Antibodies against bradykinin B1 receptor ligands

Abstract

To provide antibodies that specifically bind to Kallidin or des-Arg10-Kallidin.SOLUTION: The invention provides an isolated monoclonal antibody or antigen binding fragment thereof configured to: a) bind specifically to Kallidin or des-Arg10-Kallidin but not specifically to Bradykinin or des-Arg9-Bradykinin; b) specifically bind to Kallidin or des-Arg10-Kallidin with a KD of less than 1×10-10 M; c) specifically bind to Kallidin or des-Arg10-Kallidin with a Koff of less than 1×104 s-1; and / or d) specifically bind to Kallidin or des-Arg10-Kallidin and inhibit binding to the bradykinin B1 receptor.SELECTED DRAWING: None

Description

[Technical Field]

[0001] Related applications This application claims priority to U.S. Provisional Application No. 61 / 616,845 filed on 28 March 2012 and French Patent Application No. 1350953 filed on 4 February 2013. The contents of these applications are incorporated herein by reference in their entirety. [Background technology]

[0002] The bradykinin B1 receptor is linked to the pathogenesis of inflammatory diseases and chronic pain. By modulating tissue inflammation and renal fibrosis, the B1 receptor is also associated with the pathogenesis of acute kidney injury and chronic kidney disease, which are major causes of end-stage renal failure.

[0003] In humans, the main agonists of the bradykinin B1 receptor are kinins. Kinins are bioactive peptides produced from the proteolytic cleavage of kininogen protein. The main kinin agonists of the bradykinin B1 receptor are the decapeptide kallidine and the nonapeptide des-Arg 10 -Callidine (formed by the proteolytic cleavage of the C-terminal arginine from callidine). Therefore, callidine and des-Arg 10 Drugs that can inhibit the binding of calidine to the bradykinin B1 receptor may have the potential to treat or prevent bradykinin B1 receptor-mediated conditions. [Overview of the project] [Problems that the invention aims to solve]

[0004] Therefore, in the art, calidine and des-Arg are used in the treatment of bradykinin B1 receptor-mediated human pathologies. 10 - Novel drugs are needed that inhibit the binding of calidine to the bradykinin B1 receptor. [Means for solving the problem]

[0005] The present invention provides an antibody or an antigen-binding fragment thereof that specifically binds to kallidin and des-Arg 10 -kallidin and inhibits binding to the bradykinin B1 receptor. Such antibodies are particularly useful for treating kallidin and des-Arg 10 -kallidin-related diseases or disorders (e.g., pain or fibrosis). The present invention also provides a pharmaceutical composition, as well as a nucleic acid encoding an anti-kallidin and des-Arg 10 -kallidin antibody, a recombinant expression vector, and a host cell for producing such an antibody or a fragment thereof. Either in vitro or in vivo, kallidin and des-Arg 10 -kallidin for detection, or kallidin and des-Arg 10 -kallidin for modulating activity, methods of using the antibodies or fragments thereof of the present invention are also encompassed by the present invention. The present invention also provides a method for producing an antibody that specifically binds to des-Arg9-bradykinin and des-Arg 10 -kallidin-like peptides.

[0006] Thus, in one aspect, the present invention provides a) an antibody that specifically binds to kallidin or des-Arg 10 -kallidin but does not specifically bind to bradykinin or des-Arg9-bradykinin; b) an antibody that specifically binds to kallidin or des-Arg 10 -kallidin with a KD of less than 1×10 -10 M; c) an antibody that specifically binds to kallidin or des-Arg 10 -kallidin with a K of less than 1×10 4 s -1 ; or off d) an antibody that specifically binds to kallidin or des-Arg -kallidin and inhibits binding to the bradykinin 10 B1 receptor This provides isolated monoclonal antibodies or their antigen-binding fragments.

[0007] In one embodiment, the antibody or its antigen-binding fragment is calidine or des-Arg 10 - Binds to the N-terminal lysine residue of calidine.

[0008] In another embodiment, the antibody or its antigen-binding fragment is calidine or des-Arg 10 - Inhibits the binding of calidine to the bradykinin-1 receptor.

[0009] In another embodiment, an antibody or its antigen-binding fragment specifically binds to a mouse calidin-like peptide (KLP).

[0010] In another embodiment, the antibody or its antigen-binding fragment is a) Sequence ID 7[X1YX2X3DX4HAMX5Y], During the ceremony, X1 is Y, F, or H. X2 is R, D, A, V, L, I, M, F, Y, or W. X3 is Y, F, W, or H. X4 is D, E, or Y. X5 is either D or E. b) Sequence ID 63 [X1EYDGX2YX3X4LDX5], During the ceremony, X1 is either W or F. X2 is N, or there is no amino acid. X3 is either Y or S. X4 is D or P, X5 is either F or Y. c) Sequence ID 13, d) Sequence ID 32, e) Sequence ID 40, f) Sequence ID 47, and g) Sequence ID 55 Heavy chain variable containing an HCDR3 amino acid sequence selected from the group consisting of the following: region Includes.

[0011] In another embodiment, the antibody or its antigen-binding fragment is a) Sequence ID 8 [YFX1PX2NGNTGYNQKFRG], During the ceremony, X1 is D, R, A, V, L, I, M, F, Y, or W. X2 is Y, D, E, N, or Q. b) Sequence ID 64 [WX1DPENGDX2X3YAPKFQG], During the ceremony, X1 is either I or V, X2 is either T or S, X3 is either G or D. c) Sequence ID 14, d) Sequence ID 33, e) Sequence ID 41, f) Sequence ID 48, and g) Sequence ID 56 It contains an HCDR2 amino acid sequence selected from the group consisting of the following.

[0012] In another embodiment, the antibody or its antigen-binding fragment is a) Sequence ID 9 [GYSFTDYX1IY], During the ceremony, X1 is N, W, or Y. b) Sequence ID 65 [GFNIKDYYX1H], During the ceremony, X1 is either L or M. c) Sequence ID 15, d) Sequence ID 34, e) Sequence ID 42, f) Sequence ID 49, and g) Sequence ID 57 It contains an HCDR1 amino acid sequence selected from the group consisting of the following.

[0013] In another embodiment, the antibody or its antigen-binding fragment is a) Sequence ID 10[QQX1X2SX3PX4T], During the ceremony, X1 is Y, F, or H. X2 is Y, F, H, or W. X3 is Y, F, T, or H. X4 is W, Y, F, H, or L. b) Sequence ID 66[QX1X2X3SX4PX5T], During the ceremony, X1 is either Q or N. X2 is Y, F, D, or H. X3 is Y, F, H, or W. X4 is Y, F, T, or H. X5 is W, Y, F, H, or L. c) Sequence ID 69[X1QGTHFPYT], During the ceremony, X1 is either L or M. d) Sequence ID 16, e) Sequence ID 35, f) Sequence ID 43, g) Sequence ID 50, and h) Sequence ID 58 Light chain variable containing an LCDR3 amino acid sequence selected from the group consisting of the following: region Includes.

[0014] In another embodiment, the antibody or its antigen-binding fragment is a) Sequence ID 11[WASTRX1], During the ceremony, X1 is E, D, Q, or N. b) Sequence ID 67[X2ASTRX2], During the ceremony, X1 is either W or G. X2 is E, D, Q, or N. c) Sequence ID 17, d) Sequence ID 36, e) Sequence ID 51, and f) Sequence ID 59 It contains an LCDR2 amino acid sequence selected from the group consisting of the following.

[0015] In another embodiment, the antibody or its antigen-binding fragment is a) Sequence ID 12 [KSSQSLLX1SSNQKNX2LA], During the ceremony, X1 is W, H, Y, or F. X2 is either H or Y. b) Sequence ID 68 [KSSQSLLX1X2SX3QX4NX5LA], During the ceremony, X1 is W, H, Y, or F. X2 is either S or G. X3 is either N or D. X4 is either K or R. X5 is either H or Y. c) Sequence ID 70 [KSSQSLLYSNGX1TYLN], During the ceremony, X1 is either K or E. b) Sequence ID 18, c) Sequence ID 37, d) Sequence ID 44, e) Sequence ID 52, and f) Sequence ID 60 It contains an LCDR1 amino acid sequence selected from the group consisting of the following.

[0016] In another embodiment, the antibody or its antigen-binding fragment is a) Sequence ID 10[QQX1X2SX3PX4T], During the ceremony, X1 is Y, F, or H. X2 is Y, F, H, or W. X3 is Y, F, T, or H. X4 is W, Y, F, H, or L. b) Sequence ID 66[QX1X2X3SX4PX5T], During the ceremony, X1 is either Q or N. X2 is Y, F, D, or H. X3 is Y, F, H, or W. X4 is Y, F, T, or H. X5 is W, Y, F, H, or L. c) Sequence ID 69[X1QGTHFPYT], During the ceremony, X1 is either L or M. d) Sequence ID 16, e) Sequence ID 35, f) Sequence ID 43, g) Sequence ID 50, and h) Sequence ID 58 Light chain variable containing an LCDR3 amino acid sequence selected from the group consisting of the following: region Includes.

[0017] In another embodiment, the antibody or its antigen-binding fragment is a) Sequence ID 11[WASTRX1], During the ceremony, X1 is E, D, Q, or N. b) Sequence ID 67[X2ASTRX2], During the ceremony, X1 is either W or G. X2 is E, D, Q, or N. c) Sequence ID 17, d) Sequence ID 36, e) Sequence ID 51, and f) Sequence ID 59 It contains an LCDR2 amino acid sequence selected from the group consisting of the following.

[0018] In another embodiment, the antibody or its antigen-binding fragment is a) Sequence ID 12 [KSSQSLLX1SSNQKNX2LA], During the ceremony, X1 is W, H, Y, or F. X2 is either H or Y. b) Sequence ID 68 [KSSQSLLX1X2SX3QX4NX5LA], During the ceremony, X1 is W, H, Y, or F. X2 is either S or G. X3 is either N or D. X4 is either K or R. X5 is either H or Y. c) Sequence ID 70 [KSSQSLLYSNGX1TYLN], During the ceremony, X1 is either K or E. b) Sequence ID 18, c) Sequence ID 37, d) Sequence ID 44, e) Sequence ID 52, and f) Sequence ID 60 It contains an LCDR1 amino acid sequence selected from the group consisting of the following.

[0019] In another embodiment, the antibody or its antigen-binding fragment comprises a heavy chain variable region containing amino sequences of the HCDR3, HCDR2, and HCDR1 regions described in SEQ ID NOs: 13, 14, and 15, respectively, and one or more amino acid substitutions by Kabat at positions selected from the group consisting of H1, H5, H9, H11, H12, H16, H38, H40, H41, H43, H44, H66, H75, H79, H81, H82A, H83, H87, and H108.

[0020] In another embodiment, the antibody or its antigen-binding fragment comprises a light chain variable region containing amino sequences of the LCDR3, LCDR2, and LCDR1 regions described in SEQ ID NOs: 16, 17, and 18, respectively, and one or more amino acid substitutions by Kabat at positions selected from the group consisting of L5, L9, L15, L18, L19, L21, L22, L43, L63, L78, L79, L83, L85, L100, and L104.

[0021] In another embodiment, the antibody or its antigen-binding fragment is SEQ ID NO: 19, It includes a heavy chain variable region amino acid sequence that has at least 90% identity with an amino acid sequence selected from the group consisting of 20, 21, 22, 24, 25, 38, 45, 53, and 61.

[0022] In another embodiment, the antibody or its antigen-binding fragment is a light chain variable having at least 90% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62. region Contains amino acid sequence.

[0023] In another embodiment, the antibody or its antigen-binding fragment includes a light chain variable region amino acid sequence having at least 90% identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62.

[0024] In another embodiment, the antibody or its antigen-binding fragment is a heavy chain variable containing an amino acid sequence selected from the group consisting of SEQ ID NOs: 19, 20, 21, 22, 24, 25, 38, 45, 53, and 61. region Includes.

[0025] In another embodiment, the antibody or its antigen-binding fragment is a light chain variable selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62. region Contains amino acid sequence.

[0026] In another embodiment, the antibody or its antigen-binding fragment comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62.

[0027] In another embodiment, the antibody or its antigen-binding fragment comprises variable region amino acids of the heavy chain and light chain, respectively, as described in SEQ ID NOs: 19 and 26, SEQ ID NOs: 20 and 27, SEQ ID NOs: 21 and 28, SEQ ID NOs: 22 and 28, SEQ ID NOs: 23 and 29, SEQ ID NOs: 24 and 30, SEQ ID NOs: 25 and 31, SEQ ID NOs: 38 and 39, SEQ ID NOs: 45 and 46, SEQ ID NOs: 53 and 54, or SEQ ID NOs: 61 and 62.

[0028] In another embodiment, the present invention relates to calidine and desArg 10 - The binding to calidine competes with antibodies containing variable region amino acid sequences of the heavy chain and light chain, respectively, as described in SEQ ID NOs: 19 and 26, SEQ ID NOs: 38 and 39, SEQ ID NOs: 45 and 46, SEQ ID NOs: 53 and 54, or SEQ ID NOs: 61 and 62, for calidine and des-Arg 10 - Provides an antibody or its antigen-binding fragment that specifically binds to calidine.

[0029] In another embodiment, the present invention relates to calidine or desArg 10 - Provides an isolated monoclonal antibody or its antigen-binding fragment that competes with the antibody described in any one of the claims for binding to calidine and does not bind to bradykinin or desArg9-bradykinin.

[0030] In another embodiment, the present invention provides an isolated monoclonal antibody or its antigen-binding fragment that specifically binds to a conformational epitope of calidine (KD) or desArg10-calidine (DAKD), which adopts a Pro4 kink conformation containing a type II sharp curve at proline 4 of KD or DAKD. In one embodiment, the Pro4 kink conformation of KD or DAKD further comprises an S-shaped amino acid repeat spatially stacked and aligned with the hydrophobic side chain of the amino acid. In another embodiment, the antibody or its antigen-binding fragment comprises (a) calidine or des-Arg 10- Specifically binds to calidine, but also to bradykinin or des -Arg9-bradykinin does not specifically bind, and b) calidine or des-Arg 10 - 1 x 10 units of calidin -10 Specifically binds to KD less than M, and c) calidine or des-Arg 10 - 1 x 10 units of calidin 4 s -1 K less than off d) kalidine or des-Arg 10 - It specifically binds to calidine and inhibits its binding to the bradykinin B1 receptor.

[0031] In another embodiment, the antibody or antigen-binding fragment of the present invention is conjugated to a diagnostic or therapeutic agent.

[0032] In another embodiment, the present invention provides isolated nucleic acids encoding the amino acid sequence of the antibody or its antigen-binding fragment.

[0033] In another embodiment, the present invention provides a recombinant expression vector comprising the nucleic acid of the present invention.

[0034] In another embodiment, the present invention provides a host cell containing the recombinant expression vector of the present invention.

[0035] In another embodiment, the present invention relates to host cells of the present invention to calidine and desArg 10 - Caryidine and des-Arg, including culturing under conditions in which host cells produce antibodies that specifically bind to aryidine. 10 - Provides a method for generating antibodies that specifically bind to calidine.

[0036] In another embodiment, the present invention provides a pharmaceutical composition comprising the antibody or its antigen-binding fragment and one or more pharmaceutically acceptable carriers.

[0037] In another embodiment, the present invention comprises administering the pharmaceutical composition of the present invention to a subject in need thereof, for a disease or disorder of calidin or des-Arg 10 - Provides a method for treating calidine-related diseases or disorders.

[0038] In one embodiment, the disease or disorder is chronic pain.

[0039] In another embodiment, the present invention provides a peptide comprising the amino acid sequence described in SEQ ID NO: 11, des-Arg9-bradykinin, des-Arg 10 -Callidine, and des-Arg 10 -Immunizing animals with an immunogen containing the peptide, such that the arginine at the amino terminus of the peptide is indirectly coupled to the carrier portion by the linker portion, so that antibodies that specifically bind to the calidine-like peptide are produced by the animal's immune system, including des-Arg9-bradykinin and des-Arg 10 - Provides a method for producing antibodies that specifically bind to calidine-like peptides.

[0040] In another embodiment, the method includes isolating antibodies, nucleic isolating the nuclei encoding the antibodies, or immune cells expressing the antibodies from an animal.

[0041] In one embodiment, the carrier portion is a protein. In another embodiment, the protein is keyhole limpet hemocyanin (KLH). In yet another embodiment, the linker portion contains [Gly-Gly-Gly]n, where n is at least 1. [Brief explanation of the drawing]

[0042] [Figure 1] This figure shows the results of an ELISA assay demonstrating the binding of the EE1 antibody to the kinin peptide. [Figure 2] This figure shows the results of differential scanning calorimetry of antibody F151. [Figure 3]This figure shows the amino acid sequence alignment of the variable regions of mouse and humanized F151 antibodies. All identical residues are listed in the alignment, homologous residues are identified by the symbol "+", and non-homologous residues are left blank. [Figure 4] This figure shows the electron density map of the antigen-binding site of the F151 antibody / calidine complex. [Figure 5] This figure shows the electron density map of the antigen-binding site of the F151 antibody / des-Arg10-calidine complex. [Figure 6] This diagram, represented by ribbons and rods, shows the Fv subunit of F151 bound to calidine. [Figure 7] This figure shows the amino acid sequence alignment of the light chain variable region of an exemplary mouse anti-kalidine antibody of the present invention. Amino acid residues that interact with kalidine are marked with asterisks. [Figure 8] This figure shows the amino acid sequence alignment of the heavy chain variable region of an exemplary mouse anti-kalidine antibody of the present invention. Amino acid residues that interact with kalidine are marked with asterisks. [Figure 9] This figure shows the results of in vivo experiments determining the effect of EE1 antibodies on formalin-induced acute inflammatory pain. [Figure 10] This figure shows the results of in vivo experiments determining the effect of EE1 antibodies on CFA-induced mechanical hypersensitivity. [Figure 11] This figure shows the results of in vivo experiments determining the effect of EE1 antibodies on CFA-induced thermal hypersensitivity. [Figure 12] This figure shows the results of in vivo experiments determining the effect of the EE1 antibody on CCI-induced mechanical hypersensitivity. [Figure 13] This figure shows the results of in vivo experiments determining the effect of EE1 antibodies on CCI-induced thermal hypersensitivity. [Figure 14]This figure shows a schematic map of the VL and VH expression constructs for producing the humanized F151 variant HC3a / LC3a, with restriction DNA endonuclease sites shown as putative sequences in bold and underlined. Panel A represents the light chain, and Panel B represents the heavy chain. [Figure 15] This figure shows the alignment of the amino acid sequences of the heavy chain (A) and light chain (B) of F151 with the nearest human germline amino acid sequence. [Figure 16] This figure shows the alignment of the heavy chain (A) and light chain (B) of F151 with the heavy chain loci (1-08 and 1-18) and light chain loci (V, IV, and B3) of the VH1 subfamily. The CDR and vernier regions are shown in bold, and humanization mutations are underlined. [Figure 17] (C) This figure shows the (A) secondary structure and (B) quaternary structure of the calidin (KD) main chain polypeptide backbone conformation bound to the F151 antibody containing a type II tight turn of proline 4. [Modes for carrying out the invention]

[0043] This invention relates to calidine and desArg 10 - Provides antibodies that specifically bind to calidine and prevent binding to the bradykinin B1 receptor. Such antibodies are found in calidine and des-Arg 10 - Particularly useful for treating calidine-related diseases or disorders (e.g., pain). The present invention also relates to pharmaceutical compositions, as well as anticalidine and des-Arg 10 - The present invention also provides nucleic acids encoding calidine antibodies, recombinant expression vectors, and host cells for creating such antibodies or fragments thereof. 10 - A method for detecting calidine, or calidine and des-Arg 10 -Methods for modulating calidine activity are also included in the present invention.

