Genetically modified lepidopteran insects

Abstract

To provide a new expression system for generating target protein stably in large volume in Arguloida insects such as silkworms.SOLUTION: A gene recombinant Arguloida insect includes a target genetic sequence coding target protein or its fragment in an exon alignment that codes signal peptide of endogenous gene or its functional fragment. The target protein or its fragment is fused with a C terminal side of the signal peptide or its functional fragment.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to genetically modified Lepidoptera insects and methods for producing the same.

Background Art

[0002] The silk gland of the silkworm (Bombyx mori) has the ability to synthesize a large amount of protein in a short period of time. In addition, since the silk gland of the silkworm is a large organ, it is easy to remove, and the synthesized protein is stored in the lumen of the silk gland, so it has the advantage of being easy to recover. Therefore, genetically modified silkworms that express the target protein in the silk gland are regarded as promising for mass production systems of proteins.

[0003] The silk gland of the silkworm is a pair of left and right organs, each of which is composed of three regions: the anterior silk gland, the middle silk gland, and the posterior silk gland. In the cells of the posterior silk gland, three major proteins that make up fibroin, the fiber component of silk, fibroin heavy chain (hereinafter often abbreviated as "Fib H"), fibroin light chain (hereinafter often abbreviated as "Fib L"), and fibrohexamerin (also called p25 / FHX) are expressed. In addition, sericin, a gelatin-like protein that is a coating component of silk, is expressed in the cells of the middle silk gland. The three proteins expressed in the cells of the posterior silk gland form a complex (silk fibroin elementary unit; SFEU complex) at a ratio of Fib H:Fib L:p25 = 6:6:1 and are secreted into the lumen of the posterior silk gland. In contrast, sericin is secreted into the lumen of the middle silk gland after expression. The fibroin secreted into the lumen of the posterior silk gland then migrates into the lumen of the middle silk gland, is coated with sericin, and is spun out as silk (Non-Patent Document 1). Therefore, when using the silkworm silk gland as a protein expression system, a gene expression system that specifically expresses in the middle silk gland or the posterior silk gland may be used.

[0004] When using silkworm silk glands as a protein expression system, the GAL4 / UAS system (Non-Patent Literature 2) and a high-volume expression method using a system combining a sericin 1 promoter and an Hr3 enhancer (Non-Patent Literature 3) have been reported as recombinant protein expression systems. However, currently, the GAL4 / UAS system, which is superior in terms of protein expression levels, is widely used.

[0005] The GAL4 / UAS system is a gene regulatory system that utilizes a combination of the yeast-derived transcription factor GAL4 and the regulatory sequence UAS. In the GAL4 / UAS system used as a protein production system in the silkworm silk gland, a GAL4 line expressing the GAL4 gene under the control of a promoter of a gene specifically expressed in the mid-silk gland or posterior silk gland, and a UAS line expressing the target protein gene under the control of the regulatory sequence UAS are independently established by genetic recombination using piggyBac. Then, by crossing the two lines, an expression system that expresses the target protein in the silk gland is constructed.

[0006] The GAL4 / UAS system presents several challenges in establishing new GAL4 and UAS lines. These include the time required to establish the GAL4 and UAS lines separately before crossing, and the fact that the GAL4 gene and UAS regulatory sequence are introduced at random locations on the genome, potentially leading to fluctuations in the expression levels of the target protein. Furthermore, the expression levels in the GAL4 / UAS system are considered to have reached their technical limits. Therefore, there is a need for new methods to stably and in large quantities produce target proteins. [Prior art documents] [Non-patent literature]

[0007] [Non-Patent Document 1] Inoue S. et al., 2000, The Journal of Biological Chemistry, 275 (51): 40517-40528. [Non-Patent Document 2] Tatematsu K. et al., 2010, Transgenic Research, 19(3):473-87. [Non-Patent Document 3] Tomita M. et al., 2007, Transgenic Research, 16 (4):449-465. [Overview of the project] [Problems that the invention aims to solve]

[0008] The object of the present invention is to provide a novel expression system for the stable and large-scale production of a target protein in lepidopteran insects such as silkworms. [Means for solving the problem]

[0009] To solve the above problems, the inventors conceived of constructing a novel expression system that utilizes the promoter activity and enhancer activity of the endogenous gene to express the target gene by knocking in a target gene encoding a target protein, which is fused to the C-terminus of an endogenous signal peptide, into the exon sequence encoding the signal peptide in the sericin gene, fibroin gene, etc.

[0010] Generally, efficiently knocking in exogenous genes into the silkworm genome requires cleaving the target gene locus using genome editing enzymes or the like. Therefore, the inventors attempted to set a genome cleavage site within the exon sequence where the target gene sequence would be introduced, and then attempted knock-in within that exon sequence. However, this method resulted in over 95% of the injected generation failing to produce normal cocoons, and over 98% failing to develop into adult silkworms capable of mating. Consequently, it was found that establishing a viable lineage is extremely difficult using this method.

[0011] Therefore, the inventors attempted to knock in the target gene sequence into an exon sequence by cutting the genome not in the exon sequence where the target gene sequence is introduced, but in an intron sequence near the exon sequence. As a result, they found that almost all individuals of the injection generation developed into adults capable of mating, and that they could produce the target protein in amounts far exceeding that of the conventional GAL4 / UAS line, thus completing the present invention. The present invention is based on the above research results and provides the following.

[0012] (1) Genetically modified lepidopteran insects, An exon sequence encoding a signal peptide of an endogenous gene or a functional fragment thereof includes a target gene sequence encoding the target protein or a fragment thereof. The genetically modified lepidopteran insect wherein the target protein or a fragment thereof is fused to the C-terminal side of the signal peptide or a functional fragment thereof. (2) The genetically modified lepidopteran insect according to (1), wherein the endogenous gene encodes fibroin, sericin, and / or fibrohexamarin. (3) The genetically modified lepidopteran insect according to (2), wherein the fibroin is a fibroin H chain and / or a fibroin L chain. (4) The endogenous gene is Fibroin H chain and fibroin L chain, Fibroin H chain and sericin 1, or Fibroin H chain, fibroin L chain, and sericin 1 A genetically modified lepidopteran insect as described in (1), which codes for [the specified character]. (5) A genetically modified lepidopteran insect according to any one of (1) to (4), wherein the exon sequence includes a transcription termination sequence at the 3' end of the target gene sequence. (6) A double-stranded circular DNA for introducing a target gene sequence at a genome break site within an intron sequence in an endogenous gene of a genetically modified lepidopteran insect, The aforementioned endogenous gene is, (a) A first spacer sequence adjacent to the 5' end of the genome cleavage site, (b) A second spacer sequence adjacent to the 3' end of the genome cleavage site, (c) A first recognition sequence recognized by a first genome editing enzyme at the 5' end of the first spacer sequence, and (d) A second recognition sequence recognized by a second genome editing enzyme at the 3' end of the second spacer sequence. Includes, The double-stranded circular DNA comprises the first recognition sequence, the second spacer sequence, the first spacer sequence, a genome homologous sequence, and a target gene sequence in this order. The genome homologous sequence consists of a base sequence homologous to the genome sequence from the second recognition sequence to the exon sequence or a subsequence thereof located at the 3' end of the intron sequence. The target gene sequence is the double-stranded circular DNA encoding the target protein or fragment thereof to be fused to the C-terminal side of the signal peptide or functional fragment thereof of the endogenous gene. (7) Donor nucleic acids for producing genetically modified lepidopteran insects using homologous recombination, The homologous recombination method described above includes cutting the genome break site within the intron sequence of an endogenous gene with a genome editing enzyme, The donor nucleic acid is, (a) A first genome homologous sequence and a second genome homologous sequence derived from the endogenous gene, and (b) Target gene sequence located between them Includes, The first genome homologous sequence consists of a base sequence homologous to the genome sequence from a base located 5' end-side to the genome break site on the genome to an exon sequence or a subsequence thereof located 3' end-side to the intron sequence, and has a mutation in the recognition sequence of the genome editing enzyme. The second genome homologous sequence consists of a base sequence homologous to a genome sequence located 3' end to the exon sequence or a subsequence thereof on the genome. The target gene sequence is the donor nucleic acid that encodes the target protein or fragment thereof to be fused to the C-terminal side of the signal peptide or functional fragment thereof of the endogenous gene. (8) A donor nucleic acid for producing a genetically modified Lepidoptera insect using homologous recombination, wherein the homologous recombination method includes cleaving a genomic cleavage position within an intron sequence in an endogenous gene with a genome editing enzyme, the donor nucleic acid (a) a first genomic homologous sequence and a second genomic homologous sequence derived from the endogenous gene, and (b) a target gene sequence disposed therebetween and includes the first genomic homologous sequence consists of a nucleotide sequence homologous to the genomic sequence from the base located on the 5'-end side of the intron sequence to the exon sequence or a partial sequence thereof located on the 5'-end side of the intron sequence in the endogenous gene, the second genomic homologous sequence consists of a nucleotide sequence homologous to the genomic sequence from the base located on the 3'-end side of the exon sequence or a partial sequence thereof and on the 5'-end side of the genomic cleavage position to the base located on the 3'-end side of the genomic cleavage position, and has a mutation in the recognition sequence of the genome editing enzyme, the target gene sequence encodes a target protein or a fragment thereof fused to the C-terminal side of the signal peptide of the endogenous gene or a functional fragment thereof, the donor nucleic acid. (9) The donor nucleic acid according to (7) or (8), which includes a nuclease recognition sequence at the end opposite to the target gene sequence of the first genomic homologous sequence and / or the second genomic homologous sequence. (10) The donor nucleic acid according to (9), wherein the nuclease recognition sequence is the recognition sequence of the genome editing enzyme or a restriction enzyme recognition sequence. (11) A method for producing a genetically modified Lepidoptera insect, comprising the double-stranded circular DNA according to (6), the first genome editing enzyme or a nucleic acid encoding the first genome editing enzyme in an expressible state, and the second genome editing enzyme or a nucleic acid encoding the second genome editing enzyme in an expressible state an introduction step of introducing them into the eggs of Lepidoptera insects by microinjection The method, including the method described above. (12) A method for producing genetically modified lepidopteran insects, (7) to (10) the donor nucleic acid, and The genome editing enzyme, or a nucleic acid encoding the genome editing enzyme in a state capable of expression. The introduction process involves introducing the substance into the eggs of lepidopteran insects using the microinjection method. The method, including the method described above. (13) A method for producing the target protein or a fragment thereof using a genetically modified lepidopteran insect described in any of (1) to (5), or a genetically modified lepidopteran insect produced by the method described in (11) or (12). (14) The method according to (13), wherein the lepidopteran insect is a silkworm, and the target protein or fragment thereof is produced in the silk gland of the silkworm. [Effects of the Invention]

[0013] According to the present invention, target proteins can be produced stably and in large quantities in lepidopteran insects such as silkworms. [Brief explanation of the drawing]

[0014] [Figure 1] This describes the introduction of a target gene sequence containing a stop codon into an endogenous gene. The target gene sequence is introduced into the exon sequence encoding a signal peptide in the endogenous gene. The target protein encoded by the target gene sequence is fused to the C-terminus of the signal peptide encoded by the endogenous gene. [Figure 2] This figure shows the genome breakpoint locations in endogenous genes during the creation of knock-in lines. The genome breakpoint location is designed within an intron sequence located at the 5' end of the exon sequence into which the target gene sequence is introduced. As examples of endogenous genes into which the target gene sequence is introduced, Figure 2A shows the sericin 1 gene, Figure 2B shows the fibroin H gene, and Figure 2C shows the fibroin L gene. [Figure 3]This figure outlines the gene knock-in process using the TAL-PITCh method. Figure 3A shows the locations in the endogenous gene from which each sequence used to construct the donor nucleic acid used in the TAL-PITCh method originates. Figure 3B shows the structure of the double-stranded circular DNA used in the TAL-PITCh method. Figure 3C shows the structure of the knock-in gene obtained by knocking in the target gene sequence using the TAL-PITCh method. [Figure 4] This figure shows a method for gene knock-in using homologous recombination. [Figure 5] The results of observations of silk glands and cocoons in 5th instar larvae of the SP(FibH)-EGFP knock-in strain are shown. [Figure 6] The results of measuring EGFP expression levels per silkworm for each knock-in line are shown. The graph shows the average value of measurements for n=1 to n=4, and the error bars indicate the standard error. [Figure 7] This figure shows GM-CSF production in silkworm lines in which the GM-CSF gene sequence was knocked into the second exon of the endogenous fibroin H gene. Figure 7A shows the knock-in of the GM-CSF gene sequence into the fibroin H gene. Figure 7B shows the results of detecting GM-CSF by Western blotting. [Figure 8] Figure 8A shows the knock-in of the IgG H chain gene sequence into the fibroin H gene's second exon and the IgG L chain gene's third exon, respectively, in silkworm lines. Figure 8B shows the knock-in of the IgG L chain gene sequence into the fibroin H gene. Figure 8C shows the amount of IgG produced. [Figure 9] The results of performing knock-in by designing the genome cleavage site within an intron sequence or an exon sequence are shown. Figure 9A shows the results of performing homologous recombination by cleaving the genome within an intron sequence of the Fib H gene. Figure 9B shows the results of performing homologous recombination by cleaving the genome within an exon sequence of the Fib H gene. [Modes for carrying out the invention]

[0015] 1. Genetically modified lepidopteran insects 1-1. Overview A first aspect of the present invention is a genetically modified lepidopteran insect. The genetically modified lepidopteran insect of the present invention contains the target gene sequence in the exon sequence encoding the signal peptide or functional fragment thereof of an endogenous gene, and expresses the target protein or fragment thereof fused to the C-terminal side of the signal peptide or functional fragment thereof. The genetically modified lepidopteran insect of this aspect can stably produce the target protein in large quantities.

