Anticoronavirus drugs

Abstract

The present invention addresses the problem of providing an anti-coronavirus agent, particularly an anti-coronavirus agent against SARS-CoV-2. The problem is solved by an anti-coronavirus agent containing at least one selected from the group consisting of tea extracts, catechin compounds, and theaflavin compounds.

Description

[Technical Field]

[0001] This invention relates to anticoronavirus agents, etc. [Background technology]

[0002] Coronaviruses are a species of virus belonging to the Coronavirinae subfamily of the Coronaviridae family. They are positive-strand RNA viruses that infect humans and animals, causing respiratory, digestive, vascular, or neurological diseases. Coronaviruses can be transmitted from an infected host animal and cause large-scale epidemics in humans. Recent examples of coronaviruses include SARS-CoV-1, which caused outbreaks in 2002 and 2003, and Middle East Respiratory Syndrome Coronavirus (MERS-CoV). More recently, a global pandemic of SARS-CoV-2 has occurred, and because no treatment technology has been established, it continues to cause immense damage in various fields, including healthcare and the economy. [Overview of the project] [Problems that the invention aims to solve]

[0003] The object of this invention is to provide an anticoronavirus agent, particularly an anticoronavirus agent against SARS-CoV-2. [Means for solving the problem]

[0004] In view of the above problems, the inventors diligently conducted research and found that an anticoronavirus agent containing at least one selected from the group consisting of tea extract, catechin compounds, and theaflavin compounds can solve the above problems. Based on this finding, the inventors furthered their research and completed the present invention. That is, the present invention encompasses the following aspects.

[0005] Item 1. An anticoronavirus agent containing at least one selected from the group consisting of tea extract, catechin compounds, and theaflavin compounds.

[0006] Item 2. The coronavirus agent described in Item 1, wherein the coronavirus is SARS-CoV-2.

[0007] Item 3. The anticoronavirus agent according to item 1 or 2, wherein the tea extract is tea or a concentrate thereof.

[0008] Item 4. The anticoronavirus agent according to any one of items 1 to 3, wherein the tea extract is at least one extract selected from the group consisting of matcha tea leaves, sencha tea leaves, hojicha tea leaves, new tea leaves, black tea leaves, pu-erh tea leaves, and oolong tea leaves.

[0009] Item 5. The anticoronavirus agent according to any one of items 1 to 4, wherein the tea extract is at least one extract selected from the group consisting of matcha tea leaves, hojicha tea leaves, and black tea leaves.

[0010] Item 6. An anticoronavirus agent according to any one of items 1 to 5, comprising epigallocatechin gallate as the catechin compound.

[0011] Item 7. An anticoronavirus agent as described in any of items 1 to 6, used for application to a living organism.

[0012] Item 8. An anticoronavirus agent as described in Item 7, which is a pharmaceutical, cosmetic, food composition, food additive, disinfectant, or cleaning agent.

[0013] Item 9. An anticoronavirus agent as described in item 7 or 8, which is used for the prevention or treatment of COVID-19.

[0014] Item 10. An anticoronavirus agent as described in any of items 1 to 6, used for application to an article.

[0015] Item 11. An anticoronavirus agent as described in Item 10, which is a disinfectant or cleaning agent. [Effects of the Invention]

[0016] According to the present invention, an anti-coronavirus agent, particularly an anti-coronavirus agent against SARS-CoV-2, can be provided.

Brief Description of the Drawings

[0017] [Figure 1] The results of Test Example 4 are shown. The vertical axis represents the CPE inhibition rate. The abbreviations on the horizontal axis are as follows. EC: (-)-epicatechin, ECg: (-)-epicatechin gallate, EGC: (-)-epigallocatechin, EGCg: (-)-epigallocatechin gallate. [Figure 2] The results of Test Example 5 are shown. The vertical axis represents the CPE inhibition rate. [Figure 3] The results of Test Example 6 are shown. The vertical axis represents the cell death inhibition rate. The abbreviations on the horizontal axis are as follows. EC: (-)-epicatechin, ECG: (-)-epicatechin gallate, EGC: (-)-epigallocatechin, EGCG: (-)-epigallocatechin gallate. [Figure 4] The method (a) and results (b and c) of Test Example 7 are shown. [Figure 5] The method (A) and results (B and C) of Test Example 8 are shown. [Figure 6] The method (A) and results (B) of Test Example 9 are shown. [Figure 7] The method (A) and results (B) of Test Example 10 are shown. [Figure 8] The method (a) and results (b) of Test Example 11 are shown. [Figure 9] The results of Test Example 12 are shown.

Modes for Carrying Out the Invention

[0018] In this specification, with respect to the expressions "containing" and "comprising", the concepts of "containing", "comprising", "consisting essentially of", and "consisting only of" are included.

[0019] In one embodiment, the present invention relates to an anticoronavirus agent (which may be referred to herein as "the agent of the present invention") containing at least one selected from the group consisting of tea extract, catechin compounds, and theaflavin compounds. This will be described below.

[0020] 1. Active ingredients The active ingredient is at least one selected from the group consisting of tea extract, catechin compounds, and theaflavin compounds.

[0021] Tea extracts are not particularly limited, as long as they are obtained by extracting from tea plants.

[0022] Preferred tea plants include those of the genus Camellia, and particularly preferred is the tea plant (Camellia sinensis).

[0023] The part of the tea plant used for extraction is not particularly limited, and examples include leaves and branches. Among these, leaves are preferred.

[0024] The tea plants used for extraction may be unfermented, for example, by heat treatment after harvesting (e.g., steaming, stir-frying, roasting over a fire, sun-drying, etc.) to inactivate enzymes; or they may be partially fermented (partially fermented) by enzymes by weakening the intensity of enzyme inactivation or delaying its timing; or they may be completely fermented by enzymes by weakening the intensity of enzyme inactivation or not inactivating enzymes at all; or they may be fermented by adding microorganisms such as lactic acid bacteria.