[0044] I. Definition To make the present invention easier to understand, certain terms are defined first.

[0045] As used herein, the term "calidin" means a peptide containing or derived from the amino acid sequence KRPPGFSPFR (SEQ ID NO: 1).

[0046] The term "des-Arg" is used herein. 10 The term "-calidine" refers to a peptide that contains or is derived from the amino acid sequence KRPPGFSPF (SEQ ID NO: 2).

[0047] As used herein, the terms “mouse calidin” or “calidin-like peptide” mean a peptide containing or derived from the amino acid sequence RRPPGFSPFR (Sequence ID 3).

[0048] The term "mouse des-Arg" is used herein. 10 -Callidine or des-Arg 10 The term "calidin-like peptide" refers to a peptide that contains or is derived from the amino acid sequence RRPPGFSPF (Sequence ID 4).

[0049] As used herein, the term "bradykinin" means a peptide containing or derived from the amino acid sequence RPPGFSPFR (SEQ ID NO: 5).

[0050] As used herein, the term "des-Arg9-bradykinin" means a peptide containing or derived from the amino acid sequence RPPGFSPF (SEQ ID NO: 6).

[0051] As used herein, the term “antibody” means an immunoglobulin molecule comprising four polypeptide chains, namely two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, and their polymer (e.g., IgM). Each heavy chain has a heavy chain variable region (abbreviated as V). H or VH) and heavy chain constant region (C HIt includes (or CH). The heavy chain constant region is C H 1, C H 2, and C H It contains three domains. Each light chain has a light chain variable region (abbreviated as V). L ) and light chain constant region (C L It includes (or CL). The light chain constant region is one domain (C L Includes 1). V H and V L The region can be further subdivided into a highly variable region called the Complementarity Determination Region (CDR), into which a more conserved region called the Framework Region (FR) is inserted. H and V L Each consists of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0052] As used herein, the term “antigen-binding fragment” of an antibody includes any naturally occurring, enzymatically obtainable, synthetic, or genetically modified polypeptide or glycoprotein that specifically binds to an antigen to form a complex. Antigen-binding fragments of antibodies are antibody-variable region and in some cases, steady state region The antigen-binding portion may originate from a complete antibody molecule or the like, using any appropriate standard technique, such as proteolytic digestion or recombinant gene manipulation, involving the manipulation and expression of the DNA encoding it. Non-limiting examples of antigen-binding portions include (i) Fab fragments; (ii) F(ab')2 fragments; (iii) Fd fragments; (iv) Fv fragments; (v) single-chain Fv(scFv) molecules; (vi) dAb fragments; and (vii) minimal recognition units (e.g., isolated complementarity-determining regions (CDRs)) consisting of amino acid residues that mimic the hypervariable region of an antibody. Other manipulated molecules, such as diabodies, triabodies, tetrabodies, and minibodies, are also included within the scope of the expression “antigen-binding fragment.”

[0053] As used herein, the term “CDR” or “complementarity-determining region” refers to non-adjacent antigen-binding sites found within the variable regions of both heavy and light chain polypeptides. These specific regions have been described by Kabat et al., J. Biol. Chem., vol. 252, pp. 6609–6616 (1977), Kabat et al., Sequences of protein of immunological interest. (1991), Chothia et al., J. Mol. Biol., 196: pp. 901–917 (1987), and MacCallum et al., J. Mol. Biol., vol. 262, pp. 732–745 (1996), and their definition includes overlaps or subsets of amino acid residues when compared to each other. The amino acid residues encompassing the CDRs defined by each of the references cited above are listed for comparison. In one embodiment of the present invention, the term "CDR" is a CDR as defined by Kabat based on a comparison of sequences.

[0054] As used herein, the term “framework (FR) amino acid residue” refers to an amino acid in the framework region of the Ig chain. As used herein, the terms “framework region” or “FR region” include amino acid residues that are part of the variable region but not part of the CDR (for example, using Kabat’s definition of CDR). Thus, the variable region framework includes only amino acids between approximately 100 and 120 in length that are outside the CDR.

[0055] As used herein, the term "specifically binds to" means that the antibody or its antigen-binding fragment binds to the antigen at least about 1 × 10⁻¹⁶ times. -6 M, 1×10 -7 M, 1×10 -8 M, 1×10 -9 M, 1×10 -10 M, 1×10 -11 M, 1×10 -12This refers to the ability to bind with a Kd of M or greater. The term also encompasses the ability of an antibody or its antigen-binding fragment to bind to an antigen with an affinity at least twice as great as its affinity to nonspecific antigens. However, it should be understood that an antibody or its antigen-binding fragment can specifically bind to two or more antigens related in their sequence (e.g., kalidine or des-Arg10-kalidine and mouse kalidine or des-Arg10-kalidine).

[0056] As used herein, the term “antigen” means a binding site or epitope recognized by an antibody or its antigen-binding fragment.

[0057] As used herein, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it is ligated. One type of vector is a “plasmid,” which means a circular double-stranded DNA loop into which further DNA segments can be ligated. Another type of vector is a viral vector, into which further DNA segments can be ligated into the viral genome. Certain types of vectors can autonomously replicate in the host cell into which they are introduced (e.g., bacterial vectors have bacterial replication origins and mammalian episomal vectors). Other vectors (e.g., mammalian non-episomal vectors) can be incorporated into the host cell's genome when introduced into the host cell, thereby replicating together with the host genome. Furthermore, certain types of vectors can direct the expression of genes to which they are operably ligated. Such vectors are referred herein as “recombinant expression vectors” (or simply “expression vectors”). Generally, expression vectors useful in recombinant DNA technology are often in the form of plasmids. The terms “plasmid” and “vector” can be used interchangeably. However, the present invention also includes other forms of expression vectors that provide equivalent functionality, such as viral vectors (e.g., replication-deficient retroviruses, adenoviruses, and adeno-associated viruses).

[0058] As used herein, the term “host cell” refers to the cell into which the recombinant expression vector is introduced. It should be understood that this term includes not only the specific target cell but also its offspring. Because certain modifications may occur in subsequent generations due to mutation or environmental influences, such offspring may not actually be identical to the parent cell, but they are still included within the scope of the term “host cell” as used herein.

[0059] As used herein, the terms “to treat,” “of treatment,” and “treatment” mean the therapeutic or preventive measures described herein. A “treatment” method involves administering an antibody or antigen-binding fragment of the present invention to a subject having, for example, a calidine and des-Arg10-calidine-related disease or disorder (e.g., an inflammatory disease), or a subject predisposed to such a disease or disorder, in order to prevent, cure, delay, reduce the severity of, or restore one or more symptoms of a disease or disorder, or a recurrent disease or disorder, or to extend the survival of the subject beyond what would be expected in the absence of such treatment.

[0060] As used herein, "calidin or des-Arg 10 - The term "calidine-related disease or disorder" refers to altered levels or activity of calidine or des-Arg 10 -Includes disease conditions and / or symptoms associated with disease conditions in which calidines are found. Exemplary calidines or des-Arg 10 - Calidine-related disorders or conditions include, but are not limited to, pain and fibrosis.

[0061] As used herein, the term “effective dose” means the amount of calidin or des-Arg as described herein when administered to a subject. 10 - Sufficient to provide treatment, prognosis, or diagnosis of calidine-related diseases or disorders, or to provide a diagnosis of calidine or des-Arg 10-This refers to the amount of antibody or its antigen-binding fragment that binds to calidine. The therapeutically effective dose varies depending on the subject and disease state being treated, the subject's weight and age, the severity of the disease state, the mode of administration, etc., and can be easily determined by those skilled in the art. The dose to be administered may be in the range of, for example, about 1 ng to about 10,000 mg, about 1 ug to about 5,000 mg, about 1 mg to about 1,000 mg, or about 10 mg to about 100 mg of the antibody or its antigen-binding fragment according to the present invention. The dose regimen can be adjusted to produce the optimal therapeutic response. The effective dose is also the amount in which any toxic or adverse effects (i.e., side effects) of the antibody or its antigen-binding fragment are minimized, or the beneficial effects outweigh them.

[0062] As used herein, the term “subject” includes all human and non-human animals.

[0063] As used herein, the term “epitope” refers to an antigenic determinant that interacts with a specific antigen-binding site in the variable region of an antibody molecule, known as a paratope. A single antigen may have more than one epitope. Thus, different antibodies may bind to different regions on an antigen and have different biological effects. Epitopes may be conformational or linear. Conformational epitopes are generated by spatially juxtaposed amino acids from different segments of a linear polypeptide chain. Linear epitopes are generated by adjacent amino acid residues in a polypeptide chain.

[0064] Herein, it should be noted that the singular forms “a,” “an,” and “the” as used herein and in the appended claims include plural referents unless the context clearly indicates otherwise.

[0065] II. Anticalidine or antides-Arg 10 - Calidine antibody In one embodiment, the present invention relates to calidine or desArg10 - The present invention provides an antibody or its antigen-binding fragment that specifically binds to calidine. The amino acid sequences of exemplary VH, VL, and CDR antibodies of the present invention are shown in Table 1.

[0066] [Table 1]

[0067] [Table 2]

[0068] [Table 3]

[0069] [Table 4]

[0070] [Table 5]

[0071] In one embodiment, the antibody or its antigen-binding fragment contains one or more CDR region amino acid sequences selected from the group consisting of SEQ ID NOs: 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 32, 33, 34, 35, 36, 37, 40, 41, 42, 43, 44, 47, 48, 49, 50, 51, 52, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, and 70.

[0072] In other embodiments, the antibody or its antigen-binding fragment is, a) Sequence IDs 7, 8, and 9, b) Sequence IDs 13, 14, and 15, c) Sequence IDs 32, 33, and 34, d) Sequence IDs 40, 41, and 42, e) Sequence IDs 47, 48, and 49, f) Sequence IDs 55, 56, and 57, and g) Sequence IDs 63, 64, and 65 The amino acid sequences of the HCDR3, HCDR2, and HCDR1 regions are selected from the group consisting of the following.

[0073] In other embodiments, the antibody or its antigen-binding fragment is, a) Sequence IDs 10, 11, and 12, b) Sequence IDs 16, 17, and 18, c) Sequence IDs 35, 36, and 37, d) Sequence IDs 43, 17, and 44, e) Sequence IDs 50, 51, and 52, f) Sequence IDs 58, 59, and 60, g) Sequence IDs 66, 67, and 68, and h) The amino acid sequences of the LCDR3, LCDR2, and LCDR1 regions selected from the group consisting of SEQ ID NOs: 69, 25, and 70.

[0074] In other embodiments, the antibody or its antigen-binding fragment is, a) Sequence IDs 7, 8, 9, 10, 11, and 12, b) Sequence IDs 13, 14, 15, 16, 17, and 18, c) Sequence IDs 32, 33, 34, 35, 36, and 37, d) Sequence IDs 40, 41, 42, 43, 17, and 44, e) Sequence IDs 47, 48, 49, 50, 51, and 52, and f) Sequence IDs 55, 56, 57, 58, 59, and 60 The amino acid sequences of the HCDR3, HCDR2, HCDR1, LCDR3, LCDR2, and LCDR1 regions are selected from the group consisting of the above.

[0075] In other embodiments, the present invention provides a humanized antibody or its antigen-binding fragment comprising one or more CDR regions (or conservatively modified variants thereof) from a mouse antibody disclosed herein. The humanized antibody of the present invention can be produced by any method of humanization. Suitable methods are disclosed herein and specifically illustrated in Example 4.

[0076] In one particular embodiment, a humanized antibody or its antigen-binding fragment is A heavy chain variable region containing the amino sequences of the HCDR3, HCDR2, and HCDR1 regions described in 13, 14, and 15, respectively, and one or more amino acid substitutions at positions selected from the group consisting of H1, H5, H9, H11, H12, H16, H38, H40, H41, H43, H44, H66, H75, H79, H81, H82A, H83, H87, and H108, and / or Light chain variable regions (according to Kabat's numbering rules) containing one or more amino acid substitutions at positions selected from the group consisting of the amino sequences of the LCDR3, LCDR2, and LCDR1 regions described in 16, 17, and 18, respectively, and L5, L9, L15, L18, L19, L21, L22, L43, L63, L78, L79, L83, L85, L100, and L104. Includes.

[0077] In other embodiments, the antibody or its antigen-binding fragment comprises the VH region amino acid sequence described in SEQ ID NOs: 19, 20, 21, 22, 24, 25, 38, 45, 53, and / or 61.

[0078] In other embodiments, the antibody or its antigen-binding fragment comprises the VL region amino acid sequence described in SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and / or 62.

[0079] In other embodiments, the antibody or its antigen-binding fragment comprises VH and VL region amino acid sequences selected from the group consisting of SEQ ID NOs: 19 and 26, SEQ ID NOs: 20 and 27, SEQ ID NOs: 21 and 28, SEQ ID NOs: 22 and 28, SEQ ID NOs: 23 and 29, SEQ ID NOs: 24 and 30, SEQ ID NOs: 25 and 31, SEQ ID NOs: 38 and 39, SEQ ID NOs: 45 and 46, SEQ ID NOs: 53 and 54, or SEQ ID NOs: 61 and 62, respectively.

[0080] In one embodiment, the antibody or its antigen-binding fragment comprises one or more CDR region amino acid sequences selected from the group consisting of SEQ ID NOs: 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 32, 33, 34, 35, 36, 37, 40, 41, 42, 43, 44, 47, 48, 49, 50, 51, 52, 55, 56, 57, 58, 59, and 60, wherein one or more CDR region amino acid sequences comprises at least one or more conserved amino acid substitutions.

[0081] The present invention also includes "conservative amino acid substitutions" in the CDR amino acid sequences of the antibodies of the present invention (e.g., SEQ ID NOs: 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 32, 33, 34, 35, 36, 37, 40, 41, 42, 43, 44, 47, 48, 49, 50, 51, 52, 55, 56, 57, 58, 59, and 60), i.e., amino acid sequence modifications that do not inhibit the binding of the antibody to an antigen such as calidine or des-Arg10-calidine. Conservative amino acid substitutions include the same amino acid in one class. Substitutions by amino acids of the same class are included, and the classes are defined by the common physicochemical properties and high-frequency substitutions of amino acid side chains in homologous proteins found in nature, as determined by standard Dayhoff frequency exchange matrices or BLOUSUM matrices, etc. Six common classes of amino acid side chains have been categorized, including Class I (Cys), Class II (Ser, Thr, Pro, Ala, Gly), Class III (Asn, Asp, Gln, Glu), Class IV (His, Arg, Lys), Class V (Ile, Leu, Val, Met), and Class VI (Phe, Tyr, Trp). For example, the substitution of Asp for another residue of Class III, such as Asn, Gln, or Glu, is a conserved substitution. Thus, it is preferable that the expected non-essential amino acid residues in anti-calidine or des-Arg10-calidine antibodies are substituted with another amino acid residue from the same class. Methods for identifying conserved amino acid substitutions that do not exclude antigen binding are well known in the art (see, for example, Brummell et al., Biochem., vol. 32, pp. 1180-1187 (1993); Kobayashi et al., Protein Eng., vol. 12(10), pp. 879-884 (1999); and Burks et al., Proc. Natl. Acad. Sci. USA, vol. 94, pp. 412-417 (1997)).

[0082] In another embodiment, the present invention provides an anti-calidine or des-Arg10-calidine antibody or an antigen-binding fragment thereof comprising the VH and / or VL region amino acid sequence with approximately 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the VH region amino acid sequence described in SEQ ID NOs. 19, 20, 21, 22, 24, 25, 38, 45, 53, or 61, or the VL region amino acid sequence described in SEQ ID NOs. 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, or 62.

[0083] In another embodiment, the present invention provides anti-calidine or des-Arg10-calidine antibodies that bind to and / or cross-compete with the same epitopes as antibodies or their antigen-binding fragments containing amino acid sequences of the VH and VL regions described in SEQ ID NOs: 19 and 25, SEQ ID NOs: 38 and 39, SEQ ID NOs: 45 and 46, SEQ ID NOs: 53 and 54, or SEQ ID NOs: 61 and 62, respectively. Such antibodies can be identified using routine competitive binding assays, for example, surface plasmon resonance (SPR) based competitive assays.

[0084] In one embodiment, the antibody of the present invention binds to an epitope of a kallidine (KD) or desArg10-callidine (DAKD) conformation that adopts a “Pro4 kink” conformation. As shown in Figure 17, the “Pro4 kink” conformation is characterized by a type II tight turn of proline 4 in the main chain polypeptide backbone of KD or DAKD. As is known to those skilled in the art, the type II tight turn conformation comprises three residues (X1-X2-X3), where the carbonyl of residue X1 forms a hydrogen bond with the amide N of residue X3 (typically glycine) (see Richardson JS. “The anatomy and taxonomy of protein structure.” Adv Protein Chem., 1981, Vol. 34, pp. 167–339, incorporated herein by reference). Thus, in one embodiment, the type II tight turn conformation is formed by the Pro3-Pro4-Gly5 motif of KD or DAKD. In a more specific embodiment, the “Pro4 kink” conformation is further defined by all or substantially all of the remaining amino acids of KD(1-2 and 6-9) or DAKD taking an S-shaped repeat that is spatially stacked and aligns with the hydrophobic side chain.

[0085] III. Modified anticalidine or des-Arg10-calidine antibody In one embodiment, the anti-calidine or des-Arg10-calidine antibody of the present invention may comprise one or more modifications. Modified forms of the anti-calidine or des-Arg10-calidine antibody of the present invention can be prepared using any technique known in the art.