[0016] 1-2.Definition The following terms, which are frequently used in this specification, are defined below. In this specification, "lepidoptera insects" refers to insects belonging to the taxonomic order Lepidoptera, specifically butterflies and moths. Butterflies include insects belonging to the families Nymphalidae, Papilionidae, Pieridae, Lycaenidae, and Hesperiidae. Moths include insects belonging to families such as Saturniidae, Bombycidae, Brahmaeidae, Eupterotidae, Lasiocampidae, Psychidae, Geometridae, Archtiidae, Noctuidae, Pyralidae, and Sphingidae. For example, among moths, species belonging to the genera Bombyx, Samia, Antheraea, Saturnia, Attacus, and Rhodinia include, specifically, silkworms, mulberry silkworms (Bombyx mandarina), the Japanese silkworm (Samia cynthia; including Samia cynthia ricini and hybrids of Samia cynthia and Samia cynthia), the Japanese oak silkworm (Antheraea yamamai), the Japanese silkworm (Antheraea pernyi), the small Japanese silkworm (Saturnia japonica), and the Japanese luna moth (Actias gnoma). The lepidopteran insects that serve as hosts for the transformed organisms of the present invention are not limited to these, but silkworms, which have high industrial applicability, are particularly preferred as hosts.

[0017] "Genetically modified lepidopteran insects" refers to genetically modified lepidopteran insects or their offspring that possess foreign DNA created using genetic engineering technology. In this specification, genetically modified lepidopteran insects specifically refer to genetically modified insects obtained by introducing foreign DNA into lepidopteran insect eggs using the microinjection method.

[0018] In this specification, "silk gland" refers to a modified tubular organ of the salivary gland that has the function of producing, storing, and secreting liquid silk. Silk glands are usually found in pairs along the digestive tract, mainly in the larval stage, of insects capable of spinning silk, and each silk gland consists of three regions: anterior, middle, and posterior. The posterior silk gland produces and secretes fibroin, the fibrous component of silk. The middle silk gland produces and secretes sericin, the coating component, which accumulates in its lumen along with fibroin migrated from the posterior silk gland.

[0019] In this specification, "endogenous gene" refers to a gene of the Lepidoptera order that is congenitally present in the genome of that insect. In this invention, an endogenous gene is, in principle, a gene that codes for a protein having a signal peptide. Therefore, in this specification, an endogenous gene is, in principle, a gene that codes for a secreted protein or a membrane protein. The secreted protein may be, for example, any protein that makes up silk. In this specification, any protein that makes up silk is often referred to as "silk protein," and the gene that codes for silk protein is referred to as a "silk gene." Specific examples of endogenous genes in Lepidoptera insects include genes that code for fibroin, sericin, and fibrohexamarin.

[0020] Furthermore, in this specification, "exogenous gene" or "foreign gene" refers to an exogenous gene acquired through artificial manipulation or the like, which is not present in the genome of wild-type lepidopteran insects.

[0021] Fibroin is a protein that makes up the fiber component of silk thread. Silkworm fibroin is mainly composed of three proteins: fibroin H chain (Fib H), fibroin L chain (Fib L), and fibrohexamerin. Fibrohexamerin is also known as p25 / FHX, as mentioned above.

[0022] Sericin is a protein that forms a layered outer layer on the fibrous fibers in silk. In silkworms, sericin is synthesized in the cells of the midsilk gland and secreted into the lumen of the midsilk gland after synthesis. Known functions of sericin include adhesion between fibrous fibers and protection of fibrous fibers from external stimuli. Silkworms can spin silk immediately after hatching, but the protein components of the silk spun at each instar and the silk of the cocoon differ, and the sericin variant composition also differs. In general, in silkworms, about six types of sericin protein variants (sericin 1A', sericin 1C, sericin 1D, sericin 2, sericin 3, and sericin 4) are known to be biosynthesized from four types of sericin genes (Ser1, Ser2, Ser3, and Ser4). Of these, there are four main sericin variants found in cocoons (sericin 1A', sericin 1C, sericin 1D, and sericin 3). In this specification, when simply referred to as "sericin," it means the general term for sericin unless otherwise specified.

[0023] In this specification, "signal peptide" or "secretory signal" refers to an extracellular translocation signal necessary for the secretion of proteins biosynthesized by gene expression into the extracellular space. After translation, signal peptides are cleaved and removed by signal peptidases before being secreted into the extracellular space. In this specification, signal peptides are often abbreviated as "SP," and the name of the endogenous gene from which the signal peptide originates is indicated in parentheses. Signal peptides are usually relatively short peptide sequences of a few tens of amino acids or less, and are characterized by highly hydrophobic sequences. The sequence of a signal peptide can be predicted based on the amino acid sequence of the protein using prediction tools such as signalP, but structural predictions provided in databases can also be used. For example, in the case of silkworms, the sequence region of the signal peptide can be determined based on sequence annotations provided in databases such as KAIKObase and KAIKOcDNA, which are available in the Agrigenomics Information Database.

[0024] In this specification, a "functional fragment" of a signal peptide refers to a fragment consisting of a partial sequence of the signal peptide that retains extracellular translocation signaling activity. A functional fragment of a signal peptide may retain, for example, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 98% or more, or equivalent to or greater than the extracellular translocation signaling activity of the full-length signal peptide. The amino acid length of the functional fragment is not particularly limited as long as it retains the activity of the full-length signal peptide, but may, for example, be 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, or 98% or more of the full length.

[0025] In this specification, "full length" refers to the entire amino acid sequence corresponding to a protein synthesized and functioning in a living organism, or the entire base sequence of the gene encoding it. In principle, in the case of a gene, the entire sequence from the start codon to the stop codon corresponds to the full-length gene, and in the case of a protein, the polypeptide or peptide consisting of the amino acid sequence encoded by the full-length gene corresponds to the full-length protein. However, in the case of secreted proteins, the endogenous signal peptide contained at the N-terminus is cleaved and removed during the secretion process and is ultimately not included. Therefore, in the case of secreted proteins, the signal peptide may not be included in the "full length." In this specification, the full-length protein before the signal peptide is cleaved and removed during the secretion process is called the "precursor protein," and the full-length protein after the signal peptide has been cleaved and removed is called the "mature protein" to distinguish between the two.

[0026] In this specification, "exon" refers to the region of a gene's base sequence that remains in the mature transcript. Generally, in eukaryotes, after a gene is transcribed as a primary transcript, intervening regions called "introns" are removed by splicing, and exons are linked together to form the mature transcript. In this specification, "exon sequence" refers to the base sequence corresponding to an exon, and "intron sequence" refers to the base sequence corresponding to an intron. For any gene, the exon and intron sequences can be determined by comparing the gene's genome sequence with its cDNA sequence. However, it is also possible to obtain sequence information publicly available on databases such as the National Center for Biotechnology Information (NCBI), or to predict the exon / intron structure using genome analysis tools available in this field. For example, for silkworm genetic information, exon and intron sequences can be searched using databases such as KAIKObase and KAIKOcDNA, which are available in the Agrigenomics Information Database.

[0027] In this specification, "target gene sequence" means a gene sequence that codes for a target protein or a fragment thereof. The target gene sequence may be a gene sequence derived from a genome or a gene sequence consisting of cDNA, and may or may not contain introns. Furthermore, the target gene sequence may or may not contain a stop codon in addition to the gene sequence that codes for the target protein or a fragment thereof, and may or may not contain a transcription termination sequence downstream of the stop codon.

[0028] In this specification, "target protein" refers to the desired protein encoded by the target gene. The type of target protein is not limited. It may be either a structural protein or a functional protein. Examples of structural proteins include fibrous proteins such as collagen, actin, myosin, and fibroin, as well as keratin and histones. Examples of functional proteins include peptide hormones (insulin, calcitonin, parathyroid hormone, growth hormone, etc.), cytokines (granulocyte-macrophage colony-stimulating factor (GM-CSF), epidermal growth factor (EGF), fibroblast growth factor (FGF), interleukin (IL), interferon (IFN), tumor necrosis factor α (TNF-α), transforming growth factor β (TGF-β), etc.), transcription factors (including GAL4), antibodies (immunoglobulins, etc.), serum albumin, hemoglobin, enzymes, fluorescent proteins, pigment-synthesizing proteins, and luminescent proteins. The immunoglobulin may be any class (e.g., IgG, IgE, IgM, IgA, IgD, and IgY) or any subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, IgA2). The fluorescent protein is not limited and may be, for example, CFP, AmCyan, RFP, DsRed, YFP, or GFP (including derivatives such as EGFP and EYFP). The pigment synthesis protein may be, for example, a protein involved in the biosynthesis of melanin pigments (including dopamine melanin), ommochrome pigments, or pteridine pigments. The luminescent protein may be, for example, aequorin or luciferase. The target protein may be either a wild-type protein or a mutant protein.

[0029] In this specification, "fragment" of a protein means a polypeptide or peptide that contains a portion of a full-length protein. Preferably, the fragment retains activity. For example, it may retain 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 98% or more, or equivalent or greater of the activity of the full-length protein. The amino acid length of the fragment is not particularly limited as long as it retains the activity of the full-length protein, but for example, it may be 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, or 98% or more of the total length.

[0030] In this specification, a "transcription termination sequence" is a sequence that can terminate the transcription of a gene, and is also called a terminator. The type of transcription termination sequence is not particularly limited. Preferably, it is a terminator derived from the same species as the genetically modified lepidopteran insect. For example, in insects such as silkworms, the hsp70 terminator, SV40 terminator, etc., can be used. In this specification, "multiple" means two or more integers, for example, 2 to 10, 2 to 7, 2 to 5, 2 to 4, or 2 to 3 integers.

[0031] In this specification, "identity" of a nucleotide sequence refers to the percentage (%) of identical nucleotides in the total length of the nucleotide sequence when the two nucleotide sequences being compared are aligned by inserting gaps as appropriate, if necessary, into one or both of them, in order to maximize the number of identical nucleotides.

[0032] In this specification, "homologous sequence" refers to a nucleotide sequence that has approximately 60% or more identity with respect to a reference sequence. The identity of a homologous sequence with respect to a reference sequence may be, for example, 70% or more, 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 99.9% or more. Furthermore, "genome homologous sequence" refers to a nucleotide sequence that has any of the above-mentioned levels of identity with respect to the genome sequence of a lepidopteran insect as the reference sequence, and "genome sequence" refers to a sequence that has 100% identity with respect to its corresponding nucleotide sequence on the genome.

[0033] In this specification, "amino acid identity" refers to the percentage of identical amino acid residues in the total number of amino acid residues when the amino acid sequences of two polypeptides being compared are aligned by inserting gaps as necessary into one or both of them in order to maximize the number of identical amino acid residues.

[0034] In this specification, "amino acid substitution" refers to substitutions between the 20 amino acids that make up natural proteins, within the conserved amino acid group, which has similar properties such as charge, side chain, polarity, and aromaticity. Examples include substitutions within the uncharged polar amino acid group with low-polarity side chains (Gly, Asn, Gln, Ser, Thr, Cys, Tyr), branched-chain amino acid group (Leu, Val, Ile), neutral amino acid group (Gly, Ile, Val, Leu, Ala, Met, Pro), neutral amino acid group with hydrophilic side chains (Asn, Gln, Thr, Ser, Tyr, Cys), acidic amino acid group (Asp, Glu), basic amino acid group (Arg, Lys, His), and aromatic amino acid group (Phe, Tyr, Trp).

