Nucleic acids, drug compositions and complexes, as well as methods for their preparation and use.

Abstract

To provide: an siRNA which inhibits proprotein convertase subtilisin / kexin type 9 (PCSK9) gene expression; a pharmaceutical composition containing the siRNA; and a conjugate.SOLUTION: Each nucleotide in the siRNA is independently a modified or unmodified nucleotide. The siRNA contains a sense strand and an antisense strand. The sense strand contains a nucleotide sequence I, the nucleotide sequence I having the same length as a specific nucleotide sequence 1, with three or less nucleotide differences. The antisense strand contains a nucleotide sequence II, the nucleotide sequence II having the same length as another specific nucleotide sequence 2, with three or less nucleotide differences. The siRNA, pharmaceutical composition thereof and the conjugate can effectively treat and / or prevent hypercholesterolemia.SELECTED DRAWING: Figure 3

Description

[Technical Field]

[0001] This disclosure concerns the progenitor protein convertase subtilisin / kexin type 9 (PCSK9) gene. This disclosure relates to nucleic acids, drug compositions, and siRNA complexes that can suppress expression. This invention relates to methods for preparing and using the nucleic acid, drug composition, and siRNA complex. [Background technology]

[0002] Dyslipidemia, particularly persistently high levels of low-density lipoprotein cholesterol (LDL-c) This is an important risk factor that induces and accelerates the onset and progression of atherosclerosis. It is closely associated with ischemic cardiovascular and cerebrovascular diseases and poses a significant threat to human health. Conventional treatments for dyslipidemia Therapeutic drugs mainly include statins, cholesterol absorption inhibitors, resins, probucol, and f These include dibrates, nicotinic acid, and their derivatives. Lipid-lowering drugs reduce plasma cholesterol. Lowering blood sugar levels can reduce the risk of developing cardiovascular disease, A fairly high percentage of patients do not reach ideal lipid levels.

[0003] According to the research, the precursor protein convertase subtilisin / kexin type 9 (PCSK9) It has been revealed that this gene plays an important role in lipid metabolism, particularly cholesterol metabolism. This is the result. By suppressing PCSK9 gene expression, plasma cholesterol levels are reduced. It can be effectively reduced. Small interfering RNA (small interfering RNA) ng RNA (siRNA) is RNA interference (RNA interference, RN Based on the mechanism known as AI, the expression of any target gene of interest can be suppressed in a sequence-specific manner. It can suppress or block PCSK at the mRNA level, thereby achieving the goal of treating the disease. Suppressing the expression of gene 9 is undoubtedly the most ideal treatment method.

[0004] Development of siRNA drugs that suppress PCSK9 gene expression and treat hypercholesterolemia In development, appropriate siRNA and its modifications, as well as an effective delivery system, are key technologies. [Overview of the project] [Problems that the invention aims to solve]

[0005] The inventors of this disclosure have an siRNA complex as described herein. This specifically suppresses the expression of the PCSK9 gene, specifically targeting the liver, and in the liver By suppressing the expression of the PCSK9 gene, it may be possible to treat or prevent hypercholesterolemia. The inventors also discovered that this was unexpected. Furthermore, the inventors have developed highly active siRNA and drug compositions. He invented it. [Means for solving the problem]

[0006] In some embodiments, the present disclosure relates to siR having the structure shown in formula (308). We provide NA complex.

[0007] [ka] In the formula, n1 is an integer selected from 1 to 3, and n3 is an integer selected from 0 to 4. And m1, m2, or m3 are independent integers selected from 2 to 10, R 10 , R 11 , R 12 , R 13 , R 14 or R 15 Each of these is independently H, or C1 -C 10 an alkyl group, C1-C 10 a halogenated alkyl group and C1-C 10 an alkoxy group selected from the group consisting of, R3 is a group having the structure represented by Formula A59.

[0008]

Chemical formula

[0009] R2 is a linear alkylene group of carbon atoms with a length of 1 to 20, and one or more of these are... Carbon atoms are C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenile group, C2-C 10 Alkynylene group, C6-C 10 Arylene group, C3-C 18 Heterozy Cryylene group and C5-C 10 One or more selected from the group consisting of heteroarylene groups It can be arbitrarily substituted, and R2 is C1-C 10 Alkyl alkyl group, C6-C 10Aryl group, C5-C 10 Heteroaryl group, C1-C 10 Alkyl halogens, -OC1-C 10 Alkyl group, -OC1-C 10 Alkylphenyl group, -C1-C 10 alkyl-OH, -OC1- C 10 Alkyl halogens, -SC1-C 10 Alkyl, -SC1-C 10 Alkyl Phenyl group, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated alkyl groups, Halogen substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2, -N( C1-C 10 (Alkyl group)(C1-C 10 Alkyl(alkyl group), -NH(C1-C 10 Alkyl Base), N(C1-C 10 (Alkyl group)(C1-C 10 Alkylphenyl group), NH(C1 -C 10 Alkylphenyl group), cyano group, nitro group, -CO2H, -C(O)O(C1 -C 10 Alkyl(C1-C) 10 (Alkyl group)(C1-C 10 alkyl group ), -CONH(C1-C 10 Alkyl(alkyl group), -CONH2, -NHC(O)(C1-C 10 Alkyl group), -NHC(O)(phenyl group), -N(C1-C 10 (Alkyl group) C (O)(C1-C 10 Alkyl(C1-C) 10 Alkyl(C)(O)(Pheny ), -C(O)C1-C 10 Alkyl group, -C(O)C1-C 10 Alkylphenyl a group consisting of a group, -C(O)C1-C 10 a haloalkyl group, -OC(O)C1-C 10 an alkyl group, - SO2(C1-C 10 an alkyl group), -SO2(phenyl group), -SO2(C1-C 10 a halogenated alkyl group), -SO2NH2, -SO2NH(C1-C 10 an alkyl group), -SO2NH(phenyl group), -NHSO2(C1-C 10 an alkyl group), -NHSO2 (phenyl group) and -NHSO2(C1-C 10 a halogenated alkyl group) and may optionally have any one or more substituents selected from the group consisting of and each L1 is independently a straight-chain alkylene group of 1 to 70 carbon atoms, one or more of which carbon atoms are selected from the group consisting of C(O), NH, O, S, CH=N, S(O)2, C2-C an alkenylene group, C2-C an alkynylene group, C6-C 10 an arylene group, C3-C1 10 an alkynylene group, C6-C<00​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​A halogenated A ryl group, a halogen substituent, -OH, -SH, -NH2, -C1-C 10 alkyl-NH 2, -N(C1-C 10 alkyl group)(C1-C 10 alkyl group), -NH(C1-C1 0 alkyl group), N(C1-C 10 alkyl group)(C1-C 10 alkylphenyl group), NH(C1-C 10 alkylphenyl group), a cyano group, a nitro group, -CO2H, -C(O )O(C1-C 10 alkyl group), -CON(C1-C 10 alkyl group)(C1-C 10 alkyl group), -CONH(C1-C 10 alkyl group), -CONH2, -NHC(O) (C1-C 10 alkyl group), -NHC(O)(phenyl group), -N(C1-C 10 al kyl group)C(O)(C1-C 10 alkyl group), -N(C1-C 10 alkyl group)C(O<00007所4>)(phenyl group), -C(O)C1-C 10 alkyl group, -C(O)C1-C 10 alk ylphenyl group, -C(O)C1-C 10 haloalkyl group, -OC(O)C1-C 10 al kyl group, -SO2(C1-C 10 alkyl group), -SO2(phenyl group), -SO2(C 1-C 10 [[ID=所3]]halogenated alkyl group), -SO2NH2, -SO2NH(C1-C 10 al kyl group), -SO2NH(phenyl group), -NHSO2(C1-C<00所16>alkyl group), - NHSO2(phenyl group) and -NHSO2(C1-C 10 halogenated alkyl group) from It should be noted that there seem to be some unclear or incorrect notations in the original text (such as "<00007所4>", "<00所16>"), and the translation is based on the best understanding of the original content with these potential inaccuracies. If possible, it is recommended to clarify the original text for a more accurate translation. It may optionally have one or more substituents from the group, JPEG0007883784000003.jpg6170 represents the site where the group is covalently bonded, and M1 represents the target group.

[0010] In some embodiments, the present disclosure relates to siRNs capable of repressing PCSK9 gene expression. Provides A. The siRNA comprises a sense strand and an antisense strand, the sense strand and the Each nucleotide in the antisense strand is independently either a fluoromodified nucleotide or a non-fluoromodified nucleotide. It is a ruoro-modified nucleotide, and the sense strand contains nucleotide sequence I, and the anti The sense strand contains nucleotide sequence II, and the nucleotide sequence I and the nucleotide sequence Column II forms a double-stranded region in an inversely complementary manner in at least part of it, and the fluoromodified nucleus Otide is located in nucleotide sequence I and nucleotide sequence II, from the 5' end to the 3' end. Towards the sense strand, the nucleotides at positions 7, 8, and 9 of nucleotide sequence I Otide is a fluoromodified nucleotide, and the nucleo at the remaining position in the sense strand The nucleotide is a non-fluoromodified nucleotide, and from the 5' end to the 3' end, the aforementioned nucleotide In the cysnes chain, the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence II The nucleotide is a fluoromodified nucleotide, and the nucleotides at the remaining positions in the antisense chain Otide is a non-fluoromodified nucleotide, and the nucleotide sequence I and the nucleoti The "Do Array II" is one of the options selected from i) to vi) above.

[0011] In some embodiments, the Disclosure relates to the siRNA and pharmaceutically acceptable The present invention provides a drug composition containing a carrier.

[0012] In some embodiments, this disclosure relates to the siRNA and said The present invention provides an siRNA complex containing a complex group that binds to the siRNA.

[0013] In some embodiments, the Disclosure relates to the siRNA and / or drug compositions of the Disclosure. and / or diseases or physiological conditions caused by abnormal expression of the PCSK9 gene in the siRNA complex. It provides use in the preparation of drugs for the treatment and / or prevention.

[0014] In some embodiments, the Disclosure relates to the siRNA and / or drug compositions of the Disclosure. and / or administering an effective amount of the siRNA complex to a subject requiring it. This provides methods for treating and / or preventing diseases or physiological conditions caused by abnormal expression of the PCSK9 gene. do.

[0015] In some embodiments, the Disclosure relates to the siRNA and / or drug compositions of the Disclosure. and / or bringing an effective amount of the siRNA complex into contact with hepatocytes, This invention provides a method for suppressing the expression of the PCSK9 gene.

[0016] In some embodiments, the Disclosure relates to the siRNA and / or drug compositions of the Disclosure. The kit provides the and / or siRNA complex. [Effects of the Invention]

[0017] The siRNAs, drug compositions, and siRNA complexes provided herein are highly stable. Furthermore, it exhibits high PCSK9 mRNA inhibitory activity, reduced off-target effects, and reduced toxicity. and / or diseases or physiological conditions resulting from abnormal expression of the PCSK9 gene, such as high cholesterol. It can significantly treat or prevent terolemia.

[0018] In some embodiments, the siRNA, drug composition or s provided herein The iRNA complex exhibits excellent target mRNA repression activity in in vitro cell experiments. Several experiments In form, the siRNA, drug composition, or siRNA complex provided by this disclosure is , at least 20%, 30%, 40%, 50%, 60%, 70%, 80% in hepatocytes It exhibits a target mRNA suppression rate of 90% or 95%.

[0019] In some embodiments, the siRNA, drug composition or s provided herein iRNA complexes can have higher stability in the body and / or higher activity. In some embodiments, the siRNA, drug composition or siRNA complexes make up at least 20%, 30%, 40%, 50%, 60%, and 7% of the body. It exhibits target gene expression suppression rates of 0%, 80%, 90%, or 95%. In some embodiments, In this disclosure, the siRNA, drug composition, or siRNA complex provided herein is used in the body at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 9% It shows a PCSK9 gene expression repression rate of 5%. In some embodiments, the present disclosure The provided siRNA, drug composition, or siRNA complex will be present in the body at least 20%. 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% intrahepatic PCSK9 This shows the gene expression repression rate. In some embodiments, the siR provided by this disclosure NA, drug compositions, or siRNA complexes make up at least 20%, 30%, or 40% of the body. Intrahepatic PCSK in 50%, 60%, 70%, 80%, 90%, or 95% animal models 9. Shows the gene expression repression rate. In some embodiments, the si provided by this disclosure RNA, drug compositions, or siRNA complexes make up at least 20%, 30%, or 40% of the body. Intrahepatic PCS in 50%, 60%, 70%, 80%, 90%, or 95% of human subjects This shows the repression rate of the K9 gene expression. In some embodiments, the s provided by this disclosure iRNA, drug compositions, or siRNA complexes have not shown significant off-target effects. Off-target effects may include, for example, the suppression of the normal expression of non-target genes. The binding / repression of off-target gene expression is 50% greater than the on-target gene effect. When the percentage drops by 40%, 30%, 20%, or 10%, the off-target effect is not significant. It is considered to be.

[0020] In some embodiments, the siRNA provided herein is psiCHEC The K system exhibits high inhibitory activity against the target sequence, and IC 50 However, 0.0194~ It is 0.0561 nM. In some embodiments, the siR provided by this disclosure The NA complex was administered as a single subcutaneous injection to cynomolgus monkeys at a dose of 9 mg / kg. Compared to day 7 before administration, NHP liver tissue PCSK9 mRNA was measured on day 15 after administration. The suppression rate is high, ranging from 56% to 81%. In some embodiments, the s provided by this disclosure The iRNA complex further significantly suppresses PCSK9 protein expression in serum, and when administered... On day 14, the suppression rate of PCSK9 protein expression in serum was high, at over 90%. In one embodiment, the siRNA complex provided by this disclosure is used to control serum LDL-c and It can significantly suppress CHO levels, and especially from day 14 to day 29 after administration, LDL- The inhibition rate for c was high, exceeding 30%, and eventually reaching 64%. Inhibition rate for CHO The percentage was also high, reaching over 35%. In some embodiments, provided by this disclosure The siRNA complex, administered as a single dose of 9 mg / kg, reduces LDL over a long period of 11 weeks. - The siRNA complex provided herein can maintain a suppression rate of 50% or more. The body did not show significant toxicity in either rats or mice. Therefore, this development The siRNA complex provided by [indication] has a rapid onset of action, a long duration of action, and targets mRN The suppression of A expression is significant, and the content of PCSK9 protein in serum is effectively reduced. It can lower LDL-c and CHO in serum and has a strong inhibitory effect. It has excellent biological safety.

[0021] Thus, the siRNA, drug composition and siRNA complex provided by this disclosure are It suppresses the expression of the PCSK9 gene and reduces the symptoms of disease or physiological changes caused by abnormal expression of the PCSK9 gene. It can effectively treat and / or prevent the condition, and has a bright outlook in its application. ru. Other features and advantages of this disclosure will be discussed in the embodiment for carrying out the invention, as described later. I will explain in detail. [Brief explanation of the drawing]

[0022] [Figure 1A-1F] The following are dose-effect curves fitted according to the relative residual activity of the reporter gene Renilla in the psiCHECK system after transfection with different siRNAs (siRNA 1-6). [Figure 2]This chart shows the normalized PCSK9 protein levels in serum at different time points after a single subcutaneous injection of 9 mg / kg of complex 1, 4, or 7 to cynomolgus monkeys. [Figure 3] This chart shows standardized LDL-c levels in serum at different time points after a single subcutaneous injection of either 9 mg / kg of complex 4 or 7, respectively, to cynomolgus monkeys. [Figure 4] This chart shows standardized CHO levels in serum at different time points after a single subcutaneous injection of either 9 mg / kg of complex 4 or 7, respectively, to cynomolgus monkeys. [Modes for carrying out the invention]

[0023] The embodiments for carrying out the invention of this disclosure will be described in detail below. The modes for carrying out the invention are merely for illustrative or interpretive purposes of this disclosure. It should be understood that this is not intended to be restrictive.

[0024] In this disclosure, PCSK9 mRNA refers to Genbank registration number NM_1749 This refers to mRNA having the sequence shown in 36.3. Furthermore, unless otherwise specified, this disclosure The term "target gene" used in this context refers to a gene capable of transcribing the above-mentioned PCSK9 mRNA. The term "target mRNA" refers to the PCSK9 mRNA mentioned above.

[0025] definition In context, unless otherwise specified, uppercase C, G, U, A, and T refer to nucleotide salts. The base sequence is represented by the lowercase letter m, where the nucleotide adjacent to the left of the letter m is methoxy. The lowercase letter f indicates a modified nucleotide, and the letter f is followed by a single nu adjacent to its left. The lowercase 's' indicates that the creotide is a fluoromodified nucleotide, and the lowercase 's' is to the left of the letter 's'. The two nucleotides adjacent to the right are linked by a thiophosphate ester group. P1 is represented as having one nucleotide adjacent to the right of P1 that is a 5'-phosphate nucleotype. The combination letters VP indicate that it is a nucleotide modified with a 5'-phosphate analog. The nucleotide adjacent to the right of the combined letter VP is a vinyl phosphate ester modified nucleotide. It represents a leotide, and the combination character Ps is the 1 adjacent to the right of the combination character Ps. The letter P indicates that the nucleotides are thiophosphate-modified nucleotides. The nucleotide adjacent to the right of the letter P is a 5'-phosphate nucleotide. It represents that.

[0026] In this context, the term "fluoromodified nucleotide" refers to the ribose group of a nucleotide. This refers to a nucleotide in which the hydroxyl group at the 2' position is replaced with fluorine, and is called a "non-fluoromodified nucleotide." A "rheotide" is a nucleotide in which the 2' hydroxyl group of the ribose group is replaced by a non-fluorine group. This refers to a modified nucleotide or nucleotide analog. "Nucleotide analog" means, In nucleic acids, it can substitute for nucleotides, but adenine ribonucleotides, Guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide or This refers to a group with a different structure from thymine deoxyribonucleotide, such as isonucleotides. Bridged nucleotides (BNA) or acyclic nucleotides There is a creotide. The aforementioned "methoxy-modified nucleotide" refers to the 2'-hydro ribose group. This refers to a nucleotide in which the xy group is replaced with a methoxy group.

[0027] In the context of this specification, the terms “complementary” and “reverse complementary” are used interchangeably. It also has a meaning well-known to those skilled in the art, that is, in a double-stranded nucleic acid molecule, each base of one strand is complementarily paired with a base on the other strand. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA ). The purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair contains one purine and one pyrimidine. When adenine on one strand always pairs with thymine (or uracil ) on the other strand and guanine always pairs with cytosine, the two strands are considered complementary , and it is considered that the sequence of the strand can be deduced from the sequence of its complementary strand. Accordingly, in this field, "mismatch" means that in a double-stranded nucleic acid, the bases at corresponding positions do not exist in a complementary pairing relationship.

[0028] In the context, unless otherwise specified, "substantially reverse complementary" means that there are three or fewer base mismatches between two related nucleotide sequences, "substantially reverse complementary" means that there is one or fewer base mismatches between two nucleotide sequences, and "completely reverse complementary" means that there are no base mismatches between two nucleotide sequences. 1

[0029] In the context, when there is a "nucleotide difference" between one nucleotide sequence and another nucleotide sequence, it means that the base type of the nucleotide at the same position in the former changes compared to the latter . For example, when one nucleotide base in the latter is A, when the corresponding nucleotide base at the same position in the former is U, C, G, or T, there are 2 at this position. ​ Nucleotide differences are observed to exist between two nucleotide sequences. In some embodiments, when a nucleotide-free nucleotide or its equivalent is used instead of the nucleotide at the original position, it is also considered that a nucleotide difference has occurred at that position. In the context of explaining the preparation methods of the siRNA, pharmaceutical composition or siRNA complex of the present disclosure, unless otherwise specified, the nucleoside monomer refers to a modified or unmodified nucleoside phosphoramidite monomer (RNA phosphoramidites, which may also be referred to as Nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis according to the type and order of nucleotides in the siRNA or siRNA complex to be prepared. Phosphoramidite solid-phase synthesis is a method used in RNA synthesis known to those skilled in the art. All nucleoside monomers used in the present disclosure are available for purchase as commercial products.

[0030] In the context, especially when explaining the preparation methods of the siRNA, pharmaceutical composition or siRNA complex of the present disclosure, unless otherwise specified, the above-mentioned nucleoside monomer refers to a modified or unmodified nucleoside phosphoramidite monomer (RNA phosphoramidites, which may also be referred to as Nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis according to the type and order of nucleotides in the siRNA or siRNA complex to be prepared. Phosphoramidite solid-phase synthesis is a method used in RNA synthesis known to those skilled in the art. All nucleoside monomers used in the present disclosure are available for purchase as commercial products. In the context of the present disclosure, unless otherwise specified, "complex" refers to the covalent bonding of two or more chemical moieties each having a specific function to each other, and accordingly, "complex" refers to a compound formed by the covalent bonding of these chemical moieties to each other. Further, "siRNA complex" represents a compound formed by the covalent bonding of one or more chemical moieties having a specific function to siRNA. In the following text, the siRNA of the present disclosure d RNA phosphoramidites. RNA phosphoramidi tes may also be referred to as Nucleoside phosphoramidites refers to. Phosphoramidite solid-phase synthesis is a method used in RNA synthesis known to those skilled in the art. All nucleoside monomers used in the present disclosure are available for purchase as commercial products. In the context of the present disclosure, unless otherwise specified, "complex" refers to the covalent bonding of two or more chemical moieties each having a specific function to each other, and accordingly, "complex" refers to a compound formed by the covalent bonding of these chemical moieties to each other. Further, "siRNA complex" represents a compound formed by the covalent bonding of one or more chemical moieties having a specific function to siRNA. In the following text, the siRNA of the present disclosure

[0031] In the context of the present disclosure, unless otherwise specified, "complex" means that two or more chemical moieties each having a specific function are covalently bonded to each other, and accordingly, "complex" refers to a compound formed by the covalent bonding of these chemical moieties to each other. Further, "siRNA complex" represents a compound formed by the covalent bonding of one or more chemical moieties having a specific function to siRNA. In the following text, the siRNA of the present disclosure In the context of the present disclosure, unless otherwise specified, "complex" refers to the covalent bonding of two or more chemical moieties each having a specific function to each other, and accordingly, "complex" refers to a compound formed by the covalent bonding of these chemical moieties to each other. Further, "siRNA complex" represents a compound formed by the covalent bonding of one or more chemical moieties having a specific function to siRNA. In the following text, the siRNA of the present disclosure In the context of the present disclosure, unless otherwise specified, "complex" refers to the covalent bonding of two or more chemical moieties each having a specific function to each other, and accordingly, "complex" The iRNA complex is sometimes simply called the "complex." The siRNA complex is sometimes referred to as such depending on the context. , a collective term for multiple siRNA complexes, or an siRNA complex represented by a certain chemical formula. It is understood. In the context of this disclosure, “complex molecule” means a molecule that reacts with siRNA. A specific compound that can be compounded with and ultimately form the siRNA complex of the present disclosure It should be understood that it exists.

[0032] As used herein, “any” or “any” means the events or events described below. The situation may or may not occur, and the description may or may not be an event or situation. This refers to both cases where it occurs and cases where it does not. For example, "arbitrarily substituted" alkyl This includes "alkyl" and "substituted alkyl" as defined in the following text: 1 or more With respect to any group containing substituents, these groups are sterically impractical and synthetically unfeasible. It is not intended to introduce any substitutions or substitution patterns that are and / or inherently unstable. If not, it will be understood by those skilled in the art.

[0033] As used herein, "alkyl" means a linear chain having a specific number of carbon atoms and a fractional group. This refers to a branched chain, and the aforementioned specific number is usually 1 to 20 carbon atoms, for example, 1 to 10 carbon atoms. A child is a carbon atom consisting of 1 to 8 or 1 to 6 carbon atoms. For example, a C1-C6 alkyl group has 1 to 6 carbon atoms. This includes linear and branched alkyl groups of carbon atoms. It refers to alkyl residues having a specific number of carbon atoms. In this case, it is intended to include all branched and linear forms having that number of carbon atoms. Therefore, for example, "butyl" includes n-butyl, sec-butyl, isobutyl and tert -This means it contains butyl, and "propyl" includes n-propyl and isopropyl. An alkylene is a subset of alkyl and is the same as alkyl but has two bonding points. It refers to the remaining group that does this.

[0034] As used herein, "alkenyl" refers to an unsaturated branched or straight-chain alkyl having at least one carbon-carbon double bond, and the carbon-carbon double bond is obtained by removing one hydrogen molecule from adjacent carbon atoms of the parent alkyl. The group may be in the cis or trans configuration of the double bond. Typical alkenyls include vinyl, prop-1-en-1-yl, prop-1-en-2-yl, prop-2-en-1-yl (allyl), prop-2-en-2-yl, etc. of propenyl, and but-1-en-1-yl, but-1-en-2-yl, 2-methylprop-1-en-1-yl, but-2-en-1-yl, but-2-en-2-yl, but-1,3-dien-1-yl, but-1,3-dien-2-yl, etc. of butenyl, but are not limited thereto. In certain embodiments, alkenyl has 2 to 20 carbon atoms, but in other embodiments, it has 2 to 10, 2 to 8 or 2 to 6 carbon atoms. An alkenylene is a subset of alkenyl and refers to a residue that is the same as alkenyl but has two bonding points.

[0035] As used herein, "alkynyl" refers to an unsaturated branched or straight-chain alkyl group having at least one carbon-carbon triple bond, and the carbon-carbon triple bond is obtained by removing two hydrogen molecules from adjacent carbon atoms of the parent alkyl. Typical alkynyls include ethynyl, prop-1-yn-1-yl, prop-2-yn-1-yl. Propynnyl, including yl, and buta-1-in-1-yl, buta-1-in-3-yl, buta- This includes, but is not limited to, but but also includes, 3-in-1-yl and other butynyl compounds. In one embodiment... In other embodiments, alkynyl has 2 to 20 carbon atoms, but in other embodiments, 2 to 1 They have 0, 2-8, or 2-6 carbon atoms. Alkynylenes are a subset of alkynyls. It is the same as alkynyl, but refers to a residue that has two binding sites.

[0036] As used herein, "alkoxy" means a specific number of carbon atoms linked by oxygen bridges. This refers to alkyl groups of elementary atoms, such as methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, pentyloxy, 2-pentyl Oxy, isopentyloxy, neopentyloxy, hexyloxy, 2-hexyloxy Examples include 3-hexyloxy and 3-methylpentyloxy. Alkoxy compounds are usually 1- It has 10, 1-8, 1-6, or 1-4 carbon atoms bonded by oxygen bridges. .

[0037] As used herein, "aryl" refers to an aromatic monocyclic or polycyclic hydrocarbon ring system. This refers to a group formed by removing a hydrogen atom from a ring carbon atom, derived from the aforementioned aromatic compound. A cyclic or polycyclic hydrocarbon ring system contains only hydrogen atoms and 6 to 18 carbon atoms, At least one of the rings in the ring system is perfectly unsaturated, that is, it follows Hückel's theory. This includes cyclic and delocalized (4n+2)π-electron systems. Examples of aryls include phenyl and fluorescein. It includes, but is not limited to, groups such as nyl and naphthyl. Arylene is a aryl s A busset is a residue that is the same as an aryl compound but has two binding sites.

[0038] As used herein, "halogen substituent" or "halo" means fluoro, chloro The term "halogen" refers to bromine or iodine, and includes fluorine, chlorine, bromine, or iodine. .

[0039] As used herein, "alkyl halogenate" means a specific number of carbon atoms. This is an alkyl group defined above, which is substituted with multiple halogen atoms up to the maximum allowable number. It refers to the group. Examples of alkyl halides include trifluoromethyl and difluoromethyl. This includes, but is not limited to, 2-fluoroethyl or pentafluoroethyl.

[0040] A "heterocyclic group" is a group consisting of 2 to 12 carbon atoms and 1 atom selected from nitrogen, oxygen, or sulfur. This refers to a stable 3- to 18-membered non-aromatic cyclic group containing six heteroatoms. Unless otherwise specified, heterocyclic groups are monocyclic, dicyclic, tricyclic, or tetracyclic systems, and are fused or bridged rings. A ring system may be included. Heteroatoms in the heterocyclic group may be optionally oxidized. 1 or Multiple nitrogen atoms (if present) are optionally quaternized. Heterocyclic groups are partially saturated or complete. It is totally saturated. Heterocyclic groups can bond to the rest of the molecule via any atom in the ring. Yes, it is possible. Examples of such heterocyclic groups include dioxanyl and thiophenyl[1,3]di Sulfonyl (thienyl[1,3]dithianyl), decahydroisoquinolinyl Lu, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, Morpholinyl, octahydroindole, octahydroisoindole, 2-oxapipe Rajinil, 2-oxapiperidil, 2-oxapyrrolidinil, oxazolidinil, piperi Zill, piperazinil, 4-piperidonil, pyrrolidinil, pyrazolidil, quinuclidinil , thiazolidinyl, tetrahydrofuryl, trithianyl, te Trahydropyranil, thiomorpholinyl, thiamol folinyl (thiamorpholinyl), 1-oxothiomorpholinyl (1-ox o-thiomorpholinyl) and 1,1-dioxothiomorpholinyl (1,1 This includes, but is not limited to, -dioxo-thiomorpholinyl.

