Use of compounds as self-tanning substances and tanning compositions
The sunburn composition with compounds (I), (II), and (III) stimulates melanin synthesis in melanocytes, addressing the limitations of current self-tanning products by enhancing skin pigmentation and UV protection without UV exposure.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- ケモソンスリックス ビオサイアンス エスアー
- Filing Date
- 2021-06-25
- Publication Date
- 2026-06-02
AI Technical Summary
Current self-tanning products, such as those containing DHA, do not provide significant UV protection and can increase skin susceptibility to UV damage, and they often have unpleasant odors.
A sunburn composition comprising cosmetically acceptable carriers and sunburn compounds like those of formulas (I), (II), (III), and (IV), which stimulate melanin synthesis in melanocytes, increasing melanin content and providing UV protection without UV exposure.
The composition safely induces melanin production, enhancing skin pigmentation and UV protection while avoiding harmful effects associated with UV exposure and odors.
Smart Images

Figure 0007869153000111 
Figure 0007869153000112 
Figure 0007869153000113
Abstract
Description
[Technical Field]
[0001] Field of Invention The present invention relates to the use of organic compounds as self-tanning substances, tanning compositions containing said organic compounds that can activate melanin synthesis, and the use thereof to induce an increase in melanin content in the skin and induce a tanning effect.
[0002] Background technology Melanin is an indole-based polymer that primarily acts as the main pigment in the skin, hair, fur, and feathers of vertebrates. Melanin possesses many interesting properties, including the ability to absorb ultraviolet light (sunlight or other light sources) and prevent DNA damage. Two types of melanin coexist: eumelanin, an insoluble polymer of brownish-black color, and pheomelanin, a soluble polymer of reddish-yellow color. Eumelanin is the dominant type in people with dark skin and hair and is more efficient in photoprotection.
[0003] The skin contains epidermal components responsible for the synthesis (melanocytes) and distribution (keratinocytes) of melanin. Melanin biosynthesis takes place in melanosomes, which are specialized lysosome-related organelles found in melanocytes, and is called melanogenesis. This complex process involves various steps and begins with the oxidation of the amino acid L-tyrosine. Once synthesized, melanin moves to adjacent keratinocytes, the major cell type present in the epidermis, via the cell extensions (dendrites) of melanocytes (30-40 keratinocytes per melanocyte).
[0004] Many factors are known to regulate melanin synthesis, but the most common is ultraviolet (UVR) exposure or irradiation, such as tanning using natural sunlight or tanning lamps. The overall mechanism of tanning, i.e., melanin production, is not fully understood, but it is fairly well explained and accepted by the scientific community at the melanocyte level. Under UVR stimulation, the G protein-coupled receptor (GPCR) melanocortin 1 receptor (MC1R) is expressed on the surface of melanocytes, increasing intracellular cyclic AMP (cAMP) and qualitatively and quantitatively regulating melanin synthesis. MC1R function is regulated by the physiological agonists alpha-melanocyte-stimulating hormone (αMSH) and adrenocorticotropic hormone (ACTH), and the antagonist agouti signaling protein (ASP). Furthermore, it has been shown that people expressing mutants with low MC1R function are relatively unable to tan (redheads), confirming the central role of this receptor and the cAMP cascade in melanin production.
[0005] Skin pigmentation is of great cultural and cosmetic importance and is considered desirable by many. Today, the most common way to darken the skin is by tanning using either natural sunlight or a specially designed source of ultraviolet light (tanning lamp / bed). Other tanning methods are gaining attention due to the increasing incidence of UV-induced skin cancer and damage caused by ongoing ozone depletion and excessive sun exposure. The first self-tanning lotion containing dihydroxyacetone (DHA) was launched in California in 1945. Since the 1960s, sunless tanning has become popular, and chemists have spent vast amounts of time creating self-tanning formulas that give a "natural brown" skin tone. Most self-tanning products currently on the market contain DHA as an active ingredient, sometimes combined with erythrulose, tyrosine derivatives, and occasionally naphthoquinone. DHA is a sugar substitute that reacts with amino acids present in the skin via the Maillard reaction, a process well-known to food chemists that causes browning of food during manufacturing, storage, and cooking. While DHA does not require UV exposure to cause a color change, several studies have shown that DHA-treated skin is more susceptible to UV damage and generates a large amount of additional free radicals internally. Furthermore, most sunless tanning products do not contain sunscreen. Even if they do, it is only effective for 2-3 hours. They do not provide significant UV protection for self-tanning. In addition to this lack of protection, DHA has a so-called "scab"-like odor when applied to the skin. This odor issue varies from person to person depending on their constitution.
[0006] Thus, melanin production is crucial to skin characteristics and constitutes a response to environmental stress, and therefore its proper control is necessary. To date, there are few reliable ways to stimulate melanin production in the skin to achieve natural tanning and significant UV protection other than UV exposure.
[0007] This invention addresses these needs.
Summary of the Invention
[0008] Summary of the Invention The present invention provides a sunburn composition containing a sunburn compound that can induce self-sunburn in a safe manner while avoiding the generation of unpleasant odors.
[0009] In particular, in a first aspect, the present invention provides a sunburn composition comprising: a) a cosmetically acceptable carrier, diluent and / or excipient, and b) at least one sunburn compound selected from the group consisting of compounds of formula (I), (II), (III) and (IV), or racemates thereof, stereoisomers thereof, tautomers thereof, salts thereof and / or solvates thereof (including mixtures thereof),
[0010]
Chem.
[0011] (wherein R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , R 12 , R 20 , R 21 , R 22 , R 23 , R 24 , R 25 , R 26 , R 27 , R 28 , R 29 , R 30 , R 40 , R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 , q, R50 , R 51 (as defined herein).
[0012] In a preferred embodiment, the present invention provides the use of compounds of formula (IIb), (IIa), (IIIa), (IV), (Ie), (If), (Ig), (Ic), or (Id), their racemates, their stereoisomers, their tautomers, their salts, and / or solvates (including mixtures thereof) as self-tanning substances.
[0013] [ka]
[0014] (In the formula, dashes signify conjugation)
[0015] [ka]
[0016] represents any double bond; and
[0017] [ka]
[0018] represents any single bond; R 28 is hydrogen, oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -OC 1-6 Alkyl, -[CR 17 R 18 ] m -COH, and -[CR 17 R 18 ] m- Selected from the group containing OH; m is an integer selected from 1, 2, 3, 4, or 5. R 17 , R 18 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 29 is hydrogen or C 1-6 It is alkyl; or R 29 and R 28 Together, they form the equation -O-[CR 17 R 18 ] p It is -O- and together with the carbon atoms to which they are bonded, it forms a 5-membered or 6-membered heterocycline portion (the heterocycline is one or more C 1-6 (May be substituted with alkyl substituents) to form; p is an integer selected from 1 or 2; R 20 is hydrogen or C 1-6 It is alkyl; R 21 is hydrogen or C 1-6 It is alkyl; R 22 is hydrogen, C 1-6 Alkyl and -CO-R 19 Selected from the group including; R 23 is hydrogen or C 1-6 It is alkyl; R 24 is hydrogen or C 1-6 It is alkyl; or R 23 and R 24 These, along with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline portion (the heterocycline is C 1-6 (May be substituted with one or more substituents independently selected from each alkyl group) to form; R 25 is hydrogen or C 1-6 It is alkyl; or R 24 and R 25forms a 5- or 6-membered heterocyclyl moiety together with the carbon atom to which they are attached (the heterocyclyl may be substituted with one or more substituents independently selected from C 1-6 alkyl, or one of the substituents and R 23 forms a 3- to 6-membered heterocyclyl moiety together with the atom to which they are attached); R 27 is, when present, hydrogen or C 1-6 alkyl; or R 20 and R 27 form a C3-membered ring together with the carbon atom to which they are attached; R 40 is -[CR 17 R 18 m -OH, -CO-C 1-6 alkyl, -O-([CR 17 R 18 m -O-) t -C 1-6 alkyl, selected from the group consisting of, and t is an integer selected from 0, 1, 2 or 3; R 42 、R 43 、R 44 、R 45 、R 46 、R 47 are each independently selected from hydrogen or C 1-6 alkyl; or R 40 and R 42 form a 3- to 6-membered heterocyclyl moiety together with the carbon atom to which they are attached; R 50 is selected from OH or oxo; R 51 is hydrogen or C 1-4 alkyl; R 1 、R 2 are each independently selected from hydrogen or C 1-6 alkyl; R 3 、R 4 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -X-[CR 13 R 14 ] n -O-[CR 17 R 18 ] m -OH,-([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 13 R 14 ] n -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5; n is an integer selected from 0, 1, 2, 3, or 4; y is an integer selected from 1, 2, or 3; X is either a single bond or O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16Together with R 15 It forms an oxo group; or R 3 and R 5 Together, they form the formula -O-[CR 17 R 18 ] p It is -O- and together with the carbon atoms to which they are bonded, it forms a 5-membered or 6-membered heterocycline portion (the heterocycline is one or more C 1-6 (May be substituted with alkyl substituents) and p is an integer selected from 1 or 2; R 6 is hydrogen or C 1-6 It is alkyl; or R 5 and R 6 Together, =[CR 14 ]-[CR 17 R 18 ] m -Forms OH; or R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 7 is hydrogen or C 1-6 It is alkyl; R 8 is hydrogen or C 1-6 It is alkyl; or R 5 and R 8 These, along with the carbon atoms to which they are bonded, form saturated or unsaturated C5 or C6 membered rings (the aforementioned rings are oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 17 R18 ] m -COH, or -[CR 17 R 18 ] m -OH may be substituted with one or more substituents independently selected from each; or the two substituents on the ring may, together with the carbon atom to which they are bonded, form a 3- to 6-membered heterocyclyl moiety (the heterocyclyl moiety is C 1-6 The alkyl group may be substituted with one or more substituents independently selected from each alkyl group, or the two substituents on the heterocycline may, together with the atom to which they are bonded, form a 3- to 6-membered heterocycline moiety; R 9 , R 10 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 6 and R 9 They form a C3-membered ring together with the carbon atoms to which they are bonded; or R 9 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); or R 9 Together with R 3 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 The present invention also includes self-tanning compositions prepared using at least one compound of formula (IIb), (IIa), (IIIa), (IV), (Ie), (If), (Ig), (Ic), or (Id), its racemates, its stereoisomers, its tautomers, its salts, and / or solvates (including mixtures thereof) as a self-tanning substance.
[0019] In a second aspect, the present invention also provides compounds of formula (Ih), or racemates thereof, stereoisomers thereof, tautomers thereof, salts thereof and / or solvates thereof (including mixtures thereof);
[0020] [ka]
[0021] (In the formula, R 5 is, -O-CHR 14 -C(=O)-[CR 17 R 18 ] m -R 19 ,-O-CHR 14 -CH(OH)-[CR 17 R 18 ] m -R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5; preferably m is selected from 1, 2, 3, or 4, preferably m is selected from 1, 2, or 3, preferably m is 1 or 2; R 14 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably, R 14 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; preferably, R 14 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; preferably, R 14 , R 17 , R 18 , R 19 Each is independently selected from hydrogen or methyl; preferably, R 14 , R 17 , R 18 Each of them is independently hydrogen, and R 19 (It is methyl).
[0022] In a third aspect, the present invention also provides the use of compounds of formula (I), (II), (III), or (IV) as defined herein, or racemates thereof, stereoisomers thereof, tautomers thereof, salts thereof and / or solvates thereof (including mixtures thereof), as self-tanning substances, or the use of compounds described in the second aspect of the invention as self-tanning substances.
[0023] [ka]
[0024] In a fourth aspect, the present invention also provides compounds of formula (I), (II), (III), (IV), (IIb), (IIa), (IIIa), (Ie), (If), (Ig), (Ic), or (Id) as defined herein, or racemates thereof, stereoisomers thereof, tautomers thereof, salts thereof and / or solvates thereof (including mixtures thereof); or compounds described in the second aspect of the invention for increasing the amount of melanin in melanocytes, increasing melanin synthesis, improving melanin transport, and / or improving melanin distribution in the basal upper layer.
[0025] [ka]
[0026] The present invention also includes the use of the composition described in the first embodiment for skin darkening, or the preferred use of compounds of formula (IIb), (IIa), (IIIa), (IV), (Ie), (If), (Ig), (Ic), or (Id), or the use of compounds of formula (I), (II), (III), (IV), or (Ih) described in the second or third embodiment for skin darkening.
[0027] The present invention also includes the use of the composition described in the first embodiment for sunless tanning, or the preferred use of compounds of formula (IIb), (IIa), (IIIa), (IV), (Ie), (If), (Ig), (Ic), or (Id) for sunless tanning, or the use of compounds of formula (I), (II), (III), (IV), or (Ih) described in the second or third embodiment for sunless tanning.
[0028] The present invention also includes a tanning method comprising using the composition described in the first aspect, or the compound described in the second aspect as a self-tanning substance, or the use of the compound of formula (I), (II), (III), or (IV) described in the third aspect as a self-tanning substance, or a preferred use of the compound of formula (IIb), (IIa), (IIIa), (IV), (Ie), (If), (Ig), (Ic), or (Id) as a self-tanning substance.
[0029] The present invention also includes methods for increasing the amount of melanin in melanocytes, increasing melanin synthesis, improving melanin transport, and / or improving the melanin distribution in the upper basal layer, including applying the composition described in the first aspect or the compound described in the second aspect, or applying one of more of the compounds of formula (I), (II), (III), (IV), or (Ih), as defined herein, or any subgroup thereof, such as the compounds of formula (IIb), (IIa), (IIIa), (Ie), (If), (Ig), (Ic), or (Id).
[0030] The present invention also encompasses a method for blackening skin, comprising the steps of applying the composition described in the first embodiment or the compound described in the second embodiment to a desired skin surface, or one of more of the compounds of formula (I), (II), (III), (IV), (IIb), (IIa), (IIIa), (Ie), (If), (Ig), (Ic), or (Id) or their racemates, stereoisomers thereof, tautomers thereof, salts thereof and / or solvates thereof (including mixtures thereof), as defined herein.
[0031] In this invention, it has been surprisingly discovered that the olfactory receptor OR7C1 is expressed in melanocytes, and that agonists of this receptor can induce melanin production by melanocytes, leading to an increase in melanin content and thus an increase in pigmentation. Therefore, this invention also includes the use of human olfactory receptor family seven, subfamily C, member one; namely, agonists of OR7C1, particularly those expressed in melanocytes, as self-tanning substances to increase the amount of melanin in melanocytes, increase melanin synthesis, improve melanin transport, and / or improve the distribution of melanin in the upper basal layer to induce a tanning effect. This invention also includes the use of human olfactory receptor family seven, subfamily C, member one; namely, agonists of OR7C1, particularly those expressed on melanocytes. The present invention also encompasses a tanning composition comprising (a) a cosmetically acceptable carrier, diluent, and / or excipient, and (b) at least one tanning compound selected from the group including agonists of human olfactory receptor family seven, subfamily C, member one; i.e., OR7C1, particularly those expressed on melanocytes.
[0032] The compounds used in this invention can induce melanin synthesis in melanocytes, thereby increasing the melanin content, and thus encompass the pigmentation of subjects such as skin, hair, fur, and feathers by the compounds defined herein. Melanocytes that come into contact with the compounds of this invention may be present in the skin, hair, fur, and feathers of vertebrates.
[0033] The compounds used in this invention can be used as skin tanning agents. Therefore, they can induce melanin overproduction in the skin, thereby preventing sunburn, improving UVR skin protection, or increasing skin pigmentation, for example, in a non-therapeutic manner. Given the future importance of UV-induced skin cancer / injury, this unexpected discovery could enable safer tanning methods and avoid the harmful effects of UVR by activating the endogenous and natural tanning pathway.
[0034] The above and other characteristics, features, and advantages of the present invention will become apparent from the following detailed description, which illustrates the principle of the present invention as an example. [Brief explanation of the drawing]
[0035] [Figure 1] Figure 1 shows a schematic diagram of the treatment of moderately pigmented normal human epidermal melanocytes (NHEMs-MP) with two different compounds (Amberketal and Ambermax) described in embodiments of the present invention to test the effect of the compounds on cell viability. [Figure 2] Figure 2 shows a schematic diagram of the treatment of NHEMs-MP with two different compounds (amber ketal and ambermax) described in embodiments of the present invention to test the effect of these compounds on the pigmentation of NHEMs-MP in culture. [Figure 3]Figure 3 shows a schematic diagram of the treatment of extracts with two different compounds described in the embodiments of the present invention to test the tanning effect. [Figure 4A] Figure 4A shows a photograph illustrating the results of PCR experiments on cDNA prepared after mRNA extraction from primary melanocytes (NHEMs-MP). The results are shown as the amount of cDNA amplification on an agarose gel after PCR using three different primer couples (couples 1, 2, and 3; see experimental procedure). [Figure 4B] Figure 4B shows a graph illustrating the effects of the two compounds described in the embodiments of the present invention on the survival of primary melanocytes in culture (see MTS test, experimental procedure). The results are expressed as the mean + / - SEM of relative survival values from three measurements (n=3). [Figure 5A] Figure 5A is a graph showing the effects of the two compounds (Ambermax and Amberketal) described in the embodiments of the present invention on intracellular melanin production in melanocytes (NHEMs-MP). The results are expressed as the mean + / - SEM of the relative melanin content under DOPA (50 μM) conditions for 12 measurements (n=12). [Figure 5B] Figure 5B shows a graph illustrating the effects of the two compounds (Ambermax and Amberketal) described in the embodiments of the present invention on extracellular melanin production in melanocytes (NHEMs-MP). The results are expressed as the relative values + / - SEM of melanin content under DOPA (50 μM) conditions for 10 measurements (n=10). [Figure 6A] Figure 6A shows representative photographs of human skin biopsies stained using a modified Trichrome Masson, Goldner method to evaluate the effect of the compounds described in embodiments of the present invention on the survival of human skin biopsies. Biopsies were topically treated with 10 μM, 30 μM, and 100 μM typical compounds of the present invention on day 5 (D5 or J5). T corresponds to untreated biopsies (negative control). [Figure 6B]Figure 6B shows a table summarizing the macroscopic evaluation of the survival of human skin bioexcisions after treatment with the compounds described in the embodiments of the present invention at three concentrations and three administration methods (topical, systemic, and intradermal injection) on day 5 (D5 or J5) and day 10 (D10 or J10). T represents untreated excisions (negative control), and TUV represents excisions irradiated with a UVA dose of 0.5 MED (positive control). [Figure 6C] Figure 6C shows a table with photographs of skin excisions showing the level of melanin production in human epidermal bioexcisions after topical treatment (10 μM, 30 μM, and 100 μM) with compounds described in embodiments of the present invention, 5 days later (Masson's Fontana staining method). [Figure 6D] Figure 6D shows a graph plotting melanin levels as a function of time, illustrating the levels of melanin production after topical treatment (10 μM, 30 μM, and 100 μM) of the compounds described in embodiments of the present invention with human epidermal excisions at 5 and 10 days (Masson's Fontana staining method). [Figure 6E] Figure 6E shows a table summarizing the macroscopic evaluation of melanin levels in raw human skin excisions after treatment with the compounds described in the embodiments of the present invention at three concentrations and by three administration methods (topical, systemic, and intradermal injection) at D5 and D10. T corresponds to untreated excisions (negative control), and TUV corresponds to excisions irradiated with a UVA dose of 0.5 MED (positive control). The results are expressed as melanin content present on day 5 or 10 compared to melanin content present in unexposed or UV-exposed excisions within the same time frame. [Figure 6F] Figure 6F shows a table with photographs of skin excisions illustrating the increase in melanin levels following topical treatment (0.3 μM, 1 μM, 10 and 15 μM) of compounds described in embodiments of the present invention with human epidermal bioexcisions 6 days later (Masson's Fontana staining method). [Figure 6G]Figure 6G shows a graph plotting the percentage of melanin-positive surfaces in the evaluation of melanin production levels in epidermal excisions of human epidermis 6 days after topical treatment (1 μM, 3 μM, 10, and 15 μM) with compounds described in embodiments of the present invention (Masson's Fontana staining method). The results are the mean + / - SEM of a single measurement in three different skin excisions. [Figure 6H] Figure 6H shows a table summarizing the effects of the compounds described in embodiments of the present invention on the melanin content of raw excisions after local treatment with typical compounds of the present invention (0.3, 1, 10, and 15 μM). T corresponds to untreated excisions (negative control), and TUV corresponds to excisions irradiated with a UVA dose of 0.5 MED (positive control). The results are expressed as melanin content present on day 6 or day 10, compared to the melanin content present in unexposed or UV-irradiated excisions within the same time frame. [Figure 7] Figures 7A to 7D show schematic diagrams of the images to be analyzed.
[0036] Detailed description of the invention In describing the present invention, terms used shall be interpreted according to the following definitions unless otherwise indicated by the context.
[0037] Unless otherwise defined, all terms used in disclosing this invention, including technical and scientific terms, have the meanings generally understood by those skilled in the art to which this invention pertains. For further guidance, definitions of terms are included to better understand the teachings of this invention.
[0038] The following text provides more detailed definitions of different aspects of the present invention. Each aspect thus defined may be combined with any other aspect or aspects unless otherwise explicitly stated. In particular, any feature indicated as preferred or advantageous may be combined with any other feature indicated as preferred or advantageous.
[0039] Throughout this specification, any reference to “one embodiment” or “an embodiment” means that any particular feature, structure, or characteristic described in relation to an embodiment is included in at least one embodiment of the present invention. Therefore, the appearance of the phrase “in one embodiment” or “in an embodiment” in various places throughout this specification does not necessarily all refer to the same embodiment, but may do so. Furthermore, any particular feature, structure, or characteristic may be combined in any suitable manner in one or more embodiments, as will be apparent to those skilled in the art from this disclosure. Moreover, some embodiments described herein mean that combinations of features of different embodiments, some of which are included in other embodiments but do not include other features, form different embodiments that are within the scope of the present invention and will be understood by those skilled in the art.
[0040] As used herein, the terms “comprising,” “comprises,” and “comprised of” are synonymous with “including,” “includes,” or “containing,” and are comprehensive or open, not excluding additional, unmentioned members, elements, or method steps. As used herein, the terms “comprising,” “comprises,” and “comprised of” will be understood to include the terms “consisting of,” “consists,” and “consists of.”
[0041] As used herein and in the appended claims, the singular forms “a,” “an,” and “the” refer to multiple sources unless the context clearly indicates otherwise. For example, “a step” means one step or one or more steps.
[0042] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art. All publications referenced herein are incorporated herein by reference.
[0043] Numerical ranges indicated by endpoints include all integer values and, as appropriate, fractions within that range (for example, 1 to 5 may include 1, 2, 3, and 4 if referring to the number of elements, and may also include 1.5, 2, 2.75, and 3.80 if referring to a measurement). References to endpoints also include the values of the endpoints themselves (for example, 1.0 to 5.0 includes both 1.0 and 5.0). Any numerical ranges mentioned herein are intended to include all subranges contained therein.
[0044] Where the term “substituted” is used in this invention, it is intended to indicate that one or more hydrogen atoms on the atom indicated in the “substituted” expression are replaced by a selection from the indicated group, provided that the substitution does not exceed the normal valence of the indicated atom and the substitution results in a chemically stable compound. If a group is substituted, such group may be substituted with one or more substituents, preferably one, two, or three.
[0045] The term "alkyl" refers to a group or part of a group of the formula C n H 2n+1 This refers to a hydrocarbyl group (where n is at least one). The alkyl group may be linear or branched and may be substituted as shown herein. Preferably, the alkyl group contains 1 to 6 carbon atoms, preferably 1 to 5 carbon atoms, preferably 1 to 4 carbon atoms, preferably 1 to 3 carbon atoms, and preferably 1 to 2 carbon atoms. Where a subscript is used following a carbon atom herein, the subscript indicates the number of carbon atoms that the named group may contain. For example, the term "C" as a group or part of a group. 1-6 "alkyl" is defined by the formula C n H 2n+1It refers to the hydrocarbyl group, where n is a number in the range of 1 to 6. For example, C 1-6 Alkyl includes all linear or branched alkyl groups having 1 to 6 carbon atoms, and therefore includes, for example, methyl, ethyl, n-propyl, i-propyl, 2-methyl-ethyl, butyl and its isomers (e.g., n-butyl, i-butyl, and t-butyl); pentyl and its isomers, hexyl and its isomers, etc. For example, C 1-4 Alkyl includes all linear or branched alkyl groups having 1 to 4 carbon atoms, and therefore includes, for example, methyl, ethyl, n-propyl, i-propyl, 2-methyl-ethyl, butyl and its isomers (e.g., n-butyl, i-butyl, and t-butyl).
[0046] The term "oxo" refers to the base = O.
[0047] As used herein, the terms “heterocyclyl moiety” or “heterocyclyl ring” refer to a non-aromatic, fully saturated, or partially unsaturated ring of 3 to 6 atoms, including at least one N, O, or S atom. The N and S heteroatoms may optionally be oxidized, and the N heteroatom may optionally be quaternized, where at least one carbon atom of the heterocyclyl can be oxidized to form at least one C=O. The heterocyclic ring may be bonded by any heteroatoms or carbon atoms of the ring or ring system, as long as the valences allow.
[0048] Examples of non-restrictive heterocyclic groups include oxyranil, piperidinil, piperazinil, morpholinil, tetrahydropyranil, tetrahydrofuranil, pyrrolidinil, azilidinil, thiranil, azetidinil, oxetanil, thietanil, imidazolinil, and pyrazolidinil. Examples include imidazolidinyl, isoxazolinyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl, isothiazolidinyl, succinimidyl, 2H-pyrrolyl, 1-pyrrolinyl, 2-pyrrolinyl, 3-pyrrolinyl, 2-pyrazolinyl, 3-pyrazolinyl, tetrahydro-2H-pyranyl, 2H-pyranyl, 4H-pyranyl, 3,4-dihydro-2H-pyranyl, 1,3-dioxolanyl, 1,3-dioxanyl, 1,4-dioxanyl, tetrahydrothiophenyl, thiomorpholine-4-yl, 1,4-oxathianyl, 1,4-dithianyl, and 1,3,5-trioxanyl. Preferably, the heterocyclil is selected from the group comprising oxyranil, tetrahydropyranil, tetrahydrofuranil, oxetanil, 2H-pyrrolyl, 1-pyrrolinil, 2-pyrrolinil, 3-pyrrolinil, tetrahydro-2H-pyranil, 2H-pyranil, 4H-pyranil, 3,4-dihydro-2H-pyranil, 1,3-dioxolanil, 1,3-dioxanil, and 1,4-dioxanil.
[0049] In the formulas herein, the term "single bond," used in a manner in which a linking group is selected from single bonds and the like, refers to a molecule in which no linking group exists, and therefore refers to a compound having a direct bond via a single bond between two parts linked by a linking group.