[0086] i) Reduction of immunogenicity In one embodiment, the anti-kalidine or des-Arg10-kalidine antibodies of the present invention, or their antigen-binding fragments, are modified to reduce their immunogenicity using techniques recognized in the art. For example, the antibodies or their fragments can be chimeric, humanized, and / or deimmunized.

[0087] In one embodiment, the antibody or its antigen-binding fragment of the present invention may be a chimeric antibody. A chimeric antibody is an antibody in which different parts of the antibody originate from different animal species, such as a mouse monoclonal antibody and an antibody having a variable region derived from the constant region of human immunoglobulin. Methods for generating chimeric antibodies or fragments of the same antibody are known in the art. See, for example, Morrison, Science, Vol. 229, p. 1202 (1985); Oi et al., BioTechniques, Vol. 4, p. 214 (1986); Gillies et al., J.Immunol.Methods, Vol. 125, pp. 191-202 (1989); U.S. Patents No. 5,807,715, No. 4,816,567, and No. 4,816,397, which are incorporated herein by reference in their entirety. Techniques developed to generate "chimeric antibodies" (Morrison et al., Proc. Natl. Acad. Sci., Vol. 81, pp. 851-855 (1984); Neuberger et al., Nature, Vol. 312, pp. 604-608 (1984); Takeda et al., Nature, Vol. 314, pp. 452-454 (1985)) may be used in the synthesis of the aforementioned molecules. For example, a gene sequence encoding the binding specificity of a mouse anti-calidine or des-Arg10-calidine antibody molecule may be fused with a sequence from a human antibody molecule of appropriate biological activity. The chimeric antibodies used herein are molecules having variable regions derived from mouse monoclonal antibodies and human immunoglobulin constant regions, such as humanized antibodies, in which different parts are derived from different animal species.

[0088] In another embodiment, the antibody or its antigen-binding fragment of the present invention is humanized. The humanized antibody has binding specificity comprising one or more complementarity-determining regions (CDRs) from a non-human antibody and a framework region from a human antibody molecule. Often, framework residues in the human framework region are substituted with corresponding residues from a CDR donor antibody to modify, and preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, for example, by modeling the interaction between CDRs and framework residues to identify framework residues important for antigen binding and sequence comparison, in order to identify unusual framework residues at specific locations (see, for example, Queen et al., U.S. Patent No. 5,585,089; Riechmann et al., Nature, Vol. 332, p. 323 (1988), which is incorporated herein by reference in its entirety). Antibodies can be used, for example, by CDR grafting (EP239,400; PCT Publication WO91 / 09967, U.S. Patents 5,225,539, 5,530,101, and 5,585,089), veneering or resurfacing (EP592,106; EP519,596; Padlan, Molecular Immunology, Vol. 28 (4 / 5), pp. 489-498 (1991); Studnicka et al., Protein Engineering, Vol. 7 (6), pp. 805-814 (1994); Roguska et al., PNAS, Vol. 91, pp. 969-973 (1994)), and Humanization can be achieved using various techniques known in the art, including chain shuffling (U.S. Patent No. 5,565,332).

[0089] In a particular embodiment, a humanization method is used that is based on the influence of the flexibility of antibody molecules during and at immunorecognition (see WO2009 / 032661, which is incorporated herein by reference in its entirety). Protein flexibility is related to the molecular motion of protein molecules. Protein flexibility is the ability of a whole protein, a part of a protein, or a single amino acid residue to take on an ensemble of conformations that are remarkably different from each other. Information on protein flexibility can be obtained by performing X-ray crystallography experiments of proteins (see, e.g., Kundu et al., 2002, Biophys J, vol. 83, 723-732), nuclear magnetic resonance experiments (see, e.g., Freedberg et al., J Am Chem Soc, 1998, vol. 120(31), pp. 7916-7923), or by operating molecular dynamics (MD) simulations. Protein MD simulations are performed on a computer and can determine the motion of all protein atoms over a period of time by calculating the physical interactions between atoms. The output of an MD simulation is the trajectory of the protein under test over the duration of the simulation. The trajectory is an ensemble of protein conformations, also called a snapshot, and is sampled periodically over the duration of the simulation, for example, every picosecond (ps). The flexibility of amino acid residues in a protein can be quantified by analyzing the ensemble of snapshots. Thus, flexible residues take on different conformational ensembles in relation to the polypeptide in which they reside. MD methods are known in the art, for example, Brooks et al., "Proteins: See "A Theoretical Perspective of Dynamics, Structure and Thermodynamics" (Wiley, New York, 1988). Several software programs enable MD simulations, including Amber (see Case et al. (2005), J Comp Chem, Vol. 26, pp. 1668-1688), Charmm (see Brooks et al. (1983), J Comp Chem, Vol. 4, pp. 187-217; and MacKerell et al. (1998), "The Encyclopedia of Computational Chemistry," Vol. 1, pp. 271-177, edited by Schleyer et al., Chichester: John Wiley & Sons), or Impact (see Rizzo et al., J Am Chem Soc, 2000, Vol. 122 (51), pp. 12898-12900).

[0090] Most protein complexes share a relatively large, planar, embedded surface, and the flexibility of binding partners is the cause of the plasticity of the protein complex, allowing it to conformally adapt to one another (Structure (2000), Vol. 8, pp. R137-R142). Therefore, examples of "induced fit" have been shown to play a dominant role at the protein-protein interface. Furthermore, there is a steadily growing body of data showing that proteins do indeed bind to ligands of diverse shape, size, and composition (Protein Science (2002), Vol. 11, pp. 184-187), and that conformational diversity is considered an essential component of the ability to recognize different partners (Science (2003), Vol. 299, pp. 1362-1367). Flexible residues are involved in the binding of protein-protein partners (Structure (2006), Vol. 14, pp. 683-693).

[0091] Flexible residues offer a variety of conformations that provide an ensemble of interaction areas that may be recognized by memory B cells and potentially trigger immunogenic responses. This allows for the modification of a limited number of residues, including: (1) constructing a homology model of the parent mAb and running MD simulations; (2) analyzing the identity of flexible residues and the most flexible residues of non-human antibody molecules, as well as identifying residues or motifs that may be the source of heterogeneity or degradation reactions; (3) identifying human antibodies that exhibit the most similar ensemble of recognition areas as the parent antibody; (4) determining the flexible residues to be mutated, mutating any residues or motifs that may be the source of heterogeneity and degradation; and (5) examining the presence of known T cell or B cell epitopes. Flexible residues can be found using MD calculations taught herein with a dark-solvent model, which explains the interaction of the aqueous solvent with the protein atoms over the duration of the simulation.

[0092] After identifying a set of flexible residues within the variable light and heavy chains, a set of human heavy and light chain variable region frameworks that approximates the antibody of interest is identified. This can be done using BLAST or similar methods against a database of antibody human germline sequences, or by comparing the dynamics of the parental mAb to the dynamics of a reference germline sequence from a library. CDR residues and adjacent residues are excluded from the search to ensure high affinity for the antigen is conserved. The flexible residues are then replaced.

[0093] When several human residues exhibit similar homology, selection is also driven by the properties of the residues, which may affect the solution behavior of the humanized antibody. For example, in flexible loops exposed across hydrophobic residues, polar residues are preferred. Residues that are potential sources of instability and heterogeneity are also mutated, even if they are found in the CDR. These residues include exposed methionine, because sulfoxide formation can result from oxygen radicals, proteolytic cleavage of acid-unstable bonds (e.g., cleavage of the Asp-Pro dipeptide) (Drug Dev Res (2004) Vol. 61, pp. 137-154), deamination sites found in exposed asparagine residues and subsequent small amino acids (e.g., Gly, Ser, Ala, His, Asn, or Cys) (J Chromatog (2006) Vol. 837, pp. 35-43), and N-glycosylation sites (e.g., Asn-X-ser / Thr sites). Typically, exposed methionine is substituted with Leu, exposed asparagine is substituted with glutamine or aspartate, or the subsequent residues are altered. For glycosylation sites (Asn-X-Ser / Thr), either the Asn or Ser / Thr residue is altered.

[0094] The resulting complex antibody sequence is checked for the presence of known B-cell or linear T-cell epitopes. For example, a search is performed in publicly available immunoepitope databases (IEDPs) (PLos Biol (2005) Vol. 3(3), e91). If a known epitope is found within the complex sequence, another set of human sequences is recovered and substituted. Thus, unlike the resurgent method of U.S. Patent No. 5,639,641, both B-cell and T-cell mediated immunogenic reactions are addressed by this method. This method also avoids the loss of activity problem sometimes observed with CDR grafting (U.S. Patent No. 5,530,101). Furthermore, stability and solubility issues are also considered in the manipulation and selection processes, resulting in antibodies optimized for low immunogenicity, high antigen affinity, and improved biophysical properties.

[0095] In some embodiments, deimmunization can be used to reduce the immunogenicity of an antibody or its antigen-binding fragment. As used herein, the term “deimmunization” includes modifications in which the antibody or its antigen-binding fragment modifies T cell epitopes (see, e.g., WO9852976A1, WO0034317A2). For example, VH and VL sequences may be analyzed from a starting antibody to produce a human T cell epitope “map” from each V region indicating the epitope location with respect to complementarity-determining regions (CDRs) and other key residues in the sequence. Individual T cell epitopes are analyzed from the T cell epitope map to identify alternative amino acid substitutions that have a low risk of altering the activity of the final antibody. A range of alternative VH and VL sequences, including combinations of amino acid substitutions, are designed and these sequences are subsequently incorporated into a range of calidine or des-Arg10-calidine-specific antibodies or fragments for use in the diagnostic and treatment methods disclosed herein, and then tested for function. Typically, variant antibodies between 12 and 24 variants are produced and tested. The complete heavy and light chain genes, including the modified V and human C regions, are then cloned into an expression vector, and the subsequent plasmid is introduced into a cell line to produce the total antibody. The antibodies are then compared in appropriate biochemical and biological assays to identify the optimal variant.

[0096] ii) Effects function and Fc modification The anti-kalidine or des-Arg10-kalidine antibodies of the present invention may include an antibody constant region (e.g., an IgG constant region, e.g., a human IgG constant region, e.g., a human IgG1 or IgG4 constant region) that mediates one or more effector functions. For example, when the complement C1 component binds to the antibody constant region, the complement system may be activated. Complement activation is important in opsonization and cellular lysis of pathogens. Complement activation may also stimulate inflammatory responses and be involved in autoimmune hypersensitivity. Furthermore, antibodies bind to various receptors on cells via their Fc region, and the Fc receptor binding site on the antibody's Fc region binds to Fc receptors (FcRs) on cells. There are numerous Fc receptors that are specific to various classes of antibodies, including IgG (gamma receptor), IgE (epsilon receptor), IgA (alpha receptor), and IgM (mu receptor). The binding of antibodies to Fc receptors on the cell surface triggers a number of important and diverse biological responses, including phagocytosis and destruction of antibody-coated particles, clearance of immune complexes, lysis of antibody-coated target cells by killer cells (known as antibody-dependent cell-mediated injury or ADCC), release of inflammatory mediators, placental cross-transmission, and regulation of immunoglobulin production. In a preferred embodiment, the antibody or fragment of the present invention binds to the Fc-gamma receptor. In an alternative embodiment, the anti-kalidine or des-Arg10-kalidine antibody of the present invention may include a constant region lacking one or more effector functions (e.g., ADCC activity) and / or unable to bind to the Fc receptor.

[0097] One embodiment of the present invention includes an anti-calidine or des-Arg10-calidine antibody that, compared to an unmodified whole antibody with substantially the same immunogenicity, has been modified by deleting at least one amino acid in one or more constant region domains, or otherwise, to produce desirable biochemical characteristics such as reduced or enhanced effector function, non-covalent dimerization ability, increased ability to localize to tumor sites, reduced serum half-life, or increased serum half-life. For example, certain antibodies or fragments for use in the diagnostic and treatment methods described herein are domain-deleted antibodies that contain a polypeptide chain similar to an immunoglobulin heavy chain but lack at least a portion of one or more heavy chain domains. For example, in a given antibody, an entire domain of the constant region of the modified antibody is deleted, for example, all or part of the CH2 domain is deleted.

[0098] In another embodiment, the anti-kalidine or des-Arg10-kalidine antibody comprises constant regions derived from different antibody isotypes (e.g., constant regions from two or more human IgG1, IgG2, IgG3, or IgG4). In another embodiment, the anti-kalidine or des-Arg10-kalidine antibody comprises a chimeric hinge (i.e., a hinge containing hinge portions derived from hinge domains of different antibody isotypes, e.g., the upper hinge domain from the IgG4 molecule and the central hinge domain from IgG1). In one embodiment, the anti-kalidine or des-Arg10-kalidine antibody comprises the Fc region or a portion thereof from the human IgG4 molecule, and the Ser228Pro mutation (EU numbering) in the core hinge region of the molecule.

[0099] In certain anti-kalidine or des-Arg10-kalidine antibodies, the Fc moiety may be mutated to increase or decrease effector function using techniques known in the art. For example, deletion or inactivation of the constant region domain (by point mutation or other means) may reduce Fc receptor binding of the circulatingly modified antibody, thereby increasing tumor localization. In other cases, constant region modifications consistent with the present invention may modify complement binding, and therefore reduce serum half-life and nonspecific association of conjugated cytotoxins. Further modifications of the constant region may be used to modify disulfide linkages or oligosaccharide moieties to enhance localization by increasing antigen specificity or flexibility. The resulting physical profiles, bioavailability, and other biochemical effects of the modifications, such as tumor localization, in vivo distribution, and serum half-life, can be readily measured and quantified using well-known immunological techniques without excessive experimentation.

[0100] In one embodiment, the Fc domain used in the antibody of the present invention is an Fc variant. As used herein, the term "Fc variant" means an Fc domain having at least one amino acid substitution relative to the wild-type Fc domain from which the Fc domain is derived. For example, if the Fc domain is derived from a human IgG antibody, the Fc variant of the human IgG1 Fc domain contains at least one amino acid substitution relative to the Fc domain.

[0101] The amino acid substitutions in the Fc variant may be located at any position within the Fc domain (i.e., any amino acid position as defined by EU regulations). In one embodiment, the Fc variant includes a substitution at an amino acid position located in the hinge domain or a portion thereof. In another embodiment, the Fc variant includes a substitution at an amino acid position located in the CH2 domain or a portion thereof. In yet another embodiment, the Fc variant includes a substitution at an amino acid position located in the CH3 domain or a portion thereof. In yet another embodiment, the Fc variant includes a substitution at an amino acid position located in the CH4 domain or a portion thereof.

[0102] The antibodies of the present invention may use any Fc variant known in the art to result in improvements (e.g., reduction or enhancement) in effector function and / or FcR binding. Such Fc variants include, for example, the International PCT Publications WO88 / 07089A1, WO96 / 14339A1, WO98 / 05787A1, WO98 / 23289A1, WO99 / 51642A1, WO99 / 58572A1, WO00 / 09560A2, WO00 / 32767A1, WO00 / 42072A2, WO02 / 44215A2, WO02 / 060919A2, WO03 / 074569A2, WO04 / 0167 50A2, WO04 / 029207A2, WO04 / 035752A2, WO04 / 063351A2, WO04 / 074455A2, WO04 / 099249A2, WO05 / 040217A2, WO05 / 070963A1, WO05 / 077981A2, WO05 / 092925A2, WO05 / 123780A2, WO06 / 019447A1, WO06 / 047350A2, and WO06 / 085967A2, or U.S. Patent No. 5,648,260, No. 5, This may include any single amino acid substitution disclosed in Patent Nos. 739,277, 5,834,250, 5,869,046, 6,096,871, 6,121,022, 6,194,551, 6,242,195, 6,277,375, 6,528,624, 6,538,124, 6,737,056, 6,821,505, 6,998,253, and 7,083,784. In one exemplary embodiment, the antibody of the present invention may include an Fc variant having an amino acid substitution (e.g., H268D or H268E) at the EU268 position. In another exemplary embodiment, the antibody of the present invention may include an Fc variant having an amino acid substitution at position EU239 (e.g., S239D or S239E) and / or position EU332 (e.g., I332D or I332Q).

[0103] In some embodiments, the antibodies of the present invention may include Fc variants containing amino acid substitutions that modify the antigen-independent effector function of the antibody, particularly the circulating half-life of the antibody. Such antibodies exhibit either increased or decreased binding to FcRn compared to antibodies without these substitutions, and therefore have increased or decreased serum half-lives, respectively. Fc variants with improved affinity for FcRn are expected to have a longer serum half-life, and such molecules have useful applications in methods of treating mammals where a longer half-life of the administered antibody is desirable, such as in the treatment of chronic diseases or disorders. In contrast, Fc variants with reduced FcRn binding affinity are expected to have a shorter half-life, and such molecules are useful for administration to mammals where a shorter circulating time may be advantageous, such as in in vivo imaging or when the starting antibody has toxic side effects when present in circulation for extended periods. Fc variants with reduced FcRn binding affinity are also less likely to cross the placenta and are therefore useful for treating diseases or disorders in pregnant women. Furthermore, other applications where reduced FcRn binding affinity may be desirable include applications where localization to the brain, kidney, and / or liver is desirable. In one exemplary embodiment, the modified antibody of the present invention exhibits reduced transport from vascular structures beyond the renal glomerular epithelium. In another embodiment, the modified antibody of the present invention exhibits reduced transport from the brain across the blood-brain barrier (BBB) ​​into the interstitial spaces of blood vessels. In one embodiment, the FcRn-binding modified antibody comprises an Fc domain having one or more amino acid substitutions within an "FcRn-binding loop" of the Fc domain. The FcRn-binding loop consists of 280–299 amino acid residues (according to EU numbering). Exemplary amino acid substitutions that modify FcRn-binding activity are disclosed in International PCT Publication No. WO05 / 047327, incorporated herein by reference. In certain exemplary embodiments, the antibody or fragment of the present invention comprises an Fc domain having one or more of the following substitutions: V284E, H285E, N286D, K290E, and S304D (EU numbering).

