, namely reparixin, radarixin, danilixin, nabarixin, SX-682, and AZD-5069, are being tested in clinical trials for islet transplantation, organ transplantation, type 1 diabetes, COPD, asthma, bronchiectasis, psoriasis, bullous pemphigoid, and cancer. The CXCR1 / 2 antagonist reparixin is undergoing further clinical trials in patients with metastatic triple-negative breast cancer. The CXCR2 antagonist AZD-5069 is being tested in combination with anti-PD-L1 durvalumab or chemotherapy in solid tumors.

[0008] ELR-positive chemokines share receptors CXCR1 and CXCR2, but have different expression patterns, in vivo distributions (extracellular matrix binding properties), and mechanisms of interaction with receptors (Feniger-Barish, Cytokine 1999; Sawant, Sci Rep 2016). The understanding of the physiological functions of each different ELR-positive chemokine family member has not been deepened. Therefore, the selective inhibition of diseases that promote CXCL8 may be more effective in disease treatment and may reduce the risk of side effects compared to the broad blockade of CXCR1 / CXCR2 blockade. For example, CXCL8, rather than CXCL1, is required for the maintenance of cancer stem cells (Liotti F et al., Stem Cells 2017; 35: 135-146). In infectious diseases, chemokines have overlapping activities. As a result, broad inhibition of ELR-positive chemokines (e.g., simultaneous inhibition of CXCL8 and CXCL1) may be associated with an increased risk of infection (Yung SC and Murphy PM; frontiers in Immunology, September 2012, vol. 3, Art. 276). CXCR1 / 2 ligands share a common N-terminal ELR motif that can function as a binding epitope (described in U.S. Patent No. 9,783,605). The presence of this common structural feature within CXCR1 / 2 ligands CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, CXCL7, and CXCL8 is a challenge when attempting to identify compounds that selectively bind to and inhibit CXCL8 without interfering with other ELR-positive chemokines.

[0009] Antibodies that bind to CXCL8 rather than ELR-positive chemokines, CXCL1 (growth regulatory protein alpha, also known as GRO-alpha) and CXCL2 (growth regulatory protein beta, also known as GRO-beta), have been identified (Skov, J Immunol 2008). CXCL8-specific monoclonal antibodies have so far failed to demonstrate efficacy in clinical trials that may relate to the pharmacological properties of this class of substances, such as pharmacokinetic profiles, biodistribution, and excretion. For example, high chemokine production rates may lead to rapid saturation of therapeutic antibodies and insufficient efficacy at the long dosing intervals commonly used. Furthermore, antibodies may not interfere with the binding of chemokines to glycosaminoglycans, resulting in a lack of chemokine gradient disruption and insufficient inhibition of leukocyte migration and extravasation. Nucleic acids preferably bind to the glycosaminoglycan binding site of proteins (Oberthur, Nat Commun 2015). Therefore, other classes of substances, such as nucleic acids, may be better suited for therapeutic targeting of CXCL8.

[0010] Nucleic acids are sensitive to degradation by enzymes (nucleases) present in bodily fluids. This lack of biostability hinders the manufacture of nucleic acid-based drugs for human treatment, as well as nucleic acid-based diagnostics for disease identification and / or treatment. Chemical modifications can enhance the stability of nucleic acids, but may not be sufficient to provide adequate stability for pharmaceutical use. For example, nucleic acids containing 2'-fluoropyrimidines exhibited plasma half-lives comparable to those of all DNA nucleic acids, and 2'-O-methyl modification was required to achieve a longer half-life (Kratschmer, Nucleic Acid Ther 2017). Macidien, the first aptamer approved for therapeutic use, is stabilized by a combination of 2'-fluoropyrimidine, 2'-O-methylpurine, and 3'-cap. Furthermore, chemical modifications, when used in the manufacture of pharmaceuticals, can lead to an increased risk of side effects. In contrast, non-natural L-configured nucleic acids have been shown to be highly biostable, safe, well-tolerated, and effective in clinical trials (Ludwig, Leukemia 2017; Menne, Nephrol Dial Transplant 2016).

[0011] CXCL8-binding 2'-fluoropyrimidine RNA aptamers have been previously described (Sung, Biomaterials 2014). However, in functional assays, the high binding affinity of aptamer 8A-35, one of the described aptamers, did not translate to improved function in inhibiting CXCL8-induced neutrophil migration when the IC50 was greater than 125 nM. Semi-quantitative analysis suggested little to no binding of the precursor aptamer to the ELR-positive chemokines CXCL1 (also known as GRO-alpha) and CXCL2 (also known as GRO-beta).

[0012] The fundamental problem of the present invention is to provide a nucleic acid molecule, preferably L-nucleic acid, that specifically interacts with CXCL8, preferably does not specifically interact with other ELR-positive chemokines, and more preferably does not specifically interact with ELR-positive chemokines that bind to receptors CXCR1 and / or CXCR2.

[0013] Another problem underlying the present invention is to provide a nucleic acid molecule, preferably an L-nucleic acid molecule, which can bind to CXCL8 with high affinity, thereby effectively inhibiting CXCL8-stimulated chemotaxis with an inhibition constant preferably in the nanomolar range, more preferably in the picomolar range.

[0014] A further problem underlying the present invention is to provide nucleic acid molecules, preferably L-nucleic acid molecules, for the manufacture of pharmaceuticals for the treatment of human and / or non-human diseases, wherein the disease is characterized in that CXCL8 is directly or indirectly involved in the pathogenesis of such disease to the extent that antagonizing or inhibiting at least CXCL8 results in a therapeutic effect.

[0015] A further problem underlying the present invention is to provide nucleic acid molecules, preferably L-nucleic acid molecules, for producing diagnostic agents for the identification, diagnosis, and / or treatment of a disease, characterized in that CXCL8 is directly or indirectly involved in the pathogenesis of such a disease.

[0016] These and other problems underlying the present invention are resolved by the subject matter of the appended independent claims. Preferred embodiments can be derived from the dependent claims.

[0017] More specifically, the problem underlying the present invention is solved in a first embodiment by an L-nucleic acid molecule that can bind to human CXCL8, where the L-nucleic acid molecule comprises a central stretch of nucleotides, and the central stretch of nucleotides is a nucleotide sequence 5'-GGAAGUACGUGGAAAGCCRA(X U )RAGUGUGUCCCG-3'[SEQ ID NO: 27], where X U It is either U or does not exist.

[0018] More specifically, the underlying problem of the present invention is solved by the L-nucleic acid molecule of the first embodiment, including, in a second embodiment, any embodiment thereof for use in a method for treating and / or preventing a disease.

[0019] More specifically, the underlying problem of the present invention is solved by the L-nucleic acid molecule of the first embodiment, including, in a third embodiment, any embodiment thereof for use in a method for detecting CXCL8.

[0020] More specifically, the underlying problem of the present invention is solved by an L-nucleic acid molecule of the first embodiment, such as in a fourth embodiment for manufacturing a detection means or biosensor.

[0021] More specifically, the underlying problem of the present invention is solved in a fifth embodiment, by a pharmaceutical composition comprising an L-nucleic acid molecule according to the first embodiment, and optionally more further components, the further components being selected from the group comprising pharmaceutically acceptable excipients, pharmaceutically acceptable carriers, and pharmaceutically active agents.

[0022] More specifically, the underlying problem of the present invention is solved by the use of L-nucleic acid molecules according to the first embodiment, including, in any embodiment thereof, for the manufacture of pharmaceuticals, in the sixth embodiment.

[0023] More specifically, the underlying problem of the present invention is solved by the use of an L-nucleic acid molecule according to the first embodiment, such as in any embodiment thereof, for manufacturing a diagnostic agent, a diagnostic means, or a biosensor, as described in the seventh embodiment.

[0024] More specifically, the problem underlying the present invention is solved by the use of an L-nucleic acid molecule according to the first embodiment, such as in the eighth embodiment, for detecting CXCL8, preferably human CXCL8, or any embodiment thereof.

[0025] More specifically, the problem underlying the present invention is solved in the ninth embodiment by a kit for detecting CXCL8, the kit comprising, in any embodiment thereof, an L nucleic acid molecule according to the first embodiment, and at least an instruction leaflet or reaction vessel.

[0026] More specifically, the problem underlying the present invention is solved in a tenth aspect by a method for detecting CXCL8 using L-nucleic acid in a sample, as defined according to the first aspect, including any embodiment thereof, the method comprising the following steps: a) A step of providing a sample containing an unknown concentration of CXCL8, b) The step of bringing the sample or a dilution thereof into contact with a diagnostic agent, diagnostic means, or biosensor as defined in the seventh aspect, such as any embodiment thereof; c) The step of measuring a signal using a diagnostic agent, diagnostic means, or biosensor as defined in the seventh aspect, such as any embodiment thereof, d) optionally includes the step of comparing the signal to a reference, Optionally, the concentration of CXCL8 in a sample having an unknown CXCL8 concentration is determined by comparing it with a signal obtained from at least one sample having a known CXCL8 concentration, preferably the at least one sample having a known CXCL8 concentration, which follows steps b) to c).

[0027] More specifically, the underlying problem of the present invention is solved in the eleventh embodiment, by a complex comprising an L-nucleic acid molecule according to the first embodiment and CXCL8, preferably a crystalline complex.

[0028] More specifically, the underlying problem of the present invention is, in the twelfth embodiment, - A step of providing candidate antagonists for activity mediated by CXCL8, - The step of providing an L-nucleic acid molecule according to the first aspect, such as any embodiment thereof, - A step of providing a test system that provides a signal in the presence of an antagonist of activity mediated by CXCL8, - This is solved by a method for screening antagonists of CXCL8-mediated activity, which includes the step of determining whether a candidate antagonist of CXCL8-mediated activity is an antagonist of CXCL8-mediated activity.

[0029] More specifically, the underlying problem of the present invention is solved in the thirteenth embodiment by a method for detecting L-nucleic acid molecules in a sample according to the first embodiment, including any of its embodiments, the method being a) Providing a capture probe and a detection probe, wherein the capture probe is at least partially complementary to a first portion of an L-nucleotide molecule according to a first embodiment, such as in any embodiment thereof, and the detection probe is at least partially complementary to a second portion of an L-nucleotide molecule according to a first embodiment, such as in any embodiment thereof, or the capture probe is at least partially complementary to a second portion of an L-nucleotide molecule according to a first embodiment, such as in any embodiment thereof, and the detection probe is at least partially complementary to a first portion of an L-nucleotide molecule according to a first embodiment, such as in any embodiment thereof. b) Adding a capture probe and a detection probe separately or in combination to a sample containing an L-nucleic acid molecule according to the first embodiment, such as any embodiment thereof, or a sample presumed to contain an L-nucleic acid molecule according to the first embodiment, such as any embodiment thereof; c) A step that enables the capture probe and the detection probe to react simultaneously with or in any order with L-nucleic acid molecules according to the first embodiment, such as any embodiment thereof, d) optionally, a step of detecting whether the capture probe hybridizes to an L-nucleic acid molecule, according to a first aspect, such as any embodiment provided in step a), e) the step of detecting the complex formed in step c), which comprises an L-nucleic acid molecule according to the first embodiment, such as any embodiment thereof, and a capture probe and a detection probe.

[0030] The present invention can also be solved more specifically by the following embodiments 1 to 103, thereby, Embodiment 1 corresponds to the first embodiment, Embodiment 47 corresponds to the second embodiment, Embodiment 49 corresponds to the third embodiment, Embodiment 50 corresponds to the fourth embodiment, Embodiment 51 corresponds to the fifth embodiment, Embodiment 53 corresponds to the sixth embodiment, Embodiment 56 corresponds to the seventh embodiment, Embodiment 79 corresponds to the eighth embodiment, Embodiment 96 corresponds to the ninth embodiment, Embodiment 97 corresponds to the tenth embodiment, Embodiment 98 corresponds to the eleventh embodiment, Embodiment 99 corresponds to the twelfth embodiment, and Embodiment 100 corresponds to the thirteenth embodiment. Embodiment 1:

[0031] An L-nucleic acid molecule capable of binding to human CXCL8, wherein the L-nucleic acid molecule includes a central stretch of nucleotides, and the central stretch of nucleotides is a nucleotide sequence. 5'-GGAAGUACGUGGAAAGCCRA(X U )RAGUGUGUCCCG-3'[SEQ ID NO: 27], where X U It is either U or does not exist. Embodiment 2: The central stretch of the nucleotide is

[0032] a) 5'GGAAGUACGUGGAAAGCCAAUGAGUGUGUCCCG3'[Sequence No. 28] b) 5'GGAAGUACGUGGAAAGCCGAUGAGUGUGUCCCG3'[SEQ ID NO. 29], and c) An L-nucleic acid molecule according to Embodiment 1, comprising a nucleotide sequence selected from the group 5'GGAAGUACGUGGAAAGCCGAAAGUGUGUCCCG 3'[SEQ ID NO: 30]. Embodiment 3:

[0033] The central stretch of the nucleotide is the nucleotide sequence An L-nucleic acid molecule according to Embodiment 2, comprising 5'GGAAGUACGUGGAAAGCCGAAAGUGUGUCCCG 3'[SEQ ID NO: 30] or 5'GGAAGUACGUGGAAAGCCAAUGAGUGUGUCCCG3'[SEQ ID NO: 28], preferably 5'GGAAGUACGUGGAAAGCCGAAAGUGUGUCCCG3'[SEQ ID NO: 30]. Embodiment 4:

[0034] The L-nucleic acid molecule is an L-nucleic acid molecule according to any one of Embodiments 1 to 3, comprising a first terminal stretch of the nucleotide, a central stretch of the nucleotide, and a second terminal stretch of the nucleotide in the 5'->3' direction, The first terminal stretch of a nucleotide contains 3 to 6 nucleotides. The second terminal stretch of a nucleotide contains 3 to 6 nucleotides. Preferably, The first terminal stretch of a nucleotide contains 5-6 nucleotides. The second terminal stretch of a nucleotide contains 5-6 nucleotides. more, The first terminal stretch of the nucleotide contains 5 nucleotides. The second terminal stretch of the nucleotide contains 5 nucleotides. Embodiment 5:

[0035] The first terminal stretch of the nucleotide contains the nucleotide sequence 5'Z1Z2Z3Z4Z5C3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GZ6Z7Z8Z9Z'. 10 An L nucleic acid molecule according to Embodiment 4, comprising 3', Here, Z1 is G or does not exist, Z2 is S or does not exist, Z3 is K or does not exist, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M or does not exist, Z9 is S or does not exist, Z 10 is C or does not exist; Preferably, a) Z1 is G, Z2 is S, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 is S, Z 10 is C, or b) Z1 does not exist, Z2 is S, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 is S, Z 10 does not exist, or c) Z1 does not exist, Z2 does not exist, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 does not exist, Z 10 does not exist, or d) Z1 does not exist, Z2 does not exist, Z3 does not exist, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 does not exist, Z9 does not exist, Z 10 does not exist, or e) Z1 does not exist, Z2 is S, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 is S, Z 10 is C, or f) Z1 does not exist, Z2 does not exist, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 is S, Z 10 is C, or g) Z1 does not exist, Z2 does not exist, Z3 does not exist, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 is S, Z 10 is C, or h) Z1 is G, Z2 is S, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 is S, Z 10 It does not exist, or i) Z1 is G, Z2 is S, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 does not exist, Z 10 It does not exist, or j) Z1 is G, Z2 is S, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 does not exist, Z9 does not exist, Z 10 It does not exist, or k) Z1 does not exist, Z2 is S, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 does not exist, Z 10 It does not exist, or l) Z1 does not exist, Z2 is S, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 does not exist, Z9 does not exist, Z 10 It does not exist, or m) Z1 does not exist, Z2 does not exist, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 is S, Z 10 It does not exist, or n) Z1 does not exist, Z2 does not exist, Z3 does not exist, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 is S, Z 10 It does not exist, or o) Z1 does not exist, Z2 does not exist, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 does not exist, Z9 does not exist, Z 10 It does not exist, or p) Z1 does not exist, Z2 does not exist, Z3 does not exist, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 does not exist, Z 10 It does not exist. Embodiment 6: An L-nucleic acid molecule according to any one of Embodiments 4 to 5,

[0036] a) The first terminal stretch of the nucleotide contains the nucleotide sequence 5'CUGAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUCAG3', b) The first terminal stretch of the nucleotide contains the nucleotide sequence 5'GCUGAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUCAGC3', c) The first terminal stretch of the nucleotide contains the nucleotide sequence 5'GCUGAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUGAGC3', d) The first terminal stretch of the nucleotide contains the nucleotide sequence 5'GUGAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUCAC3', e) The first terminal stretch of the nucleotide contains the nucleotide sequence 5'UGAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUCA3', f) The first terminal stretch of the nucleotide contains the nucleotide sequence 5'GGAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUCC3', g) The first terminal stretch of the nucleotide contains the nucleotide sequence 5'GCAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUGC3', h) The first terminal stretch of the nucleotide contains the nucleotide sequence 5'GGUC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GACC3', i) The first terminal stretch of the nucleotide contains the nucleotide sequence 5'UGGC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GCCA3', j) The first terminal stretch of the nucleotide contains the nucleotide sequence 5'GAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUC3', Preferably, The first terminal stretch of the nucleotide contains the nucleotide sequence 5'CUGAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUCAG3', or The first terminal stretch of the nucleotide contains the nucleotide sequence 5'GCUGAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUCAGC3', or The first terminal stretch of the nucleotide contains the nucleotide sequence 5'GUGAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUCAC3', more, The first terminal stretch of the nucleotide contains the nucleotide sequence 5'CUGAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUCAG3', or The first terminal stretch of the nucleotide contains the nucleotide sequence 5'GUGAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUCAC3'. Embodiment 7:

[0037] An L-nucleic acid molecule according to any one of Embodiments 1 to 6, wherein the L-nucleic acid molecule comprises 40 to 45 nucleotides, preferably 42 to 45 nucleotides, and more preferably 42 nucleotides. Embodiment 8:

[0038] An L-nucleic acid molecule according to any one of embodiments 1 to 7, wherein the L-nucleic acid molecule consists of ribonucleotides. Embodiment 9:

[0039] An L-nucleic acid molecule according to any one of Embodiments 1 to 8, wherein the L-nucleic acid molecule contains a nucleotide sequence selected from the group of SEQ ID NOs: 14-26, 39-44, or the L-nucleic acid molecule contains an L-nucleic acid molecule having at least 75% identity with an L-nucleic acid molecule containing a nucleotide sequence selected from the group of SEQ ID NOs: 14-26, 39-44, or the L-nucleic acid molecule contains an L-nucleic acid molecule homologous to an L-nucleic acid molecule containing a nucleotide sequence selected from the group of SEQ ID NOs: 14-26, 39-44, wherein the homology is at least 75%. Embodiment 10:

[0040] The L-nucleic acid molecule of Embodiment 9 comprises a nucleotide sequence selected from the group of SEQ ID NOs: 16, 17, 25, 26, 39, 40, 20, and 41-44, or comprises an L-nucleic acid molecule having at least 75% identity with an L-nucleic acid molecule comprising a nucleotide sequence selected from the group of SEQ ID NOs: 16, 17, 25, 26, 39, 40, 20, and 41-44, or comprises an L-nucleic acid molecule homologous to an L-nucleic acid molecule comprising a nucleotide sequence selected from the group of SEQ ID NOs: 16, 17, 25, 26, 39, 40, 20, and 41-44, wherein the homology is at least 75%. Embodiment 11:

[0041] The L-nucleic acid molecule according to any one of Embodiments 1 to 10, wherein the L-nucleic acid molecule has the ability to bind to CXCL8, preferably CXCL8 being human CXCL8, monkey CXCL8, rabbit CXCL8, pig CXCL8, dog CXCL8, sheep CXCL8, or guinea pig CXCL8. Embodiment 12:

[0042] The L-nucleic acid molecule according to any one of Embodiments 1 to 11, wherein the L-nucleic acid molecule has the ability to specifically bind to CXCL8, and is preferably human CXCL8, monkey CXCL8, rabbit CXCL8, pig CXCL8, dog CXCL8, sheep CXCL8, or guinea pig CXCL8, and more preferably human CXCL8. Embodiment 13:

[0043] An L-nucleic acid molecule according to any one of Embodiments 1 to 12, wherein the L-nucleic acid molecule does not bind to or is unable to bind to an ELR-positive CXC chemokine different from CXCL8, and the ELR-positive CXC chemokine different from CXCL8 is preferably selected from the group consisting of CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, and CXCL7. Embodiment 14:

[0044] The L-nucleic acid molecule of Embodiment 13 is characterized in that the L-nucleic acid molecule does not bind to or is unable to bind to an ELR-positive human CXC chemokine different from human CXCL8, and the ELR-positive human CXC chemokine different from human CXCL8 is preferably selected from the group consisting of human CXCL1, human CXCL2, human CXCL3, human CXCL5, human CXCL6, and human CXCL7. Embodiment 15:

[0045] An L-nucleic acid molecule according to any one of Embodiments 1 to 14, wherein the L-nucleic acid molecule has a binding affinity for human CXCL8, represented as KD, with a concentration of 10 nM or less, preferably 1 nM or less, more preferably 100 pM or less, and most preferably 30 pM or less. Embodiment 16:

[0046] An L-nucleic acid molecule according to any one of Embodiments 1 to 15, wherein the L-nucleic acid molecule has a binding affinity expressed as IC50 of 10 nM or less, preferably 1 nM or less, more preferably 100 pM or less, and most preferably 30 pM or less, for human CXCL8. Embodiment 17:

[0047] An L-nucleic acid molecule according to any one of Embodiments 1 to 16, wherein the L-nucleic acid molecule has a binding affinity expressed as KD of 100 nM or more, preferably 500 nM or more, and more preferably 1000 nM or more, for an ELR-positive CXC chemokine different from CXCL8. Embodiment 18:

[0048] An L-nucleic acid molecule according to any one of Embodiments 1 to 17, wherein the L-nucleic acid molecule has a binding affinity expressed as IC50 of 100 nM or more, preferably 500 nM or more, and more preferably 1000 nM or more, for an ELR-positive CXC chemokine different from CXCL8. Embodiment 19:

[0049] An L-nucleic acid molecule according to any one of Embodiments 1 to 18, wherein the L-nucleic acid molecule has a binding affinity represented as KD of 10 nM or less, preferably 1 nM or less, more preferably 100 pM or less, and most preferably 30 pM or less to human CXCL8, and the L-nucleic acid molecule has a binding affinity represented as KD of 100 nM or more, preferably 500 nM or more, and more preferably 1000 nM or more to an ELR-positive CXC chemokine different from CXCL8. and / or The L-nucleic acid molecule has a binding affinity to human CXCL8, expressed as an IC50 of 10 nM or less, preferably 1 nM or less, more preferably 100 pM or less, and most preferably 30 pM or less. The L-nucleic acid molecule also has a binding affinity to ELR-positive CXC chemokines different from CXCL8, expressed as an IC50 of 100 nM or more, preferably 500 nM or more, and more preferably 1000 nM or more. Embodiment 20:

[0050] An L-nucleic acid molecule according to any one of embodiments 15 to 19, wherein the binding affinity is determined at room temperature, preferably at 25°C. Embodiment 21:

[0051] An L-nucleic acid molecule according to any one of embodiments 15 to 19, wherein the binding affinity is determined at 37°C. Embodiment 22:

[0052] The L-nucleic acid molecule according to any one of Embodiments 1 to 21, wherein the L-nucleic acid molecule is an antagonist of activity mediated by CXCL8, preferably human CXCL8, monkey CXCL8, rabbit CXCL8, pig CXCL8, dog CXCL8, sheep CXCL8, or guinea pig CXCL8, more preferably human CXCL8. Embodiment 23:

[0053] The L-nucleic acid molecule described in Embodiment 22 is either not an antagonist of an ELR-positive human CXC chemokine different from human CXCL8, or is unable to antagonize the activity mediated by an ELR-positive CXC chemokine different from CXCL8, and the ELR-positive CXC chemokine different from CXCL8 is preferably selected from the group consisting of CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, and CXCL7. Embodiment 24:

[0054] The L-nucleic acid molecule of Embodiment 23 is either not an antagonist of an ELR-positive human CXC chemokine different from human CXCL8, or is unable to antagonize the activity mediated by an ELR-positive human CXC chemokine different from human CXCL8, and the ELR-positive human CXC chemokine different from human CXCL8 is preferably selected from the group consisting of human CXCL1, human CXCL2, human CXCL3, human CXCL5, human CXCL6, and human CXCL7. Embodiment 25:

[0055] An L-nucleic acid molecule according to any one of Embodiments 22 to 24, wherein the antagonistic activity of the L-nucleic acid molecule to human CXCR1 and / or CXCR2-mediated activity, as expressed as IC50, is 10 nM or less, preferably 1 nM or less, more preferably 100 pM or less, and most preferably 30 pM or less. Embodiment 26:

[0056] The L-nucleic acid molecule according to any one of embodiments 22 to 25, wherein the antagonistic activity of the L-nucleic acid molecule against human CXCL8-mediated activity is determined at 37°C. Embodiment 27:

[0057] An L-nucleic acid molecule according to any one of Embodiments 1 to 26, wherein the L-nucleic acid molecule includes a modifying group. Embodiment 28:

[0058] The L-nucleic acid molecule according to Embodiment 27, wherein the modifying group is ligated to the 5' terminal nucleotide and / or the 3' terminal nucleotide of the L-nucleic acid molecule, and / or to the nucleotide of the L-nucleic acid molecule between the 5' terminal nucleotide and the 3' terminal nucleotide of the L-nucleic acid molecule. Embodiment 29:

[0059] An L-nucleic acid molecule according to Embodiment 27 or 28, wherein the modifying group is linked to the L-nucleic acid molecule via a linker. Embodiment 30:

[0060] The L-nucleic acid molecule of Embodiment 29 is characterized by a linker that is a hydrophilic linker, preferably comprising one or more units of ethylene glycol, and more preferably comprising triethylene glycol, hexaethylene glycol, or polyethylene glycol. Embodiment 31:

[0061] The L-nucleic acid molecule of Embodiment 29 is characterized by a biodegradable linker. Embodiment 32:

[0062] An L-nucleic acid molecule according to any one of embodiments 27 to 31, wherein the excretion rate of the L-nucleic acid molecule containing a modifying group from an organism is reduced compared to the excretion rate of the L-nucleic acid molecule without a modifying group. Embodiment 33:

[0063] An L-nucleic acid molecule according to any one of embodiments 27 to 31, wherein the L-nucleic acid molecule containing a modifying group has an extended retention time in organisms compared to the retention time in organisms of an L-nucleic acid molecule without a modifying group. Embodiment 34:

[0064] The L-nucleic acid molecule according to Embodiment 32 or 33, wherein the organism is a human or animal body, preferably a human body. Embodiment 35:

[0065] An L-nucleic acid molecule according to any one of Embodiments 27 to 34, wherein the modifying group is selected from the group comprising biodegradable modifications and non-biodegradable modifications, and preferably the modifying group is selected from the group comprising polyethylene glycol, linear polyethylene glycol, branched polyethylene glycol, hydroxyethyl starch, peptides, proteins, polysaccharides, sterols, polyoxypropylene, polyoxyamide, and poly(2-hydroxyethyl)-L-glutamine. Embodiment 36:

[0066] The L-nucleic acid molecule described in Embodiment 35, wherein the modifying group is polyethylene glycol, preferably linear polyethylene glycol or branched polyethylene glycol, and preferably the molecular weight of the polyethylene glycol is about 20,000 to about 120,000 Da, more preferably about 30,000 to about 80,000 Da, and most preferably about 40,000 Da. Embodiment 37:

[0067] The L-nucleic acid molecule described in Embodiment 36 has a molecular weight of polyethylene glycol of about 20,000 to about 120,000 Da, preferably about 30,000 to about 80,000 Da, and more preferably about 40,000 Da. Embodiment 38:

[0068] The L-nucleic acid molecule described in Embodiment 35 is wherein the modifying group is hydroxyethyl starch, preferably with a molecular weight of about 50 to about 1000 kDa, more preferably about 100 to about 700 kDa, and most preferably about 200 to about 500 kDa. Embodiment 39:

[0069] An L-nucleic acid molecule according to any one of embodiments 27 to 31, wherein the modifying group is for immobilizing the L-nucleic acid molecule. Embodiment 40:

[0070] The L-nucleic acid molecule according to Embodiment 39, wherein immobilization includes covalent linking of the L-nucleic acid molecule to a surface, preferably the surface being the surface of a reaction vessel, the surface of a device in a reaction vessel, or the surface of a biosensor. Embodiment 41:

[0071] The L-nucleic acid molecule according to Embodiment 39, wherein immobilization includes linking of the L-nucleic acid molecule to a surface by non-covalent bonds, and preferably the surface is the surface of a reaction vessel, the surface of a device in a reaction vessel, or the surface of a biosensor. Embodiment 42:

[0072] An L-nucleic acid molecule according to any one of Embodiments 39 to 41, wherein the modifying group is selected from the group comprising carboxyl, hydroxyl, phosphatidyl, sulfonic acid ester, amine, thiol, epoxide, alkyne, strained cycloalkyne, maleimide, azide, and hydrazide, and preferably the strained cycloalkyne is selected from the group comprising dibenzocyclooctyl (DBCO), bicyclo[6.1.0]non-4-yne (BCN), and azadibenzocyclooctin (ADIBO). Embodiment 43:

[0073] The L-nucleic acid molecule according to Embodiment 42, wherein the modifying group is a strained cycloalkyne, preferably dibenzocyclooctyl (DBCO). Embodiment 44:

[0074] The L-nucleic acid molecule according to Embodiment 41, wherein the modifying group is biotin, bromodeoxyuridine, digoxigenin, or an oligonucleotide, and preferably the modifying group is biotin. Embodiment 45:

[0075] An L-nucleic acid molecule according to any one of embodiments 27 to 31, wherein the L-nucleic acid molecule can be detected by a modifying group, and preferably the modifying group is a label. Embodiment 46:

[0076] An L-nucleic acid molecule according to Embodiment 45, wherein the label is selected from the group including biotin, bromodeoxyuridine, digoxigenin, oligonucleotide, fluorescent label, electrochemiluminescence label, radioactive label, enzyme label, UV label, gold colloid, nanoparticle, and chelator molecule label. Embodiment 47:

[0077] An L-nucleic acid molecule according to any one of Embodiments 1 to 46, for use in a method for treating and / or preventing a disease. Embodiment 48:

[0078] An L-nucleic acid molecule for use according to Embodiment 47, wherein the disease is related to a CXCL8-mediated pathogenicity mechanism and / or is selected from the group including inflammatory diseases and cancer, preferably the inflammatory disease being respiratory inflammatory disease, inflammatory skin disease, autoimmune disease, inflammatory neurological disease, ischemic disease, arthritis, islet transplant rejection, organ transplant rejection, organ delayed function, spinal cord injury, or cystitis. Embodiment 49:

[0079] An L-nucleic acid molecule according to any one of embodiments 1 to 47, for use in a method for detecting CXCL8. Embodiment 50:

[0080] An L-nucleic acid molecule according to any one of embodiments 1 to 47 for manufacturing a detection means or biosensor. Embodiment 51:

[0081] A pharmaceutical composition comprising an L-nucleic acid molecule as defined in any one of Embodiments 1 to 50, and optionally further components, wherein the further components are selected from pharmaceutically acceptable excipients, pharmaceutically acceptable carriers, and pharmaceutically active agents. Embodiment 52:

[0082] The pharmaceutical composition according to Embodiment 51, wherein the pharmaceutical composition comprises an L-nucleic acid molecule as defined in any one of Embodiments 1 to 50 and a pharmaceutically acceptable carrier. Embodiment 53:

[0083] Use of an L-nucleic acid molecule according to any one of Embodiments 1 to 50 for the manufacture of a pharmaceutical product. Embodiment 54:

[0084] The use according to Embodiment 53, wherein the pharmaceutical product is intended for use in human medicine or veterinary medicine. Embodiment 55:

[0085] The use according to Embodiment 54, wherein the pharmaceutical product is for the treatment and / or prevention of a disease selected from the group including inflammatory diseases and cancer, which is related to a CXCL8-mediated pathogenicity mechanism, and / or the inflammatory disease is preferably a respiratory inflammatory disease, a skin inflammatory disease, an autoimmune disease, an inflammatory neurological disease, an ischemic disease, arthritis, islet transplant rejection, organ transplant rejection, organ delayed function, spinal cord injury, or cystitis. Embodiment 56:

[0086] Use of an L-nucleic acid molecule according to any one of Embodiments 1 to 50 for manufacturing a diagnostic agent, a diagnostic means, or a biosensor. Embodiment 57:

[0087] The use according to Embodiment 56, wherein the diagnostic agent or diagnostic means has a surface on the reaction vessel or a surface on a device inside the reaction vessel. Embodiment 58:

[0088] The use according to embodiment 56, wherein the biosensor has a surface. Embodiment 59:

[0089] The use according to any one of embodiments 56 to 58, wherein the diagnostic agent, diagnostic means, or biosensor is suitable for directly or indirectly detecting CXCL8, preferably human CXCL8. Embodiment 60:

[0090] The use according to embodiment 56 or 57, wherein CXCL8 is detected by direct binding in a sandwich binding assay or a competitive binding assay. Embodiment 61:

[0091] The use according to Embodiment 60, which includes a detection method in which direct binding uses only the L-nucleic acid molecule described in any one of Embodiments 1 to 50 and does not use, or does not involve using, a second molecule different from the L-nucleic acid molecule described in any one of Embodiments 1 to 50 that interacts with CXCL8. Embodiment 62:

[0092] The sandwich assay is the use according to Embodiment 60, wherein an L-nucleic acid molecule according to any one of Embodiments 1 to 50 is immobilized on a surface, and the complex of the L-nucleic acid molecule and CXCL8 according to any one of Embodiments 1 to 50 is detected by a detection means that binds to a different CXCL8 epitope(s) than the one(s) bound by the L-nucleic acid molecule according to any one of Embodiments 1 to 50. Embodiment 63:

[0093] The use described in Embodiment 60, wherein the sandwich assay is a sandwich hybridization assay, wherein means for binding to an epitope(s) of CXCL8 different from those bound by any one of the L-nucleic acid molecules described in any one of Embodiments 1 to 50 are immobilized on a surface, and the complex of such means with CXCL8 is detected by an L-nucleic acid molecule described in any one of Embodiments 1 to 50. Embodiment 64:

[0094] The use according to Embodiment 60, in a competitive binding assay, an L-nucleic acid molecule according to any one of Embodiments 1 to 50 is immobilized on a surface, and the binding of the L-nucleic acid molecule according to any one of Embodiments 1 to 50 to CXCL8 is competed for by an oligonucleotide probe at least partially complementary to the L-nucleic acid molecule according to any one of Embodiments 1 to 50, or by CXCL8, preferably the complementarity is base complementarity based on Watson-Crick base pairing. Embodiment 65:

[0095] In a competitive binding assay, the L-nucleic acid molecule described in any one of Embodiments 1 to 50 is not immobilized on the surface, and the binding of the L-nucleic acid molecule described in any one of Embodiments 1 to 50 to CXCL8 is competed for by an oligonucleotide probe complementary to the L-nucleic acid molecule described in any one of Embodiments 1 to 50, or by CXCL8, preferably the L-nucleic acid molecule described in any one of Embodiments 1 to 50 or an oligonucleotide probe complementary to CXCL8 is immobilized on the surface, preferably the complementarity is base complementarity, more preferably based on Watson-Crick base pairing, as described in Embodiment 60. Embodiment 66:

[0096] The use according to any one of embodiments 62 to 65, wherein the L-nucleic acid molecule described in any one of embodiments 39 to 44 is used for immobilization on a surface. Embodiment 67:

[0097] The use according to any one of embodiments 57 to 66, wherein the surface, preferably the surface of the biosensor, is selected from the group consisting of gold, silver, titanium, zirconium, vanadium, chromium, manganese, cobalt, tungsten, molybdenum, platinum, aluminum, iron, steel, copper, nickel, silicon, germanium, indium phosphide, gallium arsenide, and oxides, nitrides or alloys or mixtures thereof, indium tin oxide, glassy carbon, sapphire, silicate glass and borate glass. Embodiment 68:

[0098] The use according to any one of Embodiments 57 to 67, wherein the surface, preferably the surface of the biosensor, is modified with polylysine, aminosilane, epoxysilane, nitrocellulose, carboxydextran, carbon nanomembrane, graphene oxide, carbon surface, for example, carbon black, carbon fiber, carbon plate, carbon cloth, activated carbon, glassy carbon, charcoal, activated carbon, graphite powder, graphite fiber, carbon nanotube, fullerene, carboxyl group, azide group, thiol group, hydroxyl group, epoxide, maleimide, alkyne, strained alkyne, or any combination thereof. Embodiment 69:

[0099] For the immobilization of an L-nucleic acid molecule as described in any one of Embodiments 39 to 44, the surface is functionalized with a primary amine, a thiol group, an azide, an alkyne, an alkene, a tetrazine, a tetrazole, or a strained cycloalkyne, preferably the strained cycloalkyne is selected from the group including dibenzocyclooctyl (DBCO), bicyclo[6.1.0]non-4-yne (BCN), or azadibenzocyclooctin (ADIBO), as described in Embodiment 68. Embodiment 70:

[0100] The use according to Embodiment 69, in which strain-accelerated azide-alkyne cycloaddition is used for immobilizing the L-nucleic acid molecule according to Embodiment 42 or 43. Embodiment 71:

[0101] The use according to any one of embodiments 56 to 70, wherein the L-nucleic acid molecule described in any one of embodiments 44 to 46 is used for detection. Embodiment 72:

[0102] The use of the biosensor detection system according to any one of embodiments 56 to 71, based on optical readout, mass change, refractive index, charge, surface stress, and atomic force microscopy. Embodiment 73:

[0103] The use of the biosensor according to Embodiment 72, wherein the detection system of the biosensor based on optical readout is fluorescence, absorption, or emission. Embodiment 74:

[0104] The use according to Embodiment 72, wherein the detection system for the biosensor based on mass change is a quartz crystal microbalance or a micro-electromechanical system. Embodiment 75:

[0105] The use according to Embodiment 72, wherein the detection system of the biosensor based on the refractive index is surface plasmon resonance, a ring resonator, or ellipsometry. Embodiment 76:

[0106] The use of the charge-based biosensor detection system according to Embodiment 72, wherein the detection system is electrochemical impedance, voltammetry, amperometry, potentiometry, conductivity, or a field-effect transistor. Embodiment 77:

[0107] The use according to Embodiment 72, wherein the surface stress-based biosensor detection system is a cantilever biosensor. Embodiment 78:

[0108] The use according to any one of embodiments 56 to 59, wherein CXCL8 is detected by a homogeneous assay setting. Embodiment 79:

[0109] Use of an L-nucleic acid molecule according to any one of Embodiments 1 to 50 for detecting CXCL8, preferably human CXCL8. Embodiment 80:

[0110] The use according to Embodiment 79, wherein CXCL8 is detected in a sandwich-binding assay setting, a homogeneous assay setting, or a competitive assay setting. Embodiment 81:

[0111] The use according to Embodiment 80, wherein a sandwich-binding assay setting, a homogeneous assay setting, or a competitive assay setting is suitable for directly or indirectly detecting CXCL8. Embodiment 82:

[0112] The use according to any one of embodiments 78 to 81, wherein the L-nucleic acid molecule is immobilized by covalent bond to the surface of the reaction vessel of the diagnostic agent, the surface of a device inside the reaction vessel of the diagnostic agent, or the surface of a biosensor. Embodiment 83:

[0113] The use according to Embodiment 82, wherein an L-nucleic acid molecule described in any one of Embodiments 39 to 44 is used for immobilization. Embodiment 84:

[0114] The use according to Embodiment 82 or 83, wherein the surface, preferably the surface of the biosensor, is selected from the group consisting of gold, silver, titanium, zirconium, vanadium, chromium, manganese, cobalt, tungsten, molybdenum, platinum, aluminum, iron, steel, copper, nickel, silicon, germanium, indium phosphide, gallium arsenide, and oxides, nitrides or alloys or mixtures thereof, indium tin oxide, glassy carbon, sapphire, silicate glass and borate glass. Embodiment 85:

[0115] The use according to any one of Embodiments 82 to 84, wherein the surface, preferably the surface of the biosensor, is modified with polylysine, aminosilane, epoxysilane, nitrocellulose, carboxydextran, carbon nanomembrane, graphene oxide, carbon surface, for example, carbon black, carbon fiber, carbon plate, carbon cloth, activated carbon, glassy carbon, charcoal, activated carbon, graphite powder, graphite fiber, carbon nanotube, fullerene, carboxyl group, azide group, thiol group, hydroxyl group, epoxide, maleimide, alkyne, strained alkyne, or any combination thereof. Embodiment 86:

[0116] For the immobilization of an L-nucleic acid molecule as described in any one of Embodiments 38 to 44, the surface is functionalized with an activated primary amine, a thiol group, an azide, or a strained cycloalkyne, preferably the strained cycloalkyne is selected from the group comprising dibenzocyclooctyl (DBCO), bicyclo[6.1.0]non-4-yne (BCN), or azadibenzocyclooctin (ADIBO), as described in Embodiment 85. Embodiment 87:

[0117] The use according to Embodiment 86, in which strain-accelerated azide-alkyne cycloaddition is used for immobilizing the L-nucleic acid molecule according to Embodiment 42 or 43. Embodiment 88:

[0118] The use of the biosensor detection system according to any one of embodiments 82 to 87, based on optical readout, mass change, refractive index, charge, surface stress, and atomic force microscopy. Embodiment 89:

[0119] The use of the biosensor according to Embodiment 88, wherein the detection system of the biosensor based on optical readout is fluorescence, absorption, or emission. Embodiment 90:

[0120] The use according to Embodiment 85, wherein the detection system for the biosensor based on mass change is a quartz crystal microbalance or a microelectromechanical system. Embodiment 91:

[0121] The use according to Embodiment 88, wherein the detection system of the biosensor based on the refractive index is surface plasmon resonance, a ring resonator, or ellipsometry. Embodiment 92:

[0122] The use of the charge-based biosensor according to Embodiment 88, wherein the detection system is electrochemical impedance, voltammetry, amperometry, potentiometry, conductivity, or a field-effect transistor. Embodiment 93:

[0123] The use described in Embodiment 88, wherein the surface stress-based biosensor detection system is a cantilever biosensor. Embodiment 94:

[0124] The use according to any one of Embodiments 79 to 81, wherein the L-nucleic acid molecule contains a modifying group that enables the detection of the L-nucleic acid molecule, preferably the modifying group is a label. Embodiment 95:

[0125] The use according to Embodiment 94, wherein the label is selected from the group including biotin, bromodeoxyuridine, digoxigenin, oligonucleotides, fluorescent labels, electrochemiluminescent labels, radioactive labels, enzyme labels, UV labels, gold colloids, nanoparticles, and chelator molecule labels. Embodiment 96:

[0126] A kit for detecting CXCL8, the kit comprising an L-nucleic acid molecule described in any one of embodiments 1 to 50, and at least an instruction manual or reaction vessel. Embodiment 97:

[0127] A method for detecting CXCL8 using L-nucleic acid defined in any one of Embodiments 1 to 50 in a sample, the method comprising the following steps: a) A step of providing a sample containing an unknown concentration of CXCL8, b) The step of bringing a sample or a dilution thereof into contact with a diagnostic agent, diagnostic means, or biosensor, as defined in any one of embodiments 56 to 78, c) A step of measuring a signal using a diagnostic agent, diagnostic means, or biosensor as defined in any one of embodiments 56 to 78, d) Optionally, a step of comparing the signal to a reference, e) Optionally, the concentration of CXCL8 in a sample having an unknown CXCL8 concentration is determined by comparing it with a signal obtained from at least one sample having a known CXCL8 concentration, preferably the at least one sample having a known CXCL8 concentration, which follows steps b) to c). Embodiment 98:

[0128] A complex comprising an L-nucleic acid molecule and CXCL8 as described in any one of Embodiments 1 to 50, preferably a crystalline complex. Embodiment 99:

[0129] A method for screening antagonists of activity mediated by CXCL8: - A step of providing candidate antagonists for activity mediated by CXCL8, - A step of providing an L-nucleic acid molecule as defined in any one of Embodiments 1 to 50, - A step of providing a test system that provides a signal in the presence of an antagonist of activity mediated by CXCL8, -The step of determining whether a candidate antagonist of CXCL8-mediated activity is an antagonist of CXCL8-mediated activity. Embodiment 100:

[0130] A method for detecting L-nucleic acids in a sample as defined in any one of Embodiments 1 to 50, the method comprising the following steps: a) Providing a capture probe and a detection probe, wherein the capture probe is at least partially complementary to a first portion of an L-nucleic acid molecule as defined in any one of Embodiments 1 to 50 and to the detection probe, and the detection probe is at least partially complementary to a second portion of an L-nucleic acid molecule as defined in any one of Embodiments 1 to 50, or the capture probe is at least partially complementary to a second portion of an L-nucleic acid molecule as defined in any one of Embodiments 1 to 50 and the detection probe is at least partially complementary to a first portion of an L-nucleic acid molecule as defined in any one of Embodiments 1 to 50, b) Adding a capture probe and a detection probe separately or in combination to a sample containing an L-nucleic acid molecule as defined in any one of Embodiments 1 to 50, or a sample presumed to contain an L-nucleic acid molecule as defined in any one of Embodiments 1 to 50; c) A step that enables the capture probe and the detection probe to react with L-nucleic acid molecules simultaneously or sequentially in any order, as defined in any one or part of any of Embodiments 1 to 50, d) Optionally, a step of detecting whether the capture probe hybridizes to an L-nucleic acid molecule as defined in any one of the embodiments 1 to 50 provided in step a), e) The step of detecting the complex formed in step c), comprising an L-nucleic acid molecule as defined in any one of Embodiments 1 to 50, as well as a capture probe and a detection probe. Embodiment 101:

[0131] The method according to Embodiment 100, wherein the detection probe includes detection means and / or the capture probe is immobilized on a support, preferably a solid support. Embodiment 102:

[0132] The method according to Embodiment 100 or 101, wherein any detection probes that are not part of the complex formed in step c) are removed from the reaction, so that only detection probes that are part of the complex are detected in step e). Embodiment 103:

[0133] The method according to any one of Embodiments 100 to 102, wherein step e) includes comparing the signals generated by the detection means when hybridizing the capture probe and the detection probe in the presence or absence of an L-nucleic acid molecule or a portion thereof as defined in any one of Embodiments 1 to 50, and in the absence of an L-nucleic acid molecule as defined in any one of Embodiments 1 to 50.

[0134] While we do not wish to be bound by any theory, we have surprisingly found that the biostable L-nucleic acid molecule according to the present invention binds specifically and with high affinity to human CXCL8, thereby effectively inhibiting CXCL8's binding to its receptor. Surprisingly, we have identified nucleic acid molecules that specifically bind to and inhibit CXCL8, but do not bind to or inhibit the related chemokines CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, and CXCL7, respectively, although these proteins share structural features with CXCL8, such as the ELR motif. The affinity and high selectivity of the CXCL8-binding nucleic acids, as demonstrated in the picomolar range, were unforeseen.

[0135] In particular, the inventors have surprisingly found that the nucleic acid molecules according to the present invention are suitable for blocking the interaction between CXCL8 and its receptor and inhibiting CXCL8-inducible chemotaxis with an inhibition constant in the picomolar range. To date, the nucleic acid molecules according to the present invention can also be considered antagonists of the effects of CXCL8, particularly the effects of CXCL8 on its receptors CXCR1 and / or CXCR2. Preferably as used herein, an antagonist to CXCL8 is a molecule that binds to CXCL8 (such as the nucleic acid molecules according to the present invention) and preferably inhibits the function of CXCL8 in an in vitro assay or in an in vivo model as described in the examples.

[0136] The nucleic acid molecules according to the present invention are nucleic acids within the scope of the present invention. The terms nucleic acid and nucleic acid molecule are used synonymously herein unless otherwise indicated. Furthermore, such nucleic acids(plural) are preferably also referred herein as nucleic acid molecules(plural) according to the present invention, nucleic acids(plural) according to the present invention, nucleic acids(plural) of the present invention, or nucleic acid molecules(plural) of the present invention.

[0137] The nucleic acid features of the present invention described herein can be realized in any aspect of the invention, including any embodiment in which nucleic acids are used alone or in any combination. Any embodiment of one aspect of the invention should be recognized as an embodiment of each and any other aspect of the invention. More specifically, any embodiment of the first aspect of the invention is also each and any embodiment of the second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, and thirteenth aspects.

[0138] With regard to the various diseases, conditions, and disorders that can be treated or prevented by using nucleic acid molecules and compositions according to the present invention, preferably pharmaceutical compositions containing them, it should be recognized that such diseases, conditions, and disorders are preferably those described herein, in particular those described and described in the Introduction to this Application. To date, each section of this Spec and the Introduction to this Specification form an integral part of this Disclosure teaching the suitability of the nucleic acid molecules herein for the prevention and treatment of each of the diseases, conditions, and disorders. Furthermore, the nucleic acid molecules according to the present invention are preferred when the physiological effects of the CXCL8-CXCR1 receptor and CXCL8-CXCR2 receptor axis are related to higher plasma levels of CXCL8.

[0139] Preferably as used herein, the term CXCL8 refers to any CXCL8, including but not limited to mammalian CXCL8. Preferably, mammalian CXCL8 is selected from the group including human, monkey, rabbit, pig, dog, sheep, zebrafish, and guinea pig CXCL8. More preferably, CXCL8 is human CXCL8, preferably having the amino acid sequence according to Sequence ID No. 2.

[0140] As outlined in more detail in the claims and Example 1, we were able to identify several different nucleic acid molecules that can bind to human CXCL8, which was quite remarkable.

[0141] As outlined in more detail herein, the inventors have identified several different CXCL8 nucleic acid molecules capable of binding to human CXCL8, thereby allowing the nucleic acid molecules to be characterized with respect to nucleotide stretches, which are also referred to herein (see Example 1).

[0142] Each of the different types of CXCL8-binding nucleic acid molecules of the present invention that bind to CXCL8 contains three different nucleotide stretches: a first terminal stretch of the nucleotide, a central stretch of the nucleotide, and a second terminal stretch of the nucleotide. Generally, the CXCL8-binding nucleic acid molecules of the present invention contain terminal stretches of the nucleotide at their 5' and 3' ends, i.e., a first terminal stretch of the nucleotide and / or a second terminal stretch of the nucleotide (also called the 5' terminal stretch and the 3' terminal stretch, respectively). The first terminal stretch and the second terminal stretch of the nucleotide can, in principle, hybridize with each other due to their base complementarity, thereby forming a double-stranded structure upon hybridization. However, such hybridization does not necessarily occur intramolecularly under physiological and / or non-physiological conditions. The three nucleotide stretches of a CXCL8-bound nucleic acid molecule (the first terminal stretch, the central stretch, and the second terminal stretch) are aligned with each other in the 5'->3' direction: first terminal stretch - central stretch - second terminal stretch. Alternatively, the second terminal stretch, central stretch, and first terminal stretch are aligned with each other in the 5'->3' direction.

[0143] The length of the central stretch of nucleotides in the nucleic acid according to the present invention is preferably 32 or 33 nucleotides.

[0144] The length of the first terminal stretch of the nucleotides in the nucleic acid according to the present invention is 3 to 6 nucleotides, preferably 5 to 6 nucleotides, and more preferably 5 nucleotides.

[0145] The length of the second terminal stretch of the nucleotides in the nucleic acid according to the present invention is 3 to 6 nucleotides, preferably 5 to 6 nucleotides, and more preferably 5 nucleotides.

[0146] The terms “stretch” and “nucleotide stretch” are used synonymously in this specification unless otherwise indicated.

[0147] Differences in the defined stretch sequences between different CXCL8-binding nucleic acid molecules can affect their binding affinity to CXCL8. Based on the binding analysis of different CXCL8-binding nucleic acid molecules of the present invention, the central stretch and the nucleotides forming it are essential, individually and more often as a whole, for the binding of the CXCL8-binding nucleic acid molecule to CXCL8.

[0148] In a preferred embodiment, the nucleic acid molecule according to the present invention is a single nucleic acid molecule. In a further embodiment, the single nucleic acid molecule exists as a number of single nucleic acid molecules or as a number of single nucleic acid molecular species.

[0149] Those skilled in the art will recognize that the nucleic acid molecule according to the present invention preferably consists of nucleotides linked to each other by phosphodiester bonds or linkages, and preferably by covalent bonds.

[0150] It is within the scope of the present invention that nucleic acid molecules according to the present invention include two or more stretches or parts thereof that can, in principle, hybridize with one another. During such hybridization, a double-stranded structure is formed. It will be recognized by those skilled in the art that such hybridization may or may not occur, particularly under in vitro and / or in vivo conditions. Furthermore, in the case of hybridization, such hybridization does not necessarily occur over the entire length of the two stretches, in which such hybridization, and therefore the formation of a double-stranded structure, can, in principle, occur, at least based on the rules of base pairing. Preferably as used herein, a double-stranded structure is a structure formed by a part of a nucleic acid molecule, or by two or more separate strands or two spatially separated stretches of a single strand of a nucleic acid molecule, thereby having at least one, preferably two or more base pairs that form a base pair, preferably according to the Watson-Crick base pairing rules. It will also be recognized by those skilled in the art that other base pairs, such as Hoogsten base pairs, may be present in or form such a double-stranded structure. The characteristic of two stretches hybridizing also preferably indicates that such hybridization is assumed to occur due to the base complementarity of the two stretches, regardless of whether such hybridization actually occurs in vivo and / or in vitro. In connection with the present invention, such stretches are a first terminal stretch of a nucleotide and a second terminal stretch of a nucleotide, which in one embodiment may hybridize as defined above.

[0151] In preferred embodiments, the term "arrangement" as used herein means the order or sequence of structural or functional features or elements described herein in relation to the nucleic acid molecule(s) disclosed herein.

[0152] The nucleic acid molecules according to the present invention must also contain nucleic acids that are substantially homologous to the specific sequences disclosed herein. The term substantially homologous should be understood as having homology of at least 75%, preferably 85%, more preferably 90%, and most preferably 95%, 96%, 97%, 98%, or 99%.

[0153] The actual percentage of homologous nucleotides present in the nucleic acid molecule according to the present invention will depend on the total number of nucleotides present in the nucleic acid molecule. The modification rate can be based on the total number of nucleotides present in the nucleic acid molecule.

[0154] The homology between two nucleic acid molecules can be determined in a manner known to those skilled in the art. More specifically, a sequence comparison algorithm may be used to calculate the sequence homology of a test sequence(s) to a reference sequence based on specified program parameters. The test sequence is preferably a sequence or nucleic acid molecule that is said to be homologous to a different nucleic acid molecule, or that is said to be tested for homology, and if homologous, to what extent, so that such different nucleic acid molecules are also referenced as reference sequences. In one embodiment, the reference sequence is a nucleic acid molecule described herein, preferably having sequences 14-26 and 39-44, and more preferably having sequences from any one of sequence numbers 16, 17, 25, and 26, 39, 40, 20, and 41-44. The optimal alignment of sequences for comparison can be performed, for example, by Smith & Waterman's local homology algorithm (Smith & Waterman, 1981), Needleman & Wunsch's homology alignment algorithm (Needleman & Wunsch, 1970), Pearson & Lipman's similarity search (Pearson & Lipman, 1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA from the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection.

[0155] An example of a suitable algorithm for determining sequence identity is the algorithm used in basic local alignment search tools (hereinafter referred to as "BLAST"), see, for example, Altschul et al. (Altschul et al., 1990 and Altschul et al., 1997). Software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information (hereinafter referred to as "NCBI"). Default parameters used when determining sequence identity using software available from NCBI, such as BLASTN (for nucleotide sequences) and BLASTP (for amino acid sequences), are described by McGinnis et al. (McGinnis et al., 2004).

[0156] The nucleic acid molecules according to the present invention must also include nucleic acid molecules having a certain degree of identity with nucleic acids disclosed and described herein and defined by their nucleotide sequences. More preferably, the present invention also includes nucleic acid molecules having at least 75%, preferably 85%, more preferably 90%, most preferably 95%, 96%, 97%, 98%, or more than 99% identity with nucleic acid molecules disclosed and described herein and defined by their nucleotide sequences or a portion thereof.

[0157] The term nucleic acid or nucleic acid molecule according to the present invention also preferably includes a nucleic acid molecule or a portion thereof containing a nucleic acid sequence disclosed or described herein to the extent that the nucleic acid molecule or a portion thereof is involved in binding to human CXCL8. In one embodiment, such nucleic acid is one of the nucleic acid molecules described or disclosed herein, or a derivative and / or metabolite thereof, thereby such derivative and / or metabolite is preferably a shortened nucleic acid molecule compared to the nucleic acid molecules described or disclosed herein. The shortening may relate to one or both ends of the nucleic acid molecule as disclosed or described herein. The shortening may also relate to the internal sequence of nucleotides of the nucleic acid molecule, i.e., to nucleotides between the 5' terminal nucleotide and the 3' terminal nucleotide, respectively. Furthermore, the shortening may involve the deletion of just one nucleotide from the sequence of the nucleic acid disclosed herein. The shortening may also relate to multiple stretches of the nucleic acid(s) described or disclosed herein, thereby the stretches may be as short as one nucleotide. The binding of nucleic acid molecules according to the present invention can be determined by those skilled in the art using routine experiments or by using or employing the methods described herein, preferably the methods described in the Examples section herein.

[0158] The nucleic acid molecule according to the present invention may be either a D-nucleic acid molecule or an L-nucleic acid molecule. Preferably, the nucleic acid molecule according to the present invention is an L-nucleic acid molecule.

[0159] In one embodiment, it is also within the scope of the invention that each and any of the nucleic acid molecules fully described herein with respect to those nucleic acid sequences(s) are limited to a specific indicated nucleotide sequence(s). In other words, the terms “comprising” or “comprise” shall be interpreted in such embodiments as “containing” or “consisting of.”

[0160] It is also within the scope of the present invention that the nucleic acid molecule according to the present invention is part of a long nucleic acid molecule, and that this long nucleic acid comprises several parts, and that at least one such part is the nucleic acid according to the present invention or part of it. The other(s) parts of such a long nucleic acid molecule may be one or more d-nucleic acid molecules or one or more l-nucleic acid molecules. Any combination may be used in connection with the present invention. These other(s) parts of the long nucleic acid molecule, individually or together as a whole or in a particular combination, can exhibit a function different from binding, preferably to CXCL8. One possible function is to enable interaction with other molecules, thereby allowing such other molecules to be different from CXCL8, preferably for immobilization, crosslinking, detection or amplification. In further embodiments of the present invention, the nucleic acid molecule according to the present invention comprises several nucleic acid molecules of the present invention, either as individual parts or combined parts. Such nucleic acid molecules comprising several nucleic acids of the present invention are also included in the term long nucleic acid.

[0161] As used herein, L-nucleic acids are nucleic acids or nucleic acid molecules consisting of L-nucleotides, preferably consisting entirely of L-nucleotides.

[0162] As used herein, D-nucleic acids are nucleic acids or nucleic acid molecules consisting of D-nucleotides, preferably consisting entirely of D-nucleotides.

[0163] The terms nucleic acid and nucleic acid molecule are used synonymously herein unless otherwise explicitly stated.

[0164] Furthermore, unless otherwise indicated, any nucleotide sequence is shown in the 5'->3' direction herein.