[0035] In this specification, "5' end" and "3' end" refer to directions based on the 5' and 3' ends, respectively, of the transcripts transcribed from endogenous genes, unless otherwise specified. Furthermore, in this specification, "upstream" and "downstream" refer to the upstream and downstream directions of the gene, respectively, based on the transcription direction of the endogenous gene, unless otherwise specified.

[0036] 1-3. Structure The genetically modified lepidopteran insect of the present invention includes a target gene sequence encoding a target protein or a fragment thereof in the exon sequence encoding a signal peptide or a functional fragment thereof of an endogenous gene. The target gene sequence is included in the exon sequence such that the target protein or a fragment thereof is fused to the C-terminal side of the signal peptide or functional fragment thereof.

[0037] In this specification, "exon sequence encoding a signal peptide of an endogenous gene or a functional fragment thereof" (hereinafter often referred to as "target exon sequence" in this specification) is not limited to any exon sequence encoding a signal peptide in an endogenous gene. Typically, in an endogenous gene, the signal peptide is encoded in the first exon, which is the most upstream in the mRNA transcribed from that endogenous gene, or in a sequence of multiple exons including the first exon; however, the target exon sequence may be any of these exon sequences. For example, the target exon sequence may be the first, second, third, or fourth exon. The target exon sequence may also be, for example, the exon encoding the C-terminal amino acid residue of the signal peptide, or the exon adjacent to its 5' end.

[0038] In the genetically modified lepidopteran insect of the present invention, the target gene sequence is inserted into the target exon sequence such that the target protein or fragment thereof encoded by the target gene sequence is fused to the C-terminal side of the signal peptide or functional fragment thereof of the endogenous gene. More specifically, the target gene sequence is in-frame ligated to the 3' end of the nucleotide sequence encoding the signal peptide or functional fragment thereof in the target exon sequence of the endogenous gene. Therefore, the N-terminus of the target protein or fragment thereof is fused to the C-terminus of the signal peptide or functional fragment thereof of the endogenous gene, and a fusion gene encoding a fusion polypeptide containing the signal peptide or functional fragment thereof of the endogenous gene and the target protein or fragment thereof is formed at the locus of the endogenous gene. In this fusion polypeptide, the signal peptide or functional fragment thereof and the target protein or fragment thereof may be directly linked, or an amino acid sequence other than the signal peptide encoded by the target exon sequence (for example, the amino acid sequence located at the N-terminus in the mature protein described later) may be inserted between them.

[0039] In one embodiment, the endogenous gene encodes a protein that constitutes silk. The protein that constitutes silk is not particularly limited and may be, for example, fibroin, sericin, and / or fibrohexamarin. The fibroin may be a fibroin H chain and / or a fibroin L chain. The sericin is not particularly limited and may be, for example, sericin 1.

[0040] In the silkworm fibroin H chain, the precursor protein containing the signal peptide consists of the amino acid sequence shown in SEQ ID NO: 1, while the mature protein excluding the signal peptide consists of the amino acid sequence shown in SEQ ID NO: 2. The signal peptide of the fibroin H chain consists of the amino acid sequence from positions 1 to 21 in SEQ ID NO: 1.

[0041] In the silkworm fibroin heavy chain gene, the signal peptide is encoded by the first and second exons, with the C-terminal amino acid residue of the signal peptide being encoded by the second exon (Figure 2B). In the genome sequence shown in Sequence ID 3 of the fibroin heavy chain gene, the first exon is located at positions 1001 to 1042, the first intron is located at positions 1043 to 2013, and the second exon includes positions 2014 to at least 17763, with the region encoding the signal peptide in the second exon being from positions 2014 to 2034.

[0042] In the silkworm fibroin light chain, the precursor protein containing the signal peptide consists of the amino acid sequence shown in SEQ ID NO: 4, while the mature protein excluding the signal peptide consists of the amino acid sequence shown in SEQ ID NO: 5. The signal peptide of the fibroin light chain consists of the amino acid sequence from positions 1 to 16 in SEQ ID NO: 4.

[0043] In the silkworm fibroin light chain gene, the signal peptide is encoded by the first, second, and third exons, with the C-terminal amino acid residue of the signal peptide being encoded by the third exon (Figure 2C). In the genome sequence shown in Sequence ID No. 6, the first exon of the fibroin light chain gene is located at positions 574-889, the first intron at positions 890-966, the second exon at positions 967-1036, the second intron at positions 1037-8976, and the third exon at positions 8977-9059. The region of the third exon that encodes the signal peptide is located at positions 8977-8988.

[0044] In silkworm sericin 1, multiple isoforms are generated by alternative splicing. In one example of the isoforms, the precursor protein containing the signal peptide consists of the amino acid sequence shown in SEQ ID NO: 7, while the mature protein excluding the signal peptide consists of the amino acid sequence shown in SEQ ID NO: 8. In the above isoforms of sericin 1, the signal peptide consists of the amino acid sequence from positions 1 to 19 in SEQ ID NO: 7.

[0045] In the silkworm sericin-1 gene, the signal peptide of the above isoform is encoded by the first and second exons, and the C-terminal amino acid residue of the signal peptide is encoded by the second exon (Figure 2A). In the genome sequence shown in Sequence ID No. 9, the first exon of the above isoform in the sericin-1 gene is located at positions 947-1039, the first intron is located at positions 1040-3051, and the second exon is located at positions 3052-3082. The region in the second exon that encodes the signal peptide is located at positions 3052-3069.

[0046] In silkworm fibrohexamarin, the precursor protein containing the signal peptide consists of the amino acid sequence shown in SEQ ID NO: 10, while the mature protein excluding the signal peptide consists of the amino acid sequence shown in SEQ ID NO: 11. The signal peptide of fibrohexamarin consists of the amino acid sequence from positions 1 to 17 in SEQ ID NO: 10.

[0047] In the silkworm fibrohexamarin gene, the signal peptide is encoded by the first exon, and the C-terminal amino acid residue of the signal peptide is encoded by the first exon. In the genome sequence shown in Sequence ID No. 12, the first exon of the fibrohexamarin gene is located at positions 918 to 1052, the first intron is at positions 1053 to 1536, and the second exon is at positions 1537 to 1756. The region in the first exon that encodes the signal peptide is located at positions 1001 to 1051.

[0048] In the genetically modified lepidopteran insect of the present invention, the target gene sequence may be introduced into a single endogenous gene or into multiple endogenous genes. Furthermore, the genetically modified lepidopteran insect of the present invention may have an exon sequence containing the target gene sequence in a heterozygous state or in a homozygous state. When the target gene sequence is introduced into multiple endogenous genes, the types of target gene sequences introduced into the multiple endogenous genes may be the same or different.

[0049] In one embodiment, the multiple endogenous genes into which the target gene sequence is introduced may be genes encoding fibroin H chain and fibroin L chain, genes encoding fibroin H chain and sericin 1, or genes encoding fibroin H chain, fibroin L chain, and sericin 1.

[0050] In one embodiment, the target gene sequence in the genetically modified lepidopteran insect of the present invention has a stop codon. In a further embodiment, the target exon sequence in the genetically modified lepidopteran insect of the present invention includes a transcription termination sequence at the 3' end of the stop codon of the target gene sequence.

[0051] In one embodiment, the target protein is a fluorescent protein, antibody, antigen polypeptide, enzyme, cytokine, or antimicrobial polypeptide. For example, if the target protein is an antibody, the heavy chain gene and light chain gene constituting the antibody may be introduced into different endogenous genes.

[0052] 1-4. Effects The genetically modified lepidopteran insects of the present invention can stably and in large quantities produce the target protein encoded by the target gene introduced into the target exon sequence.

[0053] In conventional GAL4 / UAS systems, the GAL4 gene and UAS regulatory sequence are introduced at random locations on the genome, which can lead to significant fluctuations in the expression level of the target protein. However, in the genetically modified lepidopteran insects of the present invention, the target gene can be expressed by directly utilizing the promoter and enhancer activity of the endogenous gene, thus enabling more reliable control of the expression level.

[0054] 2. Double-stranded circular DNA 2-1. Overview A second aspect of the present invention is a double-stranded circular DNA. According to this aspect of the double-stranded circular DNA, a target gene sequence can be introduced into a target exon sequence located at the 3' end of a genomic break site within an intronic sequence in endogenous genes of lepidopteran insects. This aspect of the double-stranded circular DNA can be used, for example, for knock-in of a target gene using the TAL-PITCh (precise integration into target chromosome) method.

[0055] 2-2.Definition In this embodiment, "double-stranded circular DNA" means a circular double-stranded DNA molecule containing at least the target gene sequence for introducing the target gene sequence into an endogenous gene of a lepidopteran insect. The double-stranded circular DNA is preferably a vector that can be maintained and / or replicated within bacterial cells such as E. coli, and may contain sequences necessary for maintenance and replication within the cell (such as a replication origin and / or a gene encoding an antibiotic resistance protein). The double-stranded circular DNA may also be, for example, a plasmid vector.

[0056] In this specification, "genome editing" refers to a gene targeting technology that utilizes DNA repair mechanisms associated with double-strand breaks (DSBs) by DNA-cutting enzymes to insert foreign genes (knock-in) or disrupt target genes (knock-out) at arbitrary locations on the genome. While zinc finger nuclease (ZFN) methods, TALEN methods, and CRISPR / Cas methods are known genome editing technologies, any of these methods may be used in this specification.

[0057] The "TALEN (Transcription Activator-Like Effector Nuclease) method" is a genome editing technology that uses an artificial DNA-cutting enzyme fused with a TAL effector (TALE) protein derived from the plant pathogenic bacterium Xanthomonas, and a nonspecific endonuclease domain. TALEN is a protein consisting of a TALE domain containing repeating DNA-binding units as a DNA-binding domain and a nonspecific endonuclease domain, such as the nuclease domain of FokI. Of these, the nuclease domain, which has enzymatic activity to cut DNA, functions as a dimer. Therefore, TALEN functions as a dimer consisting of a polypeptide that recognizes the DNA sequence near the upstream (5' side) of the double-strand break (DSB) site in the target base sequence (often referred to herein as "Left-TALEN") and a polypeptide that recognizes the DNA sequence near the downstream (3' side) of the DSB site (often referred to herein as "Right-TALEN"). The DNA-binding unit constituting the TALE domain has mutations in the amino acid residues at positions 12 and 13 from the N-terminus, and each pair of amino acids can specifically recognize one of the four bases that make up DNA (A: adenine, G: guanine, C: cytosine, T: thymine). For example, when the amino acid residues at positions 12-13 are NI or NN, it recognizes adenine; when NN, it recognizes guanine; when HD, it recognizes cytosine; and when NG, it recognizes thymine. The number of repeats in the DNA-binding unit can be varied according to the base length of the target base sequence. By manipulating the TALE domain, gene targeting targeting any DNA sequence on the genome becomes possible. Gene knockout methods using the TALEN method in lepidopteran insects such as silkworms are known techniques. For example, the method described in Takasu Y., et al., 2013, PLoS One 8, e73458 can be used as a reference.

[0058] The "Zinc-Finger Nuclease (ZFN) method" is a genome editing technology that uses an artificial DNA-cutting enzyme consisting of a zinc finger domain as a DNA-binding domain and a non-specific endonuclease domain, such as the nuclease domain of FokI. Since one zinc finger motif can recognize three bases and bind to the target nucleic acid, linking multiple zinc finger motifs together allows for the specific recognition and binding of three times the number of linked motifs. It functions as a dimer and, after binding to the target site, performs double-strand breaks (DSBs) at specific sites of the target nucleic acid through endonuclease activity.

[0059] The CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR-associated proteins) method is a genome editing technology that utilizes the adaptive immune system evolved in bacteria and archaea to eliminate foreign DNA or RNA such as viruses and plasmids. While the CRISPR / Cas9 method utilizes the Cas9 protein, variations using other Cas proteins such as Cpf1 and Cas13a have also been reported. Bacteria and archaea fragment invading foreign DNA or RNA, insert it into the CRISPR region of their genome, and use it as a template to synthesize approximately 40 bp of CRISPR RNA (crRNA). The crRNA binds to a Cas protein with nuclease activity, either directly or via trans-active RNA (tracrRNA), to form a CRISPR / Cas complex. The CRISPR / Cas complex, via crRNA, binds to and cleaves a target DNA or RNA sequence with a complementary base sequence. When double-stranded nucleases such as Cas9 and Cpf1 are used as the Cas protein, DSBs are induced at the target site.