[0025] Preferably, tea leaves are used as the tea plant for extraction. Examples of tea leaves include matcha leaves, sencha leaves, hojicha leaves, new tea leaves, black tea leaves, pu-erh tea leaves, and oolong tea leaves. In addition to these, other tea leaves include green tea leaves other than those mentioned above (e.g., gyokuro, bancha, genmaicha, etc.), white tea leaves, yellow tea leaves, black tea leaves, and flower tea leaves. Preferably, the tea leaves include matcha leaves, sencha leaves, hojicha leaves, new tea leaves, black tea leaves, pu-erh tea leaves, and oolong tea leaves, and more preferably, matcha leaves, sencha leaves, hojicha leaves, black tea leaves, and oolong tea leaves, and especially preferably, matcha leaves, hojicha leaves, and black tea leaves.

[0026] It is preferable to cut the tea plants used for extraction as needed. Furthermore, pre-treatments such as steaming, rough rolling, kneading, intermediate rolling, fine rolling, drying, and pressing may be performed as needed.

[0027] Tea plants may be used individually or in combination of two or more species.

[0028] The extraction solvent is not particularly limited. Examples of extraction solvents include water; lower monohydric alcohols such as methanol, ethanol, propanol, and butanol; liquid polyhydric alcohols such as glycerin, propylene glycol, and 1,3-butylene glycol; ketones such as acetone; ethers such as ethyl ether; esters such as methyl acetate, ethyl acetate, propyl acetate, and butyl acetate; and supercritical carbon dioxide. The extraction solvent may be used alone or in combination of two or more. Preferably, the extraction solvent is a solvent containing water (for example, containing 50% or more by mass, 70% or more by mass, 80% or more by mass, 90% or more by mass, or 95% or more by mass), and water is particularly preferred.

[0029] The temperature of the solvent during extraction is not particularly limited, but is, for example, 4 to 100°C, preferably 50 to 100°C, and more preferably 60 to 100°C. The temperature can also be set appropriately depending on the type of tea plant, etc.

[0030] The amount of extraction solvent used is not particularly limited, but for example, it is 1 to 2000 parts by mass, 5 to 1000 parts by mass, or 10 to 500 parts by mass per 1 part by mass of tea plant. The amount used can also be appropriately set depending on the type of tea plant, etc.

[0031] The extraction time varies depending on the extraction method, solvent, temperature, etc., and is not particularly limited. For example, the extraction time can range from 10 seconds to 1 hour, or from 30 seconds to 10 minutes. The extraction time can also be set appropriately depending on the type of tea plant used.

[0032] After extraction, the extraction residue can be removed as needed. The method of removal is not particularly limited, and one or more methods such as gravity flow, centrifugation, and filtration can be employed.

[0033] The properties of the tea extract are not particularly limited and may be, for example, liquid, slurry, paste, solid, or powder. The tea extract may be the extract itself, a concentrate of the extract (including dried products), or a mixture thereof.

[0034] The tea extract is preferably tea or a concentrate thereof. Tea is a beverage obtained by extracting tea plants with a solvent suitable for drinking (usually water), and is not particularly limited in this respect.

[0035] The tea extract may be a single type or a combination of two or more types.

[0036] The catechin compound is not particularly limited, as long as it is a derivative obtained by substituting multiple hydroxyl groups on a flavan-3-ol or an aromatic carboxylic acid (e.g., gallic acid) ester thereof. Examples of catechin compounds include free catechins such as catechin (C), epicatechin (EC), gallocatechin (GC), or epigallocatechin (EGC), or ester-type (gallate-type) catechins such as catechin gallate (CG), epicatechin gallate (ECG), gallocatechin gallate (GCG), or epigallocatechin gallate (EGCG). Epigallocatechin gallate is particularly preferred as a catechin compound from the viewpoint of antiviral activity (especially antiviral activity against SARS-CoV-2). The catechin compound may be a single compound or a combination of two or more. The catechin compound may be obtained from tea extracts or from plants other than tea or from food products. In that case, it may be obtained by adding some process such as concentration, and / or fractionation, and / or purification. Alternatively, the catechin compound may be synthesized and used.

[0037] The theaflavin compound is not particularly limited as long as it is theaflavin and its derivatives. Examples of theaflavin compounds include theaflavin, theaflavin-3-gallate (e.g., theaflavin-3-O-gallate, theaflavin-3'-O-gallate), theaflavin digallate (theaflavin-3-3'-di-O-gallate), and 3-isotheaflavin-3-gallate. From the viewpoint of antiviral activity (particularly antiviral activity against SARS-CoV-2), preferred theaflavin compounds include theaflavin-3-3'-di-O-gallate, theaflavin-3'-O-gallate, theaflavin-3-O-gallate, and more preferably theaflavin-3-3'-di-O-gallate, theaflavin-3'-O-gallate, and particularly preferably theaflavin-3-3'-di-O-gallate. The theaflavin compound may be a single compound or a combination of two or more compounds. The theaflavin compound may be obtained from tea extracts, or from other plants or foods. In that case, it may be obtained by processes such as concentration, fractionation, and / or purification. Furthermore, the theaflavin compound may be synthesized.

[0038] Among the active ingredients, tea extracts and catechin compounds are preferred, and tea extracts are particularly preferred.

[0039] The active ingredient may be a single ingredient or a combination of two or more ingredients.

[0040] 2.Applications The coronaviruses targeted by the agent of the present invention are not particularly limited, as long as they belong to the subfamily Orthocoronavirus. Examples of coronaviruses include the genera Alphacoronavirus, Betacoronavirus, Gammacoronavirus, and Deltacoronavirus, with Betacoronavirus being preferred among these. Examples of Betacoronavirus are SARS-related coronavirus (SARSr-CoV), coronavirus HKU1, and MERS coronavirus, with SARSr-CoV being preferred among these. Examples of SARSr-CoV are SARS-CoV-2 and SARS-CoV-1, with SARS-CoV-2 being preferred among these. The agent of the present invention can be used particularly suitably against SARS-CoV-2.