[0050] As used herein, unless otherwise specified, the term “solvate” includes any combination that can be formed with the derivatives of the present invention and a suitable inorganic solvent (e.g., hydrate) or with an organic solvent, such as, but not limited to, alcohols, ketones, esters, ethers, and nitriles.
[0051] As used herein, the term “isomer” means all possible isomeric forms, including tautomers and stereochemical forms, that a compound of the formula herein may have, but not positional isomers. Typically, the structures shown herein illustrate only one tautomer or resonance form of a compound, but corresponding alternative configurations are also intended. Unless otherwise specified, the chemical designation of a compound refers to a mixture of all possible stereochemical isomeric forms, which include all diastereomers and enantiomers of the basic molecular structure (since a compound of the formula herein may have at least one chiral center), as well as stereochemically pure or enriched compounds. More specifically, stereocenters may have either R- or S-coordination, and multiple bonds may have either cis- or trans-coordination.
[0052] A pure isomer of the aforementioned compound is defined as an isomer that substantially does not contain other enantiomer or diastereomer forms of the same basic molecular structure. In particular, the terms “stereoisomerically pure” or “chiralally pure” refer to compounds having a stereoisomer excess of at least about 80% (e.g., at least 90% of one isomer and up to 10% of other possible isomers), preferably at least 90%, more preferably at least 94%, and most preferably at least 97%. The terms “enantiomerically pure” and “diastereomerically pure” should be understood similarly, taking into account the enantiomer excess and diastereomer excess, respectively, of the mixture in question.
[0053] The separation of stereoisomers can be achieved by standard methods known to those skilled in the art. One enantiomer of the compounds of the present invention can be separated substantially without the opposite enantiomer by methods such as the formation of a diastereomer using an optically active decomposition agent ("Stereochemistry of Carbon Compounds," (1962) by EL Eliel, McGraw Hill; Lochmuller, CH, (1975) J. Chromatogr., 113:(3) 283-302). The separation of isomers in a mixture can be achieved by any suitable method, such as (1) forming an ionic diastereomer salt with a chiral compound and separating it by fractional crystallization or other methods, (2) forming a diastereomer compound with a chiral derivatization reagent, separating the diastereomer and converting it to a pure enantiomer, or (3) the enantiomer can be directly separated under chiral conditions. In method (1), diastereomer salts can be formed by reacting an enantiomerically pure chiral base such as brucine, quinine, ephedrine, strychnine, or α-methyl-β-phenylethylamine (amphetamine) with an asymmetric compound having acidic functionality such as a carboxylic acid or sulfonic acid. The diastereomer salts may be separated by fractional crystallization or ion chromatography. For the separation of optical isomers of amino compounds, diastereomer salts can be formed by adding a chiral carboxylic acid or sulfonic acid such as camphor sulfonic acid, tartaric acid, mandelic acid, or lactic acid. Alternatively, in method (2), a diastereomer pair may be formed by reacting the substrate to be separated with one enantiomer of a chiral compound (Eliel, E. and Wilen, S. (1994) Stereochemistry of Organic Compounds, John Wiley & Sons, Inc, p. 322). Diastereomer compounds can be formed by reacting an asymmetric compound with an enantiomerically pure chiral derivatization reagent such as a menthyl derivative, then separating the diastereomer and hydrolyzing it to obtain a free, enantiomerically enriched compound.A method for determining optical purity involves preparing a chiral ester of the racemic mixture (e.g., menthyl ester or Mosher ester, α-methoxy-α-(trifluoromethyl)phenyl acetate (Jacob III. (1982) J. Org. Chem. 47:4165)) and analyzing the NMR spectrum for the presence of two atropisomerous diastereomers. Stable diastereomers can be separated and isolated by normal-phase and reverse-phase chromatography according to the method for separating atropisomerous naphthylisoquinolines (Hoye, T., WO 96 / 15111). In method (3), a racemic mixture of two asymmetric enantiomers is separated by chromatography using a chiral stationary phase. Suitable chiral stationary phases are, for example, polysaccharides, particularly cellulose or amylose derivatives. A commercially available polysaccharide-based chiral stationary phase is ChiralCeI. TM CA, OA, OB5, OC5, OD, OF, OG, OJ, and OK, as well as Chiralpak TM These are AD, AS, OP(+), and OT(+). Suitable eluents or mobile phases to be used in combination with the aforementioned polysaccharide chiral stationary phases include hexane modified with alcohols such as ethanol and isopropanol ("Chiral Liquid Chromatography" (1989) WJ Lough, Ed. Chapman and Hall, New York; Okamoto, (1990) "Optical resolution of dihydropyridine enantiomers by High-performance liquid chromatography using phenylcarbamates of polysaccharides as a chiral stationary phase", J. of Chromatogr. 513:375-378).
[0054] As used herein, the term “olfactory receptor polypeptide (OR)” generally refers to polypeptides of the G protein-coupled receptor family, primarily expressed by olfactory neurons. ORs may have the ability to interact with odor molecules and to transmit the cAMP cascade.
[0055] As used herein, the terms “G protein-coupled receptor” or “GPCR” refer to membrane-bound polypeptides having a 7-alpha helical transmembrane domain. Functional GPCRs bind to ligands or agonists and also to G proteins for activation. OR7C1, as defined herein, belongs to the family of GPCRs.
[0056] As used herein, the term "OR binding" refers to the specific binding of osmoremolecules by an OR polypeptide. Examples of osmoremolecules include, but are not limited to, compounds from the formulations (Markush) described below.
[0057] As used herein, the term “OR signaling activity” refers to the initiation or propagation of signaling by OR polypeptides. OR signaling activity is monitored by measuring a detectable step in the signaling cascade; more specifically, by measuring cAMP. Alternatively, measurable activity can be measured indirectly, for example, in a reporter gene assay. Kits for most of these assays are commercially available.
[0058] As used herein, “agonist” is a ligand that binds to a receptor and mimics an intracellular response induced by a native ligand or another identified agonist, such as a novel compound present in a library.
[0059] As used herein, the term “binding” refers to the physical association of a molecule (e.g., a ligand such as an organic compound from the formulation (Markush) described below) and a receptor (e.g., OR7C1 as defined herein). As this term is used herein, binding is defined as having an EC of less than 1 mM, generally in the range of 1 mM to 10 nM. 50 Or, if it occurs in Kd, it is "specific." For example, EC 50 Alternatively, if Kd is less than or equal to 1 mM, for example, 500 μM, 100 μM, 10 μM, 9.5 μM, 9 μM, 8.5 μM, 8 μM, 7.5 μM, 7 μM, 6.5 μM, 6 μM, 5.5 μM, 5.5 μM, 4.5 μM, 3.5 μM, 2.5 μM, 1.5 μM, 1.5 μM, 750 nM, 500 nM, 250 nM, or 100 nM, the binding is specific.
[0060] The term "EC" as used herein 50 "Equation 50%" means the concentration of the compound at which a predetermined activity, such as the binding of the compound or other ligands of the present invention and the functional activity of the OR, is 50% of the maximum OR activity that can be measured using the same assay in the absence of the compound. In other words, "EC 50 " is the concentration of a compound that provides 50% activation, where 100% activation is defined as the amount of activity that does not increase even when more agonists are added.
[0061] The terms “increase” and “decrease” refer to a change in the melanin content present in melanocytes. The “increase” or “decrease” in melanocyte production is preferably measured in a reaction in which OR7C1, as defined herein, present on melanocytes or skin excisions, is brought into contact with the compound for use in the present invention, and the change in melanin content is relative to the level of melanin content present in melanocytes in the absence of the compound of the present invention or in the presence of 50 μM of 3,4-dihydroxyphenylalanine (DOPA).
[0062] In this specification, the term "non-therapeutic" refers to a concept that excludes medical practices, i.e., treatment of the human body through medical therapy.
[0063] The terms and other references used herein will be readily understood by those skilled in the art.
[0064] Preferred descriptions (features) and embodiments of the methods, compositions, and uses of the present invention are set forth herein. Each description and embodiment of the present invention as thus defined may be combined with any other description and / or embodiment unless otherwise expressly indicated. In particular, any feature indicated as preferred or advantageous may be combined with any other feature or description indicated as preferred or advantageous. Hereinafter, the present invention can be captured in particular by any combination of any one or more of the descriptions and embodiments numbered below with any other aspects and / or embodiments.
[0065] 1. A tanning composition containing the following: (a) Cosmetically acceptable carriers, diluents and / or excipients, and (b) At least one tanning compound selected from the group comprising compounds of formulas (I), (II), (III), and (IV), or their racemates, stereoisomers, tautomers, salts and / or solvates (including mixtures thereof):
[0066] [ka]
[0067] (In the formula, dashes signify conjugation)
[0068] [ka]
[0069] represents any double bond; and R 1 , R 2 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 3 , R 4 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 3 Together with R 1 These, together with the carbon atoms to which they are bonded, form a C5-membered ring from saturated C3 (the ring is composed of one or more C 1-6 They may be substituted with alkyl substituents; R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -X-[CR 13 R 14 ] n -O-[CR 17 R 18 ] m -OH,-([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR13 R 14 ] n -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5; n is an integer selected from 0, 1, 2, 3, or 4; y is an integer selected from 1, 2, or 3; X is either a single bond or O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; or R 3 and R 5 These are combined into the formula -O-[CR 17 R 18 ] p It is -O- and together with the carbon atoms to which they are bonded, it forms a 5-membered or 6-membered heterocycline portion (the heterocycline is one or more C 1-6 (May be substituted with alkyl substituents) to form; p is an integer selected from 1 or 2; or R 5 and R 6 Together, =[CR 14 ]-[CR 17 R 18 ] m -Forms OH; or R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); or R 5 and R 8 These, along with the carbon atoms to which they are bonded, form saturated or unsaturated C5 or C6 membered rings (the aforementioned rings are oxo, C 1-6 Alkyl, -OC1-6 Alkyl, -CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 17 R 18 ] m -COH or -[CR 17 R 18 ] m -OH may be substituted with one or more substituents independently selected from each; or the two substituents on the ring may, together with the carbon atom to which they are bonded, form a 3- to 6-membered heterocyclyl moiety (the heterocyclyl moiety is C 1-6 The heterocycline may be substituted with one or more substituents independently selected from alkyl or oxo, or the two substituents on the heterocycline may, together with the atom to which they are bonded, form a 3- to 6-membered heterocycline moiety; or R 6 and R 9 They form a C3-membered ring together with the carbon atoms to which they are bonded; R 6 If present, hydrogen or C 1-6 It is alkyl; R 7 If present, hydrogen or C 1-6 It is alkyl; R 8 is hydrogen or C 1-6 It is alkyl; or R 8 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 Forms (which may be substituted with alkyl substituents); R 9 , R 10 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 9 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 Forms (which may be substituted with alkyl substituents); or R 9 Together with R 3 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 Forms (which may be substituted with alkyl substituents); R 11 , R 12 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 9 and R 11 These, along with the carbon atoms to which they are bonded, form saturated or unsaturated C5 or C6 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 20 is hydrogen or C 1-6 It is alkyl; R 21 is hydrogen or C 1-6 It is alkyl; R 22 is hydrogen, C 1-6 Alkyl and -CO-R 19 Selected from the group including; R 23 is hydrogen or C 1-6 It is alkyl; R 24 is hydrogen or C 1-6 It is alkyl; or R 23 and R 24 These, along with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline portion (the heterocycline is C 1-6 (May be substituted with one or more substituents independently selected from each alkyl group) to form; R 25 is hydrogen or C 1-6 It is alkyl; or R 24 and R25 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is C 1-6 It may be substituted with one or more substituents independently selected from alkyl or oxo, or one of the substituents and R 23 They form a 3- to 6-membered heterocycline moiety together with the atoms to which they are bonded; R 26 is hydrogen or C 1-6 It is alkyl; R 27 If present, hydrogen or C 1-6 It is alkyl; or R 20 and R 27 They form a C3-membered ring together with the carbon atoms to which they are bonded; R 28 is hydrogen, oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -OC 1-6 Alkyl, -[CR 17 R 18 ] m -COH and -[CR 17 R 18 ] m Selected from the group containing -OH; R 29 is hydrogen or C 1-6 It is alkyl; R 30 If present, hydrogen or C 1-6 It is alkyl; or R 23 Together with R 30 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); or R 29 and R28 Together, they form the equation -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 Forms (which may be substituted with alkyl substituents); q is an integer selected from 0, 1, 2, or 3, preferably q is 1; R 40 is, -[CR 17 R 18 ] m -OH, -CO-C 1-6 Alkyl, -O-([CR 17 R 18 ] m -O-) t -C 1-6 Selected from the group including alkyl groups, where t is an integer selected from 0, 1, 2, or 3; R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 40 and R 42 These, together with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline moiety; R 50 is selected from OH or oxo; and R 51 is hydrogen or C 1-10 (It is alkyl.)
[0070] 2. The tanning composition described in Description 1, wherein the compound is (Ia), (Ib), (Ic), (Id), (IIa), (IIIa), or (IVa).
[0071] [ka]
[0072] (In the formula, R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 20 , R 21 , R 22 , R 23 , R 24 , R 25 , R 27 , R 40 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 , R 50 This is defined in explanation 1, R t and R s Each of them is independently of hydrogen or C 1-6 (Selected from alkyl groups).
[0073] 3. A tanning composition described in any one of descriptions 1 to 2, wherein the compound is of formula (Ie).
[0074] [ka]
[0075] (In the formula, R 3 , R 4 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 3 , R 4 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; preferably R 3 , R 4 Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; preferably R 3 , R 4 Each is independently selected from hydrogen or methyl; R 5is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -CO-R 19 Selected from the group including; preferably R 5 is -X-[CHR 14 ] n -C(=O)-[CHR 18 ] m -R 19 , -X-[CHR 14 ] n -CH(OH)-[CHR 18 ] m -R 19 , -X-[CHR 14 ] n -[CHR 18 ] m -OH, -X-[CHR 14 ] n -O-[CHR 18 ] m -OH,-[CHR 14 ] n -CO-R 19 Selected from the group including; preferably R 5 is -O-[CHR 14 ] n -C(=O)-[CHR 18 ] m -R 19 ,-[CHR 14 ] n -C(=O)-[CHR 18 ] m -R 19 、-O-[CHR 14 ] n -CH(OH)-[CHR 18 ] m -R 19 ,-[CHR 14 ] n -CH(OH)-[CHR18 ] m -R 19 、-O-[CHR 14 ] n -[CHR 18 ] m -OH,-[CHR 14 ] n -[CHR 18 ] m -OH, -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5, and n is an integer selected from 0, 1, 2, 3, or 4; preferably m is selected from 1, 2, or 3, preferably m is 1 or 2, preferably n is selected from 0, 1, 2, or 3; preferably n is selected from 0, 1, or 2; X is either a single bond or O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; preferably R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; and R 8 is hydrogen or C 1-6 It is alkyl; preferably R 8 is hydrogen or C 1-5It is alkyl; preferably R 8 is hydrogen or C 1-4 (It is alkyl.)
[0076] 4. A tanning composition described in any one of the descriptions 1 to 2, wherein the compound is of formula (If),
[0077] [ka]
[0078] (In the formula, R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -X-[CR 13 R 14 ] n -O-[CR 17 R 18 ] m -OH,-([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 13 R 14 ] n -CO-R 19 Selected from the group including; preferably R 5 is -X-[CHR 14 ] n -C(=O)-[CHR 18 ] m -R 19 , -X-[CHR 14 ] n -CH(OH)-[CHR 18 ] m -R 19 , -X-[CHR14 ] n -[CHR 18 ] m -OH, -X-[CHR 14 ] n -O-[CHR 18 ] m -OH,-([CHR 18 ] m -O) y -C 1-6 Alkyl, -[CHR 14 ] n -CO-R 19 Selected from the group including; preferably R 5 is -O-[CHR 14 ] n -C(=O)-[CHR 18 ] m -R 19 ,-[CHR 14 ] n -C(=O)-[CHR 18 ] m -R 19 、-O-[CHR 14 ] n -CH(OH)-[CHR 18 ] m -R 19 ,-[CHR 14 ] n -CH(OH)-[CHR 18 ] m -R 19 、-O-[CHR 14 ] n -[CHR 18 ] m -OH,-[CHR 14 ] n -[CHR 18 ] m -OH, -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5, n is an integer selected from 0, 1, 2, 3, or 4; y is an integer selected from 1, 2, or 3; preferably m is selected from 1, 2, or 3, preferably m is 1 or 2, preferably n is selected from 0, 1, 2, or 3, preferably n is selected from 0, 1, or 2; preferably y is 1 or 2; X is either a single bond or O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; preferably R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; and R 6 is hydrogen or C 1-6 It is alkyl; preferably R 6 is hydrogen or C 1-4 It is alkyl; preferably R 6 is hydrogen or C 1-2 It is alkyl; preferably R 6 is either hydrogen or methyl; or R 5 and R 6 Together, =[CR 14 ]-[CR 17 R 18 ] m -Forms OH; preferably R 5 and R 6 Together = [CH]-[CHR 18 ] m -Forms an OH group; and m is 1 or 2; preferably R 5 and R 6 Together = [CH]-[CH2] m-Forms an OH group; and m is either 1 or 2.
[0079] 5. A tanning composition described in any one of the descriptions 1 to 2, wherein the compound is of formula (Ig).
[0080] [ka]
[0081] (In the formula, R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -X-[CR 13 R 14 ] n -O-[CR 17 R 18 ] m -OH,-([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 13 R 14 ] n -CO-R 19 Selected from the group including; preferably R 5 is -X-[CHR 14 ] n -C(=O)-[CHR 18 ] m -R 19 , -X-[CHR 14 ] n -CH(OH)-[CHR 18 ] m -R 19 , -X-[CHR 14 ] n -[CHR18 ] m -OH, -X-[CHR 14 ] n -O-[CHR 18 ] m -OH,-([CHR 18 ] m -O) y -C 1-6 Alkyl, -[CHR 14 ] n -CO-R 19 Selected from the group including; preferably R 5 is -O-[CHR 14 ] n -C(=O)-[CHR 18 ] m -R 19 ,-[CHR 14 ] n -C(=O)-[CHR 18 ] m -R 19 、-O-[CHR 14 ] n -CH(OH)-[CHR 18 ] m -R 19 ,-[CHR 14 ] n -CH(OH)-[CHR 18 ] m -R 19 、-O-[CHR 14 ] n -[CHR 18 ] m -OH,-[CHR 14 ] n -[CHR 18 ] m -OH, -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5, n is an integer selected from 0, 1, 2, 3, or 4; y is an integer selected from 1, 2, or 3; preferably m is selected from 1, 2, or 3, preferably m is 1 or 2, preferably n is selected from 0, 1, 2, or 3; preferably n is selected from 0, 1, or 2; preferably y is 1 or 2; X is either a single bond or O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; preferably R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; R 6 is hydrogen or C 1-6 It is alkyl; preferably R 6 is hydrogen or C 1-4 It is alkyl; preferably R 6 is hydrogen or C 1-2 It is alkyl; preferably R 6 is either hydrogen or methyl; or R 5 and R 6 Together, =[CR 14 ]-[CR 17 R 18 ] m -Forms OH; or R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 5 and R 6 Together = [CH]-[CHR 18 ]m -Forms an OH group; and m is either 1 or 2; or R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a six-membered heterocycline moiety (the heterocycline consists of one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 5 and R 6 Together = [CH]-[CH2] m -Forms an OH group; and m is either 1 or 2; or R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 6-membered dioxany moiety, for example, 1,3-dioxany (the dioxany is composed of one or more C 1-6 Alkyl substituents, for example, one or more C 1-4 Alkyl substituent, one or more C 1-3 (May be substituted with alkyl substituents) to form.
[0082] 6. A tanning composition described in any one of the descriptions 1 to 2, wherein the compound is of formula (IIb).
[0083] [ka]
[0084] In the formula, use dashes for concatenation.
[0085] [ka]
[0086] represents any double bond; and
[0087] [ka]
[0088] represents any single bond; R 28 is hydrogen, oxo, C 1-6Alkyl, -O-C 1-6 Alkyl, -[CR 17 R 18 m -O-CO-C 1-6 Alkyl, -[CR 17 R 18 m -O-C 1-6 Alkyl, -[CR 17 R 18 m -COH and -[CR 17 R 18 m -OH, and is selected from the group consisting of; m is 1, 2, 3 or 4, and R 17 and R 18 are each independently hydrogen or C 1-6 alkyl; preferably R 28 is hydrogen, oxo, C 1-4 alkyl, -O-C 1-4 alkyl, -[CHR 18 m -O-CO-C 1-4 alkyl, -[CHR 18 m -O-C 1-4 alkyl, -[CHR 18 m -COH and -[CHR 18 m -OH, and is selected from the group consisting of; m is 1, 2 or 3, and R 18 is hydrogen or C 1-4 alkyl; preferably R 28 is hydrogen, oxo, C 1-3 alkyl, -O-C 1-3 alkyl, -[CHR 18 m -O-CO-C 1-3 alkyl, -[CHR 18 m -O-C 1-3 alkyl, -[CHR 18 m -COH and -[CHR 18 m -OH, and is selected from the group consisting of; m is 1, 2 or 3, and R 18 is hydrogen or C 1-3 alkyl; R 29 is hydrogen or C 1-6 alkyl; preferably R 29 is hydrogen or C 1-4 alkyl; preferably R 29 is hydrogen or C 1-2 alkyl; preferably R 29 is hydrogen or methyl; or R 29 and R 28 together form a group of the formula -O-[CR 17 R 18 p -O-, where p is an integer selected from 1 or 2; and together with the carbon atom to which they are attached form a 5- or 6-membered heterocyclyl moiety (said heterocyclyl may be substituted with one or more C 1-6 alkyl substituents), and R 17 and R 18 are each independently selected from hydrogen or C 1-6 alkyl; preferably R 29 and R 28 together form a group of the formula -O-[CR 17 R 18 -O-; and together with the carbon atom to which they are attached form a dioxolanyl (said dioxolanyl may be substituted with one or more C 1-4 alkyl substituents), and R 17 and R 18 are each independently selected from hydrogen or C 1-4 alkyl; preferably R 29 and R 28 together form a group of the formula -O-[CR 17 R 18 -O-; and together with the carbon atom to which they are attached form a dioxolanyl (said dioxolanyl may be substituted with one or more C 1-2 alkyl substituents, for example C 1-2 alkyl substituents), and R 17 and R 18 Each of them is independently of hydrogen or C 1-2 (Selected from alkyl groups).
[0089] 7. A tanning composition described in any one of the descriptions 1 to 2, wherein the compound is of formula (IIa),
[0090] [ka]
[0091] (In the formula, dashes signify conjugation)
[0092] [ka]
[0093] represents any double bond; and R 20 is hydrogen or C 1-6 It is alkyl; preferably R 20 is hydrogen or C 1-4 It is alkyl; preferably R 20 is hydrogen or C 1-2 It is alkyl; preferably R 20 is either hydrogen or methyl; R 21 is hydrogen or C 1-6 It is alkyl; preferably R 21 is hydrogen or C 1-4 It is alkyl; preferably R 21 is hydrogen or C 1-2 It is alkyl; preferably R 21 is either hydrogen or methyl; R 22 is hydrogen, C 1-6 Alkyl and -CO-R 19 Selected from the group including; R 19 is hydrogen or C 1-6 It is alkyl; preferably R 22 is hydrogen, C 1-4 Alkyl and -CO-R 19 Selected from the group including; R19 is hydrogen or C 1-4 alkyl; preferably R 22 is hydrogen, C 1-2 alkyl and -CO-R 19 is selected from the group comprising; R 19 is hydrogen or C 1-2 alkyl; preferably R 22 is selected from the group comprising hydrogen, methyl and -CO-methyl; R 23 is hydrogen or C 1-6 alkyl; preferably R 23 is hydrogen or C 1-4 alkyl; preferably R 23 is hydrogen, methyl or ethyl; R 24 is hydrogen or C 1-6 alkyl; preferably R 24 is hydrogen or C 1-4 alkyl; preferably R 24 is hydrogen or C 1-2 alkyl; preferably R 24 is hydrogen or methyl; or R 23 and R 24 together with the carbon atom to which they are attached form a 3- to 6-membered heterocyclyl moiety (said heterocyclyl may be substituted with one or more substituents independently selected from C 1-6 alkyl); preferably R 23 and R 24 together with the carbon atom to which they are attached form a 3- to 5-membered heterocyclyl moiety (said heterocyclyl may be substituted with one or more C 1-4 alkyl substituents); preferably R 23 and R 24 together with the carbon atom to which they are attached form a 3- to 4-membered heterocyclyl moiety (said heterocyclyl may be substituted with one or more C 1-2 alkyl substituents); preferably R 23 and R 24These, along with the carbon atoms to which they are bonded, form a 3-heterocyclyl moiety, preferably oxyranyl (the heterocyclyl is one or more C 1-2 Forms an alkyl substituent, preferably substituted with methyl; R 25 is hydrogen or C 1-6 It is alkyl; preferably R 25 is hydrogen or C 1-4 It is alkyl; preferably R 25 is hydrogen or C 1-2 It is alkyl; preferably R 25 is either hydrogen or methyl; or R 24 and R 25 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is C 1-6 It may be substituted with one or more substituents independently selected from alkyl or oxo, or one of the substituents and R 23 They form a 3- to 6-membered heterocycline moiety together with the atoms to which they are bonded; preferably R 24 and R 25 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is C 1-4 It may be substituted with one or more substituents independently selected from alkyl or oxo, or one of the substituents and R 23 They form a 4- to 6-membered heterocycline moiety together with the atoms to which they are bonded; preferably R 24 and R 25 These, along with the carbon atoms to which they are bonded, form a 5- or 6-membered heterocyclyl moiety, for example, tetrahydropyranyl or tetrahydrofuranyl (the heterocyclyl is C 1-2 It may be substituted with one or more substituents independently selected from alkyl or oxo, or one of the substituents and R 23 They form a 5- to 6-membered heterocycline moiety (such as dioxolanil) with the atoms to which they are bonded; R 27 However, if present, hydrogen or C 1-6 It is alkyl; preferably R 27 is hydrogen or C 1-4 It is alkyl; preferably R 27 is hydrogen or C 1-2 It is alkyl; preferably R 27 (It is either hydrogen or methyl).