[0060] In this specification, "genome editing enzyme" refers to a protein that has the activity to specifically cleave and edit target sites on the genome. Examples of genome editing proteins include TALEN (Transcription activator-like effector nuclease), Cas9 (CRISPR associated protein 9), and ZFN (zinc finger nuclease), which can be used for genome editing as described above. When the genome editing protein is a TALEN, Left TALEN and Right TALEN can be used as TALENs that can function as dimers. When the genome editing protein is Cas9, a guide RNA such as the crRNA described above is required to perform genome editing.

[0061] 2-3. Composition The double-stranded circular DNA of this embodiment includes a first recognition sequence, a second spacer sequence, a first spacer sequence, a genome homologous sequence, and a target gene sequence in this order. Here, the first recognition sequence, the second spacer sequence, the first spacer sequence, and the genome homologous sequence are derived from the base sequences of the genomic region containing the target endogenous gene into which the target gene sequence is introduced. The double-stranded circular DNA of this embodiment includes a second recognition sequence at the 5' end of the genome homologous sequence.

[0062] In the introduction of a target gene using double-stranded circular DNA according to this embodiment, two genome editing enzymes (hereinafter referred to as "first genome editing enzyme" and "second genome editing enzyme") are used to create a double-strand break site within the intron sequence on the genome of the target endogenous gene. In this specification, this double-strand break site is referred to as the "genome break site." The genome break site can be set at any position within the intron sequence of the endogenous gene, but it is preferable to place it at a position other than functional sequences such as splice donor sequences, splice acceptor sequences, and branch sites necessary for splicing. In some cases, the genome break site may not be accurately identified depending on the type of genome editing enzyme, but even in such cases, when designing the double-stranded circular DNA of the present invention, each element sequence constituting the double-stranded circular DNA is identified based on the assumed position as the genome break site, and the position in which the two genome editing enzymes actually cut the genome and double-stranded circular DNA is not limited to that position, but may be a nearby position (for example, any position in the first spacer sequence and / or the second spacer sequence).

[0063] The first recognition sequence, the second spacer sequence, and the second recognition sequence located at the 5' end of the genome homologous sequence contained in the double-stranded circular DNA of this embodiment are derived from a nucleotide sequence located near the genome break site in the genome sequence of the endogenous gene. The "first recognition sequence" and the "second recognition sequence" are identical to the nucleotide sequences located at the 5' end and 3' end, respectively, of the genome break site in the genome sequence of the endogenous gene, and are recognized and bound by the first genome editing enzyme and the second genome editing enzyme, respectively. The nucleotide lengths of the first recognition sequence and the second recognition sequence vary depending on the type of genome editing enzyme, but are usually 8 to 30 nucleotides long, for example, 10 to 25 nucleotides long, 12 to 20 nucleotides long, or 14 to 18 nucleotides long. The "first spacer sequence" is derived from a sequence adjacent to the 5' end of the genome break site in the genome sequence of the endogenous gene, and is derived from a nucleotide sequence located between the first recognition sequence and the genome break site. The "second spacer sequence" originates from a sequence adjacent to the 3' end of the genome break site in the genome sequence of the endogenous gene, and is derived from a base sequence located between the genome break site and the second recognition sequence mentioned above. The base lengths of the first and second spacer sequences vary depending on the type of genome editing enzyme, but are usually 6 to 30 bases long, for example, 8 to 25 bases, 10 to 20 bases, or 12 to 15 bases. Here, while the endogenous gene contains the first recognition sequence, first spacer sequence, second spacer sequence, and second recognition sequence in order from the upstream side of the gene, the double-stranded circular DNA of this embodiment is characterized by the reversed arrangement of the first and second spacer sequences.

[0064] The genome homologous sequence contained in the double-stranded circular DNA of this embodiment includes the second recognition sequence described above at its 5' end and consists of a base sequence homologous to the genome sequence from the second recognition sequence to the exon sequence or a subsequence thereof located at the 3' end of the intron sequence containing the genome cleavage site. Here, the exon sequence or subsequence thereof located at the 3' end of the intron sequence containing the genome cleavage site may be an exon sequence adjacent to the 3' end of the intron sequence containing the genome cleavage site. In the double-stranded circular DNA of this embodiment, the exon sequence or subsequence thereof contained at the 3' end of the genome homologous sequence encodes the C-terminal side of a signal peptide or its functional fragment and is ligated in-frame to the target gene sequence located further at its 3' end. In the double-stranded circular DNA of this embodiment, the genome homologous sequence is not particularly limited as long as it includes the second recognition sequence of the genome editing enzyme. The base lengths of genome homologous sequences may be, for example, 15 to 20,000 base lengths, 20 to 10,000 base lengths, 50 to 5,000 base lengths, 100 to 2,000 base lengths, or 500 to 1,000 base lengths.

[0065] In one embodiment, the double-stranded circular DNA of this embodiment comprises the first recognition sequence, the second spacer sequence, the first spacer sequence, and the second recognition sequence in the genome homologous sequence.

[0066] In one embodiment, the target gene sequence in the double-stranded circular DNA of this embodiment includes a stop codon. In a further embodiment, the double-stranded circular DNA of this embodiment includes a transcription termination sequence at the 3' end of the target gene sequence.

[0067] In one embodiment, the double-stranded circular DNA of this embodiment includes a marker gene for identifying an individual in which the target gene sequence has been introduced into an endogenous gene. For example, the marker gene can be located 3' to the end of a transcription termination sequence located at the 3' end of the target gene sequence.

[0068] The type of genome editing enzyme that recognizes the first and second recognition sequences contained in the double-stranded circular DNA of this embodiment is not limited and may be TALEN, ZFN, and / or Cas9. For example, the genome editing enzyme that recognizes the first and second recognition sequences may be TALEN. In this case, the two genome editing enzymes that recognize the first and second recognition sequences may be Left-TALEN and Right-TALEN, which function as a dimer. In one embodiment, the endogenous gene in this aspect comprises multiple exons, including the first exon, that encode a signal peptide.

[0069] 2-4. Effects By introducing the double-stranded circular DNA of this embodiment into the eggs of lepidopteran insects together with first and second genome editing enzymes, microhomology-mediated end-joining becomes possible between the first spacer sequence adjacent to the genome break site on the genome and the first spacer sequence in the double-stranded circular DNA. This allows the insertion of the target gene sequence into the target exon sequence located at the 3' end of the genome break site within the intron sequence in endogenous genes of lepidopteran insects.

[0070] In one embodiment, the double-stranded circular DNA of this embodiment can be used in the TAL-PITCh method. For information on the TAL-PITCh method, please refer to the known technical literature (Nature communications, 2014, 5:5560).

[0071] 3. Donor nucleic acids 3-1. Overview A third aspect of the present invention is a donor nucleic acid. According to the donor nucleic acid of this aspect, a target gene sequence can be introduced into a target exon sequence located at the 3' or 5' end of a genome break site within an intron sequence in an endogenous gene of a lepidopteran insect. The donor nucleic acid of this aspect can be used, for example, for knock-in of a target gene based on homologous recombination.

[0072] 3-2. Composition In this specification, "donor nucleic acid" refers to nucleic acid used to introduce a target gene sequence into the endogenous genes of lepidopteran insects. The form of the donor nucleic acid is not limited; for example, it may be double-stranded circular DNA such as a plasmid vector or linear DNA.

[0073] The donor nucleic acid in this embodiment includes a first genome homologous sequence and a second genome homologous sequence, and a target gene sequence positioned between them. The first genome homologous sequence and the second genome homologous sequence are derived from the base sequences of a genome region containing an endogenous gene that is the target into which the target gene sequence is introduced.

[0074] In the introduction of a target gene using donor nucleic acid according to this embodiment, a genome editing enzyme that recognizes sequences in the vicinity of a double-strand break site is used in the intron sequence of the genome of the target endogenous gene in order to create a double-strand break site. As in the second embodiment, this double-strand break site is also referred to as the "genome break site" in this embodiment. As mentioned above, depending on the type of genome editing enzyme, it may not be possible to accurately identify the genome break site. However, even in such cases, when designing the donor nucleic acid of the present invention, each element sequence constituting the donor nucleic acid is identified based on the assumed position as the genome break site, and the position in which the genome editing enzyme actually cuts the genome is not limited to that position, but may be a position in the vicinity. The genome break site can be set at any position within the intron sequence of the endogenous gene, but it is preferable to place it at a position other than the splice donor sequence, splice acceptor sequence, branch site, etc., which are necessary for splicing. In this embodiment, the sequence recognized by this genome editing enzyme is referred to as the "genome editing enzyme recognition sequence" or simply the "recognition sequence".

[0075] The specific configurations of the first and second genome homologous sequences contained in the donor nucleic acid in this embodiment differ depending on whether the genome cleavage site is located on the 5' end side of the target exon sequence into which the target gene sequence is introduced, or on the 3' end side of the genome cleavage site. Therefore, these will be explained separately below.

[0076] (1) Embodiment in which the genome cleavage site is located on the 5' end of the target exon sequence. In embodiments where the genome cleavage site is located at the 5' end of the target exon sequence, the first genome homologous sequence consists of a nucleotide sequence homologous to the genome sequence from a nucleotide located 5' end of the genome cleavage site on the genome (for example, a nucleotide located 10, 20, 50, 100, 500, or 1,000 or more nucleotides upstream of the genome cleavage site) to the target exon sequence or a subsequence thereof located at (or adjacent to) the 3' end of the intron sequence containing the genome cleavage site. In this embodiment, the genome sequence corresponding to the first genome homologous sequence has a mutation in its recognition sequence so that it is not cleaved by the genome editing enzyme that cleaves the genome cleavage site described above. The type of such mutation is not particularly limited and may be, for example, a substitution, deletion, and / or insertion of a nucleotide in the recognition sequence. The number of mutated nucleotides in the recognition sequence is not particularly limited. For example, one or more bases may be substituted, deleted, and / or inserted; more specifically, one or more, two or more, three or more, four or more, five or more, or six or more bases may be substituted, deleted, and / or inserted. In this embodiment, the second genome homologous sequence consists of a base sequence homologous to a genome sequence located 3' end-to-3' of the target sequence or a subsequence thereof.

[0077] In this embodiment, the base lengths of the first and second genome homologous sequences are not particularly limited and may be, for example, 100 to 20,000 base lengths, 200 to 10,000 base lengths, 500 to 5,000 base lengths, or 1,000 to 2,000 base lengths.

[0078] (2) Embodiment in which the genome cleavage site is located on the 3' end side of the target exon sequence. In embodiments where the genome cleavage site is located on the 3' end of the target exon sequence, the first genome homologous sequence consists of a base sequence homologous to the genome sequence from a base located 5' end of the intron sequence containing the genome cleavage site (specifically, a base 5' end of the position in the target exon sequence where the target gene sequence is inserted, for example, a base located 100, 200, 500, 1,000, 5,000, or 10,000 or more bases upstream from the position where the target gene sequence is inserted) to the target exon sequence or a subsequence thereof located on the 5' end (or adjacent) of the intron sequence (for example, up to the base encoding the C-terminal amino acid residue of the signal peptide or its functional fragment in the target exon sequence, or up to the base encoding an amino acid residue further C-terminal than the C-terminal amino acid residue of the signal peptide or its functional fragment in the target exon sequence).

[0079] In this embodiment, the second genome homologous sequence consists of a nucleotide sequence homologous to the genome sequence from a nucleotide located 3' end-to-5' end-to-3' of the target exon sequence or a subsequence thereof (for example, a nucleotide encoding an amino acid residue further C-terminal than the C-terminal amino acid residue of the signal peptide or its functional fragment in the target exon sequence) to a nucleotide located 3' end-to-3' of the genome cleavage site (for example, a nucleotide located 10, 20, 50, 100, 500, 1,000, 5,000, or 10,000 or more nucleotides downstream of the genome cleavage site). In this embodiment, the genome sequence corresponding to the second genome homologous sequence has a mutation in its recognition sequence so as not to be cleaved by the genome editing enzyme that cleaves the genome cleavage site described above. The type of mutation and the number of mutated nucleotides are not particularly limited, and as in (1) above, for example, it may be a substitution, deletion, and / or insertion of one or more nucleotides in the recognition sequence.