[0104] In other embodiments, antibodies for use in the diagnostic and treatment methods described herein have a constant region, such as an IgG1 or IgG4 heavy chain constant region, that has been modified to reduce or eliminate glycosylation. For example, the antibodies of the present invention may also include Fc variants that include amino acid substitutions that modify the glycosylation of the antibody. For example, the Fc variant may have reduced glycosylation (e.g., N-linked or O-linked glycosylation). In an exemplary embodiment, the Fc variant includes a reduction in glycosylation of an N-linked glycan commonly found at position 297 (EU numbering) of the amino acid. In another embodiment, the antibody has an amino acid substitution near or within a glycosylation motif, for example, within an N-linked glycosylation motif containing the amino acid sequence NXT or NXS. In a particular embodiment, the antibody includes an Fc variant having an amino acid substitution at position 228 or 299 (EU numbering) of the amino acid. In a more detailed embodiment, the antibody comprises a constant region of IgG1 or IgG4 containing the S228P and T299A mutations (EU numbering).

[0105] Exemplary amino acid substitutions conferring reduction or modification of glycosylation are disclosed in International PCT Publication No. WO05 / 018572, incorporated herein by reference. In a preferred embodiment, the antibody or fragment of the present invention is modified to eliminate glycosylation. Such an antibody or fragment may be referred to as an “agly” antibody or fragment (e.g., an “agly” antibody). While not intended to be theoretical, an “agly” antibody or fragment may have an improved safety and stability profile in vivo. An exemplary agly antibody or fragment contains an aglycosylated Fc region of an IgG4 antibody lacking Fc effector function, thereby eliminating potential for Fc-mediated toxicity to normal vital organs expressing calidine or des-Arg10-calidine. In yet another embodiment, the antibody or fragment of the present invention contains a modified glycan. For example, an antibody may have a small number of fucose residues on the N-glycan at Asn297 in the Fc region, i.e., it may be afucosylated. In another embodiment, an antibody may have a modified number of sialic acid residues on the N-glycan at Asn297 in the Fc region.

[0106] iii) Covalent adhesion The anti-calidine or des-Arg10-calidine antibodies of the present invention may be modified by means of covalent attachment of molecules to the antibody, etc., so that the covalent attachment does not prevent the antibody from specifically binding to its congener's epitopes. For example, the antibody or fragment of the present invention may be modified by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, linkage to cellular ligands or other proteins, etc. Any of the many chemical modifications may be carried out by known techniques, including, but not limited to, specific chemical cleavage, acetylation, formylation, etc. Furthermore, the derivative may contain one or more non-classical amino acids.

[0107] The antibodies or fragments of the present invention may be further recombinantly fused to heterologous polypeptides at their N-terminus or C-terminus, or chemically conjugated to polypeptides or other compositions (including covalent and non-covalent conjugates). For example, anti-kalidine or des-Arg10-kalidine antibodies may be recombinantly fused or conjugated to molecules useful as labels in detection assays, and effector molecules such as heterologous polypeptides, drugs, radionuclides, or toxins. See, for example, PCT Publications WO92 / 08495, WO91 / 14438, WO89 / 12624, U.S. Patent No. 5,314,995, and EP396,387.

[0108] Anti-calidine or des-Arg10-calidine antibodies may be conjugated to heterologous polypeptides to increase their in vivo half-life or for use in immunoassays using methods known in the art. For example, in one embodiment, PEG can be conjugated to the anti-calidine or des-Arg10-calidine antibody of the present invention to increase its in vivo half-life. Leong, SR et al., Cytokine, vol. 16, p. 106 (2001); Adv. in Drug Deliv. Rev., vol. 54, p. 531 (2002); or Weir et al., Biochem. Soc. Transactions, vol. 30, p. 512 (2002).

[0109] Furthermore, the anti-calidine or des-Arg10-calidine antibody of the present invention may be fused to a marker sequence such as a peptide to facilitate purification or detection. In a preferred embodiment, the amino acid sequence of the marker is one of many commercially available pQE vectors ( These are hexahistidine peptides such as tags provided by QIAGEN, Inc. (9259 Eton Avenue, Chatsworth, Calif., 91311). For example, as described by Gentz ​​et al., Proc. Natl. Acad. Sci. USA, Vol. 86, pp. 821-824 (1989), hexahistidines provide a convenient purification of fusion proteins. Other peptide tags useful for purification include, but are not limited to, the "HA" tag (Wilson et al., Cell, Vol. 37, p. 767 (1984)) and "flag" tags, which correspond to epitopes derived from influenza hemagglutinin proteins.

[0110] The anti-kalidine or des-Arg10-kalidine antibody of the present invention may be used in a non-conjugated form, or conjugated to at least one of various molecules, for example, to improve the therapeutic properties of a molecule, to facilitate target detection, or for patient imaging or treatment. The anti-kalidine or des-Arg10-kalidine antibody of the present invention may be labeled or conjugated either before or after purification if purification is performed. In particular, the anti-kalidine or des-Arg10-kalidine antibody of the present invention may be conjugated to therapeutic agents, prodrugs, peptides, proteins, enzymes, viruses, lipids, biological response modifiers, pharmaceuticals, or PEGs.

[0111] The present invention further encompasses the anti-kalidine or des-Arg10-kalidine antibodies of the present invention conjugated into diagnostic or therapeutic agents. Anti-kalidine or des-Arg10-kalidine antibodies can be used diagnostically, for example, as part of a clinical laboratory procedure to monitor the onset or progression of immunocytotoxicity (e.g., CLL) and determine the effectiveness of a given treatment and / or preventive regimen. Detection can be facilitated by coupling the anti-kalidine or des-Arg10-kalidine antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron-emitting metals used in various positron emission tomography (PET) scans, and non-radioactive paramagnetic metal ions. For example, see U.S. Patent No. 4,741,900 for metal ions that can be conjugated to antibodies for use as diagnostics according to the present invention. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansilchloride, or phycoerythrin; examples of luminescent materials include luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin; examples of suitable radioactive materials include 125I, 131I, 111In, or 99Tc.

[0112] Anti-calidine or des-Arg10-calidine antibodies for use in the diagnostic and therapeutic methods disclosed herein may be conjugated to cytotoxic substances (e.g., radioisotopes, cytotoxic drugs, or toxins), therapeutic agents, cell division inhibitors, biological toxins, prodrugs, peptides, proteins, enzymes, viruses, lipids, biological response modifiers, pharmaceuticals, immunologically active ligands (e.g., lymphokines or other antibodies in which the resulting molecule binds to both neoplastic cells and effector cells such as T cells) or PEG.

[0113] In another embodiment, the anti-calidine or des-Arg10-calidine antibody for use in the diagnostic and treatment methods disclosed herein may be conjugated to a molecule that reduces the proliferation of tumor cells. In other embodiments, the disclosed composition may include an antibody or fragment thereof coupled to a drug or prodrug. Still other embodiments of the present invention include lysine, gelonin, and Pseudomonas. This includes the use of antibodies or fragments of toxins, or specific biotoxins such as diphtheria toxin, or cytotoxic fragments thereof, conjugated to them. The choice of which conjugated or unconjugated antibody to use depends on the type and stage of cancer, the use of adjunctive treatments (e.g., chemotherapy or external radiation), and the patient's condition. Those skilled in the art will understand that such a choice can be easily made in light of the teachings herein.

[0114] Previous studies have shown that isotope-labeled antitumor antibodies have been successfully used to destroy tumor cells in animal models, and in some cases in humans. Exemplary radioisotopes include 90Y, 125I, 131I, 123I, 111In, 105Rh, 153Sm, 67Cu, 67Ga, 166Ho, 177Lu, 186Re, and 188Re. Radionuclides act by producing ionizing radiation that causes numerous strand breaks in nuclear DNA, leading to cell death. Isotopes used to create therapeutic conjugates typically produce short-path, high-energy alpha or beta particles. Such radionuclides kill cells in their immediate vicinity, such as neoplasms, to which the conjugate attaches or invades. They have little to no effect on delocalized cells. Radionuclides are inherently non-immunogenic.

[0115] IV. Expression of anti-calidine or des-Arg10-calidine antibodies, or their antigen-binding fragments. After manipulating the isolated genetic material for providing the anti-calidine or des-Arg10-calidine antibody of the present invention as described above, the gene is typically inserted into an expression vector for introduction into host cells that can be used to produce the desired amount of the requested antibody or fragment thereof.

[0116] The terms “vector” or “expression vector” are used herein for the purposes of the specification and claims and mean a vector used in accordance with the present invention as a vehicle for introducing into a desired gene in a cell and for expressing the desired gene. As is known to those skilled in the art, such vectors can be readily selected from the group consisting of plasmids, phages, viruses, and retroviruses. Generally, a vector suitable for the present invention includes a selection marker, a restriction site suitable for facilitating the cloning of the desired gene, and the ability to enter and / or replicate in eukaryotic or prokaryotic cells.

[0117] Numerous expression vector systems can be used for the purposes of this invention. For example, one class of vectors utilizes DNA elements derived from animal viruses such as bovine papillomavirus, polyomavirus, adenovirus, vaccinia virus, baculovirus, retrovirus (RSV, MMTV, or MOMLV), or SV40 virus. Others involve the use of polycistronic systems having an internal ribosome binding site. Furthermore, by introducing one or more markers that enable the selection of transfected host cells, cells incorporating the DNA into their chromosomes can be selected. Markers may provide protrophotrophy, nutritional requirements, biocide (e.g., antibiotic) resistance, or resistance to heavy metals such as copper. The selection marker gene may be directly ligated to the DNA sequence to be expressed or introduced into the same cell by co-transformation. Further elements may also be required for optimal mRNA synthesis. These elements may include signal sequences, splice signals, and transcription promoters, enhancers, and termination signals. In a particularly preferred embodiment, as discussed above, the cloned variable region gene is inserted into the expression vector together with the synthesized heavy and light chain constant region gene (preferably human). ru.

[0118] In other preferred embodiments, the anti-kalidine or des-Arg10-kalidine antibodies of the present invention, or fragments thereof, may be expressed using a polycistronic construct. In such expression systems, multiple target gene products, such as the heavy and light chains of antibodies, can be generated from a single polycistronic construct. These systems are advantageous in using an internal ribosome entry site (IRES) to provide the polypeptides of the present invention at relatively high levels in eukaryotic host cells. A suitable IRES sequence is disclosed in U.S. Patent No. 6,193,980, which is incorporated herein by reference. Those skilled in the art can effectively generate the entire range of polypeptides disclosed in this application using such expression systems.

[0119] More generally, after preparing a vector or DNA sequence encoding an antibody or its fragment, the expression vector may be introduced into a suitable host cell. That is, the host cell may be transformed. The introduction of plasmids into host cells can be carried out by a variety of techniques well known to those skilled in the art. These include, but are not limited to, transfection (including electrophoresis and electroporation), protoplast fusion, calcium phosphate precipitation, cell fusion with coated DNA, microinjection, and infection with intact viruses. See Ridgway, AAG, "Mammalian Expression Vectors," Chapter 24.2, pp. 470-472, Vectors, edited by Rodriguez and Denhardt (Butterworths, Boston, Mass., 1988). The introduction of plasmids into the host is most preferably by electroporation. Transformed cells are grown under conditions suitable for light and heavy chain production and assayed for heavy and / or light chain protein synthesis. Examples of assay techniques include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), or fluorescence-labeled cell sorter analysis (FACS), and immunohistochemistry.

[0120] As used herein, the term "transformation" is used in a broad sense to mean the introduction of DNA into recipient host cells that alters the genotype and subsequently brings about changes in the recipient cells.

[0121] In line with these same principles, “host cells” means cells constructed using recombinant DNA technology and transformed with a vector encoding at least one heterologous gene. In descriptions of processes for isolating polypeptides from recombinant hosts, the terms “cells” and “cell culture” are used interchangeably to mean the origin of the antibodies unless otherwise clearly specified. In other words, the recovery of polypeptides from “cells” can mean from whole cells that have been rotated and dropped, or from cell cultures containing both culture medium and suspended cells.

[0122] In one embodiment, the host cell line used for antibody expression is of mammalian origin, and those skilled in the art can determine the specific host cell line best suited to the desired gene product to be expressed therein. Exemplary host cell lines include, but are not limited to, DG44 and DUXB11 (Chinese hamster ovary line, DHFR-negative), HELA (human cervical cancer), CVI (monkey kidney line), COS (derivative of CVI with SV40 T antigen), R1610 (Chinese hamster fibroblast), BALBC / 3T3 (mouse fibroblast), HAK (hamster kidney line), SP2 / O (mouse myeloma), BFA-1c1BPT (bovine endothelial cell), RAJI (human lymphocyte), and 293 (human kidney). In one embodiment, the cell line provides modified glycosylation, such as afucosylation of the antibody expressed therefrom (e.g., PER.C6.RTM.(Cruc). (ell) or FUT8-knockout CHO cell line (Potelligent.RTM. cells) (Biowa, Princeton, NJ)). In one embodiment, NS0 cells can be used. CHO cells are particularly preferred. The host cell line is typically available from the American Tissue Culture Collection, a commercial service, or from published literature.

[0123] In vitro production allows for scale-up to produce large quantities of the desired polypeptide. Techniques for culturing mammalian cells under tissue culture conditions are known in the art and include homogeneous suspension culture (e.g., in an airlift reactor or a continuous stirrer reactor) or immobilized or captured cell culture (e.g., in hollow fibers, microcapsules, on agarose microbeads, or on ceramic cartridges). If necessary and / or desired, polypeptide solutions can be purified by conventional chromatographic methods such as gel filtration, ion exchange chromatography, chromatography on DEAE-cellulose, and / or (immuno)affinity chromatography.

[0124] The anti-calidine or des-Arg10-calidine antibodies of the present invention, or genes encoding fragments thereof, can also be expressed in non-mammalian cells such as bacteria, yeasts, or plant cells. In this regard, it will be understood that various non-mammalian single-celled microorganisms (e.g., bacteria), i.e., those that can be grown in culture or fermentation, can also be transformed. Bacteria are readily transformed and include members of the Enterobacteriaceae family, e.g., Escherichia coli or Salmonella; Bacillaceae family, e.g., Bacillus subtilis; Pneumococcus; Streptococcus; and Haemophilus influenzae lineages. When expressed in bacteria, it will be further understood that polypeptides can become part of inclusion bodies. Polypeptides must be isolated, purified, and then constructed into functional molecules.

[0125] In addition to prokaryotes, eukaryotic microorganisms can also be used. Budding yeast (Saccharomyces cerevisiae), or common baker's yeast, is the most commonly used eukaryotic microorganism, but numerous other strains are also commonly available. For expression in budding yeast, plasmid YRp7 (Stinchcomb et al., Nature, Vol. 282, p. 39 (1979); Kingsman et al., Gene, Vol. 7, p. 141 (1979); Tschemper et al., Gene, Vol. 10, p. 157 (1980)) is commonly used. This plasmid already contains the TRP1 gene, which provides a selection marker for yeast mutants lacking the ability to grow in tryptophan, such as ATCC No. 44076 or PEP4-1 (Jones, Genetics, Vol. 85, p. 12 (1977)). The presence of trpI lesions, which are characteristic of the yeast host cell genome, then provides an effective environment for detecting transformation by growth in the absence of tryptophan.

[0126] V. Pharmaceutical preparations and methods of administering anti-calidine or des-Arg10-calidine antibodies In another embodiment, the present invention provides a pharmaceutical composition comprising an anti-calidine or des-Arg10-calidine antibody or a fragment thereof.

[0127] Methods for preparing and administering the antibody or fragment of the present invention to a subject are well known or readily determined by those skilled in the art. The route of administration of the antibody or fragment of the present invention may be oral, parenteral, inhaled, or topical. The term parenteral includes intravenous, intra-arterial, intraperitoneal, intramuscular, subcutaneous, rectal, or vaginal administration. Parenteral administration in the form of intravenous, intra-arterial, subcutaneous, and intramuscular administration is generally preferred. While all of these forms of administration are clearly intended to be within the scope of the present invention, the form for administration is for injection, in particular, a solution for intravenous or intra-arterial injection or infusion. Typically, pharmaceutical compositions suitable for injection may contain buffers (e.g., acetate buffer, phosphate buffer, or citrate buffer), surfactants (e.g., polysorbate), and optionally stabilizers (e.g., human albumin). However, in other ways that are compatible with the teachings herein, polypeptides may be directly derivatized at the site of a population of harmful cells, thereby increasing the exposure of the affected tissue to the therapeutic agent.

[0128] Preparations for parenteral administration include sterile aqueous solutions, or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcohol / aqueous solutions, emulsions, or suspensions, and include saline and buffering media. In the present invention, pharmaceutically acceptable carriers include, but are not limited to, 0.01 M to 0.1 M, preferably 0.05 M, phosphate buffer, or 0.8% saline. Other common parenteral vehicles include sodium phosphate solutions, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's solution, or non-volatile oils. Intravenous vehicles include liquid and nutritional supplements, electrolyte supplements, such as those based on Ringer's dextrose. Preservatives and other additives, such as antimicrobial agents, antioxidants, chelating agents, and inert gases, may also be present. More specifically, pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (if water-soluble) or dispersants and sterile powders for the immediate preparation of sterile injectable solutions or dispersions. In such cases, the composition must be sterile and liquid to the extent that it allows for easy syringe handling. The composition must be stable under manufacturing and storage conditions and preferably stored in a manner that resists the action of microbial contamination, such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing water, ethanol, polyhydric alcohols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), or a suitable mixture thereof. Appropriate fluidity can be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of dispersions, or by the use of a surfactant. Prevention of microbial action can be achieved by various antimicrobial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, and thimerosal. In many cases, it is preferable that the composition contains an isotonic agent, such as a sugar, a polyhydric alcohol, such as mannitol, sorbitol, or sodium chloride.The prolonged absorption of an injectable composition can be achieved by including absorption-delaying agents in the composition, such as aluminum monostearate and gelatin.

[0129] In any case, sterile injectable solutions can be prepared by incorporating the required amount of active compound (e.g., an antibody alone or in combination with other active agents) into a suitable solvent, along with one or a combination of the components listed herein as desired, and then sterilizing by filtration. Generally, dispersants are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and other components from those listed above as needed. In the case of sterile powders for preparing sterile injectable solutions, preferred preparation methods are vacuum drying and lyophilization, where lyophilization produces a powder of the active ingredient plus any further desired components from the pre-sterilized filtered solution. The injectable preparations are processed under sterile conditions according to methods known in the art, filled into containers such as ampoules, bags, bottles, syringes, or vials, and sealed. Furthermore, the preparations are packaged and referred to herein by reference the concurrently pending U.S. Patent Applications No. 09 / 259,337 and No. 09 / 259,337, respectively. They may be sold in the form of kits, such as those described in Patent No. 9,338. Such products preferably have labels or accompanying information indicating that the relevant compositions are useful in treating subjects suffering from or susceptible to autoimmune disorders or neoplasms.