[0094] 8. A tanning composition according to any one of descriptions 1, 2, or 7, wherein the compound is of formula (IIa). (In the formula, dashes signify conjugation)
[0095] [ka]
[0096] represents any double bond; and R 20 is hydrogen or C 1-6 It is alkyl; preferably R 20 is hydrogen or C 1-4 It is alkyl; preferably R 20 is hydrogen or C 1-2 It is alkyl; preferably R 20 is either hydrogen or methyl; R 21 is hydrogen or C 1-6 It is alkyl; preferably R 21 is hydrogen or C 1-4 It is alkyl; preferably R 21 is hydrogen or C 1-2 It is alkyl; preferably R 21 is either hydrogen or methyl; R 22 is hydrogen, C 1-6 Alkyl and -CO-R 19 Selected from the group including; R 19 is hydrogen or C 1-6 It is alkyl; preferably R 22 is hydrogen, C 1-4 Alkyl and -CO-R19 Selected from the group including; R 19 is hydrogen or C 1-4 It is alkyl; preferably R 22 is hydrogen, C 1-2 Alkyl and -CO-R 19 Selected from the group including; R 19 is hydrogen or C 1-2 It is alkyl; preferably R 22 This is selected from the group including hydrogen, methyl, and -CO-methyl; R 23 is hydrogen or C 1-6 It is alkyl; preferably R 23 is hydrogen or C 1-4 It is alkyl; preferably R 23 is hydrogen, methyl, or ethyl; R 24 is hydrogen or C 1-6 It is alkyl; preferably R 24 is hydrogen or C 1-4 It is alkyl; preferably R 24 is hydrogen or C 1-2 It is alkyl; preferably R 24 is either hydrogen or methyl; or R 23 and R 24 These are 3- to 6-membered heterocyclyl moieties containing one or two oxygen atoms along with the carbon atoms to which they are bonded, with the remainder being carbon atoms (the heterocyclyl is C 1-6 Forms (which may be substituted with one or more substituents independently selected from each alkyl group); preferably R 23 and R 24 These are 3- to 5-membered heterocyclyl moieties containing one or two oxygen atoms along with the carbon atoms to which they are bonded, with the remainder being carbon atoms (the heterocyclyl is C 1-4 Forms (which may be substituted with one or more substituents independently selected from each alkyl group); preferably R 23 and R 24These include a 3- to 4-membered heterocyclyl moiety containing one oxygen atom and the rest being carbon atoms, along with the carbon atoms to which they are bonded (the heterocyclyl contains one or more carbon atoms). 1-2 Forms (which may be substituted with alkyl); preferably R 23 and R 24 These, along with the carbon atoms to which they are bonded, are oxiranyl (the oxiranyl is one or more C 1-2 Forms an alkyl substituent, preferably substituted with methyl; R 25 is hydrogen or C 1-6 It is alkyl; preferably R 25 is hydrogen or C 1-4 It is alkyl; preferably R 25 is hydrogen or C 1-2 It is alkyl; preferably R 25 is either hydrogen or methyl; or R 24 and R 25 These include a 5 or 6-membered heterocyclyl portion containing one or two oxygen atoms along with the carbon atoms to which they are bonded, with the remainder being carbon atoms (the heterocyclyl is C 1-6 It may be substituted with one or more substituents independently selected from alkyl or oxo, or one of the substituents and R 23 They form a 3- to 6-membered heterocycline moiety (containing one or two oxygen atoms and the rest being carbon atoms) together with the atoms to which they are bonded; preferably R 24 and R 25 These include a 5 or 6-membered heterocyclyl portion containing one or two oxygen atoms along with the carbon atoms to which they are bonded, with the remainder being carbon atoms (the heterocyclyl is C 1-4 It may be substituted with one or more substituents independently selected from alkyl or oxo, or one of the substituents and R 23 They form a 4- to 6-membered heterocycline moiety (containing one or two oxygen atoms and the rest being carbon atoms) together with the atoms to which they are bonded; preferably R 24 and R 25These, along with the carbon atoms to which they are bonded, are tetrahydropyranyl or tetrahydrofuranyl (the tetrahydropyranyl or tetrahydrofuranyl is C 1-2 It may be substituted with one or more substituents independently selected from alkyl or oxo, or one of the substituents and R 23 They form a 5- to 6-membered heterocycline moiety (such as dioxolanyl) containing one or two oxygen atoms and the rest being carbon atoms, together with the atoms to which they are bonded; R 27 If present, hydrogen or C 1-6 It is alkyl; preferably R 27 is hydrogen or C 1-4 It is alkyl; preferably R 27 is hydrogen or C 1-2 It is alkyl; preferably R 27 (It is either hydrogen or methyl).
[0097] 9. A tanning composition described in any one of descriptions 1, 2, 7, or 8, wherein the compound is of formula (IIa). (In the formula, dashes signify conjugation)
[0098] [ka]
[0099] represents any double bond; and R 20 is hydrogen or C 1-4 It is alkyl; preferably R 20 is hydrogen or C 1-2 It is alkyl; preferably R 20 is either hydrogen or methyl; R 21 is hydrogen or C 1-4 It is alkyl; preferably R 21 is hydrogen or C 1-2 It is alkyl; preferably R 21 is either hydrogen or methyl; R 22is hydrogen, C 1-4 Alkyl and -CO-R 19 Selected from the group including; R 19 is hydrogen or C 1-4 It is alkyl; preferably R 22 is hydrogen, C 1-2 Alkyl and -CO-R 19 Selected from the group including; R 19 is hydrogen or C 1-2 It is alkyl; preferably R 22 This is selected from the group including hydrogen, methyl, and -CO-methyl; R 23 is hydrogen or C 1-4 It is alkyl; preferably R 23 is hydrogen, methyl, or ethyl; R 24 is hydrogen or C 1-4 It is alkyl; preferably R 24 is hydrogen or C 1-2 It is alkyl; preferably R 24 is either hydrogen or methyl; or R 23 and R 24 These are 3 to 5-membered heterocyclyl moieties that contain one or two oxygen atoms along with the carbon atoms to which they are bonded, with the remainder being carbon atoms (the heterocyclyl is one or more C 1-4 Forms (which may be substituted with alkyl substituents); preferably R 23 and R 24 These consist of a 3- to 4-membered heterocycline moiety containing one oxygen atom and the rest being carbon atoms, along with the carbon atoms to which they are bonded (the heterocycline contains one or more carbon atoms). 1-2 Forms (which may be substituted with alkyl substituents); preferably R 23 and R 24 These, along with the carbon atoms to which they are bonded, are oxyranyl (the oxyranyl is one or more C 1-2 Forms an alkyl substituent, preferably substituted with methyl; R 25 is hydrogen or C 1-4 It is alkyl; preferably R25 is hydrogen or C 1-2 It is alkyl; preferably R 25 is either hydrogen or methyl; or R 24 and R 25 These include a 5 or 6-membered heterocyclyl portion containing one or two oxygen atoms along with the carbon atoms to which they are bonded, with the remainder being carbon atoms (the heterocyclyl is C 1-4 It may be substituted with one or more substituents independently selected from alkyl or oxo, or one of the substituents and R 23 They may form a 4- to 6-membered heterocycline moiety (containing one or two oxygen atoms and the rest being carbon atoms) together with the atoms to which they are bonded; preferably R 24 and R 25 These, along with the carbon atoms to which they are bonded, are tetrahydropyranyl or tetrahydrofuranyl (the tetrahydropyranyl or tetrahydrofuranyl is C 1-2 It may be substituted with one or more substituents independently selected from alkyl or oxo, or one of the substituents and R 23 They form a 5- to 6-membered heterocycline moiety (such as dioxolanyl) containing one or two oxygen atoms and the rest being carbon atoms, together with the atoms to which they are bonded; R 27 is hydrogen or C 1-4 It is alkyl; preferably R 27 is hydrogen or C 1-2 It is alkyl; preferably R 27 (It is either hydrogen or methyl).
[0100] 10. A tanning composition described in any one of the descriptions 1 to 2, wherein the compound is of formula (Ic).
[0101] [ka]
[0102] (In the formula, R 1 , R 2 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 1 , R 2 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; preferably R 1 , R 2 Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; preferably R 1 , R 2 Each is independently selected from hydrogen or methyl; R 3 , R 4 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 3 , R 4 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; preferably R 3 , R 4 Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; preferably R 3 , R 4 Each is independently selected from hydrogen or methyl; R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -X-[CR 13 R 14 ] n -O-[CR 17 R 18 ] m -OH,-([CR 17 R 18 ] m -O)y -C 1-6 Alkyl, -[CR 13 R 14 ] n -CO-R 19 Selected from the group including; preferably R 5 is -X-[CHR 14 ] n -C(=O)-[CHR 18 ] m -R 19 , -X-[CHR 14 ] n -CH(OH)-[CHR 18 ] m -R 19 , -X-[CHR 14 ] n -[CHR 18 ] m -OH, -X-[CHR 14 ] n -O-[CHR 18 ] m -OH,-([CHR 18 ] m -O) y -C 1-6 Alkyl, -[CHR 14 ] n -CO-R 19 Selected from the group including; preferably R 5 is -O-[CHR 14 ] n -C(=O)-[CHR 18 ] m -R 19 ,-[CHR 14 ] n -C(=O)-[CHR 18 ] m -R 19 、-O-[CHR 14 ] n -CH(OH)-[CHR 18 ] m -R 19 ,-[CHR 14 ] n -CH(OH)-[CHR 18 ] m -R 19 、-O-[CHR 14 ] n -[CHR 18 ]m -OH,-[CHR 14 ] n -[CHR 18 ] m -OH, -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5, n is an integer selected from 0, 1, 2, 3, or 4; y is an integer selected from 1, 2, or 3; preferably m is selected from 1, 2, or 3, preferably m is 1 or 2, preferably n is selected from 0, 1, 2, or 3; preferably n is selected from 0, 1, or 2; preferably y is 1 or 2; X is either a single bond or O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; preferably R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; or R 3 and R 5 These are combined into the formula -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C1-6 (may be substituted with alkyl substituents), where p is an integer selected from 1 or 2, and R 17 , R 18 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 3 and R 5 Together, they form the equation -O-[CR 17 R 18 ]-O- and together with the carbon atoms to which they are bonded, a 5-membered heterocycline moiety (the heterocycline is one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 3 and R 5 Together, they form the equation -O-[CR 17 R 18 ]-O- and together with the carbon atoms to which they are bonded, they form a dioxolanyl moiety, R 17 , R 18 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups, the dioxolanyl moiety consists of one or two C atoms. 1-4 Alkyl substituents, preferably one or two C 1-2 The alkyl substituent may be substituted, preferably with one or two methyl groups; R 6 is hydrogen or C 1-6 It is alkyl; preferably R 6 is hydrogen or C 1-4 It is alkyl; preferably R 6 is hydrogen or C 1-2 It is alkyl; preferably R 6 is either hydrogen or methyl; R 9 , R 10 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 9 , R 10 Each of them is independently of hydrogen or C 1-4 Selected from alkyl; R 9 , R 10Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; or R 9 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 The ring may be substituted with alkyl substituents; preferably, the ring has one or more C 1-4 The ring may be substituted with alkyl substituents; preferably, the ring has one or more C 1-2 (May be substituted with alkyl substituents) to form.
[0103] 11. The compound is of formula (Ic), a tanning composition as described in any one of descriptions 1, 2, or 10, (wherein: R 2 is hydrogen or C 1-6 It is alkyl; preferably R 2 is hydrogen or C 1-4 It is alkyl; preferably R 2 is hydrogen or C 1-2 It is alkyl; preferably R 2 is hydrogen or methyl, preferably hydrogen; R 4 is hydrogen or C 1-6 It is alkyl; preferably R 4 is hydrogen or C 1-4 It is alkyl; preferably R 4 is hydrogen or C 1-2 It is alkyl; preferably R 4 is either hydrogen or methyl; R 3 and R 5 Together, they form the equation -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (may be substituted with alkyl substituents) form; p is an integer selected from 1 or 2, R 17 , R 18Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 3 and R 5 Together, they form the equation -O-[CR 17 R 18 ]-O- and together with the carbon atoms to which they are bonded, a 5-membered heterocycline moiety (the heterocycline is one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 3 and R 5 Together, they form the equation -O-[CR 17 R 18 ]-O- and together with the carbon atoms to which they are bonded, they form a dioxolanyl moiety, R 17 , R 18 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups, the dioxolanyl moiety consists of one or two C atoms. 1-4 Alkyl substituents, preferably one or two C 1-2 The alkyl substituent may be substituted, preferably with one or two methyl groups; R 6 is hydrogen or C 1-6 It is alkyl; preferably R 6 is hydrogen or C 1-4 It is alkyl; preferably R 6 is hydrogen or C 1-2 It is alkyl; preferably R 6 is either hydrogen or methyl; R 10 is hydrogen or C 1-6 It is alkyl; preferably R 10 is hydrogen or C 1-4 It is alkyl; R 10 is hydrogen or C 1-3 Alkyl, preferably hydrogen, methyl, ethyl, n-propyl, or isopropyl; Furthermore, R 9 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6The ring may be substituted with alkyl; preferably, the ring has one or more C 1-4 The ring may be substituted with alkyl substituents; preferably, the ring has one or more C 1-2 The ring may be substituted with alkyl substituents, and preferably, the ring may be substituted with one or more methyl substituents to form a ring.
[0104] 12. A tanning composition according to any one of descriptions 1, 2, 10, or 11, wherein the compound is of formula (Ic), (wherein, R 2 is hydrogen or C 1-4 It is alkyl; preferably R 2 is hydrogen or C 1-2 It is alkyl; preferably R 2 is hydrogen or methyl, preferably hydrogen; R 4 is hydrogen or C 1-4 It is alkyl; preferably R 4 is hydrogen or C 1-2 It is alkyl; preferably R 4 is either hydrogen or methyl; R 3 and R 5 Together, they form the equation -O-[CR 17 R 18 ]-O- and together with the carbon atoms to which they are bonded, a 5-membered heterocycline moiety (the heterocycline is one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 3 and R 5 Together, they form the equation -O-[CR 17 R 18 ]-O- and together with the carbon atoms to which they are bonded, they form a dioxolanyl moiety, R 17 , R 18 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups, the dioxolanyl moiety consists of one or two C atoms. 1-4 Alkyl substituents, preferably one or two C 1-2The alkyl substituent may be substituted, preferably with one or two methyl groups; R 6 is hydrogen or C 1-4 It is alkyl; preferably R 6 is hydrogen or C 1-2 It is alkyl; preferably R 6 is either hydrogen or methyl; R 10 is hydrogen or C 1-4 It is alkyl; R 10 is hydrogen or C 1-3 Alkyl, preferably hydrogen, methyl, ethyl, n-propyl, or isopropyl; Furthermore, R 9 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 The ring may be substituted with alkyl substituents; preferably, the ring has one or more C 1-4 The ring may be substituted with alkyl substituents; preferably, the ring has one or more C 1-2 The ring may be substituted with alkyl substituents, and preferably, the ring may be substituted with one or more methyl substituents to form a ring.
[0105] 13. The compound is of formula (Id), and is a tanning composition as described in any one of descriptions 1 to 2.
[0106] [ka]
[0107] (In the formula, R 1 , R 2 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably, R 1 , R 2 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; preferably R 1 , R 2 Each of them is independently of hydrogen or C1-2 Selected from alkyl groups; preferably R 1 , R 2 Each is independently selected from hydrogen or methyl; R 3 , R 4 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 3 , R 4 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; preferably R 3 , R 4 Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; preferably R 3 , R 4 Each is independently selected from hydrogen or methyl; or R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form a C3 to C4 membered ring (the ring is composed of one or more C 1-4 Forms (which may be substituted with alkyl substituents); preferably R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form a C3-membered ring, namely cyclopropyl (the cyclopropyl is one or more C 1-2 The cyclopropyl may be substituted with an alkyl substituent; preferably, the cyclopropyl may be substituted with one or more methyl substituents) to form a compound; R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR17 R 18 ] m -OH, -X-[CR 13 R 14 ] n -O-[CR 17 R 18 ] m -OH,-([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 13 R 14 ] n -CO-R 19 Selected from the group including; preferably, R 5 is -X-[CHR 14 ] n -C(=O)-[CHR 18 ] m -R 19 , -X-[CHR 14 ] n -CH(OH)-[CHR 18 ] m -R 19 , -X-[CHR 14 ] n -[CHR 18 ] m -OH, -X-[CHR 14 ] n -O-[CHR 18 ] m -OH,-([CHR 18 ] m -O) y -C 1-6 Alkyl, -[CHR 14 ] n -CO-R 19 Selected from the group including; preferably R 5 is -O-[CHR 14 ] n -C(=O)-[CHR 18 ] m -R 19 ,-[CHR 14 ] n -C(=O)-[CHR 18 ] m -R 19 、-O-[CHR 14 ] n-CH(OH)-[CHR 18 ] m -R 19 ,-[CHR 14 ] n -CH(OH)-[CHR 18 ] m -R 19 、-O-[CHR 14 ] n -[CHR 18 ] m -OH,-[CHR 14 ] n -[CHR 18 ] m -OH, -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5, n is an integer selected from 0, 1, 2, 3, or 4; y is an integer selected from 1, 2, or 3; preferably m is selected from 1, 2, or 3, preferably m is 1 or 2, preferably n is selected from 0, 1, 2, or 3; preferably n is selected from 0, 1, or 2; preferably y is 1 or 2; X is either a single bond or O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; preferably R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; R 15 is OH, or R16 Together with R 15 It forms an oxo group; R 6 is hydrogen or C 1-6 It is alkyl; preferably R 6 is hydrogen or C 1-4 It is alkyl; preferably R 6 is hydrogen or C 1-2 It is alkyl; preferably R 6 is either hydrogen or methyl; or R 5 and R 6 Together, =[CR 14 ]-[CR 17 R 18 ] m -Forms OH; or R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 5 and R 6 Together = [CH]-[CHR 18 ] m -Forms an OH group; and m is either 1 or 2; or R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a six-membered heterocycline moiety (the heterocycline consists of one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 5 and R 6 Together = [CH]-[CH2] m -Forms an OH group; and m is either 1 or 2; or R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 6-membered dioxany moiety, for example, 1,3-dioxany (the dioxany is composed of one or more C 1-6 Alkyl substituents, for example, one or more C 1-4 Alkyl substituent, one or more C 1-3 Forms (which may be substituted with alkyl substituents); R 7is hydrogen or C 1-6 It is alkyl, preferably R 7 is hydrogen or C 1-4 It is alkyl; preferably R 7 is hydrogen or C 1-2 It is alkyl; preferably R 7 (It is either hydrogen or methyl).
[0108] 14. A tanning composition according to any one of Descriptions 1, 2, or 13, wherein the compound is of formula (Id), (wherein: R 2 is hydrogen or C 1-6 It is alkyl; preferably R 2 is hydrogen or C 1-4 It is alkyl; preferably R 2 is hydrogen or C 1-2 It is alkyl; preferably R 2 is hydrogen or methyl, preferably hydrogen; R 4 is hydrogen or C 1-6 It is alkyl; preferably R 4 is hydrogen or C 1-4 It is alkyl; preferably R 4 is hydrogen or C 1-2 It is alkyl; preferably R 4 is hydrogen or methyl, preferably hydrogen; R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form a C3 to C4 membered ring (the ring is composed of one or more C 1-4 Forms (which may be substituted with alkyl substituents); preferably R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form a C3-membered ring, namely cyclopropyl (the cyclopropyl is one or more C 1-2The cyclopropyl may be substituted with alkyl substituents; preferably, the cyclopropyl may be substituted with one or more methyl substituents) to form a compound; R 6 is hydrogen or C 1-6 It is alkyl; preferably R 6 is hydrogen or C 1-4 It is alkyl; preferably R 6 is hydrogen or C 1-2 It is alkyl; preferably R 6 is either hydrogen or methyl; R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a six-membered heterocycline moiety (the heterocycline consists of one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 6-membered dioxany moiety, for example, 1,3-dioxany (the dioxany is composed of one or more C 1-6 Alkyl substituents, for example, one or more C 1-4 Alkyl substituents, for example, one or more C 1-3 Alkyl substituents, for example, one or more C 1-2 Forming alkyl substituents (which may be substituted with one or more methyl substituents); and R 7 is hydrogen or C 1-6 It is alkyl, preferably R 7 is hydrogen or C 1-4 It is alkyl; preferably R 7 is hydrogen or C 1-2 It is alkyl; preferably R 7 (This is hydrogen or methyl, preferably methyl).
[0109] 15. A tanning composition according to any one of descriptions 1, 2, 13, or 14, wherein the compound is of formula (Id), (wherein: R 2 is hydrogen or C 1-4 It is alkyl; preferably R 2 is hydrogen or C 1-2 It is alkyl; preferably R 2 is hydrogen or methyl, preferably hydrogen; R 4 is hydrogen or C 1-4 It is alkyl; preferably R 4 is hydrogen or C 1-2 It is alkyl; preferably R 4 is hydrogen or methyl, preferably hydrogen; R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form a C3 to C4 membered ring (the ring is composed of one or more C 1-4 Forms (which may be substituted with alkyl substituents); preferably R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form a C3-membered ring, namely cyclopropyl (the cyclopropyl is one or more C 1-2 The cyclopropyl may be substituted with alkyl substituents; preferably, the cyclopropyl may be substituted with one or more methyl substituents) to form a compound; R 6 is hydrogen or C 1-4 It is alkyl; preferably R 6 is hydrogen or C 1-2 It is alkyl; preferably R 6 is either hydrogen or methyl; R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a six-membered heterocycline moiety (the heterocycline consists of one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 6-membered dioxany moiety, for example, 1,3-dioxany (the dioxany is composed of one or more C1-6 Alkyl substituents, for example, one or more C 1-4 Alkyl substituents, for example, one or more C 1-3 Alkyl substituents, for example, one or more C 1-2 Forming alkyl substituents (which may be substituted with one or more methyl substituents); and R 7 is hydrogen or C 1-4 It is alkyl; preferably R 7 is hydrogen or C 1-2 It is alkyl; preferably R 7 (This is hydrogen or methyl, preferably methyl).
[0110] 16. A tanning composition described in any one of Descriptions 1 to 2, wherein the compound is of formula (IIIa).
[0111] [ka]
[0112] (In the formula, dashes signify conjugation)
[0113] [ka]
[0114] represents any double bond; and R 40 is, -[CR 17 R 18 ] m -OH, -CO-C 1-6 Alkyl, -O-([CR 17 R 18 ] m -O-) t -C 1-6 Selected from the group including alkyl, where t is an integer selected from 0, 1, 2, or 3; m is an integer selected from 1, 2, 3, or 4, and R 17 and R 18 Each of them is independently of hydrogen or C 1-6Selected from alkyl groups; preferably R 40 is, -[CHR 18 ] m -OH, -CO-C 1-6 Alkyl, -O-([CHR 18 ] m -O-) t -C 1-6 Selected from the group including alkyl, where t is an integer selected from 0, 1, or 2; m is an integer selected from 1, 2, or 3, and R 18 is hydrogen or C 1-6 It is alkyl; preferably R 40 is, -[CHR 18 ] m -OH, -CO-C 1-4 Alkyl, -O-([CHR 18 ] m -O-) t -C 1-4 Selected from the group including alkyl, where t is an integer selected from 0 or 1; m is an integer selected from 1 or 2; and R 18 is hydrogen or C 1-4 It is alkyl; preferably R 40 is, -[CHR 18 ] m -OH, -CO-C 1-2 Alkyl, -O-[CHR 18 ] m -OC 1-2 Selected from the group including alkyl, m is an integer selected from 1 or 2, and R 18 is hydrogen or C 1-2 It is alkyl; R 42 , R 43 , R 44 , R 45 , R 46 , R 47 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 42 , R 43 , R 44 , R 45 , R 46 , R 47 Each of them is independently of hydrogen or C1-4 Selected from alkyl groups; preferably R 42 , R 43 , R 44 , R 45 , R 46 , R 47 Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; preferably R 42 , R 43 , R 44 , R 45 , R 46 , R 47 Each is independently selected from hydrogen or methyl; or R 40 and R 42 These, together with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline moiety; or preferably, R 40 and R 42 They form a 3- to 5-membered heterocycline moiety together with the carbon atoms to which they are bonded; or R 40 and R 42 They form a 3- to 4-membered heterocycline moiety together with the carbon atoms to which they are bonded; or R 40 and R 42 These atoms, together with the carbon atoms to which they are bonded, form a three-membered heterocycline moiety, preferably an oxyranyl moiety.
[0115] 17. A tanning composition described in any one of the descriptions 1 to 2, wherein the compound is of formula (IVa).
[0116] [ka]
[0117] (In the formula, R 50 (This is selected from either OH or oxo).
[0118] 18. A tanning composition according to any one of Descriptions 1 to 17, wherein the compound is selected from the group comprising the following:
[0119] [ka]
[0120] [ka]
[0121] 19. A tanning composition according to any one of Descriptions 1 to 18, wherein the compound is Amberketal or Ambermax.
[0122] 20. The tanning composition according to any one of Descriptions 1 to 19, wherein the composition is a sunless tanning composition, a moisturizing composition, or a hair care composition.
[0123] 21. The tanning composition according to any one of Descriptions 1 to 20, wherein the composition is selected from the group comprising gels, solutions, aerosols, emulsions, lotions, mousses, sprays, wipes, microcapsules, serums, creams, ointments, powders, and foams.
[0124] 22. The tanning composition according to any one of Descriptions 1 to 21, wherein the composition is incorporated into a device suitable for application to subcutaneous tissue, mucous membrane tissue, skin surface, or scalp.
[0125] 23. A sunscreen composition according to any one of Descriptions 1 to 22, further comprising a sunscreen, a skin conditioning agent, a sunscreen, a whitening agent, a skin protectant, an emollient, a viscosity enhancer, a wetting agent, or any combination thereof.
[0126] 24. A tanning composition according to any one of descriptions 1 to 23, further comprising at least one self-tanning substance.
[0127] 25. Compounds of formula (Ih), or their racemic mixtures, stereoisomers, tautomers, salts, and / or solvates (including mixtures thereof);
[0128] [ka]
[0129] (In the formula, R 5 is, -O-CHR 14 -C(=O)-[CR 17 R 18 ] m -R 19 ,-O-CHR 14 -CH(OH)-[CR 17 R 18 ] m -R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5; preferably m is selected from 1, 2, 3, or 4, preferably m is selected from 1, 2, or 3, preferably m is 1 or 2; R 14 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 14 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; preferably R 14 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; preferably R 14 , R 17 , R 18 , R 19 Each is independently selected from hydrogen or methyl; preferably R 14 , R 17 , R 18 These are, independently, hydrogen and R 19 (It is methyl).
[0130] 26. The compound is
[0131] [ka]
[0132] A compound selected from the compounds described in Description 25.
[0133] 27. Use of compounds of formula (IIb), (IIa), (IIIa), (IV), (Ie), (If), (Ig), (Ic), or (Id), or their racemates, stereoisomers, tautomers, salts and / or solvates (including mixtures thereof) as self-tanning substances, preferably, non-therapeutic use of compounds of formula (IIb), (IIa), (IIIa), (IV), (Ie), (If), (Ig), (Ic), or (Id), or their racemates, stereoisomers, tautomers, salts and / or solvates (including mixtures thereof) as self-tanning substances.