[0080] In this embodiment, the base lengths of the first and second genome homologous sequences are not particularly limited and may be, for example, 100 to 20,000 base lengths, 200 to 10,000 base lengths, 500 to 5,000 base lengths, or 1,000 to 2,000 base lengths.

[0081] In the donor nucleic acid of this embodiment, a target exon sequence or a partial sequence thereof contained in either the first or second genome homologous sequence is in-frame linked to a target gene sequence located further 3' to it via a nucleotide sequence that encodes a signal peptide or a functional fragment thereof or its C-terminal sequence, and optionally multiple amino acid residues.

[0082] In one embodiment, the target gene sequence in the donor nucleic acid of this embodiment includes a stop codon. In a further embodiment, the donor nucleic acid of this embodiment includes a transcription termination sequence at the 3' end of the target gene sequence. In one embodiment, the donor nucleic acid of this embodiment includes a labeling gene for identifying genetically modified lepidopteran insects in which a target gene sequence has been introduced into an endogenous gene. The type of genome editing enzyme used in the homologous recombination method using donor nucleic acids in this embodiment is not limited and may be TALEN, ZFN, and / or Cas9.

[0083] In one embodiment, the donor nucleic acid of this embodiment includes a nuclease recognition sequence at the end of the first genome homologous sequence and / or the second genome homologous sequence opposite to the target gene sequence. The nuclease recognition sequence is not particularly limited and may be a recognition sequence for a genome editing enzyme that cuts at the above-mentioned genome cleavage site, or a restriction enzyme recognition sequence that can be cut by any restriction enzyme different from that genome editing enzyme. If the nuclease recognition sequence is a TALEN recognition sequence, the nuclease recognition sequence may be a combination of two recognition sequences recognized by Left TALEN and Right TALEN.

[0084] 3-3. Effects By introducing the donor nucleic acid of this embodiment into the eggs of lepidopteran insects together with a genome editing enzyme, homologous recombination can be induced in the endogenous genes of lepidopteran insects, and the target gene sequence can be inserted into the target exon sequence.

[0085] 4. Method for creating genetically modified lepidopteran insects 4-1. Overview A fourth aspect of the present invention is a method for producing genetically modified lepidopteran insects. The method of this aspect involves introducing the double-stranded circular DNA described in the second aspect or the donor nucleic acid described in the third aspect into the eggs of lepidopteran insects by microinjection, thereby introducing the target gene sequence into the exon sequence of an endogenous gene and producing genetically modified lepidopteran insects.

[0086] 4-2. Method The present invention includes an introduction step as an essential step, in which double-stranded circular DNA or donor nucleic acid is introduced into the eggs of lepidopteran insects by microinjection, and includes an egg acquisition step and a genetically modified lepidopteran insect selection step as selection steps. The structure of each step will be described below.

[0087] (1) Egg acquisition process The "egg acquisition process" is the process of obtaining eggs by having adult female silkworms lay eggs. The method of egg acquisition should be carried out according to the standard methods in this field. Egg laying begins when an egg-laying mat is provided to the female silkworm after mating. The temperature during egg laying is 23-28°C, preferably around 25°C. Typically, female silkworms begin laying eggs a few hours after mating. In order to incorporate the DNA introduced into the egg into the nucleus, microinjection must be performed within 2-8 hours, preferably 3-6 hours, after egg laying.

[0088] (2) Introduction process The "introduction process" is the process of introducing double-stranded circular DNA or donor nucleic acid into the eggs of lepidopteran insects using the microinjection method.

[0089] In the embodiment of the production method of this embodiment, in the embodiment in which the introduction step introduces double-stranded circular DNA into the egg, the composition of the double-stranded circular DNA is as described in the second embodiment. In the introduction step of this embodiment, the double-stranded circular DNA described in the second embodiment, the first genome editing enzyme described in the second embodiment or nucleic acid encoding the first genome editing enzyme in a state capable of expressing it, and the second genome editing enzyme described in the second embodiment or nucleic acid encoding the second genome editing enzyme in a state capable of expressing it are introduced into the egg of a lepidopteran insect by microinjection.

[0090] In the method for production according to this embodiment, in the embodiment in which the introduction step involves introducing donor nucleic acid into an egg, the composition of the donor nucleic acid is as described in the third embodiment. In the introduction step of this embodiment, the donor nucleic acid described in the third embodiment, the genome editing enzyme described in the third embodiment, or a nucleic acid encoding a genome editing enzyme in a state capable of expression is introduced into the egg of a lepidopteran insect by microinjection.

[0091] In this specification, "expression-ready state" means that the gene to be expressed is located in the downstream region of the promoter, under the control of the promoter. Furthermore, the nucleic acid encoding the genome editing enzyme in an expression-ready state may be RNA such as mRNA, or DNA such as plasmid DNA or linear DNA. The DNA encoding the genome editing enzyme in an expression-ready state includes a promoter expressible in the eggs of lepidopteran insects in addition to the base sequence encoding the first or second genome editing enzyme, and may optionally include components such as a labeling gene (selection marker), enhancer, terminator, origin of replication, and poly(A) signal.

[0092] The microinjection method can be carried out by methods known in the field. For example, the injection solution is prepared by dissolving or diluting double-stranded circular DNA or donor nucleic acid and genome editing enzyme or nucleic acid encoding a genome editing enzyme in an expressible state with a solvent such as water or buffer to an appropriate concentration. Subsequently, microinjection is performed on fertilized eggs 3 to 6 hours post-laying. The amount of nucleic acid to be introduced is not particularly limited. It can be determined as appropriate depending on the type, properties, and purpose of the nucleic acid. Usually, 50 nL to 30 nL is sufficient. After introduction, the lepidopteran insect eggs should be incubated under appropriate conditions, for example, at 25°C, until hatching.

[0093] (3) Selection process for genetically modified lepidopteran insects The "genetically modified lepidopteran insect selection process" is the process of selecting genetically modified lepidopteran insects from hatched lepidopteran insects. This process can also be carried out by methods known in the field. For example, if the double-stranded circular DNA or donor nucleic acid used in the introduction process contains a labeling gene, the target genetically modified lepidopteran insect can be easily selected based on the expression of that labeling gene. In this specification, "labeled gene" refers to a polynucleotide consisting of a base sequence that encodes a labeled protein, also known as a selection marker.

[0094] In this specification, "labeled protein" refers to a protein that can confer new traits not present in the host lepidopteran insect through the expression of a labeled gene, and includes enzymes, fluorescent proteins, pigment-synthesizing proteins, or luminescent proteins. Based on the activity of the labeled protein, it becomes possible to easily identify transformants possessing the introduced nucleic acid.

[0095] 5. Method for producing the target protein or fusion protein 5-1. Overview A fifth aspect of the present invention is a method for producing a target protein, a fragment thereof, or a fusion protein containing the same. According to the production method of this aspect, a large quantity of the target protein, a fragment thereof, or a fusion protein containing the same can be produced using a genetically modified lepidopteran insect of the first aspect or a genetically modified lepidopteran insect produced by the production method described in the fourth aspect.

[0096] 5-2. Production Method The production method of the present invention includes a rearing step and a harvesting step. Each step will be described below.

[0097] (1) Rearing process The "reproduction process" refers to the process of raising genetically modified lepidopteran insects produced by the first embodiment or the fourth embodiment. Regarding the method of raising genetically modified lepidopteran insects, it is sufficient to use techniques known in the relevant field for each type of lepidopteran insect. For example, if the insect is a silkworm, one should refer to "General Principles of Silkworm Breeding; by Takeo Takami, published by the Japan Silkworm Breeding Association." The feed may be natural leaves of host plant species, such as leaves of the genus Morus for silkworms and mulberry silkworms, leaves of castor bean (Ricinus communis) or cinnamon (Ailanthus altissima) for Eri silkworms, or leaves of the family Fagaceae for sax silkworms. Alternatively, artificial feed such as Silk Mate L4M or for 1-3 instar silkworms (Nippon Nosan Kogyo) may be used. Artificial feed is preferred because it suppresses disease occurrence, allows for stable quality and quantity of feed, and enables aseptic rearing when necessary. The following is a simple explanation of how to raise silkworms, using silkworms as an example.

[0098] Egg rearing is carried out using eggs laid by a suitable number (e.g., 4-10) of genetically modified female lepidopteran insects of the same lineage. After hatching, the larvae are transferred from the egg tray to a container lined with anti-drying paper (paraffin-coated paper) which serves as a silkworm bed, and artificial feed such as Silk Mate is placed on the anti-drying paper and fed. As a general rule, the feed is changed once each for the 1st and 2nd instars, and 1-3 times for the 3rd instar. If there is a lot of leftover old feed, it should be removed to prevent spoilage. For rearing of mature silkworm larvae in the 4th and 5th instars, they are transferred to larger containers, and the number of larvae per container is adjusted as appropriate. Depending on the humidity and the conditions inside the container, the container may be covered with anti-drying paper, acrylic, or mesh. The rearing temperature should be 25-28°C throughout all instars.

[0099] (2) Recovery process The "recovery process" is a process of recovering the target protein, its fragments, or fusion proteins containing it, which have been expressed and secreted within the silk gland cells of genetically modified lepidopteran insect larvae and subsequently accumulated in the lumen of the silk glands.

[0100] The genetically modified lepidopteran insects used in this embodiment express a precursor protein in silk gland cells, which is a fusion protein containing the target protein or a fragment thereof, or a mature protein encoded by an endogenous gene or its C-terminal fragment (hereinafter referred to as "target protein, etc.") with a signal peptide or its functional fragment fused to its N-terminus. The precursor protein expressed in silk gland cells is transported to the endoplasmic reticulum by the action of the signal peptide or its functional fragment, and after the signal peptide or its functional fragment is cleaved by enzymes such as peptidases in the endoplasmic reticulum, it is secreted into the lumen of the silk gland. The target protein, etc., after the signal peptide or its functional fragment has been cleaved, is secreted from the anterior silk gland and spun into silk outside the individual during the pupation stage. Therefore, methods for recovering the target protein, etc. include recovering it from the cocoon, or directly recovering it by excising the silk gland from the insect body during the late final instar to pre-pupal stage. The method of recovering it from the cocoon is particularly advantageous in that it allows for the simple recovery of the target protein, etc.

[0101] The method for recovering target proteins from cocoons involves first transferring the late-stage larvae to a cocoon frame (mabushi) and allowing them to spin cocoons. Next, the target proteins are extracted from the cocoons. The extraction method is not particularly limited. For example, the target proteins can be recovered simply by immersing the cocoons in water or a suitable neutral extraction buffer that does not contain protein denaturants (e.g., phosphate-buffered saline, pH 7.2, with or without 1% Tween-20 and 0.05% sodium azide). To enhance the extraction effect, the cocoons may be cut or crushed before immersion. The extraction temperature should be low, preferably 0 to 5°C, to prevent thermal denaturation of the target proteins. However, if the target proteins are not heat-sensitive peptides, extraction can also be carried out at 10 to 40°C. The extract may be stirred as needed. The extraction time varies depending on the state of the cocoons (e.g., whether they are uncut or in powder form), the amount of extract, the extraction temperature, and whether or not stirring is performed. Therefore, it should be determined appropriately according to the conditions. Insoluble components such as fibroin can be removed from the extract by centrifugation or filtration as needed.

[0102] A method for extracting silk glands from silkworms in the late final instar to pre-spinning stage and recovering target proteins can be achieved by methods known in the field. For example, a silkworm on day 6 of the final instar (5th instar), just before spinning, can be anesthetized on ice, its dorsal side can be incised, and the silk glands can be carefully extracted with tweezers without damaging them (see Mori, Yasushi (ed.), New Biological Experiments with Silkworms, Sanseido, 1970, pp. 249-255). The extracted silk glands can then be gently shaken in the extraction buffer, for example, at a temperature of 0-10°C, preferably 0-5°C, to elute the target proteins into the buffer. If the target proteins are not heat-sensitive peptides, the process may be carried out at a temperature of 10-40°C. After that, impurities such as tissue fragments can be removed by centrifugation or filtration, and the supernatant containing the target proteins can be collected.