[0165] Preferably as used herein, any position of a nucleotide is determined or referenced relative to the 5' end of the sequence, stretch, or substretch containing such nucleotide. Thus, the second nucleotide is the second nucleotide counting from the 5' end of the sequence, stretch, and substretch, respectively. Accordingly, the second to last nucleotide is the second nucleotide counting from the 3' end of the sequence, stretch, and substretch, respectively. The nucleic acid molecule according to the present invention consists of ribonucleotides, and here, G is guanosine-5'-monophosphate, C is cytidine 5'-monophosphate, A is adenosine-5'-monophosphate, U is uridine-5'-monophosphate.

[0166] The definition of ribonucleotide sequence motifs uses the IUPAC abbreviation for ambiguous nucleotides: S Strong G or C; W is a weak A or U(T); R Pudding G or A; Y pyrimidine C or U(T); K keto G or U(T); M is an imino A or C; Not BA; C or U(T) or G; Not DC; A, G, or U(T); Not HG; A, C, or (T); Not VU; A, C, or G; N All A, G, C, or U(T).

[0167] Designing the nucleic acid molecule of the present invention as an L-nucleic acid molecule is advantageous for several reasons. L-nucleic acid molecules are enantiomers of naturally occurring nucleic acid molecules. However, D-nucleic acid molecules are not very stable in aqueous solutions, especially in biological systems or biological samples, due to the widespread presence of nucleases. Naturally occurring nucleases, particularly those derived from animal cells, cannot degrade L-nucleic acid. Therefore, the biological half-life of L-nucleic acid molecules is significantly increased in such systems, such as the bodies of animals and humans. Due to the lack of degradability of L-nucleic acid molecules, no nuclease degradation products are produced, and therefore, there are no side effects resulting from the biological half-life observed in such systems, such as the bodies of animals and humans. In this embodiment, the L-nucleic acid molecule is distinguished from virtually all other compounds used in the treatment of diseases and / or disorders involving the presence of CXCL8. L-nucleic acid molecules that specifically bind to target molecules via a mechanism different from Watson-Crick base pairing, or aptamers consisting partially or entirely of L-nucleotides, particularly those having those parts of an aptamer involved in the binding of the aptamer to its target molecule, are also called Spiegelmers. Aptamers and Spiegelmers themselves are known to those skilled in the art and are described, in particular, in "The Aptamer Handbook" (Klussmann, ed., 2006).

[0168] It is also within the scope of the present invention that nucleic acid molecules of the present invention may exist as single-stranded or double-stranded nucleic acid molecules, regardless of whether they exist as D-nucleic acid molecules, L-nucleic acid molecules, or D,L-nucleic acid molecules. Typically, nucleic acid molecules are single-stranded nucleic acid molecules that exhibit a secondary structure defined by their primary sequence and can therefore also form a tertiary structure. However, nucleic acid molecules can also be double-stranded, meaning that two strands that are complementary or partially complementary to each other hybridize with one another.

[0169] The nucleic acid molecules of the present invention can be modified. Such modifications may relate to a single nucleotide of the nucleic acid molecule and are well known in the art. Examples of such modifications are described, in particular, by Venkatesan et al. (Venkatesan et al., 2003) and Kusser (Kusser, 2000). Such modifications may be an H atom, F atom, or O-CH3 or NH2 group at the 2' position of one of several of the individual nucleotides constituting the nucleic acid molecule. Furthermore, the nucleic acid molecule according to the present invention may contain at least one LNA nucleotide. In one embodiment, the nucleic acid molecule according to the present invention consists of an LNA nucleotide.

[0170] In one embodiment, the nucleic acid molecule according to the present invention may be a polysegmented nucleic acid molecule. The polysegmented nucleic acid molecule as used herein is a nucleic acid molecule consisting of at least two distinct nucleic acid chains. These at least two nucleic acid chains form a functional unit, thereby the functional unit being a ligand for a target molecule, in the case of CXCL8, and preferably an antagonist for the target molecule. The at least two nucleic acid chains may be derived from either the nucleic acid molecule of the present invention by cleaving the nucleic acid molecule of the present invention to produce at least two chains, or by synthesizing one nucleic acid molecule corresponding to a first portion of the full-length nucleic acid molecule of the present invention and another nucleic acid molecule corresponding to another portion of the full-length nucleic acid molecule of the present invention. Depending on the number of portions forming the full-length nucleic acid molecule, a corresponding number of portions having the required nucleotide sequences will be synthesized. It shall be acknowledged that both the cleavage approach and the synthesis approach may be applied to produce a polysegmented nucleic acid molecule having two or more chains as illustrated above. In other words, at least two distinct nucleic acid strands are typically complementary, unlike two strands that hybridize with each other, but some degree of complementarity can exist between at least two distinct nucleic acid strands, and such complementarity can lead to hybridization of the distinct strands.

[0171] Finally, a completely closed, i.e., circular structure of the nucleic acid molecule according to the present invention is realized. That is, in one embodiment, the nucleic acid molecule according to the present invention is closed, preferably via covalent linkage, thereby, more preferably, such covalent linkage is formed between the 5' and 3' ends of the nucleic acid sequence of the nucleic acid molecule of the present invention disclosed herein or any derivative thereof, which is within the scope of the present invention.

[0172] The possibility of determining the binding constant of nucleic acid molecules according to the present invention is that the nucleic acid molecule according to the present invention is preferred K D The use of the methods described in Examples 3 and 4 confirms the above finding that the values ​​exhibit a range. A suitable measure for representing the strength of binding between individual nucleic acid molecules and targets is the so-called KD value, as well as the method for determining it, in the case of CXCL8 of the present invention.

[0173] Preferably, the K represented by the nucleic acid according to the present invention. D The value is less than 1 μM. K D A value of approximately 1 μM is said to be characteristic of the nonspecific binding of nucleic acids to the target. As will be recognized by those skilled in the art, the KD values ​​of the group of compounds, such as nucleic acid molecules, according to the present invention are within a specific range. D Approximately 1 μM is K D This is a preferred upper limit for the value. The lower limit of the KD of target-binding nucleic acids may be around 10 picomoles or higher. The K of individual nucleic acids that bind to CXCL8 D The present invention is within the scope of the present invention, preferably the value is within this range. The preferred range can be defined by selecting any first number and any second number within this range. Preferred upper limit K D The values ​​are 250 nM, 100 nM, and 20 nM, with a preferred lower limit K. D The values ​​are 10 nM or less, 1 nM or less, 100 pM or less, and 30 pM or less. A more preferred upper limit K D The value is 20 nM, and a more preferred lower limit K D The value is 30 pM or less.

[0174] In addition to the binding properties of the nucleic acid molecule according to the present invention, the nucleic acid molecule according to the present invention inhibits the function of each target molecule, which in this invention is CXCL8. Inhibition of CXCL8 function—for example, stimulation of each of the aforementioned receptors—is achieved by binding the nucleic acid molecule according to the present invention to CXCL8 and by forming a complex of the nucleic acid molecule according to the present invention and CXCL8. Such a complex of the nucleic acid molecule and CXCL8 cannot stimulate receptors that are normally stimulated by CXCL8, i.e., CXCL8 that is not present in the complex with the nucleic acid molecule according to the present invention. Therefore, the inhibition of receptor function by the nucleic acid molecule according to the present invention is independent of each receptor that can be stimulated by CXCL8, which results from the prevention of receptor stimulation by CXCL8 by the nucleic acid molecule according to the present invention.

[0175] The ability to determine the inhibition constant of nucleic acid molecules according to the present invention is the use of the method in Example 5, which confirms the above finding that nucleic acid molecules according to the present invention exhibit a favorable inhibition constant that enables the use of nucleic acids in therapeutic schemes. In the case of the present invention, a suitable measure for representing the intensity of the inhibitory effect of individual nucleic acid molecules on the interaction of CXCL8 and their respective receptor targets is such that a method for determining it is known to those skilled in the art as half of the so-called maximum inhibitory concentration (abbreviated as IC). 50 )

[0176] Preferably, IC represented by nucleic acid molecules according to the present invention 50 The value is less than 1 μM. IC 50 A value of approximately 1 μM is said to be characteristic of nonspecific inhibition of target function by nucleic acid molecules. As will be recognized by those skilled in the art, IC of the group of compounds such as nucleic acid molecules according to the present invention 50 The value is within a specific range. (See IC above) 50 Approximately 1 μM is IC 50 This is a preferred upper limit for the value. IC of target-binding nucleic acid molecules. 50 The lower limit may be around 10 picomoles, or it may be higher. IC of individual nucleic acids bound to CXCL8 50The value preferably falls within this range, which is within the scope of the present invention. The preferred range can be defined by selecting any first number and any second number within this range. Preferred upper limit IC 50 The values ​​are 250 nM, 100 nM, and 20 nM, and the preferred lower limit IC is 50 The values ​​are 10 nM or less, 1 nM or less, 500 pM or less, and 260 pM or less. A more preferred upper limit IC 50 The value is 20 nM, which is a more preferable lower limit IC. 50 The value is 260 pM or less.

[0177] The nucleic acid molecule according to the present invention may have any length, provided that it can still bind to a target molecule. It will be recognized in the art that there are preferred lengths for the nucleic acid molecule according to the present invention. Typically, the length is 15 to 120 nucleotides. Those skilled in the art will recognize that any integer between 15 and 120 is a possible length for the nucleic acid molecule according to the present invention. More preferred ranges of length for the nucleic acid molecule according to the present invention are about 20 to 100 nucleotides, about 20 to 80 nucleotides, about 20 to 60 nucleotides, about 38 to 45 nucleotides, and about 40 to 45 nucleotides.

[0178] It is within the scope of the present invention that the nucleic acid molecules of the present invention include a portion that is preferably a high molecular weight portion, and / or preferably a portion that enables modification of the properties of the nucleic acid molecule, particularly with respect to residence time, in the body of an animal, preferably a human body. Particularly preferred embodiments of such modifications are PEGylation and HESylation of nucleic acid molecules according to the present invention. As used herein, PEG represents poly(ethylene glycol) and HES represents hydroxyethyl starch. Preferably, PEGylation as used herein is a modification of a nucleic acid molecule according to the present invention, thereby comprising a PEG portion attached to a nucleic acid molecule according to the present invention. Preferably, HESylation as used herein is a modification of a nucleic acid molecule according to the present invention, thereby comprising a HES portion attached to a nucleic acid molecule according to the present invention. These modifications, as well as the processes for modifying nucleic acid molecules using such modifications, are described in European Patent Application No. 1 306 382 and International Publication No. 2018099600(A1), which are incorporated herein by reference in their entirety.

[0179] In the case of such a high molecular weight portion, PEG, the molecular weight is preferably about 20,000 to about 120,000 Da, more preferably about 30,000 to about 80,000 Da, and most preferably about 40,000 Da. In another preferred embodiment, PEG is PEG as described in International Publication No. 03076490. When HES is such a high molecular weight portion, the molecular weight is preferably about 50 kDa to about 1000 kDa, more preferably about 100 kDa to about 700 kDa, and most preferably 200 kDa to 500 kDa. HES exhibits a molar substitution of 0.1 to 1.5, more preferably 1 to 1.5, and exhibits a substitution grade expressed as a C2 / C6 ratio of about 0.1 to 15, preferably about 3 to 10. The process for HES modification is described, for example, in German Patent Application Publication No. 1 2004 006 249.8, the disclosure of which is incorporated herein by reference in its entirety.

[0180] Modification can, in principle, be performed at any position of the nucleic acid molecule of the present invention. Preferably, such modification is performed on the 5' terminal nucleotide, the 3' terminal nucleotide, and / or any nucleotide between the 5' and 3' nucleotides of the nucleic acid molecule.

[0181] Modifications, preferably PEG and / or HES moieties, can be attached to the nucleic acid molecule of the present invention directly or indirectly, preferably indirectly via a linker. It is also within the scope of the present invention that the nucleic acid molecule according to the present invention comprises one or more modifications, preferably one or more PEG and / or HES moieties. In one embodiment, individual linker molecules attach two or more PEG or HES moieties to the nucleic acid molecule according to the present invention. Linkers used in connection with the present invention may be either linear or branched themselves. Such linkers are known to those skilled in the art and are further described in International Publications 2005 / 074993 and 2003 / 035665.

[0182] In preferred embodiments, the linker is a biodegradable linker. The biodegradable linker makes it possible to modify the properties of the nucleic acid molecule according to the present invention by releasing modifications from the nucleic acid molecule according to the present invention, particularly with respect to the residence time in the body of an animal, preferably in the body of a human. By using a biodegradable linker, better control of the residence time of the nucleic acid molecule according to the present invention may be possible. Preferred embodiments of such biodegradable linkers are, but are not limited to, those described in International Publication Nos. 2006 / 052790, 2008 / 034122, 2004 / 092191 and 2005 / 099768, among others.

[0183] It is within the scope of the present invention that the modification or modifying group is a biodegradable modification, thereby allowing the biodegradable modification to be attached to the nucleic acid molecule of the present invention directly or indirectly, preferably via a linker. The biodegradable modification can modify the properties of the nucleic acid molecule of the present invention by releasing or degrading the modification from the nucleic acid molecule of the present invention, particularly with respect to residence time in the body of an animal, preferably in the body of a human. By using biodegradable modifications, better control of the residence time of the nucleic acid molecule of the present invention may be possible. Preferred embodiments of such biodegradable modifications are, but are not limited to, those described in International Publication Nos. 2002 / 065963, 2003 / 070823, 2004 / 113394 and 2000 / 41647, preferably International Publication No. 2000 / 41647, page 18, lines 4-24.

[0184] In a more preferred embodiment, the linker has the following structure: [ka]

[0185] Each linker is disclosed, for example, in International Publication No. 2015 / 062743. As is evident from the above structure, the linker links two separate PEG moieties to the OH group of the phosphate moiety of the nucleotide of the nucleic acid molecule according to the present invention.

[0186] In addition to the modifications described above, other modifications can be used to modify the properties of nucleic acid molecules according to the present invention, thereby allowing for the selection of such other modifications from the group of proteins, lipids such as cholesterol, and glycans such as amylase and dextran.

[0187] While we do not wish to be bound by any theory, modifying the nucleic acid molecules according to the present invention with high molecular weight moieties, preferably physiologically acceptable, such as one or more of the polymers disclosed herein, alters the excretion kinetics of the modified nucleic acid molecules from the bodies of animals or humans to which they are administered. More specifically, the increased molecular weight of the modified nucleic acid molecules and the fact that the nucleic acid molecules are not metabolized reduces excretion from the bodies of animals, preferably mammals, and more preferably humans, especially in the case of L-type nucleic acid molecules, i.e., L-nucleic acid molecules. Typically, since excretion occurs via the kidneys, we hypothesize that the glomerular filtration rate of the modified nucleic acid molecules is significantly slower compared to nucleic acid molecules without this type of high molecular weight modification, resulting in an increased residence time of the modified nucleic acid molecules in the bodies of animals. In this regard, it is particularly noteworthy that despite such high molecular weight modifications, the specificity of the nucleic acid molecules according to the present invention is not affected in an adverse manner. To date, the nucleic acid molecules according to the present invention have a remarkable feature, in particular, that a sustained-release pharmaceutical formulation is not necessarily required to produce the sustained release of the nucleic acid molecules according to the present invention (a feature not typically expected from pharmaceutically active compounds). Rather, the modified forms of the nucleic acid molecules according to the present invention, including the high molecular weight moiety, act as if they had already been released from a sustained-release formulation due to their modification, and can therefore be used as sustained-release formulations themselves. To date, the nucleic acid molecules according to the present invention disclosed herein, and modifications (plural) of such modified nucleic acid molecules and any compositions containing them according to the present invention, can provide distinct, preferably controlled pharmacokinetics and their biodistribution. This includes residence times in the circulation of animal and human bodies, and distribution to tissues within such animals and humans. Such modifications are further described in International Publication No. 2003 / 035665.

[0188] However, it is also within the scope of the present invention that the nucleic acid molecules according to the present invention do not contain any modifications, and in particular do not contain high molecular weight modifications such as PEG or HES. Such embodiments are particularly preferred when the nucleic acid molecules according to the present invention are preferably distributed to any target organ or tissue in the body, or when rapid clearance of the nucleic acid molecules according to the present invention from the body after administration is desired. Nucleic acid molecules according to the present invention disclosed herein, having a preferred distribution profile to any target organ or tissue in the body, make it possible to establish effective local concentrations in target tissues while keeping systemic concentrations of the nucleic acid molecules low. This is not only beneficial from an economic standpoint, but also allows for the use of low doses, which reduces unnecessary exposure of other tissues to the nucleic acid molecules and thus reduces the potential risk of side effects. In particular, rapid clearance of the nucleic acid molecules according to the present invention from the body after administration may be desired in in vivo imaging or certain therapeutic drug delivery requirements using the nucleic acid molecules according to the present invention or pharmaceuticals containing them.

[0189] The nucleic acids of the present invention, also called nucleic acids or nucleic acid molecules (according to the present invention), and / or antagonists according to the present invention may be used for the production or manufacture of pharmaceuticals. Such pharmaceuticals or pharmaceutical compositions according to the present invention contain at least one of the nucleic acids of the present invention together with optionally more further pharmaceutically active compounds, thereby the nucleic acids of the present invention preferably act as the pharmaceutically active compounds themselves. Such pharmaceuticals, in preferred embodiments, include at least a pharmaceutically acceptable carrier. Such carriers may be, for example, water, buffer, PBS, glucose solution, preferably a 5% glucose salt equilibrium solution, starch, sugar, gelatin, or any other acceptable carrier material. Such carriers are generally known to those skilled in the art. Any embodiment, use and manner of the pharmaceuticals of the present invention or manners related thereto will be applicable to the pharmaceutical compositions of the present invention and nucleic acid molecules according to the present invention for use in the treatment and / or prevention and / or diagnosis of any disease disclosed or described herein, and vice versa, as will be recognized by those skilled in the art.

[0190] The indications, diseases, and disorders for the treatment and / or prevention of nucleic acids, pharmaceutical compositions, and pharmaceuticals prepared in accordance with the present invention arise from either the direct or indirect involvement of CXCL8 in their respective pathogenesis mechanisms.

[0191] CXCL8 (UniProtKB / Swiss-Prot P10145, IL8_HUMAN; SEQ ID NO: 2) (also known as interleukin 8 (IL-8)), neutrophil-activating protein 1 (NAP-1), monocyte-derived neutrophil chemotactic factor (MDNCF), or granulocyte chemotactic protein 1 (GCP-1) is a small basic protein belonging to the subfamily of CXC chemokines, characterized by a glutamate-leucine-arginine (ELR) motif at its N-terminus and possessing pro-inflammatory and pro-angiogenic properties. ELR-positive chemokines CXCL1 (also known as growth regulatory alpha protein, Gro-alpha, melanoma growth stimulating activity, MGSA, or NAP-3), CXCL2 (also known as Gro-beta or macrophage inflammatory protein 2-alpha, MIP2-alpha), CXCL3 (also known as Gro-gamma or MIP2-beta), CXCL5 (also known as epithelial neutrophil-activating protein 78, ENA-78, or small inducible cytokine B5), CX CL6 (also known as chemokine alpha 3, CKA-3, granulocyte chemotactic protein 2, GCP-2, or small inducible cytokine B6), CXCL7 (also known as platelet basic protein, PBP, leukocyte-derived growth factor, LDGF, macrophage-derived growth factor, MDGF, or small inducible cytokine B7), and CXCL8 are agonists of the receptor CXCR2 (also known as IL8RB, IL8R type 2, CD182, CDw128b, or GRO / MGSA receptor). CXCL6, CXCL7, and CXCL8 are agonists of the receptor CXCR1 (also known as IL8RA, IL8R type 1, CD181, or CDw128a). CXCL8 binds to receptors CXCR1 and CXCR2 with similar affinity of approximately 4 nM. CXCL8, which binds to CXCR1 / 2, triggers a Gαi-dependent signaling pathway, inducing neutrophil migration, degranulation, and oxidative bursts, for example. Receptor sensitivity can be modulated by phosphorylation, beta-arrestin recruitment, and receptor internalization (Ha, Theranostics 2017). CXCL7 has the highest homology to CXCL8, having 33 identical amino acids.CXCL8 derived from non-human primates (rhesus macaques, cynomolgus macaques) shares 95% identity with human CXCL8 (73 out of 77 amino acids are identical). There are no orthologues of CXCL8 in mice or rats.