[0134] [ka]
[0135] (In the formula, dashes signify conjugation)
[0136] [ka]
[0137] represents any double bond; and
[0138] [ka]
[0139] represents any single bond; R 28 is hydrogen, oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C1-6 Alkyl, -[CR 17 R 18 ] m -OC 1-6 Alkyl, -[CR 17 R 18 ] m -COH and -[CR 17 R 18 ] m - Selected from the group containing OH; m is an integer selected from 1, 2, 3, 4, or 5. R 17 , R 18 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 29 is hydrogen or C 1-6 It is alkyl; or R 29 and R 28 Together, they form the equation -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (May be substituted with alkyl substituents) and p is an integer selected from 1 or 2; R 20 is hydrogen or C 1-6 It is alkyl; R 21 is hydrogen or C 1-6 It is alkyl; R 22 is hydrogen, C 1-6 Alkyl and -CO-R 19 Selected from the group including; R 23 is hydrogen or C 1-6 It is alkyl; R 24 is hydrogen or C 1-6 It is alkyl; or R 23 and R 24 These, along with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline portion (the heterocycline is C1-6 (May be substituted with one or more substituents independently selected from each alkyl group) to form; R 25 is hydrogen or C 1-6 It is alkyl; or R 24 and R 25 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is C 1-6 It may be substituted with one or more substituents independently selected from the alkyl group, or one of the substituents and R 23 They form a 3- to 6-membered heterocycline moiety together with the atoms to which they are bonded; R 27 If present, hydrogen or C 1-6 It is alkyl; or R 20 and R 27 They form a C3-membered ring together with the carbon atoms to which they are bonded; R 40 is, -[CR 17 R 18 ] m -OH, -CO-C 1-6 Alkyl, -O-([CR 17 R 18 ] m -O-) t -C 1-6 Selected from the group including alkyl groups, where t is an integer selected from 0, 1, 2, or 3; R 42 , R 43 , R 44 , R 45 , R 46 , R 47 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 40 and R 42 These, together with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline moiety; R 50 It is selected from OH or oxo; R 51is hydrogen or C 1-4 It is alkyl; R 1 , R 2 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 3 , R 4 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -X-[CR 13 R 14 ] n -O-[CR 17 R 18 ] m -OH,-([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 13 R 14 ] n -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5; n is an integer selected from 0, 1, 2, 3, or 4; y is an integer selected from 1, 2, or 3; X is either a single bond or O. R 13 , R 14, R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; or R 3 and R 5 These are combined into the formula -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (may be substituted with alkyl substituents), where p is an integer selected from 1 or 2; R 6 is hydrogen or C 1-6 It is alkyl; or R 5 and R 6 Together, =[CR 14 ]-[CR 17 R 18 ] m -Forms OH; or R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 7 is hydrogen or C 1-6 It is alkyl; R 8 is hydrogen or C 1-6 It is alkyl; or R 5 and R 8 These, along with the carbon atoms to which they are bonded, form saturated or unsaturated C5 or C6 membered rings (the aforementioned rings are oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -CO-C 1-6 Alkyl, -[CR 17R 18 ] m -O-CO-C 1-6 Alkyl, -([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 17 R 18 ] m -COH or -[CR 17 R 18 ] m -OH may be substituted with one or more substituents independently selected from each; or the two substituents on the ring may, together with the carbon atom to which they are bonded, form a 3- to 6-membered heterocyclyl moiety (the heterocyclyl moiety is C 1-6 The alkyl group may be substituted with one or more substituents independently selected from each alkyl group, or the two substituents on the heterocycline may, together with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline moiety; R 9 , R 10 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 6 and R 9 They form a C3-membered ring together with the carbon atoms to which they are bonded; or R 9 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 Forms (which may be substituted with alkyl substituents); or R 9 Together with R 3 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 (May be substituted with alkyl substituents) to form.
[0140] 28. Use of any one of the compositions described in Descriptions 1 to 24, or any one of the compounds described in Descriptions 25 to 26, or the use described in Description 27, for the purpose of darkening the skin.
[0141] 29. Use of any one of the compositions described in Descriptions 1 to 24, or any one of the compounds described in Descriptions 25 to 26, or the use described in Description 27, for sunless tanning.
[0142] 30. Use of any one of the compositions described in Descriptions 1 to 24, or any of the compounds described in Descriptions 25 to 26, or any of the uses described in Description 27, for the purpose of increasing the amount of melanin in melanocytes, increasing melanin synthesis, improving melanin transport, and / or improving the distribution of melanin in the upper basal layer.
[0143] 31. Use of compounds of formula (I), (II), (III), or (IV), or their racemates, stereoisomers, tautomers, salts, and / or solvates (including mixtures thereof), to increase the amount of melanin in melanocytes, to increase melanin synthesis, to improve melanin transport, and / or to improve the distribution of melanin in the upper basal layer.
[0144] [ka]
[0145] (In the formula, dashes signify conjugation)
[0146] [ka]
[0147] represents any double bond; and R 1 , R 2 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 3 , R 4 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 3 Together with R1 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -X-[CR 13 R 14 ] n -O-[CR 17 R 18 ] m -OH,-([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 13 R 14 ] n -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5; n is an integer selected from 0, 1, 2, 3, or 4; y is an integer selected from 1, 2, or 3; X is either a single bond or O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; or R 3 and R 5These are combined into the formula -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (May be substituted with alkyl substituents) and p is an integer selected from 1 or 2; or R 5 and R 6 Together, =[CR 14 ]-[CR 17 R 18 ] m -Forms OH; or R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); or R 5 and R 8 These, along with the carbon atoms to which they are bonded, form saturated or unsaturated C5 or C6 membered rings (the aforementioned rings are oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 17 R 18 ] m -COH or -[CR 17 R 18 ] m -OH may be substituted with one or more substituents independently selected from each; or the two substituents on the ring may, together with the carbon atom to which they are bonded, form a 3- to 6-membered heterocyclyl moiety (the heterocyclyl moiety is C 1-6The heterocycline may be substituted with one or more substituents independently selected from alkyl or oxo, or the two substituents on the heterocycline may, together with the atom to which they are bonded, form a 3- to 6-membered heterocycline moiety; or R 6 and R 9 They form a C3-membered ring together with the carbon atoms to which they are bonded; R 6 If present, hydrogen or C 1-6 It is alkyl; R 7 If present, hydrogen or C 1-6 It is alkyl; R 8 is hydrogen or C 1-6 It is alkyl; or R 8 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 Forms (which may be substituted with alkyl substituents); R 9 , R 10 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 9 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 Forms (which may be substituted with alkyl substituents); or R 9 Together with R 3 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 Forms (which may be substituted with alkyl substituents); R 11 , R 12 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 9 and R 11These, along with the carbon atoms to which they are bonded, form saturated or unsaturated C5 or C6 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 20 is hydrogen or C 1-6 It is alkyl; R 21 is hydrogen or C 1-6 It is alkyl; R 22 is hydrogen, C 1-6 Alkyl and -CO-R 19 Selected from the group including; R 23 is hydrogen or C 1-6 It is alkyl; R 24 is hydrogen or C 1-6 It is alkyl; or R 23 and R 24 These, along with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline portion (the heterocycline is C 1-6 (May be substituted with one or more substituents independently selected from each alkyl group) to form; R 25 is hydrogen or C 1-6 It is alkyl; or R 24 and R 25 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is C 1-6 It may be substituted with one or more substituents independently selected from alkyl or oxo, or one of the substituents and R 23 They form a 3- to 6-membered heterocycline moiety together with the atoms to which they are bonded; R 26 is hydrogen or C 1-6 It is alkyl; R 27 If present, hydrogen or C 1-6 It is alkyl; or R 20 and R 27They form a C3-membered ring together with the carbon atoms to which they are bonded; R 28 is hydrogen, oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -OC 1-6 Alkyl, -[CR 17 R 18 ] m -COH and -[CR 17 R 18 ] m Selected from the group containing -OH; R 29 is hydrogen or C 1-6 It is alkyl; R 30 If present, hydrogen or C 1-6 It is alkyl; or R 23 Together with R 30 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); or R 29 and R 28 Together, they form the equation -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 Forms (which may be substituted with alkyl substituents); q is an integer selected from 0, 1, 2, or 3, preferably q is 1; R 40 is, -[CR 17 R 18 ] m -OH, -CO-C 1-6 Alkyl, -O-([CR 17 R 18 ] m-O-) t -C 1-6 Selected from the group including alkyl groups, where t is an integer selected from 0, 1, 2, or 3; R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 40 and R 42 These, together with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline moiety; R 50 is selected from OH or oxo; and R 51 is hydrogen or C 1-10 (It is alkyl.)
[0148] 32. Use of compounds of formula (I), (II), (III), or (IV) as defined in any one of Descriptions 1 to 19, or their racemates, stereoisomers, tautomers, salts, and / or solvates (including mixtures thereof), or the use of compounds of formula (Ih) as defined in any one of Descriptions 25 to 26, or the use described in Description 27, in the preparation of compositions for increasing the amount of melanin in melanocytes, increasing melanin synthesis, improving melanin transport, and / or improving the distribution of melanin in the upper basal layer;
[0149] [ka]
[0150] (In the formula, dashes signify conjugation)
[0151] [ka]
[0152] represents any double bond; and R 1 , R 2 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 3 , R 4 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -X-[CR 13 R 14 ] n -O-[CR 17 R 18 ] m -OH,-([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 13 R 14 ] n -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5; n is an integer selected from 0, 1, 2, 3, or 4; y is an integer selected from 1, 2, or 3; X is either a single bond or O. R 13 , R 14 , R16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; or R 3 and R 5 These are combined into the formula -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (May be substituted with alkyl substituents) to form; p is an integer selected from 1 or 2; or R 5 and R 6 Together, =[CR 14 ]-[CR 17 R 18 ] m -Forms OH; or R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); or R 5 and R 8 These, along with the carbon atoms to which they are bonded, form saturated or unsaturated C5 or C6 membered rings (the aforementioned rings are oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 17 R 18 ]m -COH or -[CR 17 R 18 ] m -OH may be substituted with one or more substituents independently selected from each; or the two substituents on the ring may, together with the carbon atom to which they are bonded, form a 3- to 6-membered heterocyclyl moiety (the heterocyclyl moiety is C 1-6 The heterocycline may be substituted with one or more substituents independently selected from alkyl or oxo, or the two substituents on the heterocycline may, together with the atom to which they are bonded, form a 3- to 6-membered heterocycline moiety; or R 6 and R 9 They form a C3-membered ring together with the carbon atoms to which they are bonded; R 6 If present, hydrogen or C 1-6 It is alkyl; R 7 If present, hydrogen or C 1-6 It is alkyl; R 8 is hydrogen or C 1-6 It is alkyl; or R 8 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 Forms (which may be substituted with alkyl substituents); R 9 , R 10 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 9 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 Forms (which may be substituted with alkyl substituents); or R 9 Together with R 3 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6Forms (which may be substituted with alkyl substituents); R 11 , R 12 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 9 and R 11 These, along with the carbon atoms to which they are bonded, form saturated or unsaturated C5 or C6 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 20 is hydrogen or C 1-6 It is alkyl; R 21 is hydrogen or C 1-6 It is alkyl; R 22 is hydrogen, C 1-6 Alkyl and -CO-R 19 Selected from the group including; R 23 is hydrogen or C 1-6 It is alkyl; R 24 is hydrogen or C 1-6 It is alkyl; or R 23 and R 24 These, along with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline portion (the heterocycline is C 1-6 (May be substituted with one or more substituents independently selected from each alkyl group) to form; R 25 is hydrogen or C 1-6 It is alkyl; or R 24 and R 25 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is C 1-6 It may be substituted with one or more substituents independently selected from alkyl or oxo, or one of the substituents and R 23 They form a 3- to 6-membered heterocycline moiety together with the atoms to which they are bonded; R 26 is hydrogen or C 1-6 It is alkyl; R 27 If present, hydrogen or C 1-6 It is alkyl; or R 20 and R 27 They form a C3-membered ring together with the carbon atoms to which they are bonded; R 28 is hydrogen, oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -OC 1-6 Alkyl, -[CR 17 R 18 ] m -COH and -[CR 17 R 18 ] m Selected from the group containing -OH; R 29 is hydrogen or C 1-6 It is alkyl; R 30 If present, hydrogen or C 1-6 It is alkyl; or R 23 Together with R 30 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); or R 29 and R 28 Together, they form the equation -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 Forms (which may be substituted with alkyl substituents); q is an integer selected from 0, 1, 2, or 3, preferably q is 1; R 40 is, -[CR 17 R 18 ] m -OH, -CO-C 1-6 Alkyl, -O-([CR 17 R 18 ] m -O-) t -C 1-6 Selected from the group including alkyl groups, where t is an integer selected from 0, 1, 2, or 3; R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 40 and R 42 These, together with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline moiety; R 50 is selected from OH or oxo; and R 51 is hydrogen or C 1-10 (It is alkyl.)
[0153] 33. Compounds of formula (IIb), (IIa), (IIIa), (IV), (Ie), (If), (Ig), (Ic), or (Id), or their racemates, stereoisomers, tautomers, salts and / or solvates (including mixtures thereof), or compounds of formula (Ih) as described in any one of descriptions 25, 26, for use in increasing the amount of melanin in melanocytes, increasing melanin synthesis, improving melanin transport, and / or improving the melanin distribution in the upper basal layer.
[0154] [ka]
[0155] (In the formula, dashes signify conjugation)
[0156] [ka]
[0157] represents any double bond; and
[0158] [ka]
[0159] represents any single bond; R 28 is hydrogen, oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -OC 1-6 Alkyl, -[CR 17 R 18 ] m -COH and -[CR 17 R 18 ] m - Selected from the group containing OH; m is an integer selected from 1, 2, 3, 4, or 5. R 17 , R 18 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 29 is hydrogen or C 1-6 It is alkyl; or R 29 and R 28 Together, they form the equation -O-[CR 17 R 18 ]p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (May be substituted with alkyl substituents) and p is an integer selected from 1 or 2; R 20 is hydrogen or C 1-6 It is alkyl; R 21 is hydrogen or C 1-6 It is alkyl; R 22 is hydrogen, C 1-6 Alkyl and -CO-R 19 Selected from the group including; R 23 is hydrogen or C 1-6 It is alkyl; R 24 is hydrogen or C 1-6 It is alkyl; or R 23 and R 24 These, along with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline portion (the heterocycline is C 1-6 (May be substituted with one or more substituents independently selected from each alkyl group) to form; R 25 is hydrogen or C 1-6 It is alkyl; or R 24 and R 25 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is C 1-6 It may be substituted with one or more substituents independently selected from the alkyl group, or one of the substituents and R 23 They form a 3- to 6-membered heterocycline moiety together with the atoms to which they are bonded; R 27 If present, hydrogen or C 1-6 It is alkyl; or R 20 and R 27They form a C3-membered ring together with the carbon atoms to which they are bonded; R 40 is, -[CR 17 R 18 ] m -OH, -CO-C 1-6 Alkyl, -O-([CR 17 R 18 ] m -O-) t -C 1-6 Selected from the group including alkyl groups, where t is an integer selected from 0, 1, 2, or 3; R 42 , R 43 , R 44 , R 45 , R 46 , R 47 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 40 and R 42 These, together with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline moiety; R 50 It is selected from OH or oxo; R 51 is hydrogen or C 1-4 It is alkyl; R 1 , R 2 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 3 , R 4 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -X-[CR 13 R 14 ] n -O-[CR 17 R 18 ] m -OH,-([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 13 R 14 ] n -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5; n is an integer selected from 0, 1, 2, 3, or 4; y is an integer selected from 1, 2, or 3; X is either a single bond or O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; or R 3 and R 5 These are combined into the formula -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (May be substituted with alkyl substituents) and p is an integer selected from 1 or 2; R 6 is hydrogen or C1-6 It is alkyl; R 7 is hydrogen or C 1-6 It is alkyl; R 8 is hydrogen or C 1-6 It is alkyl; or R 5 and R 6 Together, =[CR 14 ]-[CR 17 R 18 ] m -Forms OH; or R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); or R 5 and R 8 These, along with the carbon atoms to which they are bonded, form saturated or unsaturated C5 or C6 membered rings (the aforementioned rings are oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 17 R 18 ] m -COH or -[CR 17 R 18 ] m -OH may be substituted with one or more substituents independently selected from each; or the two substituents on the ring may, together with the carbon atom to which they are bonded, form a 3- to 6-membered heterocyclyl moiety (the heterocyclyl moiety is C 1-6The alkyl group may be substituted with one or more substituents independently selected from each alkyl group, or the two substituents on the heterocycline may, together with the atom to which they are bonded, form a 3- to 6-membered heterocycline moiety; R 9 , R 10 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 6 and R 9 They form a C3-membered ring together with the carbon atoms to which they are bonded; or R 9 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 Forms (which may be substituted with alkyl substituents); or R 9 Together with R 3 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 (May be substituted with alkyl substituents) to form.
[0160] 34. The compound for use according to any one of descriptions 30-32, or for use according to description 33, wherein the melanocytes are present in human skin or hair.
[0161] 35. A compound for use as described in any one of descriptions 30-32 or as described in description 33, wherein the melanin is pheomelanin, eumelanin, or any combination thereof.
[0162] 36. Use of compounds of formula (I), (II), (III), or (IV) as self-tanning substances, or their racemic mixtures, stereoisomers, tautomers, salts, and / or solvates (including mixtures thereof), or use of any one of the compounds described in Descriptions 1 to 26;
[0163] [ka]
[0164] (In the formula, dashes signify conjugation)
[0165] [ka]
[0166] represents any double bond; and R 1 , R 2 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 3 , R 4 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -X-[CR 13 R 14 ] n -O-[CR 17 R 18 ] m -OH,-([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 13 R 14 ] n -CO-R19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5; n is an integer selected from 0, 1, 2, 3, or 4; y is an integer selected from 1, 2, or 3; X is either a single bond or O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; or R 3 and R 5 These are combined into the formula -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (May be substituted with alkyl substituents) and p is an integer selected from 1 or 2; or R 5 and R 6 Together, =[CR 14 ]-[CR 17 R 18 ] m -Forms OH; or R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); or R 5 and R 8 These, along with the carbon atoms to which they are bonded, form saturated or unsaturated C5 or C6 membered rings (the aforementioned rings are oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -CO-C 1-6Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 17 R 18 ] m -COH or -[CR 17 R 18 ] m -OH may be substituted with one or more substituents independently selected from each; or the two substituents on the ring may, together with the carbon atom to which they are bonded, form a 3- to 6-membered heterocyclyl moiety (the heterocyclyl moiety is C 1-6 The heterocycline may be substituted with one or more substituents independently selected from alkyl or oxo, or the two substituents on the heterocycline may, together with the atom to which they are bonded, form a 3- to 6-membered heterocycline moiety; or R 6 and R 9 They form a C3-membered ring together with the carbon atoms to which they are bonded; R 6 If present, hydrogen or C 1-6 It is alkyl; R 7 If present, hydrogen or C 1-6 It is alkyl; R 8 is hydrogen or C 1-6 It is alkyl; or R 8 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 Forms (which may be substituted with alkyl substituents); R 9 , R 10 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 9 Together with R 1These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 Forms (which may be substituted with alkyl substituents); or R 9 Together with R 3 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 Forms (which may be substituted with alkyl substituents); R 11 , R 12 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 9 and R 11 These, along with the carbon atoms to which they are bonded, form saturated or unsaturated C5 or C6 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 20 is hydrogen or C 1-6 It is alkyl; R 21 is hydrogen or C 1-6 It is alkyl; R 22 is hydrogen, C 1-6 Alkyl and -CO-R 19 Selected from the group including; R 23 is hydrogen or C 1-6 It is alkyl; R 24 is hydrogen or C 1-6 It is alkyl; or R 23 and R 24 These, along with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline portion (the heterocycline is C 1-6 (May be substituted with one or more substituents independently selected from each alkyl group) to form; R 25 is hydrogen or C 1-6 It is alkyl; or R 24 and R 25These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is C 1-6 It may be substituted with one or more substituents independently selected from alkyl or oxo, or one of the substituents and R 23 They form a 3- to 6-membered heterocycline moiety together with the atoms to which they are bonded; R 26 is hydrogen or C 1-6 It is alkyl; R 27 If present, hydrogen or C 1-6 It is alkyl; or R 20 and R 27 They form a C3-membered ring together with the carbon atoms to which they are bonded; R 28 is hydrogen, oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -OC 1-6 Alkyl, -[CR 17 R 18 ] m -COH and -[CR 17 R 18 ] m Selected from the group containing -OH; R 29 is hydrogen or C 1-6 It is alkyl; R 30 If present, hydrogen or C 1-6 It is alkyl; or R 23 Together with R 30 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); or R 29 and R 28Together, they form the equation -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 Forms (which may be substituted with alkyl substituents); q is an integer selected from 0, 1, 2, or 3, preferably q is 1; R 40 is, -[CR 17 R 18 ] m -OH, -CO-C 1-6 Alkyl, -O-([CR 17 R 18 ] m -O-) t -C 1-6 Selected from the group including alkyl groups, where t is an integer selected from 0, 1, 2, or 3; R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 40 and R 42 These, together with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline moiety; R 50 is selected from OH or oxo; and R 51 is hydrogen or C 1-10 (It is alkyl.)
[0167] 37. The compound is of formula (Ia), (Ib), (Ic), (Id), (IIa), (IIIa), or (IVa), and is used as described in any one of the descriptions 27-29.
[0168] [ka]
[0169] (In the formula, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 20 , R 21 , R 22 , R 23 , R 24 , R 25 , R 27 , R 40 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 , R 50 This is defined in any one of the following descriptions: 1, 22, 23, or 26, as well as R t and R s Each of them is independently of hydrogen or C 1-6 (Selected from alkyl groups).
[0170] 38. Non-therapeutic use of compounds of formula (IIb), (IIa), (IIIa), (IV), (Ie), (If), (Ig), (Ic), or (Id), or their racemates, stereoisomers, tautomers, salts, and / or solvates (including mixtures thereof) as substances for self-tanning.
[0171] [ka]
[0172] (In the formula, dashes signify conjugation)
[0173] [ka]
[0174] represents any double bond; and
[0175] [ka]
[0176] represents any single bond; R 28 is hydrogen, oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -OC 1-6 Alkyl, -[CR 17 R 18 ] m -COH and -[CR 17 R 18 ] m - Selected from the group containing OH; m is an integer selected from 1, 2, 3, 4, or 5. R 17 , R 18 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 29 is hydrogen or C 1-6 It is alkyl; or R 29 and R 28 Together, they form the equation -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (May be substituted with alkyl substituents) and p is an integer selected from 1 or 2; R 20 is hydrogen or C 1-6 It is alkyl; R 21 is hydrogen or C 1-6 It is alkyl; R 22 is hydrogen, C1-6 Alkyl and -CO-R 19 Selected from the group including; R 23 is hydrogen or C 1-6 It is alkyl; R 24 is hydrogen or C 1-6 It is alkyl; or R 23 and R 24 These, along with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline portion (the heterocycline is C 1-6 (May be substituted with one or more substituents independently selected from each alkyl group) to form; R 25 is hydrogen or C 1-6 It is alkyl; or R 24 and R 25 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is C 1-6 It may be substituted with one or more substituents independently selected from the alkyl group, or one of the substituents and R 23 They form a 3- to 6-membered heterocycline moiety together with the atoms to which they are bonded; R 27 If present, hydrogen or C 1-6 It is alkyl; or R 20 and R 27 They form a C3-membered ring together with the carbon atoms to which they are bonded; R 40 is, -[CR 17 R 18 ] m -OH, -CO-C 1-6 Alkyl, -O-([CR 17 R 18 ] m -O-) t -C 1-6 Selected from the group including alkyl groups, where t is an integer selected from 0, 1, 2, or 3; R 42 , R 43 , R44 , R 45 , R 46 , R 47 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 40 and R 42 These, together with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline moiety; R 50 It is selected from OH or oxo; R 51 is hydrogen or C 1-4 It is alkyl; R 1 , R 2 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 3 , R 4 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -X-[CR 13 R 14 ] n -O-[CR 17 R 18 ] m -OH,-([CR 17 R 18 ] m -O) y-C 1-6 Alkyl, -[CR 13 R 14 ] n -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5; n is an integer selected from 0, 1, 2, 3, or 4; y is an integer selected from 1, 2, or 3; X is either a single bond or O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; or R 3 and R 5 These are combined into the formula -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (May be substituted with alkyl substituents) and p is an integer selected from 1 or 2; R 6 is hydrogen or C 1-6 It is alkyl; or R 5 and R 6 Together, =[CR 14 ]-[CR 17 R 18 ] m -Forms OH; or R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 7is hydrogen or C 1-6 It is alkyl; R 8 is hydrogen or C 1-6 It is alkyl; or R 5 and R 8 These, along with the carbon atoms to which they are bonded, form saturated or unsaturated C5 or C6 membered rings (the aforementioned rings are oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 17 R 18 ] m -COH or -[CR 17 R 18 ] m -OH may be substituted with one or more substituents independently selected from each; or the two substituents on the ring may, together with the carbon atom to which they are bonded, form a 3- to 6-membered heterocyclyl moiety (the heterocyclyl moiety is C 1-6 The alkyl group may be substituted with one or more substituents independently selected from each alkyl group, or the two substituents on the heterocycline may, together with the atom to which they are bonded, form a 3- to 6-membered heterocycline moiety; R 9 , R 10 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 6 and R 9 They form a C3-membered ring together with the carbon atoms to which they are bonded; or R 9 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 Forms (which may be substituted with alkyl substituents); or R 9 Together with R 3 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 (May be substituted with alkyl substituents) to form.
[0177] 39. Compounds of formula (Ie) for use as described in any one of descriptions 27-32, 34-38, or for use as described in description 33.
[0178] [ka]
[0179] (In the formula, R 3 , R 4 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5, and n is an integer selected from 0, 1, 2, 3, or 4; X is either a single bond or O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R15 is OH, or R 16 Together with R 15 It forms an oxo group; and R 8 is hydrogen or C 1-6 (It is alkyl.)
[0180] 40. Compounds for use in any one of the uses described in Descriptions 27-32, 34-38, or the use described in Description 33, where the compound is of formula (If)
[0181] [ka]
[0182] (In the formula, R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5, and n is an integer selected from 0, 1, 2, 3, or 4; X is either a single bond or O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; and R6 is hydrogen or C 1-6 It is alkyl; or R 5 and R 6 Together, =[CR 14 ]-[CR 17 R 18 ] m (Forms -OH)
[0183] 41. Compounds of formula (Ig), for use as described in any one of descriptions 27-32, 34-38, or for use as described in description 33.