[0041] The agent of the present invention can exert antiviral activity against coronaviruses. Specifically, antiviral activities include suppression of viral infection, suppression of cell death caused by viruses, viral inactivation, suppression of viral proliferation, suppression of viral budding, and induction of viral resistance. Furthermore, due to these activities, it can also be used as a preventive or therapeutic agent for coronavirus infections (particularly COVID-19).

[0042] The agent of the present invention can be widely used in various fields requiring antiviral properties. For example, it can be used in various fields such as industry, cleaning, medicine, food, and daily necessities. The uses of the agent of the present invention can be mainly divided into applications applied to living organisms and applications applied to the articles described below.

[0043] 2-1. Applications for use in living organisms Applications in living organisms include, for example, pharmaceuticals, cosmetics, food compositions (including health foods, health enhancers, and nutritional supplements), food additives, disinfectants, and cleaning agents. The target organisms for application in this case are not particularly limited and include various mammals such as humans, monkeys, mice, rats, dogs, cats, rabbits, pigs, horses, cattle, sheep, goats, and deer.

[0044] By applying the agent of the present invention to a living organism, an antiviral effect can be exerted at the site of contact with the active ingredient.

[0045] The form of the agent of the present invention is not particularly limited and can take the form commonly used in each application, depending on the application of the agent of the present invention.

[0046] In terms of form, when the intended use is pharmaceutical, examples include injections, intravenous infusions, gargles, inhalants, transdermal patches (plasters, ointments, etc., tape-type patches (reservoir type, matrix type, etc.), poultices, patches, microneedles, etc.), ointments, topical solutions (liniments, lotions, etc.), sprays (topical aerosols, pump sprays, etc.), creams, gels, eye drops, eye ointments, nasal drops, suppositories, semi-solid rectal preparations, enema preparations, and other formulations suitable for parenteral administration; Examples of oral formulations include tablets (including orally disintegrating tablets, chewable tablets, effervescent tablets, lozenges, jelly drops, and sublingual tablets), pills, granules, fine granules, powders, hard capsules, soft capsules, dry syrups, liquids (including drinks, suspensions, and syrups), and jellies; as well as enteral nutrition formulas, nasogastric catheters, esophageal fistulas, and gastrostomy catheters.

[0047] In terms of form, when the intended use is as a cosmetic, examples include liquids, gels, creams, ointments, sprays, sticks, etc.

[0048] In terms of form, when used in food compositions, examples include liquid, gel, or solid foods such as juices, soft drinks, teas, soups, soy milk, salad oils, dressings, yogurts, jellies, puddings, furikake (rice seasonings), infant formula, cake mixes, dairy products (e.g., powders, liquids, gels, solids, etc.), bread, and confectionery (e.g., cookies, etc.). When used as food additives, health enhancers, or nutritional supplements, examples include tablets (including orally disintegrating tablets, chewable tablets, effervescent tablets, lozenges, and jelly drops), pills, granules, fine granules, powders, hard capsules, soft capsules, dry syrups, liquids (including suspensions and syrups), and jellies.

[0049] In terms of form, if the intended use is as a disinfectant or cleaning agent, it can take any form, such as liquid (solution, emulsion, suspension, spray, etc.), semi-solid (gel, cream, paste, etc.), or solid (tablet, particulate, capsule, film, compound, molten solid, waxy solid, elastic solid, etc.). For example, when applied to the oral cavity, more specifically, examples include toothpaste (paste, liquid toothpaste, powder toothpaste, etc.), mouthwash, topical agents, patches, mouth fresheners, and foods (e.g., chewing gum, tablets, candy, gummies, films, lozenges, etc.). When applied to the nasal cavity, more specifically, examples include nasal sprays. When applied to the skin, examples include soap, body wash, shampoo, conditioner, and sprays.

[0050] The agent of the present invention may further contain other components as needed. These other components are not particularly limited as long as they can be incorporated into pharmaceuticals, cosmetics, disinfectants, detergents, etc., but examples include bases, carriers, solvents, dispersants, emulsifiers, buffers, stabilizers, excipients, binders, disintegrants, lubricants, thickeners, humectants, colorants, fragrances, chelating agents, and the like.

[0051] The buffering agent is not particularly limited, and any suitable and acceptable one can be used depending on the application. Preferably, it is a phosphate buffer, an acetate buffer, or the like.

[0052] The content of the active ingredient in the agent of the present invention depends on the type of active ingredient, its use, the manner of use, the target of application, the condition of the target of application, etc., and is not limited thereto, but for example it can be 0.000001 to 100% by weight, preferably 0.01 to 50% by weight.

[0053] The amount of the agent of the present invention to be administered (e.g., by administration, ingestion, etc.) is not particularly limited as long as it is an effective amount that produces the desired effect, and is usually 0.1 to 1000 mg / kg body weight per day as the weight of the active ingredient. The above dosage is preferably administered once a day or divided into 2 to 3 doses, and can be increased or decreased as appropriate depending on age, condition, and symptoms.

[0054] 2-2. Applications of the product Examples of applications for this product include disinfectants and cleaning agents. In this case, there are no particular restrictions on the target of application; it can include industrial products and their raw materials used in various fields.