[0192] Naturally, since the CXCL8-binding nucleic acid molecules according to the present invention interact with or bind to human CXCL8, it will be generally understood by those skilled in the art that the CXCL8-binding nucleic acid molecules according to the present invention can be readily used for the treatment, prevention, and / or diagnosis of any of the diseases of humans and animals described herein. In this regard, it is acknowledged that the nucleic acid molecules according to the present invention can be used for the treatment and / or prevention of any of the diseases, disorders, or conditions described herein, regardless of the underlying mechanism of action of such diseases, disorders, and conditions.

[0193] In the following, we do not wish to be bound by any theory, but the rationale for using the nucleic acid molecules according to the present invention in relation to various diseases, disorders, and conditions is provided, and thus the plausible claimed therapeutic, prophylactic, and diagnostic applicability of the nucleic acid molecules according to the present invention is provided. To avoid unnecessary repetition, for the involvement of the CXCL8-CXCL8 receptor axis outlined in relation thereto, it is acknowledged that this axis may be designated by the nucleic acid molecules according to the present invention so as to achieve the claimed therapeutic, prophylactic, and diagnostic effects. Furthermore, it is acknowledged that any specificity of the patient's disease, disorder, and condition, as well as the details of the treatment regimen described in relation thereto, may be subject to preferred embodiments of this application.

[0194] CXCL8 and its receptor are involved in or pertain to the pathophysiology of several inflammatory diseases, and the potential for inhibiting CXCL8 for the treatment of such inflammatory diseases has been supported by animal disease models. Inflammatory diseases and / or disorders and / or conditions for which the pharmaceuticals according to the present invention may be used for the treatment and / or prevention include, but are not limited to, the following: Respiratory inflammatory diseases a. Chronic obstructive pulmonary disease b. Acute respiratory distress syndrome c. Asthma and allergic inflammation d. Bronchitis, bronchiolitis, obliterative bronchiolitis, bronchiectasis e. Interstitial lung diseases such as pulmonary fibrosis f. Cystic fibrosis g. Lung transplantation h. Lung injury caused by physical injury, e.g., tobacco smoke, post-collapse re-expansion, hyperoxia i. Lung injury caused by bacterial, viral, or fungal infections (pneumonia) Skin inflammatory diseases a. Neutrophilic dermatoses b. Psoriasis c. Bullous pemphigoid d. Epidermolysis bullosa e. Hidradenitis suppurativa f. Neurodermatitis g. Eczema Autoimmune diseases a. Inflammatory bowel disease b. Ulcerative colitis[[ID=​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​

[0195] CXCL8 is overexpressed in human cancers, and experimental cancer models support the possibility of inhibiting CXCL8 for cancer treatment. Thus, diseases and / or disorders and / or conditions for which the pharmaceutical according to the invention can be used for treatment and / or prevention include, but are not limited to, the following: a. Lung cancer b. Colorectal cancer c. Colorectal cancer d. Prostate cancer, hormone-resistant prostate cancer, etc. e. Pancreatic cancer f. Liver cancer g. Breast cancer h. Ovarian cancer i. Thyroid cancer j. Melanoma k. Glioblastoma l. Osteosarcoma m. Esophageal cancer n. Blood cancers (leukemia and lymphoma) o. Tumors with insufficient PTEN p. P53 mutant tumors q. Kras mutant tumors r. Treatment-resistant cancers, such as cancers resistant to treatment with chemotherapeutic agents, anti-angiogenic agents, tyrosine kinase inhibitors, and immune checkpoint inhibitors.

[0196] In a further embodiment, the pharmaceutical comprises a further pharmaceutically active agent for the treatment of cancer and / or tumor. Such further pharmaceutically active compounds are, inter alia, but not limited to, alkylating agents, antimetabolites, anti-angiogenic agents, mitosis inhibitors, topoisomerase inhibitors, cell signaling inhibitors, hormones, antibodies, immunoconjugates, and fusion proteins known as antitumor active substances.

[0197] Other pharmaceutically active compounds for the treatment of cancer and / or tumor are immunotherapeutic agents. Such further pharmaceutically active compounds are, inter alia, but not limited to, checkpoint inhibitors, cancer vaccines, immunostimulants, cells, cancer treatments.

[0198] Other pharmaceutically active compounds include, but are not limited to, those known to be effective against bleomycin, thymidylate synthase inhibitors such as larcitrexed and pemetrexed, enzymes such as L-asparaginase, miltefosine and anagrelide, and proteasome inhibitors such as bortezomib.

[0199] The use of pharmaceuticals and pharmaceutical compositions containing nucleic acids, respectively, by the present inventors in therapeutic applications in such a manner is within the scope of the present invention.

[0200] In further embodiments, the pharmaceutical product includes further pharmaceutically active agents for the treatment of inflammatory diseases. Such further pharmaceutically active compounds are, but are not limited to, nonsteroidal anti-inflammatory drugs, corticosteroids, calcineurin inhibitors, cyclosporine A, methotrexate, azathioprine, tacrolimus, rapamycin, chlorambucil, leflunomide, mycophenolate mofetil, brequinal, mizoribine, thalidomide, deoxysperguarine, dapsone, hydroxychloroquine, sulfasalazine, antihistamines, or anti-inflammatory biologics such as the antitumor necrosis factor antibody adalimumab, the B-cell depletion anti-CD20 antibody rituximab, the anti-IL6R antibody tocilizumab, the anti-IgE antibody omalizumab, and those known to suppress the immune system, such as intravenous immunoglobulins.

[0201] Finally, further pharmaceutically active agents may be modulators of the activity of any other chemokine, which may be a chemokine agonist or antagonist, or a chemokine receptor agonist or antagonist. Alternatively or additionally, such further pharmaceutically active agents are further nucleic acid molecules according to the present invention. Alternatively, the pharmaceutical product comprises at least one nucleic acid that binds to a target molecule different from CXCL8 or exhibits a function different from one of the nucleic acids according to the present invention.

[0202] In principle, the use of a pharmaceutical product as an alternative or additional means for the prevention of any of the diseases disclosed in connection with the use of a pharmaceutical product for the treatment of a disease falls within the scope of this invention. Accordingly, each marker, i.e., each disease marker, is known to those skilled in the art. Preferably, each marker is CXCL8.

[0203] In one embodiment of the pharmaceutical product of the present invention, such a pharmaceutical product is intended to be used in combination with other treatments for any of the diseases disclosed herein, particularly for diseases in which the pharmaceutical product of the present invention is used.

[0204] "Combination therapy" (or "co-therapy") involves administering the pharmaceutically active ingredient and at least one second agent as part of a specific treatment regimen aimed at providing beneficial effects from the synergistic effects of these therapeutic agents, i.e., the pharmaceutically active ingredient and at least one second agent. Beneficial effects of co-therapy include, but are not limited to, pharmacokinetic or pharmacodynamic synergies resulting from the combination of therapeutic ingredients. Administration of these therapeutic ingredients in combination is typically carried out over a defined period of time (usually minutes, hours, days, or weeks, depending on the chosen combination).

[0205] "Combination therapy" may, but is not generally intended, include administrations of two or more of these therapeutic agents as part of a separate monotherapy regimen that incidentally and arbitrarily results in the combination of the present invention. "Combination therapy" is intended to include administering these therapeutic agents sequentially, i.e., administering each therapeutic agent at different times, as well as administering these therapeutic agents, or at least two therapeutic agents, substantially simultaneously. Substantially simultaneous administration can be achieved, for example, by administering a single capsule containing each therapeutic agent in a fixed ratio, or by administering each therapeutic agent in multiple single capsules.

[0206] The sequential or substantially simultaneous administration of each therapeutic agent can be carried out by any suitable route, including, but not limited to, local, oral, intravenous, intramuscular, and direct absorption via mucosal tissue. The therapeutic agents can be administered by the same or different routes. For example, the first therapeutic agent of a selected combination may be administered by injection, while the other therapeutic agents of the combination may be administered topically.

[0207] Alternatively, for example, all therapeutic agents may be administered topically, or all therapeutic agents may be administered by injection. The order in which the therapeutic agents are administered is not strictly important unless otherwise specified. "Combination therapy" may also include administering the therapeutic agents described above in combination with other biologically active components. If combination therapy further includes non-pharmacological treatment, the non-pharmacological treatment may be administered at any suitable time, as long as the beneficial effects from the synergistic effects of the combination of therapeutic agents and non-pharmacological treatment are achieved. For example, in appropriate cases, beneficial effects may be achieved even if the non-pharmacological treatment is temporarily removed from the administration of the therapeutic agent, perhaps up to a few days or weeks.

[0208] As outlined in the general terms above, the pharmaceuticals according to the present invention can, in principle, be administered in any form known to those skilled in the art. The preferred route of administration is systemic administration, more preferably parenteral administration, and preferably by injection. Alternatively, the pharmaceuticals may be administered topically. Other routes of administration include intramuscular, intraperitoneal, and subcutaneous, oral, nasal, tracheal, or pulmonary, with the least invasive route of administration being preferred while ensuring efficiency.

[0209] Parenteral administration is generally performed using subcutaneous, intramuscular, or intravenous injection and infusion. Furthermore, one approach for parenteral administration, well known to those skilled in the art, involves the implantation of a sustained-release or continuous-release system that ensures a constant level of drug dosage is maintained.

[0210] Furthermore, the preferred pharmaceutical of the present invention can be administered intranasally via a suitable intranasal vehicle, via topical use of an inhalant, or via a transdermal route using a transdermal skin patch well known to those skilled in the art. For administration in the form of a transdermal delivery system, the dosing of the dosage will of course be continuous rather than intermittent throughout the dosage regimen. Other preferred topical formulations include creams, ointments, lotions, aerosol sprays, and gels, and the concentration of the active ingredient typically ranges from 0.01% to 15% (w / w or w / v).

[0211] The pharmaceutical of the present invention generally comprises a therapeutically effective amount of the active ingredient(s), such as, but not limited to, the nucleic acid molecule of the present invention dissolved or dispersed in a pharmaceutically acceptable medium. Pharmaceutically acceptable media or carriers include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the pharmaceuticals of the present invention.

[0212] In a further aspect, the present invention relates to a pharmaceutical composition. Such a pharmaceutical composition comprises at least one of the nucleic acids according to the present invention, and preferably a pharmaceutically acceptable vehicle. Such a vehicle can be any vehicle or any binder used and / or known in the art. More specifically, such a binder or vehicle is any binder or vehicle discussed in connection with the manufacture of the pharmaceuticals disclosed herein. In a further embodiment, the pharmaceutical composition comprises a further pharmaceutically active agent.

[0213] The preparation of pharmaceuticals and pharmaceutical compositions will be known to those skilled in the art with respect to this disclosure. Typically, such compositions can be prepared as either liquid solutions or suspensions, as injections, as solid forms suitable for dissolution in or suspension in liquids before injection, as tablets or other solids for oral administration, as time-release capsules, or in any other form currently in use, such as eye drops, creams, lotions, ointments, inhalants, etc. The use of sterile preparations, such as saline-based washes by surgeons, physicians, or healthcare professionals, may also be particularly useful for treating specific areas in the surgical field. Compositions may also be delivered via microdevices, microparticles, or sponges.

[0214] During formulation, the pharmaceutical or pharmaceutical composition will be administered in a manner compatible with the dosage form and in a pharmacologically effective amount. The formulation can be easily administered in various dosage forms, such as the injectable solution type described above, but drug-release capsules may also be used.

[0215] In this context, the amount of active ingredient administered and the volume of the composition depend on the individual or the subject being treated. The specific amount of active compound required for administration depends on the practitioner's judgment and is unique to each individual.

[0216] Typically, the minimum amount of drug or pharmaceutical composition necessary to disperse the active compound is used. While the preferred administration regimen can also be modified, a typical approach involves administering the compound initially, monitoring the results, and then administering further controlled doses at further intervals.

[0217] For example, in the case of oral administration in the form of tablets or capsules (e.g., gelatin capsules), the active drug component, i.e., any further pharmaceutically active agent, i.e., the nucleic acid molecule of the present invention and / or also herein referred to as therapeutic agent(s) or active compound(s), may be used in combination with an oral, non-toxic, pharmaceutically acceptable inert carrier (such as ethanol, glycerol, or water). Furthermore, if desired or necessary, suitable binders, lubricants, disintegrants, and colorants may also be incorporated into the mixture. Suitable binders include starch, aluminum magnesium silicate, starch paste, gelatin, methylcellulose, sodium carboxymethylcellulose and / or polyvinylpyrrolidone, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia and tragacanth, or sodium alginate, polyethylene glycol, wax, etc. Lubricants used in these dosage forms include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, silica, talcum, stearic acid, its magnesium or calcium salts, and / or polyethylene glycol. Disintegrants include, but are not limited to, starch, methylcellulose, agar, bentonite, xanthan gum starch, agar, alginic acid or its sodium salts, or effervescent mixtures. Diluents include, for example, lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, and / or glycine.

[0218] The pharmaceuticals or pharmaceutical compositions of the present invention can also be administered in oral dosage forms such as time-release and sustained-release tablets or capsules, pills, powders, granules, elixirs, tinctures, suspensions, syrups, and emulsions. Suppositories are advantageously prepared from fatty emulsions or suspensions.

[0219] Pharmaceutical compositions or medicinal products may be sterilized and may contain medicinal / or adjuvants such as preservatives, stabilizers, wetting agents or emulsifiers, dissolution accelerators, salts and / or buffers for adjusting osmotic pressure. Furthermore, they may also contain other therapeutically valuable substances. The compositions are prepared according to conventional mixing, granulation, or coating methods and typically contain about 0.1% to 75%, preferably about 1% to 50%, of the active ingredient.

[0220] Liquids, particularly injectable compositions, can be prepared by means of dissolution, dispersion, etc. Active compounds are dissolved or mixed in a pharmaceutically pure solvent, such as water, saline, aqueous dextrose, glycerol, or ethanol, thereby forming an injectable solution or suspension. Furthermore, solid forms suitable for dissolution in liquid before injection can be formulated.

[0221] In the case of solid compositions, excipients include pharmaceutical-grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, and magnesium carbonate. The active compounds defined above can also be formulated as suppositories using, for example, polyalkylene glycols, such as propylene glycol, as carriers. In some embodiments, suppositories are advantageously prepared from fatty emulsions or suspensions.

[0222] The pharmaceuticals, pharmaceutical compositions, and nucleic acid molecules of the present invention can also be administered in the form of liposome delivery systems such as small monolayer vesicles, large monolayer vesicles, and multilayer vesicles, respectively. Liposomes can be formed from various phospholipids, including cholesterol, stearylamine, or phosphatidylcholine. In some embodiments, the lipid component membrane is hydrated with an aqueous solution of the drug to form a lipid layer that encapsulates the drug. This is well known to those skilled in the art. For example, the nucleic acid molecules described herein may be provided as complexes with lipophilic compounds or non-immunogenic high molecular weight compounds constructed using methods known in the art. Furthermore, liposomes may harbor such nucleic acid molecules on their surface to target and deliver cytotoxic agents internally and mediate cell killing. Examples of nucleic acid-related complexes are provided in U.S. Patent No. 6,011,020.

[0223] The pharmaceuticals, pharmaceutical compositions, and nucleic acid molecules of the present invention can each be linked to soluble polymers as targetable drug carriers. Examples of such polymers include polyvinylpyrrolidone, pyran copolymers, polyhydroxypropyl-methacrylamide-phenol, polyhydroxyethyl aspanamidephenol, or polyethylene oxide polylysine substituted with palmitoyl residues. Furthermore, the pharmaceuticals and nucleic acid molecules of the present invention can each be linked to a class of biodegradable polymers useful for achieving controlled drug release, such as crosslinked or amphiphilic block copolymers of polylactic acid, polyepsilon-caprolactone, polyhydroxybutyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates, and hydrogels.

[0224] If desired, the administered pharmaceutical composition and drug may each contain small amounts of non-toxic auxiliary substances such as wetting agents or emulsifiers, pH buffers, and other substances such as sodium acetate and triethanolamine oleate.

[0225] The drug regimens utilizing the nucleic acid molecules, pharmaceuticals, or pharmaceutical compositions of the present invention are selected according to various factors, including the patient's type, species, age, weight, sex, and medical condition, the severity of the condition being treated, the route of administration, the patient's renal and hepatic function, and the specific aptamer or salt thereof used. A typical, experienced physician or veterinarian can easily determine and prescribe the effective dose of the drug necessary to prevent, counteract, or halt the progression of the condition.

[0226] The effective plasma level of nucleic acid according to the present invention is preferably in the range of 500 fM to 500 μM in the treatment of any of the diseases disclosed herein.

[0227] The nucleic acid molecules, pharmaceuticals, and pharmaceutical compositions of the present invention may, preferably, be administered once daily, every two or three days, weekly, every two weeks, once a month, or every three months.

[0228] It is within the scope of the present invention that the pharmaceuticals described herein constitute the pharmaceutical compositions disclosed herein.

[0229] In a further embodiment, the present invention relates to a method for treating a subject requiring such treatment, thereby comprising administering a pharmaceutically active amount of at least one nucleic acid molecule according to the present invention. In one embodiment, the subject is suffering from or at risk of developing a disease, thereby the disease being any of those disclosed herein, in particular any of those disclosed in connection with the use of any of the nucleic acids according to the present invention for the manufacture of pharmaceuticals.

[0230] It should be understood that the nucleic acids and antagonists according to the present invention can be used not only as pharmaceuticals or for the manufacture of pharmaceuticals, but also for cosmetic purposes, particularly in relation to the involvement of CXCL8 in inflammatory topical skin lesions. Therefore, further conditions or diseases for which the nucleic acids, pharmaceuticals and / or pharmaceutical compositions according to the present invention can be used for treatment or prevention are topical inflammatory skin lesions.

[0231] Naturally, since the CXCL8-binding nucleic acid molecule according to the present invention interacts with or binds to human CXCL8, those skilled in the art will generally understand that the CXCL8-binding nucleic acid molecule according to the present invention can be readily used in the manufacture of CXCL8 detection and diagnostic agents or biosensors.

[0232] Preferably, as used herein, diagnostic agents or diagnostic means or biosensors are suitable for directly or indirectly detecting CXCL8, preferably the CXCL8 described herein, more preferably the CXCL8 described herein in relation to the various disorders and diseases described herein. Diagnostic agents or biosensors are, but are not limited to, suitable for the detection and / or follow-up of any of the disorders and diseases described herein. Such detection is possible via the binding of nucleic acids to CXCL8 according to the present invention. Such binding can be detected directly or indirectly, thereby the nucleic acid molecule may or may not contain a modifying group. In one preferred embodiment, the modifying group enables the immobilization of the nucleic acid. In another preferred embodiment, the modifying group is a label. Each of the respective methods and means is known to those skilled in the art.

[0233] In one embodiment, the nucleic acid of the present invention is immobilized on the surface of a reaction vessel of a diagnostic agent, the surface of a device contained in a reaction vessel of a diagnostic agent, or the surface of a biosensor by any means known to those skilled in the art (such as non-covalent or covalent linkage).

[0234] In preferred embodiments, the nucleic acids according to the present invention are immobilized by covalent linkage to a surface. Therefore, it is within the scope of the present invention that the nucleic acid molecules of the present invention include modifying groups that enable the immobilization of the nucleic acid molecules to a surface. Such modifying groups for covalent linkage include, but are not limited to, (activated) carboxyls, hydroxyls, phosphatidyls, sulfonic acid esters, amines, thiols, epoxides, alkynes, strained cycloalkynes (e.g., dibenzocyclooctyl, DBCO; bicyclo[6.1.0]non-4]-yin, BCN; or azadibenzocyclooctin, ADIBO), maleimides, azides, and hydrazides.