[0041] A "heteroaryl" is a compound consisting of 2 to 17 carbon atoms and selected nitrogen, oxygen, and sulfur. This refers to a group derived from a 3-18 membered aromatic ring radical containing 1-6 heteroatoms. As used herein, heteroaryl is a monocyclic, dicyclic, tricyclic, or tetracyclic system. Also, at least one of the rings in this ring system is completely unsaturated, that is, it is Hucke It contains a cyclic delocalized (4n+2)π-electron system that follows the theory of cyclic delocalization. Heteroaryls are fused rings or It contains a bridging ring system. The heteroatoms in the heteroaryl are optionally oxidized. One or more The nitrogen atom (if present) is optionally quaternized. The heteroaryl is any in the ring It is bonded to the rest of the molecule via atoms. An example of a heteroaryl is azepinine. Lu, acridinyl, benzimidazolyl, benzoindole, 1,3-benzodioxazol Lyl, benzofuryl, benzoxazolyl, benzo[d]thiazolyl, benzothiadiazol Lil, benzo[b][1,4]dioxepinyl pinyl), benzo[b][1,4]oxazinyl (benzo[b][1,4]ox azinyl), 1,4-benzodioxanyl, Benzonaphthofuranil, benzoxazolyl, benzodioxolyl olyl), benzodioxinyl, benzopyranyl, Nzopyronil, benzofuryl, benzofuranol, benzothiophenyl, benzothieno[ 3,2-d]pyrimidinyl, benzotriazolyl, benzo[4,6]imidazo[1,2- a] Pyridyl, carbazolyl, cinnolinyl, cyclopenta[d ]pyrimidinyl, 6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-d ] Pyrimidinyl, 5,6-dihydrobenzo[h]quinazolinyl (5,6-dihydro benzo[h]quinazolinyl), 5,6-dihydrobenzo[h]cinnoly Nyl(5,6-dihydrobenzo[h]cinnolinyl), 6,7-dihydrobenzo[h]cinnolinyl Dro-5H-benzo[6,7]cyclohepta[1,2-c]pyridazinyl, dibenzofri Lu, dibenzothiophenyl, furyl, furanol, flo[3,2-c]pyridyl, 5,6 ,7,8,9,10-Hexahydrocycloocta[d]pyrimidinyl, 5,6,7,8, 9,10-Hexahydrocycloocta[d]pyridazinyl, 5,6,7,8,9,10- Hexahydrocycloocta[d]pyridyl, isothiazolyl, imidazolyl, indazoli Indazolyl, indole, isoindole, indolinyl, isoindri Nyl, Isoquinolyl, Indolizinyl, Isoxazolyl, 5,8-methano-5,6,7,8-tetrahydroquinazolinyl(5,8-methano (-5,6,7,8-tetrahydroquinazolinyl), naphthilidinyl (naphthyridinyl), 1,6-naphthyridinyl (1,6-naphth yridinonyl), oxadiazolyl, 2-oxoazepinyl pinyl), oxazolyl, oxiranyl, 5,6,6a,7, 8,9,10,10a-Octahydrobenzo[H]quinazolinyl,1-phenyl-1H- Pyrrolyl, phenazinil, phenothiazinil, phenoxadinil, phthalazinil (pht halazinyl, pteridinyl, prinyl, pyrrolyl, Pyrazolyl, pyrazolo[3,4-d]pyrimidinyl, pyridyl, pyrido[3,2-d]pyrimidinyl Limidinil, Pyrid[3,4-d]pyrimidinil, Pyrazinil, Pyrimidinil, Pyridadi Nyl, quinazolinyl, quinoxalinyl, quinolyl, tetra Hydroquinolyl, 5,6,7,8-tetrahydroquinazolinyl, 5,6,7,8-tetra Hydrobenzo[4,5]thieno[2,3-d]pyrimidinyl, 6,7,8,9-tetrahydro Dro-5H-cyclohepta[4,5]thieno[2,3-d]pyrimidinyl, 5,6,7, 8-Tetrahydropyrid[4,5-c]pyridazinyl, thiazolyl, thiadiazolyl, Liazolyl, tetrazolyl, triazinyl, thieno[2,3-d]pyrimidinyl, thieno [3,2-d]pyrimidinyl, thieno[2,3-c]pridinyl (thieno[2,3 -c]pridinyl) and thiophenyl (thiophenyl / thienyl) This includes, but is not limited to, the following:

[0042] Various hydroxy protecting groups can be used in this disclosure. Generally, protecting groups are , to inactivate chemical functionalities under specific reaction conditions It is possible to remove the functional group in the molecule without substantially damaging the rest of the molecule. It can be added to and removed. Typical hydroxy protecting groups include Beaucage et al. Tetrahedron 1992, 48, 2223~2311, and Greene a nd Wuts,Protective Groups in Organic Syn thesis,Chapter 2,2d ed.John Wiley & Sons Disclosed in New York, 1991, and by citation, the above documents are all It is incorporated herein as a body. In some embodiments, the protecting group is under basic conditions It is stable under acidic conditions, but can be removed under acidic conditions. In some embodiments, Non-exclusive examples of hydroxy protecting groups that can be used in the specification include dimethoxytrityl (D MT), monomethoxytrityl, 9-phenylxanthene-9-yl (Pixyl) or Contains 9-(p-methoxyphenyl)xanthene-9-yl (Mox). Several implementations In terms of form, non-exclusive examples of hydroxy protecting groups that can be used herein include Tr( Trityl), MMTr(4-methoxytrityl), DMTr(4,4'-dimethoxytrityl) Contains trimethoxytrityl (4,4',4''-trimethoxytrityl).

[0043] As used herein, the term "subject" refers to any animal, for example, a mammal. or marsupials. Subjects of this disclosure include humans and non-human primates (e.g., rhesus). (Little macaques or other species of macaques), mice, pigs, horses, donkeys, cattle, sheep, rats or any type of poultry, including but not limited to these.

[0044] As used herein, “treatment” means a method for obtaining a beneficial or desired outcome. This includes, but is not limited to, therapeutic effects. "Therapeutic effect" means eradicating the underlying disorder being treated. Or it means improvement. Also, the therapeutic effect means that the subject is still suffering from the underlying disability. Despite the possibility of receiving one or more physiological symptoms associated with the potential disorder, By eradicating or improving the condition, improvement is observed in the subject.

[0045] As used herein, “prevention” means a method for obtaining a beneficial or desired outcome. This includes, but is not limited to, preventive effects. In order to obtain a "preventive effect," the diagnosis of the disease in question Although a diagnosis may not have been made, the siRNA complex or drug composition may be used in relation to a specific disease. Administration to subjects at risk of developing the disease, or to subjects who have reported one or more pathological symptoms of the disease. It can be administered to the test subject.

[0046] In some contexts, this disclosure provides six siRNAs capable of repressing PCSK9 gene expression. do.

[0047] The siRNAs of this disclosure include a nucleotide group as a basic structural unit, and the nucleo It is known to those skilled in the art that the tide group includes a phosphate group, a ribose group, and a base, so here The explanation for this is omitted.

[0048] The siRNA disclosed herein comprises a sense strand and an antisense strand. The chain lengths are the same or different, and the length of the sense chain is 19-23 nucleotides, The length of the nucleotide chain is 19 to 26 nucleotides. Thus, provided in this disclosure The sense strand to antisense strand length ratio of the siRNA is 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 20, 2 0 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 20 , 21 / 21, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 2 3 / 20, 23 / 21, 23 / 22, 23 / 23, 23 / 24, 23 / 25 or 23 / 2 6 may also be used. In some embodiments, the sense strand and antiseptic strand of the siRNA are used. The length ratio of the lance chains is 19 / 21, 21 / 23, or 23 / 25.

[0049] <First siRNA> According to this disclosure, the siRNA may be a first siRNA.

[0050] The first siRNA comprises a sense strand and an antisense strand, and each of the first siRNA Each nucleotide is independently modified or unmodified, and the sense strand is The nucleotide sequence I is included, the antisense strand includes the nucleotide sequence II, and the nucleotide sequence Cleotide sequence I and nucleotide sequence II are double-stranded in a reverse complementary manner, at least in part. The region is formed, and the nucleotide sequence I and the nucleotide sequence shown in Sequence ID No. 1 are The lengths are equal, the nucleotide difference is 3 or less, and the nucleotide sequence is the same as sequence number II. The nucleotide sequences shown in No. 2 are those with equal lengths and three or fewer nucleotide differences. ru. 5'-AAGCAAGCAGACAUUUAUZ1-3'(Sequence ID 1), 5'-Z2AUAAAUGUCUGCUUGCUU-3'(Sequence ID 2) However, Z1 is C and Z2 is G, and in the nucleotide sequence I, the position is Z1 The corresponding nucleotide Z3 is included, and the nucleotide sequence II has a position corresponding to Z2. The nucleotide Z4 is the first nucleotide at the 5' end of the antisense strand. It is creotide.

[0051] In this context, "corresponding positions" means that from the same end of a nucleotide sequence, the nucleotides correspond to each other. This refers to the same position in a sequence. For example, nucleotide 1 at the 3' end of nucleotide sequence I. The nucleotide in the eye corresponds to the 1st nucleotide at the 3' end of sequence number 1. It is leotide.

[0052] In some embodiments, the sense strand comprises only nucleotide sequence I, and The antisense strand contains only nucleotide sequence II.

[0053] In some embodiments, the nucleotide sequence I and the nucleotide shown in SEQ ID NO: 1 The nucleotide difference between the ocidal sequence and / or the nucleotide sequence is one or less, and / or the nucleotide sequence If there is one or fewer nucleotide differences between the nucleotide sequences shown in column II and sequence number 2 be.

[0054] In some embodiments, the nucleotide sequence II and the nucleotide shown in SEQ ID NO: 2 The nucleotide differences between the rheotide sequence and the rheotide sequence include differences at the Z4 position, where Z4 is A, U or is selected from C. In some embodiments, the nucleotide difference is at position Z4. The difference lies in the position, where Z4 is selected from A, U, or C. In some embodiments, Z3 is a nucleotide complementary to Z4. siRNA with the above nucleotide differences. It has high target mRNA suppression capability by siRNA, and these nucleotide differences include siRNA is also within the scope of protection of this disclosure.

[0055] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are , basically inversely complementary, substantially inversely complementary, or completely inversely complementary, the aforementioned basically inversely complementary A mismatch refers to the presence of three or fewer base mismatches between two nucleotide sequences. The term "substantially reverse complementary" means that there is one or fewer base mismatches between the two nucleotide sequences. This refers to the presence of a base mismatch between two nucleotide sequences, and being completely inversely complementary means that there is no base mismatch between the two nucleotide sequences. It refers to something that is not present.

[0056] In some embodiments, nucleotide sequence I is the nucleo shown in SEQ ID NO: 3 The nucleotide sequence is the nucleotide sequence shown in Sequence ID No. 4. ru. 5'-AAGCAAGCAGACAUUUAUZ3-3'(Sequence ID 3), 5'-Z4AUAAAUGUCUGCUUGCUU-3'(Sequence ID 4) However, Z4 is the first nucleotide at the 5' end of the antisense strand, and Z3 Z4 is selected from A, U, G, or C, and Z4 is a nucleotide complementary to Z3, and In one embodiment, Z3 is C and Z4 is G.

[0057] In some embodiments, the sense strand further comprises nucleotide sequence III. The antisense strand further comprises nucleotide sequence IV and nucleotide sequence III The nucleotide sequence IV has a length of 1 to 4 nucleotides, and the nucleotide sequence IV has a length of 1 to 4 nucleotides. Sequence III and nucleotide sequence IV are of equal length and substantially inversely complementary or complete. It is inversely complementary to the above, and the nucleotide sequence III is at the 5' end of the nucleotide sequence I. The nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II. In some embodiments, the nucleotide sequence IV and the second nucleotide sequence The sequence is substantially inversely complementary or completely inversely complementary, and is related to the second nucleotide sequence. It is adjacent to the 5' end of the nucleotide sequence shown in SEQ ID NO: 1 in the target mRNA, This refers to a nucleotide sequence whose length is equal to that of nucleotide sequence IV.

[0058] In some embodiments, nucleotide sequence III and nucleotide sequence IV are The length of each is 1 nucleotide, and the base of nucleotide sequence III is C, The base of creotide sequence IV is G, and in this case, the length ratio of the sense strand to the antisense strand is It is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. It is an Otid, and the base sequence of nucleotide sequence III is from the 5' end to the 3' end. It is CC, and the base sequence of nucleotide sequence IV is GG, and in this case the sense strand and annealed The length ratio of the cysnes chains is 21 / 21, or nucleotide sequences III and IV are long Each of them consists of 3 nucleotides, and the nucleotide arrangement is such that it moves from the 5' end to the 3' end. The base sequence of column III is CCC, and the base sequence of nucleotide sequence IV is GGG. At this time, the length ratio of the sense chain to the antisense chain is 22 / 22, or nucleoty Sequences III and IV are both 4 nucleotides long, and from the 5' end to the 3' end... Towards the next step, the base sequence of nucleotide sequence III is ACCC, and nucleotide sequence IV The base sequence is GGGU, and in this case, the length ratio of the sense strand to the antisense strand is 23 / 2. 3. In some embodiments, the nucleotide sequence III and the nucleotide sequence Column IV is 2 nucleotides long, and from the 5' end to the 3' end, it is nucleotide The base sequence of nucleotide sequence III is CC, and the base sequence of nucleotide sequence IV is GG. In this case, the length ratio of the sense chain to the antisense chain is 21 / 21.

[0059] In some embodiments, nucleotide sequences III and nucleotide IV are complete Since they are inversely complementary, given the bases of nucleotide sequence III, nucleotide The bases of sequence IV are also determined.

[0060] <Second siRNA> According to this disclosure, the siRNA may be a second siRNA.

[0061] The second siRNA comprises a sense strand and an antisense strand, and each of the second siRNA Each nucleotide is independently modified or unmodified, and the sense strand is The nucleotide sequence I is included, the antisense strand includes the nucleotide sequence II, and the nucleotide sequence Cleotide sequence I and nucleotide sequence II are double-stranded in a reverse complementary manner, at least in part. The region is formed, and the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 61 are different , the lengths are equal, the nucleotide difference is 3 or less, and the nucleotide sequence II and the sequence The nucleotide sequence shown in number 62 is one that is equal in length and has three or fewer nucleotide differences. That is the case. 5'-UUUGUAGCAUUUUUAUUAZ5-3'(Sequence ID 61), 5'-Z6UAAUAAAAAUGCUACAAA-3'(Sequence ID 62) However, Z5 is A, Z6 is U, and in the aforementioned nucleotide sequence I, the position is Z5. The corresponding nucleotide Z7 is included, and the nucleotide sequence II has a position corresponding to Z6. The nucleotide Z8 is the first nucleotide at the 5' end of the antisense strand. It is creotide.

[0062] In some embodiments, the sense strand comprises only nucleotide sequence I, and The antisense strand contains only nucleotide sequence II.

[0063] In some embodiments, the nucleotide sequence I and the nucleotide shown in SEQ ID NO: 61 The nucleotide difference between the rheotide sequence and the rheotide sequence is one or less, and / or the nucleotide There is no difference of one nucleotide between the nucleotide sequence shown in sequence II and sequence number 62. It is below.

[0064] In some embodiments, the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 62 are used. Nucleotide differences between the sequence and the creotide sequence include differences at the position of Z8, where Z8 is A, C Or selected from G. In some embodiments, the nucleotide difference is Z8 The difference lies in position, with Z8 being selected from A, C, or G. In some embodiments Z7 is a nucleotide complementary to Z8. SIRN with the above nucleotide differences. A has a high ability to suppress targeted mRNA with siRNA, and these nucleotide differences The included siRNAs are also within the scope of protection of this disclosure.

[0065] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are They are basically inversely complementary, substantially inversely complementary, or completely inversely complementary.

[0066] In some embodiments, nucleotide sequence I is the nucleotide shown in SEQ ID NO: 63 The ocidal sequence is the nucleotide sequence II shown in Sequence ID No. 64. That is the case. 5'-UUUGUAGCAUUUUUAUUAZ7-3'(Sequence ID 63), 5'-Z8UAAUAAAAAUGCUACAAA-3'(Sequence ID 64) However, Z8 is the first nucleotide at the 5' end of the antisense strand, and Z7 Z8 is selected from A, U, G, or C, and Z8 is a nucleotide complementary to Z7, and In one embodiment, Z7 is A and Z8 is U.

[0067] In some embodiments, the sense strand further comprises nucleotide sequence III. The antisense strand further comprises nucleotide sequence IV and nucleotide sequence III The nucleotide sequence IV has a length of 1 to 4 nucleotides, and the nucleotide sequence IV has a length of 1 to 4 nucleotides. Sequence III and nucleotide sequence IV are of equal length and substantially inversely complementary or complete. It is inversely complementary to the above, and the nucleotide sequence III is at the 5' end of the nucleotide sequence I. The nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially inversely complementary or complete. It is completely inversely complementary, and the second nucleotide sequence is the sequence number in the target mRNA. Adjacent to the 5' end of the nucleotide sequence shown in No. 61, the length is the same as the nucleotide sequence I This refers to a nucleotide sequence that is equal to the selected one.

[0068] In some embodiments, nucleotide sequence III and nucleotide sequence IV are The length of each is 1 nucleotide, and the base of nucleotide sequence III is U, The base of creotide sequence IV is A, and in this case, the length ratio of the sense strand to the antisense strand is It is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. It is an Otid, and the base sequence of nucleotide sequence III is from the 5' end to the 3' end. It is GU, and the base sequence of nucleotide sequence IV is AC, and in this case the sense strand and annealing The length ratio of the cysnes chains is 21 / 21, or nucleotide sequences III and IV are long Each of them consists of 3 nucleotides, and the nucleotide arrangement is such that it moves from the 5' end to the 3' end. The base sequence of column III is GGU, and the base sequence of nucleotide sequence IV is ACC. At this time, the length ratio of the sense chain to the antisense chain is 22 / 22, or nucleoty Sequences III and IV are both 4 nucleotides long, and from the 5' end to the 3' end... Towards the next step, the base sequence of nucleotide sequence III is GGGU, and nucleotide sequence IV The base sequence is ACCC, and in this case, the length ratio of the sense strand to the antisense strand is 23 / 2. 3. In some embodiments, the nucleotide sequence III and the nucleotide sequence Column IV is 2 nucleotides long, and from the 5' end to the 3' end, it is nucleotide The base sequence of nucleotide sequence III is GU, and the base sequence of nucleotide sequence IV is AC. In this case, the length ratio of the sense chain to the antisense chain is 21 / 21.

[0069] In some embodiments, nucleotide sequences III and nucleotide IV are complete Since they are inversely complementary, given the bases of nucleotide sequence III, nucleotide The bases of sequence IV are also determined.

[0070] <Third siRNA> According to this disclosure, the siRNA may be a third siRNA.

[0071] The third siRNA comprises a sense strand and an antisense strand, and each of the third siRNA Each nucleotide is independently modified or unmodified, and the sense strand is The nucleotide sequence I is included, the antisense strand includes the nucleotide sequence II, and the nucleotide sequence Cleotide sequence I and nucleotide sequence II are double-stranded in a reverse complementary manner, at least in part. A region is formed, and the nucleotide sequence I and the nucleotide sequence shown in Sequence ID No. 121 It has the same length, a nucleotide difference of 3 or less, and is paired with the nucleotide sequence II. The nucleotide sequence shown in column number 122 is of equal length and has three nucleotide differences. The following applies: 5'-GCCUGGAGUUUAUUCGGAZ9-3'(Sequence ID 121), 5'-Z 10 UCCGAAUAAACUCCAGGC-3' (Sequence ID 122) However, Z9 is A, and Z 10 It is U, and in the nucleotide sequence I, the position is Z9 Nucleotide Z corresponding to 11 It includes, and the nucleotide sequence II has position Z 10 to Corresponding nucleotide Z 12 The above Z 12 The 5' end of the antisense chain It is the first nucleotide.

[0072] In some embodiments, the sense strand comprises only nucleotide sequence I, and The antisense strand contains only nucleotide sequence II.

[0073] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 121 The nucleotide difference between the cleotide sequence and / or the nucleotide sequence is one or less, and / or the nucleotide sequence There is a nucleotide difference of 1 between sequence II and the nucleotide sequence shown in sequence number 122. It is one or less.

[0074] In some embodiments, the nucleotide sequence II and sequence number 122 are shown The nucleotide difference between the nucleotide sequence and the nucleotide sequence is Z 12 Including the difference in position, Z 12 but Selected from A, C, or G. In some embodiments, the nucleotide difference is Z 12 This is the difference at the position of Z 12 The selected form is A, C, or G. In state, Z 11 is, Z 12 It is a complementary nucleotide. The above nucleotide differences The siRNA possesses high siRNA-mediated target mRNA suppression capability, and these nucleotides siRNAs containing rheotide differences are also within the scope of protection of this disclosure.

[0075] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are They are basically inversely complementary, substantially inversely complementary, or completely inversely complementary. In some embodiments, nucleotide sequence I is the nucleotide shown in SEQ ID NO: 123 The rheotide sequence is the nucleotide sequence II shown in Sequence ID No. 124. It is an array. 5'-GCCUGGAGUUUAUUCGGAZ 11 -3'(Sequence ID 123), 5'-Z 12 UCCGAAUAAACUCCAGGC-3' (Sequence ID 124) However, the aforementioned Z 12 Z is the first nucleotide at the 5' end of the antisense strand. 11 is selected from A, U, G, or C, and Z 12 is, Z 11 It is a complementary nucleotide. In some embodiments, Z 11 A is Z 12 It is U.

[0076] In some embodiments, the sense strand further comprises nucleotide sequence III. The antisense strand further comprises nucleotide sequence IV and nucleotide sequence III The nucleotide sequence IV has a length of 1 to 4 nucleotides, and the nucleotide sequence IV has a length of 1 to 4 nucleotides. Sequence III and nucleotide sequence IV are of equal length and substantially inversely complementary or complete. It is inversely complementary to the above, and the nucleotide sequence III is at the 5' end of the nucleotide sequence I. The nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially inversely complementary or complete. It is completely inversely complementary, and the second nucleotide sequence is the sequence number in the target mRNA. Adjacent to the 5' end of the nucleotide sequence shown in No. 121, and the length is the same as the nucleotide sequence. This refers to a nucleotide sequence equal to IV.

[0077] In some embodiments, nucleotide sequence III and nucleotide sequence IV are Both are nucleotides of length 1, and the base of nucleotide sequence III is G, The base of creotide sequence IV is C, and in this case, the length ratio of the sense strand to the antisense strand is It is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. It is an Otid, and the base sequence of nucleotide sequence III is from the 5' end to the 3' end. It is AG, and the base sequence of nucleotide sequence IV is CU, and in this case the sense strand and AG The length ratio of the cysnes chains is 21 / 21, or nucleotide sequences III and IV are long Each of them consists of 3 nucleotides, and the nucleotide arrangement is such that it moves from the 5' end to the 3' end. The base sequence of column III is UAG, and the base sequence of nucleotide sequence IV is CUA. At this time, the length ratio of the sense chain to the antisense chain is 22 / 22, or nucleoty Sequences III and IV are both 4 nucleotides long, and from the 5' end to the 3' end... Towards the next step, the base sequence of nucleotide sequence III is AUAG, and nucleotide sequence IV The base sequence is CUAU, and in this case, the length ratio of the sense strand to the antisense strand is 23 / 2. 3. In some embodiments, the nucleotide sequence III and the nucleotide sequence Column IV is 2 nucleotides long, and from the 5' end to the 3' end, it is nucleotide The base sequence of sequence III is AG, and the base sequence of nucleotide sequence IV is CU. In this case, the length ratio of the sense chain to the antisense chain is 21 / 21.

[0078] In some embodiments, nucleotide sequences III and nucleotide IV are complete Since they are inversely complementary, given the bases of nucleotide sequence III, nucleotide The bases of sequence IV are also determined.

[0079] <The fourth siRNA> According to this disclosure, the siRNA may be a fourth siRNA.

[0080] The fourth siRNA comprises a sense strand and an antisense strand, and each of the fourth siRNA Each nucleotide is independently modified or unmodified, and the sense strand is The nucleotide sequence I is included, the antisense strand includes the nucleotide sequence II, and the nucleotide sequence Cleotide sequence I and nucleotide sequence II are double-stranded in a reverse complementary manner, at least in part. A region is formed, and the nucleotide sequence I and the nucleotide sequence shown in Sequence ID No. 181 It has the same length, a nucleotide difference of 3 or less, and is paired with the nucleotide sequence II. The nucleotide sequence shown in column number 182 is of equal length and has three nucleotide differences. The following applies: 5'-CUGUUUUGCUUUUGUAACZ 13 -3'(Sequence ID 181), 5'-Z 14 GUUACAAAAGCAAAACAG-3' (Sequence ID 182) However, Z 13 is U, Z 14 is A, and in the nucleotide sequence I, position Z 13 Nucleotide Z corresponding to 15 It includes, and the nucleotide sequence II has position Z1 nucleotide Z corresponding to 4 16 The above Z 16 This is the 5' end of the antisense chain. It is the first nucleotide at the end.

[0081] In some embodiments, the sense strand comprises only nucleotide sequence I, and The antisense strand contains only nucleotide sequence II.

[0082] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 181 The nucleotide difference between the cleotide sequence and / or the nucleotide sequence is one or less, and / or the nucleotide sequence There is a nucleotide difference of 1 between sequence II and the nucleotide sequence shown in sequence number 182. It is one or less.

[0083] In some embodiments, the nucleotide sequence II and sequence number 182 are shown The nucleotide difference between the nucleotide sequence and the nucleotide sequence is Z 16 Including the difference in position, Z 16 but Selected from U, C, or G. In some embodiments, the nucleotide difference is Z 16 This is the difference at the position of Z 16 is selected from U, C, or G. Several implementation forms In state, Z 15 is, Z 16 It is a complementary nucleotide. The above nucleotide differences The siRNA possesses high siRNA-mediated target mRNA suppression capability, and these nucleotides siRNAs containing rheotide differences are also within the scope of protection of this disclosure.

[0084] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are They are basically inversely complementary, substantially inversely complementary, or completely inversely complementary.

[0085] In some embodiments, nucleotide sequence I is the nucleotide shown in SEQ ID NO: 183 The rheotide sequence is the nucleotide sequence II shown in SEQ ID NO: 184. It is an array. 5'-CUGUUUUGCUUUUGUAACZ 15 -3'(Sequence ID 183), 5'-Z 16GUUACAAAAGCAAAACAG-3' (Sequence ID 184) However, the aforementioned Z 16 Z is the first nucleotide at the 5' end of the antisense strand. 15 is selected from A, U, G, or C, and Z 16 is, Z 15 It is a complementary nucleotide. In some embodiments, Z 15 is U, Z 16 It is A.

[0086] In some embodiments, the sense strand further comprises nucleotide sequence III. The antisense strand further comprises nucleotide sequence IV and nucleotide sequence III The nucleotide sequence IV has a length of 1 to 4 nucleotides, and the nucleotide sequence IV has a length of 1 to 4 nucleotides. Sequence III and nucleotide sequence IV are of equal length and substantially inversely complementary or complete. It is inversely complementary to the above, and the nucleotide sequence III is at the 5' end of the nucleotide sequence I. The nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially inversely complementary or complete. It is completely inversely complementary, and the second nucleotide sequence is the sequence number in the target mRNA. Adjacent to the 5' end of the nucleotide sequence shown in No. 181, and the length is the same as the nucleotide sequence. This refers to a nucleotide sequence equal to IV.

[0087] In some embodiments, nucleotide sequence III and nucleotide sequence IV are The length of each is 1 nucleotide, and the base of nucleotide sequence III is C, The base of creotide sequence IV is G, and in this case, the length ratio of the sense strand to the antisense strand is It is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. It is an Otid, and the base sequence of nucleotide sequence III is from the 5' end to the 3' end. AC, and the base sequence of nucleotide sequence IV is GU, and in this case, the sense strand and A The length ratio of the cysnes chains is 21 / 21, or nucleotide sequences III and IV are long Each of them consists of 3 nucleotides, and the nucleotide arrangement is such that it moves from the 5' end to the 3' end. The base sequence of column III is GAC, and the base sequence of nucleotide sequence IV is GUC. At this time, the length ratio of the sense chain to the antisense chain is 22 / 22, or nucleoty Sequences III and IV are both 4 nucleotides long, and from the 5' end to the 3' end... Towards the next step, the base sequence of nucleotide sequence III is AGAC, and nucleotide sequence IV The base sequence is GUCU, and in this case, the length ratio of the sense strand to the antisense strand is 23 / 2. 3. In some embodiments, the nucleotide sequence III and the nucleotide sequence Column IV is 2 nucleotides long, and from the 5' end to the 3' end, it is nucleotide The base sequence of sequence III is AC, and the base sequence of nucleotide sequence IV is GU. In this case, the length ratio of the sense chain to the antisense chain is 21 / 21.

[0088] In some embodiments, nucleotide sequences III and nucleotide IV are complete Since they are inversely complementary, given the bases of nucleotide sequence III, nucleotide The bases of sequence IV are also determined.

[0089] <The fifth siRNA> According to this disclosure, the siRNA may be a fifth siRNA.

[0090] The fifth siRNA comprises a sense strand and an antisense strand, and each of the fifth siRNA Each nucleotide is independently modified or unmodified, and the sense strand is The nucleotide sequence I is included, the antisense strand includes the nucleotide sequence II, and the nucleotide sequence Cleotide sequence I and nucleotide sequence II are double-stranded in a reverse complementary manner, at least in part. A region is formed, and the nucleotide sequence I and the nucleotide sequence shown in Sequence ID No. 241 It has the same length, a nucleotide difference of 3 or less, and is paired with the nucleotide sequence II. The nucleotide sequence shown in column number 242 is of equal length and has three nucleotide differences. The following applies: 5'-GGUUUUGUAGCAUUUUUAZ 17 -3'(Sequence ID 241), 5'-Z 18 UAAAAAUGCUACAAAACC-3' (Sequence ID 242) However, Z 17 is U, Z 18 is A, and in the nucleotide sequence I, position Z 17 Nucleotide Z corresponding to 19 It includes, and the nucleotide sequence II has position Z1 Nucleotide Z corresponding to 8 20 The above Z 20 This is the 5' end of the antisense chain. It is the first nucleotide at the end.

[0091] In some embodiments, the sense strand comprises only nucleotide sequence I, and The antisense strand contains only nucleotide sequence II.

[0092] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241 are used. The nucleotide difference between the cleotide sequence and / or the nucleotide sequence is one or less, and / or the nucleotide sequence There is a nucleotide difference of 1 between sequence II and the nucleotide sequence shown in sequence number 242. It is one or less.

[0093] In some embodiments, the nucleotide sequence II and sequence number 242 are shown The nucleotide difference between the nucleotide sequence and the nucleotide sequence is Z 20 Including the difference in position, Z 20 but Selected from U, C, or G. In some embodiments, the nucleotide difference is Z 20 This is the difference at the position of Z 20 is selected from U, C, or G. Several implementation forms In state, Z 19 is, Z 20 It is a complementary nucleotide. The above nucleotide differences The siRNA possesses high siRNA-mediated target mRNA suppression capability, and these nucleotides siRNAs containing rheotide differences are also within the scope of protection of this disclosure.