[0103] 5-3. Effects According to the production method of the present invention, by using the larvae of genetically modified lepidopteran insects produced by the production method described in the first embodiment or the fourth embodiment as a protein production system, it is possible to produce large quantities of the target protein and other substances and to recover them easily, compared to when using the GAL4 / UAS line. [Examples]

[0104] <Example 1: Preparation of knock-in lines for useful protein production> (the purpose) The conventional GAL4 / UAS system is a gene regulation system that utilizes a combination of the yeast-derived transcription factor GAL4 and the regulatory sequence UAS. In the GAL4 / UAS system used as a protein production system in silkworms, an expression system that expresses the target protein in the silk gland is constructed by crossing a GAL4 line that expresses the GAL4 gene under the control of a promoter such as the silk gene with a UAS line that expresses the target gene under the control of the regulatory sequence UAS.

[0105] In the GAL4 / UAS system, it is necessary to establish GAL4 and UAS lines separately before crossing them, which makes building the expression system time-consuming. Furthermore, because the GAL4 gene and UAS regulatory sequence are introduced at random locations on the genome, the expression levels of the target protein fluctuate and are difficult to predict. Therefore, after creating numerous lines, it is necessary to examine the expression levels in individuals obtained by crossing GAL4 and UAS lines, and select good parent lines based on the results.

[0106] Therefore, the inventors conceived of constructing a new expression system for the stable and large-scale production of a target protein by knocking in the target gene sequence into an endogenous gene. More specifically, by knocking in the target gene encoding the target protein into the exon sequence encoding the signal peptide in an endogenous sericin gene or fibroin gene so as to fuse with the signal peptide, it may be possible to highly express the target gene by directly utilizing the promoter activity and enhancer activity of the endogenous gene.

[0107] However, efficient knock-in of endogenous genes requires cleaving the target gene using genome editing enzymes or similar methods.

[0108] In Comparative Example 1, described later, the inventors attempted knock-in by designing the genome cleavage site within the exon sequence. As a result, they obtained that more than 95% of the injected individuals were unable to produce normal cocoons, and more than 98% were unable to develop into adults capable of mating. Therefore, it is extremely difficult to establish a lineage using this method.

[0109] Therefore, in this embodiment, we will investigate whether the above problems can be overcome by designing the genome cleavage site within the intron sequence and performing knock-in into the exon sequence.

[0110] (Methods and Results) In this example, a target gene encoding the EGFP protein is knocked into the exon sequence encoding the signal peptide in the endogenous silk gene, to be fused to the C-terminus of the signal peptide. The target gene knock-in is performed using the TAL-PITCh (precise integration into target chromosome) method and homologous recombination method, by cleaving the intron sequence adjacent to the 5' end of the target exon sequence with the genome editing enzyme TALEN (transcription activator-like effector nuclease) (Figure 2). The target gene, the EGFP gene sequence, has a stop codon and transcription termination sequence at its 3' end (Figure 1).

[0111] Knock-in of the fibroin H (FibH) gene, fibroin L (FibL) gene, and sericin 1 (Ser1) gene was performed by the following method. The vectors expressing TALENs in the following examples were constructed based on Y. Takasu, S. Sajwan, T. Daimon, M. Osanai-Futahashi, K. Uchino, H. Sezutsu, T. Tamura, M. Zurovec (2013): Efficient TALEN construction for Bombyx mori gene targeting, PLoS One, 8, e73458. TALEN mRNA was synthesized using the mMESSAGE mMACHINE T7 ULTRA Transcription Kit (Invitrogen) with each TALEN expression vector as a template.

[0112] (1) Knock-in of the fibroin H gene by TAL-PITCh method In the fibroin H gene (hereinafter referred to as the "FibH gene"), the first and second exons encode a signal peptide. The EGFP gene sequence was introduced into the second exon using the TAL-PITCh method so that the EGFP protein is fused to the C-terminus of the FibH signal peptide.

[0113] Specifically, in the genome sequence of the FibH gene (SEQ ID NO: 3), the position within the first intron between the first and second exons (between positions 1945 and 1964 in SEQ ID NO: 3, Figure 2A) was used as the genome cleavage site, and a double-stranded circular DNA, as shown in Figure 3B, was constructed as the donor nucleic acid to be used in the TAL-PITCh method (hereinafter referred to as "TAL-PITCh SP(FibH)-EGFP donor nucleic acid"). The TAL-PITCh SP(FibH)-EGFP donor nucleic acid contains the first recognition sequence, second spacer sequence, first spacer sequence, genome homology sequence, target gene sequence, transcription termination sequence, and marker gene in this order (Figure 3B).

[0114] Here, the first spacer sequence is a 10-nucleotide sequence adjacent to the 5' end of the genome break site, consisting of positions 1945-1954 in SEQ ID NO: 3. The second spacer sequence is a 10-nucleotide sequence adjacent to the 3' end of the genome break site, consisting of positions 1955-1964 in SEQ ID NO: 3. The first recognition sequence is a 20-nucleotide sequence recognized by the Left TALEN at the 5' end of the first spacer sequence, consisting of positions 1925-1944 in SEQ ID NO: 3. The genome homology sequence is a nucleotide sequence homologous to the genome sequence from the second recognition sequence to the codon encoding the C-terminal residue of the signal peptide in the second exon sequence, consisting of a 70-nucleotide sequence consisting of positions 1965-2034 in SEQ ID NO: 3. Here, the second recognition sequence is a 20-nucleotide sequence recognized by the Right TALEN at the 3' end of the second spacer sequence, consisting of positions 1965-1984 in SEQ ID NO: 3. The target gene sequence was the EGFP gene sequence, and the transcription termination sequence used was the transcription termination sequence of the sericin 1 gene derived from silkworms. The nucleotide sequence from the first recognition sequence to the transcription termination sequence of the EGFP gene in the SP(FibH)-EGFP donor nucleic acid for TAL-PITCh is shown in SEQ ID NO: 13. In addition, the amino acid sequence of the protein encoded by the knock-in gene (Figure 3C), in which a signal peptide derived from FibH is fused to the N-terminus of the C-terminal fragment of EGFP excluding the initiating methionine, is shown in SEQ ID NO: 14 (hereinafter referred to as "SP(FibH)-EGFP fusion protein").

[0115] SP(FibH)-EGFP donor nucleic acid for TAL-PITCh was injected into silkworm eggs 2-8 hours post-laying from the w1-pnd line, a white-eyed, white-egg, non-diapause line maintained at the National Agriculture and Food Research Organization, along with mRNA encoding Left TALEN and Right TALEN synthesized using the mMESSAGE mMACHINE T7 ULTRA Transcription Kit (Invitrogen). The injected eggs were incubated at 25°C under humid conditions until hatching. The injected silkworms were crossed with the parent line, and the resulting next-generation larvae were selected based on fluorescence of DsRed2 expressed throughout the body or EGFP expressed in the silk glands to obtain knock-in silkworm lines. Hereinafter, the obtained knock-in lines will be referred to as "SP(FibH)-EGFP knock-in lines." The Fib H gene after this knock-in will be referred to as the "SP(FibH)-EGFP knock-in gene."

[0116] Of the 105 embryos that underwent the above microinjection, 103 larvae developed and successfully spun cocoons. Therefore, no cocooning problems were observed in the injected larvae.

[0117] Furthermore, among the adult silkworms of the current generation that developed through normal cocooning, 34 out of 36 female silkworms successfully mated with wild-type male silkworms and laid eggs, and 50 out of 53 male silkworms successfully mated with wild-type female silkworms, resulting in female silkworms laying eggs. Therefore, no mating problems were observed among the adult silkworms of the current generation. These results demonstrate that by cutting the genome within intron sequences, knock-in lines capable of normal cocooning and mating can be produced very efficiently.

[0118] In the SP(FibH)-EGFP knock-in strain, strong EGFP fluorescence was observed in the mid-silk glands and posterior silk glands from the first instar larvae. Figure 5 shows the observation results of the silk glands and cocoons of fifth instar larvae. Specifically, on the sixth day of the fifth instar, just before spinning silk, the larvae were anesthetized on ice, the dorsal side was incised, and the mid- and posterior silk glands were carefully extracted with tweezers without damaging them. When observed under a fluorescence microscope without fixation, extremely strong EGFP fluorescence was observed (Figure 5, left). In addition, the cocoons of this strain exhibited a distinct yellowish-green color under normal white light (Figure 5, right).

[0119] (2) Knock-in of the fibroin H gene by homologous recombination The EGFP gene sequence was introduced into the second exon of the FibH gene using homologous recombination so that the EGFP protein is fused to the C-terminus of the FibH signal peptide.

[0120] Specifically, similar to (1) above, the position within the first intron (between positions 1945 and 1964 in Sequence ID No. 3, Figure 2A) was used as the genome cleavage site, and a double-stranded circular DNA shown in Figure 4 was constructed as the donor nucleic acid to be used in homologous recombination (hereinafter referred to as "SP(FibH)-EGFP donor nucleic acid for homologous recombination"). The SP(FibH)-EGFP donor nucleic acid for homologous recombination includes a first genome homologous sequence and a second genome homologous sequence, as well as the target gene sequence, the EGFP gene sequence, a transcription termination sequence, and a marker gene, which are positioned between them. The first genome homologous sequence and the second genome homologous sequence contain a TALEN recognition sequence at the end opposite to the EGFP gene sequence.

[0121] Here, the first genome homologous sequence is a 1034-base sequence homologous to the genome sequence from the base located 5' end of the genome break site (position 1001 in SEQ ID NO: 3) to the codon encoding the C-terminal residue of the signal peptide in the second exon sequence. The first genome homologous sequence has a mutation near the genome break site described above so that it is not recognized by the Left TALEN and Right TALEN described in (1) above (specifically, the base sequence AACTTCGATTGAATGTGCGAAATTTATAGCTCAATATTTTAGCACTTATCGTATTGATTT (SEQ ID NO: 33), located at positions 1925 to 1984 in SEQ ID NO: 3, is replaced with the base sequence AtCTaCGATTGAAaGaGCGtAATTTATAGCTCAATATTTTAtGCtCaTAaCGTATTGATTT (SEQ ID NO: 34)). The second genome homologous sequence is a 377-nucleotide sequence homologous to the genome sequence located 3' end to the codon encoding the C-terminal residue of the signal peptide in the second exon sequence on the genome. In the SP(FibH)-EGFP donor nucleic acid for homologous recombination, the nucleotide sequence from the TALEN recognition sequence and the first genome homologous sequence to the second genome homologous sequence and the TALEN recognition sequence is shown in SEQ ID NO: 15. Furthermore, the protein encoded by the knock-in gene (Figure 4), in which the signal peptide derived from FibH is fused to the N-terminus of EGFP, consists of the amino acid sequence shown in SEQ ID NO: 14, as in (1) above (hereinafter referred to as "SP(FibH)-EGFP fusion protein," as in (1) above).

[0122] Homologous recombination SP(FibH)-EGFP donor nucleic acid was injected into silkworm eggs of the w1-pnd line 2-8 hours after oviposition, along with mRNA encoding Left TALEN and Right TALEN synthesized using the mMESSAGE mMACHINE T7 ULTRA Transcription Kit (Invitrogen). The injected eggs were incubated in a humidified environment at 25°C until hatching. The injected silkworms were crossed with the parent line, and the resulting next-generation larvae were selected based on the fluorescence of DsRed2 expressed throughout the body or EGFP expressed in the silk glands to obtain knock-in silkworm lines. Hereinafter, the obtained knock-in lines will be referred to as "SP(FibH)-EGFP knock-in lines" as described in (1) above.

[0123] In individuals developed from embryos subjected to the above microinjection, no cocooning failures or mating failures were observed, similar to (1) above. Therefore, it was demonstrated that even with homologous recombination, knock-in lines capable of normal cocooning and mating can be efficiently produced by cutting the genome within the intron sequence.

[0124] (3) Knock-in of the fibroin L (FibL) gene by homologous recombination The EGFP gene sequence was introduced into the third exon of the FibL gene using homologous recombination so that the EGFP protein is fused to the C-terminus of the fibroin L (hereinafter referred to as "FibL") signal peptide.

[0125] Specifically, a double-stranded circular DNA was constructed as the donor nucleic acid used for homologous recombination, with the genome cleavage site being located within the second intron of the FibL gene (between positions 8937 and 8954 in Sequence ID No. 6). The SP(FibL)-EGFP donor nucleic acid for homologous recombination contains a first genome homologous sequence and a second genome homologous sequence, as well as the target gene sequence, the EGFP gene sequence, a transcription termination sequence, and a marker gene, which are positioned between them. The first genome homologous sequence and the second genome homologous sequence contain a TALEN recognition sequence at the end opposite to the EGFP gene sequence.