[0055] Specific examples of items include masks, face masks, and gloves. Other examples include endotracheal tubes, bite blocks, laryngoscopes, electrodes, measuring instruments, intravenous drip devices, oxygen masks, nasal catheters, tubes, catheters, white coats, gowns, caps, protective clothing, protective shields, surgical instruments and other medical equipment, operating tables, beds, stretchers, and wheelchairs. Other items include office automation equipment, home appliances, air conditioners, vacuum cleaners, desks, chairs, sofas, benches, windows, straps, handles, seats, automatic ticket gates, automatic ticket vending machines, vending machines, doors, fences, handrails, tableware, cooking utensils, packaging film, packaging bags, bottles, containers, packaging packs, sinks, toilets, stationery, books, shelves, toothbrushes, mirrors, air conditioning filters, masks, coats, jackets, trousers, skirts, dress shirts, knit shirts, blouses, sweaters, cardigans, nightwear, underwear, diapers, supporters, socks, tights, stockings, hats, scarves, mufflers, neck wraps, stoles, gloves, clothing linings, interlinings, padding, work clothes, uniforms, school uniforms, curtains, screen doors, futon fabric, futon cotton, futon covers, pillowcases, sheets, mats, carpets, towels, handkerchiefs, wall coverings, bandages, and more.

[0056] By applying the agent of the present invention to an article, an antiviral effect can be exerted at the site of contact with the active ingredient. The site of contact with the active ingredient is not limited to a site on the article; if the article is applied to a living organism, it also includes sites within the living organism.

[0057] The dosage form of the agent of the present invention is not particularly limited and can be appropriately selected according to its application. Examples of dosage forms include liquids such as liquid preparations, emulsions, suspensions, dispersants, sprays, and aerosols; and solid or semi-solid preparations such as wettable powders, powders, granules, fine granules, and flowable preparations. It can be applied or coated onto various articles.

[0058] The agent of the present invention may further contain other components as needed. These other components are not particularly limited as long as they can be incorporated into, for example, cleaning agents, disinfectants, etc., but examples include bases, carriers, solvents, dispersants, emulsifiers, buffers, stabilizers, excipients, binders, disintegrants, lubricants, thickeners, humectants, colorants, fragrances, chelating agents, and the like.

[0059] The buffering agent is not particularly limited, and any suitable and acceptable one can be used depending on the application. Preferably, it is a phosphate buffer, an acetate buffer, or the like.

[0060] The content of the active ingredient in the agent of the present invention depends on the type of active ingredient, its use, the manner of use, the target of application, the condition of the target of application, etc., and is not limited thereto, but for example it can be 0.000001 to 100% by weight, preferably 0.001 to 50% by weight. [Examples]

[0061] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0062] The tea preparation in the following example followed the method described on the product packaging.

[0063] Example 1: Preparation of matcha 1.5g of matcha tea leaf powder (Otemae no Matcha, manufactured by Marukou Tea Co., Ltd.) and 70mL of 70°C hot water were mixed and stirred several times. The mixture was filtered through a 100-mesh filtration system to remove the tea leaves and allowed to stand at room temperature. The supernatant was filtered through a 0.22μm pore size filter to obtain matcha. It was stored at 4°C until use in the following Test Examples 1 and 2.

[0064] Reference Example 2: Preparation of Green Tea 5g of sencha tea leaves (Uji sencha for farmer's personal use, manufactured by Tsuboichi Tea Shop) and 100mL of 70°C water were mixed and allowed to stand for 60 seconds. The mixture was filtered through a 100-mesh filter to remove the tea leaves and allowed to stand until it reached room temperature. The supernatant was filtered through a 0.22μm pore size filter to obtain green tea. It was stored at 4°C until use in the following Test Examples 1 and 2.

[0065] Reference Example 3: Preparation of Hojicha (roasted green tea) 5g of roasted green tea leaves (organic roasted green tea, manufactured by Marukou Tea Co., Ltd.) and 100mL of boiling water were mixed and allowed to stand for 60 seconds. The tea leaves were removed by filtering through a 100-mesh filter, and the mixture was allowed to stand until it reached room temperature. The supernatant was filtered through a 0.22μm pore size filter to obtain roasted green tea. It was stored at 4°C until use in Test Example 2 described below.

[0066] Reference Example 4. Preparation of New Tea 5g of new tea leaves (new tea harvested in April 2020 by a tea farmer, manufactured by Tsuboichi Tea Shop) were mixed with 100mL of 70°C water and allowed to stand for 60 seconds. The mixture was filtered through a 100-mesh filter to remove the tea leaves and allowed to stand until it reached room temperature. The supernatant was filtered through a 0.22μm pore size filter to obtain new tea. It was stored at 4°C until use in the following Test Examples 1 and 2.

[0067] Reference Example 5. Preparation of Black Tea 2.5g of black tea leaves (high-fragrant Darjeeling blend, manufactured by Mitsui Norin Co., Ltd.) were mixed with 150mL of boiling water and allowed to stand for 3 minutes. The tea leaves were removed by filtering through a 100-mesh filter, and the mixture was allowed to stand until it reached room temperature. The supernatant was filtered through a 0.22μm pore size filter to obtain black tea. It was stored at 4°C until use in Test Examples 1 and 2 described below.

[0068] Reference Example 6. Preparation of Pu-erh Tea 3g of Pu-erh tea leaves (Black Slimming Pu-erh Tea, manufactured by Tsuboichi Tea Shop Co., Ltd.) were mixed with 1L of boiling water and allowed to stand for 5 minutes. The tea leaves were removed by filtering through a 100-mesh filter, and the mixture was allowed to stand until it reached room temperature. The supernatant was filtered through a 0.22μm pore size filter to obtain Pu-erh tea. It was stored at 4°C until use in the following Test Examples 1 and 2.

[0069] Reference Example 7. Preparation of Oolong Tea 4g of oolong tea leaves (Oolong Tea Teaba, manufactured by Tsuboichi Seichachaho Co., Ltd.) were mixed with 1L of boiling water and allowed to stand for 15 minutes. The tea leaves were removed by filtering through a 100-mesh filter, and the mixture was allowed to stand until it reached room temperature. The supernatant was filtered through a 0.22μm pore size filter to obtain oolong tea. It was stored at 4°C until use in Test Examples 1 and 2 described below.