[0094] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are They are basically inversely complementary, substantially inversely complementary, or completely inversely complementary.

[0095] In some embodiments, nucleotide sequence I is the nucleotide shown in SEQ ID NO: 243 The rheotide sequence is the nucleotide sequence II shown in Sequence ID No. 244. It is an array. 5'-GGUUUUGUAGCAUUUUUAZ 19 -3'(Sequence ID 243), 5'-Z 20 UAAAAAUGCUACAAAACC-3' (Sequence ID 244) However, the aforementioned Z 20Z is the first nucleotide at the 5' end of the antisense strand. 19 is selected from A, U, G, or C, and Z 20 is, Z 19 It is a complementary nucleotide. In some embodiments, Z 19 is U, Z 20 It is A.

[0096] In some embodiments, the sense strand further comprises nucleotide sequence III. The antisense strand further comprises nucleotide sequence IV and nucleotide sequence III The nucleotide sequence IV has a length of 1 to 4 nucleotides, and the nucleotide sequence IV has a length of 1 to 4 nucleotides. Sequence III and nucleotide sequence IV are of equal length and substantially inversely complementary or complete. It is inversely complementary to the above, and the nucleotide sequence III is at the 5' end of the nucleotide sequence I. The nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially inversely complementary or complete. It is completely inversely complementary, and the second nucleotide sequence is the sequence number in the target mRNA. Adjacent to the 5' end of the nucleotide sequence shown in No. 241, and the length is the same as the nucleotide sequence. This refers to a nucleotide sequence equal to IV.

[0097] In some embodiments, nucleotide sequence III and nucleotide sequence IV are Both are nucleotides of length 1, and the base of nucleotide sequence III is G, The base of creotide sequence IV is C, and in this case, the length ratio of the sense strand to the antisense strand is It is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. It is an Otid, and the base sequence of nucleotide sequence III is from the 5' end to the 3' end. UG is nucleotide sequence IV is CA, and in this case the sense strand and AN The length ratio of the cysnes chains is 21 / 21, or nucleotide sequences III and IV are long Each of them consists of 3 nucleotides, and the nucleotide arrangement is such that it moves from the 5' end to the 3' end. The base sequence of column III is CUG, and the base sequence of nucleotide sequence IV is CAG. At this time, the length ratio of the sense chain to the antisense chain is 22 / 22, or nucleoty Sequences III and IV are both 4 nucleotides long, and from the 5' end to the 3' end... Towards the next step, the base sequence of nucleotide sequence III is UCUG, and nucleotide sequence IV The base sequence is CAGA, and in this case, the length ratio of the sense strand to the antisense strand is 23 / 2. 3. In some embodiments, the nucleotide sequence III and the nucleotide sequence Column IV is 2 nucleotides long, and from the 5' end to the 3' end, it is nucleotide The base sequence of sequence III is UG, and the base sequence of nucleotide sequence IV is CA. In this case, the length ratio of the sense chain to the antisense chain is 21 / 21.

[0098] In some embodiments, nucleotide sequences III and nucleotide IV are complete Since they are inversely complementary, given the bases of nucleotide sequence III, nucleotide The bases of sequence IV are also determined.

[0099] <The sixth siRNA> According to this disclosure, the siRNA may be a sixth siRNA.

[0100] The sixth siRNA comprises a sense strand and an antisense strand, and each of the sixth siRNA Each nucleotide is independently modified or unmodified, and the sense strand is The nucleotide sequence I is included, the antisense strand includes the nucleotide sequence II, and the nucleotide sequence Cleotide sequence I and nucleotide sequence II are double-stranded in a reverse complementary manner, at least in part. A region is formed, and the nucleotide sequence I and the nucleotide sequence shown in Sequence ID No. 301 It has the same length, a nucleotide difference of 3 or less, and is paired with the nucleotide sequence II. The nucleotide sequence shown in column number 302 is of equal length and has three nucleotide differences. The following applies: 5'-GUGACUUUUUAAAAUAAAZ 21 -3'(Sequence ID 301), 5'-Z 22 UUUAUUUUAAAAAGUCAC-3' (Sequence ID 302) However, Z 21 A is Z 22 It is U, and in the nucleotide sequence I, position Z 21 Nucleotide Z corresponding to 23 It includes, and the nucleotide sequence II has position Z2 Nucleotide Z corresponding to 2 24 The above Z 24 This is the 5' end of the antisense chain. It is the first nucleotide at the end.

[0101] In some embodiments, the sense strand comprises only nucleotide sequence I, and The antisense strand contains only nucleotide sequence II.

[0102] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 The nucleotide difference between the cleotide sequence and / or the nucleotide sequence is one or less, and / or the nucleotide sequence There is a nucleotide difference of 1 between sequence II and the nucleotide sequence shown in sequence number 302. It is one or less.

[0103] In some embodiments, the nucleotide sequence II and sequence number 302 are shown The nucleotide difference between the nucleotide sequence and the nucleotide sequence is Z 24 Including the difference in position, Z 24 but Selected from A, C, or G. In some embodiments, the nucleotide difference is Z 24 This is the difference at the position of Z 24 The selected form is A, C, or G. In state, Z 23 is, Z 24 It is a complementary nucleotide. The above nucleotide differences The siRNA possesses high siRNA-mediated target mRNA suppression capability, and these nucleotides siRNAs containing rheotide differences are also within the scope of protection of this disclosure.

[0104] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are They are basically inversely complementary, substantially inversely complementary, or completely inversely complementary.

[0105] In some embodiments, nucleotide sequence I is the nucleotide shown in SEQ ID NO: 303 The rheotide sequence is the nucleotide sequence II shown in SEQ ID NO: 304. It is an array. 5'-GUGACUUUUUAAAAUAAAZ 23 -3'(Sequence ID 303), 5'-Z 24 UUUAUUUUAAAAAGUCAC-3' (Sequence ID 304) However, the aforementioned Z 24 Z is the first nucleotide at the 5' end of the antisense strand. 23is selected from A, U, G, or C, and Z 24 is, Z 23 It is a complementary nucleotide. In some embodiments, Z 23 A is Z 24 It is U.

[0106] In some embodiments, the sense strand further comprises nucleotide sequence III. The antisense strand further comprises nucleotide sequence IV and nucleotide sequence III The nucleotide sequence IV has a length of 1 to 4 nucleotides, and the nucleotide sequence IV has a length of 1 to 4 nucleotides. Sequence III and nucleotide sequence IV are of equal length and substantially inversely complementary or complete. It is inversely complementary to the above, and the nucleotide sequence III is at the 5' end of the nucleotide sequence I. The nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially inversely complementary or complete. It is completely inversely complementary, and the second nucleotide sequence is the sequence number in the target mRNA. Adjacent to the 5' end of the nucleotide sequence shown in No. 301, and the length is the same as the nucleotide sequence. This refers to a nucleotide sequence equal to IV.

[0107] In some embodiments, nucleotide sequence III and nucleotide sequence IV are Both are nucleotides of length 1, and the base of nucleotide sequence III is G, The base of creotide sequence IV is C, and in this case, the length ratio of the sense strand to the antisense strand is It is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. It is an Otid, and the base sequence of nucleotide sequence III is from the 5' end to the 3' end. It is UG, the base sequence of nucleotide sequence IV is CA, and at this time, the length ratio of the sense strand to the anti-sense strand is 21 / 21, or nucleotide sequences III and IV both have a length of 3 nucleotides. From the 5' end to the 3' end, the base sequence of nucleotide sequence III is AUG, and the base sequence of nucleotide sequence IV is CAU. At this time, the length ratio of the sense strand to the anti-sense strand is 22 / 22, or nucleotide sequences III and IV both have a length of 4 nucleotides. From the 5' end to the 3' end, the base sequence of nucleotide sequence III is UAUG, and the base sequence of nucleotide sequence IV is CAUA. At this time, the length ratio of the sense strand to the anti-sense strand is 23 / 23. In some embodiments, nucleotide sequences III and IV have a length of 2 nucleotides. From the 5' end to the 3' end, the base sequence of nucleotide sequence III is UG, and the base sequence of nucleotide sequence IV is CA. At this time, the length ratio of the sense strand to the anti-sense strand is 21 / 21. The length ratio of the sense strand to the anti-sense strand is 21 / 21, or nucleotide sequences III and IV both have a length of 3 nucleotides. From the 5' end to the 3' end, the base sequence of nucleotide sequence III is AUG, and the base sequence of nucleotide sequence IV is CAU. At this time, the length ratio of the sense strand to the anti-sense strand is 22 / 22, or nucleotide sequences III and IV both have a length of 4 nucleotides. From the 5' end to the 3' end, the base sequence of nucleotide sequence III is UAUG, and the base sequence of nucleotide sequence IV is CAUA. At this time, the length ratio of the sense strand to the anti-sense strand is 23 / 23. In some embodiments, nucleotide sequences III and IV have a length of 2 nucleotides. From the 5' end to the 3' end, the base sequence of nucleotide sequence III is UG, and the base sequence of nucleotide sequence IV is CA. At this time, the length ratio of the sense strand to the anti-sense strand is 23 / 23. In some embodiments, nucleotide sequences III and IV have a length of 2 nucleotides. From the 5' end to the 3' end, the base sequence of nucleotide sequence III is UG, and the base sequence of nucleotide sequence IV is CA. At this time, the length ratio of the sense strand to the anti-sense strand is 21 / 21. In some embodiments, nucleotide sequences III and IV are completely reverse complementary. So, when the bases of nucleotide sequence III are given, the bases of nucleotide sequence IV are also determined. At this time, the length ratio of the sense strand to the anti-sense strand is 21 / 21.

[0108]

[0109] <siRNA Overhang Ends and Modifications> The following descriptions of nucleotide sequence V, nucleic acid sequence, nucleotide modifications in siRNA, and modification sequences are applicable to any one of the above siRNAs 1 to 6. That is, Unless otherwise specified, the following descriptions of siRNA apply to siRNA 1, siRNA 2 Unless otherwise specified, the following descriptions of siRNA apply to siRNA 1, siRNA 2 siRNA, third siRNA, fourth siRNA, fifth siRNA and sixth siRNA It should be considered that each siRNA is described individually. For example, if a specific siRNA is specified If not, "the siRNA further comprises nucleotide sequence V" means "the siRNA 1, siRNA 2, siRNA 3, siRNA 4, siRNA 5 This means that the RNA or sixth siRNA further contains nucleotide sequence V.

[0110] In some embodiments, the sense chain and the antisense chain have different lengths, The antisense strand further contains nucleotide sequence V, and nucleotide sequence V has a length of 1 It consists of ~3 nucleotides, which are attached to the 3' end of the antisense strand, and the antisense strand This constitutes a 3' protruding end (overhang end). This provides the s provided by this disclosure The length ratio of the sense strand to the antisense strand of the iRNA is 19 / 20, 19 / 21, 19 / 22. 20 / 21, 20 / 22, 20 / 23, 21 / 22, 21 / 23, 21 / 24, 22 / 2 3, 22 / 24, 22 / 25, 23 / 24, 23 / 25, or 23 / 26 may also be used. In some embodiments, the nucleotide sequence V has a length of 2 nucleotides. This provides the sense strand to antisense strand length ratio of the siRNA provided in this disclosure. It may also be 19 / 21, 21 / 23, or 23 / 25.

[0111] Each nucleotide in the nucleotide sequence V may be any nucleotide. Furthermore, in order to facilitate synthesis and save on synthesis costs, the nucleotide sequence V is divided into two consecutive sequences. 1 thyminedeoxyribonucleotide (dTdT) or 2 consecutive uracilribonucleonucleotides It is a rheotide (UU), or the affinity between the antisense strand of siRNA and the target mRNA. To enhance its power, nucleotide sequence V is the nucleo at the corresponding position of the target mRNA. It is complementary to siRNA. Therefore, in some embodiments, the siRNA of this disclosure The ratio of the sense strand length to the antisense strand length is 19 / 21 or 21 / 23, and in this case, The disclosed siRNA has higher mRNA silencing activity.

[0112] The nucleotide at the corresponding position of the target mRNA is the third nucleotide of the target mRNA at the 5' end. This refers to a nucleotide or nucleotide sequence adjacent to a nucleotide sequence, and the third row of the nucleotide sequence. The creotide sequence is substantially or completely inversely complementary to nucleotide sequence II. It is a nucleotide sequence, or it is composed of nucleotide sequence II and nucleotide sequence IV. Nucleotide sequences that are substantially or completely inversely complementary to the resulting nucleotide sequence It is a row.

[0113] In some embodiments, the first siRNA is subjected to the siRNA's sensor The S-chain contains the nucleotide sequence shown in Sequence ID No. 5, and the antisense chain is sequence number It contains the nucleotide sequence shown in No. 6. 5'-AAGCAAGCAGACAUUUAUZ3-3'(Sequence ID 5), 5'-Z4AUAAAUGUCUGCUUGCUUGG-3'(Sequence ID 6)

[0114] Alternatively, the sense strand of the siRNA may contain the nucleotide sequence shown in Sequence ID No. 7. The antisense strand includes the nucleotide sequence shown in Sequence ID No. 8. 5'-CCAAGCAAGCAGACAUUUAUZ3-3'(Sequence ID 7), 5'-Z4AUAAAUGUCUGCUUGCUUGGGU-3'(Sequence ID 8) However, Z4 is the first nucleotide at the 5' end of the antisense strand, and Z3 Z4 is selected from A, U, G, or C, and Z4 is a nucleotide complementary to Z3.

[0115] In some embodiments, the second siRNA is subjected to the siRNA's saturation. The S-chain contains the nucleotide sequence shown in SEQ ID NO: 65, and the antisense chain is the sequence It contains the nucleotide sequence shown in number 66. 5'-UUUGUAGCAUUUUUAUUAZ7-3'(Sequence ID 65), 5'-Z8UAAUAAAAAUGCUACAAAAC-3'(Sequence ID 66)

[0116] Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in Sequence ID No. 67. Furthermore, the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 68. nothing. 5'-GUUUUGUAGCAUUUUUAUUAZ7-3'(Sequence ID 67), 5'-Z8UAAUAAAAAUGCUACAAAACCC-3'(Sequence ID 68) However, Z8 is the first nucleotide at the 5' end of the antisense strand, and Z7 Z8 is selected from A, U, G, or C, and Z8 is a nucleotide complementary to Z7.

[0117] In some embodiments, the third siRNA is used to obtain the siRNA. The siRNA chain comprises the nucleotide sequence shown in Sequence ID No. 125, and the antiseptic of the siRNA. The nucleotide chain contains the nucleotide sequence shown in SEQ ID NO: 126. 5'-GCCUGGAGUUUAUUCGGAZ 11 -3'(Sequence ID 125), 5'-Z 12 UCCGAAUAAACUCCAGGCCU-3' (Sequence ID 126)

[0118] Alternatively, the sense strand of the siRNA may have the nucleotide sequence shown in Sequence ID No. 127 The antisense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 128. Includes. 5'-AGGCCUGGAGUUUAUUCGGAZ 11 -3'(Sequence ID 127), 5'-Z 12 UCCGAAUAAACUCCAGGCCUAU-3'(Sequence No. 128) ) However, the aforementioned Z 12 Z is the first nucleotide at the 5' end of the antisense strand. 11 is selected from A, U, G, or C, and Z 12 is, Z 11 It is a complementary nucleotide. ru.

[0119] In some embodiments, the fourth siRNA is used to obtain the siRNA. The siRNA chain comprises the nucleotide sequence shown in Sequence ID No. 185, and the antiseptic of the siRNA. The nucleotide chain contains the nucleotide sequence shown in SEQ ID NO: 186. 5'-CUGUUUUGCUUUUGUAACZ 15 -3'(Sequence ID 185), 5'-Z 16 GUUACAAAAGCAAAACAGGU-3' (Sequence ID 186)

[0120] Alternatively, the sense strand of the siRNA may have the nucleotide sequence shown in Sequence ID No. 187 The antisense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 188. Includes. 5'-ACCUGUUUUGCUUUUGUAACZ 15-3'(Sequence ID 187), 5'-Z 16 GUUACAAAAGCAAAACAGGUCU-3'(Sequence ID 188) ) However, the aforementioned Z 16 Z is the first nucleotide at the 5' end of the antisense strand. 15 is selected from A, U, G, or C, and Z 16 is, Z 15 It is a complementary nucleotide. ru.

[0121] In some embodiments, the siRNA is used with respect to the fifth siRNA. The siRNA chain comprises the nucleotide sequence shown in Sequence ID No. 245, and the antiseptic of the siRNA. The nucleotide chain contains the nucleotide sequence shown in SEQ ID NO: 246. 5'-GGUUUUGUAGCAUUUUUAZ 19 -3'(Sequence ID 245), 5'-Z 20 UAAAAAUGCUACAAAACCCA-3' (Sequence ID 246)

[0122] Alternatively, the sense strand of the siRNA may have the nucleotide sequence shown in Sequence ID No. 247 The antisense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 248. Includes. 5'-UGGGUUUUGUAGCAUUUUUAZ 19 -3'(Sequence ID 247), 5'-Z 20 UAAAAAUGCUACAAAACCCAGA-3'(Sequence ID 248) ) However, the aforementioned Z 20 Z is the first nucleotide at the 5' end of the antisense strand. 19 is selected from A, U, G, or C, and Z 20 is, Z 19 It is a complementary nucleotide. ru.

[0123] In some embodiments, the siRNA is used with respect to the sixth siRNA. The siRNA chain comprises the nucleotide sequence shown in Sequence ID No. 305, and the antiseptic of the siRNA. The nucleotide chain contains the nucleotide sequence shown in SEQ ID NO: 306. 5'-GUGACUUUUUAAAAUAAAZ 23 -3'(Sequence ID 305), 5'-Z 24 UUUAUUUUAAAAAGUCACCA-3' (Sequence ID 306)

[0124] Alternatively, the sense strand of the siRNA may have the nucleotide sequence shown in SEQ ID NO: 307 The antisense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 308. Includes. 5'-UGGUGACUUUUUAAAAUAAAZ 23 -3'(Sequence ID 307), 5'-Z 24 UUUAUUUUAAAAAGUCACCAUA-3'(Sequence ID 308) ) However, the aforementioned Z 24 Z is the first nucleotide at the 5' end of the antisense strand. 23 is selected from A, U, G, or C, and Z 24 is, Z 23 It is a complementary nucleotide. ru.

[0125] In some embodiments, the siRNAs described herein are listed in Tables 1a to 1f. siPCSKa1, siPCSKa2, siPCSKb1, siPCSKb2 , siPCSKc1, siPCSKc2, siPCSKd1, siPCSKd2, siP These are CSKe1, siPCSKe2, siPCSKf1, or siPCSKf2.

[0126] As mentioned above, each nucleotide in the siRNA of this disclosure is independently modified or This is an unmodified nucleotide. In some embodiments, the siRNA of this disclosure is The nucleotides are unmodified nucleotides, and in some embodiments, as disclosed in this disclosure Some or all of the nucleotides in the siRNA are modified nucleotides, and the nucleotides These modifications on the otide group allow the siRNA of this disclosure to repress PCSK9 gene expression. It does not significantly weaken or cause loss of function.

[0127] In some embodiments, the siRNAs of this disclosure have at least one modified nucleo Contains nucleotides. In the context of this disclosure, the term "modified nucleotide" means nucleotide. A nucleotide or nucleotide in which the hydroxyl group at the 2' position of the ribose group of an ocide is substituted with another group. This refers to a rheotide analog, or a nucleotide having a modified base. Reotide clearly weakens or eliminates the gene expression repressive function of siRNA. It will not happen. For example, JK Watts, GF Deleavey, and MJ Damha,Chemically modified siRNA: to ols and applications. Drug Discov Today, Select the modified nucleotides disclosed in 2008,13(19-20):842-55. That's fine.

[0128] In some embodiments, the sense strand of the siRNA provided herein or the aforementioned The antisense strand has at least one modified nucleotide, and / or It is a phosphate ester group in which at least one phosphate ester group has a modifying group. Alternatively, at least one single-stranded phosphate group in the sense chain and the antisense chain. - At least a portion of the phosphate ester groups and / or ribose groups in the sugar skeleton have modifying groups. It is a ribose group having a phosphate ester group and / or a modifying group.

[0129] In some embodiments, the sense chain and / or the antisense chain Cleotides are all modified nucleotides. In some embodiments, as disclosed herein Each nucleotide in the sense strand and antisense strand of the provided siRNA is They are either fluoromodified nucleotides or non-fluoromodified nucleotides.

[0130] Surprisingly, the inventors of this disclosure have found that the siRNA described herein can be used in animal experiments. In this case, a high degree of balance is achieved between plasma stability and gene silencing efficiency. I found it.

[0131] In some embodiments, the fluoromodified nucleotide is nucleotide sequence I And located in nucleotide sequence II, from the 5' end toward the 3' end, the nucleotide At least the nucleotides at positions 7, 8, and 9 of sequence I are fluoromodified nucleotides. From the 5' end toward the 3' end, at least the 2nd, 6th, and 1st nucleotides of the nucleotide sequence II The nucleotides at positions 4 and 16 are fluoromodified nucleotides.

[0132] In some embodiments, the fluoromodified nucleotide is nucleotide sequence I It is located in nucleotide sequence II, and is a fluoromodified nucleus in nucleotide sequence I. There are 5 or fewer ocides, and from the 5' end to the 3' end, the nucleotide sequence I The nucleotides at positions 7, 8, and 9 are fluoromodified nucleotides, and the nucleotide arrangement The number of fluoromodified nucleotides in column II is 7 or less, and the nucleotide sequence II The nucleotides at positions 2, 6, 14, and 16 are fluoromodified nucleotides.

[0133] In some embodiments, the sense strand odor is located from the 5' end to the 3' end. Then, the nucleotides at positions 7, 8, and 9 or 5, 7, 8, and 9 of the nucleotide sequence I are It is a ruoro-modified nucleotide, and the remaining nucleotides in the sense strand are non-fu It is a ruoro-modified nucleotide, and from the 5' end to the 3' end, the antisense strand In the above nucleotide sequence II, positions 2, 6, 14, 16 or 2, 6, 8, 9, 1 The nucleotides at positions 4 and 16 are fluoromodified nucleotides, and the antisense strand is The remaining nucleotides are un-fluoromodified nucleotides.

[0134] In the context of this disclosure, “fluoromodified nucleotide” means a nucleotide with ribose It has the structure shown in formula (7) below, in which the hydroxyl group at the 2' position of the group is substituted with fluorine. This refers to nucleotides that have ribose added. "Non-fluoromodified nucleotides" are nucleotides that have ribose added. A nucleotide in which the hydroxyl group at the 2' position of the base is substituted with a nonfluorine group, or a nucleotide A Refers to the nucleotide. In some embodiments, each non-fluoromodified nucleotide is a nucleotide. A nucleotide in which the hydroxyl group at the 2' position of the ribose group of an ocide is substituted with a nonfluorine group or It is one of the nucleotide analogs that is selected independently.

[0135] These nucleotides, in which the hydroxyl group at the 2' position of the ribose group is replaced with a nonfluorine group, are These nucleotides are known to those skilled in the art, and are 2'-alkoxy modified nucleotides. 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted Alkyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides The rheotide may be one selected from 2'-deoxynucleotides.

[0136] In some embodiments, the 2'-alkoxy-modified nucleotide is shown in formula (8) It is a 2'-methoxy(2'-OMe) modified nucleotide. In some embodiments, For example, 2'-substituted alkoxy modified nucleotides are shown in formula (9) as 2'-O -Methoxyethyl (2'-MOE) modified nucleotides may also be used. Several implementation forms In this state, the 2'-amino(2'-NH2) modified nucleotide is as shown in formula (10). In some embodiments, the 2'-deoxynucleotide (DNA) is of formula (1 As shown in 1).

[0137] [ka]

[0138] Nucleotide analogs are substances that can substitute for nucleotides in nucleic acids. adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, This refers to a group whose structure differs from that of uracil ribonucleotide or thymine deoxyribonucleotide. In some embodiments, the nucleotide analog is an isonucleotide, a cross-linked nucleotide. They may be rheotides or acyclic nucleotides.

[0139] Bridged nucleic acid (BNA) is a restraint Refers to nucleotides that have been or are not brought close together. BNAs are five-membered, six-membered, or seven-membered rings. It may include a crosslinked structure having "fixed" C3'-endoglycan puckering. The bridge is introduced at the 2'- and 4'- positions of the ribose to produce a 2',4'-BNA nucleotide. Provided. In some embodiments, BNA is LNA shown in formula (12), formula (1 3) may be ENA as shown in formula (14), cET BNA as shown in formula (14), etc.

[0140] [ka]

[0141] Acyclic nucleotides are nucleotides in which the sugar ring of the nucleotide has been opened. In that embodiment, the acyclic nucleotide is an unlocked nucleic acid represented by formula (15). (UNA), or glycerol nucleic acid (GNA) represented by formula (16).

[0142] [ka]

[0143] In formulas (15) and (16) above, R is H, OH, or alkoxy (O-alkoxy Selected from (Lu)

[0144] Isonucleotides are nucleotides in which the position of the base in the ribose ring changes. This refers to a compound. In some embodiments, the isonucleotide is of formula (17) or ( 18) The chemicals in which the base is transposed from the 1'-position to the 2'-position or 3'-position of the ribose ring. Mixed ingredients are also acceptable.

[0145] [ka]

[0146] In the compounds of formulas (17) to (18) above, the base is A, U, G, C, or T, etc. The base is represented, and R is selected from H, OH, F, or the non-fluorinated group mentioned above.

[0147] In some embodiments, the nucleotide analog is an isonucleotide, LNA, One of the following is selected from ENA, cET, UNA, and GNA. Several implementations In terms of morphology, each non-fluoromodified nucleotide is a methoxy-modified nucleotide. In this context, the methoxy-modified nucleotide refers to the 2'-hydroxy of the ribose group. This refers to a nucleotide in which the c group is replaced with a methoxy group.

[0148] In this context, "fluoromodified nucleotide" and "2'-fluoromodified nucleotide" are used. "A nucleotide in which the 2'-hydroxyl group of the ribose group is replaced with fluorine" and "2'- "Nucleotides containing a fluororibose group" have the same meaning, and both are nucleotides. Compounds having the structure shown in formula (7), in which the 2'-hydroxyl group of is replaced with fluorine. This refers to "methoxy-modified nucleotides," "2'-methoxy-modified nucleotides," and "ribo." "nucleotides in which the 2'-hydroxyl group of the - group is replaced with methoxy" and "2'-methyl "Nucleotides containing a siribose group" have the same meaning, and both refer to nucleotides. The 2'-hydroxyl group of the bose group is substituted with methoxy, and the structure is as shown in formula (8). It refers to compounds.

[0149] In some embodiments, the siRNAs of this disclosure are siRNAs having the following modifications. That is, in the sense chain, from the 5' end toward the 3' end, the nucleus Nucleotides at positions 7, 8, and 9 or positions 5, 7, 8, and 9 of rheotide sequence I are fluoromodified. It is a nucleotide, and the remaining nucleotides in the sense strand are methoxy-modified It is a creotide, and in the antisense strand, the 2nd and 6th nucleotides of nucleotide sequence II , nucleotides at positions 14, 16 or 2, 6, 8, 9, 14, 16 are fluoromodified nucleotides It is a rheotide, and the remaining nucleotides in the antisense chain are methoxy-modified. It is a nucleotide.

[0150] In some embodiments, the siRNAs of this disclosure are siRNAs having the following modifications. That is, from the 5' end toward the 3' end, in the sense strand of the siRNA Nucleotides at positions 5, 7, 8 and 9 of nucleotide sequence I are fluoromodified nucleotides. The nucleotides at the remaining positions of the sense strand of the siRNA are methoxy-modified nucleotides. It is a do, and from the 5' end to the 3' end, in the antisense strand of the siRNA Nucleotides at positions 2, 6, 8, 9, 14 and 16 of nucleotide sequence II are fluoromodified. These are decorative nucleotides, and the nucleotides at the remaining positions of the antisense strand of the siRNA are met It is a xy-modified nucleotide, Alternatively, from the 5' end to the 3' end, the nucleus in the sense strand of the siRNA The nucleotides at positions 5, 7, 8, and 9 of the ocidal sequence I are fluoromodified nucleotides. The remaining nucleotides in the sense strand of the siRNA are methoxy-modified nucleotides. , from the 5' end toward the 3' end, the nucleo in the antisense strand of the siRNA The nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence II are fluoromodified nucleotides. Yes, the nucleotides at the remaining positions of the siRNA antisense strand are methoxy-modified nucleos It is Chido, Alternatively, from the 5' end to the 3' end, the nucleus in the sense strand of the siRNA The nucleotides at positions 7, 8, and 9 of the ocidal sequence I are fluoromodified nucleotides, The remaining nucleotides in the sense strand of the iRNA are methoxy-modified nucleotides, and 5 From the 'terminus' to the '3' terminus, the nucleotides in the antisense strand of the siRNA The nucleotides at positions 2, 6, 14, and 16 of sequence II are fluoromodified nucleotides. The nucleotides at the remaining positions of the siRNA antisense strand are methoxy-modified nucleotides. That is the case.

[0151] In some embodiments, the siRNAs provided in this disclosure are shown in Tables 1a to 1f. The listed siPCSKa1-M1, siPCSKa1-M2, siPCSKa1- M3, siPCSKa2-M1, siPCSKa2-M2, siPCSKa2-M3, s iPCSKb1-M1, siPCSKb1-M2, siPCSKb1-M3, siPCS Kb2-M1, siPCSKb2-M2, siPCSKb2-M3, siPCSKc1- M1, siPCSKc1-M2, siPCSKc1-M3, siPCSKc2-M1, s iPCSKc2-M2, siPCSKc2-M3, siPCSKd1-M1, siPCS Kd1-M2, siPCSKd1-M3, siPCSKd2-M1, siPCSKd2- M2, siPCSKd2-M3, siPCSKe1-M1, siPCSKe1-M2, s iPCSKe1-M3, siPCSKe2-M1, siPCSKe2-M2, siPCS Ke2-M3, siPCSKf1-M1, siPCSKf1-M2, siPCSKf1- M3, siPCSKf2-M1, siPCSKf2-M2, or siPCSKf2-M3 It is one of the following.