[0130] The effective dose of the stabilized antibody or fragment of the present invention for treating the conditions described above varies depending on many factors, including the means of administration, the target site, the patient's physiological state, whether the patient is human or animal, other drug therapies administered, and whether the treatment is prophylactic or therapeutic. Typically, the patient is human, but non-human mammals, including transgenic mammals, can also be treated. The dosage of the treatment can be titrated using routine methods known to those skilled in the art to optimize safety and efficacy.

[0131] For passive immunization with the antibody of the present invention, the dosage may be in the range of, for example, about 0.0001 mg / kg body weight to 100 mg / kg body weight (of the host), more typically 0.01 mg / kg body weight to 5 mg / kg body weight (e.g., 0.02 mg / kg body weight, 0.25 mg / kg body weight, 0.5 mg / kg body weight, 0.75 mg / kg body weight, 1 mg / kg body weight, 2 mg / kg body weight, etc.). For example, the dosage may be 1 mg / kg body weight or 10 mg / kg body weight, or in the range of 1 to 10 mg / kg body weight, preferably at least 1 mg / kg body weight. The intermediate values ​​of the dosage within the above range are also intended to be within the range of the present invention.

[0132] The subjects may be administered such doses daily, every other day, weekly, or according to any other schedule determined by empirical analysis. Exemplary treatments involve multi-dose administration over a long period, e.g., at least 6 months. Further exemplary treatment regimens involve administration every 2 weeks, once a month, or once every 3 to 6 months. Exemplary dose schedules include 1 to 10 mg / kg or 15 mg / kg daily, 30 mg / kg every other day, or 60 mg / kg weekly. In some embodiments, two or more monoclonal antibodies with different binding specificities are administered simultaneously, in which case the dose of each antibody administered may be within the range noted.

[0133] The antibody or fragment of the present invention can be administered on multiple occasions. The interval between single doses may be, for example, daily, weekly, monthly, or yearly. The interval may also be irregular, as indicated by measuring the blood levels of polypeptides or target molecules in the patient. In some cases, the dose is adjusted to achieve a certain concentration of the antibody or toxin in the plasma, such as 1-1000 ug / ml or 25-300 ug / ml. Alternatively, the antibody or fragment can be administered as a sustained-release formulation, in which case less frequent administration is required. The dose and frequency vary depending on the half-life of the antibody in the patient. Generally, humanized antibodies exhibit the longest half-lives, followed by chimeric antibodies and non-human antibodies. In one embodiment, the antibody or fragment of the present invention can be administered in a non-conjugate form. In another embodiment, the antibody can be administered multiple times in a conjugate form. In yet another embodiment, the antibody or fragment of the present invention can be administered in a non-conjugate form, then in a conjugate form, or vice versa.

[0134] The dosage and frequency of administration may vary depending on whether the treatment is prophylactic or therapeutic. In prophylactic applications, a composition or cocktail containing the antibody of the present invention is administered to patients who are not yet in a disease state to enhance their resistance. Such an amount is defined as the “effective prophylactic dose.” In this use, the exact amount further depends on the patient’s health and systemic immunity, but is generally in the range of 0.1 mg to 25 mg per dose, and particularly 0.5 mg to 2.5 mg per dose. Relatively low doses may be used over a long period of time. The medication is administered at relatively infrequent intervals. Some patients continue to receive treatment for the rest of their lives.

[0135] In therapeutic applications, relatively high doses at relatively short intervals (e.g., doses of approximately 1 mg to 400 mg / kg of antibody per dose, 5 mg to 25 mg for radioimmunoconjugates, and higher doses more commonly used for cytotoxic-drug conjugate molecules) may sometimes be required until disease progression is reduced or terminated, preferably until the patient shows partial or complete recovery of disease symptoms. A prophylactic regimen may then be administered to the patient.

[0136] In one embodiment, the subject may be treated with a nucleic acid molecule encoding the polypeptide of the present invention (e.g., in a vector). The dose of nucleic acid encoding the polypeptide ranges from approximately 10 ng to 1 g, 100 ng to 100 mg, 1 ug to 10 mg, or 30 to 300 ug of DNA per patient. The dose of infectious viral vector varies from 10 to 100 virions per dose, or more.

[0137] The therapeutic agent may be administered for prophylactic and / or therapeutic purposes by parenteral, topical, intravenous, oral, subcutaneous, intra-arterial, intracranial, intraperitoneal, nasal, or intramuscular means. Intramuscular injection or intravenous infusion is preferred for the administration of the antibody of the present invention. In some methods, the therapeutic antibody or a fragment thereof is injected directly into the skull. In some methods, the antibody or a fragment thereof is administered as a sustained-release composition or device, for example, as a Medipat® device.

[0138] The agents of the present invention may be administered in combination with other agents that are effective in treating disorders or conditions requiring treatment (e.g., prophylactic or therapeutic). Preferred further agents are those recognized in the art and administered as standard for specific disorders.

[0139] The effective single-treatment dose (i.e., therapeutically effective dose) of the 90Y-labeled antibody of the present invention is in the range of about 5 mCi to about 75 mCi, more preferably between about 10 mCi and about 40 mCi. The effective single-treatment non-marrow ablative dose of the 131I-labeled antibody is in the range of about 5 mCi to about 70 mCi, more preferably between about 5 mCi and about 40 mCi. The effective single-treatment ablative dose (i.e., potentially requiring autologous bone marrow transplantation) of the 131I-labeled antibody is in the range of about 30 mCi to about 600 mCi, more preferably between about 50 mCi and less than 500 mCi. When combined with chimerically modified antibodies, iodine-131-labeled chimeric antibodies have a longer circulating half-life compared to mouse antibodies. Therefore, the effective single-treatment non-marrow ablative dose of iodine-131-labeled chimeric antibodies is in the range of approximately 5 mCi to 40 mCi, more preferably less than 30 mCi. The typical criterion for imaging methods, such as those used for 111In labeling, is less than 5 mCi.

[0140] While extensive clinical trials have been achieved with 131I and 90Y, other radiolabels are known in the art and used for similar purposes. Furthermore, other radioisotopes have been used in imaging techniques. For example, further radioisotopes suitable for the scope of this invention include, but are not limited to, 123I, 125I, 32P, 57Co, 64Cu, 67Cu, 77Br, 81Rb, 81Kr, 87Sr, 113In, 127Cs, 129Cs, 132I, 197Hg, 203Pb, 206Bi, 177Lu, 186Re, 212Pb, 212Bi, 47Sc, 105Rh, 109Pd, 153Sm, 188Re, 199Au, 225Ac, 211A, and 213Bi. In this regard, alpha, gamma, and beta emitters are all suitable for the scope of this invention. Furthermore, in view of this disclosure, a person skilled in the art Therefore, it is proposed that it be possible to easily determine which radionuclides are suitable for the selected course of treatment without excessive experimentation. For this purpose, further radionuclides already used in clinical diagnosis include 125I, 123I, 99Tc, 43K, 52Fe, 67Ga, 68Ga, and 111In. Antibodies have also been labeled with various radionuclides for potential use in targeted immunotherapy (Peirersz et al., Immunol. Cell Biol., Vol. 65, pp. 111-125 (1987)). These radionuclides include 188Re and 186Re, as well as to lower degrees 199Au and 67Cu. U.S. Patent No. 5,460,785 provides further data on such radioisotopes and is incorporated herein by reference.

[0141] As previously discussed, the antibodies or fragments of the present invention can be administered in pharmaceutically effective amounts to treat mammalian disorders in vivo. In this regard, it will be understood that the antibodies or fragments of the present disclosure are formulated to facilitate the administration and stability of the active agent. It is preferable that the pharmaceutical composition according to the present invention comprises a pharmaceutically acceptable, non-toxic, sterile carrier, such as saline, a non-toxic buffer, or a preservative. For the purposes of this application, a pharmaceutically effective amount of the antibodies of the present invention, conjugated or unconjugated to a therapeutic agent, can be sustained to achieve effective binding to a target and to realize a benefit, for example, restoring symptoms of a disease or disorder, or detecting a substance or cell. In the case of tumor cells, the polypeptide can preferably interact with selected immunoreactive antigens on neoplastic or immunoreactive cells, resulting in increased cell death of these cells. Of course, the pharmaceutical composition of the present invention can be administered in single or multiple doses to provide a pharmaceutically effective amount of polypeptide.

[0142] In accordance with the scope of this disclosure, the antibodies of the present invention can be administered to humans or other animals in an amount sufficient to produce a therapeutic or prophylactic effect, in accordance with the treatment methods described above. The polypeptides of the present invention can be administered to such humans or other animals in conventional dosage forms prepared by combining the antibodies of the present invention with conventional pharmaceutically acceptable carriers or diluents, in accordance with known techniques. Those skilled in the art will recognize that the form and characteristics of a pharmaceutically acceptable carrier or diluent are indicated by the amount of the active ingredient to be combined with it, the route of administration, and other well-known variables. Those skilled in the art will further understand that a cocktail containing one or more species of polypeptides according to the present invention may prove to be particularly effective.

[0143] VI. Methods for treating calidin or des-Arg10-calidin-related diseases or disorders The anti-kalidine or des-Arg10-kalidine antibodies or fragments thereof of the present invention are useful for antagonizing the activity of kalidine or des-Arg10-kalidine. Accordingly, in another embodiment, the present invention provides a method for treating a kalidine or des-Arg10-kalidine-related disease or disorder by administering a pharmaceutical composition comprising one or more of the anti-kalidine or des-Arg10-kalidine antibodies or antigen-binding fragments thereof to a subject in need.

[0144] Diseases or disorders related to kalidine or des-Arg10-kalidine that may be treated include, without limitation, pathophysiological conditions such as inflammation, trauma, burns, shock, allergies, acute or chronic pain, and fibrosis such as renal fibrosis. In one exemplary embodiment, the antibody of the present invention may be administered to treat renal fibrosis and associated acute kidney injury, which are major causes of end-stage renal failure, as well as chronic kidney disease.

[0145] Those skilled in the art can determine, through routine experimentation, what is an effective, non-toxic dose of antibody (or further therapeutic agent) for treating calidine or des-Arg10-calidine-related diseases or disorders. For example, the therapeutically effective dose of polypeptide may vary depending on factors such as the stage of the disease (e.g., stage I vs. stage IV), age, sex, medical complications (e.g., immunosuppressive conditions or diseases), the subject's body weight, and the antibody's ability to induce the desired response in the subject. The dosage regimen can be adjusted to produce the optimal therapeutic response. For example, several divided doses may be administered daily, or the dose may be proportionally reduced as indicated by the emergency of the treatment situation. However, generally, the effective dose is expected to be in the range of about 0.05 to 100 milligrams per kilogram of body weight per day, more preferably about 0.5 to 10 milligrams per kilogram of body weight per day.

[0146] VII. Examples The present invention will be further illustrated by the following examples, but these examples should not be construed as further limitations. The sequence listings, figures, and all references, cited throughout this application, the contents of patents and published patent applications are expressly incorporated herein by reference.

[0147] Furthermore, conventional molecular biology, microbiology, and recombinant DNA techniques can be used in accordance with the present invention, as are well described in the literature. For example, Sambrook, Fritsch, and Maniatis, Molecular Cloning: A Laboratory Manual, 2nd edition (1989), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (referred to herein as "Sambrook et al., 1989"); DNA Cloning: A Practical Approach, Vol. I and II (edited by DNGlover, 1985); Oligonucleotide Synthesis (edited by MJ Gait, 1984); Nucleic Acid Hybridization [edited by B.D. Hames and S.J. Higgins (1985)]; Transcription and Translation [edited by B.D. Hames and S.J. Higgins (1984)]; Animal Cell Culture [edited by R.I. Freshney (1986)]; Immobilized Cells and Enzymes [IRL Press (1986)]; B. Perbal, A Practical Guide To Molecular Cloning (1984); F.M. Ausubel et al. (eds.), Current Protocols in Molecular See Biology, John Wiley & Sons, Inc. (1994).

[0148] [Example 1] Hybridoma generation: Immunization of mice with a calidine peptide conjugate to KLH and antibody production against human BKR1 ligand. The objective was to develop cross-reactive antibodies against their ligands (kalidine and des-arg-kalidine) that inhibit the binding of kalidine (KD; SEQ ID NO: 1) and des-arg-kalidine (DAKD; SEQ ID NO: 2) to human BKR1. Generally, mouse splenocytes were obtained for fusion with the mouse myeloma cell line as fusion partners for generating hybridomas, using mouse immunization with KLH, which is conjugated to KD by an additional cysteine ​​at either the C-terminus or N-terminus of the peptide.

[0149] In short, the immunization protocol was as follows: BALB / c mouse ( Untreated female mice aged 8-20 weeks were immunized intraperitoneally with a mixture of equal amounts of KLH-KD and KD-KLH in phosphate-buffered saline (PBS) as the antigen, totaling 100 ug per mouse, and Sigma adjuvant (Sigma catalog number 6322) in a 1:1 ratio in a total volume of 200 μl per mouse (Day 0). On Day 21, the mice were immunized again with a mixture of equal amounts of KLH-KD and KD-KLH in PBS as the antigen, totaling 50 ug per mouse, and Sigma adjuvant (Sigma catalog number 6322) in a 1:1 ratio in a total volume of 200 μl per mouse. On Day 30, blood samples were collected to evaluate the titer of KD-specific antibodies. On day 51, mice were immunized for fusion with a mixture of equal amounts of KLH-KD and KD-KLH in PBS as antigens, totaling 50 ug per mouse, and with Sigma adjuvant (Sigma catalog number 6322) in a 1:1 ratio in a total volume of 200 μl per mouse. On day 55, mice were sacrificed in a CO2 chamber, blood was collected by cardiac puncture, and spleens were collected for hybridoma generation.

[0150] Hybridomas were created by fusing mouse myeloma cells lacking adenosine phosphoribosyltransferase (APRT) with spleen cells from mice immunized with a specific antigen. A selection system using HAT (hypoxanthine, azaserine, and thymidine) medium eliminated all fusion cells except those that were APRT+. Successful hybridomas must also possess one of the immunoglobulin (Igh) heavy chain and immunoglobulin light chain gene loci and secrete functional antibodies.

[0151] Hybridoma-forming medium (IMDM) was prepared by combining the following: 500 ml of Iscove's Dulbecco's modified Eagle agar (HyClone SH30259.01), 50 ml of fetal bovine serum (HyClone SH30070.03), 5 ml of L-glutamine (Gibco Invitrogen catalog no. 25030), 5 ml of non-essential amino acids (Gibco Invitrogen catalog no. 11140050), 5 ml of sodium pyruvate (Gibco Invitrogen catalog no. 11360070), and 5 ml of 0.1% penicillin-streptomycin (Gibco Invitrogen catalog no. 15140148). The medium was filtered before use. Growth medium was prepared by combining the following: serum-free medium (Gibco Hybridoma 1000 ml of SFM#12045, 100 ml of 10% HyClone SuperLow IgG Defined FBS#SH30898.03, and 10 ml of penicillin / streptomycin. The frozen medium was 45 ml of filter-sterilized, heat-inactivated FBS (HyClone SH30070.03) and 5 ml of DMSO. Other materials included were: HAT (50×) obtained from Sigma-Aldrich (#HO262); hybridoma fusion and cloning supplement (50×) (Roche Diagnostics 11 363 735 001), trypan blue stain 0.4% (Invitrogen catalog no. 15250-061 or T10282); PEG1500 in 75 mM Hepes 50 w / v% (Roche catalog no. 783641 (10783641001)). All reagents except HAT and the hybridoma fusion and cloning supplement were used at 37°C.

[0152] [Table 6]

[0153] In short, three or four days before fusion, mice were boosted with the target antigen either intraperitoneally or intravenously. On the day of fusion, mice were sacrificed in a CO2 chamber, blood was collected by cardiac puncture, the spleen was removed and placed in 10 ml of serum-free IMDM in a petri dish. Fusion partner cells, myeloma:FO (ATCC ref CRL-1646) / ×63Ag8.653 (ATCC ref CRL1580), were grown in the logarithmic phase, then divided (1:2 and 1:5) one day before fusion, collected in a 20 ml centrifuge tube, circulated, and the pellet was resuspended in 10 ml of serum-free IMDM. The pellet was washed twice with serum-free IMDM medium. All centrifugation was performed at 1570 rpm for 5 minutes. Final resuspending was in 10 ml of serum-free IMDM. The connective tissue was separated from the spleen. The spleen was injected with 1 ml of serum-free IMDM preheated to 37°C using a 1 ml syringe and a 25 gauge needle. The splenocytes were squeezed out from the elastic fiber outer membrane with forceps, washed twice with 10 ml of serum-free IMDM (including the first rotation), and resuspended in 10 ml of serum-free IMDM. The cells were counted using a Countess automated cell counter.

[0154] Fusion partner cells and splenocytes were combined in a 50 ml tube in a ratio of 1:2 to 1:10 (depending on cell number) and rotated at 970 rpm for 10 minutes (slow rotation) to form a loose pellet. After the "slow" rotation, the supernatant was carefully removed, taking care not to disturb the pellet but also to minimize the amount of liquid on top of the cells so as not to dilute the PEG1500. The remaining medium was saved and added back after the PEG was added (see below). Preheated PEG1500 (37°C, 1 ml total) was added dropwise to the cell pellet over a period of 1 minute, and after the entire PEG had been added, the cells were mixed. The pellet was incubated with PEG for another minute, and then 10 ml of serum-free IMDM medium was added over 1 minute, with the first 1 ml added over 30 seconds. The cells and supernatant, which had been rotated slowly at 970 rpm for 10 minutes, were decanted. The following were added to the 100 ml trough of (2): 70 ml of IMDM containing 10% FBS, 2 ml of HAT, and 2 ml of hybridoma and fusion cloning supplement. The cells were resuspended in 10 ml of IMDM containing 10% FBS, divided into 50 ml tubes of (2) (5 ml of cells per tube), and 25 ml of IMDM containing 10% FBS was added. The resulting 30 ml was transferred to a trough containing 70 ml of HBSS / HAT / cloning supplement, and 200 ul of cells / well were pipetteed into the 96-well plate of (10). After approximately 10 to 14 days, or when the medium in the wells turned yellow, the fusions were prepared for screening by ELISA (50 ul). After the first screening, positive clones were selected, numbered, and transferred to a 24-well plate in 500 ul of IMDM containing 10% FBSHI per well. Hybridoma supernatants were screened by ELISA on streptavidin plates coated with N-terminal and C-terminal biotinylated peptides (see below).