[0235] Such covalent couplings can be formed, for example, by activated carboxyl groups reacting with primary amines (e.g., EDC / NHS activation), by maleimides reacting with thiol groups, by copper-catalyzed azido-alkene cycloaddition (click chemistry), and by copper-free click chemistry such as, but not limited to, copper-free azide-strain alkyne cycloaddition, alkene azide [3+2] cycloaddition, alkene-tetrazine reverse demand Diels-Alder, and alkene-tetrazole photoclick reactions, or by direct coupling of thiolation probes on a gold surface. It is within the scope of this embodiment that such methods are not limited to a specific shape and that the reactive group can be located on either the surface or the nucleic acid.

[0236] In preferred embodiments, the nucleic acids of the present invention are linked to the azide-functionalized surface of the biosensor by strain-enhanced azide-alkyne cycloaddition (click chemistry). Thus, the surface is functionalized with azides, and the oligonucleotides are functionalized, preferably at their 5' or 3' ends, with strain alkynes, such as dibenzocyclooctyl, DBCO; bicyclo[6.1.0]non-4-yne (BCN), and azadibenzocyclooctin (ADIBO). Alternatively, the reverse configuration may be used, namely, a strain-alkyne-functionalized biosensor surface and azide-modified nucleic acids.

[0237] In another embodiment, the nucleic acids according to the present invention are immobilized by non-covalent linkage. Therefore, it is within the scope of the invention that the nucleic acid molecules of the present invention include modifying groups that enable immobilization of the nucleic acid molecule onto the surface, thereby making this linkage reversible. Such modifying groups for non-covalent linkage include, but are not limited to, biotin (linking to avidin, streptavidin, or neutravidin), bromodesoxyuridine (linking to anti-bromodesoxyuridine antibodies), digoxigenin (linking to anti-digoxigenin antibodies), and oligonucleotides (linking to complementary oligonucleotides). The unblocked 3' end of an oligonucleotide can function as a primer for polymerase or as an acceptor for another nucleic acid in a ligase reaction. It is within the scope of this embodiment that such methods are not limited to a specific shape and that the reactive group can be located on either the surface or the nucleic acid.

[0238] It is within the scope of the present invention that the nucleic acid molecules of the present invention are not immobilized but are used in solution and include modifying groups, preferably referred to herein as labels, that enable the detection of the nucleic acid molecules. Examples of such labels, but not limited to, include biotin (bound to avidin, streptavidin, or neutraavidin), bromodesoxyuridine (bound to anti-bromodesoxyuridine antibodies), digoxigenin (bound to anti-digoxigenin antibodies), oligonucleotides (bound to complementary oligonucleotides), fluorescent labels (e.g., fluorescein, Cy-3, Cy-5), electrochemiluminescent labels, radioactive labels, enzymatic labels, UV labels, colloidal gold, nanoparticles, and chelator molecule labels.

[0239] In further embodiments, the diffusion molecule of the present invention comprises a non-nucleoside, preferably a single-unit or repeated ethylene glycol, such as triethylene glycol (TEG), hexaethylene glycol (HEG), or even polyethylene glycol (PEG), which is a hydrophilic linker capable of binding nucleic acids and modifying groups.

[0240] In relation to the detection of CXCL8, preferred methods include setting up direct binding, sandwich binding assays, competitive binding assays, or lateral flow assays for CXCL8.

[0241] In one embodiment, CXCL8 is detected by direct binding of immobilized nucleic acid to CXCL8. The direct binding according to the present invention is a method that uses only the nucleic acid according to the present invention and does not use a second molecule that interacts with CXCL8.

[0242] One form of the sandwich-binding assay involves the formation of an immobilized complex of CXCL8 with a nucleic acid molecule according to the present invention containing a modifying group for immobilization, thereby immobilizing the complex on the surface of a reaction vessel of a diagnostic agent, the surface of a device contained in a reaction vessel of a diagnostic agent, or the surface of a biosensor, thereby preferably detecting the complex. Detection of CXCL8 from the complex is within one embodiment. Each detection means conforming to this requirement is, for example, specific to that portion (epitope)(plural) of CXCL8 that is not detected by the nucleic acid molecule of the present invention, and is any detection means selected from the group including nucleic acids, polypeptides, proteins, and antibodies, the generation of which is known to those skilled in the art. Methodologies for such sandwich-binding assays are known to those skilled in the art.

[0243] It is within the scope of the sandwich-binding assay embodiment that the detection means may be in an inverse shape immobilized on the surface of the diagnostic reaction vessel, the surface of a device contained in the diagnostic reaction vessel, or the surface of a biosensor in order to form a complex with CXCL8 provided in the sample, and the complex is detected by the nucleic acid molecule of the present invention. It is within the scope of this embodiment that the nucleic acid molecule according to the present invention may be labeled or unlabeled. Detection of the unlabeled nucleic acid molecule may preferably involve the use of a second detection means selected from the group including nucleic acids, polypeptides, proteins and embodiments in the various embodiments described herein. Such a detection means is preferably specific to the nucleic acid according to the present invention.

[0244] Finally, the present invention also includes the detection of a second detection means using a third detection means, preferably the third detection means being linked to an enzyme and more preferably exhibiting an enzymatic reaction upon detection of the second detection means, or the third detection means being a means for detecting radiation, more preferably radiation emitted by a radionuclide. Preferably the third detection means specifically detects and / or interacts with the second detection means.

[0245] In further embodiments, the binding of the nucleic acid molecule according to the present invention to CXCL8 is detected in a competitive assay. In this specification, an immobilized oligonucleotide probe complementary to a portion of the nucleic acid molecule according to the present invention competes with the complex formation between the nucleic acid and CXCL8, thereby preventing the nucleic acid molecule from being immobilized on the surface in such embodiments. Alternatively, immobilized CXCL8 competes with the complex formation between the nucleic acid and CXCL8, thereby preventing the nucleic acid molecule from being immobilized on the surface in such embodiments. In further embodiments, the nucleic acid molecule according to the present invention is immobilized on a surface, and the binding of CXCL8 to the immobilized nucleic acid molecule according to the present invention is competed with an oligonucleotide probe complementary to a portion of the nucleic acid molecule according to the present invention. Methodologies for such assays are known to those skilled in the art.

[0246] With regard to the detection of CXCL8, a more preferred embodiment is the use of nucleic acid molecules according to the present invention for the manufacture of a biosensor. By definition, a biosensor is an analytical device used for the detection of an analyte such as CXCL8, and combines a biological component such as a nucleic acid according to the present invention with a physicochemical detector. The transducer or detector element that converts one signal to another operates in a physicochemical way such as optical, piezoelectric, electrochemical, or electrochemiluminescence, resulting from the interaction between CXCL8 and the biological component. The biosensor may include at least one biological component covalently immobilized on the biosensor surface. The at least one biological component covalently immobilized on the biosensor surface is a nucleic acid or CXCL8 according to the present invention, comprising a modifying group for immobilization, means for specifically binding to its epitope(s) of CXCL8 not bound by the nucleic acid of the present invention, and an oligonucleotide probe complementary to the nucleic acid of the present invention. If the nucleic acid of the present invention is not immobilized on the surface of the biosensor, the nucleic acid of the present invention may or may not include a modifying group that is a label.

[0247] The biosensor surface or diagnostic reagent surface can be selected from the group consisting of gold, silver, titanium, zirconium, vanadium, chromium, manganese, cobalt, tungsten, molybdenum, platinum, aluminum, iron, steel, copper, nickel, silicon, germanium, indium phosphide, gallium arsenide, and oxides, nitrides or alloys or mixtures of the aforementioned materials, indium tin oxide, vitreous carbon, sapphire, and silicate or borate glass.

[0248] These surfaces may be further modified by polylysine, aminosilane, epoxysilane, nitrocellulose, carboxydextran, carbon nanomembrane, graphene oxide, aminographene, carbon surfaces, such as carbon black, carbon fiber, carbon plate, carbon cloth, activated carbon, glassy carbon, charcoal, activated carbon, graphite powder, graphite fibers, carbon nanotubes, fullerene, carboxyl groups, azide groups, thiol groups, hydroxyl groups, epoxides, maleimides, alkynes, strained alkynes, or combinations thereof.

[0249] In a preferred embodiment, a nucleic acid molecule according to the present invention, including a modifying group for immobilization, is immobilized on the surface of a biosensor for direct detection of CXCL8 or for detection of CXCL8 in a sandwich assay format or a competitive assay format. In another preferred embodiment, a detection means specific to its epitope(s) of CXCL8 not detected by the nucleic acid(s) of the present invention, an oligonucleotide probe complementary to the nucleic acid(s) of the present invention or CXCL8, is immobilized on the surface of a biosensor, and the labeled or unlabeled nucleic acid according to the present invention(s) is used for detection in a sandwich assay format or a competitive assay format.

[0250] Diagnostic means and detection systems in biosensors can be based, for example, on optical readout (fluorescence, absorption, and emission), mass change (e.g., quartz crystal microbalance, microelectromechanical system), refractive index (surface plasmon resonance, ring resonator, elliptic measurement), electric charge (electrochemical impedance, voltammetry, amperometry, potentiometric measurement, or conductivity, field-effect transistor), surface stress (cantilever biosensor), and atomic force microscopy.

[0251] In further embodiments, nucleic acid molecules according to the present invention are used in sandwich or competitive lateral flow assays. Methodologies for such lateral flow assays are known to those skilled in the art.

[0252] In further embodiments, the binding of the nucleic acid molecule according to the present invention to CXCL8 is detected in a homogeneous assay with a nucleic acid probe complementary to the portion of the nucleic acid molecule according to the present invention, thereby, in such embodiments, the nucleic acid molecule is not immobilized on the surface. Hereinafter, hybridization results in a change in the fluorescence signal of two fluorophore groups linked to the nucleic acid, preferably a change in intensity, and hybridization competes with complex formation between the nucleic acid of the present invention and CXCL8. The two fluorophore groups are either both linked to a nucleic acid probe (molecular beacon), or one is linked to the probe and the other is linked to the nucleic acid of the present invention. In further embodiments, one or two fluorophore groups are linked to the nucleic acid of the present invention, and complex formation with CXCL8 results in a change in the fluorescence signal, preferably a change in intensity. Methodologies for such assays are known to those skilled in the art.

[0253] The nucleic acid molecules according to the present invention can be further used as starting materials for drug design. Basically, there are two possible approaches. One approach is screening a compound library, which is preferably a low molecular weight compound library. In one embodiment, the screening is a high-throughput screening. Preferably, high-throughput screening is a rapid and efficient trial-and-error evaluation of compounds in a target-based assay. In best case, the analysis is performed by colorimetric analysis. The libraries used in connection therewith are known to those skilled in the art.

[0254] Alternatively, nucleic acid molecules according to the present invention can be used for rational drug design. Preferably, rational drug design is the design of lead structures for pharmaceuticals. Typically, starting with the three-dimensional structure of a target identified by methods such as X-ray crystallography or nuclear magnetic resonance spectroscopy, a computer program is used to search through a database containing the structures of many different compounds. The selection is made by computer, and the identified compounds can then be tested in the laboratory.

[0255] The rational design of a drug can begin with any of the nucleic acid molecules according to the present invention, and include a structure similar to the structure of the nucleic acid of the present invention, or identical to the binding mediating portion of the structure of the nucleic acid of the present invention, preferably a three-dimensional structure. In either case, such a structure still exhibits the same or similar binding properties as the nucleic acid of the present invention. In either a further or alternative step in the rational drug design, the preferred three-dimensional structure of those portions of the nucleic acid that bind to the neurotransmitter is mimicked by chemical groups different from nucleotides and nucleic acids. This mimicry allows for the design of compounds different from the nucleic acids according to the present invention. Such compounds are preferably small molecules or peptides.

[0256] In the case of screening a compound library using competitive assays known to those skilled in the art, suitable CXCL8 analogs, CXCL8 agonists, or CXCL8 antagonists may be found. Such a competitive assay may be set up as follows: The nucleic acid of the present invention, preferably the target-binding L-nucleic acid Spiegelmer, is linked to a solid phase. To identify CXCL8, analogs labeled with CXCL8 may be added to the assay. Potential analogs compete with the CXCL8 molecule bound to Spiegelmer, which may result in a decrease in the signal obtained by their respective labels. Screening for agonists or antagonists may involve the use of cell culture assays known to those skilled in the art.

[0257] A kit according to the present invention may comprise at least one or more nucleic acid molecules of the present invention. Furthermore, the kit may comprise at least one or more positive or negative controls. A positive control may be, for example, CXCL8, or a nucleic acid of the present invention selected in particular, or one to which it is preferably bound in liquid form. A negative control may be, for example, a peptide defined with respect to similar biophysical properties as CXCL8 but not identified by the nucleic acid of the present invention. Furthermore, the kit may comprise one or more buffers. Various components may be included in the kit in a dried or lyophilized form, or they may be dissolved in liquid. The kit may comprise one or more containers, which may then comprise one or more components of the kit. In further embodiments, the kit may comprise instructions or user manuals providing the user with information on how to use the kit and its various components.

[0258] The pharmaceutically and bioanalytical determination of nucleic acid molecules according to the present invention is fundamental for evaluating their pharmacokinetic and biomechanical profiles in several bodily fluids, tissues, and organs of the human and non-human bodies. For such purposes, any detection method disclosed herein or known to those skilled in the art can be used. In a further aspect of the present invention, a sandwich hybridization assay for detecting nucleic acids according to the present invention is provided. In the detection assay, a capture probe and a detection probe are used. According to the present invention, the capture probe is complementary to a first portion of the nucleic acid, and the detection probe is complementary to a second portion of the nucleic acid. Both the capture probe and the detection probe may be formed from DNA nucleotides, modified DNA nucleotides, modified RNA nucleotides, RNA nucleotides, LNA nucleotides, and / or PNA nucleotides.

[0259] Accordingly, the capture probe comprises a sequence stretch complementary to the 5' end of the nucleic acid molecule according to the present invention, and the detection probe comprises a sequence stretch complementary to the 3' end of the nucleic acid molecule according to the present invention. In this case, the capture probe is immobilized on a surface or matrix via its 5' end, thereby the capture probe can be immobilized directly at its 5' end or via a linker between its 5' end and the surface or matrix. However, in principle, the linker can be attached to each nucleotide of the capture probe. The linker can be formed by a hydrophilic linker of those skilled in the art, or by D-DNA nucleotides, modified D-DNA nucleotides, D-RNA nucleotides, modified D-RNA nucleotides, D-LNA nucleotides, PNA nucleotides, L-RNA nucleotides, L-DNA nucleotides, modified L-RNA nucleotides, modified L-DNA nucleotides and / or L-LNA nucleotides.

[0260] Alternatively, the capture probe comprises a sequence stretch complementary to the 3' end of the nucleic acid molecule according to the present invention, and the detection probe comprises a sequence stretch complementary to the 5' end of the nucleic acid molecule according to the present invention. In this case, the capture probe is immobilized on a surface or matrix via its 3' end, thereby the capture probe can be immobilized directly at its 3' end or via a linker between its 3' end and the surface or matrix. However, in principle, the linker can be linked to each nucleotide in the sequence stretch complementary to the nucleic acid according to the present invention. The linker can be formed by a hydrophilic linker of those skilled in the art, or by D-DNA nucleotides, modified D-DNA nucleotides, D-RNA nucleotides, modified D-RNA nucleotides, D-LNA nucleotides, PNA nucleotides, L-RNA nucleotides, L-DNA nucleotides, modified L-RNA nucleotides, modified L-DNA nucleotides, and / or L-LNA nucleotides.

[0261] The number of nucleotides in the capture probe and detection probe that can hybridize to the nucleic acid molecule according to the present invention is variable and may depend on the number of nucleic acids in the capture probe and / or detection probe, and / or the number of nucleotides in the nucleic acid according to the present invention itself. The total number of nucleotides in the capture probe and detection probe that can hybridize to the nucleic acid according to the present invention should be the maximum number of nucleotides that make up the nucleic acid according to the present invention. The minimum number of nucleotides (2 to 10 nucleotides) in the detection probe and capture probe allows hybridization to the 5' or 3' end, respectively, of the nucleic acid according to the present invention. In order to achieve high specificity and selectivity between the nucleic acid according to the present invention and other nucleic acids present in the sample being analyzed, the total number of nucleotides in the capture probe and detection probe should be the number of nucleotides that make up the nucleic acid molecule according to the present invention, or the maximum number thereof.

[0262] Furthermore, the detection probe preferably carries a marker molecule or label that can be detected as described herein. The label or marker molecule can, in principle, be linked to each nucleotide of the detection probe. Preferably, the label or marker is positioned at the 5' or 3' end of the detection probe so that a linker can be inserted between the nucleotide in the detection probe and the label, which is complementary to the nucleic acid molecule according to the present invention. The linker can be formed by a hydrophilic linker of those skilled in the art, or by D-DNA nucleotides, modified D-DNA nucleotides, D-RNA nucleotides, modified D-RNA nucleotides, D-LNA nucleotides, PNA nucleotides, L-RNA nucleotides, L-DNA nucleotides, modified L-RNA nucleotides, modified L-DNA nucleotides and / or L-LNA nucleotides.

[0263] The nucleic acid detection according to the present invention can be carried out as follows: The nucleic acid molecule according to the present invention hybridizes one end to a capture probe and the other end to a detection probe. The unbound detection probe is then removed, for example, by one or more washing steps. Preferably, the amount of bound detection probe carrying the labeled or marker molecule can then be measured, as outlined in detail, for example, in International Publication No. 2008 / 052774, incorporated herein by reference.

[0264] Preferably, as used herein, the term treatment includes, in preferred embodiments, additional or alternative prevention and / or follow-up. Preferably, as used herein, the terms disease and disorder shall be used interchangeably unless otherwise indicated.

[0265] Where used herein, the term “including” is preferably not intended to limit the subject matter that follows or is described. However, in alternative embodiments, the term “including” should be understood to mean including, and therefore limiting, the subject matter that follows or is described.

[0266] The various sequence numbers, the chemical properties of the nucleic acid molecules according to the present invention and the target molecule CXCL8 used herein, their actual sequences, and internal reference numbers are summarized in the table below. [Table 1] TIFF0007857029000003.tif239161TIFF0007857029000004.tif238161

[0267] The features of the present invention disclosed herein, in the claims, in the sequence listing and / or in the drawings may be materials for realizing the invention in its various forms, both individually and in any combination thereof.

[0268] The present invention is further illustrated by figures, examples, and sequence listings, which may provide further features, embodiments, and advantages. [Brief explanation of the drawing]

[0269] [Figure 1] This figure shows the sequence alignment of nucleic acid molecules capable of binding to human CXCL8, including KD values ​​determined by competitive pull-down binding assays. [Figure 2] This figure shows the truncated derivatives of the nucleic acid molecule 315-F8-001, including their KD values ​​and relative binding activity to human CXCL8, as determined by competitive pull-down binding assays and / or surface plasmon resonance measurements. [Figure 3] This figure shows the kinetic evaluation of D-nucleic acid molecules 315-F8-001 and 315-F8-002 to D-CXCL8 using a competitive pull-down binding assay. [Figure 4] This figure shows the binding of the nucleic acid molecule 315-F8-002 to CXCL8 at (A) 25°C and (B) 37°C, as determined by surface plasmon resonance (SPR) measurements. The association constant ka and dissociation constant kd are obtained. [Figure 5] This figure shows the binding of the nucleic acid molecule 315-F8-002-PEG to CXCL8 at (A) 25°C and (B) 37°C, as determined by surface plasmon resonance (SPR) measurements. The association constant ka and dissociation constant kd are obtained. [Figure 6] This figure shows the selectivity of 315-F8-002 binding to CXCL8, as determined by a competitive binding assay using surface plasmon resonance. [Figure 7] This figure shows the inhibition of CXCL8-inducible chemotaxis in CXCR2-expressing cells by the nucleic acid molecule 315-F8-002-PEG. [Figure 8] These bar graphs show the quantification of CXCL8 using nucleic acid molecule 315-F8-002 (Figure 8A) and the quantification of CCL5 using nucleic acid molecule 315-F8-002 (Figure 8B). [Figure 9]This bar graph shows the binding of L-aptamer 315-F8-002 (Figure 9A) and aptamer 8A-35 (Figure 9B) to soluble CXCL8 and CXCL1 at different concentrations. Example 1: CXCL8 Nucleic acid capable of binding to human CXCL8

[0270] Several CXCL8-binding nucleic acids and their derivatives were identified, and their nucleotide sequences are shown in Figures 1 and 2. The CXCL8-binding nucleic acids were tested as D-aptamers (D-nucleotides) and L-aptamers (L-nucleotides), and the D-nucleotides and L-nucleotides were synthesized as described in Example 2.