[0152] siRNAs having the above modifications are not only low-cost, but also react with ribonucleases in the blood. This makes it more difficult to cleave nucleic acids, thereby improving the stability of nucleic acids and making them more durable. To give it the characteristic of strong resistance to nuclease hydrolysis. And the above modified siR Furthermore, NA exhibits high target mRNA suppression activity.

[0153] In some embodiments, the sense strand and antinucleotide provided herein are used. In the sense chain, the number of phosphate ester groups in at least one single-chain phosphate-sugar skeleton is small. At least some of them are phosphate ester groups having modifying groups. In some embodiments , the phosphate ester group having a modifying group, the phosphate diester bond in the phosphate ester group It is a thiophosphate ester group in which at least one oxygen atom is replaced by a sulfur atom. In several embodiments, the phosphate ester group having the modifying group is represented by formula (1) It is a thiophosphate ester group with a specific structure.

[0154] [ka]

[0155] These modifications stabilize the double-stranded structure of siRNA, resulting in high base pairing specificity. And it can maintain a high level of affinity.

[0156] In some embodiments, the siRNA provided in this disclosure contains thioline The acid ester group is connected to the first nucleotide at any one end of the sense strand or antisense strand and 2 Between the second nucleotide and the second nucleotide at any end of the sense strand or antisense strand Selected from the group consisting of the relationship between the ocide and the third nucleotide, or any combination thereof. It exists bound to at least one of them. In some embodiments, thiophosphate ester The tel group is present at all of the above positions except the 5' end of the sense chain. In the embodiment, the thiophosphate ester group is located at all of the above positions except the 3' end of the sense chain. It exists bonded to the following. In some embodiments, the thiophosphate ester group is as follows: It is attached to at least one of the locations. Between the first and second nucleotides from the 5' end of the sense strand, Between the second and third nucleotides from the 5' end of the sense strand, Between the first and second nucleotides from the 3' end of the sense strand, Between the second and third nucleotides from the 3' end of the sense strand, The first nucleotide and the second nucleotide from the 5' end of the aforementioned antisense strand Between, The second and third nucleotides from the 5' end of the aforementioned antisense strand Between, The first nucleotide and the second nucleotide from the 3' end of the aforementioned antisense strand between, and The second and third nucleotides from the 3' end of the aforementioned antisense strand Between.

[0157] In some embodiments, the siRNAs provided in this disclosure are shown in Tables 1a to 1f. The listed siPCSKa1-M1S, siPCSKa1-M2S, siPCSKa 1-M3S, siPCSKa2-M1S, siPCSKa2-M2S, siPCSKa2 -M3S, siPCSKb1-M1S, siPCSKb1-M2S, siPCSKb1- M3S, siPCSKb2-M1S, siPCSKb2-M2S, siPCSKb2-M 3S, siPCSKc1-M1S, siPCSKc1-M2S, siPCSKc1-M3 S, siPCSKc2-M1S, siPCSKc2-M2S, siPCSKc2-M3S , siPCSKd1-M1S, siPCSKd1-M2S, siPCSKd1-M3S, siPCSKd2-M1S, siPCSKd2-M2S, siPCSKd2-M3S, s iPCSKe1-M1S, siPCSKe1-M2S, siPCSKe1-M3S, si PCSKe2-M1S, siPCSKe2-M2S, siPCSKe2-M3S, siP CSKf1-M1S, siPCSKf1-M2S, siPCSKf1-M3S, siPC Either SKf2-M1S, siPCSKf2-M2S, or siPCSKf2-M3S There is one.

[0158] In some embodiments, the 5' terminal nucleoty of the antisense strand of the siRNA The nucleotide is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide.

[0159] The conventional 5'-phosphate nucleotide or 5'-phosphate analog modified nucleotide is, It is known to those skilled in the art that, for example, a 5'-phosphate nucleotide may have the following structure. .

[0160] [ka]

[0161] Also, for example, Anastasia Khvorova and Jonathan K. Watts,The chemical evolution of oligo nucleotide therapies of clinical utility . Nature Biotechnology,2017,35(3): 238~4 Section 8 discloses the following four types of 5'-phosphate analog modified nucleotides.

[0162] [ka] In the formula, R is selected from H, OH, methoxy, and fluorine, Base represents a base, and A and U represent bases. Selected from C, G, or T.

[0163] In some embodiments, the 5'-phosphate nucleotide is represented by formula (2), 5 A nucleotide containing '-phosphate, and a 5'-phosphate analog modified nucleotide is given by formula ( 3) Vinyl phosphate ester (5'-(E)-vinylphosphona A nucleotide containing the te, E-VP) modification, or a thioline as shown in formula (5). These are acid ester-modified nucleotides.

[0164] In some embodiments, the siRNAs provided in this disclosure are shown in Tables 1a to 1f. The listed siPCSKa1-M1P1, siPCSKa1-M2P1, siPCS Ka1-M3P1, siPCSKa2-M1P1, siPCSKa2-M2P1, siP CSKa2-M3P1、siPCSKb1-M1P1、siPCSKb1-M2P1、s iPCSKb1-M3P1、siPCSKb2-M1P1、siPCSKb2-M2P1 、siPCSKb2-M3P1、siPCSKc1-M1P1、siPCSKc1-M2 P1、siPCSKc1-M3P1、siPCSKc2-M1P1、siPCSKc2- M2P1、siPCSKc2-M3P1、siPCSKd1-M1P1、siPCSKd 1-M2P1、siPCSKd1-M3P1、siPCSKd2-M1P1、siPCS Kd2-M2P1、siPCSKd2-M3P1、siPCSKe1-M1P1、siP CSKe1-M2P1、siPCSKe1-M3P1、siPCSKe2-M1P1、s iPCSKe2-M2P1、siPCSKe2-M3P1、siPCSKf1-M1P1 、siPCSKf1-M2P1、siPCSKf1-M3P1、siPCSKf2-M1 P1、siPCSKf2-M2P1、siPCSKf2-M3P1、siPCSKa1- M1SP1、siPCSKa1-M2SP1、siPCSKa1-M3SP1、siPC SKa2-M1SP1、siPCSKa2-M2SP1、siPCSKa2-M3SP1 、siPCSKb1-M1SP1、siPCSKb1-M2SP1、siPCSKb1- M3SP1、siPCSKb2-M1SP1、siPCSKb2-M2SP1、siPC SKb2-M3SP1、siPCSKc1-M1SP1、siPCSKc1-M2SP1 、siPCSKc1-M3SP1、siPCSKc2-M1SP1、siPCSKc2- M2SP1、siPCSKc2-M3SP1、siPCSKd1-M1SP1、siPC SKd1-M2SP1、siPCSKd1-M3SP1、siPCSKd2-M1SP1 , siPCSKd2-M2SP1, siPCSKd2-M3SP1, siPCSKe1- M1SP1, siPCSKe1-M2SP1, siPCSKe1-M3SP1, siPC SKe2-M1SP1, siPCSKe2-M2SP1, siPCSKe2-M3SP1 , siPCSKf1-M1SP1, siPCSKf1-M2SP1, siPCSKf1- M3SP1, siPCSKf2-M1SP1, siPCSKf2-M2SP1, siPC It is one of the following: SKf2-M3SP1.

[0165] <The 7th siRNA> According to this disclosure, the siRNA may be a seventh siRNA.

[0166] The seventh siRNA comprises a sense strand and an antisense strand, and each of the seventh siRNA Each nucleotide is independently modified or unmodified, and the sense strand is The nucleotide sequence I is included, the antisense strand includes the nucleotide sequence II, and the nucleotide sequence Cleotide sequence I and nucleotide sequence II are double-stranded in a reverse complementary manner, at least in part. A region is formed, and the nucleotide sequence I and the nucleotide sequence shown in Sequence ID No. 399 It has the same length, a nucleotide difference of 3 or less, and is paired with the nucleotide sequence II. The nucleotide sequence shown in column number 400 is of equal length and has three nucleotide differences. The following applies: 5'-AGACCUGUUUUGCUUUUGZ 25 -3'(Sequence ID 399), 5'-Z 26 CAAAAGCAAAACAGGUCU-3' (Sequence ID 400) However, Z 25 is U, Z 26is A, and in the nucleotide sequence I, position Z 25 Nucleotide Z corresponding to 27 It includes, and the nucleotide sequence II has position Z2 Nucleotide Z corresponding to 6 28 The above Z 28 This is the 5' end of the antisense chain. It is the first nucleotide at the end.

[0167] In some embodiments, the sense strand comprises only nucleotide sequence I, and The antisense strand contains only nucleotide sequence II.

[0168] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 399 are used. The nucleotide difference between the cleotide sequence and / or the nucleotide sequence is one or less, and / or the nucleotide sequence There is a nucleotide difference of 1 between sequence II and the nucleotide sequence shown in sequence number 400. It is one or less.

[0169] In some embodiments, the nucleotide sequence II and the sequence number 400 are shown The nucleotide difference between the nucleotide sequence and the nucleotide sequence is Z 28 Including the difference in position, Z 28 but Selected from G, U, or C. In some embodiments, the nucleotide difference is Z 28 This is the difference at the position of Z 28 is selected from G, U, or C. Several implementation forms In state, Z 27 is, Z 28 It is a complementary nucleotide.

[0170] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 399 are used. The nucleotide difference between the creotide sequence and the nucleotide sequence is the 9th nucleotide from the 5' end of nucleotide sequence I. This includes the difference in nucleotide Z, where Z is dT.

[0171] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 399 are used. The nucleotide difference between the creotide sequence and the other sequence is Z 27 Including the difference in position, Z 27 is A Selected from G or C.

[0172] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 399 are used. The cleotide sequence has two nucleotide differences, and the nucleotide sequence I and the nucleotide Cleotide sequence II is completely inversely complementary, and the difference between the two nucleotides is Z and Z2. This is the difference at position 7, where Z is dT, and Z 27 This is selected from A, G, or C.

[0173] siRNAs with the above nucleotide differences exhibit high siRNA-mediated suppression of target mRNA. siRNAs that possess these capabilities, including those containing these nucleotide differences, are also within the scope of protection of this disclosure. .

[0174] In some embodiments, nucleotide sequence I is the nucleotide shown in SEQ ID NO: 401 The rheotide sequence is the nucleotide sequence II shown in Sequence ID No. 402. It is an array. 5'-AGACCUGUdTUUGCUUUUGZ 27 -3'(Sequence ID 401), 5'-Z 28 CAAAAGCAAAACAGGUCU-3' (Sequence ID 402) However, dT is thymine deoxyribonucleotide, and the aforementioned Z 28 is anti-sensing It is the first nucleotide at the 5' end of the chain, Z 27The following can be selected from A, U, G, or C. Re, Z 28 is, Z 27 It is a complementary nucleotide, and in some embodiments, Z 27 is U, Z 28 It is A.

[0175] In some embodiments, the seventh siRNA is used to obtain the siRNA. The nucleotide chain comprises the nucleotide sequence shown in Sequence ID No. 403, and the antisense chain is It contains the nucleotide sequence shown in column number 404. 5'-AGACCUGUdTUUGCUUUUGZ 27 -3'(Sequence ID 403), 5'-Z 28 CAAAAGCAAAACAGGUCUAG-3' (Sequence ID 404)

[0176] Alternatively, the sense strand of the siRNA may have the nucleotide sequence shown in SEQ ID NO: 405 The antisense strand includes the nucleotide sequence shown in SEQ ID NO: 406. 5'-CUAGACCUGUdTUUGCUUUUGZ 27 -3'(Sequence ID 405) , 5'-Z 28 CAAAAGCAAAACAGGUCUAGAA-3'(Sequence No. 406) )

[0177] In some embodiments, the siRNAs described herein are as listed in Table 1g. It is either siPCSKg3 or siPCSKg4.

[0178] In some embodiments, the above Z and / or Z 27 There is a nucleotide difference at the position In siRNA, at least some of the nucleotides are modified nucleotides, and the modified The decorative nucleotides are either fluoromodified or non-fluoromodified nucleotides. The aforementioned fluoromodified nucleotide is located in nucleotide sequence I and nucleotide sequence II. , from the 5' end toward the 3' end, at least the second and sixth nucleotide sequences of the aforementioned nucleotide sequence II, The nucleotides at positions 14 and 16 are fluoromodified nucleotides.

[0179] In some embodiments, the siRNAs provided herein are listed in Table 1g. The following are available: siPCSKg3-M4, siPCSKg4-M5, siPCSKg3-M4S , siPCSKg4-M5S, siPCSKg3-M4P1, siPCSKg4-M5P 1. Use either siPCSKg3-M4SP1 or siPCSKg4-M5SP1. be.

[0180] The inventors of this disclosure demonstrate the plasma and lysosomal stability of the siRNA provided herein. Not only has it significantly improved, but we also unexpectedly discovered that it exhibits high target mRNA suppression activity.

[0181] The siRNAs provided in this disclosure are prepared using conventional siRNA preparation methods in the art (e.g., For example, it can be obtained by a solid-phase synthesis method and a liquid-phase synthesis method. Here, solid-phase synthesis is A commercial customization service is already available. Nucleosids with corresponding modifiers. By using a mer, modified nucleotide groups are introduced into the siRNA described herein. A method for preparing nucleoside monomers having the corresponding modifications, and modified nucleos Methods for introducing a rheotide group into siRNA are also well known to those skilled in the art.

[0182] <Drug composition> This disclosure relates to a drug comprising the above-mentioned siRNA as an active ingredient and a pharmaceutically acceptable carrier. A composition is provided.

[0183] Even if the pharmaceutically acceptable carrier is a carrier commonly used in the field of siRNA administration, Often, for example, magnetic nanoparticles, for example (nanoparticles based on Fe3O4 or Fe2O3), carbon nanotubes (carbon nanotubes, mesoporous silicon n), calcium phosphate nanoparticles Polyethylenes (PEI) , polyamidoamine dendrimer (PAMAM) d endrimer, polylysine (poly(L-lysine, PLL), chitosan) (chitosan), 1,2-dioleoyl-3-trimethylammonium propane ( 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly-D- or L-lactic acid / glycolic acid copolymer (poly(D&L-l Actic / glycolic acid copolymer, PLGA, poly(a) (poly(2-aminoethyl ethylene phosphate ester)) lene phosphate), PPEEA), and poly(N,N-dimethylaminoethyl) (poly(2-dimethylaminoethyl methacrylate)) This includes acrylate, PDMAEMA, and one or more derivatives thereof. These are not the only options.

[0184] With respect to the content of siRNA and pharmaceutically acceptable carrier in the aforementioned drug composition, There is no requirement for this, but the usual content of each component may be acceptable. In some embodiments, The weight ratio of siRNA to a pharmaceutically acceptable carrier may be 1:(1-500). In some embodiments, the above weight ratio is 1:(1~50).

[0185] In some embodiments, the drug composition contains other pharmaceutically acceptable additives. It may be included, and the additive is one of the various formulations or compounds commonly used in this field. There may be multiple types. For example, the other pharmaceutically acceptable additives may be a pH buffer, It may contain at least one of a protective agent and an osmotic pressure regulator.

[0186] The aforementioned pH buffer is trishydroxymethylaminomethane hydrochloride with a pH of 7.5 to 8.5. Buffer solution (tris(hydroxymethyl) aminomethane hyd rochloride buffer and / or phosphate buffer with a pH of 5.5 to 8.5 It may also be a phosphate buffer solution with a pH of 5.5 to 8.5.

[0187] The aforementioned protective agents are inositol, sorbitol, sucrose, trehalose, and mannose. The drug combination may be at least one of maltose, lactose, and glucose. Based on the total weight of the product, the content of the protective agent may be 0.01 to 30% by weight.

[0188] The osmotic pressure regulator may be sodium chloride and / or potassium chloride. The content of the osmotic pressure regulator is such that the osmotic pressure of the drug composition is 200 to 700 milliosmoles / kilogram. It is determined to be ram (mOsm / kg). With the desired osmotic pressure, a person skilled in the art will know the above The content of the osmotic pressure regulator can be easily determined.

[0189] In some embodiments, the drug composition may be a liquid formulation such as an injection solution. Alternatively, it may be prepared as a lyophilized powder injection, mixed with a liquid additive at the time of administration, to form a liquid formulation. The liquid formulation described above can be administered by subcutaneous, intramuscular, or intravenous injection, but is not limited to these methods. It is administered to the lungs by spraying, or to other organs and tissues (e.g., the liver) through the lungs by spraying. It can also be administered to, but is not limited to, the following embodiments. The drug composition is used for intravenous administration.

[0190] In some embodiments, the drug composition may be in the form of a liposomal formulation. i. In some embodiments, pharmaceutically acceptable substances used in the liposome formulation The carrier is an amine-containing transfection compound (hereinafter also called an organic amine), and an auxiliary lipid. Contains organic amines and / or PEGylated (PEGylated) lipids. Herein, the organic amines, auxiliary lipids and PEGylated lipids are incorporated herein by reference in their entirety by CN103380113A. ) an amine-containing transfection compound or a pharmaceutically acceptable salt thereof as described above. This may be one or more types selected from derivatives, auxiliary lipids, and PEGylated lipids, respectively. good.

[0191] In some embodiments, the organic amine is as described in CN103380113A. The compound shown in formula (201) or a pharmaceutically acceptable salt thereof may be used.

[0192] [ka] During the ceremony, each X 101 or X 102 Each of these is independently O, S, NA, or CA, where A is water. Prime or C1-C 20 It is a hydrocarbon chain, Each Y 101 or Z 101 Each of these is independently C=O, C=S, S=O, CH-OH or It is SO2, Each R 101 , R 102 , R 103 , R 104 , R 105 , R 106 or R 107 That Each independently consists of hydrogen, a cyclic or acyclic, substituted or unsubstituted, branched or linear aliphatic group, and a ring. Formula or acyclic, substituted or unsubstituted, branched or linear heteroaliphatic groups, substituted or unsubstituted , branched or linear acyl group, substituted or unsubstituted, branched or linear aryl group, substituted or unsubstituted A substituted, branched or linear heteroaryl group, x is an integer from 1 to 10, n is an integer between 1 and 3, m is an integer between 0 and 20, and p is either 0 or 1, where, If m=p=0, then R 102 It is hydrogen, If at least one of n or m is 2, then R 103 And nitrogen in equation (201) , forming a structure shown in formula (202) or formula (203).

[0193] [ka] In the formula, g, e, or f are each an integer from 1 to 6, and "HCC" represents a hydrocarbon chain. Each represents * N represents the nitrogen atom in equation (201).

[0194] In some embodiments, R 103 is a polyamine. In other embodiments, R 103 is a ketal. In some embodiments, R in formula (201) 10 1 and R 102 Each of these can be independently and optionally substituted or unsubstituted, branched or linear aluminum chains. The alkyl or alkenyl is a alkyl or alkenyl having 3 to about 20 carbon atoms. For example, 8 to about 18 carbon atoms and 0 to 4 double bonds, for example, 0 to 2 double bonds They have a common characteristic.

[0195] In some embodiments, when n and m are independently a value of 1 or 3, R 103 This may be any one of the following equations (204) to (213).

[0196] [ka]

[0197] In equations (204) to (213), g, e, and f are each independent integers from 1 to 6. Each "HCC" represents a hydrocarbon chain, and each * is R 103 and nitrogen in equation (201) It shows the bonding points with atoms, and any * Each H at position corresponds to the nitrogen atom in equation (201) and It may be substituted for joining purposes.

[0198] The compound shown in formula (201) is prepared according to the description in CN103380113A. That's good too.

[0199] In some embodiments, the organic amine is an organic amine represented by formula (214). and / or an organic amine represented by formula (215).

[0200] [ka]

[0201] The aforementioned supplementary lipids are cholesterol, cholesterol analogs and / or cholesterol It is a derivative of , The PEGylated lipid is 1,2-dipalmitamide-sn-glycero-3-phosphatidi Ethanolamine-N-[methoxy(polyethylene glycol)]-2000(1,2 -dipalmitoyl-sn-glycero-3-phosphatidylet hanolamine-N-[methoxy(polyethylene glyco (l)-2000)

[0202] In some embodiments, the drug composition includes the organic amine and the auxiliary lipid. The molar ratio of the PEGylated lipids is (19.7~80):(19.7~80):(0.3~ 50) and for example, (50~70):(20~40):(3~20) may also be the case. .

[0203] In some embodiments, the siRNA of the present disclosure and the amine-containing transfects The drug composition particles formed by the reagent have an average diameter of approximately 30 nm to approximately 200 nm. Generally, the wavelength is approximately 40 nm to 135 nm, and more generally, the average of the liposome particles. The diameter is approximately 50nm to 120nm, 50nm to 100nm, and 60nm to 90nm. The wavelength is approximately 70 nm to 90 nm, and for example, the average diameter of the liposome particles is approximately 30,4 0, 50, 60, 70, 75, 80, 85, 90, 100, 110, 120, 130, 1 The wavelength is 40, 150, or 160 nm.

[0204] In some embodiments, the siRNA of the present disclosure and the amine-containing transfects In a drug composition formed by a reagent, siRNA and total lipids (e.g., organic amines) The weight ratio (weight / weight ratio) of the supplementary lipids and / or PEGylated lipids is approximately 1:1 to 1:5 0, approximately 1:1~1:30, approximately 1:3~1:20, approximately 1:4~1:18, approximately 1:5~ Approximately 1:17, approximately 1:5 to approximately 1:15, approximately 1:5 to approximately 1:12, approximately 1:6 to approximately 1:12 or The ratio is within the range of approximately 1:6 to approximately 1:10, for example, the weight ratio of siRNA to total lipids in this disclosure is Approximately 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13 , 1:14, 1:15, 1:16, 1:17, or 1:18.

[0205] In some embodiments, the drug composition is such that each component exists independently at the time of market release. In some embodiments, this disclosure may exist as a liquid formulation at the time of use. Drug composition formed from siRNA provided by and the above-mentioned pharmaceutically acceptable carrier. These may be prepared according to various known methods, and instead of conventional siRNA, the present disclosure The provided siRNA can be used. In some embodiments, the following method is used. It may be prepared in a different way.

[0206] The organic amine, auxiliary lipid, and PEGylated lipid are suspended in alcohol in the above molar ratio and mixed uniformly. Combine to obtain a lipid solution. The amount of alcohol is such that the total mass concentration of the obtained lipid solution is 2-25 The concentration is determined to be mg / mL, for example, 8-18 mg / mL. The alcohol is Pharmaceutically acceptable alcohols, such as ethanol, propylene glycol, and benzyl Alcohol, glycerin, polyethylene glycol 200, polyethylene glycol 30 Selected from alcohols that are liquid at around room temperature, such as polyethylene glycol 400. It may be one or more types, for example, ethanol.

[0207] The siRNA provided in this disclosure is dissolved in a buffer salt solution to obtain an aqueous siRNA solution. The concentration of the buffer salt solution is 0.05 to 0.5 M, but it may also be, for example, 0.1 to 0.2 M. Adjust the pH of the buffer salt solution to 4.0-5.5, or for example, 5.0-5.2. The amount of buffer salt solution should be such that the siRNA concentration is 0.6 mg / mL or less, for example, 0.2~ The concentration is determined to be 0.4 mg / mL. The buffer salt is soluble acetate, soluble citrate One or more salts selected from salts, for example, sodium acetate and / or potassium acetate. It's fine if it's "um".

[0208] After mixing the lipid solution and the aqueous siRNA solution, the resulting product was heated at 40-60°C to a minimum temperature. Also, culture for 2 minutes, for example, 5 to 30 minutes to obtain the cultured liposome formulation. Lipid solution and s The volume ratio of iRNA aqueous solutions is 1:(2~5).

[0209] The cultured liposome formulation is concentrated or diluted, impurities are removed, and sterilization is performed according to the present disclosure. The drug composition to be supplied is obtained. Its physicochemical parameters include a pH of 6.5 to 8. Yes, it has an encapsulation efficiency of 80% or more, a particle size of 40-200 nm, and a polydispersity index of 0. It is less than 0.30, and the osmotic pressure is 250-400 mOsm / kg, for example, physicochemical As parameters, the pH is 7.2 to 7.6, the encapsulation efficiency is 90% or more, the particle size is 60 to 100 nm, the polydispersity index is 0.20 or less, and the osmotic pressure is 300 to 400 mOsm / kg, which may be acceptable.

[0210] Here, concentration or dilution may be performed before removing impurities, after removing impurities, or simultaneously. As a method for removing impurities, various conventional methods may be employed. For example, using a tangential flow system and a hollow fiber column, ultrafiltration is performed under the condition of 100 KDa, and the ultrafiltration exchange solution may be a phosphate buffer (PBS) with a pH of 7.4. As a sterilization method, various conventional methods may be employed. For example, it may be sterilized by filtration with a 0.22 μm filter.

[0211] <siRNA complex> The present disclosure provides an siRNA complex including the above siRNA and a complex group that is complexed and bound to the siRNA.

[0212] Generally, the complex group includes at least one target group that is pharmaceutically acceptable and an optional linker, and the siRNA, the linker, and the target group are bound in sequence. In some embodiments, the number of the target groups is 1 to 6. In some embodiments, the number of the target groups is 2 to 4. The siRNA molecule may be complexed to the complex group non-covalently or covalently. For example, it may be covalently complexed to the complex group. The complex site between the siRNA and the complex group may be at the 3' end or 5' end of the sense strand of the siRNA, may be at the 5' end of the antisense strand, or may be in the internal sequence of the siRNA. In some embodiments, the complex site between the siRNA and the complex group ​ It is located at the 3' end of the sense strand of siRNA.

[0213] In some embodiments, the complex group is the phosphate group of the nucleotide, the 2'-position nucleotide It may be bonded to a droxy group or a base. In some embodiments, the composite group is It may also be bonded to the hydroxyl group at the 3' position, in which case the nucleotide-nucleotide bond is 2'-5'. They are linked by nitrate diester bonds. The complex group is attached to the end of the siRNA chain. In this case, it is usually bound to the phosphate group of a nucleotide and to the internal sequence of siRNA. They are usually bonded to a ribose sugar ring or a base. For various bonding methods, see Muthia. h Manoharan et.al. siRNA conjugates carr ying sequentially assembled trivalent N- acetylgalactosamine linked through nucleus osides elicit robust gene silencing in v ivo in hepatocytes. ACS Chemical biology See 2015, 10 (5): 1181~7.

[0214] In some embodiments, the relationship between the siRNA and the complex group is acid-unstable or reducible. They may be bound by chemical bonds, and in the acidic environment of cell endosomes, these chemical bonds The compound is broken down, and the siRNA can be released. The complex group is bound to the sense strand of the siRNA, and the complex has an effect on siRNA activity. It can be reduced as much as possible.

[0215] In some embodiments, the pharmaceutically acceptable target group is the siRNA administration field. Ligands commonly used in this, for example, the various types described in WO2009082607A2 It may also be a ligand, and its disclosure as a whole is incorporated herein by reference. .

[0216] In some embodiments, the pharmaceutically acceptable target group is cholesterol, bile duct. Lipophilic molecules such as juice acids, vitamins (e.g., tocopherol), and lipid molecules with different chain lengths, Polymers such as polyethylene glycol, polypeptides such as membrane-permeable peptides, and apters Mer, antibodies, quantum dots, lactose, polylactose, mannose, galactose Sugars such as N-acetylgalactosamine (GalNAc) and folic acid (folate) , asialoglycoprotein, asialoglycoprotein residue, lipoprotein (e.g., high-density lipoprotein) (e.g., low-density lipoproteins), glucagon, neurotransmitters (e.g., adrenaline), growth Factors, target molecules such as receptor ligands expressed in hepatocytes such as transferrin, or their It may be one or more ligands selected from those formed by the derivatives.

[0217] In some embodiments, each ligand is a ligand that can bind to a receptor on the cell surface. Selected independently from the ligand. In some embodiments, at least one ligand It is a ligand that can bind to receptors on the surface of hepatocytes. In some embodiments, At least one ligand is a ligand that can bind to receptors on the surface of mammalian liver cells. In some embodiments, at least one ligand is a receptor on the surface of human hepatocytes. It is a ligand that can bind to. In some embodiments, at least one ligand It is a ligand that can bind to the asialoglycoprotein receptor (ASGPR) on the surface of the liver. The types of these ligands are known to those skilled in the art, and their action is generally to target the surface of cells. It binds to specific receptors on the surface and mediates the delivery of ligand-bound siRNA to target cells. do.

[0218] In some embodiments, the pharmaceutically acceptable target group is the surface of mammalian hepatocytes. One of the ligans that binds to the asialocryprotein receptor (ASGPR) on the surface It may also be a compound. In some embodiments, each ligand is independently an asialocactose compound. Proteins, for example, asialoorosomucoid (A) It is either SOR or asialofetuin (ASF). In several embodiments, the ligand is a sugar or a derivative of a sugar.

[0219] In some embodiments, at least one ligand is a sugar. Morphologically, each ligand is a sugar. In some embodiments, at least Another ligand is a monosaccharide, polysaccharide, modified monosaccharide, modified polysaccharide, or sugar derivative. In the embodiment, at least one of the ligands may be a monosaccharide, disaccharide, or trisaccharide. In some embodiments, at least one ligand is a modified sugar. In this embodiment, each ligand is a modified sugar. Each ligand is independently a polysaccharide, modified polysaccharide, monosaccharide, modified monosaccharide, polysaccharide derivative or Selected from monosaccharide derivatives. In some embodiments, each or a few of the ligands At least one of them is glucose and its derivatives, mannan and its derivatives, galactose and Its derivatives, xylose and its derivatives, ribose and its derivatives, fucose and its derivatives Conductors, lactose and its derivatives, maltose and its derivatives, arabinose and its derivatives Selected from the group consisting of conductors, fructose and its derivatives, and sialic acid.