[0184] [ka]
[0185] (In the formula, R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5, and n is an integer selected from 0, 1, 2, 3, or 4; X is either a single bond or O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R15 It forms an oxo group; R 6 is hydrogen or C 1-6 It is alkyl; or R 5 and R 6 Together, =[CR 14 ]-[CR 17 R 18 ] m -Forms OH; or R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is composed of one or more C 1-6 (May be substituted with alkyl substituents) to form.
[0186] 42. Compounds of formula (IIb) for use as described in any one of descriptions 27-32, 34-38, or for use as described in description 33.
[0187] [ka]
[0188] (In the formula, dashes signify conjugation)
[0189] [ka]
[0190] represents any double bond; and
[0191] [ka]
[0192] represents any single bond; R 28 is hydrogen, oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C1-6 Alkyl, -[CR 17 R 18 ] m -OC 1-6 Alkyl, -[CR 17 R 18 ] m -COH and -[CR 17 R 18 ] m Selected from the group containing -OH; R 29 is hydrogen or C 1-6 It is alkyl; or R 29 and R 28 Together, they form the equation -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 17 , R 18 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; m is an integer selected from 1, 2, 3, 4, or 5; and p is an integer selected from 1 or 2.
[0193] 43. Compounds of formula (IIa), for use as described in any one of descriptions 27-32, 34-38, or for use as described in description 33.
[0194] [ka]
[0195] (In the formula, dashes signify conjugation)
[0196] [ka]
[0197] represents any double bond; and R 20 is hydrogen or C 1-6 It is alkyl; R 21 is hydrogen or C 1-6 It is alkyl; R 22 is hydrogen, C 1-6 Alkyl and -CO-R 19 Selected from the group including; R 23 is hydrogen or C 1-6 It is alkyl; R 24 is hydrogen or C 1-6 It is alkyl; or R 23 and R 24 These, along with the carbon atoms to which they are bonded, form a three-membered heterocycline moiety (the heterocycline is C 1-6 They form (which may be substituted with one or two substituents independently selected from each alkyl group); R 25 is hydrogen or C 1-6 It is alkyl; or R 24 and R 25 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is C 1-6 It may be substituted with one or more substituents independently selected from the alkyl group, or one of the substituents and R 23 They form a 5- to 6-membered heterocycline moiety together with the atoms to which they are bonded; R 27 If present, hydrogen or C 1-6 (It is alkyl.)
[0198] 44. Compounds of formula (IIa), used in any one of the uses described in Descriptions 27-32, 34-38, or 43, or for the use described in Description 33. (In the formula, dashes signify conjugation)
[0199] [ka]
[0200] represents any double bond; and R 20 is hydrogen or C 1-6 It is alkyl; preferably R 20 is hydrogen or C 1-4 It is alkyl; preferably R 20 is hydrogen or C 1-2 It is alkyl; preferably R 20 is either hydrogen or methyl; R 21 is hydrogen or C 1-6 It is alkyl; preferably R 21 is hydrogen or C 1-4 It is alkyl; preferably R 21 is hydrogen or C 1-2 It is alkyl; preferably R 21 is either hydrogen or methyl; R 22 is hydrogen, C 1-6 Alkyl and -CO-R 19 Selected from the group including; R 19 is hydrogen or C 1-6 It is alkyl; preferably R 22 is hydrogen, C 1-4 Alkyl and -CO-R 19 Selected from the group including; R 19 is hydrogen or C 1-4 It is alkyl; preferably R 22 is hydrogen, C 1-2 Alkyl and -CO-R 19 Selected from the group including; R 19 is hydrogen or C 1-2 It is alkyl; preferably R 22 This is selected from the group including hydrogen, methyl, and -CO-methyl; R 23 is hydrogen or C 1-6 It is alkyl; preferably R 23 is hydrogen or C 1-4 It is alkyl; preferably R23 is hydrogen, methyl, or ethyl; R 24 is hydrogen or C 1-6 It is alkyl; preferably R 24 is hydrogen or C 1-4 It is alkyl; preferably R 24 is hydrogen or C 1-2 It is alkyl; preferably R 24 is either hydrogen or methyl; or R 23 and R 24 These are 3- to 6-membered heterocyclyl moieties containing one or two oxygen atoms along with the carbon atoms to which they are bonded, with the remainder being carbon atoms (the heterocyclyl is C 1-6 Forms (which may be substituted with one or more substituents independently selected from each alkyl group); preferably R 23 and R 24 These are 3 to 5-membered heterocyclyl moieties containing one or two oxygen atoms along with the carbon atoms to which they are bonded, with the remainder being carbon atoms (the heterocyclyl is C 1-4 Forms (which may be substituted with one or more substituents independently selected from each alkyl group); preferably R 23 and R 24 These consist of a 3- to 4-membered heterocycline moiety containing one oxygen atom and the rest being carbon atoms, along with the carbon atoms to which they are bonded (the heterocycline contains one or more carbon atoms). 1-2 Forms (which may be substituted with alkyl substituents); preferably R 23 and R 24 These, along with the carbon atoms to which they are bonded, are oxyranyl (the oxyranyl is one or more C 1-2 Forms an alkyl substituent, preferably substituted with methyl; R 25 is hydrogen or C 1-6 It is alkyl; preferably R 25 is hydrogen or C 1-4 It is alkyl; preferably R 25 is hydrogen or C 1-2 It is alkyl; preferably R25 is either hydrogen or methyl; or R 24 and R 25 These include a 5 or 6-membered heterocyclyl portion containing one or two oxygen atoms along with the carbon atoms to which they are bonded, with the remainder being carbon atoms (the heterocyclyl is C 1-6 It may be substituted with one or more substituents independently selected from alkyl or oxo; or one of the substituents and R 23 They form a 3- to 6-membered heterocycline moiety (containing one or two oxygen atoms and the rest being carbon atoms) together with the atoms to which they are bonded; preferably R 24 and R 25 These include a 5 or 6-membered heterocyclyl portion containing one or two oxygen atoms along with the carbon atoms to which they are bonded, with the remainder being carbon atoms (the heterocyclyl is C 1-4 It may be substituted with one or more substituents independently selected from alkyl or oxo, or one of the substituents and R 23 They form a 4- to 6-membered heterocycline moiety (containing one or two oxygen atoms and the rest being carbon atoms) together with the atoms to which they are bonded; preferably R 24 and R 25 These, along with the carbon atoms to which they are bonded, are tetrahydropyranyl or tetrahydrofuranyl (the tetrahydropyranyl or tetrahydrofuranyl is C 1-2 It may be substituted with one or more substituents independently selected from alkyl or oxo, or one of the substituents and R 23 They form a 5- to 6-membered heterocycline moiety (such as dioxolanyl) containing one or two oxygen atoms and the rest being carbon atoms, together with the atoms to which they are bonded; R 27 If present, hydrogen or C 1-6 It is alkyl; preferably R 27 is hydrogen or C 1-4 It is alkyl; preferably R 27 is hydrogen or C 1-2It is alkyl; preferably R 27 (It is either hydrogen or methyl).
[0201] 45. Compounds of formula (IIa) for use as described in any one of descriptions 27-32, 34-38, 43-44, or for use as described in description 33. (In the formula, dashes signify conjugation)
[0202] [ka]
[0203] represents any double bond; and R 20 is hydrogen or C 1-4 It is alkyl; preferably R 20 is hydrogen or C 1-2 It is alkyl; preferably R 20 is either hydrogen or methyl; R 21 is hydrogen or C 1-4 It is alkyl; preferably R 21 is hydrogen or C 1-2 It is alkyl; preferably R 21 is either hydrogen or methyl; R 22 is hydrogen, C 1-4 Alkyl and -CO-R 19 Selected from the group including; R 19 is hydrogen or C 1-4 It is alkyl; preferably R 22 is hydrogen, C 1-2 Alkyl and -CO-R 19 Selected from the group including; R 19 is hydrogen or C 1-2 It is alkyl; preferably R 22 This is selected from the group including hydrogen, methyl, and -CO-methyl; R 23 is hydrogen or C 1-4 It is alkyl; preferably R 23 is hydrogen, methyl, or ethyl; R 24 is hydrogen or C 1-4 It is alkyl; preferably R 24 is hydrogen or C 1-2 It is alkyl; preferably R 24 is either hydrogen or methyl; or R 23 and R 24 These are 3 to 5-membered heterocyclyl moieties that contain one or two oxygen atoms along with the carbon atoms to which they are bonded, with the remainder being carbon atoms (the heterocyclyl is one or more C 1-4 Forms (which may be substituted with alkyl substituents); preferably R 23 and R 24 These consist of a 3- to 4-membered heterocycline moiety containing one oxygen atom and the rest being carbon atoms, along with the carbon atoms to which they are bonded (the heterocycline contains one or more carbon atoms). 1-2 Forms (which may be substituted with alkyl substituents); preferably R 23 and R 24 These, along with the carbon atoms to which they are bonded, are oxyranyl (the oxyranyl is one or more C 1-2 Forms an alkyl substituent, preferably substituted with methyl; R 25 is hydrogen or C 1-4 It is alkyl; preferably R 25 is hydrogen or C 1-2 It is alkyl; preferably R 25 is either hydrogen or methyl; or R 24 and R 25 These include a 5 or 6-membered heterocyclyl portion containing one or two oxygen atoms along with the carbon atoms to which they are bonded, with the remainder being carbon atoms (the heterocyclyl is C 1-4 It may be substituted with one or more substituents independently selected from alkyl or oxo, or one of the substituents and R 23 They form a 4- to 6-membered heterocycline moiety (containing one or two oxygen atoms and the rest being carbon atoms) together with the atoms to which they are bonded; preferably R 24and R 25 These, along with the carbon atoms to which they are bonded, are tetrahydropyranyl or tetrahydrofuranyl (the tetrahydropyranyl or tetrahydrofuranyl is C 1-2 It may be substituted with one or more substituents independently selected from alkyl or oxo, or one of the substituents and R 23 They form a 5- to 6-membered heterocycline moiety (such as dioxolanyl) containing one or two oxygen atoms and the rest being carbon atoms, together with the atoms to which they are bonded; R 27 is hydrogen or C 1-4 It is alkyl; preferably R 27 is hydrogen or C 1-2 It is alkyl; preferably R 27 (It is either hydrogen or methyl).
[0204] 46. Compounds of formula (Ic) for use as described in any one of descriptions 27-32, 34-38, or for use as described in description 33.
[0205] [ka]
[0206] (In the formula, R 1 , R 2 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 3 , R 4 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ]n -[CR 17 R 18 ] m -OH, -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5, and n is an integer selected from 0, 1, 2, 3, or 4; X is either a single bond or O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; or R 3 and R 5 These are combined into the formula -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (May be substituted with alkyl substituents) and p is an integer selected from 1 or 2; R 6 is hydrogen or C 1-6 It is alkyl; R 9 , R 10 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 9 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 (May be substituted with alkyl substituents) to form.
[0207] 47. Compounds for use in any one of the uses described in Descriptions 27-32, 34-38, or 46, or for use in Description 33, (in the formula) R 2 is hydrogen or C 1-6 It is alkyl; preferably R 2 is hydrogen or C 1-4 It is alkyl; preferably R 2 is hydrogen or C 1-2 It is alkyl; preferably R 2 is hydrogen or methyl, preferably hydrogen; R 4 is hydrogen or C 1-6 It is alkyl; preferably R 4 is hydrogen or C 1-4 It is alkyl; preferably R 4 is hydrogen or C 1-2 It is alkyl; preferably R 4 is either hydrogen or methyl; R 3 and R 5 Together, they form the equation -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (may be substituted with alkyl substituents) form; p is an integer selected from 1 or 2, R 17 , R 18 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 3 and R 5 Together, they form the equation -O-[CR 17 R 18 ]-O- and together with the carbon atoms to which they are bonded, a 5-membered heterocycline moiety (the heterocycline is one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 3 and R 5 Together, they form the equation -O-[CR 17 R18 ]-O- and together with the carbon atoms to which they are bonded, they form a dioxolanyl moiety, R 17 , R 18 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups, the dioxolanyl moiety consists of one or two C atoms. 1-4 Alkyl substituents, preferably one or two C 1-2 The alkyl substituent may be substituted, preferably with one or two methyl groups; R 6 is hydrogen or C 1-6 It is alkyl; preferably R 6 is hydrogen or C 1-4 It is alkyl; preferably R 6 is hydrogen or C 1-2 It is alkyl; preferably R 6 is either hydrogen or methyl; R 10 is hydrogen or C 1-6 It is alkyl; preferably R 10 is hydrogen or C 1-4 It is alkyl; R 10 is hydrogen or C 1-3 Alkyl, preferably hydrogen, methyl, ethyl, n-propyl, or isopropyl; Furthermore, R 9 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 The ring may be substituted with alkyl substituents; preferably, the ring has one or more C 1-4 The ring may be substituted with alkyl substituents; preferably, the ring has one or more C 1-2 The ring may be substituted with alkyl substituents, and preferably, the ring may be substituted with one or more methyl substituents to form a ring.
[0208] 48. Compounds for use in any one of the uses described in Descriptions 27-32, 34-38, 46-47, or the use described in Description 33, (wherein the formula, R2 is hydrogen or C 1-4 It is alkyl; preferably R 2 is hydrogen or C 1-2 It is alkyl; preferably R 2 is hydrogen or methyl, preferably hydrogen; R 4 is hydrogen or C 1-4 It is alkyl; preferably R 4 is hydrogen or C 1-2 It is alkyl; preferably R 4 is either hydrogen or methyl; R 3 and R 5 Together, they form the equation -O-[CR 17 R 18 ]-O- and together with the carbon atoms to which they are bonded, a 5-membered heterocycline moiety (the heterocycline is one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 3 and R 5 Together, they form the equation -O-[CR 17 R 18 ]-O- and together with the carbon atoms to which they are bonded, they form a dioxolanyl moiety, R 17 , R 18 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups, the dioxolanyl moiety consists of one or two C atoms. 1-4 Alkyl substituents, preferably one or two C 1-2 The alkyl substituent may be substituted, preferably with one or two methyl groups; R 6 is hydrogen or C 1-4 It is alkyl; preferably R 6 is hydrogen or C 1-2 It is alkyl; preferably R 6 is either hydrogen or methyl; R 10 is hydrogen or C 1-4 It is alkyl; R 10 is hydrogen or C 1-3Alkyl, preferably hydrogen, methyl, ethyl, n-propyl, or isopropyl; Furthermore, R 9 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 The ring may be substituted with alkyl substituents; preferably, the ring has one or more C 1-4 The ring may be substituted with alkyl substituents; preferably, the ring has one or more C 1-2 The ring may be substituted with alkyl substituents, and preferably, the ring may be substituted with one or more methyl substituents to form a ring.
[0209] 49. Compounds of formula (Id) for use as described in any one of descriptions 27-32, 34-38, or for use as described in description 33.
[0210] [ka]
[0211] (In the formula, R 1 , R 2 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 3 , R 4 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR13 R 14 ] n -[CR 17 R 18 ] m -OH, -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5, and n is an integer selected from 0, 1, 2, 3, or 4; X is either a single bond or O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; R 6 is hydrogen or C 1-6 It is alkyl; or R 5 and R 6 Together, =[CR 14 ]-[CR 17 R 18 ] m -Forms OH; or R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 7 is hydrogen or C 1-6 (It is alkyl.)
[0212] 50. Compounds of formula (Id) for use as described in any one of descriptions 27-32, 34-38, or 49, or for use as described in description 33, (wherein the formula, R 2 is hydrogen or C 1-6 It is alkyl; preferably R 2is hydrogen or C 1-4 It is alkyl; preferably R 2 is hydrogen or C 1-2 It is alkyl; preferably R 2 is hydrogen or methyl, preferably hydrogen; R 4 is hydrogen or C 1-6 It is alkyl; preferably R 4 is hydrogen or C 1-4 It is alkyl; preferably R 4 is hydrogen or C 1-2 It is alkyl; preferably R 4 is hydrogen or methyl, preferably hydrogen; R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form a C3 to C4 membered ring (the ring is composed of one or more C 1-4 Forms (which may be substituted with alkyl substituents); preferably R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form a C3-membered ring, namely cyclopropyl (the cyclopropyl is one or more C 1-2 The cyclopropyl may be substituted with alkyl substituents, and preferably, the cyclopropyl may be substituted with one or more methyl substituents) to form a structure; R 6 is hydrogen or C 1-6 It is alkyl; preferably R 6 is hydrogen or C 1-4 It is alkyl; preferably R 6 is hydrogen or C 1-2 It is alkyl; preferably R 6 is either hydrogen or methyl; R 5 and R 6These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a six-membered heterocycline moiety (the heterocycline consists of one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 6-membered dioxany moiety, for example, 1,3-dioxany (the dioxany is composed of one or more C 1-6 Alkyl substituents, for example, one or more C 1-4 Alkyl substituents, for example, one or more C 1-3 Alkyl substituents, for example, one or more C 1-2 Forms alkyl substituents, which may be substituted with one or more methyl substituents; and R 7 is hydrogen or C 1-6 It is alkyl, preferably R 7 is hydrogen or C 1-4 It is alkyl; preferably R 7 is hydrogen or C 1-2 It is alkyl; preferably R 7 (This is hydrogen or methyl, preferably methyl).
[0213] 51. Compounds for use in any one of the uses described in Descriptions 27-32, 34-38, 49-50, or the use described in Description 33, (wherein the formula, R 2 is hydrogen or C 1-4 It is alkyl; preferably R 2 is hydrogen or C 1-2 It is alkyl; preferably R 2 is hydrogen or methyl, preferably hydrogen; R 4 is hydrogen or C 1-4 It is alkyl; preferably R 4is hydrogen or C 1-2 It is alkyl; preferably R 4 is hydrogen or methyl, preferably hydrogen; R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form a C3 to C4 membered ring (the ring is composed of one or more C 1-4 Forms (which may be substituted with alkyl substituents); preferably R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form a C3-membered ring, namely cyclopropyl (the cyclopropyl is one or more C 1-2 The cyclopropyl may be substituted with alkyl substituents, and preferably, the cyclopropyl may be substituted with one or more methyl substituents) to form a structure; R 6 is hydrogen or C 1-4 It is alkyl; preferably R 6 is hydrogen or C 1-2 It is alkyl; preferably R 6 is either hydrogen or methyl; R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a six-membered heterocycline moiety (the heterocycline consists of one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 6-membered dioxany moiety, for example, 1,3-dioxany (the dioxany is composed of one or more C 1-6 Alkyl substituents, for example, one or more C 1-4 Alkyl substituents, for example, one or more C 1-3 Alkyl substituents, for example, one or more C 1-2 Forming alkyl substituents (which may be substituted with one or more methyl substituents); and R 7 is hydrogen or C 1-4 It is alkyl; preferably R 7 is hydrogen or C 1-2 It is alkyl; preferably R 7(This is hydrogen or methyl, preferably methyl).
[0214] 52. Compounds of formula (IIIa) for use as described in any one of descriptions 27-32, 34-38, or for use as described in description 33.
[0215] [ka]
[0216] (In the formula, dashes signify conjugation)
[0217] [ka]
[0218] represents any double bond; and R 40 is, -[CR 17 R 18 ] m -OH, -CO-C 1-6 Alkyl, -O-([CR 17 R 18 ] m -O-) t -C 1-6 Selected from the group including alkyl, m is an integer selected from 1, 2, 3, 4, or 5, and t is an integer selected from 0 or 1; R 17 , R 18 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 42 , R 43 , R 44 , R 45 , R 46 , R 47 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 40 and R 42 (These atoms, along with the carbon atoms to which they are bonded, form a three-membered heterocycline moiety.)
[0219] 53. Compounds of formula (IVa) for use as described in any one of descriptions 27-32, 34-38, or for use as described in description 33.
[0220] [ka]
[0221] (In the formula, R 50 (This is selected from either OH or oxo).
[0222] 54. Compounds selected from the group including the following for use as described in any one of descriptions 27-32, 34-38, or for use as described in description 33:
[0223] [ka]
[0224] [ka]
[0225] 55. A compound for use as described in any one of descriptions 27-32, 34-38, or for use as described in description 33, wherein the compound is an amberketal or ambermax.
[0226] 56. The use described in any one of descriptions 27-32 or 34-55, wherein the use is in a cosmetic composition.
[0227] 57. A compound for use as described in any one of Descriptions 27-32, 34-56, or for use as described in Description 33, comprising adjusting hair color by bringing a hair follicle into contact with the compound or composition, thereby increasing the concentration of pigment in the growth of new hair produced by the hair follicle, preferably the hair follicle being part of the scalp, eyebrow, or eyelash area.
[0228] 58. Uses described in any one of Descriptions 27-32 or 34-57, where the use is for non-therapeutic purposes.
[0229] 59. The use described in any one of descriptions 27-32, 34-58, wherein the composition is a sunless tanning composition, a moisturizing composition, or a hair care composition.
[0230] 60. Uses as described in any one of descriptions 27-32, 34-59, wherein the composition may be a gel, solution, aerosol, emulsion, lotion, mousse, spray, wipe, microcapsule encapsulation, serum, cream, ointment, powder, or foam.
[0231] 61. The use described in any one of descriptions 27-32, 34-60, wherein the composition is incorporated into a device suitable for application to skin tissue, mucous membrane tissue, skin surface, or scalp.
[0232] 62. For skin darkening, use as described in any one of the following descriptions 27-32 or 34-61.
[0233] 63. For sunless tanning, use as described in any one of the instructions 27-32 or 34-62.
[0234] 64. A tanning method comprising using, as a self-tanning substance, a composition described in any one of Descriptions 1 to 24 or a compound described in any one of Descriptions 25 to 26, or one of more compounds of formula (I), (II), (III), (IV), (IIb), (IIa), (IIIa), (Ie), (If), (Ig), (Ic), or (Id) described in any one of Descriptions 27 to 32 or 34 to 55, or a racemic mixture thereof, a stereoisomer thereof, a tautomer thereof, a salt thereof, and / or a solvate thereof (including mixtures thereof).
[0235] 65. A method for self-tanning, comprising the step of applying a self-tanning substance selected from the group comprising a compound defined in any one of Descriptions 1-32 or 34-55, or a racemate thereof, a stereoisomer thereof, a tautomer thereof, a salt thereof, and / or a solvate thereof (including mixtures thereof) to a desired skin surface.
[0236] 66. A method for increasing the amount of melanin in melanocytes, a method for increasing melanin synthesis, a method for improving melanin transport, and / or improving the melanin distribution in the upper basal layer, comprising applying locally any one of the compositions described in any one of Descriptions 1 to 24, or any one of the compounds described in any one of Descriptions 25 to 26, or any one of the compounds of formula (I), (II), (III), (IV), (IIb), (IIa), (IIIa), (Ie), (If), (Ig), (Ic), or (Id), or any racemic mixture thereof, stereoisomer thereof, tautomer thereof, salt thereof, and / or solvates thereof (including mixtures thereof).
[0237] 67. A method for blackening skin, preferably a method in which the method is non-therapeutic, comprising the steps of applying a composition described in any one of Descriptions 1 to 24 to a desired skin surface, or one of more compounds described in any one of Descriptions 25 to 26, or a compound of formula (I), (II), (III), (IV), (IIb), (IIa), (IIIa), (Ie), (If), (Ig), (Ic), or (Id) described in any one of Descriptions 27 to 32, 34 to 55, or a racemate thereof, a stereoisomer thereof, a tautomer thereof, a salt thereof, and / or a solvate thereof (including mixtures thereof), to a desired skin surface.
[0238] 68. Compounds of formula (I), (II), (III), or (IV) for use in increasing the amount of melanin in melanocytes, for increasing melanin synthesis, for improving melanin transport, and / or for improving the distribution of melanin in the upper basal layer, or racemates thereof, stereoisomers thereof, tautomers thereof, salts thereof and / or solvates thereof (including mixtures thereof), or compounds described in any one of descriptions 25-26.
[0239] [ka]
[0240] (In the formula, dashes signify conjugation)
[0241] [ka]
[0242] represents any double bond; and R 1 , R 2 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 3 , R 4 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR17 R 18 ] m -OH, -X-[CR 13 R 14 ] n -O-[CR 17 R 18 ] m -OH,-([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 13 R 14 ] n -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5; n is an integer selected from 0, 1, 2, 3, or 4; y is an integer selected from 1, 2, or 3; X is either a single bond or O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; or R 3 and R 5 These are combined into the formula -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (May be substituted with alkyl substituents) and p is an integer selected from 1 or 2; or R 5 and R 6 Together, =[CR 14 ]-[CR 17 R 18 ] m -Forms OH; or R5 and R 6 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); or R 5 and R 8 These, along with the carbon atoms to which they are bonded, form saturated or unsaturated C5 or C6 membered rings (the aforementioned rings are oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 17 R 18 ] m -COH or -[CR 17 R 18 ] m -OH may be substituted with one or more substituents independently selected from each; or the two substituents on the ring may, together with the carbon atom to which they are bonded, form a 3- to 6-membered heterocyclyl moiety (the heterocyclyl moiety is C 1-6 The heterocycline may be substituted with one or more substituents independently selected from alkyl or oxo, or the two substituents on the heterocycline may, together with the atom to which they are bonded, form a 3- to 6-membered heterocycline moiety; or R 6 and R 9 They form a C3-membered ring together with the carbon atoms to which they are bonded; R 6 If present, hydrogen or C 1-6 It is alkyl; R 7 If present, hydrogen or C 1-6 It is alkyl; R 8 is hydrogen or C1-6 It is alkyl; or R 8 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 Forms (which may be substituted with alkyl substituents); R 9 , R 10 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 9 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 Forms (which may be substituted with alkyl substituents); or R 9 Together with R 3 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 Forms (which may be substituted with alkyl substituents); R 11 , R 12 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 9 and R 11 These, along with the carbon atoms to which they are bonded, form saturated or unsaturated C5 or C6 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 20 is hydrogen or C 1-6 It is alkyl; R 21 is hydrogen or C 1-6 It is alkyl; R 22 is hydrogen, C 1-6 Alkyl and -CO-R 19 Selected from the group including; R 23 is hydrogen or C 1-6 It is alkyl; R 24 is hydrogen or C 1-6 It is alkyl; or R 23 and R 24 These, along with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline portion (the heterocycline is C 1-6 (May be substituted with one or more substituents independently selected from each alkyl group) to form; R 25 is hydrogen or C 1-6 It is alkyl; or R 24 and R 25 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is C 1-6 It may be substituted with one or more substituents independently selected from alkyl or oxo, or one of the substituents and R 23 They form a 3- to 6-membered heterocycline moiety together with the atoms to which they are bonded; R 26 is hydrogen or C 1-6 It is alkyl; R 27 If present, hydrogen or C 1-6 It is alkyl; or R 20 and R 27 They form a C3-membered ring together with the carbon atoms to which they are bonded; R 28 is hydrogen, oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -OC 1-6 Alkyl, -[CR 17 R 18 ] m -COH and -[CR 17 R 18 ] m Selected from the group containing -OH; R 29 is hydrogen or C1-6 It is alkyl; R 30 If present, hydrogen or C 1-6 It is alkyl; or R 23 Together with R 30 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); or R 29 and R 28 Together, they form the equation -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 Forms (which may be substituted with alkyl substituents); q is an integer selected from 0, 1, 2, or 3, preferably q is 1; R 40 is, -[CR 17 R 18 ] m -OH, -CO-C 1-6 Alkyl, -O-([CR 17 R 18 ] m -O-) t -C 1-6 Selected from the group including alkyl groups, where t is an integer selected from 0, 1, 2, or 3; R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; or R 40 and R 42 These, together with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline moiety; R 50 is selected from OH or oxo; and R51 is hydrogen or C 1-10 (It is alkyl.)