[0155] [Example 2] Characterization and selection of hybridomas expressing antibodies against human BKR1 ligands The supernatant of hybridomas was screened by ELISA on streptavidin plates coated with N-terminal and C-terminal biotinylated peptides (see, for example, Table 2), and the antibody binding kinetics were then determined for the confirmed positive hybridoma clones.

[0156] The ability of antibodies in hybridoma supernatant to bind to BKR1 ligand peptides was evaluated by ELISA assay. DAKD-biotin or KD-biotin peptides were coated onto 96-well SA plates in phosphate-buffered saline (PBS) buffer at room temperature for 1 hour, and nonspecific binding sites were blocked with 1% bovine serum albumin (BSA) in PBS buffer. Primary and secondary screening of crude hybridoma supernatants was performed using these plates. Hybridoma supernatants were added to plates to bind to coated KD or DAKD peptides. After incubation for 1 hour, the plates were washed, and the bound antibodies were detected using horseradish peroxidase (HRP) conjugated secondary antibody (HRP-goat anti-mouse IgG(H+L): Jackson ImmunoResearch Labs#115-035-166). The samples were then developed using 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) substrate (Roche diagnostics#11 204 521 001). Data were analyzed using Excel. A positive signal was detected (1:10000 serum dilution ELISA). Antibodies showing a signal twice as high were selected and re-screened twice for confirmation. Confirmed positive hybridoma clones were selected and subjected to Biacore binding-dissociation rate ranking.

[0157] For antibody binding kinetics, the instrument used was the BIACORE2000 or BIACORE3000 (GE Healthcare), designed for biomolecular interaction analysis (BIA) in real-time molecules. The sensor chip used was the SA chip (GE Healthcare), in which streptavidin was covalently immobilized on a carboxymethylated dextran matrix. Each sensor chip had four parallel flow cells (Fc). Any biotinylated BKR1 or BKR2 ligand peptide was immobilized on one of the flow cells 2 to 4 (Fc2 to Fc4) of the SA chip for screening of binding and dissociation rates and selective screening. Flow cell 1 (Fc1) was reserved and immobilized with a random peptide (one end biotinylated) with a peptide length equal to or close to that of the ligand peptide under test as a negative control. In the screening assay, cell culture supernatant of hybridoma clones selected by primary screening of transiently expressed humanized variants was injected onto the immobilized peptide. A baseline was established by injecting hybridoma cell culture medium as a blank onto the surface of the chip. After subtracting the signals for Fc1 and blank buffer activity, the dissociation rates of antibodies from the supernatant for each peptide were analyzed and rated using BIAevaluation software. The top (Kd<10) -4 Only antibody clones demonstrating a binding-dissociation rate of 1 / s were selected for subcloning and further characterization. In dynamic analysis, the corresponding biotin peptides identified in screening for the test antibody were immobilized at Fc2 to Fc4, and Fc1 cells with random peptides were used as reference cells. Each purified antibody selected from screening was prepared in 2-fold serial dilutions in running buffer (1×HBS-EP buffer, GE Healthcare) between 0.1 nM and 10 nM. Binding association rate, dissociation rate, and overall affinity were calculated using BIAevaluation. Antibody binding dynamics for each antibody were consistently confirmed in three assays using Biacore.

[0158] A total of eight mice were immunized with mixtures of KLH-KD / KD-KLH and KLH-DAKD / DAKD-KLH, and their spleens were fused using the protocol described above. After a primary screening of approximately 7680 hybridoma clones in ELISA with DAKD-biotin and KD-biotin, only 76 clones were confirmed positive and selected for ranking the binding and dissociation rates on Biacore3000 / 2000 for DAKD-biotin and KD-biotin immobilized on streptavidin (SA) chips. Of these, those with binding and dissociation rates <= 10 -4 Eight hybridoma clones were subcloned, sequenced, purified, and further characterized (see Table 3).

[0159] [Table 7]

[0160] [Table 8]

[0161] Based on the results shown in Table 3, five clones with unique sequences were selected for kinetics testing. These antibodies were highly selective for binding to DAKD-biotin, KD-biotin, DAKLP-biotin, and KLP-biotin (see Table 4). They did not bind to other kinin peptides or peptides with biotinylated N-terminants.

[0162] [Table 9]

[0163] An array of immunogens (see list of peptides, Table 2) for producing antibodies that block rodent BKR1 ligands, DABK and DAKD, as well as antibodies having other binding specificities for different members of the kinin family peptides was used for further immunization. Table 5 lists the sequences of the heavy and light chains of the antibodies produced.

[0164]

Table 10

[0165]

Table 11

[0166] 〔Example 3〕 Production of surrogate antibodies for mouse animal studies Surrogate antibodies used in mouse animal studies are rodent BKR1 ligands, DA The ability to bind to and neutralize BK and DAKLP (the mouse equivalent of DAKD) was required. To produce the required surrogate antibodies, mice were first immunized with DABK and / or DAKD, and KLH was directly conjugated to the N-terminus of the peptides. Biotin-DABK / biotin-DAKD (direct biotinization on the N-terminus of the peptide) positive hybridoma clones were selected from ELISA screening for scale-up and purification. Antibodies listed in Family 7 (see Table 12) that demonstrated high binding affinity to biotin-DABK, biotin-DAKLP, and biotin-DAKD were selected based on the Biacore direct binding assay (Table 10). However, these Family 7 antibodies did not show binding to the natural, unmodified DABK and DAKD peptides in competitive ELISAs and lacked neutralizing function in the calcium influx assay using the Functional Drug Screening System (FDSS) (Hamamatsu Photonics KK, Japan). Furthermore, biotin-DABK and biotin-DAKD completely lost their physiological activity in the FDSS assay compared to natural, unmodified DABK and DAKD peptides (data not shown).

[0167] We hypothesized that direct N-terminal conjugates of KLH and biotin would interfere with the formation of the native conformations of DABK and DAKD. To restore the native conformations of KLH-conjugated and biotin-conjugated peptides, we designed linkers and attached them to the N-terminus of DABK and / or DAKD, attempting to "cushion" the KLH / biotin conjugate effect on the peptide conformation. Based on modeling results, polyglycine linkers were initially tried and tested due to their simple, nonpolar, and neutral nature. FDSS assay results indicated that the gly-gly-gly (3G) linker was the best, according to its ability to restore the bioactivity of KLH and biotin-conjugated DABK and DAKD peptides (data not shown). Therefore, we selected KLH-3G-DABK for immunizing mice. Furthermore, biotin-3G-DABK and biotin-3G-KD were used in binding-based screening assays (ELISA and Biacore). Several DABK / DAKD-specific antibodies (Family 3, see Table 13) were identified in this new round of surrogate antibody hybridoma selection. Based on superior binding affinity, neutralizing activity against native DABK / DAKD, and lack of cross-reactivity to other peptides, EE1 was selected as the primary surrogate antibody (see Tables 6-12).

[0168] Antibodies with different specificities were produced using the different immunogens listed in Table 13. Antibodies from Family 4 were specific to the BKR2 receptor ligand, BK, and KD. Antibodies from Family 5 specifically bind to the C-terminus of BK and DABK. Antibodies from Family 6 bind to BK, DABK, and DAKD, but not to KD.

[0169] Further linkers, including existing linkers such as longer polyglycine linkers, polyalanine linkers, polyethylene glycol (PEG2) linkers, and aminohexanoic acid (Ahx) linkers (6-carbon inactive linkers), were evaluated for their ability to fit into the DABK / DAKD binding pocket in EE1 for binding to surrogate EE1 antibodies. All linker peptides were custom-synthesized by Abgent (San Diego, CA). All biotinylated peptides with linkers tested (biotin-linker-DABK / DAKD) bound well to EE1, and it was noted that any inactive N-terminal linker, when conjugated with biotin and other molecules, helps DABK and DAKD peptides maintain their native physiologically active conformation. In contrast, biotin-DABK and biotin-DAKD peptides, which have a direct biotin conjugate at the N-terminus, either did not bind to EE1 or showed poor binding (see Figure 1).

[0170] Tables 5-11 summarize the binding dynamics of the produced antibodies. Next, all produced antibodies are classified into families, and their binding specificities are summarized in Table 12. Table 13 provides the heavy and light chain sequences of the antibodies placed in Family 1 and Family 2 based on their binding specificity (see Table 12).

[0171] [Table 12]

[0172] [Table 13]

[0173] [Table 14]

[0174]

Table 15

[0175]

Table 16

[0176]

Table 17

[0177]

Table 18

[0178]

Table 19

[0179] 〔Example 4〕 Characterization of des-arg-kinin ligand depletion using calcium mobilization Seven families of the produced antibodies were further characterized using functional assays. Bradykinin B1 receptor signaling is Gq-linked, and thus receptor activation can be monitored using the IP3 activation of Gq and downstream calcium mobilization. Calcium mobilization was measured using HEK mBKR1 (recombinant mouse bradykinin B1 receptor) cells or MRC5 (endogenous expression of bradykinin B2 receptor (ATCC CCL-171)).

[0180] In short, the mouse Bdkrb1 gene (sequence provided below) was amplified from mouse lung cDNA (Biochain, catalog number C1334152) using PCR primers 804_cGWY_F:5'-AAAAGCAGGCTTAGGAGCGGCCGCCATGGCGTCCCAGGCCTCGCTG-3' (SEQ ID NO: 107) and 804_cGWY_R:5'-CAAGAAAGCTGGGTCGGATCCTTATAAAGTTCCCAGAACCCTGGTC-3' (SEQ ID NO: 108), along with Pfu polymerase (Agilent Technologies, catalog number 600264), and cloned into pDONR201 using a BP clonase enzyme mix (Invitrogen, catalog number 11789-020). In parallel, the pEAK8 expression vector (EDGE Biosystems) was modified by inserting an N-terminal HA tag (GCATACCCATACGACGTCCCAGACTACGCT, GenBank SEQ ID NO: 109CY100443) into pEAK8 linearized with EcoRI and HindIII (vector pEAK8-nHA). Subsequently, Gateway cassette B (Invitrogen, catalog number 11828-029) was digested with EcoRI and NotI, and inserted into pEAK8_nHA blunt-terminated with Krenoh polymerase (NEB, catalog number M0210S) to obtain vector pEAK8_nHA_DEST. Next, mouse Bdkrb1 was subcloned into pEAK8_nHA_DEST using LR clonase (Invitrogen, catalog number 11791-100). Next, 293-PSC cells were transfected with the pEAK8-Bdkrb1 plasmid using Fugene6 transfection reagent. 24 hours after transfection, the cells were placed under antibiotic (puromycin) selection to maintain selection and produce a stable cell line. The presence of the Bdkrb1 gene in the resulting stable cell line was confirmed by agarose gel electrophoresis using real-time RT-PCR. Cell surface expression of the bradykinin B1 receptor was performed using an antibody against the N-terminal HA-tag (Covance, catalog number MMS-101P) on bradykinin B1R on a FACS instrument. The functional activity of the bradykinin B1 receptor was demonstrated in a calcium mobilization assay with a selective agonist.

[0181] Bdkrb1 gene subcloned into cells:

[0182] HEK mBKR1 or MRC5 cells were plated in growth medium in 384-well clear-bottom plates and allowed to adhere overnight. The growth medium was removed, and the cells were washed in assay buffer (HBSS, 20 mM HEPES, 2.5 mM probenecid), and then dyed with 0.5 μM Fluo-4 AM cell-permeable calcium-sensing dye containing 0.04% pluronic acid at 37°C for 1 hour. The AM ester was cleaved, and the calcium dye was retained in the cytoplasm. After 1 hour, the cells were washed to remove excess dye, leaving a residual buffer of 20 μL on the cells. The treatment was added as a 2× solution on a Functional Drug Screening System (FDSS) from Hamamatsu, and calcium mobilization was kinetically monitored for at least 4 minutes. Activation of the B1R or B2R receptor leads to activation of Galpha q-mediated phospholipase C and IP3-mediated calcium mobilization. The Fluo-4 dye chelates the released calcium, and robust changes in fluorescence are observed. The results were exported as maximum-minimum relative fluorescence units to normalize for differences in cell density or dye addition across plates.

[0183] The ligand titer was determined each day by operating the ligand concentration-response curve, and an approximate ligand concentration with an EC70-80 was selected for incubation with the antibody. A certain EC80 concentration was selected because it lay on the linear range of the detection curve and there was a sufficient window to observe reduction with antagonist or ligand-depleting antibodies. The antibody dose-response curve allowed binding to a ligand at a certain EC80 concentration, and the degree of ligand depletion was monitored using changes in fluorescence. The results were standardized for the buffer and EC80 ligand reactions, and the EC50 for ligand depletion was calculated. The results were then reported as a molar ratio, which corresponds to the antibody concentration (i.e., EC50 of Ab) that reduces ligand depletion by 50% of the ligand reaction divided by the ligand concentration used. Since one unit of antibody must be able to deplete two units of ligand, the theoretical maximum value should be 0.5, but the inventors actually observed a much lower value. This may reflect the insensitivity of the detection method to low ligand concentrations rather than a stoichiometric constraint on the antibody. The results of these experiments are shown in Tables 14-16.

[0184] Antibodies from Family 1 and Family 2 (see Table 13) demonstrate superior binding kinetics by Biacore (Table 13) and neutralization activity measured by calcium mobilization to DAKD and KD peptides (Tables 14 and 15). The antibodies were further analyzed for their thermal stability and sequence compatibility for humanization. F151 was thermally stable, lacked problematic residues in the CDR region, and cross-reactive to mouse ligands KLP and DAKLP, thus F151 was advanced for humanization.

[0185] [Table 20]

[0186] [Table 21]

[0187] [Example 5] F151 manipulation: Humanization, stabilization, and mutation of unnecessary sequence motifs 1. Humanization The humanization protocol used is incorporated herein by reference in its entirety, PCT. This is described in / US08 / 74381 (US20110027266). Homology models of anti-DAKD / KD F151 LC and HC in the Molecular Operating Environment (MOE; v.2009.10; Chemical Computing Group) were constructed using variable light chain (VL) and variable heavy chain (VH) sequences of mouse F151. The following templates were used: light chain framework-1SBS (93% identity in the framework region), heavy chain framework-2VXT (84% identity in the framework region), L1-1LVE (93% identity), L2-1EEU (100% identity), L3-2R56 (93% identity), H1-1NJ9 (95% identity), H2-2VXU (76% identity), and H3-1HIL (49% identity). The template is available from the RCSB Protein Data Bank, a website managed by Rutgers and the University of California, San Diego, located on the World Wide Web at rcsb.org (Berman, HM, Westbrook J., Feng Z., Gilliland, G., Bhat, TN, Weissig, H., Shindyalov, IN, Bourne, PE, The Protein Data Bank, Nucleic Acids Research, 2000, vol. 28, pp. 235-242). The homology model was subsequently energy-minimized using standard methods performed in MOE. Molecular dynamics (MD) simulations of the minimized 3D homology model of mouse F151 were subsequently performed in Generalized Born with 1.1 nanoseconds (ns) in dark solvent at a temperature of 500 K, bound to the protein backbone. Ten diverse conformations were extracted every 100 picoseconds (ps) from this initial MD operation during the final 1 ns. These diverse conformations were then subjected to MD simulations, and no binding was observed on the protein backbone for 2.3 ns at a temperature of 300 K.For each of the 10 MD actions, the last 2,000 snapshots, one per 1 ps from the MD orbital, were then used to calculate the mean squared deviation (rmsd) for each F151 amino acid in each mouse, compared to the reference medoid position. By comparing the average rmsd for 10 separate MD actions of a given amino acid with the overall average rmsd for all amino acids in all F151 mice, it was determined that if an amino acid is sufficiently flexible, it is likely to interact with the T cell receptor as seen during MD and is responsive to the activation of the immune response. Sixty-two amino acids were identified as flexible in the mouse F151 antibody, with the exception of the CDR and the immediate vicinity of 5 Å.

[0188] The movement of the 28 most flexible mouse F151 amino acids over 20 ns (10 × 2 ns) was then compared to the movement of the corresponding flexible amino acids in 49 human germline phase models, with 10 × 2 ns MD simulations run for each. The 49 human germline models were constructed by systematically combining seven of the most common human germline light chains (vk1, vk2, vk3, vk4, v-lambda1, v-lambda2, v-lambda3) and seven of the most common human germline heavy chains (vh1a, vh1b, vh2, vh3, vh4, vh5, vh6). The flexible amino acids of the vk1-vh1b human germline antibody showed a 4D similarity of 0.80 compared to the flexible amino acids of the mouse F151 antibody; therefore, the F151 amino acids were humanized using the vk1-vh1b germline antibody, focusing on the flexible amino acids. For the paired amino acid association between the vk1 and vh1b amino acids in mouse F151, the two sequences were aligned based on the optimal 3D superposition of the alpha carbons of two corresponding homology models (see Figure 15 for the alignments of F151 LC and F151 HC with vk1 and vh1b, respectively).

[0189] 2. Stabilization We improved antibody stability using two approaches.

[0190] a) Knowledge-based approach It had been proposed that the canonical sequences of the light and heavy chain amino acid pairs with low occurrence frequencies, excluding the CDR, should mutate to the most frequently found amino acid (ΔΔGth > 0.5 kcal / mol; E. Monsellier, H. Bedouelle, J. Mol. Biol., Vol. 362, 2006, pp. 580-593). This initial list of consensus mutations for the light chain (LC) and heavy chain (HC) was restricted to amino acids found in the nearest human germline (vk1-vh1b). Changes suggested in the nearest CDR (the 5-angstrom "vernier" zone, J. Mol. Biol., Vol. 224, 1992, pp. 487-499) were excluded from consideration. This resulted in five stabilizing mutations in the LC (see Table 19) and four stabilizing mutations in the HC (see Table 20). Considering other criteria, these mutations were considered for potential stabilization of the anti-DAKD / KD F151 antibody. These criteria included favorable changes in surface hydroxylation or stabilization of expected variants based on molecular mechanics. Further stabilizing mutations reported to be successful in the literature (E. Monsellier and H. Bedouelle, J. Mol. Biol., Vol. 362, 2006, pp. 580-593; BJSteipe et al., J. Mol. Biol., 1994, Vol. 240, pp. 188-192) were also considered (see Tables 16-22). One of these changes was incorporated as a stabilizing mutation (D89E) in the following HC2a, HC2b, and HC2c sequences. Another suggested change (Q62E) was incorporated into variant HC2b.