[0220] In some embodiments, each ligand is D-mannopyrano, L-mannopyrano Pyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D- Glucose, L-glucose, D-galactose, L-galactose, α-D-mannofura North, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyrano -α-D-glucopyranose, β-D-glucopyranose, α-D-glucofurano S, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyrano - α-D-galactopyranose, β-D-galactopyranose, α-D-galactof Lanose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N - Acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionine Lugalactosamine, Nn-butyrylgalactosamine, N-isobutyrylgalactosamine , 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-g Lucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-di Deoxy-4-formamido-2,3-di-O-methyl-D-mannopyrano, 2-de Oxy-2-sulfamino-D-glucopyranose, N-glycolyl-α-neuraminic acid , 5-thio-β-D-glucopyranose, methyl 2,3,4-tris-O-acetyl-1 -Thio-6-O-trityl-α-D-glucopyranoside, 4-Thio-β-D-galactopyranoside Lanose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-diethyl O-α-D-glucoheptopyranoside, 2,5-anhydro-D-alonitrile, ribo From D-ribose, D-4-thioribose, L-ribose, or L-4-thioribose They may be selected independently. Other alternative ligands include, for example, CN1053780 You may also refer to the description in 82A, which, by reference, incorporates the entirety of its disclosure into this Specified. Born.

[0221] In some embodiments, the pharmaceutically acceptable label in the siRNA complex The target group may be galactose or N-acetylgalactosamine, or galactose or The N-acetylgalactosamine molecule may be monovalent, divalent, trivalent, or tetravalent. The terms monovalent, divalent, trivalent, and tetravalent refer to the siRNA molecule and the galactose used as the target group, respectively. An siRNA complex formed from a complex group containing a molecule of or N-acetylgalactosamine The molar ratio of siRNA molecules to galactose or N-acetylgalactosamine molecules is It should be understood that this refers to a ratio of 1:1, 1:2, 1:3, or 1:4. In the application form, the pharmaceutically acceptable target group is N-acetylgalactosamine. In some embodiments, the siRNA described herein is N-acetylgalactosa When compounded with a complex group containing mine, the N-acetylgalactosamine molecule is trivalent or tetravalent. In some embodiments, the siRNA described herein is N-acetylgalactam When combined with a complex group containing tosamine, the N-acetylgalactosamine molecule is trivalent.

[0222] The target group may be bound to the siRNA molecule via a suitable linker, and those skilled in the art will know The appropriate linker can be selected depending on the specific type of target substrate. These linkers, For information on the types of target groups and methods of binding to siRNA, please refer to WO2015006740A2. You may refer to the disclosed content, which will be incorporated into this specification in whole by citation.

[0223] In some embodiments, when the target group is N-acetylgalactosamine, A suitable linker may have the structure shown in formula (301).

[0224] [ka] During the ceremony, k is an integer between 1 and 3. L A This is a chain-like portion containing an amide bond having the structure shown in formula (302), and each of the above L A It has one target group at each end and the L C Bonded to the part by ether bond It will be done.

[0225] [ka]

[0226] L B This is a chain portion containing N-acylpyrrolidine having the structure shown in formula (303). Furthermore, the chain portion has a carbonyl group at one end, and the L C The parts are bonded by amide bonds. It has an oxygen group at the other end and is bonded to the siRNA by a phosphate ester bond.

[0227] [ka]

[0228] L C This refers to hydroxymethylaminomethane, dihydroxymethylaminomethane, or trihydroxymethylaminomethane. A divalent to tetravalent linker group based on droxymethylaminomethane, and the L C is an oxygen source Each of the Ls is bonded via ether through the child. A It is bonded to the part, and via nitrogen atoms, The L B It is joined to the part.

[0229] In some embodiments, n=3, L C is trihydroxymethylaminometh If it is a tetravalent linker group based on , then the linker is -(L A )3-trihydroxy Methylaminomethane-L B - This allows N-acetylgalactosamine molecules and siRNA molecules to The structure of the siRNA complex formed by binding is shown in formula (304) below.

[0230] [ka] In the formula, the double helix structure represents siRNA.

[0231] Similarly, the complex site between siRNA and the complex group is the 3' or 5' end of the sense strand of siRNA. It may be at the end, or at the 5' end of the antisense strand, or within the internal sequence of the siRNA. That's fine.

[0232] In some embodiments, the 3' end of the sense strand of the siRNA described herein is Linker-(L A)3-trihydroxymethylaminomethane-L B - three N-A It is covalently bound to the cetylgalactosamine (GalNAc) molecule and to the siRNA molecule. The structure of the si molecule with a molar ratio of 1:3 to the GalNAc molecule is shown in the following formula (305). An RNA complex (hereinafter also referred to as (GalNAc)3-siRNA) is obtained.

[0233] [ka] In the formula, the double helix structure represents the siRNA, and the linker represents the sense of the siRNA. It is attached to the 3' end of the chain.

[0234] In some embodiments, when the target group is N-acetylgalactosamine, A suitable linker may have the structure shown in formula (306).

[0235] [ka] During the ceremony, l is an integer between 0 and 3. * This represents the site in the linker that is bonded to the target group by an ether bond. # This represents the site in the linker that binds to siRNA via a phosphate ester bond. .

[0236] In some embodiments, when l=2, the siRNA complex is given by formula (30 It has the structure shown in 7).

[0237] [ka] In the formula, the double helix structure represents the siRNA, and the linker represents the sense of the siRNA. It is attached to the 3' end of the chain.

[0238] The above-mentioned composite may be synthesized by methods already described in detail in the prior art. For example, WO2015006740A2 describes in detail the preparation methods for multiple types of complexes. The siRNA complex of this disclosure is obtained by a method well known to those skilled in the art. For example, WO2014025805A1 describes the method for preparing the structure shown in formula (305). It is published in ChemBioChem 2015, 16, 903- Section 908 describes the method for preparing the structure shown in formula (307).

[0239] In some embodiments, the siRNA complex has a structure shown in formula (308). It holds.

[0240] [ka] During the ceremony, n1 is an integer selected from 1 to 3, and n3 is an integer selected from 0 to 4. , Each of m1, m2, or m3 is an integer selected independently from 2 to 10. R 10 , R 11 , R 12 , R 13 , R 14 or R 15 Each of them is independently H. , or C1-C 10 Alkyl alkyl group, C1-C 10 Alkyl halogens and C1-C 10 a Selected from the group consisting of lucoxy groups, R3 is the base of the structure shown in formula A59.

[0241] [ka] In the formula, E1 is OH, SH, or BH2, and Nu is the siRNA of the present disclosure.

[0242] R2 is a linear alkylene group of carbon atoms with a length of 1 to 20, and one or more of these are... Carbon atoms are C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenile group, C2-C 10 Alkynylene group, C6-C 10 Arylene group, C3-C 18 Heterozy Cryylene group and C5-C 10 One or more selected from the group consisting of heteroarylene groups It can be arbitrarily substituted, and R2 is C1-C 10 Alkyl alkyl group, C6-C 10 Aryl group, C5-C 10 Heteroaryl group, C1-C 10 Alkyl halogens, -OC1-C 10 Alkyl group, -OC1-C 10 Alkylphenyl group, -C1-C 10 alkyl-OH, -OC1- C 10 Alkyl halogens, -SC1-C 10 Alkyl, -SC1-C 10 Alkyl Phenyl group, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated alkyl groups, Halogen substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2, -N( C1-C 10 (Alkyl group)(C1-C 10 Alkyl(alkyl group), -NH(C1-C 10 Alkyl Base), N(C1-C 10 (Alkyl group)(C1-C 10 Alkylphenyl group), NH(C1 -C 10Alkylphenyl group), cyano group, nitro group, -CO2H, -C(O)O(C1 -C 10 Alkyl(C1-C) 10 (Alkyl group)(C1-C 10 alkyl group ), -CONH(C1-C 10 Alkyl(alkyl group), -CONH2, -NHC(O)(C1-C 10 Alkyl group), -NHC(O)(phenyl group), -N(C1-C 10 (Alkyl group) C (O)(C1-C 10 Alkyl(C1-C) 10 Alkyl(C)(O)(Pheny ), -C(O)C1-C 10 Alkyl group, -C(O)C1-C 10 Alkylphenyl Base, -C(O)C1-C 10 Haloalkyl group, -OC(O)C1-C 10 alkyl group, - SO2(C1-C 10 Alkyl group), -SO2 (phenyl group), -SO2 (C1-C 10 (Halogenated alkyl group), -SO2NH2, -SO2NH(C1-C 10 (Alkyl alkyl group), -SO2NH (phenyl group), -NHSO2 (C1-C 10 Alkyl(alkyl group), -NHSO2 (phenyl group) and -NHSO2(C1-C 10 The group consisting of halogenated alkyl groups It may optionally have one or more substituents. Each L1 is independently a linear alkylene group of carbon atoms with a length of 1 to 70, and one of them Or multiple carbon atoms, C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenylene group, C2-C 10 Alkynylene group, C6-C 10 Arylene group, C3-C1 8 heterocyclylene group and C5-C 10 Selected from the group consisting of heteroarylene groups Alternatively, it can be replaced with any number of other elements, and L1 is C1-C 10 Alkyl alkyl group, C6-C 10 aryl group , C5-C 10 Heteroaryl group, C1-C 10 Alkyl halogens, -OC1-C1 0 alkyl group, -OC1-C 10 Alkylphenyl group, -C1-C 10 alkyl-OH, -OC1-C 10 Alkyl halogens, -SC1-C 10 Alkyl, -SC1-C1 0 alkylphenyl group, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated Lukyl group, halogen substituent, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH 2, -N(C1-C 10 (Alkyl group)(C1-C 10 Alkyl(alkyl group), -NH(C1-C1 0 alkyl group), N(C1-C 10 (Alkyl group)(C1-C 10 (Alkylphenyl group), NH(C1-C 10 Alkylphenyl group, cyano group, nitro group, -CO2H, -C(O )O(C1-C 10 Alkyl(C1-C) 10 (Alkyl group)(C1-C 10 Alkyl(C1-C) 10 Alkyl(alkyl group), -CONH2, -NHC(O) (C1-C 10 Alkyl group), -NHC(O)(phenyl group), -N(C1-C 10 Al Kill group)C(O)(C1-C 10 Alkyl(C1-C) 10Alkyl(C)(O )(phenyl group), -C(O)C1-C 10 Alkyl group, -C(O)C1-C 10 Alki phenyl group, -C(O)C1-C 10 Haloalkyl group, -OC(O)C1-C 10 Al Kill group, -SO2(C1-C 10 Alkyl group), -SO2 (phenyl group), -SO2 (C 1-C 10 (Halogenated alkyl group), -SO2NH2, -SO2NH(C1-C 10 Al (Cyl group), -SO2NH (phenyl group), -NHSO2 (C1-C 10 (Alkyl alkyl group), - NHSO2 (phenyl group) and -NHSO2 (C1-C 10 (from halogenated alkyl group) It may optionally have one or more substituents from the group.

[0243] In some embodiments, L1 is made up of a base of A1 to A26 or any combination thereof. The groups may be selected from the following, and the structures and definitions of A1 to A26 are as follows.

[0244] [ka] In the formula, each j1 is an independent integer between 1 and 20, and each j2 is an independent integer between 1 and 20. the law of nature, Each R' is independently C1-C 10 It is an alkyl group, Each Ra is independently derived from the groups shown in formulas (A27) to (A45) or any combination thereof. It is selected from the following group.

[0245] [ka] Each Rb independently corresponds to C1-C 10 It is an alkyl group, JPEG0007883784000026.jpg6170 represents the site where groups are covalently bonded.

[0246] For convenience, L1 is defined as a linear alkylene group, but for example, the above substitution and / or The amine or alkenyl groups resulting from substitution may not be linear groups, or they may have different names. It will be understood by those skilled in the art that there are two lengths of L1. This is the number of atoms in the chain that connects the bond points. For this purpose, the carbon of the straight-chain alkylene A ring obtained by substituting elementary atoms (for example, heterocyclylene or heteroarylene) is 1 Let's consider them as individual atoms.

[0247] M1 represents the target group, and its definition and selectable range are the same as those for the target group described above. How many? In that embodiment, each M1 is an asial glycoprotein on the surface of mammalian hepatocytes. It is one of the ligands that is independently selected from those that have affinity for the receptor.

[0248] M1 has affinity for asialoglycoprotein receptors on the surface of mammalian hepatocytes. If it is a ligand, in some embodiments n1 is an integer from 1 to 3. n3 may also be an integer from 0 to 4, and the number of M1 target groups in the complex Ensure that it is at least 2. In some embodiments, n1+n3≧2 Therefore, the number of M1 target groups is at least 3, and the M1 target groups and the asiatica on the liver surface It allows the glycoprotein receptor to bind more easily, and furthermore, the complex undergoes endocytosis. It can be promoted to be taken up by cells through intracellular uptake. As shown above, if the number of M1 target groups is 3 or more, the M1 target groups and asialosaccharides on the liver surface Since the improvement in ease of binding to protein receptors is not clear, ease of synthesis, structure / Considering various factors such as process cost and delivery efficiency, in several embodiments... There, n1 is an integer between 1 and 2, n3 is an integer between 0 and 1, and n1 + n3 = 2. The answer is 3.

[0249] In some embodiments, each m1, m2, or m3 is independently 2 to 10 When selected from integers, the spatial position between multiple M1 target groups is determined by the asia between the M1 target group and the liver surface. It can be adapted to binding to glycoprotein receptors. To simplify RNA complexes, make them easier to synthesize, and / or reduce their cost. In some embodiments, each m1, m2, or m3 is independently 2 to 5 These are numbers, and in some embodiments, m1=m2=m3.

[0250] R 10 , R 11 , R 12 , R 13 , R 14 or R 15 However, H, C1-C 10 alkyl group , C1-C 10 Alkyl halogens and C1-C 10 Each alkoxy group is independent If one is selected, neither alters the properties of the siRNA complex of this disclosure. Those skilled in the art will understand that the objectives of this disclosure can be achieved in any way. In this embodiment, R 10 , R 11 , R 12 , R 13 , R 14 or R 15 These are, Independently selected from H, a methyl group, or an ethyl group. In some embodiments, R1 0, R 11 , R 12 , R 13 , R 14 and R 15 All of these are H.

[0251] R3 is the base of the structure shown in formula A59, where E1 is OH, SH, or BH2. In some embodiments, considering the availability of the raw materials for preparation, E1 is OH or It is SH.

[0252] R2 is selected to enable bonding between the N atom on the nitrogen-containing skeleton and A59. In the context of the above, "nitrogen-containing skeleton" means R 10 , R 11 , R 12 , R 13 , R 14 Reach biR 15 This refers to a chain-like structure in which carbon atoms and N atoms are bonded to each other. R2 is capable of bonding the A59 group to the N atom on the nitrogen-containing skeleton in an appropriate manner. It may be any linker group. In some embodiments, by a solid-phase synthesis process When preparing the siRNA complex shown in formula (308), the R2 group contains a nitrogen-containing skeleton. It includes both the site that bonds to the N atom above and the site that bonds to the P atom in R3. It is necessary. In some embodiments, the N atoms on the nitrogen-containing skeleton in R2 The bonding site is the site that forms an amide bond with the N atom and bonds to the P atom on R3. R2 forms a phosphate ester bond with the P atom, and in some embodiments, R2 is B5 It may also be B6, B5', or B6'.

[0253] [ka] During the ceremony, JPEG0007883784000028.jpg6170 represents the site where groups are covalently bonded.

[0254] The range of the value of q2 may be an integer from 1 to 10, and in some embodiments, q 2 is an integer between 1 and 5.

[0255] L1 is bonded to the M1 target group and N on the nitrogen-containing skeleton, forming the siRN shown in formula (308). It plays a role in providing liver targeting function to the A complex. In some embodiments, L 1 is a combination of one or more bonds selected from the bases of formulas A1 to A26. In this embodiment, L1 is A1, A4, A5, A6, A8, A10, A11 and A13 It is a combination of one or more combinations selected from. In some embodiments, L1 is , in a combination of at least two joins selected from A1, A4, A8, A10 and A11 Yes. In some embodiments, L1 is selected from A1, A8, A10. Both are combinations of two bonds.

[0256] In some embodiments, the length of L1 is 3 to 25 atoms, 3 to 20 atoms, The number of atoms may be 4 to 15 or 5 to 12. In some embodiments, The length of L1 is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 pieces. 13 pieces, 14 pieces, 15 pieces, 16 pieces, 17 pieces, 18 pieces, 19 pieces, 20 pieces, 21 pieces, 22 pieces, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60 It is an atom.

[0257] In some embodiments, j1 is an integer from 2 to 10, and in some embodiments... In some embodiments, j1 is an integer between 3 and 5. In some embodiments, j2 is an integer between 2 and 10. In some embodiments, j2 is an integer between 3 and 5. R' is C1-C4. It is a methyl group, and in some embodiments, R' is a methyl group, an ethyl group, and an isopyl group. It is one of the ropyl groups. Ra is one of A27, A28, A29, A30 and A31. In some embodiments, Ra is A27 or A28. Rb is C1-C It is a 5-alkyl group, and in some embodiments, Rb is a methyl group, an ethyl group, or an iso It is one of the propyl group and the butyl group. In some embodiments, formulas A1 to A26 By selecting j1, j2, R', Ra, and Rb respectively, the M1 target group and nitrogen This achieves bonding with the N atom on the contained skeleton, and the spatial position between the M1 target groups is determined between the M1 target group and the liver surface. Further improves the binding to the asialoclycoprotein receptor.

[0258] In some embodiments, the composite is of formulas (403), (404), (405), (406), (407), (408), (409), (410), (411), (412 ), (413), (414), (415), (416), (417), (418), (4 It has the structure shown in 19), (420), (421), or (422).

[0259] [ka] JPEG0007883784000030.jpg218170JPEG0007883784000031.jpg214170JPEG0007883784000032.jpg209170 JPEG0007883784000033.jpg228170JPEG0007883784000034.jpg216170JPEG0007883784000035.jpg155170

[0260] In some embodiments, the P atom in formula A59 is a different atom in the siRNA sequence. It may be bonded to any possible position; for example, the P atom in formula A59 is of the siRNA. It may be bound to one nucleotide of either the sense strand or the antisense strand, and any number In that embodiment, the P atom in formula A59 is any one of the sense strands of the siRNA. In some embodiments, the P atom in formula A59 It is bound to the end of the sense or antisense strand of the siRNA, and in some embodiments In formula A59, the P atom is bound to the end of the sense strand of the siRNA. The term "part" refers to the four nucleos in the sense chain or antisense chain that are located at one end of the sense chain or antisense chain. It refers to siRNA. In some embodiments, the P atom in formula A59 is the siRNA. Bonded to the end of an antisense chain or antisense chain, in some embodiments, formula A59 The P atom is attached to the 3' end of the sense strand of the siRNA. When bound to the above position, the siRNA complex represented by formula (308) enters the cell. After being inserted, when it is unwound, it releases the antisense strand of a single siRNA, and PCS K9 mRNA blocks the protein translation process, suppressing PCSK9 gene expression. It is possible.

[0261] In some embodiments, P in formula A59 is the nucleotypic in siRNA. Any possible position on the nucleotide, for example, the 5' position of a nucleotide, the 2' position of a nucleotide, It may be bonded to the 3' position of the rheotide or to a nucleotide base. In some embodiments... Furthermore, the P atom in formula A59 forms a phosphate diester bond, thereby si It may be attached to the 2', 3', or 5' position of a nucleotide in RNA. In this embodiment, the P atom in formula A59 is the 3' terminal nucleus of the sense strand of the siRNA. The 3' hydroxyl group of the rheotide is bonded to the oxygen atom obtained by dehydrogenation (at this time, in A59) The P atom can also be considered as the P atom of the phosphate group contained in siRNA), or, In formula A59, the P atom is the 2'- of one nucleotide in the sense strand of the siRNA. By substituting a hydrogen atom in the hydroxyl group, it is attached to the nucleotide, or, formula A59 The P atom in this case is in the 5' hydroxyl group of the 5' terminal nucleotide of the sense strand of the siRNA. It is bonded to the nucleotide by substituting a hydrogen atom.

[0262] The inventors of this disclosure claim that the siRNA complex of this disclosure exhibits significantly improved stability in plasma and is off The target effect is reduced, and high PCSK9 mRNA silencing activity is further demonstrated. Furthermore, we unexpectedly discovered that it also possesses a high lipid-suppressing effect. In several embodiments, The siRNA of this disclosure may be one of the siRNAs shown in Tables 1a to 1g. These siRNA-containing complexes exhibit higher PCSK9 mRNA silencing activity. This indicates.

[0263] [Table 1a] JPEG0007883784000037.jpg255163JPEG0007883784000038.jpg47170 [Table 1b] JPEG0007883784000040.jpg255164JPEG0007883784000041.jpg41170 [Table 1c] JPEG0007883784000043.jpg255166JPEG0007883784000044.jpg41170 [Table 1d] JPEG0007883784000046.jpg255167JPEG0007883784000047.jpg42170 [Table 1e] JPEG0007883784000049.jpg255166JPEG0007883784000050.jpg42170 [Table 1f] JPEG0007883784000052.jpg255168JPEG0007883784000053.jpg42170 [Table 1g]

[0264] In the siRNA or siRNA complex described in this disclosure, each adjacent nucleoti The bonds between the phosphates are connected by phosphate diester bonds or thiophosphate diester bonds, In a sterling bond or thiophosphate diester bond, the non-crosslinked oxygen or sulfur atom is negatively charged. It carries a charge and has a hydroxyl group or sulfhydryl group. They may exist as such, and the hydrogen ions in the hydroxyl group or sulfhydryl group may be partially or The entire molecule may be substituted with a cation. The cation is any cation, for example, a metal. Cation, ammonium ion NH4 + Even if it is one of the organic ammonium cations i. Considering the improvement of solubility, in one embodiment, the cation is an alkali metal i On, ammonium cations formed by tertiary amines and quaternary ammonium catios It is one or more types selected from the following. Alkali metal ions are K + and / or Na + It may also be the case that the cation formed by the tertiary amine is formed by triethylamine. Formed by ammonium ions and / or N,N-diisopropylethylamine The ammonium ion may be formed. Therefore, the siRN described in this disclosure A or the siRNA complex may exist as a salt in at least a portion of it. In one embodiment... Furthermore, non-crosslinked oxygen atoms in the phosphate diester bond or thiophosphate diester bond or At least a portion of the sulfur atom is bonded to a sodium ion, as described in this disclosure. NA or siRNA complexes exist as sodium salts or partial sodium salts.

[0265] As will be obvious to those skilled in the art, nucleoside monomas having the corresponding modifications By using -, modified nucleotide groups can be introduced into the siRNA described in this disclosure. This can be done. A method for preparing nucleoside monomers having the corresponding modifications, and modified nucleos Methods for introducing rheotide groups into siRNA are also well known to those skilled in the art. Rheoside monomers may be purchased commercially or prepared by known methods. stomach.

[0266] <Preparation of the siRNA complex shown in formula (308)> Even if the siRNA complex shown in formula (308) is prepared by any reasonable synthetic route, good.

[0267] In some embodiments, the siRNA complex represented by formula (308) is as follows: It can be prepared by the method. This method is performed under the conditions of phosphoramidite solid-phase synthesis. Depending on the nucleotide types and order of the sense and antisense strands of each siRNA, 3' Nucleoside monomers are sequentially bonded from the 5' end, and the bonding of each nucleoside monomer... This involves four reactions: deprotection, coupling, capping, oxidation, or sulfidation, and siRNA The process includes isolating the sense strand and antisense strand of the siRNA and annealing them, wherein the siRNA is , the siRNA of the present disclosure described above.

[0268] Furthermore, this method, under coupling reaction conditions and in the presence of a coupling reagent, is performed using formula (32 1) The compound shown in 1) is bound to a nucleoside monomer or a nucleotide on a solid support. The sequence is brought into contact with the compound shown in formula (321) and coupled to form a nucleotide. This further includes binding to the sequence. Below, the compound shown in formula (321) is a complex molecule. It is also called [another name].

[0269] [ka] During the ceremony, R4 can bind to the siRNA represented by Nu in the compound shown in formula (308). It is a group. In some embodiments, R4 is a si represented by covalent bonding to Nu. It is a group that can bind to RNA. In some embodiments, R4 reacts to form a phosphate group. It is a group that can be compounded with any functional group of siRNA represented by Nu via a diester bond. In each S1, all active hydroxyl groups in M1 are independently replaced with YCOO- groups. The group is a methyl group, trifluoromethyl group, difluoromethyl group, fluoromethyl group, and fluoromethyl group. Tyl group, trichloromethyl group, dichloromethyl group, chloromethyl group, ethyl group, n-pro Independently of pyr group, isopropyl group, phenyl group, halophenyl group and alkylphenyl group One of the selected elements is a methyl group, and in some embodiments, Y is a methyl group.

[0270] n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R 13 , R 14 , R 15 , The definitions and selectable ranges for L1 and M1 are as described above.

[0271] R4 forms a bond with the N atom on the nitrogen-containing skeleton, resulting in the siRN shown in formula (308). Selected to provide a suitable reaction site for the synthesis of complex A. And R4 is either an R2 linker group or a protected R2 linker group, and reacts It contains functional groups that can form the structure shown in siRNA and A59.

[0272] In some embodiments, R4 is represented by Nu, which is an siRNA or nucleoside. A first functional group that can form a phosphite ester with a group on the nomer, and a hydroxyl group Alternatively, a second functional group that can react with an amino group to form a covalent bond or the covalent bond It includes a solid support bonded by bonding. In some embodiments, the first functional group These are phosphoramidites, hydroxyl groups, or protected hydroxyl groups. In embodiments, the second functional group is a phosphoramidite, a carboxyl group, or a carbo It is a phosphate salt. In some embodiments, the second functional group is separated by a covalent bond. A solid support bonded to the rest of the child, wherein the covalent bond is a hydroxyl group or an amino group It is formed by phosphate ester. In some embodiments, the solid phase support is phosphate ester They are bonded via carboxylic acid ester bonds or amide bonds. Several implementations In terms of form, the solid-phase carrier is a resin.

[0273] In some embodiments, the first functional group is a hydroxyl group, -OR k or formula ( The group is represented by C3), and the second functional group is represented by formula (C1), (C2), (C3), ( Includes the structure shown in C1' or (C3').

[0274] [ka] In the formula, q1 is an integer from 1 to 4, X is O or NH, and M + R is a cation, k is a hydroxy protecting group, and SPS represents a solid support. JPEG0007883784000057.jpg6170 represents the site where groups are covalently bonded.

[0275] In some embodiments, the first functional group is as shown in formula (C3), It contains a foramidite group, and the phosphoramidite group is at any position on the nucleotide Coupling with a hydroxyl group, for example, a hydroxyl group at the 2' position or a hydroxyl group at the 3' position. The reaction forms a phosphite ester, which is then oxidized or sulfurized to form a phosphate diphosphate represented by formula A59. By forming an ester bond or thiophosphate ester bond, the complex molecule can be combined with siRNA. This is possible. In this case, even if the second functional group is not present, the compound of formula (321) is It can be compounded with nucleotides, and is used to obtain the siRNA complex shown in formula (308). It will not have any effect. In this case, siRN can be synthesized by methods such as phosphoramidite solid-phase synthesis. After obtaining the sense strand or antisense strand of A, the compound of formula (321) and the nucleotide sequence In the subsequent oxidation or sulfurization process, the hydroxyl group on the terminal nucleotide is reacted, and in the subsequent oxidation or sulfurization process... A bond is formed by a phosphate diester bond or a thiophosphate ester bond, and the formula (321) The compound is combined with the siRNA.

[0276] In some embodiments, the first functional group comprises a protected hydroxyl group. In some embodiments, the second functional group includes a group that can react with a solid support, and The reaction provides a composite molecule containing a solid support. In some embodiments, the The functional group of 2 is a carboxyl group, as shown in formula (C1), (C2), or (C3). The second functional group is a carboxyl group or a carboxyl group. When containing hydroxyl salts, the compound of formula (321) and the solid support, for example, hydroxyl salts in resins. The group or amino group is subjected to an esterification or amidation reaction, and a carboxylic acid ester bond is formed The bonded, solid-phase support forms a composite molecule. The second functional group is phosphoramide When it contains a functional group, the compound of formula (321) and a general-purpose solid support, for example, a resin The hydroxy group is subjected to a coupling reaction, oxidized, and bonded by a phosphate diester bond. Then, a composite molecule containing a solid support is formed. Subsequently, the product to which the solid support is bound is used as a starting point. Then, following the phosphoramidite solid-phase synthesis method, nucleoside monomers are sequentially bonded, forming a complex Obtain the sense or antisense strand of siRNA to which the group is attached. During the phase synthesis process, the first functional group is deprotected, and then the coupling reaction conditions are met. Below, it is coupled with the phosphoramidite group in the nucleoside monomer.

[0277] In some embodiments, the first functional group is a hydroxyl group or a protected hydroxyl group The roxy group is included, and the second functional group is as shown in formula (C1') or (C3'), Solid support bonded by carboxylic acid ester bonds or solid phase bonded by amide bonds It includes a carrier, or a solid-phase carrier bonded by phosphate ester bonds. In this case, as Using the compound of formula (321) instead of a solid support, according to the phosphoramidite solid-phase synthesis method The sense strand or a complex group of siRNA is formed by sequentially linking nucleoside monomers. Obtain an inthense chain.

[0278] In some embodiments, the carboxylate salt is -COO - M + It may also be expressed as this, Here, M + These are cations, such as metal cations and ammonium cations (NH4). + , It is one selected from organic ammonium cations. In one embodiment, the gold The group ion is one selected from alkali metal ions, for example, K + or Na + in Yes. In some embodiments, taking into consideration the need to improve solubility and facilitate the reaction, In this case, the organic ammonium ion is formed by tertiary amines, ammonium catio Ammonia formed by a quaternary ammonium cation, such as triethylamine. Ammonium ions formed by ammonium ions or N,N-diisopropylethylamine In some embodiments, the carboxylate salt is triethylaminecarboxylic acid. It is a salt or an N,N-diisopropylethylamine carboxylate salt.

[0279] In some embodiments, R4 is derived from formulas (B9), (B10), (B9'), and (B1 Includes the structure shown in (0'), (B11), (B12), (B11'), or (B12'). .

[0280] [ka] In the formula, q1 is an integer between 1 and 4, q2 is an integer between 1 and 10, and X is either O or NH. Ri, M + R is a cation, k is a hydroxy protecting group, and SPS represents a solid support. JPEG0007883784000059.jpg6170 represents a site where the group is covalently bonded. In some embodiments, q1 is 1 or It is 2. In some embodiments, q2 is an integer from 1 to 5. In this state, R4 includes the structure shown in formula (B9) or (B10). Several implementations In terms of form, R4 includes the structure shown in formula (B11) or (B12).