[0243] 69. A self-tanning composition prepared using one or more compounds as defined in any one of Descriptions 25-26, or one or more compounds of formula (I), (II), (III), (IV), (IIb), (IIa), (IIIa), (Ie), (If), (Ig), (Ic), or (Id) as described in any one of Descriptions 27-32 or 34-55, or a racemic mixture thereof, a stereoisomer thereof, a tautomer thereof, a salt thereof, and / or a solvate thereof (including mixtures thereof).
[0244] Uses as defined herein, or compositions as defined herein, may include at least one compound of formula (I), (Ia), (Ib), (Ic), (Id), (Ie), (If), or (Ig), or its racemic mixture, stereoisomer, tautomer, salt, solvate, and / or mixture thereof.
[0245] [ka]
[0246] (In the formula, dashes signify conjugation)
[0247] [ka]
[0248] represents any double bond; and R 1 , R 2 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 1 , R 2 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; preferably R 1 , R 2 Each of them is independently of hydrogen or C 1-2Selected from alkyl groups; preferably R 1 , R 2 Each is independently selected from hydrogen or methyl; R 3 , R 4 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 3 , R 4 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; preferably R 3 , R 4 Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; preferably R 3 , R 4 Each is independently selected from hydrogen or methyl; or R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form a C3 to C4 membered ring (the ring is composed of one or more C 1-4 Forms (which may be substituted with alkyl substituents); preferably R 3 Together with R 1 These, along with the carbon atoms to which they are bonded, form a C3-membered ring, namely cyclopropyl (the cyclopropyl is one or more C 1-2 The cyclopropyl may be substituted with an alkyl substituent; preferably, the cyclopropyl may be substituted with one or more methyl substituents) to form a structure; R 5 is, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17R 18 ] m -OH, -X-[CR 13 R 14 ] n -O-[CR 17 R 18 ] m -OH,-([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 13 R 14 ] n -CO-R 19 Selected from the group including; preferably R 5 is -X-[CHR 14 ] n -C(=O)-[CHR 18 ] m -R 19 , -X-[CHR 14 ] n -CH(OH)-[CHR 18 ] m -R 19 , -X-[CHR 14 ] n -[CHR 18 ] m -OH, -X-[CHR 14 ] n -O-[CHR 18 ] m -OH,-([CHR 18 ] m -O) y -C 1-6 Alkyl, -[CHR 14 ] n -CO-R 19 Selected from the group including; preferably R 5 is -O-[CHR 14 ] n -C(=O)-[CHR 18 ] m -R 19 ,-[CHR 14 ] n -C(=O)-[CHR 18 ] m -R 19 、-O-[CHR 14 ] n -CH(OH)-[CHR18 ] m -R 19 ,-[CHR 14 ] n -CH(OH)-[CHR 18 ] m -R 19 、-O-[CHR 14 ] n -[CHR 18 ] m -OH,-[CHR 14 ] n -[CHR 18 ] m -OH, -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5, n is an integer selected from 0, 1, 2, 3, or 4; y is an integer selected from 1, 2, or 3; preferably m is selected from 1, 2, or 3, preferably m is 1 or 2, preferably n is selected from 0, 1, 2, or 3; preferably n is selected from 0, 1, or 2; preferably y is 1 or 2; X is either a single bond or O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; preferably R 13 , R 14 , R 16 , R 17 , R 18 , R 19 Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; R 15 is OH, or R 16 Together with R15 It forms an oxo group; or R 3 and R 5 Together, they form the equation -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (may be substituted with alkyl substituents) form; p is an integer selected from 1 or 2, R 17 , R 18 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 3 and R 5 Together, they form the equation -O-[CR 17 R 18 ]-O- and together with the carbon atoms to which they are bonded, a 5-membered heterocycline moiety (the heterocycline is one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 3 and R 5 Together, they form the equation -O-[CR 17 R 18 ]-O- and together with the carbon atoms to which they are bonded, they form a dioxolanyl moiety, R 17 , R 18 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups, the dioxolanyl moiety consists of one or two C atoms. 1-4 Alkyl substituents, preferably one or two C 1-2 The alkyl substituent may be substituted, preferably with one or two methyl groups; or R 5 and R 6 Together, =[CR 14 ]-[CR 17 R 18 ] m -Forms OH; or R 5 and R 6These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 5 and R 6 Together = [CH]-[CHR 18 ] m -Forms an OH group; and m is either 1 or 2; or R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a six-membered heterocycline moiety (the heterocycline consists of one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 5 and R 6 Together = [CH]-[CH2] m -Forms an OH group; and m is either 1 or 2; or R 5 and R 6 These, along with the carbon atoms to which they are bonded, form a 6-membered dioxany moiety, for example, 1,3-dioxany (where the dioxany is composed of one or more C 1-6 Alkyl substituents, for example, one or more C 1-4 Alkyl substituent, one or more C 1-3 Forms (which may be substituted with alkyl substituents); or R 5 and R 8 These, along with the carbon atoms to which they are bonded, form saturated or unsaturated C5 or C6 membered rings (the aforementioned rings are oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 17 R 18 ] m -COH or -[CR 17 R 18 ] m-OH may be substituted with one or more substituents independently selected from each; or the two substituents on the ring may, together with the carbon atom to which they are bonded, form a 3- to 6-membered heterocyclyl moiety (the heterocyclyl moiety is C 1-6 The alkyl group may be substituted with one or more substituents independently selected from each alkyl group, or the two substituents on the heterocycline may, together with the atom to which they are bonded, form a 3- to 6-membered heterocycline moiety; preferably R 5 and R 8 These, along with the carbon atoms to which they are bonded, form a saturated or unsaturated C6-membered ring (the ring is oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -OC 1-6 Alkyl, -[CR 17 R 18 ] m -COH or -[CR 17 R 18 ] m -OH may be substituted with one or more substituents independently selected from each; or the two substituents on the ring may, together with the carbon atom to which they are bonded, form a 3- to 6-membered heterocyclyl moiety (such as oxyranyl, tetrahydrofuranyl, dioxolanyl, tetrahydropyranyl, etc.) (the heterocyclyl moiety is C 1-6 Alkyl, for example, C 1-4 Alkyl, for example, C 1-2 The alkyl group may be substituted with one or more substituents independently selected from each alkyl group, or the two substituents on the heterocyclyl may, together with the atom to which they are bonded, form a five- to six-membered heterocyclyl moiety (such as dioxanyl); or R 6 and R 9 They form a C3-membered ring together with the carbon atoms to which they are bonded; R 6 If present, hydrogen or C 1-6 It is alkyl; preferably R 6 If present, hydrogen or C 1-4 It is alkyl; preferably R 6 If present, hydrogen or C 1-2 It is alkyl; preferably R 6 If present, it is hydrogen or methyl; R 7 If present, hydrogen or C 1-6 It is alkyl; preferably R 7 If present, hydrogen or C 1-4 It is alkyl; preferably R 7 If present, hydrogen or C 1-2 It is alkyl; preferably R 7 If present, it is hydrogen or methyl; R 8 is hydrogen or C 1-6 It is alkyl; preferably R 8 is hydrogen or C 1-5 It is alkyl; preferably R 8 is hydrogen or C 1-4 It is alkyl; or R 8 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 The ring may be substituted with alkyl substituents; preferably, the ring has one or more C 1-4 The ring may be substituted with alkyl substituents; preferably, the ring has one or more C 1-2 Forms (which may be substituted with alkyl substituents); R 9 , R 10 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 9 , R 10 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; R 9 , R 10Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; or R 9 Together with R 1 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 The ring may be substituted with alkyl substituents; preferably, the ring has one or more C 1-4 The ring may be substituted with alkyl substituents; preferably, the ring has one or more C 1-2 Forms (which may be substituted with alkyl substituents); or R 9 Together with R 3 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (the ring is composed of one or more C atoms). 1-6 The ring may be substituted with alkyl substituents; preferably, the ring has one or more C 1-4 The ring may be substituted with alkyl substituents; preferably, the ring has one or more C 1-2 Forms (which may be substituted with alkyl substituents); R 11 , R 12 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 11 , R 12 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; preferably R 11 , R 12 Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; preferably R 11 , R 12 Each is independently selected from hydrogen or methyl; or R 9 and R 11 These, along with the carbon atoms to which they are bonded, form saturated or unsaturated C5 or C6 membered rings (the rings consist of one or more C 1-6 The ring may be substituted with alkyl substituents; preferably, the ring has one or more C 1-4 The ring may be substituted with alkyl substituents; preferably, the ring has one or more C 1-2(May be substituted with alkyl substituents) to form.
[0249] Uses as defined herein, or compositions as defined herein, may include at least one compound of formula (II), (IIa), or (IIb), or its racemic mixture, stereoisomer, tautomer, salt, solvate, and / or mixture thereof.
[0250] [ka]
[0251] (In the formula, dashes signify conjugation)
[0252] [ka]
[0253] represents any double bond; and R 20 is hydrogen or C 1-6 It is alkyl; preferably R 20 is hydrogen or C 1-4 It is alkyl; preferably R 20 is hydrogen or C 1-2 It is alkyl; preferably R 20 is either hydrogen or methyl; R 21 is hydrogen or C 1-6 It is alkyl; preferably R 21 is hydrogen or C 1-4 It is alkyl; preferably R 21 is hydrogen or C 1-2 It is alkyl; preferably R 21 is either hydrogen or methyl; R 22 is hydrogen, C 1-6 Alkyl and -CO-R 19 Selected from the group including; R 19 is hydrogen or C 1-6 It is alkyl; preferably R 22is hydrogen, C 1-4 Alkyl and -CO-R 19 Selected from the group including; R 19 is hydrogen or C 1-4 It is alkyl; preferably R 22 is hydrogen, C 1-2 Alkyl and -CO-R 19 Selected from the group including; R 19 is hydrogen or C 1-2 It is alkyl; preferably R 22 This is selected from the group including hydrogen, methyl, and -CO-methyl; R 23 is hydrogen or C 1-6 It is alkyl; preferably R 23 is hydrogen or C 1-4 It is alkyl; preferably R 23 is hydrogen, methyl, or ethyl; R 24 is hydrogen or C 1-6 It is alkyl; preferably R 24 is hydrogen or C 1-4 It is alkyl; preferably R 24 is hydrogen or C 1-2 It is alkyl; preferably R 24 is either hydrogen or methyl; or R 23 and R 24 These, along with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline portion (the heterocycline is C 1-6 Forms (which may be substituted with one or more substituents independently selected from each alkyl group); preferably R 23 and R 24 These, along with the carbon atoms to which they are bonded, form a 3- to 5-membered heterocycline moiety (the heterocycline has one or more C 1-4 Forms (which may be substituted with alkyl substituents); preferably R 23 and R 24 These, along with the carbon atoms to which they are bonded, form a 3- to 4-membered heterocycline moiety (the heterocycline has one or more C 1-2Forms (which may be substituted with alkyl substituents); preferably R 23 and R 24 These, along with the carbon atoms to which they are bonded, form a 3-heterocyclyl moiety, preferably oxyranyl (the heterocyclyl is one or more C 1-2 Forms an alkyl substituent, preferably substituted with methyl; R 25 is hydrogen or C 1-6 It is alkyl; preferably R 25 is hydrogen or C 1-4 It is alkyl; preferably R 25 is hydrogen or C 1-2 It is alkyl; preferably R 25 is either hydrogen or methyl; or R 24 and R 25 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is C 1-6 It may be substituted with one or more substituents independently selected from the alkyl group, or one of the substituents and R 23 They form a 3- to 6-membered heterocycline moiety together with the atoms to which they are bonded; preferably R 24 and R 25 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocycline portion (the heterocycline is C 1-4 It may be substituted with one or more substituents independently selected from the alkyl group, or one of the substituents and R 23 They form a 4- to 6-membered heterocycline moiety together with the atoms to which they are bonded; preferably R 24 and R 25 These, along with the carbon atoms to which they are bonded, form a 5-membered or 6-membered heterocyclyl moiety, for example, tetrahydropyranyl or tetrahydrofuranyl (the heterocyclyl is C 1-2 It may be substituted with one or more substituents independently selected from the alkyl group, or one of the substituents and R 23They form a 5- to 6-membered heterocycline moiety (such as dioxolanil) with the atoms to which they are bonded; R 26 is hydrogen or C 1-6 It is alkyl; preferably R 26 is hydrogen or C 1-4 It is alkyl; preferably R 26 is hydrogen or C 1-2 It is alkyl; preferably R 26 is either hydrogen or methyl; R 27 If present, hydrogen or C 1-6 It is alkyl; preferably R 27 is hydrogen or C 1-4 It is alkyl; preferably R 27 is hydrogen or C 1-2 It is alkyl; preferably R 27 is either hydrogen or methyl; or R 20 and R 27 They form a C3-membered ring (cyclopropyl) together with the carbon atoms to which they are bonded; R 28 is hydrogen, oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -OC 1-6 Alkyl, -[CR 17 R 18 ] m -COH and -[CR 17 R 18 ] m - Selected from the group containing OH; m is 1, 2, 3 or 4, and R 17 and R 18 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 28 is hydrogen, oxo, C 1-4 Alkyl, -OC1-4 Alkyl, -[CHR 18 ] m -O-CO-C 1-4 Alkyl, -[CHR 18 ] m -OC 1-4 Alkyl, -[CHR 18 ] m -COH and -[CHR 18 ] m Selected from the group containing -OH, m is 1, 2, or 3, and R 18 is hydrogen or C 1-4 It is alkyl; preferably R 28 is hydrogen, oxo, C 1-3 Alkyl, -OC 1-3 Alkyl, -[CHR 18 ] m -O-CO-C 1-3 Alkyl, -[CHR 18 ] m -OC 1-3 Alkyl, -[CHR 18 ] m -COH and -[CHR 18 ] m Selected from the group containing -OH, m is 1, 2, or 3, and R 18 is hydrogen or C 1-3 It is alkyl; R 29 is hydrogen or C 1-6 It is alkyl; preferably R 29 is hydrogen or C 1-4 It is alkyl; preferably R 29 is hydrogen or C 1-2 It is alkyl; preferably R 29 is either hydrogen or methyl; or R 29 and R 28 Together, they form the equation -O-[CR 17 R 18 ] p It is -O-, where p is an integer selected from 1 or 2; and together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl portion (the heterocyclyl is one or more C 1-6Forms R (which may be substituted with alkyl substituents), and 17 and R 18 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 29 and R 28 Together, they form the equation -O-[CR 17 R 18 ]-O- and together with the carbon atoms to which they are bonded, dioxolanyl (the dioxolanyl is one or more C 1-4 Forms R (which may be substituted with alkyl substituents), and 17 and R 18 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; preferably R 29 and R 28 Together, they form the equation -O-[CR 17 R 18 ]-O- and together with the carbon atoms to which they are bonded, dioxolanyl (the dioxolanyl is one or more C 1-2 alkyl substituents, for example, C 1-2 (May be substituted with alkyl substituents) form; R 17 and R 18 Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; R 30 If present, hydrogen or C 1-6 It is alkyl; preferably R 30 is hydrogen or C 1-4 It is alkyl; preferably R 30 is hydrogen or C 1-2 It is alkyl; preferably R 30 is either hydrogen or methyl; or R 23 Together with R 30 These, along with the carbon atoms to which they are bonded, form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); preferably R 23 Together with R 30These, along with the carbon atoms to which they are bonded, form saturated C4 to C5 membered rings (the rings consist of one or more C 1-4 Forms (which may be substituted with alkyl substituents); preferably R 23 Together with R 30 These, along with the carbon atoms to which they are bonded, form a saturated C5-membered ring (cyclopentyl) (the ring is composed of one or more C 1-2 (May be substituted with alkyl substituents) to form.
[0254] Uses as defined herein, or compositions as defined herein, may include at least one compound of formula (III) or (IIIa), or its racemic mixture, stereoisomer, tautomer, salt, solvate, and / or mixture thereof.
[0255] [ka]
[0256] (In the formula, dashes signify conjugation)
[0257] [ka]
[0258] represents any double bond; and q is an integer selected from 0, 1, 2, or 3, preferably q is 0, 1, or 2, preferably q is 1 or 2; preferably q is 1; R 40 is, -[CR 17 R 18 ] m -OH, -CO-C 1-6 Alkyl, -O-([CR 17 R 18 ] m -O-) t -C 1-6 Selected from the group including alkyl, where t is an integer selected from 0, 1, 2, or 3; m is an integer selected from 1, 2, 3, or 4, and R 17 and R18 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 40 is, -[CHR 18 ] m -OH, -CO-C 1-6 Alkyl, -O-([CHR 18 ] m -O-) t -C 1-6 Selected from the group including alkyl, where t is an integer selected from 0, 1, or 2; m is an integer selected from 1, 2, or 3, and R 18 is hydrogen or C 1-6 It is alkyl; preferably R 40 is, -[CHR 18 ] m -OH, -CO-C 1-4 Alkyl, -O-([CHR 18 ] m -O-) t -C 1-4 Selected from the group including alkyl, where t is an integer selected from 0 or 1; m is an integer selected from 1 or 2, and R 18 is hydrogen or C 1-4 It is alkyl; preferably R 40 is, -[CHR 18 ] m -OH, -CO-C 1-2 Alkyl, -O-[CHR 18 ] m -OC 1-2 Selected from the group including alkyl, m is an integer selected from 1 or 2, and R 18 is hydrogen or C 1-2 It is alkyl; R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 Each of them is independently of hydrogen or C 1-6 Selected from alkyl groups; preferably R 41 , R 42 , R 43 , R 44, R 45 , R 46 , R 47 Each of them is independently of hydrogen or C 1-4 Selected from alkyl groups; preferably R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 Each of them is independently of hydrogen or C 1-2 Selected from alkyl groups; preferably R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 Each is independently selected from hydrogen or methyl; or R 40 and R 42 These, together with the carbon atoms to which they are bonded, form a 3- to 6-membered heterocycline moiety; or preferably R 40 and R 42 They form a 3- to 5-membered heterocycline moiety together with the carbon atoms to which they are bonded; or R 40 and R 42 They form a 3- to 4-membered heterocycline moiety together with the carbon atoms to which they are bonded; or R 40 and R 42 These atoms, together with the carbon atoms to which they are bonded, form a three-membered heterocycline moiety, preferably an oxyranyl moiety.
[0259] Uses as defined herein, or compositions as defined herein, may include at least one compound of formula (IV), its racemic mixture, its stereoisomer, its tautomer, its salt, its solvate, and / or mixture thereof.
[0260] [ka]
[0261] (In the formula, dashes signify conjugation)
[0262] [ka]
[0263] represents any double bond; and R 50 is selected from OH or oxo; and R 51 is hydrogen or C 1-10 It is alkyl, preferably R 51 is hydrogen or C 1-4 It is alkyl; preferably R 51 is hydrogen or C 1-2 It is alkyl; preferably R 51 (This is hydrogen or methyl, preferably hydrogen).
[0264] The compounds used in the present invention can be added as materials to compositions, formulations applied to target tissues, such as topical cosmetics, or used in the manufacture of such products. These compositions, such as topical formulations and cosmetics, can be used to increase pigmentation in target tissues, such as increasing melanin production, thereby increasing pigmentation in hair, skin, fur, and / or feathers, coloring the skin, or preventing, improving, or treating symptoms such as photodermatitis and UVR hypersensitivity of the skin. These compositions, such as topical formulations and cosmetics, are also included in the scope of the present invention.
[0265] Compounds, compositions, formulations, and cosmetics may be manufactured or used for human or non-human animals. Compounds for use herein may be active ingredients for stimulating OR7C1 activity, increasing cAMP levels, thereby increasing melanin production, causing sunburn, and / or preventing, improving, and / or treating conditions such as photodermatitis, UVR hypersensitivity, and / or other skin conditions.
[0266] Compounds, compositions, formulations, and cosmetics can be administered in different forms of dosing. Dosage may be oral or parenteral. Dosage forms for oral administration include, for example, solid forms such as tablets, coated tablets, granules, powders, and capsules, as well as liquid forms such as elixirs, syrups, and suspensions. Dosage forms for parenteral administration include, for example, injection, infusion, topical application, topical formulations, subcutaneous, transmucosal, transnasal, intestinal, inhalation, suppositories, boluses, and patches. The composition may preferably be in the form of a topical application formulation to the skin.
[0267] The cosmetic composition contains this compound as an active ingredient. The cosmetic can take any form that can be used in cosmetics, such as creams, emulsions, lotions, suspensions, gels, powders, packs, sheets, patches, sticks, cakes, etc. The cosmetic composition of the present invention is preferably a cosmetic for tanning, and more preferably a cosmetic for topical application to the skin. The cosmetic is more preferably a cosmetic for topical application for skin pigmentation.
[0268] The packaging may be a patch, bottle, tube, roll ball applicator, propellant-driven aerosol device, squeeze container, or jar with a lid.
[0269] Cosmetic compositions or cosmetics may contain the compounds defined above in combination with pharmaceutically or cosmetically acceptable carriers, diluents, and / or excipients.
[0270] The carrier can act as a diluent or dispersant to the components of the composition. The carrier may be an emulsion such as an aqueous base, anhydrous, or a water-in-oil or oil-in-water emulsion.
[0271] In addition to water, organic solvents can be used as carriers or diluents in the compositions of the present invention. Non-limiting examples include ethyl and isopropyl alcohols, and alkanols such as propanediol.
[0272] Other suitable organic solvents include isopropyl myristate, cetyl myristate, 2-octyldodecyl myristate, avocado oil, almond oil, olive oil, and ester oils such as neopentyl glycol dicaprate. Typically, such ester oils assist in emulsifying the composition.
[0273] Furthermore, an emollient may be used as a carrier if desired. Alcohols such as 1-hexadecanol (i.e., cetyl alcohol) are preferred. Other emollients include silicone oils and synthetic esters. Suitable silicone oils for use include cyclic or linear polydimethylsiloxanes containing 3 to 9, preferably 4 to 5, silicon atoms. Non-volatile silicone oils useful as emollients include polyalkylsiloxanes, polyalkylarylsiloxanes, and polyethersiloxane copolymers. Silicone elastomers can also be used. Optional ester emollients may include the following:
[0274] (i) Alkenyl or alkyl esters of fatty acids having 10 to 20 carbon atoms. Examples include isoarachidyl neopentanoate, isononyl isonanonoate, oleyl myristate, oleyl stearate, and oleyl oleate; (ii) Ether esters such as fatty acid esters of ethoxylated aliphatic alcohols; (iii) Polyhydric alcohol esters. Ethylene glycol mono and di fatty acid esters, diethylene glycol mono and di fatty acid esters, polyethylene glycol (200-6000) mono and di fatty acid esters, propylene glycol mono and di fatty acid esters, polypropylene glycol 2000 monooleate, polypropylene glycol 2000 monostearate, ethoxylated propylene glycol monostearate, glyceryl mono and di fatty acid esters, polyglycerol poly fatty acid esters, ethoxylated glyceryl monostearate, 1,3-butylene glycol monostearate, 1,3-butylene glycol distearate, polyoxyethylene polyol fatty acid esters, sorbitan fatty acid esters, and polyoxyethylene sorbitan fatty acid esters are satisfactory polyhydric alcohol esters; (iv) Wax esters such as beeswax, spermaceous acid, stearyl stearate and arachidyl behenate; and (v) Sterol esters, of which cholesterol fatty acid esters are an example.
[0275] Fatty acids having 10 to 30 carbon atoms may also be included as carriers. Examples of such fatty acids include pelargonic acid, lauric acid, myristic acid, palmitic acid, stearic acid, isostearic acid, oleic acid, linoleic acid, arachidic acid, behenic acid or erucic acid, and mixtures thereof.
[0276] Polyhydric alcohol-type humectants can also be used in compositions. Humidants often help enhance the emollient effect, reduce scaling on the skin surface, stimulate the removal of accumulated scale, and improve skin feel. Typical polyhydric alcohols include glycerol, polyalkylene glycol, more preferably alkylene polyols and their derivatives, such as propylene glycol, dipropylene glycol, polypropylene glycol, polyethylene glycol and its derivatives, sorbitol, hydroxypropyl sorbitol, hexylene glycol, 1,3-butylene glycol, 1,2,6-hexanetriol, ethoxylated glycerol, propoxylated glycerol and mixtures thereof. For best results, the humectant is preferably propylene glycol or sodium hyaluronate. Other humectants that can be used include hydroxyethylurea.
[0277] Moisture retention can be improved by the use of petrolatum or paraffin. Thickeners can also be used as part of the carrier in the composition. Typical thickeners include cross-linked acrylates (e.g., Carbopol® 982), hydrophobic modified acrylates (e.g., Carbopol® 1382), cellulose derivatives, and natural gums. Useful cellulose derivatives include sodium carboxymethylcellulose, hydroxypropyl methylcellulose, hydroxypropylcellulose, hydroxyethylcellulose, ethylcellulose, and hydroxymethylcellulose. Suitable natural gums for the present invention include guar, xanthan gum, sclerotium, carrageenan, pectin, and combinations thereof.
[0278] Surfactants may also be present. The surfactants are selected from the group consisting of anionic, nonionic, cationic, and amphoteric surfactants. Particularly preferred nonionic surfactants include those obtained by condensing hydrophobic C10-20 aliphatic alcohols or acids with 2 to 100 moles of ethylene oxide or propylene oxide per mole of hydrophobic substance; mono and di fatty acid esters of ethylene glycol; fatty acid monoglycerides; sorbitan, mono and di C8-C20 fatty acids; block copolymers (ethylene oxide / propylene oxide); and polyoxyethylene sorbitan, as well as combinations thereof. Alkyl polyglycosides and saccharide fatty acid amides (e.g., methylgluconamide) are also suitable nonionic surfactants. Preferred anionic surfactants include soaps, alkyl ether sulfates and sulfons, alkyl sulfates and sulfons, alkylbenzene sulfons, alkyl and dialkyl sulfosuccinates, C8 to 20 acyl isothionates, acyl glutamates, C8 to 20 alkyl ether phosphates, and combinations thereof.