[0271] CXCL8-bound nucleic acids are a) As shown in Example 3, the D-aptamer was obtained by a pull-down binding assay to biotinylated D-CXCL8 (SEQ ID NO: 1), b) L-CXCL8 (SEQ ID NO: 2) was characterized as an L-aptamer by surface plasmon resonance (SPR) measurement (Example 4) and by an in vitro assay using cells expressing the human CXCR2 receptor (Example 5). The nucleic acids generated in this way exhibit slightly different sequences, which allows the sequences to be grouped or combined into sequence families. The definition of a nucleotide sequence motif uses the IUPAC abbreviation for ambiguous nucleotides: S Strong G or C; W is a weak A or U(T); R Pudding G or A; Y pyrimidine C or U(T); K keto G or U(T); M is an imino A or C; Not BA; C or U(T) or G; Not DC; A, G, or U(T); Not HG; A, C, or (T); Not VU; A, C, or G; N All A or G or C or U(T)

[0272] Unless otherwise indicated, any nucleic acid sequence or stretch sequence is shown in the 5'→3' direction, respectively.

[0273] As shown in Figures 1 and 2, CXCL8-binding nucleic acids contain a central stretch of one nucleotide that defines a potential CXCL8-binding motif, so that Figure 1 shows different sequences of the sequence family, and Figure 2 shows truncated derivatives of CXCL8 nucleic acid 315-F8-001, such as CXCL8 nucleic acid 315-F8-002-PEG.

[0274] Generally, CXCL8-binding nucleic acid molecules contain 5' and 3' end stretches of the nucleotide, i.e., the first end stretch and the second end stretch of the nucleotide. The first and second end stretches of the nucleotide can hybridize with each other, thereby forming a double-stranded structure upon hybridization. However, such hybridization is not always conferred intramolecularly in vivo and in vitro.

[0275] The three nucleotide stretches of a CXCL8-bound nucleic acid molecule (the first terminal stretch of the nucleotide, the central stretch of the nucleotide, and the second terminal stretch of the nucleotide) are aligned to each other in the 5'->3' direction: first terminal stretch of the nucleotide - central stretch of the nucleotide - second terminal stretch of the nucleotide. However, instead, the first terminal stretch of the nucleotide, the central stretch of the nucleotide, and the second terminal stretch of the nucleotide are aligned to each other in the 5'->3' direction: second terminal stretch of the nucleotide - central stretch of the nucleotide - first terminal stretch of the nucleotide.

[0276] The defined stretch sequences may differ among CXCL8-binding nucleic acid molecules, thereby affecting their binding affinity to CXCL8. Based on binding analyses of different CXCL8-binding nucleic acid molecules, the nucleotide central stretches and their nucleotide sequences described below are essential for binding to CXCL8, individually, or more preferably, as a whole.

[0277] CXCL8-binding nucleic acids are composed of ribonucleotides (as shown in Figures 1 and 2).

[0278] As shown in Figure 1, the sequences of the central stretch of nucleotides in CXCL8-binding nucleic acids 315-H9-001, 315-F11-001, and 315-F8-001 are slightly different: 5'GGAAGUACGUGGAAAGCCAAUGAGUGUGUCCCG3'(315-H9-001), 5'GGAAGUACGUGGAAAGCCGAUGAGUGUGUCCCG3'(315-F11-001), 5'GGAAGUACGUGGAAAGCCGAAAGUGUGUCCCG3'(315-F8-001).

[0279] The central stretch of nucleotides in the CXCL8-bound nucleic acid according to the present invention contains 32-33 nt, and the consensus sequence is: 5'GGAAGUACGUGGAAAGCCRA(X U )RAGUGUGUCCCG 3' can be combined into this, and in the formula, X U It is either U or does not exist.

[0280] A CXCL8-binding nucleic acid having the best binding affinity to CXCL8, i.e., a CXCL8-binding nucleic acid having the highest binding affinity to CXCL8 or the lowest dissociation constant Kd of CXCL8, including a central stretch of nucleotides containing the sequences 5'GGAAGUACGUGGAAAGCCGAAAGUGUGUCCCG3'(315-F8-001) and 5'GGAAGUACGUGGAAAGCCAAUGAGUGUGUCCCG3'(315-H9-001), thereby resulting in the central stretch of nucleotides having the sequence 5'GGAAGUACGUGGAAAGCCGAAAGUGUGUCCCG3'(315-F8-001) resulting in the best binding affinity of the CXCL8 nucleic acid to CXCL8.

[0281] As shown in Figures 1 and 2, the first and second terminal stretches of nucleotides in CXCL8-bound nucleic acids contain 6, 5, 4, or 3 nucleotides, thereby allowing the stretches to hybridize with each other as desired, thereby forming a double-stranded structure upon hybridization. This double-stranded structure can consist of 6, 5, 4, or 3 base pairs. However, such hybridization is not necessarily achieved intramolecularly.

[0282] As shown in Figure 1, the first and second stretches of nucleotides in the CXCL8-binding nucleic acids 315-H9-001, 315-F11-001, and 315-F8-001 each contain six nucleotides. a) The first terminal stretch of the CXCL8-bound nucleic acids 315-H9-001 and 315-F8-001-nucleotides contains the nucleotide sequence 5'GCUGAC3', and the second terminal stretch of the nucleotides contains the nucleotide sequence 5'GUCAGC3'; b) The first terminal stretch of the CXCL8-bound nucleic acid 315-F11-001-nucleotide contains the nucleotide sequence 5'GCUGAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUGAGC3'.

[0283] As shown in Figure 2, the first and second stretches of nucleotides in the CXCL8-bound nucleic acid contain five, four, or three nucleotides, respectively. a) The first terminal stretch of the CXCL8-bound nucleic acid 315-F8-002-nucleotide contains the nucleotide sequence 5'CUGAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUCAG3'; b) The first terminal stretch of the CXCL8-bound nucleic acid 315-F8-005-nucleotide contains the nucleotide sequence 5'GUGAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUCAC3'; c) The first terminal stretch of the CXCL8-bound nucleic acid 315-F8-003-nucleotide contains the nucleotide sequence 5'UGAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUCA3'; d) The first terminal stretch of the CXCL8-bound nucleic acid 315-F8-006-nucleotide contains the nucleotide sequence 5'GGAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUCC3'; e) The first terminal stretch of the CXCL8-bound nucleic acid 315-F8-007-nucleotide contains the nucleotide sequence 5'GCAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUGC3'; f) The first terminal stretch of the CXCL8-bound nucleic acid 315-F8-008-nucleotide contains the nucleotide sequence 5'GGUC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GACC3'; g) The first terminal stretch of the CXCL8-bound nucleic acid 315-F8-009-nucleotide contains the nucleotide sequence 5'UGGC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GCCA3'; h) The first terminal stretch of the CXCL8-bound nucleic acid 315-F8-004-nucleotide contains the nucleotide sequence 5'GAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUC3'.

[0284] The first and second terminal stretches of nucleotides of all CXCL8-bound nucleic acid molecules tested can be summarized by the following general formula: The general formula for the first terminal stretch of a nucleotide is 5'Z1Z2Z3Z4Z5C3', and the general formula for the second terminal stretch of a nucleotide is 5'GZ6Z7Z8Z9Z'. 10 3', where Z1 is G or does not exist, Z2 is S or does not exist, Z3 is K or does not exist, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M or does not exist, Z9 is S or does not exist, Z 10 is C or does not exist. Therefore, in the first preferred embodiment, q) Z1 is G, Z2 is S, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 is S, Z 10 Is C, or r) Z1 does not exist, Z2 is S, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 is S, Z 10 It does not exist, or s) Z1 does not exist, Z2 does not exist, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 does not exist, Z 10 It does not exist, or t) Z1 does not exist, Z2 does not exist, Z3 does not exist, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 does not exist, Z9 does not exist, Z 10 It does not exist, or u) Z1 does not exist, Z2 is S, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 is S, Z 10 Is C, or v) Z1 does not exist, Z2 does not exist, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 is S, Z 10 Is C, or w) Z1 does not exist, Z2 does not exist, Z3 does not exist, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 is S, Z 10 Is C, or x) Z1 is G, Z2 is S, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 is S, Z 10 It does not exist, or y) Z1 is G, Z2 is S, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 does not exist, Z 10 It does not exist, or z) Z1 is G, Z2 is S, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 does not exist, Z9 does not exist, Z 10 It does not exist, or aa) Z1 does not exist, Z2 is S, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 does not exist, Z 10 It does not exist, or bb) Z1 does not exist, Z2 is S, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 does not exist, Z9 does not exist, Z 10 It does not exist, or cc) Z1 does not exist, Z2 does not exist, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 is S, Z 10 It does not exist, or dd) Z1 does not exist, Z2 does not exist, Z3 does not exist, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 is S, Z 10 It does not exist, or ee)Z1 does not exist, Z2 does not exist, Z3 is K, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 does not exist, Z9 does not exist, Z 10 It does not exist, or ff) Z1 does not exist, Z2 does not exist, Z3 does not exist, Z4 is S, Z5 is D, Z6 is H, Z7 is S, Z8 is M, Z9 does not exist, Z 10 It does not exist.

[0285] CXCL8-binding nucleic acids having the best binding affinity to CXCL8, i.e., CXCL8-binding nucleic acids having the highest binding affinity to CXCL8 or the lowest dissociation constant Kd of CXCL8, include the following nucleotide first and second terminal stretches: a) The first terminal stretch of the CXCL8-bound nucleic acids 315-H9-001 and 315-F8-001-nucleotides contains the nucleotide sequence 5'GCUGAC3', and the second terminal stretch of the nucleotides contains the nucleotide sequence 5'GUCAGC3'; b) The first terminal stretch of the CXCL8-bound nucleic acid 315-F8-002-nucleotide contains the nucleotide sequence 5'CUGAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUCAG3'; c) The first terminal stretch of the CXCL8-bound nucleic acid 315-F8-005-nucleotide contains the nucleotide sequence 5'GUGAC3', and the second terminal stretch of the nucleotide contains the nucleotide sequence 5'GUCAC3'.

[0286] The Kd values ​​of CXCL8-binding nucleic acids 315-F8-001, 315-H9-001, and 315-F11-001 (including the terminal stretch with 6 nucleotides) were measured in the range of 1.5–12.5 nM as determined by competitive pull-down binding assays (Figures 1–3). In direct pull-down assay form, CXCL8-binding nucleic acid 315-F8-001 showed a Kd value of 0.8 nM. Using surface plasmon resonance assay, a more sensitive method for determining Kd values, the Kd of CXCL8-binding nucleic acid 315-F8-001 was 0.22 nM at 25°C and 0.68 nM at 37°C (Figure 2).

[0287] Surprisingly, the shortening of the first terminal stretch from 6 to 5 nucleotides and the second terminal stretch from 6 to 5 nucleotides were found not to adversely affect the binding affinity to CXCL8. When measured by competitive pull-down assay (Kd 1.1 nM; Figures 2 and 3) and surface plasmon resonance assay (Kd 0.22 nM at 25°C, 0.75 nM at 37°C; Figures 2 and 4), the binding affinity of CXCL8-binding nucleic acid 315-F8-002 was within the range of the binding affinity determined for CXCL8-binding nucleic acid 315-F8-001 (see the Kd value for 315-F8-001 above).

[0288] When we attempted to further shorten and / or mutate the terminal stretch of CXCL8-binding nucleic acid 315-F8-002, we obtained CXCL8-binding nucleic acids 315-F8-003, 315-F8-004, 315-F8-006, 315-F8-007, 315-F8-008, and 315-F8-009 having low binding affinity (315-F8-003, 315-F8-004, 315-F8-006, 315-F8-007, 315-F8-008, and 315-F8-009) to CXCL8 (Figure 2).

[0289] For the 5'-40kDa-PEGylated variant of CXCL8-binding nucleic acid 315-F8-002, the Kd of CXCL8-binding nucleic acid 315-F8-002-PEG (also known as AON-S08) was 0.2 nM at 25°C and 0.8 nM at 37°C, as determined by surface plasmon resonance (Figures 2 and 5).

[0290] CXCL8 is one of several ELR-positive human CXC chemokines. In addition to CXCL8, ELR-positive human CXC chemokines CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, and CXCL7 bind to the CXCL8 receptor CXCR2, and ELR-positive human CXC chemokines CXCL6 and CXCL7 also bind to the CXCL8 receptor CXCR1. To demonstrate the specificity and selectivity of the binding properties of CXCL8-binding nucleic acid 315-F8-002, the binding affinity of CXCL8-binding nucleic acid 315-F8-002 to ELR-positive human CXC chemokines CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, and CXCL7 was tested by SPR in a competitive binding assay (Example 4). CXCL8-binding nucleic acid 315-F8-002 did not show binding to other ELR-positive human CXC chemokines CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, and CXCL7 (Figure 6).

[0291] CXCL8-binding nucleic acid 315-F8-002-PEG inhibited CXCL8-inducible chemotaxis in CXCR2-expressing BA / F3 cells with an average inhibition constant IC50 of 0.26 nM (Figure 7, Example 5).

[0292] CXCL8 was detected and quantified using a biosensor equipped with immobilized CXCL8-binding nucleic acid 315-F8-002. The detection limit (mean baseline value + 3x standard deviation of baseline value) was <98 pM CXCL8, and the lower limit of quantification (mean baseline value + 10x standard deviation of baseline value) was also <98 pM CXCL8 (Figure 8A, Example 6). To demonstrate the specificity of immobilized CXCL8-binding nucleic acid 315-F8-002, a different chemokine (CCL5) was used as the analyte. No binding of CCL5 was detected at concentrations up to 12.5 nM (Figure 8B, Example 6). Example 2: Synthesis of D- and L-aptamers Small-scale solid-phase synthesis

[0293] D-aptamers (D-nucleic acid) and L-aptamers (L-nucleic acid) were synthesized by solid-phase synthesis using an ABI394 synthesizer (Applied Biosystems, Foster City, CAUSA) with 2'TBDMS RNA phosphoramidite chemistry (Damha and Ogilvie, 1993). L-rA(N-Bz)-, L-rC(Ac)-, L-rG(N-ibu)-, L-rU-, D-rA(N-Bz)-, D-rC(Ac)-, D-rG(N-ibu)-, and D-rU-phosphoramidites were purchased from ChemGenes, Wilmington, MA. D-aptamers and L-aptamers were purified by gel electrophoresis. Large-scale solid-phase synthesis

[0294] L-aptamers were generated by solid-phase synthesis using an AktaPilot100 synthesizer (Amersham Biosciences; General Electric Healthcare, Freiburg) with 2'TBDMS RNA and DNA phosphoramidite chemistry (Damha and Ogilvie, 1993). L-rA(N-Bz)-, L-rC(Ac)-, L-rG(N-ibu)-, and L-rU- were purchased from ChemGenes (Wilmington, MA). 5'-amino modifiers were purchased from American International Chemicals Inc. (Framingham, MA, USA). Synthesis of unmodified or 5'-amino modified L-aptamers was initiated with L-riboA, L-riboC, L-riboG, or L-riboU, modified CPG pore size 1000A (Link Technology, Glasgow, UK). For RNA phosphoramidite coupling (15 min / cycle), acetonitrile containing 0.3 M benzylthiotetrazole (CMS-Chemicals, Abingdon, UK) and acetonitrile containing 2 equivalents of 0.2 M phosphoramidite solution were used. Oxidative capping cycles were employed. Further standard solvents and reagents for oligonucleotide synthesis were purchased from Biosolve (Valkenswaard, NL). L-aptamers were synthesized in DMT-ON, deprotected, and purified by preparative RP-HPLC (Wincott et al., 1995) using Sourcel5RPC medium (Amersham). The 5'DMT group was removed with 80% acetic acid (RT 30 min). For 5' amino-modified L-aptamers, the 5'MMT group was removed with 80% acetic acid (RT 90 min). Subsequently, a 2M NaOAc aqueous solution was added, and the L-aptamer was desalted by tangential flow filtration using a 5K regenerated cellulose membrane (Millipore, Bedford, MA). PEGylation of L-aptamers

[0295] To extend the plasma residence time of L-aptamers in vivo, the L-aptamers were covalently linked at their 5' end to a 40kDa polyethylene glycol (PEG) moiety. For PEGylation (see European Patent Application No. 1306382 for technical details of the PEGylation method), the purified 5' amino-modified L-aptamers were dissolved in a mixture of H2O (2.5 ml), DMF (5 ml), and buffer A (5 ml; prepared by mixing citrate·H2O [7 g], ​​boric acid [3.54 g], phosphoric acid [2.26 ml], and 1 M NaOH [343 ml], adding water to bring the final volume to 1 L, and adjusting the pH to 8.4 with 1 M HCl).

[0296] The pH of the L-aptamer solution was adjusted to 8.4 with 1M NaOH. Next, 40kDa PEG-NHS ester (Jenkem Technology, Allen, TX, USA) was added in six 0.25 equivalent portions every 30 minutes at 37°C until a maximum yield of 75–85% was achieved. During the addition of the PEG-NHS ester, the pH of the reaction mixture was maintained at 8–8.5 with 1M NaOH.

[0297] The reaction mixture was mixed with 4 ml of urea solution (8 M) and 4 ml of buffer B (H2O containing 0.1 M triethylammonium acetate) and heated to 95°C for 15 minutes. Next, the PEGylated L-aptamers were purified by RP-HPLC using Source 15 RPC medium (Amersham) with an acetonitrile gradient (buffer B; buffer C: acetonitrile containing 0.1 M triethylammonium acetate). Excess PEG was eluted with 5% buffer C, and the PEGylated L-aptamers were eluted with 10–15% buffer C. The product fractions with a purity of over 95% (assessed by HPLC) were combined and mixed with 40 ml of 3 M NaOAc. The PEGylated L-aptamers were desalted by tangential flow filtration (5K regenerated cellulose membrane, Millipore, Bedford MA). Example 3: Pull-down coupling assay Direct pull-down assay for determining the binding constant of D-aptamers

[0298] The affinity of the D-aptamer for D-CXCL8(C-bio)(SEQ ID NO: 1) is determined using a direct pull-down assay. For this purpose, the D-aptamer is [γ- 32 The D-aptamers were radiolabeled with T4 polynucleotide kinase (Invitrogen, Karlsruhe, Germany) using P]-ATP (Hartmann Analytic, Braunschweig, Germany). The specific activity of the labeled D-aptamers was 110,000–300,000 cpm / pmol. The labeled D-aptamers were incubated at 0.2 nM in selective buffer (20 mM Tris, pH 7.4, 150 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, 0.1% Tween 20, 100 μg / ml essential fatty acid-free bovine serum albumin, 200 μg / ml yeast RNA) with various amounts of D-CXCL8 (C-bio) ranging from 0.0192 to 300 nM for 1.5–2 hours at 37°C. The D-CXCL8(C-bio) / D-aptamer complex is immobilized on NAag+ beads (Neutravidin agarose plus, Pierce Biotechnology, Rockford, USA) pre-equilibrated with a selective buffer. After removing the supernatant and washing appropriately, the radioactivity bound to the beads is measured using a scintillation counter (LS6500; Beckman Coulter, Fullerton, USA). The amount of immobilized and labeled D-aptamer (intake rate) is plotted against the concentration of D-CXCL8(C-bio), and the dissociation constant Kd is obtained using a software algorithm (GRAFIT; Erithacus Software; Surrey UK) assuming a 1:1 stoichiometry.