[0281] In some embodiments, R k This is Tr (trityl group), MMTr (4-methoxy Trityl group), DMTr (4,4'-bismethoxytrityl group), TMTr (4,4', It is one or more 4''-trimethoxytrityl groups. In some embodiments, R k This is DMTr, i.e., 4,4'-bismethoxytrityl(4,4'-dimetho (xytrityl) is also acceptable.

[0282] The definition of L1 is as described above.

[0283] In some embodiments, L1 bonds the M1 target group to the N atom on the nitrogen-containing skeleton. It is used to provide liver targeting function to the siRNA complex shown in formula (308). In some embodiments, L1 includes one of A1 to A26 or a combination thereof. nothing.

[0284] As can be easily understood by those skilled in the art from the above description, phosphorus known in the art Compared to the midite solid-phase synthesis method, the above first functional group and an arbitrary second functional group allow for multiple synthesis. The compound molecule can be placed at any possible position in the nucleotide sequence, for example, at the ends of the nucleotide sequence. Obtain an siRNA complex represented by formula (308) bound to the end of a rheotide sequence. This can be done. Accordingly, unless otherwise specified, the preparation of complexes and / or complex molecules is described below. In the description concerning this, the terms "deprotection," "coupling," "capping," and "oxidation" are used. When referring to reactions such as "sulfidation," the known solid-phase synthesis methods of phosphoramidite nucleic acids in this field are used. The reaction conditions and reagents related to the law should also be understood to apply to these reactions. The typical reaction conditions and reagents are described in detail below.

[0285] In some embodiments, each S1 is independently M1. In each S1, at least one active hydroxyl group is present in M1. It is a group protected by a protective group. In some embodiments, each S1 is independently M1 All of the active hydroxyl groups present are protected by hydroxyl protecting groups. In embodiments, any hydroxy protecting group known to those skilled in the art is used to activate the hydroxyl group at M1. It can be used to protect the roxy group. In some embodiments, it is protected. The hydroxyl group may also be represented by the formula YCOO-, where each Y is independently C1-C 10 Al Kill group and C6-C 10 Selected from the group consisting of aryl groups, the C1-C 10 Alkyl Base and C6-C 10 The aryl group is optionally substituted with one or more substituents, and the substituents are Selected from the group consisting of halogens and C1-C6 alkyl groups. In some embodiments In this structure, each Y independently comprises a methyl group, a trifluoromethyl group, a difluoromethyl group, and a mo Nofluoromethyl group, trichloromethyl group, dichloromethyl group, chloromethyl group, ethyl Groups, n-propyl groups, isopropyl groups, phenyl groups, halophenyl groups and C1-C6 groups Selected from the group consisting of chylphenyl groups.

[0286] In some embodiments, each S1 independently consists of formulas A46 to A54. Selected from the group.

[0287] [ka]

[0288] In some embodiments, S1 is formula A49 or A50.

[0289] In some embodiments, each Y is a methyl group, a trifluoromethyl group, a difluoromethyl group. Methyl group, fluoromethyl group, trichloromethyl group, dichloromethyl group, chloromethyl group ethyl group, n-propyl group, isopropyl group, phenyl group, halophenyl group and alkyl One independently selected from the phenyl group, and in some embodiments, Y is me It is a chill group.

[0290] As mentioned above, the method for preparing the siRNA complex shown in formula (308) is as follows: Synthesize the other chain (for example, the sense chain of the siRNA to which the complex molecule was attached in the above step). When synthesizing, further synthesize the siRNA antisense strand according to the solid-phase synthesis method. (Included in, and vice versa), isolate the sense strand and antisense strand, and anneal them. The process further includes the following steps: Specifically, in the isolation step, the nucleotide sequence and / or The solid support bonded to the composite molecule is cleaved, and the necessary protecting groups are removed (at this point In combination, each S1 group in the compound of formula (321) is converted to the corresponding M1 target group. The sense strand (or antisense strand) of the siRNA to which the synthesizer is bound and the corresponding antisense strand A sense strand (or antisense strand) is obtained, and the sense strand and antisense strand are annealed to form a double-stranded RN. Structure A is formed, and an siRNA complex shown in formula (308) is obtained.

[0291] In some embodiments, the method for preparing the siRNA complex shown in formula (308) Under coupling reaction conditions and in the presence of a coupling reagent, the compound represented by formula (321) The substance is brought into contact with the first nucleoside monomer at the 3' end of the sense chain or antisense chain. The compound shown in formula (321) is attached to the first nucleotide in the sequence, and a phosphorus is formed. Under the conditions of ruamidite solid-phase synthesis, seed nucleotides of the desired sense or antisense strand are obtained. Depending on the class and order, nucleoside monomers are bonded sequentially from 3' to 5', forming siRN A step to synthesize a sense chain or antisense chain of A, wherein the compound of formula (321) is R 4. A first functional group containing a protected hydroxyl group, and formula (C1') or (C3') A compound containing a second functional group having the structure shown, the first nucleoside mono Before bonding with Mer, the compound of formula (321) is deprotected, and each nucleoside monomer is bonded. This involves four reactions: deprotection, coupling, capping, oxidation, or sulfidation, and the complex group is bonded. A step to obtain a sense or antisense strand of a combined nucleic acid; solid-phase synthesis of phosphoramidites Depending on the type and order of nucleotides in the antisense or sense strand, the 3' to 5' Nucleoside monomers are sequentially bonded toward the antisense or sense strand of the nucleic acid. The bond between each nucleoside monomer undergoes deprotection, coupling, capping, oxidation, or The process involves four sulfidation reactions, removal of protecting groups, cleavage from the solid support, isolation and purification to obtain the sense chain. The process also includes obtaining an antisense chain and performing an annealing step.

[0292] In some embodiments, the method for preparing the siRNA complex shown in formula (308) , the type and order of nucleotides in the sense strand or antisense strand of the double-stranded siRNA. In order, nucleoside monomers are bonded sequentially from 3' to 5', and the sense chain and A The nucleosine chain is synthesized, and the bonds of each nucleoside monomer undergo deprotection, coupling, and capping. The process involves four reactions: ping, oxidation, or sulfurization, and includes a sense chain bonded to a solid support, and the solid support Steps to obtain an antisense chain bound to a body; coupling reaction conditions and coupling reagents In the presence of the compound shown in formula (321), the sense chain or solid phase bonded to the solid support The antisense chain bound to the support is brought into contact with the first phosphoramidite group at R4. A compound of formula (321) containing a functional group is attached to a sense chain or antisense chain for protection. The groups were removed, the solid support was cleaved, and each was isolated and purified to obtain siRNA with the complex group attached. The process includes obtaining a sense chain or antisense chain and performing an annealing step.

[0293] In some embodiments, the P atom in formula A59 is a sense atom in siRNA. The method for preparing the siRNA complex shown in formula (308), which is bound to the 3' end of the chain, is as follows: (1) Compound of formula (321) (The compound of formula (321) has a protected hydroxygen at R4. C base OR k A first functional group containing, and having a structure represented by formula (C1') or (C3') (A compound containing a second functional group) with a hydroxy protecting group R k Remove, cut Under pulling reaction conditions and in the presence of a coupling reagent, the deprotected product is converted to a nucleoside. By contacting the monomer, a nucleoside monomer is obtained that is bonded to a solid support via a composite molecule. thing, (2) Starting with a nucleoside monomer that is bonded to a solid support by the composite molecule, 3 The sense strand of siRNA was synthesized in the '-5' direction using a phosphoramidite solid-phase synthesis method. to do, (3) Synthesize the antisense chain of siRNA by a phosphoramidite solid-phase synthesis method. to (4) The sense strand and antisense strand of the siRNA are isolated and annealed, and formula (308) This includes obtaining the siRNA complex shown in [reference].

[0294] In step (1), the protecting group R in the compound of formula (321) above k How to remove This includes contacting the compound of formula (321) with a deprotection reagent under deprotection conditions. The temperature is 0-50°C, and in some embodiments, 15-35°C, and the reaction time is 30 ~300 seconds, 50~150 seconds in some embodiments, and the deprotection reagent is trifluor. One or more selected from chloroacetic acid, trichloroacetic acid, dichloroacetic acid, and chloroacetic acid. It may also be dichloroacetic acid in some embodiments. Deprotection agent and formula (321) The molar ratio with the compound is 10:1 to 1000:1, and in some embodiments it is 50:1 to The ratio is 500:1.

[0295] The coupling reaction conditions and coupling reagents are suitable for the above coupling reaction. Any conditions and reagents may be used. In some embodiments, solid-phase synthesis is employed. The same conditions and reagents as those used in the coupling reaction may be employed.

[0296] In some embodiments, the conditions for the coupling reaction are such that the reaction temperature is 0 to 50°C. In some embodiments, the temperature is 15-35°C. Compounds of formula (321) and nucleosides The molar ratio with nomer is 1:1 to 1:50, and in some embodiments it is 1:2 to 1:5. Yes, the molar ratio of the compound in formula (321) to the coupling reagent is 1:1 to 1:50. In some embodiments, the ratio is 1:3 to 1:10, and the reaction time is 200 to 3000. The time is 500 to 1500 seconds, in some embodiments. The coupling reagent is 1H-T Trazol, 5-ethylthio-1H-tetrazol, 5-benzylthio-1H-tetrazol One or more selected from, and in some embodiments, 5-ethylthio-1H-the It is trazole. The coupling reaction may be carried out with an organic solvent, and the organic solvent This is one or more selected from anhydrous acetonitrile, anhydrous DMF, and anhydrous dichloromethane. The species is anhydrous acetonitrile in some embodiments. In contrast, the amount of the organic solvent is 3 to 50 L / mol, and in some embodiments, 5 to 20 L. It is / mol.

[0297] In step (2), the phosphoramidite nucleic acid prepared in the above step is synthesized by a solid-phase synthesis method. Starting with a nucleoside monomer bonded to a solid support by a composite molecule, 3'-5' The sense strand SS of the siRNA complex is synthesized in this direction. In this case, the complex group is obtained It is attached to the 3' end of the sense strand.

[0298] Other conditions for the solid-phase synthesis in steps (2) and (3) include the removal of nucleoside monomers. Protection conditions, type and dosage of deprotection reagent, coupling reaction conditions, type of coupling reagent and Dosage, conditions for the capping reaction, type and dosage of the capping reagent, conditions for the oxidation reaction, oxidation This includes the types and amounts of reagents, the sulfurization reaction conditions, and the types and amounts of sulfurizing reagents commonly used in this field. Various reagents, dosages, and conditions are used.

[0299] For example, in some embodiments, in steps (2) and (3), the solid-phase synthesis Then, the following conditions may be used.

[0300] The deprotection conditions for nucleoside monomers are a temperature of 0-50°C, and in some embodiments, 1 The temperature is 5-35°C, and the reaction time is 30-300 seconds, or 50-150 seconds in some embodiments. The deprotection reagents are trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and chloroacetic acid. It may be one or more selected from, and in some embodiments, dichloroacetic acid Yes. The molar ratio of the deprotection reagent to the 4,4'-dimethoxytrityl protecting group in the solid support is The ratio may be 2:1 to 100:1, and in some embodiments it is 3:1 to 50:1.

[0301] The coupling reaction conditions are a temperature of 0-50°C, and in some embodiments, 15-35°C. Yes, the molar ratio of the nucleic acid sequence bound to the solid support to the nucleoside monomer is 1:1 to 1: It may be 50, and in some embodiments it is 1:5 to 1:15, and is bonded to the solid support. The molar ratio of the nucleic acid sequence to the coupling reagent is 1:1 to 1:100, and several implementations In this state, the reaction time is 1:50 to 1:80, and the reaction time and selection of coupling reagents are the same as described above. be.

[0302] The capping reaction conditions are a temperature of 0-50°C, and in some embodiments, 15-35°C. Yes, the reaction time is 5 to 500 seconds, and in some embodiments it is 10 to 100 seconds, and the catch The selection of the capping reagent is the same as described above. The total amount of capping reagent and the amount bound to the solid support. The molar ratio of the nucleic acid sequence is 1:100 to 100:1, and in some embodiments, 1:10 to 1 The ratio is 0:1. Equimolar amounts of anhydride acetate and N-methylimidazole are used as the capping reagent. When using acetic anhydride, N-methylimidazole, and nucleic acid sequence bound to the solid support The molar ratio may be 1:1:10 to 10:10:1, and in some embodiments it is 1:1 The ratio is 2~2:2:1.

[0303] The conditions for the oxidation reaction are a temperature of 0-50°C, and in some embodiments, 15-35°C. The reaction time is 1 to 100 seconds, and in some embodiments, 5 to 50 seconds, and the oxidizing reagent is... In some embodiments, it is iodine (provided as iodine water in some embodiments). The molar ratio of the oxidizing reagent to the nucleic acid sequence bound to the solid support in the coupling step is 1 The ratio may be 1 to 100:1, and in some embodiments it is 5 to 50:1. In some embodiments, the oxidation reaction is carried out using tetrahydrofuran:water:pyridine = 3:1: The reaction is carried out using a mixed solvent of 1 to 1:1:3. The sulfurization reaction conditions are a temperature of 0 to 50°C, and several In some embodiments, the temperature is 15-35°C, the reaction time is 50-2000 seconds, and in some embodiments... The time is 100 to 1000 seconds, and the sulfiding reagent is xanthan hydride in some embodiments. The ratio of the sulfurizing reagent to the nucleic acid sequence bonded to the solid support in the coupling step is as follows: The ratio is 10:1 to 1000:1, and in some embodiments it is 10:1 to 500:1. In some embodiments, the sulfurization reaction is carried out in a ratio of acetonitrile:pyridine = 1:3~3 This is done using a mixed solvent of :1.

[0304] After all nucleoside monomers have been bonded, and before annealing, the method involves siRN The method further includes isolating the sense and antisense strands of A. The isolation method is publicly known to those skilled in the art. It is a known process, and generally, it involves cleaving a synthesized nucleotide sequence from a solid support, and then, on the base, phosphorus... This includes removing protecting groups from acid groups and ligands, purifying the material, and desalting it.

[0305] The synthesized nucleotide sequence is cleaved from the solid support, and then cleaved at the base, phosphate group, and ligand. The protecting group above is removed by the usual cleavage and deprotection methods used in siRNA synthesis. For example, the nucleotide sequence to which the obtained solid support is bound can be measured in concentrated ammonia water. In contact with the hydroxyl group, the protecting group YCOO- of the A46-A54 group is removed during the deprotection process. The S1 group is converted to the corresponding M1 group, and the siRNA compound shown in formula (308) is obtained. A compound is formed. Here, the concentrated ammonia water is 25-30% by weight ammonia water. However, the dosage of concentrated ammonia water is 0.2 ml / of the target siRNA sequence. The concentration may be μmol to 0.8 ml / μmol.

[0306] If the synthesized nucleotide sequence has at least one 2'-TBDMS protection, then The notation method involves recording the nucleotide sequence from which the solid support has been removed using triethylamine hydrofluoric acid. This further includes removing the 2'-TBDMS protection by bringing it into contact with the In this case, the corresponding nucleotide in the obtained target siRNA sequence contains two free nucleotides. It has a hydroxyl group. The dose of pure triethylamine hydrofluoric acid is intended and For the siRNA sequence, a concentration of 0.4 ml / μmol to 1.0 ml / μmol is acceptable. i. Thus, an siRNA complex represented by formula (308) can be obtained.

[0307] Methods of purification and desalting are well known to those skilled in the art. For example, preparative ion chromatography Nucleic acid purification is performed by gradient elution of NaBr or NaCl using a Graphy purification column. After completing the process and collecting and combining the products, desalting is performed using a reverse-phase chromatography purification column. It is possible.

[0308] In the siRNA complex shown in formula (308) obtained in this way, nucleotides Non-crosslinked oxygen atoms or sulfur in the phosphate diester bond or thiophosphate diester bond between them. The yellow atoms are basically bonded to sodium ions, as shown in formula (308) siR The NA complex basically exists as a sodium salt. By well known ion exchange methods... or, the sodium ion is replaced with a hydrogen ion and / or other cation, and other forms of formula An siRNA complex shown in (308) can be obtained. The cation is as described above. That is correct.

[0309] During the synthesis process, the purity and molecular weight of the nucleic acid sequence are constantly detected to better control the synthesis quality. Such detection methods are known to those skilled in the art. For example, ion exchange chromatography Nucleic acid purity is detected by matrixing, and liquid chromatography-tandem mass spectrometry (L) is performed. Molecular weight can be measured by C-MS.

[0310] The annealing method is also well known to those skilled in the art. For example, a easily synthesized annealing Mix SS chains and AS chains in equimolar ratios with sterile water for injection to obtain 70-9 By heating to 5°C and then cooling to room temperature, a double-chain structure can be formed through hydrogen bonding. Thus, an siRNA complex represented by formula (308) can be obtained.

[0311] After obtaining the composite, in some embodiments, for example, liquid chromatography The molecule shown in formula (308) was synthesized by molecular weight detection using methods such as tandem mass spectrometry. The characteristics of the synthesized siRNA complex were clarified, and the synthesized siRNA complex was identified as being suitable for the target design. The siRNA complex shown in formula (308), as well as the sequence of the synthesized siRNA. However, it is necessary to confirm that the sequence is one of the desired siRNA sequences, for example, one of the sequences shown in Tables 1a to 1g. It is also possible to do so.

[0312] The compound shown in formula (321) reacts in organic solvents under esterification conditions and in base And in the presence of an esterification catalyst, the compound shown in formula (313) is brought into contact with a cyclic acid anhydride. A preparation method comprising ion exchange and isolation to obtain a compound shown in formula (321). It can be obtained by doing so.

[0313] [ka] In the formula, n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R 13 , R 14 , R 15 , L 1、 The definitions and selectable ranges for each S1 are as described above. R6 is the group that provides R4 in formula (321). In some embodiments, R6 has the structure shown in formula (A61).

[0314] [ka] In the formula, R i This enables bonding with N atoms on the nitrogen-containing skeleton, R k It combines with O to form one Any group to which the free hydroxyl group is attached, R k This is a hydroxy protecting group. In this case, R4 includes a first functional group and a second functional group as hydroxy protecting groups, and the above A compound of formula (321) is obtained in which the second functional group contains the structure shown in formula (C1) or (C2). It is possible.

[0315] The esterification reaction conditions are a reaction temperature of 0 to 100°C and a reaction time of 8 to 48 hours. In some embodiments, the esterification reaction conditions are such that the reaction temperature is 10-4 The temperature is 0°C, and the reaction time is 20-30 hours.

[0316] In some embodiments, the organic solvent is an epoxy solvent, an ether solvent, etc. Alkyl chloroformides solvents, dimethyl sulfoxide, N,N-dimethylformamide and N , comprising one or more types of N-diisopropylethylamine. In some embodiments, The epoxy solvent is dioxane and / or tetrahydrofuran, and the The tert solvent is ethyl ether and / or methyl tert-butyl ether, and the above Alkyl halogenated solvents include dichloromethane, trichloromethane, and 1,2-dichloro It is one or more types of ethane. In some embodiments, the organic solvent is dichloro It is lomethane. For the compound shown in formula (313), the amount of the organic solvent is 3 The concentration is approximately 50 L / mol, and in some embodiments, it is 5 to 20 L / mol.

[0317] In some embodiments, the cyclic acid anhydride is succinic acid anhydride, glutaric acid anhydride. It is one of the substances, adipic anhydride, or pimeric acid anhydride, and in some embodiments , succinic anhydride. The cyclic acid anhydride and the compound represented by formula (313) The ratio is 1:1 to 10:1, and in some embodiments, it is 2:1 to 5:1.

[0318] The esterification catalyst may be any catalyst that catalyzes the esterification reaction, for example. For example, the catalyst may be 4-dimethylaminopyridine. The catalyst and formula (313 The molar ratio with the compound shown in ) is 1:1 to 10:1, and in some embodiments The ratio is 2:1 to 5:1.

[0319] In some embodiments, the base is any inorganic base, organic base, or combination thereof. They may be combined. Considering solubility and product stability, the base may be, for example, the It may be a tertiary amine. In some embodiments, the tertiary amine is a tri- It is ethylamine or N,N-diisopropylethylamine. The above tertiary amine and formula (3 The molar ratio with the compound shown in 13) is 1:1 to 20:1, and in some embodiments... And the ratio is 3:1 to 10:1.

[0320] The aforementioned ion exchange action involves transferring the compound of formula (321) to a desired carboxylic acid or carboxylate. The process involves converting to a specific format, and the ion exchange method is known to those skilled in the art, and appropriate ion exchange Using the solution and exchange conditions, M + A complex molecule containing a cation can be obtained, and here we will explain in detail. The explanation is omitted. In some embodiments, the ion exchange reaction is performed by triethyl The procedure is performed using a triethylamine phosphate solution, with a concentration of 0.2- The concentration is 0.8M, and in some embodiments, the triethylamine phosphate solution The concentration is 0.4 to 0.6 M, and the triethylamine is used with respect to the compound of formula (313). The dosage of the phosphate solution is 3-6 L / mol, and in further embodiments, 4-5 L / m². I am an office lady.

[0321] To isolate the compound of formula (321) from the reaction mixture by any suitable isolation method. This can be done. In some embodiments, after the solvent is evaporated and removed, chromatography is performed. The compound of formula (321) can be isolated by the method, for example, (1) normal-phase purified silicone : 200-300 mesh silica gel packing material containing 1 wt‰ triethylamine Chloromethane:methanol = 100:18~100:20 gradient elution, or ( 2) Reverse-phase purification: C18, C8 reverse-phase packing material, methanol:acetonitrile = 0.1:1 Isolation can be achieved using two chromatography conditions: gradient elution at a ratio of 1:0.1. In some embodiments, the solvent is directly removed to obtain the crude product of the compound of formula (321). This can be obtained, and the crude product can be used directly in subsequent reactions.

[0322] In some embodiments, the method for preparing the compound of formula (321) is under condensation reaction conditions. In an organic solvent, in the presence of a condensing agent, a condensation catalyst, and a tertiary amine, the above ion exchange reaction The product obtained by the response is further brought into contact with a solid support containing an amino group or a hydroxyl group. This further includes the following: In this case, R4 includes a first functional group and a second functional group, and the first A functional group containing a hydroxy protecting group, and a second functional group containing the structure shown in formula (C1'). Compound (321) is obtained.

[0323] The aforementioned solid-phase support is one of the supports used in the solid-phase synthesis of siRNA, and among them The details are known to those skilled in the art. For example, the solid support is an activated hydroxyl group or an amino A solid support containing functional groups may be selected, and in some embodiments, the solid support The body is an amino resin or a hydroxy resin. In some embodiments, the amino The resin or hydroxy resin has a particle size of 100 to 400 mesh, and on the surface The parameter for the amount of amino or hydroxyl group supported is 0.2 to 0.5 mmol / g. The dose ratio of the compound shown in formula (321) to the solid support is 10 to 400 μmol. The solid phase support is a compound per gram (μmol / g). In some embodiments, the above The dose ratio of the compound shown in formula (321) to the solid support is 50 to 200 μmol / g. .

[0324] The aforementioned organic solvent may be any suitable solvent or mixture known to those skilled in the art. In several embodiments, the organic solvent is acetonitrile, epoxy solvents, ether Solvents, alkyl halides, dimethyl sulfoxide, N,N-dimethylformaldehyde It is one or more of mido and N,N-diisopropylethylamine. Several implementations In form, the epoxy solvent is dioxane and / or tetrahydrofuran. The ether solvent is ethyl ether and / or methyl tert-butyl ether. Yes, the alkyl halogenated solvents are dichloromethane, trichloromethane and 1,2 - One or more types of dichloroethane. In some embodiments, the organic solvent This is acetonitrile. For the compound of formula (321), the amount of the organic solvent is 20 It is ~200 L / mol, and in some embodiments, it is 50~100 L / mol. ru.

[0325] In some embodiments, the condensing agent is benzotriazole-1-yloxy Tripyrrolidino-phosphonium hexafluorophosphate / ester (benzotr iazol-1-yl-oxytripyrrolidino phosphonium hexafluorophosphate (PyBop), 3-diethoxyphosphoryl -1,2,3-Benzoxazole 4(3H)-one (3-(Diethoxyphos phoryloxy)-1,2,3-benzotriazin-4(3H)-one, DEPBT) and / or O-benzotriazole-tetramethyluronium hexafluor Lophosphate / ester (O-benzotriazol-1-yl-tetrame It may also be thyluronium hexafluorophosphate. In some embodiments, the condensing agent is O-benzotriazole-tetramethyl It is rhonium hexafluorophosphate / ester. The condensing agent is shown in formula (321). The molar ratio with the compound being used is 1:1 to 20:1, and in other embodiments it is 1:1 to 5: It is 1.

[0326] In some embodiments, the tertiary amine is triethylamine and / or N, It is N-diisopropylethylamine, and in some embodiments, N,N-diiso It is a propylethylamine, and is a compound of the tertiary amine and the compound shown in formula (321). The ratio is 1:1 to 20:1, and in some embodiments, it is 1:1 to 5:1.

[0327] In some embodiments, the method for preparing the compound of formula (321) involves a capping reaction. Under these conditions, the obtained condensation product is treated with a capping reagent and an acylation catalyst in an organic solvent. This may further include contacting the compound with another compound and isolating it to obtain the compound shown in formula (321). The capping reaction prevents the formation of unwanted by-products in subsequent reactions. To do this, the first step is to remove any active functional groups that have not yet fully reacted. The conditions for the capping reaction are a reaction temperature of 0-50°C, and in some embodiments, 15-3°C. The temperature is 5°C, and the reaction time is 1 to 10 hours, or 3 to 6 hours in some embodiments. The capping reagent is a capping reagent known to those skilled in the art and used in siRNA solid-phase synthesis. You may also use [this].

[0328] In some embodiments, the capping reagent is capping reagent 1 (cap 1) consists of capping reagent 2 (cap2), and capping reagent 1 is N-methyl It is an imidazole, and in some embodiments, a pyridine of N-methylimidazole. / Provided as an acetonitrile mixed solution, with a volume ratio of pyridine to acetonitrile of 1: The ratio is 10 to 1:1, and in some embodiments, 1:3 to 1:1, with pyridine and The volume ratio of acetonitrile to N-methylimidazole is 1:1 to 10:1. In some embodiments, the ratio is 3:1 to 7:1. The capping reagent 2 is vinegar. It is an acid anhydride. In some embodiments, the capping reagent 2 is an acetic anhydride. It is provided as an acetonitrile solution, with a volume ratio of acetic anhydride to acetonitrile of 1:1 The ratio is approximately 1:10, and in further embodiments, it is 1:2 to 1:6.

[0329] In some embodiments, the pyridine / acetonite of the N-methylimidazole The ratio of the volume of the mixed solution to the mass of the compound in formula (321) is between 5 ml / g and 50 ml / g. In some embodiments, the concentration is 15 ml / g to 30 ml / g. The acetate anhydride of the acetic acid. The ratio of the volume of the tonitrile solution to the mass of the compound in formula (321) is 0.5 ml / g to 10 ml. The concentration is / g, and in some embodiments it is 1ml / g to 5ml / g.

[0330] In some embodiments, the capping reagent consists of equimolar amounts of anhydride acetate and N2. -Methylimidazole is used. In some embodiments, the organic solvent is acetone. Nitriles, epoxy solvents, ether solvents, alkyl halogens, dimethyl sulfur One of the following: hooxide, N,N-dimethylformamide and N,N-diisopropylethylamine It is one or more species. In some embodiments, the organic solvent is acetonitrile. Yes. For the compound of formula (321), the amount of the organic solvent is 10 to 50 L / mol. In some embodiments, the concentration is 5 to 30 L / mol.

[0331] In some embodiments, the acylation catalyst undergoes esterification condensation or amidation condensation. Any catalyst that can be used may be selected, for example, from alkali heterocyclic compounds. In this embodiment, the acylation catalyst is 4-dimethylaminopyridine. The mass ratio of the catalyst to the compound shown in formula (321) is 0.001:1 to 1:1, and how many In that embodiment, the ratio is 0.01:1 to 0.1:1.

[0332] In some embodiments, the reaction mixture is isolated from formula (321) by any suitable isolation method. The compound can be isolated. In some embodiments, it is thoroughly washed with an organic solvent. Purify, filter, and remove unreacted reactants, excess capping reagents, and other impurities. By this, a compound of formula (321) can be obtained. The organic solvent is acetonitrile, Selected from dichloromethane and methanol, in some embodiments, acetonitrile It is.

[0333] In some embodiments, the method for preparing the complex molecule represented by formula (321) is an organic solvent In the agent, under coupling reaction conditions and in the presence of a coupling reagent, formula (313) The compound shown was contacted with phosphordiamidite, isolated, and chemically converted as shown in formula (321). This includes obtaining a compound. In this case, R4 contains a first functional group and a second functional group, and the first The functional group of the first is a hydroxy protecting group, and the second functional group is a formula containing the structure shown in formula (C3). Compound (321) is obtained.

[0334] In some embodiments, the coupling reaction conditions are such that the temperature is 0 to 50°C. Often, for example, the temperature range is 15-35°C. The compound of formula (313) and phosphordiamidite The ratio can be anywhere from 1:1 to 1:50, for example, 1:5 to 1:15, as shown in equation (313). The molar ratio of the compound to the coupling reagent may be 1:1 to 1:100, for example 1 The reaction time is 50 to 1:80. The reaction time may also be 200 to 3000 seconds, for example, 500 The duration is approximately 1500 seconds. The phosphordiamidite is, for example, bis(diisopropylamino (2-cyanoethoxy)phosphine may be used, or a commercially available product may be purchased, or this It may be synthesized by methods known in the field. The coupling reagent is 1H-tetrazole. Selected from 5-ethylthio-1H-tetrazole and 5-benzylthio-1H-tetrazole It is one or more types, for example, 5-ethylthio-1H-tetrazole. The pulling reaction may be carried out in an organic solvent, the organic solvent being anhydrous acetonitrile, One or more substances selected from water DMF and anhydrous dichloromethane, for example, anhydrous acetone. It is a nitrile. In some embodiments, the compound of formula (313) is given the aforementioned The solvent concentration is 3 to 50 L / mol, or for example, 5 to 20 L / mol. By performing this coupling reaction, the hydroxyl group in the compound of formula (313) The phosphoramidite is reacted with a phosphoramidite to form a phosphoramidite group. Several implementations In terms of form, the solvent can be directly removed to obtain a crude product of the compound of formula (321), The crude product can be used directly in subsequent reactions.