[0279] Various other components may also be used in the composition. Non-limiting examples of additional components may include coating agents, binders, fillers, disintegrants, lubricants, diluents, osmotic pressure regulators, pH adjusters, dispersants, emulsifiers, preservatives, stabilizers, antioxidants, colorants, UV absorbers, humectants, thickeners, activity enhancers, anti-inflammatory agents, bactericides, fragrances, flavoring agents, and odor modifiers.
[0280] Furthermore, the composition or cosmetic may contain other active ingredients or pharmacological components, as long as they do not affect the OR7C1 activating activity of the compound.
[0281] Furthermore, the composition or cosmetic may also contain other active ingredients and cosmetic ingredients such as moisturizers, skin sunscreens, UV protectants, cell activators, cleansing agents, keratolytic agents, and makeup ingredients (e.g., makeup base, foundation, face finishing powder, powder, blush, lipstick, eye makeup, eyebrow pencil, mascara, etc.), as long as they do not affect the OR7C1 activating activity of the compound.
[0282] The above compositions or cosmetics may be manufactured by conventional methods, which may involve combining the compounds with carriers, diluents and / or excipients, and / or other active ingredients, cosmetic ingredients, or pharmacological ingredients as needed. For example, compositions for topical application to the skin may contain ingredients typically added to topical formulations, topical pharmaceuticals, or skin cosmetics, such as oils or oily substances (e.g., fats and oils, waxes, higher fatty acids, essential oils, silicone oils, etc.), humectants (e.g., glycerol, sorbitol, gelatin, polyethylene glycol, etc.), powders (chalk, talc, fuller's earth, kaolin, starch, rubber, etc.), pigments, emulsifiers, solubilizers, cleansing agents, UV absorbers, thickeners, pharmaceutical ingredients, fragrances, resins, antibacterial and antifungal agents, other plant extracts (e.g., crude drugs, herbal preparations, herbs), alcohols, polyhydric alcohols, inorganic acids (e.g., bicarbonates, carbonates, sodium chloride, potassium chloride, sodium sulfate, etc.) It can be prepared using organic acids (e.g., succinic acid, glutaric acid, fumaric acid, glutamic acid, malic acid, citric acid, ascorbic acid, etc.), vitamins (e.g., vitamin A group, vitamin E group, vitamin B group, vitamin C, folic acid, etc.), water-soluble polymers, anionic surfactants (e.g., alkylbenzene sulfonates, alkyl sulfates, etc.), cationic surfactants (e.g., alkyl quaternary ammonium salts, alkyldimethylbenzylammonium salts, etc.), nonionic surfactants (e.g., polyoxyethylene alkyl ethers, polyoxyethylene alkylphenyl ethers, etc.), and amphoteric surfactants (e.g., alkyl group-containing imidazoline or carbobetine, etc.).
[0283] In the case of topical application compositions, the content of the compound for use in the present invention is preferably 0.00001 to 20% by weight, more preferably 0.0001 to 10% by weight, on a dry weight basis.
[0284] Those skilled in the art will understand that light or very pale skin and / or hair may require higher doses than those required for skin and / or hair that is less pigmented and not pale. For example, subjects with a Fitzpatrick scale type I or II may require higher doses to promote pigmentation than subjects with a type III or higher. The Fitzpatrick scale is shown in the table below.
[0285] [Table 1]
[0286] The present invention is particularly suitable for subjects that are Fitzpatrick scale types I, II, III, and IV.
[0287] The present invention encompasses a method for darkening skin, comprising the step of applying a composition or compound, such as those disclosed herein, to a desired skin surface.
[0288] This method is preferably essentially non-therapeutic.
[0289] Suitable skin surfaces include the face, hands, arms, feet, legs, neck, chest, back including the waist, and scalp. Of particular interest is the face, including the forehead, perietus, chin, perietus, nose, and / or cheeks. The composition may be applied to the desired surface and left for a sufficient amount of time, or it may be applied repeatedly a sufficient number of times. In certain embodiments, the contact time is greater than 1 hour, greater than 2 hours, greater than 6 hours, greater than 8 hours, greater than 12 hours, or greater than 24 hours. The contact time is the time from application of the composition until it is removed. In certain embodiments, the composition may be removed by rinsing or washing the substrate. The composition may be removed by washing or rinsing the skin. The composition may be applied at least once a day. In other embodiments, the composition may be applied at least twice a day. Multiple applications may be made over a period of at least about one week. Alternatively, the application period may continue for more than about three weeks or more than about nine weeks. The composition may be applied daily over a long period of time.
[0290] In yet another aspect, the present invention provides the use of the compositions disclosed herein for skin darkening. This use is preferably for cosmetic purposes.
[0291] The present invention also provides the use of compounds of formula (I), (II), (III), or (IV), or their subgroups, or their racemates, stereoisomers, tautomers, salts, and / or solvates (including mixtures thereof) in the preparation of compositions for providing skin blackening.
[0292] The present invention provides a method for increasing intracellular melanin. This method comprises adding a compound or a subgroup of formula (I), (II), (III), or (IV) described herein, or a racemate thereof, its stereoisomer, its tautomer, its salt and / or solvate thereof (including mixtures thereof), or a composition thereof, to tyrosinase-expressing cells in which tyrosinase production needs to be stimulated.
[0293] The present invention provides a method for increasing intracellular melanin production. The method comprises adding a compound or a subgroup of formula (I), (II), (III), or (IV) described herein, or a racemate thereof, its stereoisomer, its tautomer, its salt and / or solvate thereof (including mixtures thereof), or a composition thereof to melanin-producing cells in which melanin production needs to be stimulated.
[0294] In the present invention, the "cells" whose melanin production is to be activated are not particularly limited, as long as they are tyrosinase-expressing cells or melanin-producing cells, either native or modified by genetic engineering techniques. The cells are preferably pigment cells (melanocytes, retinal pigment epithelial cells, etc.), and more preferably melanocytes. Alternatively, the "cells" may be cell fragments or cell fractions of the above cells, tissues containing the above cells, or cultures derived from the above cells. If the cells are a cell culture, it is preferable that the cells have been cultured in the presence of the formulation of the present invention. The concentration of the compound to be added, if the cells are a cell culture, is in the range of 0.01 μM to 1 mM, preferably 0.05 μM to 500 μM, and most preferably 0.1 μM to 150 μM as the final concentration in the culture.
[0295] In the present invention, the compounds or compositions described herein can be administered or ingested in an effective amount to a subject for the prevention, improvement, or treatment of symptoms such as increased melanin synthesis, sunburn, or photodermatitis or UVR hypersensitivity. They may also be administered or ingested non-therapeutically for health promotion or cosmetic purposes. Examples of subjects for administration or ingestion include animals that need to have their melanin synthesis stimulated. Alternatively, examples of subjects for administration or ingestion include animals that desire increased melanin production or sunburn, or animals that desire the prevention, improvement, or treatment of symptoms such as photodermatitis or UVR hypersensitivity. The animal is preferably a human or a non-human mammal, and is preferably a human.
[0296] The effective dose of administration or ingestion should be an amount that can stimulate melanin production in the target cells. The preferred dose or ingestion will vary depending on the species, weight, sex, age, subject condition, or other factors. The dose, route, and interval of administration or injection, as well as the amount and interval of ingestion, can be suitably determined by those skilled in the art. For example, when administered topically to human skin, the dose per adult (60 kg) is 0.01 μM to 1 mM, preferably 0.05 μM to 500 μM, and most preferably 0.1 μM to 150 μM.
[0297] The present invention will be described in detail with the help of the following non-limiting embodiments. [Examples]
[0298] Examples Experimental procedure: Cell culture and cell line preparation HEK293T-RTP1A1 / RTP2 cells were maintained in minimal essential medium (EMEM, Lonza) containing 10% fetal bovine serum (M10). These cells were generated by transfecting HEK293T (Thermofisher Scientific, cat ref: R70007) with an expression vector containing the sequences of chaperone proteins RTP1A1 and RTP2 and a puromycin resistance gene using Lipofectamine 2000. Recombinant cell populations used in these experiments were selected by adding 10 μg / ml of puromycin to the medium and then subcloned (WO 2014 / 191047 A1).
[0299] Experiments on melanin production were conducted using Normal Human Epidermal Melanocytes (NHEMs-MP) (moderately pigmented, LIFE TECHNOLOGIES; ref:C-102-5C (LOT # 706296)).
[0300] This primary culture was cultured in medium M254 supplemented with HMGS (human melanocyte growth supplement; LIFE TECHNOLOGIES; ref: S-002-5) and gentamicin (LIFE TECHNOLOGIES; ref: 15710-049) (LIFE TECHNOLOGIES; ref: M-254-500), and maintained in a wet incubator at 37°C and a 5% CO2 atmosphere. The experiment (see below) involved 9 × 10⁶ cells. 4 Cells were seeded at a density of cells / well (100 μL / well) and cultured at 37°C under 5% CO2.
[0301] Dilution of OR7C1 agonist Stock solutions were prepared by diluting candidate OR7C1 agonists at a concentration of 1 mol / liter (M) in organic solvents such as dimethyl sulfoxide (DMSO) or ethanol.
[0302] For the screening experiment, compound stock solutions were diluted in EMEM placed in 96-well plates. Plates containing the test compound at concentrations of 2 mM, 632 μM, and 200 μM (1 compound / well) were prepared.
[0303] For concentration-response analysis, serial dilutions of the test molecule were prepared from stock solutions in EMEM and plated into 96-well plates.
[0304] Luciferase assay For dose-response analysis, a luciferase-based gene reporter assay (Promega, Leiden, the Netherlands) was used. Briefly, cells were plated on poly-D-lysine-coated 96-well plates and transfected with plasmids containing CRE-luciferase and olfactory receptors. Sixteen hours after transfection, the medium was replaced with serum-free EMEM containing the test compounds at predetermined concentrations. After incubation at 37°C for four hours, the cells were lysed and processed for luminescence measurement. Luminescence emission was recorded. Results were expressed as luciferase activity (relative fluorescence units (RLU)) or as the percentage of response induced by 10 μM adenylyl cyclase activator forskolin. An empty plasmid was used as a negative control.
[0305] Total RNA extraction Total RNA was extracted using the Qiagen RNeasy kit (Qiagen; ref: 74100). Cells were rinsed with PBS and lysed in appropriate buffer. Extraction was performed according to the supplier's recommendations. The recovered RNA was stored at -80°C.
[0306] cDNA synthesis cDNA synthesis and reverse transcription were performed from 1 μg of total RNA using SuperScript III (Invitrogen; ref:18080_051) according to the manufacturer's instructions. The cDNA was then stored at -20°C until the PCR reaction.
[0307] Polymerase chain reaction (PCR) PCR was performed on 50 ng of cDNA obtained after reverse transcription synthesis (see above). For Couple 1, the primers used were: forward: CATTCTCTTTGGCTGTTCC (SEQ ID NO: 1); reverse: TTATGAAAGTCCCTGCAGTGATG (SEQ ID NO: 2). For Couple 2, the primers used were: forward: ATGGAAACAGGAAATCAAACAC (SEQ ID NO: 3); reverse: TTATGAAAGTCCTGCAGTGATG (SEQ ID NO: 4), and for Couple 3, forward: CATTCTTTGGCTGTTCC (SEQ ID NO: 5); reverse: GAAGGAAATCACACCCAGA (SEQ ID NO: 6). The expected amplification products were 889 base pairs (pb), 962 pb, and 559 pb, respectively. The positive PCR control used was the cDNA sequence of OR7C1 present in the expression plasmid (pEFIBRHO). PCR products were prepared in a 1% agarose gel containing ethidium bromide, according to the manufacturer's instructions (Thermo Fisher Scientific, ref: 15585011).
[0308] Cell treatment and cytotoxicity testing (MTS) Moderately pigmented NHEMs (NHEMs-MP) were treated at different concentrations of the two compounds described in the embodiments of the present invention, 72 hours prior to treatment with 9 × 10⁻¹⁴ NHEMs. 4 Cells were seeded in 24-well plates at a cell / well density. After treatment with these compounds for 2 days, the compounds were reapplied for another 2 days according to the experimental scheme shown in Figure 1. To validate the experiment, 0.05% sodium dodecyl sulfate (SDS) was used as a cytotoxicity positive control. Samples treated with 0.1% ethanol (corresponding to the solvent of the test substance) were also tested in the same manner. After 4 days of treatment, the MTS cytotoxicity test was performed according to the supplier's recommendation (Promega; ref: G3581).
[0309] Evaluation of the effect of the compounds described in the embodiments of the present invention on pigment formation of NHEMs-MP during culture. NHEMs-MP were treated with amber ketal, ambermax, and a reference molecule (L-DOPA) for 2 days after the medium was collected and stored at -80°C as shown in Figure 2, followed by a medium refresh for 4 days. At the end of the treatment, the medium was collected twice, pooled with the medium collected on day 2, and centrifuged for 30 minutes (14000 rpm). The pellet obtained after centrifugation and the NHEMs-MP treated cells were lysed in 150 μl of NaOH (1M) solution. 5 μl of each cell lysate was used for protein quantification using a BCA protein assay. The remaining 145 μl of lysate was heated at 80°C for 1 hour. Optical density was measured at 490 nm, and melanin content was determined by comparison with a standard curve for synthetic melanin. The amount of protein present in each tested cell well was reported.
[0310] Evaluation of the tanning effect of the compound of the present invention. a. Preparation of excised material : Human skin excisions with an average diameter of 12 mm (±1 mm) were prepared by abdoplasty from a 47-year-old Caucasian woman (reference: P2237AB47, phototype II) or a 61-year-old woman (reference: P2196-AB61, phototype III). These excisions were kept alive in BEM medium (BIO-EC's Explants Medium) at 37°C and 5% humidity in a CO2 atmosphere.
[0311] b. Product preparation Ambermax was diluted with 0.1% ethanol to the following concentrations: 0.3 μM, 1 μM, 3 μM, 10 μM, 15 μM, 30 μM, and 100 μM. The diluted solutions were stored at 4°C during the study.
[0312] c. Research schedule: The extracted samples were treated with Ambermax for 10 days (see product application below), or left untreated. The experimental scheme is shown in Figure 3.
[0313] d. Product application: On days 0 (D0), 3 (D3), 5 (D5), 7 (D7), and 10 (D10), the test product (compound used in the present invention) was administered at the indicated concentration using a small spatula, at a concentration of 2 μl (cm³) per sample. 2 The treatment was administered topically based on a concentration of 2 mg per excision; 2) intradermally by syringe injection into the dermis, with 20 μL of the product applied to each excision; or 3) systemically by dilution of the compound of the present invention in culture medium at the indicated concentration. The control excision (T) received no treatment other than refreshing the culture medium. The culture medium was halved on days 3, 5, 7, and 10 (1 ml / well). or On days 0 (D0), D2, D3, D6, and D8, the test product (compound for use in this invention) was applied locally using a small spatula, 2 μl per excision (1 cm). 2 A dose of 2 mg per well was used as a baseline. Control excised specimen T underwent no treatment other than the replacement of the culture medium. The medium was replaced by half each on D2, D3, D6, and D8 (1 ml / well).
[0314] e. Chronic UVA-irradiations : For D0, D3, D4, D5, D6, D7, and D10, the batch TUV extracts were placed in 1 mL of HBSS (Hank's Balanced Saline Solution) and subjected to UVA 2.25 J / cm² using a Vilber Lourmat RMX 3W UV simulator. 2 The irradiation was performed at a dose equivalent to (0.5 MED - Minimal Erythemal Dose). or For batches D0, D1, D2, D3, D6, D7, D8, and D9, the batch TUV extracts were placed in 1 mL of HBSS (Hank's Balanced Saline Solution) and subjected to UVA 2.25 J / cm² using a Vilber Lourmat RMX 3W UV simulator. 2 The irradiation was performed at a dose equivalent to (0.5 MED - Minimal Erythemal Dose).
[0315] f. sampling On day 0 (D0), three excisions were collected from batch T0 and divided into three parts. One part was fixed in formalin buffer, the second part was frozen at -80°C, and the third part was placed in RNA later® solution. On days D5 and D10, three samples from each batch were collected and processed in the same manner as on day 0. or On days D6 and D10, three samples from each batch were collected and processed in the same manner as on day 0. In accordance with the research plan, the number of days for processing, irradiation, and sampling were adjusted to fit the workday schedule.
[0316] calcium. Histological processing After fixing in buffered formalin solution for 24 hours, the samples were dehydrated and impregnated in paraffin using a Leica PEARL automated dehydration system. The samples were then embedded in paraffin using a Leica EG 1160 embedding station. 5 μm thick fixed sections of the paraffin-embedded formol were obtained using a Leica RM 2125 Minot-type microtome, and these sections were mounted on Superfrost® Plus glass slides. Microscopic observations were performed using Leica DMLB, BX43, or BX63 Olympus microscopes. Photographs were digitized using an Olympus DP72 or DP74 camera and Cell^D or cellSens data storage software.
[0317] g.1. Visualization of Melanin Melanin was visualized after silver impregnation of formalin-fixed paraffin-embedded (FFPE) skin sections according to Masson's Fontana staining method. Staining was evaluated by microscopic observation and image analysis of specific batches. Target batches: T0 (TUV, P1→P10) in D5 or D6 and D10.
[0318] g.2. Cell viability of excised tissue Cell viability of epidermal and dermal papillae was observed in formalin-fixed, paraffin-embedded (FFPE) skin sections after Masson's trichrome staining, Goldner modified. Cell viability was evaluated by microscopic observation. Target batches: T0 (TUV, P1→P10) at D5 or D6 and D10.
[0319] h. Image analysis methods Image analysis was performed on all images from each batch using Cell^D or cellSens software, following the method described below.
[0320] [Table 2]
[0321] For each batch of excised material, the percentage of the target area covered by staining (stained area percentage) is determined by image analysis according to the process described above.
[0322] Stained surface comparison: Compare the percentage of stained surface (Surf%) in each treatment with the untreated condition ⇒ P vs T. Perform the same comparison for treated or untreated induction batches ⇒ T vs TUV.
[0323] Statistical analysis: The Student t-test gives the probability "p" that two treatments / groups are significantly different. Since the difference between two treatments is significant at p < 0.1 (limit of significance), the probability that the two treatments / groups are significantly different is 90%, or 95% at p < 0.05 (*), or 99% at p < 0.01 (**).
[0324] Example 1: Synthesis of Organic Compounds Synthesis of 1-((1,3,3-trimethylbicyclo[2.2.1]heptan-2-yl)oxy)pentan-2-ol (5):
[0325] [ka]
[0326] To a stirred solution of 1,3,3-trimethylbicyclo[2.2.1]heptan-2-ol (500 mg, 3.24 mmol) in THF (25 mL), sodium hydride (93 mg, 3.89 mmol) and 2-propyloxirane (279 mg, 3.24 mmol) were added under an argon atmosphere at 0°C. The reaction mixture was heated under microwave at 110°C for 3 hours. The reaction was monitored by TLC; after consumption of the starting materials, the reaction mixture was diluted with water (20 mL) and extracted with ethyl acetate (2 x 20 mL). The combined organic extracts were dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The crude product was purified by combiflash chromatography eluting with 3-4% ethyl acetate / hexane to obtain title compound 5 (250 mg, 32%) as a colorless oil. 1 H NMR (400 MHz, CDCl3): δ 3.82-3.73 (m, 2H), 3.55-3.50 (m, 1H), 3.42-3.30 (m, 2H), 3.23-3.19 (m, 1H), 2.90-2.85 (m, 2H), 2.22-2.19 (m, 2H), 1.73-1.60 (m, 6H), 1.55-1.38 (m, 11H), 1.12-1.09 (m, 7H), 1.08-1.00 (m, 7H), 0.99-0.90 (m, 12H)
[0327] Synthesis of 1-((1,3,3-trimethylbicyclo[2.2.1]heptan-2-yl)oxy)pentan-2-one (6): To a stirred solution of 1-((1,3,3-trimethylbicyclo[2.2.1]heptan-2-yl)oxy)pentan-2-ol (100 mg, 0.41 mmol) in CH2Cl2 (10 mL), Dess martin periodinane (176 mg, 0.41 mmol) was added at 0°C. The reaction mixture was stirred at RT for 2 hours. The reaction was monitored by TLC; after consumption of the starting materials, the reaction mixture was diluted with saturated sodium bicarbonate solution (20 mL) and extracted with CH2Cl2 (3 x 20 mL). The combined organic extracts were dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The crude product was purified by combiflash chromatography eluting with 5% ethyl acetate / hexane to obtain title compound 6 (30 mg, 30%) as a colorless oil. 1 H NMR (400 MHz, CDCl3): δ 4.11-3.97 (m, 1H), 3.97-3.87 (m, 1H), 2.92 (d, J = 1.7 Hz, 1H), 2.54 (t, J = 7.3 Hz, 2H), 1.85-1.67 (m, 2H), 1.65-1.59 (m, 2H), 1.55 (s, 2H), 1.48-1.36 (m, 1H), 1.14 (s, 3H), 1.12-1.08 (m, 1H), 1.05-1.02 (m, 4H), 0.97-0.90 (m, 6H)
[0328] Synthesis of 1-((1,3,3-trimethylbicyclo[2.2.1]heptan-2-yl)oxy)butan-2-ol (7):
[0329] [ka]
[0330] To a stirred solution of 1,3,3-trimethylbicyclo[2.2.1]heptan-2-ol (100 mg, 0.65 mmol) in THF (5 mL), sodium hydride (15 mg, 0.65 mmol) and 2-ethyloxirane (48 mg, 0.65 mmol) were added under an argon atmosphere by RT. The reaction mixture was heated under microwave at 120°C for 30 minutes. The reaction mixture was monitored by TLC; after consumption of the starting materials, the reaction mixture was diluted with water (20 mL) and extracted with ethyl acetate (2 x 20 mL). The combined organic extract was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The crude substance was purified by combiflash chromatography eluting with 3-4% ethyl acetate / hexane to obtain the title compound 7 (50 mg, 34%) as a colorless oil. 1 H NMR (400 MHz, CDCl3): δ 3.73-3.59 (m, 2H), 3.56-3.53 (m, 1H), 3.44-3.34 (m, 2H), 3.27-3.17 (m, 1H), 2.91-2.89 (m, 2H), 2.43-2.40 (m, 2H), 1.79-1.61 (m, 6.67H), 1.54-1.23 (m, 11.95H), 1.13-1.07 (m, 8.99H), 1.05-1.00 (m, 7.31H), 0.99-0.94 (m, 8.29H), 0.91-0.84 (m, 12H)
[0331] Synthesis of 1-((2,2,6-trimethylcyclohexyl)oxy)pentan-2-ol (14):
[0332] [ka]
[0333] To a stirred solution of 2,2,6-trimethylcyclohexane-1-ol (200 mg, 1.40 mmol) in THF (10 mL), sodium hydride (33 mg, 1.40 mmol) was added at 0°C and the mixture was stirred for 2 hours. Next, DMPU (23 mg, 1.40 mmol) and 2-propyloxirane (121 mg, 1.40 mmol) were added to the reaction mixture at 0°C. The reaction mixture was heated at 80°C for 12 hours. The reaction was monitored by TLC; after consumption of the starting materials, the reaction mixture was diluted with water (20 mL) and extracted with ethyl acetate (2 x 20 mL). The combined organic extracts were dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The crude material was purified by combiflash chromatography eluting with 3-4% ethyl acetate / hexane to obtain the title compound 14 (60 mg, 8%) as a colorless liquid diastereomer mixture. 1 H NMR (400 MHz, CDCl3): δ 3.84-3.73 (m, 1H), 3.61-3.50 (m, 1H), 3.49-3.37 (m, 1H), 2.50-2.41 (m, 2H), 1.72-1.58 (m, 2H), 1.54-1.31 (m, 7H), 1.01-0.86 (m, 14H)
[0334] Synthesis of 1-((2,2,6-trimethylcyclohexane)oxy)butan-2-ol (15):
[0335] [ka]
[0336] To a stirred solution of 2,2,6-trimethylcyclohexane-1-ol (200 mg, 1.40 mmol) in THF (10 mL), sodium hydride (33 mg, 1.40 mmol) was added at 0°C and the mixture was stirred for 2 hours. Next, DMPU (23 mg, 1.40 mmol) and 2-ethyloxirane (101 mg, 1.40 mmol) were added to the reaction mixture at 0°C. The reaction mixture was heated at 80°C for 12 hours. The reaction was monitored by TLC; after consumption of the starting materials, the reaction mixture was diluted with water (20 mL) and extracted with ethyl acetate (2 x 20 mL). The combined organic extracts were dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The crude material was purified by combiflash chromatography eluting with 3-4% ethyl acetate / hexane to obtain the title compound 15 (50 mg, 7%) as a colorless oily mixture of diastereomers. 1 H NMR (400 MHz, CDCl3): δ 3.75-3.66 (m, 1H), 3.62-3.51 (m, 1H), 3.50-3.39 (m, 1H), 2.48 (d, J = 10.1 Hz, 1H), 2.43 (dd, J = 3.2, 1.0 Hz, 1H), 1.71-1.31 (m, 8H), 1.27-1.13 (m, 1H), 1.00-0.93 (m, 12H)
[0337] Example 2: Dose-response analysis of organic compound-OR interactions Most of the test compounds were purchased from the suppliers listed in Table 1 below. Compounds 5, 6, 7, 14, and 17 were prepared as described in Example 1.
[0338] [Table 3-1]
[0339] [Table 3-2]
[0340] [Table 3-3]
[0341] [Table 3-4]
[0342] [Table 3-5]
[0343] [Table 3-6]
[0344] [Table 3-7]
[0345] Dose-response analyses using luciferase-based reporter assays were performed against OR7C1 using semi-logarithmic serial dilutions of compounds from 1 mM to 316 nM. 46 compounds were tested in concentration-response analyses. An empty vector (pEFIBRHO) was used as a negative control in each experiment. The calculated log EC was calculated. 50 All results, including those shown, are presented in Table 2. The values are EC 50 This was expressed in moles as the negative logarithm of the result.
[0346] [Table 4-1]
[0347] [Table 4-2]
[0348] [Table 4-3]
[0349] The results shown in Table 2 indicate that the test compounds belonging to formulas I, II, III, and IV were able to activate OR7C1 in a luciferase-based reporter assay. This receptor responded with an average log EC50 close to 4.85 for structure (I), 5.045 and 5.06 for compounds belonging to formulas (II) and (III), and 4.78 for compounds belonging to formula (IV). Furthermore, Table 2 shows that the tested compounds specifically activate the olfactory receptor OR7C1.