[0191] b) 3D and MD-based approaches 3D and MD-based approaches have been previously reported (Seco J, Luque FJ, Barril X., J Med Chem., April 23, 2009, Vol. 52(8), pp. 2363-2371; Malin Jonsson et al., J. Phys. Chem. B, 2003, Vol. 107, pp. 5511-5518). By analyzing molecular dynamics simulations of Fab in a two-component solvent (20% isopropanol in water, 20 ns generation simulation), the hydrophobic regions of the antibody were clearly identified. Lysine mutations were then introduced near these regions to prevent aggregation. Further analysis was completed using hydrophobic surface maps in Schrödinger's Maestro software (v.8.5.207). Using a combination of these two techniques, two Lys mutations are suggested: one in the heavy chain and one in the light chain.

[0192] 3. Humanization through grafting Humanization using grafting techniques has been previously reported (Peter T. Jones, Paul H. Dear, Jefferson Foote, Michael S. Neuberger, and Greg Winter, Nature, 1986, Vol. 321, pp. 522-525). The humanization process used began with identifying the human germline most closely related to the anti-DAKD / KD light and heavy chains. This was done by performing a BLAST search on all systematically enumerated human germlines (all possible combinations of V and J domains for kappa and lambda chains; V, D, and J domains for the heavy chain).

[0193] The following closest human germlines were identified with 83% and 62% sequence identity to the anti-DAKD / KD F151 light chain (LC) and heavy chain (HC), respectively (see Figure 16). Using the internal VBASE germline, the light chain was found to be close to the V IV-B3 locus (approximately 83% identity), and the heavy chain to the 1-08 and 1-18 loci of the VH1 subfamily (approximately 62% identity). The CDR region (defined by MOE) and Vernier region (defined in Foote and Winter, J. Mol. Biol., 1992, Vol. 224, pp. 487-499) are shown in bold. Underlined humanization variants Differences were obtained by comparing pairs of aligned sequences after excluding the CDR and vernier zone residues defined above. In another humanized variant, only the CDR was excluded from the comparison.

[0194] 4. Mutation of unnecessary sequence motifs The following sequence motifs were considered: Asp-Pro (acid-unstable binding), Asn-X-Ser / Thr (glycosylation, X=any amino acid other than Pro), Asp-Gly / Ser / Thr (succinimide / iso-asp formation in the flexible region), Asn-Gly / His / Ser / Ala / Cys (exposed deamide site), and Met (oxidation in the exposed region). Mouse F151 does not have any exposed unwanted sequence motifs, but these are introduced in some humanized variants; therefore, among other criteria, the VL and VH domains of mouse F151 were selected from other mouse antibodies.

[0195] LC3a, LC3b, HC3a, and HC3b each possess identified, potentially problematic succinimide sites. These sites were not modified in the proposed sequences because the residues involved are potentially involved in the H-binding network (visual examination of the homology model). These positions are also found in numerous other antibody structures. Furthermore, in both HC3a and HC3b, strict humanization by grafting involves a substitution of Ser115 with Met. This methionine is exposed. Since leucine is a common residue among many closely related human germline sequences, the substitution of leucine at this position is suggested as a humanization mutation.

[0196] The obtained humanized sequences were subjected to a BLAST search against the International Epitope Database (IEDB) database (found on the World Wide Web at immuneeepitope.com; version June 2009; Vita R, Zarebski L, Greenbaum JA, Emami H, Hoof I, Salimi N, Damle R, Sette A, Peters B., The immune epitope database 2.0., Nucleic Acids Res., January 2010; 38 (database publication): D854~62. Epub November 11, 2009) for sequence similarity, confirming that none of the sequences contained any known human B cell or T cell epitopes (70% sequence identity was used as a cutoff for the results obtained by the BLAST search, considering only results from the human species).

[0197] 5. Mouse F151 Variable region Original arrangement The CDR is highlighted in bold, and the vernier area (Foote and Winter, J.Mol.Biol., 1992, Vol. 224, pp. 487-499) is underlined.

[0198] Light chain (Sequence number 26) [ka] Germinality index = Z46615_1_V_X67858_1_J[V IV-B3] and 83%

[0199] Heavy chain (SEQ ID NO: 19): [ka] Germinality Index = Z12316_1_VX97051_4_D_X97051_5_J[VH1 1-18] and 62%

[0200] 6. Manipulated array a) Background Five versions of the light chain (LC1, LC2a, LC2b, LC3a, and LC3b) and five versions of the heavy chain (HC1, HC2a, HC2b, HC3a, and HC3b) were proposed.

[0201] LC1 contains five humanization mutations identified using a 4D humanization protocol. LC2a introduces five additional stabilization mutations. LC2b adds one lysine mutation to help prevent aggregation. LC3a contains 15 mutations derived from grafting to the nearest human germline sequence, preserving mouse CDR and vernier zone residues. LC3c contains 16 mutations derived from CDR grafting, along with one additional humanization mutation.

[0202] HC1 contains six humanization mutations identified by our internal protocol. HC2a introduces five additional stabilizing mutations, and HC2b contains six more stabilizing mutations compared to HC1. HC2c contains one Lys mutation in addition to the stabilizing mutations of HC2a to help prevent aggregation. HC3a contains 19 mutations that preserve mouse CDR and vernier zone residues, derived from grafting to the nearest human germline sequence. HC3b contains 25 mutations derived from CDR grafting.

[0203] A total of six combinations were proposed (summarized in Table 16): LC1×HC1 (a mutation that addresses only humanization) LC2a × HC2a (mutation to address humanization and stabilization) LC2a × HC2b (mutation to address humanization and stabilization) LC2b × HC2c (mutation addressing humanization, stabilization, and "anti-aggregation") LC3a × HC3a (a mutation that almost completely addresses humanization through grafting and vernier technology) LC3b × HC3b (a mutation that addresses humanization through grafting)

[0204] [Table 22]

[0205] [Table 23]

[0206] [Table 24]

[0207] a) The arrangement of the manipulated light chains No potentially problematic, known T-cell or B-cell epitopes were found in any of the proposed variants.

[0208] LC1 (SEQ ID NO: 27), the humanized variant is underlined, and the CDR and vernier zone are in bold: [ka]

[0209] LC2a (SEQ ID NO: 28), humanization mutations are underlined, CDR and vernier zones are in bold, and stabilizing mutations are in italics (shown below: T at position 5, S at position 12, I at position 21, S at position 69, T at position 91): [ka]

[0210] In LC2b (SEQ ID NO: 29), humanization mutations are underlined, CDR and vernier zones are in bold, stabilizing mutations are in italics (as shown below: T at position 5, S at position 12, I at position 21, S at position 69, T at position 91), and the antiaggregation mutation is K at position 89: [ka]

[0211] LC3a (SEQ ID NO: 30), grafting mutations are underlined, and the CDR and vernier zones are shown in bold: [ka]

[0212] LC3b (SEQ ID NO: 31), grafting mutations are underlined, and the CDR and vernier zones are shown in bold: [ka] Please note that the L at position 52 is a vernier residue that is mutated in humans.

[0213] c) Manipulated heavy chain sequence HC1 (SEQ ID NO: 20), the humanized variant is underlined, and the CDR and vernier zone are in bold: [ka]

[0214] HC2a (SEQ ID NO: 21), humanization mutations are underlined, CDR and vernier zones are in bold, and stabilizing mutations are in italics (as shown below: Q at position 1, A at position 9, G at position 44, Y at position 80, and E at position 90): [ka]

[0215] HC2b (SEQ ID NO: 22), humanization mutations are underlined, CDR and vernier zones are in bold, and stabilizing mutations are in italics (as shown below: Q at position 1, A at position 9, G at position 44, E at position 62, Y at position 80, and E at position 90): [ka]

[0216] In the IEDB database, no human epitope was identified for the sequence HC2b.

[0217] In HC2c (SEQ ID NO: 23), humanization mutations are underlined, CDR and vernier zones are in bold, stabilizing mutations are in italics (Q at position 1, A at position 9, G at position 44, Y at position 80, and E at position 90, as shown below), and the antiaggregation mutation is K at position 86: [ka]

[0218] HC3a (SEQ ID NO: 24), grafting mutations are underlined, and the CDR and vernier zones are shown in bold: [ka]

[0219] LC3b (SEQ ID NO: 25), grafting mutations are underlined, and the CDR and vernier zones are shown in bold: [ka]

[0220] Note that the following Vernier residues are mutated in humans: V at position 2, M at position 48, V at position 68, M at position 70, and T at position 74. In the IED8 database, no human epitope was identified for the sequence HC3b. HC3b germinality index = Z12316_1_V_J00235_1_D_U42590_1_J[1-18 / DP-14] and 83%

[0221] [Table 25]

[0222] [Table 26]

[0223] [Table 27]

[0224] [Table 28]

[0225] [Example 6] Characterization of humanized variants Based on the in silico modeling shown in Table 16, the variable regions of the light chain (VL) and heavy chain (VH) of humanized F151 were codon-optimized for HEK293 expression and synthesized by GeneArt (a subsidiary of Life Technologies). The synthesized DNA fragments were cloned into the constant region of pFF0362 (A. Human Kappa LC vector), a vector encoding the light chain (CL) at the ApaLI / BsiWI site, and into the constant region of pFF0363 (B. Human IgG1 HC vector), a vector encoding the heavy chain (CH1, CH2, and CH3) at the ApaLI / ApaI site. The resulting plasmid pFF0640, containing the full-length LC, and humanized F151 were obtained. pFF0466 containing full-length HCs of 151 variants was cotransfected and transiently expressed in the FreeStyle® 293 expression system (Invitrogen / Life Technologies, catalog number K9000-01).

[0226] The six humanized variants shown in Table 16 were characterized by various parameters, including the coupling dynamics (discussed above), as well as chemical and physical properties, such as thermal stability, which is routinely used in this art.

[0227] Characterization was performed in two stages. Stage I included differential scanning calorimetry (DSC) data, as shown in Table 24 and Figure 2. Briefly, for the DSC experiments, antibodies were dialyzed against phosphate-buffered saline. Antibody concentration was measured by UV absorption. Antibodies were diluted to 1 mg / mL using PBS. Scans were performed using a Calorimetry Sciences Corporation N-DSC II instrument with 0.3268 mL capillary cells in PBS in reference cells. The scan rate was 2°C / min, and samples were scanned from 20°C to 100°C.

[0228] All variants except HC3b / LC3b showed comparable binding affinity to the parent antibody. Variants HC3a / LC3a were selected over the others based on SEC data, stability, and other physicochemical properties such as lack of aggregation (see Tables 23-25).

[0229] [Table 29]

[0230] [Table 30]

[0231] [Table 31]

[0232] [Table 32]

[0233] For the alignment of the parental F151 light and heavy chains with respect to the humanized F151 variant (HC3a / LC3a), please refer to Figure 3.

[0234] [Example 7] BRK1 ligand calidin and desArg 10 - Humanized antibody F1 against calidine 51 crystal structures Kalidine or desArg 10 -The crystal structure of humanized F151(HC3a / LC3a)Fab that binds to calidine was determined, and molecular interactions were analyzed.

[0235] Kalidine powder was purchased from Phoenix Pharmaceuticals (catalog number 009-37). For Fab protein production, the heavy chain (HC)VH region DNA from humanized F151 HC3a was cloned into a 6×His-tagged CH1 vector pFF0366. The light chain (LC) plasmid used here was the same as the original F151 LC3a plasmid used in F151 humanization (see Example 5). The two plasmids were cotransfected into freestyle HEK293 cells for Fab expression. The Fab protein was purified using cobalt resin, and after replacing the buffer with 50 mM MES pH 6.0 and 50 mM NaCl, it was concentrated to approximately 9 mg / mL. The purified F151 Fab protein was mixed with kalidine in a molar ratio of 1:2 and prepared for crystallization screening. Crystallization screening was performed under a wide range of conditions. Hampton Research Screening Kit PEG / ION The best crystals were observed under HT B10, B12, and G10 conditions. The crystals were freeze-protected in 20% glycerol in well buffer and frozen for diffraction data acquisition. X-ray diffraction data for both complexes were collected at Canadian Light Source, beamline CMCF-08ID. The Rmerge for the F151-KD complex was 8.9%, with I / s(I) = 20.2, and for F151-DAKD it was 7.7% and 18.5, respectively. The F151-KD structure was modified by molecular substitution in the phaser. L -V H and C L -C H Each domain was treated as an independent unit and analyzed using the Fab coordination from PDB entry 3QOS. The structure was refined using autoBuster with a resolution of 2.07 Å in space group P212121 for Rfactor 0.205 and Rfree 0.228. The F151-DAKD structure was analyzed using the F151-KD coordination. The structure was refined using autoBuster with a resolution of 1.86 Å in space group P212121 for Rfactor 0.232 and Rfree 0.238.

[0236] The electron density maps shown in Figures 4 and 5 are for calidine (KD) and Des-Arg. 10 -This shows the binding of calidine (DAKD) to F151 Fab and clearly determines the position of each amino acid. Regarding calidine, the Arg at the C terminal residue 10 There is no electron density for F151. This is consistent with the observation that DAKD (shown in Table 27 below), which lacks arginine at the C-terminal residue, binds equally well to F151 as KD. The IC50 values ​​of F151 in neutralization FDSS cell assays for KD and DAKD are 0.12 nM and 0.09 nM, respectively. In both cases, the electron density weakens towards the C-terminus of the peptide. 9 Phe in DAKD 9Because it has a slightly better electron density than, when bound to F151, the presence of additional arginine at the C-terminus of KD may stabilize the C-terminus of this peptide, although this arginine itself is not stable enough to be observed by X-rays. Since the two structures are essentially identical (the rms between KD and DAKD are 0.139 for the C atom and 0.328 for all atoms), all the following discussion will be based on the F151-KD structure.

[0237] [Table 33]

[0238] As shown in Figure 6, the KD binds to its N-terminus, which is embedded in the interface between the Fv subunits of the light and heavy chains. The interface between the light and heavy chains is filled with aromatic amino acids, including Tyr-L42, Tyr-L93, Tyr-L100, Trp_L102, Phe-L104, and Tyr-H35, Trp-H47, Tyr-H50, Tyr-H99, and Trp-H110, which are mutually stabilized by stacking and hydrophobic interactions. Residues from both the light and heavy chains of the CDR contribute to the binding. Residues along the light and heavy chains involved in the interaction with the KD, as mapped on the CDR, are shown in Figures 7 and 8. CDR H3 on the heavy chain is the longest loop and is most frequently used in the interaction with the KD, forming a side cover for the KD. The loop was stabilized primarily by interactions with the other two CDRs, H1 and H2 of the heavy chain: a salt bridge between Asp-H101 and Arg-H52 (stabilizing H1 and H3), an arene-H interaction between Tyr-H102 and Tyr-H54 (stabilizing H2 and H3), an H-bond between Asp-H108 and Tyr-H35, and an H-bond between His-H105 and Tyr-L55 (stabilizing H3 and L2).

[0239] Comparing the KD-interacting residues between the antibodies produced reveals similarities among them, with some being more closely related to KD interactions through the use of specific amino acids than others. For example, in the light chain, F151, C63, and I22 bind to KD using more similar amino acids in their CDRs, while B21 and I54 were even more similar. In the heavy chain, F151 and C63 were remarkably unique to each other, as well as to B21, I22, and I54. The latter three appear to form a group in terms of similarity. C63 is particularly interesting in its heavy chain, with loop lengths at H2 and H3 being even more different from all the others. Considering Fab as a whole, B21 and I54 were the most closely related.

[0240] In the crystal structure, the inventors found that KD is involved in systematic hydrogen bonding and hydrophobic interactions with Fab. The N-terminus of KD is embedded in Fab and has more concentrated interactions, while the C-terminus is essentially exposed to the solvent. Except for the first four residues (Lys-Arg-Pro-Pro), the other residues of KD gradually extend into the bulk solvent. The amidinium group of the Lys1 side chain is tethered by a salt bridge with Glu-L61 (L: light chain), and the amino group Lys1 at the amino terminus forms a salt bridge with Asp-H108 (H: heavy chain). The amidinium group of the Lys1 side chain also hangs on the aromatic ring of Tyr-L55 and is involved in cation interactions. Such strong interactions involving Lys1 tightly tether the amino terminus of KD in Fab. This is the F1 of KD. This also explains the importance of Lys1 in binding to 51. Without it (i.e., bradykinin), it would be impossible to measure detectable binding to hF151 or F151. Like Lys1, Arg2 interacts with Fab via salt bridges. The guanidium group of Arg2 interacts with the side chain of Asp-H104. The side chain of Arg2 is also H-bonded to the carbonyl oxygen of the back chain of Arg-H101. In addition, the back chain oxygen of Pro8 is H-bonded to the side chain of Arg-H101. Tyr-H102 half-intercalates to Phe8 and Pro9 and is involved in hydrophobic interactions with KD. In addition to direct interactions, many water-mediated H-bonds are also found between KD and Fab. It is also interesting to note that tyrosine residues are used most frequently in interactions compared to other amino acids, with 9 of the 16 residues marked with asterisks in Figures 7 and 8 being tyrosine. All residues in F151 surrounding the KD, with the exception of Asn-H33, appear to play a role in ligand binding. Asn-H33 is close to the Phe6 side chain but is polarly incompatible and lacks other significant interactions. Substitutions of aromatic / hydrophobic residues such as Trp or Tyr for interactions with Phe8 seem to be a quick choice when considering affinity maturation. These two aromatic amino acids are indeed found in other antibodies (Trp in C63 and Tyr in B21, I22, and I54). Table 28 below provides a detailed analysis of the 16 KD-interacting amino acid residues marked in Figures 7 and 8, describing functional substitutions that can be made in the CDR region where antigen binding should not be disrupted.

[0241] [Table 34]

[0242] [Table 35]

[0243] Epitope analysis of the conformation of calidine (KD) or desArg10-calidine (DAKD) revealed that it adopts a “Pro4 kink” conformation. As shown in Figure 17, the “Pro4 kink” conformation is characterized by a type II tight turn in the main chain polypeptide backbone of KD or DAKD at proline 4 (see Richardson JS, “The anatomy and taxonomy of protein structure,” Adv Protein Chem., 1981, vol. 34, pp. 167–339, incorporated herein by reference). The “Pro4 kink” conformation can be further defined by the fact that all or substantially all of the remaining amino acids of KD (1–2 and 6–9) or DAKD adopt an S-shaped repeat that spatially stacks and aligns with the hydrophobic side chain.

[0244] [Example 8] In vivo pharmacology of anti-BKR1-ligand antibodies in pain models This embodiment of the present invention illustrates the in vivo efficacy of an anti-BKR1 receptor-ligand antibody in various preclinical models of acute and chronic pain using the modified procedure described in (a) Saddi GM and Abbott FV., Pain, 2000, Vol. 89, pp. 53-63; (b) Chen et al., Molecular Pain, 2010, Vol. 2, pp. 6-13; and (c) Bennett GJ and Xie YK., Pain, 1988, Vol. 33, pp. 87-107.