[0335] In some embodiments, the method for preparing the compound of formula (321) involves a coupling reaction. Under these conditions, in an organic solvent, in the presence of a coupling reagent, the isolated product was obtained The process further includes contacting the hydroxyl group-containing solid support. Subsequently, the capping The compound of formula (321) is obtained by performing a oxidative reaction and then isolating it. In this case, R4 is the first It contains a functional group and a second functional group, the first functional group contains a hydroxy protecting group and the second functional group A compound of formula (321) is obtained in which the active group has the structure shown in formula (C3').

[0336] In some embodiments, the solid support is used in solid-phase nucleic acid synthesis known in the art. It is a solid phase support that can be used, for example, a commercially available general-purpose solid phase support that has undergone a deprotection reaction (NittoPh ase(registered trademark)HL UnyLinker TM 300 Oligonucleot ide Synthesis Support, Kinovate Life Science The structure may also be as shown in formula B80 (nces Inc.).

[0337] [ka]

[0338] The deprotection reaction is known to those skilled in the art. In some embodiments, the deprotection conditions are: The temperature range is 0-50°C, for example, 15-35°C, and the reaction time is 30-300 seconds, for example, 50- The time is 150 seconds. The deprotection reagents are trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and It may be one or more selected from loroacetic acid, and in some embodiments, The deprotection agent is dichloroacetic acid. The deprotection agent and the stationary phase are -DMTr(4,4' The molar ratio with the (dimethoxytrityl) protecting group is 2:1 to 100:1, for example, 3:1 to The ratio is 50:1. By performing the deprotection, the surface of the solid support has reactive activity. A free hydroxyl group is obtained, facilitating the subsequent coupling reaction.

[0339] The coupling reaction conditions and the selection of coupling reagents are as described above. By performing the pulling reaction, the free hydroxyl group formed in the deprotection reaction and the phosphorus The midite group reacts to form a phosphite ester bond.

[0340] In some embodiments, the capping reaction conditions are such that the temperature is 0 to 50°C, for example 1 The temperature is 5-35°C, the reaction time is 5-500 seconds, for example, 10-100 seconds, and the aforementioned cap The Ping reaction is performed in the presence of a capping reagent. The selection and dosage of the capping reagent are as follows: That is correct.

[0341] The conditions for the oxidation reaction may be a temperature of 0 to 50°C, for example, 15 to 35°C, and the reaction time This can be 1 to 100 seconds, for example, 5 to 50 seconds, and the oxidizing agent is, for example, iodine. It is also fine (provided as iodine water in some embodiments). In some embodiments, The molar ratio of the oxidizing reagent to the nucleic acid sequence bound to the solid support is 1:1 to 100:1, for example The ratio may be 5:1 to 50:1. In some embodiments, the oxidation reaction is performed by tetra This is done using a mixed solvent of lahydrofuran, water, and pyridine in a ratio of 3:1:1 to 1:1:3.

[0342] In some embodiments, R6 is one of the bases of formula B7 or B8.

[0343] [ka] In the formula, q2, R k The definition is as stated above.

[0344] In this case, the compound shown in formula (313) reacts in an organic solvent under amidation reaction conditions. And in the presence of an amidation reaction condensing agent and a tertiary amine, the compound shown in formula (314) is converted to formula The compound shown in (A-1) or the compound of formula (A-2) is brought into contact with the compound, and then isolated. It can be obtained by the following preparation method.

[0345] [ka] In the formula, n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R 13 , R14 , R 15 , L1, S1, q2 and R k The definitions and selectable ranges for each are as described above. be.

[0346] The amidation reaction conditions are such that the reaction temperature is 0 to 100°C and the reaction time is 1 to 48 hours. It may be present, and in some embodiments, the amidation reaction conditions are such that the reaction temperature is 10-4 The temperature is 0°C, and the reaction time is 2 to 16 hours.

[0347] In some embodiments, the organic solvent is an alcohol solvent, an epoxy solvent, Ether solvents, alkyl halogen solvents, dimethyl sulfoxide, N,N-dimethyl It is one or more of formamide and N,N-diisopropylethylamine. In some embodiments, the ethanol solvent is methanol, ethanol, propano It is one or more types of , and in some embodiments, it is ethanol. In some embodiments, the xylic solvent is dioxane and / or tetrahydrofuran. The ether solvent is, in some embodiments, ethyl ether and / or It is methyl tert-butyl ether. The alkyl halogen solvents are several In the embodiment, dichloromethane, trichloromethane and 1,2-dichloroethane It is one or more types. In some embodiments, the organic solvent is dichloromethane. Therefore, for the compound of formula (314), the amount of organic solvent is 3 to 50 L / mol. In further embodiments, the concentration is 3 to 20 L / mol.

[0348] In some embodiments, the amidation reaction condensation agent is benzotriazole-1- Il-oxytripyrrolidino-phosphonium hexafluorophosphate / ester, 3 -diethoxyphosphoryl-1,2,3-benzoxazole 4(3H)-one, 4-(4 ,6-dimethoxytriazine-2-yl)-4-methylmorpholine hydrochloride (4-(4,6 -dimethoxytriazin-2-yl)-4-methylmorpholi (1,2 hydrochloride), 2-ethoxy-1-ethoxycarbonyl-1,2 -Dihydroquinoline (EEDQ) or O-benzotriazole-tetramethyluronium Hexafluorophosphate / ester, and in further embodiments, 3-diethoxy It is cyphosphoryl-1,2,3-benzoxazole 4(3H)-one. The amidation The molar ratio of the reaction condenser to the compound shown in formula (314) may be 1:1 to 10:1. In some embodiments, the ratio is 2.5:1 to 5:1.

[0349] In some embodiments, the tertiary amine is triethylamine or N,N-di It is isopropylethylamine, and in further embodiments, N,N-diisopropyl ethylamine It is a thylamine. The molar ratio of the tertiary amine to the compound shown in formula (314) is 3: The ratio is 1 to 20:1, and in some embodiments, it is 5 to 10:1.

[0350] In some embodiments, compounds of formulas (A-1) and (A-2) are used as appropriate. It may be prepared by any method. For example, R k If it is a DMTr group, glyceryl phosphate The compound of formula (A-1) can be prepared by reacting Calcium with DMTrCl. As shown, 3-amino-1,2-propanediol and a cyclic acid anhydride are brought into contact, and then DMTr The compound of formula (A-2) can be prepared by reacting it with Cl, and the cyclic acid anhydride is carbon The cyclic acid anhydride may have 4 to 13 primary atoms, or in some embodiments, 4 to 8. As can be easily understood by those skilled in the art, the selection of the cyclic acid anhydride is the combination of (A-2) It corresponds to different values ​​of q2 in the substance, for example, the cyclic acid anhydride is succinic acid anhydride If so, q2=1, and if the cyclic acid anhydride is glutaric acid anhydride, q2= The answer is 2, and by analogy, this is also correct.

[0351] In some variations, the compound shown in formula (314) is the cyclic acid anhydride, 3- By reacting amino-1,2-propanediol and DMTrCl in sequence, the formula ( Compound 313) can also be prepared. As will be easily understood by those skilled in the art, These modifications do not affect the structure and function of the compound of formula (313), and This can be easily achieved by the contractor using the method described above.

[0352] Similarly to the above, the compound of formula (313) can be isolated from the reaction mixture by any suitable isolation method. It can be separated. In some embodiments, after the solvent is evaporated and removed, chromatography The compound of formula (313) can be isolated by the Raffie method, for example, (1) normal phase pulverization. Silica gel: 200-300 mesh silica gel packing material, petroleum ether: ethyl acetate L:Dichloromethane:N,N-dimethylformamide = 1:1:1:0.5~1:1:1 (2) Gradient elution at 0.6, and (2) Reverse phase purification: C18, C8 reverse phase packing material, Two characteristics of the compound are that it undergoes gradient elution at a ratio of 0.1:1 to 1:0.1 for acetonenitrile. It can be isolated under matrixing conditions. In some embodiments, the solvent can be directly By removing it, a crude product of the compound of formula (313) can be obtained, and this crude product can be used as is. It can be used in reactions.

[0353] In some embodiments, the compound represented by formula (314) is used in organic solvents. Under condensation reaction conditions in the presence of an amidation reaction coupling agent and a tertiary amine, the reaction shown in formula (320) A preparation method comprising contacting a compound with a compound represented by formula (316) and then isolating it. It can be obtained by law.

[0354] [ka] In the formula, n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R 13 , R 14 , R 15 The definitions and selectable ranges for each are as described above.

[0355] Examples of compounds of formula (316) include those described in J. Am. Chem. Soc. 201 Compounds disclosed in 4,136,16958-16961 may be used, or formula ( 316) Compounds can be prepared by various methods by those skilled in the art, for example, U.S. Patent U Refer to the method disclosed in Example 1 of S 8,106,022 B2 and several formulas (3 Compound 16) can be prepared, and by citation, all the contents of the above literature as a whole can be found in this book. It will be included in the specifications.

[0356] In some embodiments, the condensation reaction conditions are such that the reaction temperature is 0 to 100°C. The reaction time is 0.1 to 24 hours, and in some embodiments, the reaction temperature is 10 to 40°C. The reaction time is 0.5 to 16 hours.

[0357] Considering the structure of the compound of formula (314), which is the desired product, as shown in formula (316) The molar ratio of the compound to be used and the compound shown in formula (320) is given by formula (320) It should be determined based on the sum of n1 and n3. In some embodiments, for example, In the case where n1 + n3 = 3, in order to ensure that the reaction is complete and not in excess, the equation ( The molar ratio of the compound shown in formula (316) to the compound shown in formula (320) is 3:1 to 3 It may be 0.5:1, and in some embodiments, 3.01:1 to 3.15:1 be.

[0358] In some embodiments, the organic solvent is acetonitrile, epoxy solvents, etc. methyl solvents, alkyl halogens, dimethyl sulfoxide, N,N-dimethyl hydroxypropyl alcohol The epoxy is one or more of the following: lumamide and N,N-diisopropylethylamine. In some embodiments, the xylic solvent is dioxane and / or tetrahydrofuran. The ether solvent is, in some embodiments, ethyl ether and / or It is methyl tert-butyl ether, and the alkyl halogen solvent is several In the embodiment, dichloromethane, trichloromethane and 1,2-dichloroethane There may be one or more types, and in some embodiments, the organic solvent is dichloromethane. Therefore, for the compound of formula (320), the dose of the organic solvent is 3 to 50 L / mol. In some embodiments, the concentration is 5 to 20 L / mol.

[0359] In some embodiments, the amidation reaction condensation agent is benzotriazole-1- Il-oxytripyrrolidino-phosphonium hexafluorophosphate / ester, 3 -Diethoxyphosphoryl-1,2,3-benzoxazole 4(3H)-one (DEPB T), O-benzotriazole-tetramethyluronium hexafluorophosphate / Ester, 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine salt The salt is one or more of the salt or 1-hydroxybenzotriazole, and in further embodiments... In this case, benzotriazole-1-yl-oxytripyrrolidino-phosphonium hexaf It is a mixture of ruolophosphate / ester and 1-hydroxybenzotriazole, Nzotriazole-1-yl-oxytripyrrolidino-phosphonium hexafluorophosphonium Equimolar amounts of phosphate / ester and 1-hydroxybenzotriazole are used. The molar ratio of the total amidation reaction condenser to the compound shown in formula (316) is 1:1 to 3:1. It is also possible that the ratio is 1.05:1 to 1.5:1 in some embodiments.

[0360] The tertiary amine is N-methylmorpholine, triethylamine, or N,N-diisopropylamine. It may also be propylethylamine, and in some embodiments, N-methylmorphol The tertiary amine and the compound represented by formula (316) are in a molar ratio of 2:1 to 10. The ratio may be 1, and in some embodiments, it is 2:1 to 5:1.

[0361] Similarly to the above, the compound of formula (314) can be isolated from the reaction mixture by any suitable isolation method. It can be separated. In some embodiments, after the solvent is evaporated and removed, chromatography The compound of formula (314) can be isolated by the Raffie method, for example, (1) normal phase pulverization. Silica gel: 200-300 mesh silica gel packing material, dichloromethane: methyl (2) Reverse phase purification: C18, C 8. Elute the reversed-phase packing material with a gradient elution of methanol:acetonitrile = 0.1:1 to 1:0.1. It can be isolated under two chromatographic conditions. Several embodiments In this process, the solvent can be directly removed to obtain a crude product of the compound of formula (314), and the crude The product can be used directly in subsequent reactions.

[0362] Compound (320) can be purchased commercially or obtained by methods known to those skilled in the art. This can be obtained. For example, m1=m2=m3=3, n1=1, n3=2, and each R 10 , R 11 , R 12 , R 13 , R 14 , R 15 If both are H, then equation (320) The compound can be purchased commercially from Alpha Acer Corporation.

[0363] The siRNA complex of this disclosure may be used in combination with other pharmaceutically acceptable additives. The additive may be one or more of the various formulations or compounds commonly used in this field. For further details, please refer to the description of the drug composition in this disclosure above.

[0364] <Use of the siRNA, drug compositions and complexes of this disclosure> In some embodiments, the Disclosure relates to the siRNA and / or drug compositions of the Disclosure. and / or diseases or physiological conditions caused by abnormal expression of the PCSK9 gene in the siRNA complex. It provides use in the preparation of drugs for the treatment and / or prevention.

[0365] In some embodiments, the Disclosure relates to the siRNA and / or drug compositions of the Disclosure. and / or administering an effective amount of the siRNA complex to a subject requiring it. This provides a method for preventing and / or treating diseases or physiological conditions caused by abnormal expression of the PCSK9 gene. do.

[0366] By administering the siRNA active component of this disclosure to a subject requiring it, RN The A interference mechanism prevents and / or prevents diseases or physiological conditions caused by abnormal expression of the PCSK9 gene. The therapeutic objective can be achieved. Therefore, the siRNA and / or drug of this disclosure can achieve the therapeutic objective. The chemical composition and / or siRNA complex may be used to treat diseases or illnesses caused by abnormal expression of the PCSK9 gene. It is used for the prevention and / or treatment of a medical condition, or for diseases caused by abnormal expression of the PCSK9 gene. It can be used in the preparation of drugs for the prevention and / or treatment of physiological conditions.

[0367] In some embodiments, diseases or physiological conditions caused by abnormal expression of the PCSK9 gene are associated with This includes hypercholesterolemia, and the resulting atherosclerosis, coronary heart disease, This refers to cardiovascular diseases such as hypertension.

[0368] As used herein, the term "drug administration / administration" refers to the siRNA, drug composition of this disclosure. and / or localize at least a portion of the siRNA complex to a desired site to produce the desired effect. By a method or route that causes the siRNA, drug composition and / or siRNA polymorphism of the Disclosure, This refers to introducing the combined substance into the body of the subject. Suitable administration routes for the method disclosed herein include local administration and This includes systemic administration. Generally, local administration allows for a greater amount of siRNA to be administered than is available in the subject's systemic circulation. The complex is delivered to a specific site, but systemic administration allows the siRNA, drug composition of this disclosure to be used. and / or the siRNA complex is delivered to the subject's basic systemic circulation. This disclosure is high-cholesterol Considering the need to provide means for the prevention and / or treatment of terolemia, In several embodiments, a drug administration method is employed that can deliver the drug to the liver.

[0369] The subject can be administered via any appropriate route known in this field, such as: Oral administration or extra-gastrointestinal routes, such as intravenous, intramuscular, subcutaneous, transdermal, or tracheal administration. Intravenous administration (aerosol), pulmonary administration, nasal administration, rectal administration, and local administration (oral administration and sublingual administration) This includes, but is not limited to, administration of, daily, weekly, or bi-weekly doses. This may be once or multiple times every three weeks, one month, two months, three months, six months, or one year.

[0370] The doses of siRNA, drug compositions, or siRNA complexes described herein are in the Art of the Disclosure. The usual dose may be used, and the dose may be determined by various parameters, particularly the age of the subject. It may also be determined by weight and sex. Toxin can be obtained in cell cultures or experimental animals using standard pharmaceutical procedures. Sexuality and therapeutic effect are measured, for example, LD 50 (Dose that causes 50% of the population to die), ED 50 (In quantitative reactions, this refers to the dose that can produce 50% of the maximum reaction intensity.) (This refers to the dose at which a positive response is obtained in 50% of the experimental subjects in sexual response tests) or IC 50 The concentration of the inhibitor / drug at which the quantitative response is suppressed by half may also be measured. Based on data obtained from nutritional analysis and animal studies, a range of human doses can be determined. ru.

[0371] When administering the siRNA, drug composition and / or siRNA complex described in this disclosure For example, for a male or female crab-eating macaque, 3-5 years old, weighing 2-6 kg, si As for the amount of RNA, (i) for the siRNA complex, the siRNA dose is 0.001 It may be ~100 mg / kg body weight, and in some embodiments it may be 0.01~50 mg / This is kg body weight, and in some embodiments it is 0.05 to 20 mg / kg body weight, and further In some embodiments, it is 0.1 to 15 mg / kg body weight, and in some other embodiments... In terms of administration, the dose is 0.1 to 10 mg / kg body weight, and (ii) siRNA and pharmaceutically For drug compositions formed with an acceptable carrier, the siRNA dose is 0.001 It may be ~50 mg / kg body weight, and in some embodiments it may be 0.01~10 mg / kg This is g body weight, and in some embodiments it is 0.05 to 5 mg / kg body weight, and some In the embodiment, the concentration is 0.1 to 3 mg / kg body weight.

[0372] In some embodiments, the Disclosure relates to the siRNA and / or drug compositions of the Disclosure. and / or bring an effective amount of the siRNA complex into contact with hepatocytes, and / Alternatively, the drug composition and / or siRNA complex may be introduced into the hepatocytes, and by the RNA interference mechanism The objective is to suppress the expression of the PCSK9 gene in hepatocytes, The present invention provides a method for suppressing the expression of the PCSK9 gene in cells. The hepatocytes are SMMC- Selected from liver cancer cell lines such as 7721, HepG2, Huh7, or isolated primary hepatocytes. This may also be the case. In some embodiments, the cells are HepG2 liver cancer cells.

[0373] The method provided herein suppresses the expression of the PCSK9 gene in cells. Modified siRNA, drug composition and / or siRNA in siRNA complex provided The dosage is generally such that it can reduce the expression of the target gene, and on the surface of target cells, it is 1 pM to 1 μM. This ranges from 0.01 nM to 100 nM, or from 0.05 nM to 50 nM, or from 0.05 nM to approximately 5 nM. This is the amount that results in the extracellular concentration of M. The amount required to achieve this local concentration depends on the delivery method and delivery The site of delivery, the number of cell layers between the delivery site and the target cells or tissue, the delivery route (local or systemic), etc. It varies depending on various factors, including the delivery site. The concentration may be significantly higher than that in [location].

[0374] <Kit> This disclosure relates to at least one of the modified siRNAs, drug compositions, and siRNA complexes of this disclosure. We provide a kit containing an effective amount of seeds.

[0375] In some embodiments, the kit described herein includes a container for modified siRNA. It is possible to provide. In some embodiments, the kit described herein is The container may include a container that provides pharmaceutically acceptable excipients. Furthermore, the aforementioned kit may contain other ingredients, such as stabilizers or preservatives. In several embodiments, the kit described herein is modified according to the specifications described herein. The container providing the iRNA may contain at least one other therapeutic agent in a separate container. In several embodiments, the kit comprises modified siRNA and a pharmaceutically acceptable carrier. It may also include instructions for mixing in and / or additives or other ingredients (if any).

[0376] In the kit of this disclosure, the modified siRNA and a pharmaceutically acceptable carrier and / or Additives, as well as the modified siRNA, drug composition and / or siRNA complex and / or The complex and / or pharmaceutically acceptable additives may be in any form, e.g., liquid form, dry form. It may be provided in a dried form or a freeze-dried form. In some embodiments, the repair Decorative siRNA and pharmaceutically acceptable carriers and / or additives, and the drug composition, and / or complexes and any pharmaceutically acceptable additives are basically clean and / or It is sterile. In some embodiments, sterile water can be provided in the kit of this disclosure. Cut.

[0377] The present disclosure will be further illustrated below by examples, but the present disclosure is not limited in any way. do not have. [Examples]

[0378] Unless otherwise specified, the reagents and culture media used in the following examples are all commercially available products. The nucleic acid electrophoresis and real-time PCR procedures used are all performed by Mole. cular Cloning(Cold Spring Harbor Laborat This is done by referring to the method described in Ory Press (1989).

[0379] siRNA, siRNA complex or When cells are transfected with negative control siRNA or siRNA complex, Lipofectamine as a transfection reagent TM2000 (Invit For specific instructions, please refer to the manufacturer's manual. That.

[0380] Unless otherwise specified, all reagent ratios provided below are expressed as volume ratios (v / v). It will be calculated.

[0381] All experimental data

number

[0382] (Preparation Example 1) Preparation of Complex 1 In this preparation example, complex 1, number L10-siPCSKa1M1S, shown in Table 3, is synthesized. The siRNA complexed in the complex corresponds to the sense strand of complex 1 in Table 3. It has an antisense strand sequence.

[0383] (1-1) Synthesis of L-10 compounds The L-10 compound was synthesized according to the following method.

[0384] [ka]

[0385] (1-1-1) Synthesis of the composite terminal segment GAL-5 [ka]

[0386] (1-1-1a) Synthesis of GAL-2 100.0g of GAL-1 (N-acetyl-D-galactosamine hydrochloride, CAS number: Purchased on March 8, 1772, from Ningbo Hongxiang Biochemical Company, 1000 ml of 463.8 mmol. Dissolve in anhydrous pyridine and dissolve in 540 ml of anhydrous acetic acid (purchased from Enox) in an ice bath. Add 5565.6 mmol) and stir at room temperature for 1.5 hours. The reaction solution was then placed in 10 L of ice water. Inject into, filter under reduced pressure and suction, wash the cake with 2L of ice water, and then ace until completely dissolved. Add a tonitrile / toluene mixed solvent (volume ratio of acetonitrile:toluene = 1:1), The solvent was evaporated to dryness, yielding 130.0 g of a white solid product, GAL-2.

[0387] (1-1-1b) Synthesis of GAL-3 The GAL-2 (35.1g, 90.0 mmol) obtained in step (1-1-1a) was divided into 21 Dissolve in 3 ml of anhydrous 1,2-dichloroethane and steep in an ice bath under nitrogen protection conditions until 24.0 g of trimethylsilyl trifluoromethanesulfonate (TMSOTf, CAS No.: 27) Add 607-77-8 (purchased from Maclin, 108.0 mmol) and incubate overnight at room temperature. They responded.

[0388] Dilute the reaction solution by adding 400 ml of dichloromethane, filter it through diatomaceous earth, and add 1 L of saturated carbon Add an aqueous solution of sodium oxyhydrogen, stir uniformly, separate the organic phase, and collect the aqueous phase from dichloroethane. The extraction was performed twice with 300ml each time, combining the organic phases, and then 300ml of saturated solution was added for each extraction. Wash with sodium bicarbonate aqueous solution and 300 ml of saturated saline solution to separate the organic phase, and then anhydrous The mixture was dried with sodium sulfate, and the solvent was evaporated under reduced pressure to dryness, yielding 26.9 g of a pale yellow, viscous, syrup-like substance. Product GAL-3 was obtained.

[0389] (1-1-1c) Synthesis of GAL-4 The GAL-3 (26.9g, 81.7 mmol) obtained in step (1-1-1b) was divided into 13 Dissolve in 6 ml of anhydrous 1,2-dichloroethane, add 30 g of dried 4 Å molecular sieve powder, 9.0g of 5-hexen-1-ol (CAS number: 821-41-0, Adamas- Purchased from Beta, add 89.9 mmol), stir at room temperature for 30 minutes, and then in an ice bath and nitrogen. Under subsurface protection, add 9.08 g of TMSOTf (40.9 mmol) and stir overnight at room temperature. The 4Å molecular sieve powder was filtered off, and 300 ml of dichloromethane was added to the filtrate to dilute it. Filter with diatomaceous earth, add 500 ml of saturated sodium bicarbonate solution and stir for 10 minutes. Wash, separate the organic phase, extract the aqueous phase once with 300 ml of dichloroethane, and remove the organic phase. In addition, 300 ml of saturated sodium bicarbonate solution and 300 ml of saturated saline solution were used. Wash, separate the organic phase, dry with anhydrous sodium sulfate, evaporate the solvent under reduced pressure to dryness, 4 1.3 g of a yellow, syrup-like product, GAL-4, was obtained and, without purification, proceeded directly to the next oxidation reaction. went.

[0390] (1-1-1d) Synthesis of GAL-5 GAL-4 (14.9g, 34) obtained by the method described in step (1-1-1c) Dissolve 0.7 mmol) in a mixed solvent of 77 ml of dichloromethane and 77 ml of acetonitrile. Dissolve the mixture in 103 ml of deionized water and 29.7 g of sodium periodate (CA). S number: 7790-28-5, purchased from Aladdin, with 138.8 mmol added. Stir in an ice bath for 10 minutes to remove ruthenium(III) chloride (CAS number: 14898-6 Add 7-0 (purchased from Energy, 238 mg, 1.145 mmol) and leave at room temperature. The reaction was carried out in the evening. 300 ml of water was added to the reaction solution to dilute and stir, and saturated sodium bicarbonate was added. In addition, the pH was adjusted to approximately 7.5, the organic phase was separated and discarded, and the aqueous phase was treated with dichloromethane once. The mixture was extracted three times using 200ml of liquid, and the organic phase was discarded. The pH of the aqueous phase was adjusted to approximately 3 using solid citric acid. The organic phase was then combined with dichloromethane, extracted three times at 200 ml each time, and then subjected to anhydrous sulfurous acid extraction. Dry with sodium acid, evaporate the solvent under reduced pressure to dryness, and obtain 6.85 g of white foamy solid product GAL I got -5. 1 H NMR (400 MHz,DMSO) δ 12.01 (br, 1H),7.83 (d,J = 9.2 Hz,1H),5.21 (d,J = 3 .2 Hz,1H),4.96 (dd,J = 11.2,3.2 Hz,1H),4 .49 (d,J = 8.4 Hz,1H),4.07-3.95 (m,3H),3 .92-3.85 (m,1H),3.74-3.67 (m,1H),3.48-3. 39 (m,1H),2.20 (t,J = 6.8 Hz,2H),2.11 (s ,3H),2.00 (s,3H),1.90 (s,3H),1.77 (s,3H) ,1.55-1.45 (m,4H).

[0391] (1-1-2) Synthesis of L-8 [ka]

[0392] J-0 (9.886g, 52.5mmol, purchased from Alpha Acer) and process ( 1-1-1) GAL-5 obtained (72.819 g, 162.75 mmol, multiple lo Dissolve the combined product (of the set) in 525 ml of dichloromethane, and diisopropyl Ethylamine (DIEA, 44.782g, 346.50mmol), benzotriazole Lu-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate / es Tel (PyBOP, 90.158g, 173.25mmol) and hydroxybenzotri Add azole (HOBt, 23.410 g, 173.25 mmol) and react at room temperature for 4 hours. Then, wash by adding 20 ml of saturated sodium bicarbonate and 200 ml of saturated saline solution. The aqueous phase was extracted twice with dichloromethane at a rate of 100 ml each time, and the organic phase was combined with anhydrous sulfur. The crude product was obtained by drying with sodium acid, filtering, and then evaporating the solvent under reduced pressure to dryness. Using 200-300 mesh normal-phase silica gel, and 10 wt% triethylamine, Neutralize the acidity of Kagel, equilibrate the column with 1 wt‰ triethylamine, and dichloromethane Gradient elution was performed using methanol at a ratio of 100:25 to 100:40, and the product eluate was collected. The mixture was evaporated under reduced pressure to dryness to obtain 38.8 g of pure L-8. 1 1H NMR (400 MHz) ,DMSO) δ 7.84 (d,J = 9.0 Hz,3H),7.27-7.2 3 (m,1H),7.13-7.18 (m,1H),5.22 (d,J = 3. 1 Hz,3H),4.97 (dd,J = 11.3,3.1 Hz,3H),4. 48 (d,J = 8.4 Hz,3H),4.09-3.98 (m,9H),3. 88 (dd,J = 19.3,9.3 Hz,3H),3.75-3.66 (m, 3H),3.44-3.38 (m,3H),3.17-3.30 (m,4H),3. 10-2.97 (m,4H),2.35-2.20 (m,6H),2.15-2.0 8 (m,9H),2.07-1.98 (m,13H),1.94-1.87 (m, 9H),1.81-1.74 (m,9H),1.65-1.42 (m,18H). MS m / z:C 85 H 119 N7O 30 [M+H] + Theoretical value: 1477.59, Actual Measured value: 1477.23.

[0393] (1-1-3a) Synthesis of A-1 [ka]

[0394] DMTrCl(4,4'-bismethoxytrityl chloride, 101.65g, 300ml) Dissolve (mol) in 1000 ml of anhydrous pyridine and hydrate DL-glycerate calcium Add the substance (28.63g, 100 mmol), react at 45°C for 20 hours, and filter the reaction solution. Rinse the cake with 200 ml of DCM, concentrate the filtrate under reduced pressure until dry, and use 500 ml of the remainder. Dissolve again in 1 liter of dichloromethane and 0.5 M triethylamine phosphate (pH=7~ 8) Wash twice with 200 ml each time, and rinse the aqueous phase with dichloromethane, 20 ml each time. Extract twice with 0 ml, combine the organic phases, dry with anhydrous sodium sulfate, filter, and remove the solvent. The solution is evaporated to dryness under reduced pressure, purified using a normal-phase silica gel column with a 200-300 mesh size, and then processed into petroleum ether. L:ethyl acetate:dichloromethane:methanol = 1:1:1:0.35~1:1:1:0 Gradient elution was performed at 0.55, the product eluate was collected, the solvent was evaporated under reduced pressure to dryness, and 600 ml of the solution was added. Dissolve again in lolomethane and wash once with 200 ml of 0.5 M triethylamine phosphate. The solution is purified, the aqueous phase is extracted once with 200 ml of dichloromethane, and the organic phase is combined with anhydrous sodium sulfate. Dry with alum, filter, evaporate the solvent under reduced pressure to dryness, and then reduce pressure overnight with a vacuum oil pump for 50°C. A 7g white solid product A-1 was obtained. 1 1H NMR (400 MHz, DMSO-d6) δ 7.46 (ddd,J = 6.5,2.3,1.1 Hz,1H),7.40 -7.28 (m,7H),6.89-6.81 (m,4H),4.84 (d,J = 5.0 Hz,1H),4.36-4.24 (m,1H),4.29 (s,6H ),3.92 (dd,J = 12.4,7.0 Hz,1H),3.67 (dd, J = 12.3,7.0 Hz,1H),2.52 (q,J = 6.3 Hz,6 H),1.03 (t,J = 6.3 Hz,9H).MS m / z:C 24 H 23 O6, [MH] - Theoretical value: 407.15, measured value: 406.92.