[0070] Reference Example 8. Preparation of water in a pot The purified drinking water was boiled and then cooled to room temperature. It was stored at 4°C until use in Test Examples 1 and 2 described below.

[0071] Test Example 1. Evaluation Test of Antiviral Efficacy 1 The antiviral activity of each sample (stored at 4°C for 11 days) in Reference Examples 1-2 and 4-8 was evaluated as follows.

[0072] Day -1 VeroE6 / TMPRSS2 cells were divided into 5.0 x 10⁶ cells. 4 Cells were seeded in 96-well plates at a concentration of 100 μL per cell. The culture medium was DMEM medium supplemented with 5% fetal bovine serum. Cells were incubated at 37°C under 5% CO2 / 95% air for 24 hours.

[0073] Day 0 Each sample (Reference Examples 1-8) contains 500 μL of SARS-CoV-2 (5 x 10) solution. 5 TCID 50 20 μL of (50 μL) was added and incubated. Immediately after 1 minute, a 10-fold dilution series was prepared using 0.5% FBS DMEM as the diluent. The culture supernatant was discarded from the 96-well plate in which cells were seeded and culture started the previous day (Day 1), and 50 μL of each dilution was added (quadruplicate). After adsorption for 50 minutes (tilting every 10 minutes), 50 μL of 0.5% FBS DMEM was added. The cells were incubated at 37°C under 5% CO2 / 95% air for 72 hours.

[0074] Day 3 100 μL of glutaraldehyde solution (25% W / V) was added to the cells (96-well plate) and allowed to stand at room temperature for 30 minutes. The culture medium / glutaraldehyde mixture was discarded and the wells were washed with tap water. The plates were allowed to stand at room temperature to dry. 100 μL of 1% crystal violet staining solution was added to the fixed cells (96-well plate) and allowed to stand at room temperature for 30 minutes. The staining solution was discarded and the wells were washed with tap water. After allowing to stand at room temperature to dry, the plates were photographed to observe the presence or absence of staining and the cytopathic effect (CPE). TCID 50 The viral reduction rate was calculated using the Reed-Muench method for 50 μL, and the viral reduction rate was calculated based on the obtained value.

[0075] The results are shown in Table 1.

[0076] [Table 1]

[0077] Test Example 2. Evaluation Test of Antiviral Efficacy 2 The antiviral activity of samples O (reference examples 1-2 and 4-8, stored at 4°C for 20 days) and N (reference examples 2-8, stored at 4°C for 2 hours) was evaluated using the same method as in Test Example 1.

[0078] The results are shown in Tables 2 and 3.

[0079] [Table 2]

[0080] [Table 3]

[0081] Reference Example 9. Preparation of Epicatechin Gallate 20 mg of (-)-epicatechin gallate standard (Wako, 051-0889) was dissolved in 900 μL of ethanol and filtered through a 0.22 μm pore filter to obtain 50 mM epicatechin gallate. It was stored at -20°C until use in Test Examples 3 and 4 described below.

[0082] Test Example 3. Evaluation Test of Antiviral Efficacy Day -1 VeroE6 / TMPRSS2 cells were divided into 5.0 x 10⁶ cells. 4 Cells were seeded in 96-well plates at a concentration of 100 μL per cell. The culture medium was DMEM medium supplemented with 5% fetal bovine serum. Cells were incubated at 37°C under 5% CO2 / 95% air for 24 hours.

[0083] Day 0 Dilute the sample (Reference Example 9) with 0.5% fetal bovine serum in DMEM medium, and add SARS-CoV-2 (10 TCID) to 2 μL of the solution. 50 200 μL (100 μL) was added and incubated for 5 minutes. The final concentration of the sample was 0 μM or 100 μM. The culture supernatant was discarded from the 96-well plate in which cells were seeded and culture started the previous day (Day 1), and 100 μL of each virus solution was added (triplicate). The cells were incubated at 37°C, 5% CO2 / 95% air for 72 hours.

[0084] Day 3 100 μL of glutaraldehyde solution (25% W / V) was added to the cells (96-well plate) and allowed to stand at room temperature for 30 minutes. The culture medium and glutaraldehyde mixture was discarded and the wells were washed with tap water. The plates were allowed to stand at room temperature and dry. 100 μL of 1% crystal violet staining solution was added to the fixed cells (96-well plate) and allowed to stand at room temperature for 30 minutes. The staining solution was discarded and the wells were washed with tap water. After allowing to stand at room temperature and dry, the plates were photographed to observe the presence or absence of staining and CPE. The results are shown in Table 4.

[0085] [Table 4]

[0086] For each group, and for each well treated using the triplicate method, a score of + was given if CPE was observed, and - if not.

[0087] Reference Example 10. Preparation of (-)-epicatechin 20 mg of (-)-epicatechin standard (Wako, 054-08881) was dissolved in 1380 μL of methanol and filtered through a 0.22 μm pore filter to obtain 50 mM epicatechin. It was stored at -20°C until use in Test Example 4 described below.

[0088] Reference Example 11. Preparation of (-)-epigallocatechin gallate 50 mg of (-)-epigallocatechin gallate standard (Wako, 056-08961) was dissolved in 2180 μL of ethanol and filtered through a 0.22 μm pore filter to obtain 50 mM epigallocatechin gallate. It was stored at -20°C until use in Test Example 4 described below.

[0089] Reference Example 12. Preparation of (-)-epigallocatechin (-)-Epigallocatechin standard (Wako, 059-08951) 20 mg Wako (50 mM: +EtOH μL) was dissolved in 1310 μL of ethanol and filtered through a 0.22 μm pore size filter to obtain 50 mM epigallocatechin. It was stored at -20°C until use in Test Example 4 described below.