[0350] These results indicate that compounds belonging to formulas I, II, III, and IV are involved in the increase of cAMP in cells expressing OR7C1 and constitute valuable candidates for activating ectopic OR7C1. Therefore, treatment of OR7C1-expressing cells with the compounds used in this invention will induce an increase in cAMP levels in these cells.
[0351] Example 3: OR7C1 is ectopically expressed in primary cultures of melanocytes. Using publicly available databases (https: / / www.ebi.ac.uk / gxa / home; https: / / www.proteinatlas.org / ), the inventors discovered that melanocytes express the target olfactory receptor, namely OR7C1, thereby demonstrating the endogenous expression of this receptor outside the olfactory epithelium.
[0352] This was confirmed by PCR. OR7C1 expression levels: Moderately pigmented primary neonatal foreskins melanocytes (NHEMs-MP) were grown as previously described herein. After total mRNA extraction and cDNA synthesis (RT), PCR experiments were performed using specific primers for OR7C1 detection / amplification. As observed in Figure 4A, the PCR product of OR7C1 cDNA was detected in the RT+ sample (corresponding to a sample in which NHEMs-MP mRNA was reverse transcribed into cDNA). The RT- sample (a sample without the cDNA synthesis step) showed no amplification of the target gene and was used as a negative control, as well as water. The CTL+ lane corresponds to amplification obtained after PCR using a plasmid containing the OR7C1 cDNA sequence (positive control). The observed data showed that melanocytes ectopically expressed the olfactory receptor OR7C1, as described in different databases, using three different primer couples (Figure 4A). Therefore, melanocytes can be used as a cell model to test the effects of the compounds described in the embodiments of the present invention on melanin production, a pathway sensitive to fluctuations in cAMP levels present in these cells.
[0353] An MTS assay (3-(4,5-dimethythiazol)-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) was performed to determine the maximum concentration of the compound that could be used in NHEMs-MP culture medium without affecting cell viability. The assay was performed as described herein. Different test concentrations were based on EC50 (in moles) obtained by a luciferase-based reporter assay (Table 2). Four days after contact, MTS assays were performed on cells treated with the test compound (5 concentrations) or with a reference for cytotoxicity; the experiment was performed three times (n=3). The results are shown in Figure 4B. Cell viability was analyzed, and toxicity / viability was expressed as a percentage relative to ethanol treatment conditions fixed at 100%. The cytotoxicity threshold was conventionally set at 80% of viability. As shown in Figure 4B, Georgy Wood did not exhibit significant cytotoxicity regardless of the concentration tested. Four days after treatment, a decrease in survival rate was observed at concentrations of 10 μM or higher.
[0354] These results indicate that OR7C1 is expressed in cells outside the olfactory epithelium. This receptor is present in melanocytes where melanin production occurs. The compounds described in the embodiments of the present invention exhibit good tolerance and can be used to modulate cAMP in these cells.
[0355] Example 4: Effect of the formulation on melanin production in human melanocytes The effect of the compounds described in the embodiments of the present invention (amber ketal and ambermax) on melanin production was tested by treating normal human epidermal melanocytes (NHEMs-MP) with the compounds.
[0356] The effects of these two compounds, Ambermax and Amberketal, on melanin production were evaluated as described above. Based on the MTS results, moderately pigmented (MP)NHEMs were treated with these two compounds at one concentration (100 μM for Amberketal and 3.16 μM for Ambermax) for 4 days. In parallel, cell cultures were treated with 0.1% ethanol at a concentration equivalent to the solvent for the test compounds and a known pigment modifier (L-DOPA 50 μM). Microscopic analysis showed that melanin accumulated in the cytoplasm of cells under the treated conditions (not shown). At the end of treatment (D4), cells were lysed, and melanin content was quantified by spectrophotometric analysis and normalized to the amount of protein. Extracellular melanin was also evaluated in the same manner after centrifugation of the culture medium. As expected, L-DOPA slightly increased the melanin content of NHEMs after 4 days of treatment. The experimental results are shown in Figures 5A and 5B. The tested compounds, amber ketal (100 μM) and ambermax (3.16 μM), significantly increased intracellular melanin content (+40%; p<0.01**; n=12 and +46%; p<0.01**; n=12, respectively), and also significantly increased the amount of melanin present in the culture medium compared to DOPA (50 μM) treatment (+99%; p<0.01**; n=10 and +123%; p<0.01** n=10, respectively) (Figures 5A and 5B. Results are expressed as relative values; DOPA value = 1).
[0357] In melanocytes, which endogenously express OR7C1, one of the major cAMP-dependent pathways is melanin production. This result indicates that treatment with the compounds described in the embodiments of the present invention was able to regulate melanin production.
[0358] Example 5: Macroscopic effect of the formulation on melanin production in human excised tissue. Ex vivo effects were demonstrated by treating human biopsies (human bioexcisions: 12 mm + / - 1, Caucasian donor, skin type III) for 10 days with the compound (Ambermax) described in embodiments of the present invention by systemic application, intradermal injection, or topical application. Concentrations of 1, 5, and 10 μM of this compound were used for systemic application and intradermal injection to human excisions. For topical application, biopsies were treated with 10, 30, and 100 μM Ambermax. For control, untreated excisions and / or excisions exposed to low UVA irradiation were used as described in the experimental procedure.
[0359] As shown in Figure 6B, at the start of the study (D0), the cell viability of the excised tissue was normal, with typical tissue of papillary dermal and epidermal structures. At days 5 (D5) and 10 (D10), treatment with Ambermax at three different concentrations and three different application methods demonstrated no significant change in excised tissue viability, except for the highest concentration (100 μM) local administration. At this concentration, macroscopic evaluation of the excised tissue showed a very slight decrease in epidermal viability (very slightly altered, VSA), but no changes were observed in the dermal papillae where melanin production occurs. Under all other conditions, the dermal and epidermal structures were similar to those of untreated excised tissue. Figure 6A shows representative photographs of excised tissue viability 5 days after local treatment. Under low UVA irradiation conditions, no changes in the epidermal compartment were observed (positive control, Figure 6B). Overall, these results indicate that the compounds described in the embodiments of the present invention have good tolerance and can be used to stimulate melanin production in ex vivo models such as skin biopsies. A summary of the macroscopic effect of Ambermax on excision survival is shown in Figure 6B.
[0360] The effects of the compounds described in the embodiments of the present invention on melanin production were measured at D0, D5, and D10 using Masson's Fontana staining of paraffin skin sections as described in the experimental procedure. After 5 days, systemic treatment with the test compounds (3 and 5 μM) induced an increase in melanin production comparable to that obtained with slow UVA irradiation. On day 10, 1 μM of Ambermax was shown to be the concentration that most efficiently stimulated melanin synthesis. Five days after intradermal injection, Ambermax was shown to induce a slightly weaker increase in melanin production than that obtained with slow UVA. This activity was observed at concentrations of 1 μM and 10 μM. After 10 days of intradermal injection, the most effective concentration was 1 μM, slightly more effective than the concentrations of 5 μM and 10 μM. Topical administration of Ambermax for 5 days induced an increase in melanin production comparable to that obtained with slow UVA irradiation (Figures 6C, 6D). This activity was observed at a concentration of 10 μM. After 10 days of local treatment, concentrations of 10 μM, 30 μM, and 100 μM induced moderate melanin production, slightly lower than that obtained with mild UVA (Figure 6D). A summary of the macroscopic effects of the compounds of the present invention on melanin production is shown in Figure 6E.
[0361] Further experiments were conducted with a second batch of human skin excisions obtained from abdominoplasty in Caucasian women (photographic type II). The results are shown in Figures 6F, 6G, and 6H. Ambermax was found to induce an increase in melanin content in the basal layer of the skin excisions. Figure 6F shows representative photographs of skin treated with Ambermax 0.3 μM, 1 μM, 10 μM, and 30 μM at D6. The melanin-positive surface percentage in the basal layer of the epidermis at different concentrations was quantified using the image analysis procedure described herein. At D6, in the untreated excision (T), melanin content accounted for 4.6% of the surface of the basal layer of the epidermis (Figure 6G). UVA irradiation exposure (TUVJ6) induced a significant increase of 94% (**; p<0.01) in basal layer melanin content compared to the untreated excision (TJ6). After quantification, Ambermax was confirmed to induce an increase in melanin content at the microscopic level at 10 μM and 15 μM concentrations (Figure 6F). Image analysis showed significant increases of 152% and 160%, respectively (**, p<0.01, Figure 6H). A summary of the macroscopic effects of Ambermax (D6 and D10) on melanin production and the results of the image analysis is shown in Figure 6H.
[0362] Ex vivo experiments (on live human skin excisions) using Ambermax at different concentrations (0.3–100 μM) and three different application methods demonstrated that the compound exhibits good tolerance and does not induce excision toxicity. After applying 100 μM to D10, only a slight change was observed, which did not affect either product activity or melanin synthesis. Such changes would likely not be observed in an in vivo model. Furthermore, semi-quantification by microscopic observation and image analysis of melanin staining in FFPE skin sections demonstrated that Ambermax is highly effective in promoting melanin production without exposure to UV.
Claims
1. The use of compounds of formula (IIb), (IIa), (IIIa), (IV), (Ie), (If), (Ig), (Ic), or (Id), their racemates, their stereoisomers, their tautomers, their salts and / or solvates (including mixtures thereof) as self-tanning substances, 【Chemistry 1】 (In the formula, dashes are used for concatenation) 【Chemistry 2】 However, it represents any double bond; and 【Transformation 3】 However, this represents any single bond; R 28 However, hydrogen, oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alki Le, -[CR 17 R 18 m -O-C 1-6 Alkyl, -[CR 17 R 18 m -COH, and -[CR 17 R 18 m Selected from the group consisting of -OH The following is selected; m is an integer selected from 1, 2, 3, 4, or 5. R 17 , R 18 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; R 29 is hydrogen or C 1-6 It is alkyl; or R 29 and R 28 However, together they form the equation -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (May be substituted with alkyl substituents) and p is an integer selected from 1 or 2; R 20 However, hydrogen or C 1-6 It is alkyl; R 21 However, hydrogen or C 1-6 It is alkyl; R 22 However, hydrogen, C 1-6 Alkyl and -CO-R 19 Selected from the group including; R 23 However, hydrogen or C 1-6 It is alkyl; R 24 However, hydrogen or C 1-6 It is alkyl; or R 23 and R 24 However, along with the carbon atoms to which they are bonded, there are 3- to 6-membered heterocyclyl portions (wherein the formula, the heterocyclyl is C 1-6 (May be substituted with one or more substituents independently selected from the alkyl group); R 25 However, hydrogen or C 1-6 It is alkyl; or R 24 and R 25 However, along with the carbon atoms to which they are bonded, there is a 5-membered or 6-membered heterocycline portion (the heterocycline is C 1-6 It may be substituted with one or more substituents independently selected from the alkyl group, or one of the substituents and R 23 They combine (Together with the atoms, it forms a 3- to 6-membered heterocycline portion); R 27 However, if present, hydrogen or C 1-6 It is alkyl; or R 20 and R 27 However, together with the carbon atoms to which they are bonded, they form a C3-membered ring; R 40 However, -[CR 17 R 18 ] m -OH, -CO-C 1-6 Alkyl, -O-([CR 17 R 18 ] m -O-) t -C 1-6 Selected from the group including alkyl groups, where t is an integer selected from 0, 1, 2, or 3; R 42 , R 43 , R 44 , R 45 , R 46 , R 47 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; or R 40 and R 42 However, together with the carbon atoms to which they are bonded, they form a 3- to 6-membered heterocycline moiety; R 50 However, it is selected from either OH or oxo; R 51 However, hydrogen or C 1-4 It is alkyl; R 1 , R 2 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; R 3 , R 4 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; or R 3 Together with R 1 However, along with the carbon atoms to which they are bonded, they form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 5 is -X-[CR 13 R 14 n -CR 15 R 16 -[CR 17 R 18 m -R 19 、-X-[CR 13 R 14 n -[CR 17 R 18 m -OH, -X-[CR 13 R 14 n -O-[CR 17 R 18 m -OH, -([CR 17 R 18 m -O) y -C 1-6 alkyl, -[CR 13 R 14 n -CO-R 19 including Selected from the group; m is an integer selected from 1, 2, 3, 4, or 5; n is an integer selected from 0, 1, 2, 3, or 4; y is an integer selected from 1, 2, or 3; X is either a single bond or an O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; or R 3 and R 5 However, together they form the equation -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (May be substituted with alkyl substituents) and p is an integer selected from 1 or 2; R 6 However, hydrogen or C 1-6 It is alkyl; or R 5 and R 6 But together = [CR 14 ]-[CR 17 R 18 ] m -Forms OH; or R 5 and R 6 However, along with the carbon atoms to which they are bonded, there are 5-membered or 6-membered heterocyclyl portions (the heterocyclyl is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 7 However, hydrogen or C 1-6 It is alkyl; R 8 However, hydrogen or C 1-6 It is alkyl; or R 5 and R 8 However, together with the carbon atoms to which they are bonded, they form saturated or unsaturated C5 or C6 membered rings (the aforementioned rings are oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 17 R 18 ] m -COH, or -[CR 17 R 18 ] m -OH may be substituted with one or more substituents independently selected from each; or the two substituents on the ring may, together with the carbon atom to which they are bonded, form a 3- to 6-membered heterocyclyl moiety (the heterocyclyl moiety is C 1-6 The alkyl group may be substituted with one or more substituents independently selected from each alkyl group, or the two substituents on the heterocycline may, together with the atom to which they are bonded, form a 3- to 6-membered heterocycline moiety; R 9 , R 10 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; or R 6 and R 9 However, together with the carbon atoms to which they are bonded, they form a C3-membered ring; or R 9 Together with R 1 However, together with the carbon atoms to which they are bonded, they form a saturated C5-membered ring (the ring is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); or R 9 Together with R 3 However, together with the carbon atoms to which they are bonded, they form a saturated C5-membered ring (the ring is composed of one or more C 1-6 (May be substituted with alkyl substituents)
2. Compounds of formula (Ih), or their racemic mixtures, stereoisomers thereof, tautomers thereof, salts thereof and / or solvates thereof (including mixtures thereof); 【Chemistry 4】 (In the formula, R 5 However, -O-CHR 14 -C(=O)-[CR 17 R 18 ] m -R 19 ,-O-CHR 14 -CH(OH)-[CR 17 R 18 ] m -R 19 From the group including Selected; m is an integer selected from 1, 2, or 3; R 14 , R 17 , R 18 , R 19 Each is independently either hydrogen or C 1-6 (Selected from alkyl groups).
3. Use of the compound of formula (Ih) described in claim 2 as a substance for self-tanning.
4. The use of a compound of formula (IIb), (IIa), (IIIa), (IV), (Ie), (If), (Ig), (Ic), or (Id), or a racemate thereof, its stereoisomer, its tautomer, its salt, and / or its solvate (including mixtures thereof), or the use of a compound of formula (Ih) according to claim 2, for the purpose of increasing the amount of melanin in melanocytes, increasing melanin synthesis, improving melanin transport, and / or improving the melanin distribution in the basal upper layer; 【Transformation 5】 (In the formula, dashes are used for concatenation) 【Transformation 6】 However, it represents any double bond; and 【Transformation 7】 However, this represents any single bond; R 28 However, hydrogen, oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -OC 1-6 Alkyl, -[CR 17 R 18 ] m -COH, and -[CR 17 R 18 ] m - Selected from the group containing OH; m is an integer selected from 1, 2, 3, 4, or 5. R 17 , R 18 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; R 29 However, hydrogen or C 1-6 It is alkyl; or R 29 and R 28 However, together they form the equation -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (May be substituted with alkyl substituents) and p is an integer selected from 1 or 2; R 20 However, hydrogen or C 1-6 It is alkyl; R 21 However, hydrogen or C 1-6 It is alkyl; R 22 However, hydrogen, C 1-6 Alkyl and -CO-R 19 Selected from the group including; R 23 However, hydrogen or C 1-6 It is alkyl; R 24 However, hydrogen or C 1-6 It is alkyl; or R 23 and R 24 However, along with the carbon atoms to which they are bonded, there are 3- to 6-membered heterocyclyl portions (the heterocyclyl is C 1-6 (May be substituted with one or more substituents independently selected from the alkyl group); R 25 However, hydrogen or C 1-6 It is alkyl; or R 24 and R 25 However, along with the carbon atoms to which they are bonded, there is a 5-membered or 6-membered heterocycline portion (the heterocycline is C 1-6 It may be substituted with one or more substituents independently selected from alkyl, or one of the substituents and R 23 They form a 3- to 6-membered heterocycline moiety together with the atoms to which they are bonded; R 27 However, if present, hydrogen or C 1-6 It is alkyl; or R 20 and R 27 However, together with the carbon atoms to which they are bonded, they form a C3-membered ring; R 40 However, -[CR 17 R 18 ] m -OH, -CO-C 1-6 Alkyl, -O-([CR 17 R 18 ] m -O-) t -C 1-6 Selected from the group including alkyl groups, where t is an integer selected from 0, 1, 2, or 3; R 42 , R 43 , R 44 , R 45 , R 46 , R 47 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; or R 40 and R 42 However, together with the carbon atoms to which they are bonded, they form a 3- to 6-membered heterocycline moiety; R 50 However, it is selected from either OH or oxo; R 51 However, hydrogen or C 1-4 It is alkyl; R 1 , R 2 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; R 3 , R 4 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; or R 3 Together with R 1 However, along with the carbon atoms to which they are bonded, they form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 5 However, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -X-[CR 13 R 14 ] n -O-[CR 17 R 18 ] m -OH,-([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 13 R 14 ] n -CO-R 19 including Selected from the group; m is an integer selected from 1, 2, 3, 4, or 5; n is an integer selected from 0, 1, 2, 3, or 4; y is an integer selected from 1, 2, or 3; X is either a single bond or an O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; or R 3 and R 5 However, together they form the equation -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (May be substituted with alkyl substituents) and p is an integer selected from 1 or 2; R 6 However, hydrogen or C 1-6 It is alkyl; R 7 However, hydrogen or C 1-6 It is alkyl; R 8 However, hydrogen or C 1-6 It is alkyl; or R 5 and R 6 But together = [CR 14 ]-[CR 17 R 18 ] m -Forms OH; or R 5 and R 6 However, along with the carbon atoms to which they are bonded, there are 5-membered or 6-membered heterocyclyl portions (the heterocyclyl is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); or R 5 and R 8 However, together with the carbon atoms to which they are bonded, they form saturated or unsaturated C5 or C6 membered rings (the aforementioned rings are oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -([CR 17 R 18 ] m -O) y -C 1-6 Alkyl, -[CR 17 R 18 ] m -COH, or -[CR 17 R 18 ] m -OH may be substituted with one or more substituents independently selected from each; or the two substituents on the ring may, together with the carbon atom to which they are bonded, form a 3- to 6-membered heterocyclyl moiety (the heterocyclyl moiety is C 1-6 Each alkyl group is independent The substituents may be substituted with one or more substituents selected by the same means, or the two substituents on the heterocycline may, together with the atom to which they are bonded, form a 3- to 6-membered heterocycline moiety; R 9 , R 10 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; or R 6 and R 9 However, together with the carbon atoms to which they are bonded, they form a C3-membered ring; or R 9 Together with R 1 However, together with the carbon atoms to which they are bonded, they form a saturated C5-membered ring (the ring is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); or R 9 Together with R 3 However, together with the carbon atoms to which they are bonded, they form a saturated C5-membered ring (the ring is composed of one or more C 1-6 (May be substituted with alkyl substituents)
5. Use of the compound according to claim 2, or use according to any one of claims 1 or 3, for the purpose of darkening the skin.
6. Use of the compound according to claim 2 for sunless tanning, or use according to any one of claims 1, 3.
7. The compound is given by formula (Ie): 【Transformation 8】 (In the formula, R 3 , R 4 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; R 5 However, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5, and n is an integer selected from 0, 1, 2, 3, or 4; X is either a single bond or an O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 and R 8 However, hydrogen or C 1-6 The use according to any one of claims 1, 3, 5 to 6, wherein the material is alkyl.
8. The compound is given by formula (If): 【Chemistry 9】 (In the formula, R 5 However, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5, and n is an integer selected from 0, 1, 2, 3, or 4; X is either a single bond or an O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 and R 6 However, hydrogen or C 1-6 It is alkyl; or R 5 and R 6 Together = [CR 14 ]-[CR 17 R 18 ] m The use according to any one of claims 1, 3, 5 to 6, which is a product that forms an -OH group.
9. The compound is given by formula (Ig): 【Chemistry 10】 (In the formula, R 5 However, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5, and n is an integer selected from 0, 1, 2, 3, or 4; X is either a single bond or an O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; R 6 However, hydrogen or C 1-6 It is alkyl; or R 5 and R 6 But together = [CR 14 ]-[CR 17 R 18 ] m -Forms OH; or R 5 and R 6 However, along with the carbon atoms to which they are bonded, there are 5-membered or 6-membered heterocyclyl portions (the heterocyclyl is composed of one or more C 1-6 The use according to any one of claims 1, 3, 5 to 6, which is to form (which may be substituted with alkyl substituents).
10. The compound is given by formula (IIb): 【Chemistry 11】 (In the formula, dashes are used for concatenation) 【Chemistry 12】 However, it represents any double bond; and 【Chemistry 13】 However, this represents any single bond; R 28 However, hydrogen, oxo, C 1-6 Alkyl, -OC 1-6 Alkyl, -[CR 17 R 18 ] m -O-CO-C 1-6 Alkyl, -[CR 17 R 18 ] m -OC 1-6 Alkyl, -[CR 17 R 18 ] m -COH and -[CR 17 R 18 ] m Selected from the group containing -OH; R 29 However, hydrogen or C 1-6 It is alkyl; or R 29 and R 28 However, together they form the equation -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 17 , R 18 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; The use according to any one of claims 1, 3, 5 to 6, wherein m is an integer selected from 1, 2, 3, 4, or 5; and p is an integer selected from 1 or 2.
11. The compound is given by formula (IIa): 【Chemistry 14】 (In the formula, dashes are used for concatenation) 【Chemistry 15】 However, it represents any double bond; and R 20 However, hydrogen or C 1-6 It is alkyl; R 21 However, hydrogen or C 1-6 It is alkyl; R 22 However, hydrogen, C 1-6 Alkyl and -CO-R 19 Selected from the group including; R 23 However, hydrogen or C 1-6 It is alkyl; R 24 However, hydrogen or C 1-6 It is alkyl; or R 23 and R 24 However, along with the carbon atoms to which they are bonded, there is a three-membered heterocycline portion (the heterocycline is C 1-6 (May be substituted with one or more substituents independently selected from the alkyl group); R 25 However, hydrogen or C 1-6 It is alkyl; or R 24 and R 25 However, along with the carbon atoms to which they are bonded, there is a 5-membered or 6-membered heterocycline portion (the heterocycline is C 1-6 It may be substituted with one or more substituents independently selected from alkyl, or one of the substituents and R 23 However, they form a 5- to 6-membered heterocycline moiety together with the atoms to which they are bonded; R 27 However, if present, hydrogen or C 1-6 (It is alkyl.) The use according to any one of claims 1, 3, 5 to 6.
12. The compound is given by formula (Ic): 【Chemistry 16】 (In the formula, R 1 , R 2 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; R 3 , R 4 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; R 5 However, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5, and n is an integer selected from 0, 1, 2, 3, or 4; X is either a single bond or an O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; or R 3 and R 5 These two combine into the formula -O-[CR 17 R 18 ] p They are -O- and, together with the carbon atoms to which they are bonded, a 5-membered or 6-membered heterocyclyl moiety (the heterocyclyl is one or more C 1-6 (May be substituted with alkyl substituents) and p is an integer selected from 1 or 2; R 6 However, hydrogen or C 1-6 It is alkyl; R 9 , R 10 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; or R 9 Together with R 1 However, together with the carbon atoms to which they are bonded, they form a saturated C5-membered ring (the ring is composed of one or more C 1-6 The use according to any one of claims 1, 3, 5 to 6, which is to form (which may be substituted with alkyl substituents).
13. The compound is given by formula (Id): 【Chemistry 17】 (In the formula, R 1 , R 2 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; R 3 , R 4 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; or R 3 Together with R 1 However, along with the carbon atoms to which they are bonded, they form saturated C3 to C5 membered rings (the rings consist of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 5 However, -X-[CR 13 R 14 ] n -CR 15 R 16 -[CR 17 R 18 ] m -R 19 , -X-[CR 13 R 14 ] n -[CR 17 R 18 ] m -OH, -CO-R 19 Selected from the group including; m is an integer selected from 1, 2, 3, 4, or 5, and n is an integer selected from 0, 1, 2, 3, or 4; X is either a single bond or an O. R 13 , R 14 , R 16 , R 17 , R 18 , R 19 However, each is independently hydrogen or C 1-6 Selected from alkyl groups; R 15 is OH, or R 16 Together with R 15 It forms an oxo group; R 6 However, hydrogen or C 1-6 It is alkyl; or R 5 and R 6 together = [CR 14 ]-[CR 17 R 18 ] m -Forms OH; or R 5 and R 6 However, along with the carbon atoms to which they are bonded, there are 5-membered or 6-membered heterocyclyl portions (the heterocyclyl is composed of one or more C 1-6 Forms (which may be substituted with alkyl substituents); R 7 However, hydrogen or C 1-6 The use according to any one of claims 1, 3, 5 to 6, wherein the material is alkyl.
14. The compound is given by formula (IVa): [Chemistry 18] (In the formula, dashes are used for concatenation) 【Chemistry 19】 However, this represents any double bond; and R 50 However, any of claims 1, 3, 5-6 is a (selected from OH or oxo) Use as described in item 1.
15. The aforementioned compound, 【Chemistry 20-1】 【Chemistry 20-2】 A use according to any one of claims 1, 3, 5 to 6, selected from the group including the above.
16. The use according to any one of claims 1, 3, 5 to 6, wherein the compound is amberketal or ambermax.
17. The use according to any one of claims 1, 3, 5 to 6, wherein the use is in a cosmetic composition.
18. The use according to claim 17, wherein the composition is a sunless tanning composition, a moisturizing composition, or a hair care composition.
19. A method for self-tanning, comprising the step of applying a self-tanning substance selected from the group comprising a compound defined in any one of claims 1 to 3, 5 to 16, or a racemate thereof, a stereoisomer thereof, a tautomer thereof, a salt thereof, and / or a solvate thereof (including mixtures thereof) to a desired skin surface.
20. A method for blackening skin, comprising the step of applying a compound defined in any one of claims 1 to 3, 5 to 16, or a racemate thereof, a stereoisomer thereof, a tautomer thereof, a salt thereof, and / or a solvate thereof (including mixtures thereof) to a desired skin surface.
21. The aforementioned compound, 【Chemistry 21】 The use described in any one of claims 1, 3, 5 to 6.