[0126] Here, the genome cleavage site described above is cleaved by a Left TALEN that recognizes a 20-nucleotide sequence from position 8917 to 8936 in SEQ ID NO: 6, and by a Right TALEN that recognizes a 20-nucleotide sequence from position 8955 to 8974 in SEQ ID NO: 6.

[0127] Furthermore, the first genome homologous sequence is a 1128-nucleotide sequence homologous to the genome sequence from the base located 5' end of the genome break site (position 7864 in SEQ ID NO: 6) to the codon encoding the C-terminal residue of the signal peptide in the third exon sequence. Note that the first genome homologous sequence has mutations in the vicinity of the aforementioned genome break site so that it is not recognized by the Left TALEN and Right TALEN (specifically, the base sequence CCCGAGAAAACAATTTGTTGTGTATAATTTAAACCAAAACCCGAATTTAATTTTTCGC (SEQ ID NO: 35), located at positions 8917-8974 in SEQ ID NO: 6, is replaced with the base sequence CCCGAGAAAAgAATTcGTTcTGTATAATTTAAACCAAAAttCGAATTTAATTTTTCGC (SEQ ID NO: 36)). The second genome homologous sequence is a 1362-nucleotide sequence homologous to the genome sequence located 3' end to the codon encoding the C-terminal residue of the signal peptide in the third exon sequence of the genome. In the SP(FibL)-EGFP donor nucleic acid for homologous recombination, the nucleotide sequence from the TALEN recognition sequence and the first genome homologous sequence to the second genome homologous sequence and the TALEN recognition sequence is shown in SEQ ID NO: 16. Furthermore, the protein encoded by the knock-in gene, in which the FibL signal peptide is fused to the N-terminal side of the C-terminal fragment of EGFP with the initiating methionine removed, consists of the amino acid sequence shown in SEQ ID NO: 17 (hereinafter referred to as the "SP(FibL)-EGFP fusion protein").

[0128] Homologous recombination SP(FibL)-EGFP donor nucleic acid was injected into silkworm eggs of the w1-pnd line 2-8 hours after oviposition, along with mRNA encoding Left TALEN and Right TALEN synthesized using the mMESSAGE mMACHINE T7 ULTRA Transcription Kit (Invitrogen). The injected eggs were incubated under humid conditions at 25°C until hatching. Knock-in silkworm lines were obtained using the same method as in (2) above. Hereafter, the obtained knock-in lines will be referred to as the "SP(FibL)-EGFP knock-in lines" as in (1) above. The FibL gene after knock-in will be referred to as the "SP(FibL)-EGFP knock-in gene". In individuals developed from embryos subjected to the above microinjection procedure, no cocooning failures or mating failures were observed, similar to (1) above.

[0129] (4) Knock-in of the sericin 1 gene by homologous recombination The EGFP gene sequence was introduced into the second exon of the Ser1 gene using homologous recombination so that the EGFP protein is fused to the C-terminus of the sericin 1 (hereinafter referred to as "Ser1") signal peptide.

[0130] Specifically, a double-stranded circular DNA was constructed as the donor nucleic acid used in homologous recombination, with the genome cleavage site being the position within the first intron of the Ser1 gene (between positions 3020 and 3033 in Sequence ID No. 9). The SP(Ser1)-EGFP donor nucleic acid for homologous recombination contains a first genome homologous sequence and a second genome homologous sequence, as well as the target gene sequence, the EGFP gene sequence, a transcription termination sequence, and a marker gene, which are positioned between them. The first genome homologous sequence and the second genome homologous sequence contain a TALEN recognition sequence at the end opposite to the EGFP gene sequence.

[0131] Here, the genome cleavage site described above is cleaved by a Left TALEN that recognizes a 19-nucleotide sequence consisting of positions 3001 to 3019 in SEQ ID NO: 9, and a Right TALEN that recognizes a 16-nucleotide sequence consisting of positions 3034 to 3049 in SEQ ID NO: 9.

[0132] Furthermore, the first genome homologous sequence is a 2069-base sequence homologous to the genome sequence located 5' end to the genome break site (position 947 in SEQ ID NO: 9) to the codon encoding the C-terminal residue of the signal peptide in the second exon sequence. Note that the first genome homologous sequence has mutations near the genome break site so that it is not recognized by Left TALEN and Right TALEN (specifically, the base sequence TATATTGTAAAGCACAACATATATATTAATGAATTTTTTATTTATTTTTC (SEQ ID NO: 37), located at positions 3000-3049 in SEQ ID NO: 9, is replaced with the base sequence agTATTGagAAGCACAAgtaATATATTAATGAATTTTTTcTTTcTTTTTC (SEQ ID NO: 38)). The second genome homologous sequence is a 2000-base sequence homologous to the genome sequence located 3' end to the codon encoding the C-terminal residue of the signal peptide in the second exon sequence. In the SP(Ser1)-EGFP donor nucleic acid for homologous recombination, the restriction enzyme recognition sequence and the nucleotide sequence from the first genome homologous sequence to the second genome homologous sequence and the restriction enzyme recognition sequence are shown in SEQ ID NO: 18. Furthermore, the protein encoded by the knock-in gene, in which the Ser1 signal peptide is fused to the N-terminus of the C-terminal fragment of EGFP with the initiating methionine removed, consists of the amino acid sequence shown in SEQ ID NO: 19 (hereinafter referred to as the "SP(Ser1)-EGFP fusion protein").

[0133] Homologous recombination SP(Ser1)-EGFP donor nucleic acid was injected into silkworm eggs of the w1-pnd line 2-8 hours after oviposition, along with mRNA encoding Left TALEN and Right TALEN synthesized using the mMESSAGE mMACHINE T7 ULTRA Transcription Kit (Invitrogen). The injected eggs were incubated under humid conditions at 25°C until hatching. Knock-in silkworm lines were obtained using the same method as in (2) above. Hereafter, the obtained knock-in lines will be referred to as the "SP(Ser1)-EGFP knock-in lines" as in (1) above. The Ser1 gene after knock-in will also be referred to as the "SP(Ser1)-EGFP knock-in gene".

[0134] In individuals developed from embryos subjected to the above microinjection procedure, no cocooning failures or mating failures were observed, similar to (1) above.

[0135] <Example 2: Production of EGFP protein> (the purpose) The expression level of EGFP protein in the silk glands of each knock-in line prepared in Example 1 was measured.

[0136] (Methods and Results) (1) Silkworm lineage By crossing the knock-in lines produced in (2) to (4) of Example 1 with each other, lines possessing a combination of multiple knock-in genes were created. In this example, a line possessing two knock-in genes, for example, the SP(FibH)-EGFP knock-in gene and the SP(FibL)-EGFP knock-in gene, is referred to as the SP(FibH)-EGFP / SP(FibL)-EGFP knock-in line, etc. In the silkworms used in this example, all knock-in genes were heterozygous.

[0137] In this example, a line obtained by crossing a FibH+Ser1-GAL4 line, which expresses the GAL4 gene under the control of the FibH gene promoter and the Ser1 gene promoter, with a UAS-EGFP line, which expresses the EGFP gene under the control of the UAS regulatory sequence (hereinafter referred to as the "EGFP-producing GAL4 / UAS line") was used as the control group.

[0138] (2) Rearing conditions Silkworm rearing was carried out using the following method: Larvae of all instars were reared in a rearing room at 25-27°C on artificial feed (Silkmate original strain 1st-3rd instar S, Nippon Nosan Kogyo). The artificial feed was changed every 2-3 days (Uchino K. et al., 2006, J Insect Biotechnol Sericol, 75:89-97).

[0139] (3) Measurement of EGFP protein expression level On the 6th day of the 5th instar, immediately before spinning, the maggots were anesthetized on ice, and the dorsal incision was made to carefully excise the silk glands with forceps, taking care not to damage them. The mid-silk glands and posterior silk glands were excised. Each of these was placed in 10 mL of PBS (pH 7.2) / 1% Tween20 / 0.05% sodium azide and shaken at room temperature for 24 hours to extract the water-soluble proteins. The resulting water-soluble protein extract was centrifuged at 2,000 × g for 10 minutes, and the supernatant was collected. The concentration of EGFP protein in the water-soluble proteins contained in the supernatant was measured by ELISA. Specifically, 100 μL of the supernatant was added to a 96-well plate coated with anti-GFP antibody (Aves GFP-1010, CosmoBio) and allowed to stand at room temperature for 1 hour. After washing three times with PBS / 0.05% Tween 20, horseradish peroxidase-conjugated anti-GFP antibody (Rockland Immunochemicals) was added and the mixture was allowed to stand at room temperature for 1 hour. After washing three times with PBS / 0.05% Tween 20, a color reaction was performed using the TMB Peroxidase EIA Substrate Kit (Bio-Rad), and the reaction was stopped by adding 1N sulfuric acid. The color development was quantified using a plate reader (SpectraMax iD3; Molecular Devices). Standard curves were constructed using serial dilutions (1-400 pg / μL) of recombinant GFP protein (Takara Bio; Z2373N). Figure 6 shows the results of measuring the EGFP expression level per silkworm.

[0140] The EGFP expression level in the SP(Ser1)-EGFP knock-in line (Figure 6, SP(Ser1)-EGFP) was slightly higher than that of the EGFP-producing GAL4 / UAS line (Figure 6, Control(GAL4 / UAS)). In the EGFP-producing GAL4 / UAS line, GAL4 protein is expressed by two promoters, the Ser1 gene promoter and the FibH gene promoter. Since it is estimated that less than 1 mg of the 3.3 mg of EGFP expression originates from the Ser1 gene promoter, the EGFP expression level in the SP(Ser1)-EGFP knock-in line is overwhelmingly higher.

[0141] The EGFP expression level of the SP(FibH)-EGFP knock-in line (Figure 6, SP(FibH)-EGFP) was more than twice that of the SP(FibL)-EGFP knock-in line (Figure 6, SP(FibL)-EGFP), and more than four times that of the SP(Ser1)-EGFP knock-in line (Figure 6, SP(Ser1)-EGFP). This result was unexpected, as it is based on the fact that the number of moles of FibH and FibL proteins produced in the silkworm silk gland are equivalent in terms of fibroin composition, and that fibroin, which constitutes silk, is three times the weight of sericin.

[0142] The SP(FibH)-EGFP / SP(FibL)-EGFP / SP(Ser1)-EGFP knock-in lines (Figure 6, far right) showed an EGFP expression level of 33.7 mg, which significantly exceeded the expected sum of EGFP expression levels in each of the SP(FibH)-EGFP knock-in, SP(FibL)-EGFP knock-in, and SP(Ser1)-EGFP knock-in lines.

[0143] <Example 3: Production of GM-CSF protein> (the purpose) Homologous recombination knock-in is performed to fuse granulocyte-macrophage colony-stimulating factor (GM-CSF) to the C-terminus of the FibH signal peptide. GM-CSF production in silk glands is then evaluated.

[0144] (Methods and Results) (1) Silkworm lineage The homologous recombination method described in Example 1(2) was performed by replacing the target gene from the EGFP gene sequence to the GM-CSF gene sequence. The GM-CSF gene sequence consists of the nucleotide sequence shown in SEQ ID NO: 20 and encodes the GM-CSF protein consisting of the amino acid sequence shown in SEQ ID NO: 21. The resulting knock-in line is called the "SP(FibH)-GM-CSF knock-in line". Furthermore, the protein encoded by the knock-in gene (Figure 7A), in which the signal peptide derived from FibH is fused to the N-terminus of the mature amino acid sequence of GM-CSF (excluding the signal peptide derived from GM-CSF), consists of the amino acid sequence shown in SEQ ID NO: 22 (hereinafter referred to as the "SP(FibH)-GM-CSF fusion protein").

[0145] Furthermore, a line obtained by crossing a Ser1-GAL4 line, which expresses the GAL4 gene under the control of the Ser1 gene promoter, with a UAS-GM-CSF line, which expresses the GM-CSF gene under the control of the UAS regulatory sequence (hereinafter referred to as the "middle silk gland GM-CSF producing GAL4 / UAS line"), and a line obtained by crossing a FibH-GAL4 line, which expresses the GAL4 gene under the control of the FibH gene promoter, with a UAS-GM-CSF line (hereinafter referred to as the "posterior silk gland GM-CSF producing GAL4 / UAS line") were used as control groups.