[0090] Test Example 4. Evaluation Test of Antiviral Efficacy Day -1 VeroE6 / TMPRSS2 cells were divided into 5.0 x 10⁶ cells. 4 Cells were seeded in 96-well plates at a concentration of 100 μL per cell. The culture medium was DMEM medium supplemented with 5% fetal bovine serum. Cells were incubated at 37°C under 5% CO2 / 95% air for 24 hours.

[0091] Day 0 Dilute the samples (Reference Examples 9-12) in DMEM medium supplemented with 0.5% fetal bovine serum, and add SARS-CoV-2 (10 TCID) to 2 μL of the solution. 50 200 μL of (100 μL) was added and incubated for 5 minutes. The final concentrations of the samples were 0 μM, 25 μM, 50 μM, or 100 μM. The culture supernatant was discarded from the 96-well plates in which cells were seeded and culture started the previous day (Day 1), and 100 μL of each virus solution was added (triplicate). The cells were incubated at 37°C under 5% CO2 / 95% air for 72 hours.

[0092] Day 3 100 μL of glutaraldehyde solution (25% W / V) was added to the cells (96-well plate) and allowed to stand at room temperature for 30 minutes. The culture medium and glutaraldehyde mixture was discarded, and the wells were washed with tap water. The plates were allowed to stand at room temperature to dry. 100 μL of 1% crystal violet staining solution was added to the fixed cells (96-well plate) and allowed to stand at room temperature for 30 minutes. The staining solution was discarded, and the wells were washed with tap water. After allowing to stand at room temperature to dry, the plates were photographed to observe the presence or absence of staining and CPE.

[0093] A virus infection score was assigned to each of the three wells in the Triplicate model, as shown in Table 5. The average score of the three wells was then calculated.

[0094] [Table 5]

[0095] The CPE reduction rate was calculated using the following formula.

[0096]

number

[0097] The results are shown in Figure 1. All tea catechins were found to suppress SARS-CoV-2 infection.

[0098] Test Example 5 Day -1 VeroE6 / TMPRSS2 cells were seeded into a 96-well plate at 5.0 x 10 4 cells / 100 μL. The cells were cultured for 24 hours at 37 °C under 5% CO2 / 95% air.

[0099] Day 0 Theaflavin-3-O-gallate, Theaflavin-3’-O-gallate, Theaflavin-3-3’-di-O-gallate (purchased from Nagara Science) were diluted in a medium containing 10% FBS (Theaflavin-3-O-gallate at 10 mM, 5 mM; Theaflavin-3’-O-gallate at 10 mM, 5 mM, 2.5 mM; Theaflavin-3-3’-di-O-gallate at 10 mM, 5 mM, 2.5 mM, 1.25 mM). 200 μL of SARS-CoV-2 (30 TCID 50 / 100 μL) was added to 2 μL of each of these dilutions, and the mixture was incubated for 5 minutes. The final concentrations of each drug were: Theaflavin-3-O-gallate at 100 μM, 50 μM; Theaflavin-3’-O-gallate at 100 μM, 50 μM, 25 μM; Theaflavin-3-3’-di-O-gallate at 100 μM, 50 μM, 25 μM, 12.5 μM. The culture supernatant was discarded from the 96-well plate in which the cells were seeded and the culture was started the previous day (Day -1), and 100 μL of each virus solution was added (Quadruplicate), and the cells were cultured for 72 hours at 37 °C under 5% CO2 / 95% air.

[0100] Day 3 100 μL of glutaraldehyde solution (25% W / V) was added to the cells (96-well plate) and allowed to stand at room temperature for 30 minutes. The culture medium and glutaraldehyde mixture was discarded, and the wells were washed with tap water. The plates were allowed to stand at room temperature to dry. 100 μL of 1% crystal violet staining solution was added to the fixed cells (96-well plate) and allowed to stand at room temperature for 30 minutes. The staining solution was discarded, and the wells were washed with tap water. After allowing to stand at room temperature to dry, the plates were photographed to observe the presence or absence of staining and CPE.

[0101] A virus infection score was assigned to each of the four wells of the Quadruplicate, as shown in Table 6. The average score for the four wells was then calculated.

[0102] [Table 6]

[0103] The CPE reduction rate was calculated using the following formula.

[0104]

number

[0105] The results are shown in Figure 2. Theaflavin-3-O-gallate, Theaflavin-3'-O-gallate, and Theaflavin-3-3'-di-O-gallate were all found to suppress SARS-CoV-2 infection.

[0106] Test Example 6 method Day -1 VeroE6 / TMPRSS2 cells were divided into 5.0 x 10⁶ cells. 4 Cells were seeded in 100 μL in 96-well plates. They were incubated at 37°C under 5% CO2 / 95% air for 24 hours.

[0107] Day 0 Discard the culture supernatant from the 96-well plate in which cells were seeded and cultured the previous day (Day 1), and then test for SARS-CoV-2 (30 TCID). 50 100 μL of (100 μL) was added. The culture was incubated at 37°C under 5% CO2 / 95% air for 1 hour. After 1 hour, the virus solution was discarded, and 100 μL of EC, ECG, EGC, and EGCG (final concentrations 200 μM, 100 μM, 50 μM, and 25 μM) diluted in 0.5% FBS-containing medium was added (quadruplicate), and the culture was incubated at 37°C under 5% CO2 / 95% air for 72 hours.

[0108] Day 3 100 μL of glutaraldehyde solution (25% W / V) was added to the cells (96-well plate) and allowed to stand at room temperature for 30 minutes. The culture medium / glutaraldehyde mixture was discarded and the wells were washed with tap water. The plates were allowed to stand at room temperature to dry. 100 μL of 1% crystal violet staining solution was added to the fixed cells (96-well plate) and allowed to stand at room temperature for 30 minutes. The staining solution was discarded and the wells were washed with tap water. After allowing to stand at room temperature to dry, the plates were photographed to observe the presence or absence of staining and CPE. The OD of each well was measured and the % Inhibition of Cell Death was calculated as follows.