[0245] animal Formalin experiments were conducted using adult male OF1 mice (20-30 grams), while both CFA and CCI tests used adult male C57BI / 6J mice (25-30 grams). Mice were kept in a temperature-controlled room under a 12-hour light-dark cycle. Food and water were freely available. For all experiments, mice were allowed to acclimate to the laboratory environment for at least two hours before being tested. No randomization was used for the tests. While the experimenters conducting the behavioral tests were not blinded to the treatment, they were not informed about the test hypotheses. All procedures were approved by the Animal Care and Use Committee of Sanofi-Aventis Research and Development and followed French legislation (Ministerial Decrees 87-848, October 19, 1987; Decision 19, 1988) implemented under European directive 86 / 609 / EEC.

[0246] A. Formalin-induced acute inflammatory pain The formalin test was used to measure nociceptive pain and inflammatory pain. In fact, intraplantar injection of formalin induced an initial acute nociceptive behavioral response (0-12 minutes), followed by a second inflammation-mediated response (15-45 minutes) caused by spinal cord excitability.

[0247] Formaldehyde (37%, Sigma) was diluted (v / v) with saline to obtain a formaldehyde concentration of 2.5% (i.e., a formalin concentration of approximately 6.25%). 20 μL of this solution was subcutaneously injected into the dorsal side of one hind leg of a mouse while it was gently held down. Behavioral responses were scored immediately after formalin injection and then at 3-minute intervals for 45 minutes as follows: (0) normal weight bearing on the injected leg, (1) light resting of the injected leg on the floor, (2) lifting-elevation of the injected leg, (3) licking or biting the injected leg. The group size consisted of 11-12 male OF1 mice.

[0248] The scores were plotted against time, and the area under the curve (AUC) was calculated from the mean score (±SEM) for both the early phase (0-12 minutes) and the late phase (15-45 minutes). Reversal of pain-like behavior was expressed as the change in AUC as a percentage.

[0249] The EE1 antibody inhibited pain-like behavior in the late phase of the formalin test in male OF1 mice. When administered intravenously 48 hours before intraplantar injection of formalin, the EE1 antibody showed dose-dependent reversal of pain-like behavior only in the late phase, with a minimum effective dose (MED) of 2.5 mg / kg, as shown in Figure 9. In fact, when administered at doses of 2.5, 10, and 30 mg / kg, EE1 reversed the late phase by 35±5%, 33±5%, and 45±7%, respectively, as shown in Table 29.

[0250] In contrast, when F151 is administered 48 hours prior to intraplantar injection of formalin, it weakly inhibits pain-like behavior in the late phase of the formalin test. Indeed, as shown in Table 29, F151 reversed the late phase by 15±7% and 21±5% at doses of 2.5 and 10 mg / kg, respectively.

[0251] [Table 36]

[0252] B.CFA (Freund's complete adjuvant)-induced chronic inflammatory pain Chronic inflammation was induced by intraplantar administration of 25 μL of Freund's complete adjuvant (CFA) containing 1 μg / μL of heat-sterilized Mycobacterium tuberculosis in mineral oil and mannide monooleate (Sigma) under short-term anesthesia (isoflurane, 3%). The group size was 8 male C57B / 6 mice.

[0253] CFA at doses of 2.5 mg / kg and 30 mg / kg were administered intraplantar, followed by intravenous administration of EE1 antibody 22 hours later. Mechanical and thermal hypersensitivity were evaluated on day 1 (D1), day 4 (D4), and day 7 (D7) after intraplantar administration of CFA.

[0254] B1. Mechanical hypersensitivity Mechanical hypersensitivity was evaluated by measuring the frequency of withdrawal response (FR, in %) after applying 0.6 g of Von Frey filament (Bioseb, France) 10 times to the plantar surface of the injected foot. To investigate the efficacy of the EE1 antibody against pain-like behavior, the inventors calculated the reversal of mechanical hypersensitivity (in %) as follows: The percentage of reversal for each mouse (average FR - isotype - control) 投与後 -FR-Ipsi 投与後 ) / (Average FR-Isotype-Control 投与後 -Average FR-sham 投与後 ) was calculated as follows.

[0255] Following intraplantar injection of CFA, a significant increase in FR against Von Frey filaments was observed in the isotype-control 1B7.11-treated group compared to the untreated group at D1, D4, and D7, demonstrating the development of mechanical hypersensitivity. Intravenous administration of EE1 antibody 22 hours after intraplantar CFA significantly reduced this FR at various time points compared to those obtained in the isotype-control 1B7.11-treated group (Figure 10).

[0256] Reversal of mechanical hypersensitivity occurred in 41±8% and 22±8% of patients on D1, 36±9% and 32±9% on D4, and 27±10% and 50±9% on D7, respectively, for intravenous administration of EE1 antibody at 2.5 mg / kg and 30 mg / kg (Table 30).

[0257] [Table 37]

[0258] B2. Thermal hypersensitivity For thermal hypersensitivity, measurement of paw withdrawal latencies (PWL, in seconds) responsive to radiant heat was evaluated using a plantar apparatus (IITC, Woodland Hills, USA).

[0259] To investigate the efficacy of the EE1 antibody against pain-like behavior, the inventors calculated the reversal of thermal hypersensitivity (%): The percent reversal for each mouse was calculated as (PWL 投与後 - mean isotype - control 投与後 ) / (mean isotype - control 投与前 - mean isotype - control 投与後 ).

[0260] There was no difference in thermal hypersensitivity among all groups at baseline, before intra - plantar injection of CFA (data not shown).

[0261] After intra - plantar injection of CFA, a significant reduction in paw withdrawal latency of the injected paw was observed in mice of the isotype - control 1B7.11 - treatment group at D1, D4, and D7, demonstrating that CFA induced thermal hypersensitivity (data not shown). The EE1 antibody was administered intravenously 22 hours after intra - plantar CFA injection (i.e., on day 1 after intra - plantar CFA injection). The EE1 antibody could not increase the paw withdrawal latency at D1 regardless of the dose tested (Figure 11). However, EE1 significantly increased the paw withdrawal latency at D4, and this effect also existed at D7 (Figure 11).

[0262] The reversal of thermal hypersensitivity was 41 ± 15% and 58 ± 21% at D4, and 46 ± 10% and 52 ± 17% at D7 for 2.5 mg / kg and 30 mg / kg intravenous administration of EE1, respectively (Table 31).

[0263]

Table 38

[0264] ​C.CCI (Chronic Compression Injury)-induced neuropathic pain (Bennett's model) The CCI model was used as a model for peripheral nerve injury. Briefly, mice were anesthetized with isoflurane (3%), and the right sciatic nerve was exposed at the mid-thigh level by making a small incision. Three loose ligations of 6.0 chromium gut (Ethicon) were placed around the sciatic nerve with a 1 mm space between them. The surgical procedure was completed by closing the muscles and skin. The day of the CCI surgery was designated as day 0. The group size consisted of 6-10 male C57BI / 6 mice.

[0265] On the 11th postoperative day, EE1 antibodies at 2.5 and 30 mg / kg were administered intravenously. Mechanical and thermal hypersensitivity were evaluated on the 12th (D12), 14th (D14), and 18th (D18) postoperative days, which corresponded to the conditions observed on the 1st (D1), 3rd (D3), and 7th (D7) postoperative days.

[0266] C1. Mechanical hypersensitivity Mechanical hypersensitivity was assessed by applying a steel rod to the hind leg of a mouse and increasing the force (5 grams in 10 seconds), and measuring the hind leg retraction threshold (for both injured [i.e., 1psi] and uninjured [i.e., contra] legs) to increasing pressure (in g) using a Dynamic Plantar Aesthesiometer (Ugo-Basile, Italy).

[0267] To investigate the effect of the EE1 antibody on pain-like behavior, the inventors determined the reversal of mechanical hypersensitivity as follows: the percentage of reversal for each mouse was (Ipsi 投与後 -Ipsi 投与前 ) / (Contra 投与前 -Ipsi 投与前 ) was calculated as follows.

[0268] After surgery, the operated mice developed robust sensitization to mechanical stimuli applied to the injured foot, but not to the uninjured foot. On day 11, mechanical sensitization to the injured foot reached a plateau (data not shown).

[0269] Intravenous administration of EE1 antibody on day 11 demonstrated a slight tendency towards reversal of CCI-induced mechanical hypersensitivity on D12, D14, and D18, at 15.2 ± 4.9% and 15.2 ± 5.7% on D12, 26.8 ± 5.7% and 25.7 ± 4.5% on D14, and 30.3 ± 7.1% and 20.8 ± 5.9% on D18, respectively, for 2.5 and 30 mg / kg (Figure 12 and Table 32).

[0270] [Table 39]

[0271] C2. Thermal hypersensitivity For thermal hypersensitivity, measurement of the withdrawal latency of the foot (in seconds) in response to radiant heat was evaluated on the injected hind foot using a plantar apparatus (IITC, Woodland Hills, USA).

[0272] To investigate the efficacy of EE1 antibody on pain-like behavior, the inventors calculated the reversal of thermal hypersensitivity (%) as follows: The percent reversal for each mouse was calculated as (Ipsi 投与後 - mean isotype - control 投与後 ) / (mean untreated 投与後 - mean isotype - control 投与後 ).

[0273] After surgery, the operated mice developed robust sensitization to thermal stimuli applied to the injured foot, but not to the uninjured foot. On day 11, thermal sensitization to the injured foot reached a plateau (data not shown).

[0274] Intravenous administration of EE1 antibody on day 11 did not significantly increase the latency period of hind leg retraction, even if a trend was observed on day 12. However, from day 14 onwards, EE1 antibody significantly increased hind leg retraction (Figure 13). Reversal of thermal hypersensitivity was observed in 41±16% and 56±24% on day 12, 51±16% and 98±48% on day 14, and 78±19% and 84±22% on day 18, respectively, for intravenous administration of EE1 antibody at 2.5 mg / kg and 30 mg / kg (Table 33).

[0275] [Table 40]

Claims

1. A pharmaceutical composition for use in a method for treating inflammatory pain in a subject requiring the same, wherein the pharmaceutical composition is calidine or des-Arg 10 - Specifically binds to calidine, but also to bradykinin or des-Arg 9 - Containing an isolated monoclonal antibody or its antigen-binding fragment that does not specifically bind to bradykinin, The antibody or antigen-binding fragment comprises the amino acid sequences of three heavy chain complementarity-determining regions (CDRs) selected from the group consisting of the following, and the amino acid sequences of three light chain CDRs: a) Sequence ID 13, Sequence ID 14, Sequence ID 15, Sequence ID 16, Sequence ID 17, and Sequence ID 18, b) Sequence ID 32, Sequence ID 33, Sequence ID 34, Sequence ID 35, Sequence ID 36, and Sequence ID 37, c) Sequence ID 40, Sequence ID 41, Sequence ID 42, Sequence ID 43, Sequence ID 17, and Sequence ID 44, d) Sequence ID 47, Sequence ID 48, Sequence ID 49, Sequence ID 50, Sequence ID 51, and Sequence ID 52, and e) Sequence ID 55, Sequence ID 56, Sequence ID 57, Sequence ID 58, Sequence ID 59, and Sequence ID 60 The pharmaceutical composition comprising the above.

2. A pharmaceutical composition for use in a method for treating inflammatory pain according to Claim 1, wherein the antibody or its antigen-binding fragment comprises amino acid sequences of the heavy chain and light chain variable regions, respectively, as described in SEQ ID NOs: 19 and 26, SEQ ID NOs: 20 and 27, SEQ ID NOs: 21 and 28, SEQ ID NOs: 22 and 28, SEQ ID NOs: 23 and 29, SEQ ID NOs: 25 and 31, SEQ ID NOs: 38 and 39, SEQ ID NOs: 45 and 46, SEQ ID NOs: 53 and 54, or SEQ ID NOs: 61 and 62.

3. A pharmaceutical composition for use in a method for treating inflammatory pain according to Claim 1, wherein the antibody or its antigen-binding fragment comprises: a) a heavy chain variable region comprising amino acid sequences of the HCDR3, HCDR2, and HCDR1 regions described in SEQ ID NOs: 13, 14, and 15, respectively; and b) a light chain variable region comprising amino acid sequences of the LCDR3, LCDR2, and LCDR1 regions described in SEQ ID NOs: 16, 17, and 18, respectively.

4. A pharmaceutical composition for use in a method for treating inflammatory pain according to Claim 1, wherein the antibody or its antigen-binding fragment comprises: a) a heavy chain variable region comprising amino acid sequences of the HCDR3, HCDR2, and HCDR1 regions described in SEQ ID NOs. 32, 33, and 34, respectively; and b) a light chain variable region comprising amino acid sequences of the LCDR3, LCDR2, and LCDR1 regions described in SEQ ID NOs. 35, 36, and 37, respectively.

5. A pharmaceutical composition for use in a method for treating inflammatory pain according to Claim 1, wherein the antibody or its antigen-binding fragment comprises: a) a heavy chain variable region comprising amino acid sequences of the HCDR3, HCDR2, and HCDR1 regions described in SEQ ID NOs: 40, 41, and 42, respectively; and b) a light chain variable region comprising amino acid sequences of the LCDR3, LCDR2, and LCDR1 regions described in SEQ ID NOs: 43, 17, and 44, respectively.

6. A pharmaceutical composition for use in a method for treating inflammatory pain according to Claim 1, wherein the antibody or its antigen-binding fragment comprises: a) a heavy chain variable region comprising amino acid sequences of the HCDR3, HCDR2, and HCDR1 regions described in SEQ ID NOs: 47, 48, and 49, respectively; and b) a light chain variable region comprising amino acid sequences of the LCDR3, LCDR2, and LCDR1 regions described in SEQ ID NOs: 50, 51, and 52, respectively.

7. A pharmaceutical composition for use in a method for treating inflammatory pain according to Claim 1, wherein the antibody or its antigen-binding fragment comprises: a) a heavy chain variable region comprising amino acid sequences of the HCDR3, HCDR2, and HCDR1 regions described in SEQ ID NOs. 55, 56, and 57, respectively; and b) a light chain variable region comprising amino acid sequences of the LCDR3, LCDR2, and LCDR1 regions described in SEQ ID NOs. 58, 59, and 60, respectively.

8. A pharmaceutical composition for use in a method for treating inflammatory pain according to Claim 1, wherein the antibody or its antigen-binding fragment comprises a) amino acid sequences of the HCDR3, HCDR2, and HCDR1 regions described in SEQ ID NOs: 13, 14, and 15, respectively, and selected from the group consisting of H1, H5, H9, H11, H12, H16, H38, H40, H41, H43, H44, H75, H79, H81, H82A, H83, and H87 by Kabat a) a heavy chain variable region comprising one or more amino acid substitutions at the positions; and b) a light chain variable region comprising the amino acid sequences of the LCDR3, LCDR2, and LCDR1 regions described in SEQ ID NOs: 16, 17, and 18, respectively, and one or more amino acid substitutions at positions selected by Kabat from the group consisting of L5, L9, L15, L18, L19, L21, L22, L43, L63, L78, L79, L83, L85, and L104; the pharmaceutical composition comprising: a) a heavy chain variable region comprising one or more amino acid substitutions at the positions;

9. A pharmaceutical composition for use in a method for treating inflammatory pain according to Claim 1, wherein the inflammation is chronic inflammation.

10. A pharmaceutical composition for use in a method for treating inflammatory pain in a subject requiring the use thereof, the pharmaceutical composition comprising an antibody or antigen-binding fragment thereof that specifically binds to calidine or des-Arg 10-calidine but not to bradykinin or des-Arg 9-bradykinin, and one or more pharmaceutically acceptable carriers, wherein the antibody or antigen-binding fragment thereof comprises the amino acid sequences of the heavy chain and light chain variable regions described in SEQ ID NOs. 24 and 30, respectively.

11. A pharmaceutical composition for use in a method for treating inflammatory pain in a subject requiring the use thereof, the pharmaceutical composition comprising an antibody or antigen-binding fragment thereof that specifically binds to calidine or des-Arg 10-calidine but not to bradykinin or des-Arg 9-bradykinin, and one or more pharmaceutically acceptable carriers, wherein the antibody or antigen-binding fragment thereof a) A heavy chain variable region containing an amino acid sequence having at least 90% identity with the amino acid sequences of the three heavy chain complementarity determining regions (CDRs) of SEQ ID NOs: 13, 14, and 15 and an amino acid sequence selected from the group consisting of SEQ ID NOs: 19, 20, 21, 22, 24, and 25; and a light chain variable region containing an amino acid sequence having at least 90% identity with the amino acid sequences of the three light chain CDRs of SEQ ID NOs: 16, 17, and 18 and an amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 30, and 31; b) A heavy chain variable region comprising an amino acid sequence having at least 90% identity with the amino acid sequences of the three heavy chain CDRs of SEQ ID NOs. 32, 33, and 34 and the amino acid sequence of SEQ ID NO. 38, and a light chain variable region comprising an amino acid sequence having at least 90% identity with the amino acid sequences of the three light chain CDRs of SEQ ID NOs. 35, 36, and 37 and the amino acid sequence of SEQ ID NO. 39; c) A heavy chain variable region comprising an amino acid sequence having at least 90% identity with the amino acid sequences of the three heavy chain CDRs of SEQ ID NOs. 40, 41, and 42 and the amino acid sequence of SEQ ID NO. 45, and a light chain variable region comprising an amino acid sequence having at least 90% identity with the amino acid sequences of the three light chain CDRs of SEQ ID NOs. 43, 17, and 44 and the amino acid sequence of SEQ ID NO. 46; d) A heavy chain variable region comprising an amino acid sequence having at least 90% identity with the amino acid sequences of the three heavy chain CDRs of SEQ ID NOs. 47, 48, and 49 and the amino acid sequence of SEQ ID NO. 53, and a light chain variable region comprising an amino acid sequence having at least 90% identity with the amino acid sequences of the three light chain CDRs of SEQ ID NOs. 50, 51, and 52 and the amino acid sequence of SEQ ID NO. 54; or e) A heavy chain variable region containing an amino acid sequence having at least 90% identity with the amino acid sequences of the three heavy chain CDRs of SEQ ID NOs. 55, 56, and 57 and the amino acid sequence of SEQ ID NO. 61, and a light chain variable region containing an amino acid sequence having at least 90% identity with the amino acid sequences of the three light chain CDRs of SEQ ID NOs. 58, 59, and 60 and the amino acid sequence of SEQ ID NO. 62 The pharmaceutical composition comprising the above.

Images