[0146] (2) Western blotting Following the method described in Example 2, the mid-silk glands and posterior silk glands were excised from each strain, and proteins were extracted from each silk gland. Subsequently, the undiluted or 2- to 128-fold diluted silk gland extracts were mixed with specified amounts of NuPAGE LDS Sample Buffer (Thermo Fisher) and NuPAGE Sample Reducing Agent (Thermo Fisher), and the mixture was converted to SDS by heating at 70°C for 10 minutes. The SDS-converted samples were electrophoresed on an 8 cm × 13 cm 4-12% SDS-PAGE gel at a constant current of 20 mA for approximately 90 minutes. The gels were transferred to a PVDF membrane using a semi-dry transfer device (iBlot2, Thermo Fisher). After transfer, the membrane was gently shaken for 5 minutes with EZ wash (AE-1480, ATTO), and then reacted with primary antibody (anti-GM-CSF antibody, 3000-fold dilution, Immundiagnostik, product number AS1021.2) overnight at 4°C. The membrane was washed three times for 10 minutes each with EZ wash, and then reacted with secondary antibody (Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey, Cytiva, product number NA934-100UL, 50,000-fold dilution) at room temperature for 1 hour. The membrane was washed three times for 10 minutes each with EZ wash, and then reacted with ECL prime (RPN2232, GE Healthcare) for 5 minutes, and the signal was detected using Fusion FX (Vilber Bio Imaging).

[0147] The results are shown in Figure 7B. In the combined extract of the mid-silk and posterior silk glands of the SP(FibH)-GM-CSF knock-in strain, approximately 13 times and 3 times more GM-CSF were detected compared to the mid-silk GM-CSF-producing GAL4 / UAS strain and the posterior silk gland GM-CSF-producing GAL4 / UAS strain, respectively. This demonstrates that GM-CSF is expressed and secreted very efficiently in the silk glands of the SP(FibH)-GM-CSF knock-in strain.

[0148] <Example 4: Antibody Production> (the purpose) Homologous recombination knock-in is performed so that an IgG H chain is fused to the C-terminus of the FibH signal peptide. Furthermore, homologous recombination knock-in is performed so that an IgG L chain is fused to the C-terminus of the FibL signal peptide. The two resulting knock-in lines are crossed to produce antibody molecules containing IgG H and IgG L chains.

[0149] (Methods and Results) (1) Silkworm lineage The homologous recombination method described in Example 1(2) was performed by replacing the target gene from the EGFP gene sequence to the IgG H chain gene sequence. The IgG H chain gene sequence consists of the nucleotide sequence shown in SEQ ID NO: 23 and encodes an IgG H chain consisting of the amino acid sequence shown in SEQ ID NO: 24. The resulting knock-in line is called the "SP(FibH)-IgG H chain knock-in line". Furthermore, the protein encoded by the knock-in gene (Figure 8A), in which a signal peptide derived from FibH is fused to the N-terminus of the IgG H chain, consists of the amino acid sequence shown in SEQ ID NO: 25 (hereinafter referred to as the "SP(FibH)-IgG H chain fusion protein").

[0150] Furthermore, the homologous recombination method described in Example 1(3) was carried out by replacing the target gene from the EGFP gene sequence to the IgG L chain gene sequence. The IgG L chain gene sequence consists of the nucleotide sequence shown in SEQ ID NO: 26 and encodes an IgG L chain consisting of the amino acid sequence shown in SEQ ID NO: 27. The resulting knock-in line is called the "SP(FibL)-IgG L chain knock-in line". In addition, the protein encoded by the knock-in gene (Figure 8B), in which a signal peptide derived from FibL is fused to the N-terminus of the IgG L chain, consists of the amino acid sequence shown in SEQ ID NO: 28 (hereinafter referred to as the "SP(FibL)-IgG L chain fusion protein").

[0151] By crossing the two knock-in lines mentioned above, we created a line that possesses two knock-in genes and can produce IgG molecules containing IgG H chains and IgG L chains (hereinafter referred to as the "SP(FibH)-IgG H chain / SP(FibL)-IgG L chain knock-in line").

[0152] In this example, a control group was used consisting of a FibH+Ser1-GAL4 line, which expresses the GAL4 gene under the control of the FibH gene promoter and the Ser1 gene promoter; a UAS-IgG H chain line, which expresses the IgG H chain gene under the control of the UAS regulatory sequence; and a UAS-IgG L chain line, which expresses the IgG L chain gene under the control of the UAS regulatory sequence (hereinafter referred to as the "antibody-producing GAL4 / UAS line").

[0153] (2) Quantification of IgG expression levels Following the method described in Example 2, the mid-silk glands and posterior silk glands were excised from each strain, and proteins were extracted from each silk gland. Subsequently, IgG was purified using Ab SpinTrap (Cytiva), and the amount of IgG in the extract was quantified using the Protein Assay BCA Kit (Nacalai).

[0154] The results are shown in Figure 8C. The SP(FibH)-IgG H chain / SP(FibL)-IgG L chain knock-in lines were shown to produce approximately 4.6 times more IgG compared to the mid-silk and posterior silk glands of the antibody-producing GAL4 / UAS lines. It was revealed that antibody molecules containing IgG H chains and IgG L chains are expressed and secreted very efficiently in the silk glands of the SP(FibH)-IgG H chain / SP(FibL)-IgG L chain knock-in lines.

[0155] <Comparative Example 1: Knock-in line generation when designing the genome cleavage site within the exon sequence> (the purpose) Instead of creating a genome cleavage site within an exon sequence, a homologous recombination method is used to knock in the EGFP gene into the fibroin H gene. The efficiency of generating the knock-in line is compared with that of cleaving the genome within an intron sequence.

[0156] (Methods and Results) In the homologous recombination method described in (2) of Example 1, the method was modified to set the genome cleavage site within the second exon of the FibH gene, and knock-in of the EGFP gene sequence into the fibroin H gene was performed. Specifically, a mutation was introduced into the homologous recombination donor nucleic acid near the genome cleavage site within the second exon so that it would not be recognized by TALEN. 384 eggs were injected with the above homologous recombination donor nucleic acid along with mRNA encoding TALEN synthesized using the mMESSAGE mMACHINE T7 ULTRA Transcription Kit (Invitrogen) into silkworm eggs of the w1-pnd line 2 to 8 hours after oviposition. The injected eggs were incubated in a humidified state at 25°C until hatching. The injected silkworms were reared to adulthood and crossed with the parent line to determine their mating ability.

[0157] The results are shown in Figure 9B. In homologous recombination when the genome is cut within the exon sequence, of the 118 larvae that grew to the 5th instar, 113 suffered from pupation failure, or developed naked pupae or thin cocoons, and even after eclosion, showed mating failure, with only 5 individuals producing normal cocoons. However, of the 5 normal cocoons, only 2 individuals were capable of mating; only 1 out of 2 females and 1 out of 3 males possessed mating ability. The reason why abnormalities occur when the exon sequence is cut is thought to be that in the injected embryos, mutations such as frameshifts occur at the genome cut site, resulting in the inability to express normally functioning proteins.

[0158] This result is in contrast to the results in Example 1(2), where almost no cocooning or mating problems were observed when the genome was cut within an intron sequence (Figure 9A). This indicates that the method for producing knock-in silkworm lines using the method in Example 1 is overwhelmingly more efficient in producing knock-in lines. This is thought to be because even if some mutations occur in the intron sequence, the impact on normal protein expression is minimal.

Claims

1. Genetically modified lepidopteran insects, In the endogenous gene of the genetically modified lepidopteran insect, the exon sequence encoding the signal peptide or a functional fragment thereof of the endogenous gene includes a target gene sequence encoding the target protein or a fragment thereof. The aforementioned target protein or fragment thereof is fused to the C-terminal side of the signal peptide or functional fragment thereof. The endogenous genes encode fibroin, sericin, and / or fibrohexamarin in the genetically modified lepidopteran insect.

2. The genetically modified lepidopteran insect according to claim 1, wherein the fibroin is a fibroin H chain and / or a fibroin L chain.

3. The aforementioned endogenous gene, Fibroin H chain and fibroin L chain, Fibroin H chain and sericin 1, or Fibroin H chain, fibroin L chain, and sericin 1 A genetically modified lepidopteran insect according to claim 1, which codes for the insect.

4. The genetically modified lepidopteran insect according to claim 1, wherein the exon sequence includes a transcription termination sequence at the 3' end of the target gene sequence.

5. A double-stranded circular DNA for introducing a target gene sequence at a genome break site within an intron sequence in an endogenous gene of a genetically modified lepidopteran insect, The endogenous gene codes for fibroin, sericin, and / or fibrohexamarin. The aforementioned endogenous gene is, (a) A first spacer sequence adjacent to the 5' end of the genome cleavage site, (b) A second spacer sequence adjacent to the 3' end of the genome cleavage site, (c) A first recognition sequence recognized by a first genome editing enzyme at the 5' end of the first spacer sequence, and (d) A second recognition sequence recognized by a second genome editing enzyme at the 3' end of the second spacer sequence. Includes, The double-stranded circular DNA comprises the first recognition sequence, the second spacer sequence, the first spacer sequence, a genome homologous sequence, and a target gene sequence in this order. The genome homologous sequence consists of a base sequence homologous to the genome sequence from the second recognition sequence to the exon sequence or a subsequence thereof located at the 3' end of the intron sequence. The target gene sequence is the double-stranded circular DNA encoding the target protein or fragment thereof to be fused to the C-terminal side of the signal peptide or functional fragment thereof of the endogenous gene.

6. A donor nucleic acid for producing genetically modified lepidopteran insects using homologous recombination, The homologous recombination method described above includes cutting the genome break site within the intron sequence of an endogenous gene with a genome editing enzyme, The endogenous gene codes for fibroin, sericin, and / or fibrohexamarin. The donor nucleic acid is, (a) A first genome homologous sequence and a second genome homologous sequence derived from the endogenous gene, and (b) Target gene sequence located between them Includes, The first genome homologous sequence consists of a base sequence homologous to the genome sequence from a base located 5' end-side to the genome break site on the genome to an exon sequence or a subsequence thereof located 3' end-side to the intron sequence, and has a mutation in the recognition sequence of the genome editing enzyme. The second genome homologous sequence consists of a base sequence homologous to a genome sequence located 3' end to the exon sequence or a subsequence thereof on the genome. The target gene sequence is the donor nucleic acid that encodes the target protein or fragment thereof to be fused to the C-terminal side of the signal peptide or functional fragment thereof of the endogenous gene.

7. A donor nucleic acid for producing genetically modified lepidopteran insects using homologous recombination, The homologous recombination method described above includes cutting the genome break site within the intron sequence of an endogenous gene with a genome editing enzyme, The endogenous gene codes for fibroin, sericin, and / or fibrohexamarin. The donor nucleic acid is, (a) A first genome homologous sequence and a second genome homologous sequence derived from the endogenous gene, and (b) Target gene sequence located between them Includes, The first genome homologous sequence consists of a base sequence homologous to the genome sequence from a base located 5' end-side to the intron sequence to an exon sequence or a subsequence thereof located 5' end-side to the intron sequence. The second genome homologous sequence consists of a base sequence homologous to the genome sequence from a base located 3' end-to-5 The target gene sequence is the donor nucleic acid that encodes the target protein or fragment thereof to be fused to the C-terminal side of the signal peptide or functional fragment thereof of the endogenous gene.

8. The donor nucleic acid according to claim 6 or 7, wherein the end of the first genome homologous sequence and / or the second genome homologous sequence opposite to the target gene sequence includes a nuclease recognition sequence.

9. The donor nucleic acid according to claim 8, wherein the nuclease recognition sequence is the recognition sequence of the genome editing enzyme or the restriction enzyme recognition sequence.

10. A method for creating genetically modified lepidopteran insects, The double-stranded circular DNA described in claim 5, The first genome editing enzyme or a nucleic acid encoding the first genome editing enzyme in a state capable of expression, and The second genome editing enzyme or a nucleic acid encoding the second genome editing enzyme in a state capable of expression The introduction process involves introducing the substance into the eggs of lepidopteran insects using the microinjection method. The method, including the method described above.

11. A method for creating genetically modified lepidopteran insects, The donor nucleic acid according to claim 6 or 7, and The genome editing enzyme, or a nucleic acid encoding the genome editing enzyme in a state capable of expression. The introduction process involves introducing the substance into the eggs of lepidopteran insects using the microinjection method. The method, including the method described above.

12. A method for producing the target protein or a fragment thereof using a genetically modified lepidopteran insect according to any one of claims 1 to 4, or a genetically modified lepidopteran insect produced by the method described in claim 10.

13. The method according to claim 12, wherein the lepidopteran insect is a silkworm, and the target protein or a fragment thereof is produced in the silk gland of the silkworm.

Images