[0109]

number

[0110] The results are shown in Figure 3. EC, ECG, EGC, and EGCG were all found to suppress SARS-CoV-2 infection.

[0111] Test Example 7 The sample (EGCG or TFDG (theaflavin-3,3'-di-O-gallate)) was adjusted for osmotic pressure by adding an equal volume of serum-free (SF) 2X DMEM, then diluted twice with SF DMEM (MS) and used immediately. 10 μl of SARS-CoV-2 (1.5 X 10^6 / 50 μl) was added to 100 μl of each concentration of sample solution or SF DMEM (MS) (control), and the mixture was allowed to stand at room temperature for 1 minute. The supernatant was removed from a 96-well plate from which VeroE6 / TMPRSS2 cells had been seeded at 5 X 10^4 / 100 μl / well and cultured for 15 hours the previous day. 50 μl of the above virus / sample solution was added (MOI 3). After 1 hour of adsorption, the virus solution was removed and 100 μl / well of MS was added. The cells were cultured for 30 hours. Cell viability was quantified by the following method. The medium was removed from the plate and washed with PBS. Cell Count Reagent SF (Nacalai) was mixed with 20% phenol red-free medium, and 50 μl / well was added to the cells and cultured for 50 minutes. As a blank, wells were prepared in which only the reagent mixture was added to wells in which no cells had been cultured. After the reaction was complete, 20 μl / well of 10% SDS was added to inactivate any viruses remaining in the wells. The absorbance at a wavelength of 450 nm was measured using a plate reader. The measurement was performed using a tetraplicate.

[0112] A schematic diagram of the method is shown in Figure 4a, and the results (mean ± standard deviation of A450 values ​​for each group) are shown in Figures 4b and 4c. Both EGCG and TFDG acted on the virus in a concentration-dependent manner, attenuating its ability to infect and kill cells. EGCG at concentrations of 500-1000 μM or higher, and TFDG at concentrations of 60 μM or higher, completely suppressed cell death caused by viral infection. N = 3. *p<0.05, **p<0.01, ***p<0.001 (between groups) (Student's t-test).

[0113] Test Example 8 Saliva samples from five healthy individuals were purchased from Lee Biosolutions (Maryland Heights, MO, USA) and sterilized by 30 minutes of UV irradiation. 45 μL of saliva or distilled water was mixed with 3.0 × 10⁶ SARS-CoV-2. 5 TCID 50 Only 5 μL was added. Green tea or black tea was added to this in a 1:1 volume ratio and incubated for 10 seconds. Immediately afterward, it was diluted 1000-fold in serum-free DMEM medium, and then serially diluted 10-fold by MS. After cooling with ice, VeroE6 / TMPRSS2 cells were 5 x 10⁶ the day before. 4 Cells were seeded at 100 μl / well and cultured for 15 hours in a 96-well plate. The supernatant was removed, and 50 μl of the above virus / saliva / sample solution was added. After 1 hour of adsorption, the virus solution was removed, and 100 μl / well of MS was added. After 3 days of culture, the supernatant was removed, the cells were fixed, and stained with crystal violet solution to observe CPE. TCID 50 This was calculated using the Reed-Muench method.

[0114] A schematic diagram of the method is shown in Figure 5A, and the results (TCID for each group) are shown. 50 The mean ± standard deviation of 50 μL is shown in Figures 5B and 5C. It can be seen that both green tea and black tea reduced the infectivity of SARS-CoV-2 to 1 / 100 to below the detection limit after 10 seconds of treatment. N = 3.

[0115] Test Example 9 Saliva samples from five healthy individuals were purchased from Lee Biosolutions (Maryland Heights, MO, USA) and sterilized by 30 minutes of UV irradiation. SARS-CoV-2 was added to 45 μL of saliva in a 3.0 × 10⁶ dose. 5 TCID 50 Only 5 μL was added. Green tea or black tea was added to this in a 1:1 volume ratio and incubated for 10 seconds. Immediately afterward, it was diluted 1000-fold in DMEM medium without serum, and then serially diluted 10-fold by MS. After cooling with ice, VeroE6 / TMPRSS2 cells were divided into 2.5 × 10⁶ cells the previous day. 5After seeding in one well and incubating for 15 hours in a 24-well plate, the supernatant was removed, and 100 μl of the above virus / saliva / sample solution was added. After 1 hour, the supernatant was discarded, 500 μL of fresh medium was added, and the plate was incubated for 10 hours. The supernatant was collected and serially diluted 10-fold, and TCID was used. 50 The assay was performed in the same manner as in Test Example 8. TCID 50 This was calculated using the Reed-Muench method.

[0116] A schematic diagram of the method is shown in Figure 6A, and the results (TCID for each group) are shown. 50 Figure 6B shows the mean ± standard deviation of 50 μL. It can be seen that treating SARS-CoV-2 with green tea or black tea for 10 seconds significantly reduced the amplification of SARS-CoV-2 within cells after infection, leading to the production of secondary viruses. N = 3. * p < 0.05 (between groups) (Student's t-test).