[0299] For CXCL8-conjugated aptamers 315-H9-001 and 315-F8-001, Kd values ​​of 1.7 nM and 0.8 nM were determined by direct pull-down assays, respectively. Competitive pull-down assay for ranking and determining D-aptamer binding constants

[0300] The competitive pull-down assay is used to compare the affinity of different D-CXCL8(C-bio)-binding D-aptamers. For this purpose, a reference D-aptamer was radiolabeled (as described above), immobilized in NAag+, washed (e.g., 3 nM D-CXCL8(C-bio), 0.15 nM labeled D-aptamer), and incubated at 37°C with a selection buffer containing D-CXCL8(C-bio) under conditions that yielded an unsaturated binding signal. By adding an excess amount of unlabeled D-aptamer that competes with the labeled D-aptamer for binding to D-CXCL8(C-bio), the amount of bead-binding radioactivity after immobilization and washing is reduced. The degree of signal reduction depends on the amount and affinity of the unlabeled D-aptamer. The competitive pull-down assay is used for ranking experiments and determining the dissociation constant (Kd) of the selected D-aptamer. The dissociation constant Kd is determined by plotting the percentage of labeled D-aptamers bound to D-CXCL8(C-bio) against the concentration of unlabeled competing D-aptamers. Data analysis was performed using GRAFIT.

[0301] The results of the pull-down binding assay are specified in Example 1 and are shown in Figures 1, 2, and 3, using CXCL8 nucleic acid 315-F8-001 as the labeled D-aptamer. Example 4: Surface Plasmon Resonance (SPR) Coupled Assay

[0302] Surface plasmon resonance measurements were performed using a Biacore2000 instrument (GE Healthcare) set to a constant temperature of 25°C or 37°C. Proteins were immobilized on CM4 sensor chips (GE Healthcare) by amine coupling. The surface of the sensor chips was activated by injecting a 1:1 mixture of 0.4M EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide; GE) and 0.1M NHS (N-hydroxysuccinimide; GE). The maximum response observed for covalently immobilized peptides or proteins was approximately 500 RU. Flow cells were blocked with 1M ethanolamine hydrochloride (GE, BR-1000-50). Non-covalently bonded peptides or proteins were also removed using this procedure. Flow cells with untreated dextran surfaces and flow cells with ethanolamine-blocked surfaces served as controls. Prior to measurement, the sensor tip was primed twice with deaerated physiological running buffer (20 mM Tris pH 7.4, 150 mM NaCl, 5 mM KCl, 1 mM MgCl2, and 1 mM CaCl2), and at least three injection and regeneration (5 M NaCl) cycles were performed.

[0303] The binding affinity of the L-aptamer was measured by injection of a concentration series of 1000, 500, 250, 125, 62.5, 31.3, 15.6, 7.8, 3.9, 1.95, 0.98, 0.49, 0.24, 0.12, and 0.06 nM, and by associating binding events and recording dissociation stages. The obtained binding curves were fitted to a Langmuir 1:1 stoichiometric binding model to determine the binding rate constant (binding constant ka; dissociation constant kd) used in the calculation of the dissociation constant (Kd = kd / ka). Data analysis was performed using constant refractive index (RI) values ​​and 1 x 10 e7 (RU·M- 1 s- 1 The evaluation was performed using the BIAevaluation 3.1.1 software (BIACORE AB, Uppsala, Sweden) with the initial mass transfer coefficient kt of ).

[0304] The selectivity of L-aptamer binding was evaluated by a competitive binding assay. For this purpose, human chemokines CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, CXCL7, and CXCL8 (purchased from RnD Systems, PeproTech, or ProSpecTech) were individually injected at 40 nM with the L-aptamer CXCL8-binding nucleic acid 315-F8-002 (0.25 nM) to compete for L-aptamer binding to immobilized CXCL8. As a control, chemokines were injected in the absence of L-aptamers to monitor binding to the sensor chip dextran matrix and / or immobilized CXCL8. Binding of 315-F8-002 to immobilized CXCL8 was recorded at a predefined reporting point 240 seconds after the end of injection. The selected chemokines were immobilized, and the binding affinity of the L-aptamer of CXCL8-binding nucleic acid 315-F8-002 was determined as described above. The results of the SPR binding assay are specified in Example 1 and are shown in Figures 2, 4, 5, and 6. Example 5: In Vitro Pharmacology - Chemotaxis Assay

[0305] BA / F3 mouse pro-B cell lines were stably transfected using a plasmid encoding human CXCR2. For cell chemotaxis assays, recombinant CXCL8 (0.5 nM) was pre-incubated with the L-aptamer of CXCL8-conjugated nucleic acid 315-F8-002-PEG at the indicated concentrations in HBH buffer (Hanks equilibrium salt solution (HBSS) + 1 mg / ml BSA + 20 mM HEPES) for 20–30 minutes at 37°C in the lower compartment of a 5 μm pore 96-well Corning Transwell plate (Costar Corning, NY). +Cells were added to the upper compartment in HBH buffer and incubated at 37°C for 3 hours. After removing the upper compartment, PBS containing 50 μM rezazrin (Sigma-Aldrich) was added to the lower compartment and incubated at 37°C for 2.5 hours. Fluorescence was measured at 590 nm (excitation wavelength 544 nm). Background-corrected and normalized fluorescence values ​​were plotted against L-aptamer concentration. Inhibition constant IC50 50 The value (the L-aptamer concentration required for half of the maximum inhibition) was determined by nonlinear regression (4-parameter fit) using Prism 5 software (GraphPad Software, San Diego, CA).

[0306] The results of the chemotactic assay are shown in Example 1 and Figure 7. Example 6: CXCL8 Biosensor

[0307] SPR sensor tips coated with azide-terminated carbonanomembranes were prepared, and the CXCL8-conjugated L-aptamer 315-F8-002-DBCO (a DBCO-modified variant of 315-F8-002-amino) was immobilized on a commercially available Biacore system flow cell from a 20 μM 2 M NaCl solution (up to approximately 1000 RU). For reference, an equal amount of the non-functional L-aptamer (DBCO-modified reverse 315-F8-002-amino) was immobilized on a separate flow cell. The surface was passivated by immobilizing DBCO-modified linear methoxy-terminated polyethylene glycol (MW: 5 kDa). A dose-dependent increase in signal was demonstrated by injecting a concentration series of the analyte CXCL8 spiked in standard sample buffer (Copan Universal Transport Medium) with the addition of 0.1% (w / v) Tween 20. The measurement temperature was 25°C, the flow rate was 30 μL / min, and the running buffer was the measurement buffer (20 mM Tris pH 7.4, 150 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, 0.1% (w / v) Tween 20). The analytes were allowed to associate for 10 minutes, followed by a dissociation time of 2.5 minutes in the measurement buffer. The signal at the end of the dissociation phase was referenced by subtracting the signal on the reference flow cell.

[0308] The results for the CXCL8 biosensor are shown in Example 1, and are also shown in Figure 8. Example 7: SPR binding assay to compare binding to soluble chemokines

[0309] The inhibitory activity of an aptamer depends on its ability to bind to its target in solution. Here, we used a competitive SPR binding assay to determine the binding of the L aptamer of CXCL8-binding nucleic acid 315 F8002 according to the present invention and the previously published aptamer 8A-35 (Sung, Biomaterials 2014) to soluble CXCL8 and CXCL1. For this purpose, SPR measurements as described in Example 4 were performed using CXCL8 immobilized on a C1 sensor chip (GE Healthcare) by amine coupling. Binding of 315 F8002 (3 nM) or 8A-35 (1.6 nM) to immobilized CXCL8 resulted in a binding response of approximately 20 response units. In the 8A-35 binding assay, the sensor chip was regenerated using a 1 M CaCl2 solution. To evaluate the binding of both aptamers to their targets in solution, soluble CXCL8 was simultaneously injected at equimolar concentrations (1:1 ratio) or in a 5-fold excess (1:5 ratio) to compete with aptamer binding to immobilized CXCL8. Binding of soluble CXCL1 was used as a control. All measurements were performed at 37°C. The binding response to immobilized CXCL8 was recorded 240 seconds after injection.

[0310] The binding of 315-F8-002 to immobilized CXCL8 was completely blocked (>90%) by equimolar concentrations of soluble CXCL8 (Figure 9A). In contrast, the binding of 8A-35 was only partially blocked by soluble CXCL8 at equimolar (approximately 30%) and 5-fold excess concentrations (approximately 45%) (Figure 9B). This indicates that 315-F8-002 has a higher binding affinity to soluble CXCL8 compared to 8A-35. The decreased binding affinity to soluble CXCL8 (compared to surface-immobilized CXCL8) may explain the lower inhibitory activity of 8A-358 observed in the CXCL8-induced neutrophil migration assay (Sung, Biomaterials 2014).

[0311] Since 315-F8-002 was shown not to cross-react with other ELR-positive chemokines, soluble CXCL1 was used as a control (Figure 6). Therefore, the binding of 315-F8-002 was not blocked by soluble CXCL1 (Figure 9A). Surprisingly, the binding of 8A-358 was blocked by soluble CXCL1 with a similar effect to soluble CXCL8 (approximately 25% at equimolar concentrations and approximately 35% at 5-fold excess concentrations) (Figure 9B). This indicates that, in contrast to 315-F8-002, 8A-35 does not selectively bind to CXCL8 in solution and does not prospectively inhibit it. References

[0312] The complete bibliographic data for the documents described herein, unless otherwise indicated, is as follows, with their disclosure incorporated by reference: Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990), Basic local alignment search tool. J Mol Biol. 215(3):403-10. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25(17):3389-402. Bao, Z., et al. (2010), Humanized monoclonal antibody against the chemokine CXCL-8 (IL-8) effectively prevents acute lung injury. Int Immunopharmacol. 10(2): 259-63. Brand, H.K., et al. (2013), CD4+ T-cell counts and interleukin-8 and CCL-5 plasma concentrations discriminate disease severity in children with RSV infection. Pediatr Res. 73(2): 187-93. Brat, D.J., A.C. Bellail, and E.G. Van Meir (2005), The role of interleukin-8 and its receptors in gliomagenesis and tumoral angiogenesis. Neuro Oncol. 7(2): 122-33. Campbell, L.M., P.J. Maxwell, and D.J. Waugh (2013), Rationale and Means to Target Pro-Inflammatory Interleukin-8 (CXCL8) Signaling in Cancer. Pharmaceuticals (Basel). 6(8): 929-59. Chen, Y., et al. (2012), Interleukin-8, a promising predictor for prognosis of pancreatic cancer. World J Gastroenterol. 18(10): 1123-9. David, J.M., et al. (2016), The IL-8 / IL-8R Axis: A Double Agent in Tumor Immune Resistance. Vaccines (Basel). 4(3): 22. Fang, Q.I., et al. (2017), Increased CXCL8 Expression Is Negatively Correlated with the Overall Survival of Patients with ER-Negative Breast Cancer. Anticancer Res. 37(9): 4845-4852. Feniger-Barish, R., et al. (1999), Differential modes of regulation of cxc chemokine-induced internalization and recycling of human CXCR1 and CXCR2. Cytokine. 11(12): 996-1009. Garau, A., et al. (2005), Neuroprotection with the CXCL8 inhibitor repertaxin in transient brain ischemia. Cytokine.30(3): 125-31. Ginestier, C., et al. (2010), CXCR1 blockade selectively targets human breast cancer stem cells in vitro and in xenografts. J Clin Invest. 120(2): 485-97. Ha, H., B. Debnath, and N. Neamati (2017), Role of the CXCL8-CXCR1 / 2 Axis in Cancer and Inflammatory Diseases. Theranostics. 7(6): 1543-1588. Harada, A., et al. (1994), Essential involvement of interleukin-8 (IL-8) in acute inflammation. J Leukoc Biol. 56(5): 559-64. Highfill, S.L., et al. (2014), Disruption of CXCR2-mediated MDSC tumor trafficking enhances anti-PD1 efficacy. Sci Transl Med. 6(237): 237ra67. Jamal, R., et al. (2017), Peripheral and local predictive immune signatures identified in a phase II trial of ipilimumab with carboplatin / paclitaxel in unresectable stage III or stage IV melanoma. J Immunother Cancer. 5(1): 83. Klussmann S. (2006). "The Aptamer Handbook - Functional Oligonucleotides and their Applications." Edited by S. Klussmann. WILEY-VCH, Weinheim, Germany, ISBN 3-527-31059-2 Koch, A.E., et al. (1992), Interleukin-8 as a macrophage-derived mediator of angiogenesis. Science. 258(5089): 1798-801. Kratschmer, C. and M. Levy, Effect of Chemical Modifications on Aptamer Stability in Serum. Nucleic Acid Ther, 2017. 27(6): p. 335-344. Kusser W (2000). J Biotechnol 74:27-38 Li, A., et al. (2005), Autocrine role of interleukin-8 in induction of endothelial cell proliferation, survival, migration and MMP-2 production and angiogenesis. Angiogenesis. 8(1): 63-71. Liu, Q., et al. (2016), The CXCL8-CXCR1 / 2 pathways in cancer. Cytokine Growth Factor Rev. 31: 61-71. Ludwig, H., et al. (2017), Olaptesed pegol, an anti-CXCL12 / SDF-1 Spiegelmer, alone and with bortezomib-dexamethasone in relapsed / refractory multiple myeloma: a Phase IIa Study. Leukemia. 31(4): 997-1000. Maxwell, P.J., et al. (2013), Potentiation of inflammatory CXCL8 signalling sustains cell survival in PTEN-deficient prostate carcinoma. Eur Urol. 64(2): 177-88. Maxwell, P.J., et al. (2014), Tumor-derived CXCL8 signaling augments stroma-derived CCL2-promoted proliferation and CXCL12-mediated invasion of PTEN-deficient prostate cancer cells. Oncotarget. 5(13): 4895-4908. McGinnis S, Madden TL (2004) BLAST: at the core of a powerful and diverse set of sequence analysis tools. Nucleic Acids Res. 32(Web Server issue):W20-5. Menne, J., et al. (2017), C-C motif-ligand 2 inhibition with emapticap pegol (NOX-E36) in type 2 diabetic patients with albuminuria. Nephrol Dial Transplant. 32(2): 307-315. Merritt, W.M., et al. (2008), Effect of interleukin-8 gene silencing with liposome-encapsulated small interfering RNA on ovarian cancer cell growth. J Natl Cancer Inst. 100(5): 359-72. Morris, A.C., et al. (2009), Diagnostic importance of pulmonary interleukin-1β and interleukin-8 in ventilator-associated pneumonia. Thorax. thx. 2009.122291. Needleman & Wunsch (1970) A general method applicable to the search for similarities in the amino acid sequence of two proteins. J Mol Biol.48(3):443-53. Oberthur, D., et al. (2015), Crystal structure of a mirror-image L-RNA aptamer (Spiegelmer) in complex with the natural L-protein target CCL2. Nat Commun. 6: 6923. Pearson & Lipman (1988) Improved tools for biological sequence comparison. Proc. Nat'l. Acad. Sci. USA 85: 2444 Russo, R.C., et al. (2014), The CXCL8 / IL-8 chemokine family and its receptors in inflammatory diseases. Expert Rev Clin Immunol. 10(5): 593-619. Sanmamed, M.F., et al. (2014), Serum interleukin-8 reflects tumor burden and treatment response across malignancies of multiple tissue origins. Clin Cancer Res. 20(22): 5697-707. Sawant, K.V., et al. (2016), Chemokine CXCL1 mediated neutrophil recruitment: Role of glycosaminoglycan interactions. Sci Rep. 6: 33123. Shahzad, A., et al. (2010), Interleukin 8 (IL-8) - a universal biomarker? Int Arch Med. 3: p. 11. Skov, L., et al. (2008), IL-8 as antibody therapeutic target in inflammatory diseases: reduction of clinical activity in palmoplantar pustulosis. J Immunol. 181(1): 669-79. Smith & Waterman (1981) Adv. Appl. Math. 2: 482 Steele, C.W., et al. (2016), CXCR2 Inhibition Profoundly Suppresses Metastases and Augments Immunotherapy in Pancreatic Ductal Adenocarcinoma. Cancer Cell. 29(6): 832-45. Sung, H.J., et al., Inhibition of human neutrophil activity by an RNA aptamer bound to interleukin-8. Biomaterials, 2014. 35(1): p. 578-89. Venkatesan N, Kim SJ, Kim BH (2003) Novel phosphoramidite building blocks in synthesis and applications toward modified oligonucleotides. Curr Med Chem 10(19): 1973-1991 Visvader, J.E. and G.J. Lindeman (2008), Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8(10): 755-68. Wang, C., et al. (2016), CXCL13, CXCL10 and CXCL8 as Potential Biomarkers for the Diagnosis of Neurosyphilis Patients. Sci Rep.6: 33569. Wincott F, DiRenzo A, Shaffer C, Grimm S, Tracz D, Workman C, Sweedler D, Gonzalez C, Scaringe S, and Usman N (1995). Synthesis, deprotection, analysis and purification of RNA and ribosomes. Nucleic Acids Res. 23:2677-2684. Xu, L. and IJ Fidler (2000), Interleukin 8: an autocrine growth factor for human ovarian cancer. Oncol Res. 12(2): 97-106. Yao, R., et al. (2015), Diagnostic performance of interleukin-6 and interleukin-8 for bacterial meningitis: a meta-analysis. Int J Clin Exp Med. 8(5): 7059-68. Zhou, M., et al. (2015), Interleukin-8 for diagnosis of neonatal sepsis: a meta-analysis. PLoS One. 10(5): e0127170. The project leading to this application is funded by the European Union's Horizon 2020 Research and Innovation Programme under funding agreement No. 634415.

Claims

1. An L-nucleic acid molecule that can bind to human CXCL8, The L-nucleic acid molecule comprises a nucleotide sequence selected from the group of SEQ ID NOs: 14, 16, 17, 20, 25, 26, 39-44. The nucleotide sequences of sequence numbers 14, 16, 17, 20, 25, 26, and 39-44 are shown in the table below: Table 1 An L nucleic acid molecule, configured in such a way.

2. The L-nucleic acid molecule contains a modifying group. The L-nucleic acid molecule according to claim 1.

3. The excretion rate of the L-nucleic acid molecule containing the modifying group from living organisms is reduced compared to the excretion rate of L-nucleic acid without the modifying group, and / or The L-nucleic acid molecule containing the modifying group exhibits an increased retention time in organisms compared to the L-nucleic acid molecule without the modifying group. The L nucleic acid molecule according to claim 2.

4. The modifying group is selected from the group consisting of biodegradable modifications and non-biodegradable modifications. The L nucleic acid molecule according to claim 2 or 3.

5. The L-nucleic acid molecule according to claim 4, wherein the modifying group is selected from the group consisting of polyethylene glycol, linear polyethylene glycol, branched polyethylene glycol, hydroxyethyl starch, peptide, protein, polysaccharide, sterol, polyoxypropylene, polyoxyamide, and poly(2-hydroxyethyl)-L-glutamine.

6. The L-nucleic acid molecule according to claim 1, wherein the L-nucleic acid molecule includes a modifying group, the modifying group is for immobilizing the L-nucleic acid molecule, or the modifying group enables the detection of the L-nucleic acid molecule.

7. An L nucleic acid molecule according to any one of claims 1 to 6, for use in a method for treating and / or preventing a disease.

8. An L nucleic acid molecule according to any one of claims 1 to 6, used in a method for detecting CXCL8.

9. An L nucleic acid molecule according to any one of claims 1 to 6 for manufacturing a detection means or biosensor.

10. A pharmaceutical composition comprising an L-nucleic acid molecule as defined in any one of claims 1 to 6, and optionally further components, wherein the further components are selected from pharmaceutically acceptable excipients, pharmaceutically acceptable carriers, and pharmaceutically active agents.

11. Use of an L-nucleic acid molecule according to any one of claims 1 to 6 for the manufacture of a pharmaceutical product.

12. Use of an L-nucleic acid molecule according to any one of claims 1 to 6 for manufacturing a diagnostic agent, a diagnostic means, or a biosensor.

13. Use of an L-nucleic acid molecule according to any one of claims 1 to 6 for detecting CXCL8.

14. A kit for detecting CXCL8, the kit comprising an L-nucleic acid molecule according to any one of claims 1 to 6, and at least an instruction manual or a reaction vessel.

15. A complex comprising the L-nucleic acid molecule and CXCL8 as described in any one of claims 1 to 6.

Images