[0117] Test Example 10 Saliva samples from five healthy individuals were purchased from Lee Biosolutions (Maryland Heights, MO, USA) and sterilized by 30 minutes of UV irradiation. SARS-CoV-2 was added to 45 μL of saliva in a 3.0 × 10⁶ dose. 5 TCID 50 Only 5 μL was added. Black tea was added to this in a 1:1 volume ratio and incubated for 10 seconds. Immediately afterward, it was diluted 1000-fold in DMEM medium without serum, and then serially diluted 10-fold by MS. After cooling with ice, 2.5 × 10⁶ VeroE6 / TMPRSS2 cells were used on the previous day. 5After seeding in one well and culturing for 15 hours in a 24-well plate, the supernatant was removed, and 100 μl of the above virus / saliva / sample solution was added. After 1 hour, the supernatant was discarded, 500 μL of fresh medium was added, and the cells were cultured for 10 hours. RNA was recovered from the culture supernatant and cells using TRI Reagent LS (Molecular Research Center, Inc., Montgomery Road, Cincinnati, OH, USA). After reverse transcription using ReverTra Ace qPCR RT Master Mix (Toyobo, Shiga, Japan), cDNA was subjected to real-time PCR. For real-time PCR, a Step-One Plus Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) was used, employing the following primers / probes specific to the viral N gene: Forward primer, 5'-AAATTTTGGGGACCAGGAAC-3' (SEQ ID NO: 1); reverse primer, 5'-TGG-CAGCTGTGTAGGTCAAC-3' (SEQ ID NO: 2); and probe, 5'-(FAM) ATGTCGCGCATTGGCATGGA (BHQ)-3' (SEQ ID NO: 3).

[0118] A schematic diagram of the method is shown in Figure 7A, and the results (mean ± standard deviation of relative N gene RNA levels in the culture supernatant and intracellularly for each group) are shown in Figure 7B. It can be seen that treating SARS-CoV-2 with black tea for 10 seconds significantly reduced the amplification of SARS-CoV-2 within cells after infection and the production of secondary viruses. N = 3. * p < 0.05 (between groups) (Student's t-test). † The p-value cannot be calculated (because one or two of the triplicates have a value of 0).

[0119] Test Example 11 Samples of the specified concentration (EGCG or TFDG) and 1.25 x 10⁻¹⁵ 7SARS-CoV-2 at a concentration of TCID50 / mL was added to 500 μL and left to stand at room temperature for 1 minute. The day before, 2.5 × 10⁶ VeroE6 / TMPRSS2 cells were added. 5 The supernatant was removed from a 24-well plate cultured for 15 hours after seeding at / well, and 100 μl of the above virus / saliva / sample solution was added (MOI 5). After 1 hour of adsorption, the virus solution was removed, washed with PBS, and 100 μl / well of MS was added. After 10 hours of incubation, the supernatant was collected, and the viral titer was measured by the TCID50 assay in the same manner as in Test Example 8. RNA was also extracted from the culture supernatant and cells using the method described below, and viral RNA was quantified by quantitative RT-PCR. RNA was collected using TRI Reagent LS (Molecular Research Center, Inc., Montgomery Road, Cincinnati, OH, USA) and reverse transcribed using ReverTra Ace qPCR RT Master Mix (Toyobo, Shiga, Japan). Quantitative PCR was performed using the Step-One Plus Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) and virus N gene-specific primers / probes (Forward primer, 5′-AAATTTTGGGGACCAGGAAC-3′ (SEQ ID NO: 1); reverse primer, 5′-TGG-CAGCTGTGTAGGTCAAC-3′ (SEQ ID NO: 2); and probe, 5′-(FAM) ATGTCGCGCATTGGCATGGA (BHQ)-3′ (SEQ ID NO: 3)). The Ct value of each sample was analyzed using StepOne Software (ABI, Warrington, UK). Cellular N gene RNA levels were standardized to the 18S rRNA level of each sample. Relative RNA levels (mean ± SD) are relative values ​​with the control infected with untreated virus set to 1.0.

[0120] A schematic diagram of the method is shown in Figure 8a, and the results are shown in Figure 8b. Both EGCG and TFDG acted on the virus in a concentration-dependent manner, suppressing its amplification within cells after infection (top of b) and inhibiting the production of secondary viruses from cells (middle and bottom of b). EGCG at concentrations of 500-1000 μM or higher and TFDG at concentrations of 60 μM or higher completely suppressed cell death caused by viral infection. N = 4. * p < 0.05, ** p < 0.01, *** p < 0.001 vs. Control (Tukey's multiple comparison test).

[0121] Test Example 12 The inhibition of the interaction between the SARS-CoV-2 spike protein RBD and ACE2 by EGCG and TFDG was measured using the SARS-CoV-2 Surrogate Virus Neutralization Test Kit from GenScript (Piscataway, NJ, USA). Specifically, samples at the specified concentrations (EGCG or TFDG or a control containing neither (0 μM)), or the positive or negative control provided with the kit, were added to horseradish peroxidase (HRP)-conjugated recombinant RBD fragment in a 1:1 volume ratio and incubated at 37°C for 30 minutes. 100 μL of the mixture was added to wells coated with human ACE2 protein. After incubation at 37°C for 15 minutes, the wells were washed and 3,3′,5,5′-tetramethyl-benzidene (TMB) solution was added. After incubation in the dark at 20–25°C for 15 minutes, the absorbance at 459 nm was measured.

[0122] The results are shown in Figure 9. Both EGCG and TFDG strongly inhibited the interaction between the SARS-CoV-2 spike protein RBD and ACE2. Values ​​are mean ± SD (n = 3). *** p < 0.001 vs. 0 μM (Tukey's multiple comparison test).

Claims

1. An anti-SARS-CoV-2 agent containing roasted green tea or a concentrate thereof.

2. The anti-SARS-CoV-2 agent according to claim 1, comprising the roasted green tea.

3. An anti-SARS-CoV-2 agent according to claim 1 or 2, for use in a living organism.

4. The anti-SARS-CoV-2 agent according to claim 3, which is a pharmaceutical, cosmetic, food composition, food additive, disinfectant, or cleaning agent.

5. An anti-SARS-CoV-2 agent according to claim 3 or 4, which is a preventive or therapeutic agent for COVID-19.

6. An anti-SARS-CoV-2 agent according to claim 1 or 2, used for application to an article.

7. The anti-SARS-CoV-2 agent according to claim 6, which is a disinfectant or cleaning agent.

Images