[0395] (1-1-3b) Synthesis of L-7 [ka]

[0396] L-8 obtained in process (1-1-2) (40g, 27.09 mmol, multiple lots) (combining the products) and A-1 obtained in process (1-1-3a) (41.418g, 81 Mix with (0.27 mmol) and dissolve in 271 ml of dichloromethane, then add 3-diethoxy Phosphoryl-1,2,3-benzoxazole 4(3H)-one (DEPBT) (24. Add 318g (81.37 mmol), and further add diisopropylethylamine (21.0 Add 0.7g (162.54 mmol) and stir at 25°C for 1.5 hours, then add 800ml The organic phase is washed with saturated sodium bicarbonate, and the aqueous phase is washed with dichloromethane, 50 ml per cycle. Extract three times with 1 ml, wash the organic phase with 150 ml of saturated saline solution, and remove the aqueous phase with 50 ml of dichloroethylene solution. Extract once with methane, combine with the organic phase, dry with anhydrous sodium sulfate, filter, and then dissolve. The agent was evaporated to dryness under reduced pressure, and then foam-dried overnight using a vacuum oil pump to obtain the crude product. For column purification... Using 2 kg of 200-300 mesh normal-phase silica gel, add 200 ml of triethyl alcohol. The acidity of the silica gel was neutralized with amine, and then colored with petroleum ether containing 1 wt% triethylamine. Equilibrate the mixture: petroleum ether: ethyl acetate: dichloromethane: N,N-dimethylformaldehyde Gradient elution was performed with a mid ratio of 1:1:1:0.5 to 1:1:1:0.6, and the product eluate was collected. The solvent was evaporated under reduced pressure to dryness to obtain 40.4 g of pure L-7. 1 1H NMR (400 M) Hz,DMSO) δ7.90-7.78 (m,4H),7.75-7.64 (m, 1H),7.38-7.18 (m,9H),6.91-6.83 (m,4H),5. 25-5.10 (m,4H),4.97 (dd,J = 11.2,3.2 Hz, 3H),4.48-4.30 (m,4H),4.02 (s,9H),3.93-3. 84 (m,3H),3.76-3.66 (m,9H),3.45-3.35 (m, 3H),3.24-2.98 (m,10H),2.30-2.20 (m,2H),2 .11-1.88 (m,31H),1.80-1.40 (m,28H). MS m / z:C 90 H 128 N7O35 [M-DMTr] + Theoretical value: 1564.65, actual measurement Value: 1564.88.

[0397] (1-1-4) Synthesis of L-9 [ka]

[0398] L-7 (40g, 21.4247 mmol) obtained in process (1-1-3b), succinate Acid anhydride (4.288 g, 42.8494 mmol) and 4-dimethylaminopyridine ( Mix DMAP (5.235g, 42.8494mmol) in 215ml of dichloromethyl Dissolve in tan, and further diisopropylethylamine (DIEA, 13.845g, 10 Add 7.1235 mmol) and stir at 25°C for 24 hours, then add 800 ml of 0.5 M triethyl alcohol. Wash the reaction mixture with luminamine phosphate, and rinse the aqueous phase with dichloromethane at a rate of 5 ml per rinse, for a total of three rinses. Extraction, combination of organic phases, and evaporation to dryness under reduced pressure were performed to obtain the crude product. For column purification, 1 kg of 2 Using normal-phase silica gel of 00-300 mesh, with 1 wt% triethylamine, silica gel The acidity is neutralized, the column is equilibrated with dichloromethane, and 1 wt‰ triethylamine is added. Gradient elution was performed using dichloromethane:methanol = 100:18 to 100:20, and the product eluate was obtained. The sample was recovered, and the solvent was evaporated to dryness under reduced pressure to obtain 31.0 g of pure L-9 composite molecules. 1 HN MR (400 MHz,DMSO) δ 8.58 (d,J = 4.2 Hz,1 H),7.94-7.82 (m,3H),7.41-7.29 (m,5H),7.2 2 (d,J = 8.1 Hz,5H),6.89 (d,J = 8.3 Hz,4 H),5.49-5.37 (m,1H),5.21 (d,J = 3.0 Hz,3 H),4.97 (d,J = 11.1 Hz,3H),4.49 (d,J = 8 .2 Hz,3H),4.02 (s,9H),3.88 (dd,J = 19.4, 9.4 Hz,3H),3.77-3.65 (m,9H),3.50-3.39 (m ,6H),3.11-2.90 (m,5H),2.61-2.54 (m,4H),2 .47-2.41 (m,2H),2.26-2.17 (m,2H),2.15-1. 95 (m,22H),1.92-1.84 (m,9H),1.80-1.70 (m ,10H),1.65-1.35 (m,17H),1.31-1.19 (m,4H) ,0.96 (t,J = 7.1 Hz,9H). MS m / z:C 94 H 132 N 7O 38 [M-DMTr] + Theoretical value: 1664.72, measured value: 1665.03.

[0399] (1-1-5) Synthesis of L-10 compounds [ka]

[0400] In this process, the L-9 composite molecule is bonded to the solid support, thereby forming the L-10 compound We prepared it.

[0401] L-9 composite molecule obtained in step (1-1-4) (22.751 g, 11 mmol), O -Benzotriazole-tetramethyluronium hexafluorophosphate / ester (HBTU, 6.257g, 16.5mmol) and diisopropylethylamine (DI Mix EA (2.843g, 22 mmol) and dissolve in 900ml of acetonitrile. Stir at room temperature for 5 minutes, and add aminomethyl resin (88g, 100-200 mesh) to the reaction solution. Add the amino group-supported compound (400 μmol / g, purchased from Minamikai Kazunari Co., Ltd.) and shake at 25°C. The reaction was carried out at 150 revolutions per minute for 18 hours, then filtered, and the cake was DC Rinse twice with 300ml each time, then rinse with acetonitrile, 300ml each time. Rinse three times, dry for 18 hours using a vacuum oil pump, and then use raw materials according to the mixing ratios shown in Table 2. (CapA, CapB, 4-dimethylaminopyridine (DMAP), and acetonitrile) The capping reaction was carried out by adding [the substance]. The mixture was left to stand in a shaker at 25°C and rotated at 150 rpm / Allow the reaction to proceed for 5 hours, filter the reaction solution, and dry the cake in acetonitrile at a rate of 300 ml per batch. Rinse three times with 1, evaporate the solvent under reduced pressure until dry, and dry under reduced pressure overnight using a vacuum oil pump. 0.2 g of L-10 compound with a supported weight of 90.8 μmol / g (i.e., L-10 compound bonded to a solid support) -9 A composite molecule was obtained.

[0402] [Table 2]

[0403] Here, CapA and CapB are capping reagent solutions, and CapA is 20 volumes. This is a pyridine / acetonitrile mixture solution of % N-methylimidazole, and contains pyridine and a The volume ratio with cetonitrile is 3:5, and CapB is 20 vol% acetonitrile anhydride. This is Toll's solution.

[0404] (1-2) Synthesis of the sense strand of complex 1 Starting with the L-10 compound prepared in the above step by the solid-phase phosphoramidite method The nucleotides are rotated and, following the sequence of nucleotides in the sense strand, one nucleocytose is added in each direction from 3' to 5'. The sense strand of siRNA complex 1 in Table 3 was synthesized by attaching the monomer. Each time a side monomer is bonded, deprotection, coupling, capping, oxidation, or sulfidation occurs. Four reactions were performed. When two nucleotides are bonded together by a phosphate ester, the following occurs: When nucleoside monomers are bonded, deprotection, coupling, capping, and oxidation occur. Four reactions were performed. When two nucleotides are bonded by a thiophosphate ester. When the next nucleoside monomer is attached, protection, coupling, capping, and sulfidation occur. The following four reactions were carried out. The synthesis conditions were defined as follows:

[0405] Nucleoside monomers are provided in a 0.1 M acetonitrile solution, and each deprotection reaction is performed. The conditions are the same, namely the temperature is 25°C, the reaction time is 70 seconds, and the deprotection reagent is It is a dichloromethane solution (3% v / v) of dichloroacetic acid, and dichloroacetic acid and a solid support The molar ratio of the 4,4'-dimethoxytrityl protecting group to the protecting group was 5:1.

[0406] The conditions for each coupling reaction are the same: the temperature is 25°C, and the solid support is... The molar ratio of the bound nucleic acid sequence to the nucleoside monomer is 1:10, and it binds to a solid support. The molar ratio of the nucleic acid sequence to be coupled to the coupling reagent is 1:65, and the reaction time is 600 seconds. The coupling reagent is 5-ethylthio-1H-tetrazole (5-(Ethyl This was a 0.5 M acetonitrile solution of thio)-1H-tetrazole (ETT). Ta.

[0407] The capping conditions were all the same: a temperature of 25°C and a reaction time of 15 It took seconds. The capping reagent solution is a mixture of CapA and CapB in a molar ratio of 1:1. It is a solution, and the molar ratio of the capping reagent to the nucleic acid sequence bound to the solid support is acetic anhydride. The ratio of substance:N-methylimidazole to the nucleic acid sequence bound to the solid support was 1:1:1.

[0408] The conditions for each oxidation reaction are the same: the temperature is 25°C, the reaction time is 15 seconds, and the acid The chemical reagent was iodine solution with a concentration of 0.05 M. Iodine and solid phase in the coupling process. The molar ratio of the nucleic acid sequence bound to the support was 30:1. The reaction was carried out using tetrahydrofuran: The procedure was performed using a mixed solvent of water and pyridine in a ratio of 3:1:1.

[0409] The conditions for each sulfidation reaction were the same: the temperature was 25°C and the reaction time was 300 seconds. The sulfidating agent was xanthan hydride. The sulfidating agent and the solid-phase carrier in the coupling process. The molar ratio of the nucleic acid sequence bound to the body was 120:1. The reaction was carried out using acetonitrile:pyrazole. The procedure was performed using a 1:1 mixture of din and solvent.

[0410] After the binding of the last nucleoside monomer is complete, the nucleic acid sequence bound to the solid support Then, after sequentially performing cleavage, deprotection, purification, and desalting, the sense chain was obtained by freeze-drying.

[0411] The cleavage and deprotection conditions are as follows: The synthesized support is bound to the nucleotide. The column was added to a 25 wt% ammonia solution, and the volume of the ammonia solution was 0.5 ml / μmol. The mixture was reacted at 55°C for 16 hours, the remaining support was filtered off, and the supernatant was vacuum concentrated until dry. did.

[0412] The purification and desalting conditions are as follows: Preparative ion chromatography purification column. Nucleic acid purification was completed by gradient elution with NaCl using (Source 15Q). Specifically, the eluent A is 20 mM sodium phosphate (pH 8.1), and the solvent is water / acetone. The nitrile ratio is 9:1 (by volume), and the eluent B consists of 1.5M sodium chloride and 20mM phosphorus. The solution is sodium acetate (pH 8.1), and the solvent is water / acetonitrile in a volume ratio of 9:1. Elution gradient: Eluting agent A:Eluting agent B = 100:0 to 50:50. Product eluate was obtained. After recovery and combination, desalting was performed using a reverse-phase chromatography purification column, and specific conditions were determined. Then, desalting is performed using a dextran gel column, and the packing material is dextran gel G25 (Sep It was Hadex G25 and eluted with deionized water.

[0413] The detection method is as follows: Ion exchange chromatography (IEX-HPLC) The purity of the sense chain is detected using the above method, and liquid chromatography-mass spectrometry (LC-MS) is performed. The molecular weight was analyzed using this method. The measured value matched the theoretical value, and an L-9 complex molecule was found at the 3' end. This demonstrated that a composite sense strand SS was synthesized.

[0414] (1-3) Synthesis of the antisense chain of complex 1 The solid-phase phosphoramidite method allows for the production of general-purpose solid-phase supports (UnyLinker TM loa ded NittoPhase(registered trademark)HL Solid Supports, Ki Starting from Novate Life Sciences, the cycle is repeated as shown in Table 3. The antisense chain of combination 1 was synthesized. Deprotection, coupling, and caching in solid-phase synthesis methods. Conditions for topping, oxidation or sulfidation reactions, cleavage and deprotection, purification and desalting are used for the synthesis of sense chains. The same procedure was followed. Then, freeze-drying was performed to obtain the antisense chain. Ion exchange chromatography was used. The purity of the antisense chain was detected by IEX-HPLC, and liquid chromatography was used. -Molecular weight was analyzed by mass spectrometry (LC-MS). As a result, the measured value matched the theoretical value. This demonstrated that an antisense strand AS having the target sequence was synthesized.

[0415] (1-4) Synthesis of Complex 1 For complex 1, the sense chain and antisense chain are dissolved in sterile water for injection, and 40 ml of water is prepared. After obtaining a g / mL solution, mixing in equimolar ratios, heating at 50°C for 15 minutes, and cooling at room temperature, The product was annealed and freeze-dried to obtain a freeze-dried powder. Ultrapure water (Mil The composite was diluted using an li-Q ultrapure water system (resistivity 18.2 MΩ*cm (25℃)). After adjusting the concentration to 0.2 mg / mL, the sample was measured using a liquid chromatography-mass spectrometer (LC-MS, L iquid Chromatography-Mass Spectrometry, W Molecular weight was detected using a device purchased from Aters (model number: LCT Premier). The value matches the theoretical value, and the synthesized siRNA complex 1 contains the L-9 complex molecule. It was shown to be a double-stranded nucleic acid sequence of a specific design. Its structure is shown in formula (403), and The combined siRNA sequences are shown in Table 3 as complex 1 (L10-siPCSKa1M1S It was an array corresponding to (also known as).

[0416] (Preparation Example 2) Preparation of Complexes 2-7 The sense strand and antisense strand sequences are shown in Table 3 as complex 2, complex 3, and complex The sense strand and antisensor of the siRNA compounded in body 4, complex 5, complex 6, or complex 7 Except for synthesizing the sequence of the chain, the preparations shown in Table 3 were made using the same method as in Preparation Example 1. Complexes 2-7 were synthesized and their molecular weights were detected. This yielded complexes 2-7. Ta.

[0417] Table 3 shows the complex number and siRNA sequence composition.

[0418] [Table 3]

[0419] (Preparation Example 3) Synthesis of siRNA Sequence 1) For sense chains, a general-purpose solid support (UnyLinker) is used. TM load NittoPhase(R) HL Solid Supports, Kinova Starting with te Life Sciences, the company created a cycle. 2) For the antisense strand, the sequence of siRNA 1 is compounded into complex 1. Compared to the antisense strand sequence of NA, the antisense strand of siRNA 1 has a 5'-terminus 1 It has a 5'-phosphate group at the nucleotide number. Therefore, by the solid-phase phosphoramidite method... In the process of preparing the antisense chain, the last nucleoside monomer of the antisense chain After bonding, four reactions are carried out: deprotection, coupling, capping, and oxidation. RI monomer (Suzhou Jima, number Cat#13-2601-XX) in 5 antisense chains The preparation method is the same as in Example 1, except that it is bonded to the terminal and forms a 5'-phosphate ester modification. siRNA 1, shown in Table 4, was synthesized using this method.

[0420] [ka]

[0421] The conditions for the deprotection, coupling, capping, and oxidation reactions used in the bond in question, The conditions for cleavage and deprotection, purification and desalting were the same as those for the sense chain synthesis.

[0422] The nucleic acid sequences of the sense strand and antisense strand of siRNA are shown in Table 4. Other than being synthesized to form the sense and antisense strand sequences for NA 2, si siRNA 2 was prepared using the same method as for RNA 1, and siRNA 2 was obtained.

[0423] The nucleic acid sequences of the sense strand and antisense strand of siRNA are shown in Table 4. Sense strands corresponding to NA 3, siRNA 4, siRNA 5, or siRNA 6 and Synthesized to form an antisense strand sequence, and the 5'-end of the antisense strand of these siRNAs Because the first nucleotide has a 5'-thiophosphate modification, CPR-I mono When MAR is attached, the conditions for the sulfurization reaction are used instead of the conditions for the oxidation reaction described above, and 5'-thio Aside from obtaining an antisense chain with phosphate ester modification, the preparation of siRNA 1 was successful. siRNAs 3-6 were prepared using the same method as in the manufacturing process. Thus, each siRNA was obtained. 3. siRNA 4, siRNA 5, or siRNA 6 was obtained.

[0424] Table 4 shows the siRNA numbers and siRNA sequence compositions.

[0425] [Table 4]

[0426] (Experimental Example 1) Inhibitory activity of siRNA and off-tank in an in vitro psiCHECK system Detection of the -get effect

[0427] In this experimental example, each of the siRNAs 1-6 was measured in the in vitro psiCHECK system. Suppression of target plasmid expression by sense strand, sense strand and antisense strand of each siRNA Detection of off-target plasmid expression repression by seed region or sense strand seed region. As a result, the on-target activity and off-target effects of the siRNAs disclosed herein were evaluated. It was worth it.

[0428] Kumico Ui-Tei et.al.,Functional dissect ion of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammalia n gene silencing with significantly redu ced off-target effect. Nucleic Acids Res In accordance with the method described in earch, 2008.36(7), 2136-2151, the test plastic Construct the smid and introduce the test plasmid and test siRNA into HEK293A cells. Sfection occurs, and the expression level of the dual luciferase reporter gene determines si The on-target activity and off-target effects of RNA were reflected. The specific steps are as follows: It is as follows:

[0429] [1] Construction of the test plasmid

[0430] psiCHECK TM-2(Promega TM Using plasmids, four types of test plasmids Rasmid was constructed, and within it, GSCM showed an on-target plasmid, while PSCM and G SSM and PSSM showed off-target plasmids.

[0431] (1) GSCM detects the on-target activity of the antisense strand of siRNA. The target sequence is used and contains a region that is completely complementary to the antisense strand sequence of the test siRNA. The target sequence in GSCM corresponding to siRNA 1, 2, 4, 5, and 6 is the sequence number. This is shown in 373. 5'-GGCGTGCCTGCCAAGCTCACACAGCAGGAACTGAGC CAGAAACGGAGATTGGGCTGGCTCTGAAGCCAAGCCTCTT CTTACTTCACCCGGCTGGGCTCCTCATTTTTACGGGTAAC AGTGAGGCTGGGAAGGGGAACACAGACCAGGAAGCTCGGT GAGTGATGGCAGAACGATGCCTGCAGGCATGGAACTTTTT CCGTTATCACCCAGGCCTGATTCACTGGCCTGGCGGAGAT GCTTCTAAGGCATGGTCGGGGGAGAGGGCCAACAACTGTC CCTCCTTGAGCACCAGCCCCACCCAAGCAAGCAGACATTT ATCTTTTGGGTCTGTCCTCTCTGTTGCCTTTTTACAGCCA ACTTTTCTAGACCTGTTTTGCTTTTGTAACTTGAAGATAT TTATTCTGGGTTTTGTAGCATTTTTATTAATATGGTGACT TTTTAAAATAAAAACAAACAAACGTTGTCCTAACAAAAAA AAAAAAAAAAAAAAA-3'(Sequence ID 373)

[0432] The target sequence in GSCM corresponding to siRNA 3 is shown as sequence number 374. 5'-GCGTGGCCAAGGGTGCCAGCATGCGCAGCCTGCGCG TGCTCAACTGCCAAGGGAAGGGCACGGTTAGCGGCACCCT CATAGGCCTGGAGTTTATTCGGAAAAGCCAGCTGGTCCAG CCTGTGGGGCCACTGGTGGTGCTGCTGCCCCTGGCGGGTG GGTACAGCCGCGTCCTCAACGCCGCCTGCCAGCGCTGGC GAGGGCTGGGGTCGTGCTGGTCACCGCTGCCGGCAACTTC CGGGACGATGCCTGCCTCTACTCCCCAGCCTCAGCTCCCG AGGTCATCACAGTTGGGGCCACCAATGCCCAAGACCAGCC GGTGACCCTGGGGACTTTGGGGACCAACTTTGGCCGCTGT GTGGACCTCTTTGCCCCAGGGAGGACATCATTGGTGCCT CCAGCGACTGCAGCACCTGCTTTGTGTCACAGAGTGGGAC ATCACAGGCTGCTGCCCACGTGGCTGGCATTGCAGCCATG ATGCTGTCTGCCGAGCCGGAGCTCACCCTGGCCGAGTTGA GGCAGAGACTGATCCACTTCTCTGCCAAAGATGTCATCAA TGAGGCCTGGTTCCCTGAGGACCACGGGGTACTG-3' (sequence Number 374)

[0433] (2) PSCM was used to detect off-target effects of the sense strand, and the subjects It contains a target sequence that perfectly matches the antisense strand sequence of the iRNA, corresponding to each siRNA. The target sequence in the PSCM is shown in Table 5a.

[0434] [Table 5a]

[0435] (3) GSSM detects off-target effects in the seed region of the antisense chain. The target sequences in GSSM corresponding to each siRNA are shown in Table 5b.

[0436] [Table 5b]

[0437] (4) PSSM is used to detect off-target effects in the seed region of the sense strand. The target sequences in the PSSM corresponding to each siRNA are shown in Table 5c.

[0438] [Table 5c]

[0439] Each of the above target sequences is psiCHECK'd. TM -2 plasmid Xho Cloned to the I / Not I site.

[0440] [2] Cell culture and transfection (1) Cotransfection of GSCM and siRNA-1 10% fetal bovine serum (FBS, HyClone) and 0.2% by volume of penicillin - Streptomycin (Penicillin-Streptomycin, HyClon) HEK293A cells (Nanjing) were cultured in H-DMEM complete medium (HyClone) containing (e company). (Purchased from Bai Biotechnology Co., Ltd.) in a 5% CO2 / 95% air incubator The cells were cultured at 37°C.

[0441] 8 × 10⁶ HEK293A cells 3 Inoculate cells / well into a 96-well plate and inoculate for 16 hours. Later, when the cell growth density reaches 70-80%, the H-DMEM complete medium in the culture wells is used. Remove all aspirated material, then add 80 μl of Opti-MEM medium (GIBCO) to each well. The culture was then continued for 1.5 hours.

[0442] The GSCM test plasmid was diluted with DEPC-treated water to obtain a 200 ng / μl test plasmid. A dilution standard solution of smid (working solution) was used. DEPC treated water was used. Then, from siRNA 1, the concentrations were 1000nM, 333nM, 111nM, and 37.0n M, 12.3nM, 4.12nM, 1.37nM, 0.46nM, 0.15nM, 0.0 A total of 11 siRNA dilution standard solutions were prepared, with concentrations of 5 nM and 0.017 nM. .

[0443] Prepare solutions A1 to A11, and each of the A1 to A11 solutions will be used in the following order at the 11 concentrations mentioned above. 1 μl of diluted siRNA standard solution, 0.05 μl of diluted test plasmid standard solution (test plasmid plus Contains 10 ng of midi and 10 μl of Opti-MEM medium.

[0444] Prepare solution B, and each solution B contains 0.2 μl of Lipofectamine. TM 200 Contains 0 and 10 μl of Opti-MEM medium.

[0445] Prepare solution C, and each solution C contains 0.05 μl of the test plasmid diluted standard solution (test plasmid Contains 10 ng of midi and 10 μl of Opti-MEM medium.

[0446] Mix one B solution with one A1-A11 solution and one C solution in sequence, at room temperature. The cells were cultured for 20 minutes to obtain 12 transfection complexes X1-X12. Three infection complexes were fabricated.

[0447] Add transfection complexes X1-X11 to the culture wells at a rate of 20 μl / well. Add each of the ingredients and mix uniformly to create three transfections with the same siRNA concentration. The siRNA complex was added to three different culture wells, and the final siRNA concentrations were each 10nM, 3.33nM, 1.11nM, 0.37nM, 0.123nM, 0.0412 nM, 0.0137nM, 0.0046nM, 0.0015nM, 0.0005nM and A cotransfection mixture with a concentration of 0.00017 nM was obtained and designated as test groups 1 to 11.

[0448] Transfection complex X was added to three other culture wells at a rate of 20 μl / well. Each of the 12 was added to obtain a transfection mixture that did not contain siRNA, and the control group and did.

[0449] Cotransfection mixture containing siRNA and transfection mixture without siRNA After transfection of the ion mixture in the culture wells for 4 hours, 20% per well 100 μl of FBS-containing H-DMEM complete medium was added. The 96-well plate was then heated in CO2. The culture was continued in an incubator for 24 hours.

[0450] (2) Cotransfection of plasmids with other siRNAs Aside from using siRNA 2-6 sequentially instead of siRNA 1, the GSCM and si GSCM and siRNA 2-6 were cotransfected using the same method as RNA 1. Cotransfection was performed.

[0451] Aside from using PSCM instead of GSCM, the combination of GSCM and siRNA 1-6 PSCM and siRNA 1-6 are cotransfected using the same method as transfection. I took a picture.

[0452] Aside from using GSSM instead of GSCM, the combination of GSCM and siRNA 1-6 GSSM and siRNA 1-6 are cotransfected using the same method as transfection. I took a picture.

[0453] Aside from using PSSM instead of GSCM, the combination of GSCM and siRNA 1-6 PSSM and siRNA 1-6 are cotransfected using the same method as transfection. I took a picture.

[0454] [3] Detection Remove the culture medium from the culture wells by aspirating, and add 150 μl of Dual-Glo (indicated in each well). (Registered Trademark) Add a mixed solution of Luciferase reagent and H-DMEM (volume ratio 1:1) Mix thoroughly until uniform, incubate at room temperature for 10 minutes, then add 120 μl of the mixture to 9 Transfer to a 6-well ELISA plate and use Synergy II multi-function microplate. Using a Firefly processor (BioTek), Firefly is used in each well of an ELISA plate. Read the ly chemiluminescence value (Fir), and then add 60 μL to each well of the ELISA plate. Dual-Glo (registered trademark) Add Stop & Glo® reagent and mix until smooth. Mix thoroughly until it becomes one, then incubate at room temperature for 10 minutes, and then, according to the sequence of Fir read... Therefore, using a microplate reader, Re in each well of the ELISA plate The chemiluminescence value (Ren) of nilla was read.

[0455] The luminescence ratio (Ratio = Ren / Fir) of each well in the ELISA plate is calculated, and each sample The luminescence ratio of the test group or control group, Ratio(test) or Ratio(control), is measured in three culture wells. This is the average of the ratios, normalized using the emission ratio of the control group as the baseline, and the emission ratio of each test group. The ratio R (test) / Ratio (control) is obtained, and the Renilla report is then generated. This represents the expression level of the ter gene, i.e., the relative residual activity. The suppression rate of siRNA is (1-R) It is ×100%.

[0456] Different siRNAs (siRNA 1, siRNA 2, siRNA 3, siRNA 4. After transfection with siRNA 5 or siRNA 6), psiCHE From the relative residual activity of the reporter gene Renilla in the CK system, Graph The nonlinear regression analysis function of pad 5.0 software allows log(inhibitor) vs. response-Variable slope (four param (eters) The dose-effect curves were fitted, and Figures 1A to 1F show siRNA 1 to 1F in order. This is the dose-response curve for 6. Here, the logarithm of the siRNA concentration (lg nM) is used as the x-coordinate. The y-axis represents the relative residual activity (%) of Renilla, and each black circle represents the test compared to the control group. This represents the average relative residual activity of Renilla in the three culture wells of the group.

[0457] From the following function corresponding to the fitted dose-effect curve, the subject siRN IC A targets GSCM 50 The value was calculated.

[0458]

number

[0459] From the dose-effect curve and the corresponding function, the corresponding X when Y = 50% 50 value Determine the IC for each siRNA. 50 Value = 10^X 50 (nM) is calculated, IC 50 Value and R 2 The values ​​are summarized in Table 6.

[0460] [Table 6]

[0461] As can be seen from Table 6 and Figures 1A-1F, the siRNA provided in this disclosure is ex vivo High inhibitory activity in HEK293A cells, IC 50 is 0.0194~0.0561 It was nM.

[0462] Aside from using PSCM, GSSM, and PSSM instead of GSCM, the above Using the same method as described above, PSCM, GSSM and Dose-response curves for PSSM were obtained sequentially. As can be seen from the results, each siRNA was At each concentration, the corresponding off-target plasmids PSCM, GSSM, and PSSM are... It did not have any inhibitory effect on this either.

[0463] From the results above, the siRNA of this disclosure has high target specificity, and the sense strand and antisensor strand are present. Neither the seed region of the sense chain nor the seed region of the sense chain exhibited significant off-target effects. This was shown to be the case.

[0464] (Experimental Example 2) Evaluation of the efficacy of siRNA complexes in non-human primates (NHPs) We used typical crab-eating macaques aged 3-4 years (weighing 2.4-3.1 kg), grouped by weight, with 4 macaques per group, divided into two groups. The monkeys are divided into two groups, with half being female and half male, and each group has a complex of four-pronged crab-eating macaques. The drug 5 was administered as a single subcutaneous injection.

[0465] We used typical crab-eating macaques aged 4-5 years (weighing 4.0-5.5 kg), grouped by weight, with 3 macaques per group, totaling 3 individuals per group, for a total of 3 groups. They are divided into groups, and each group consists entirely of males, with each group containing complex 1, 2, or 7. It was administered as a single dose by subcutaneous injection.

[0466] Each complex was then diluted with sterile sodium chloride injection solution at a concentration of 9 mg / ml (as siRNA). Prepare the solution (same as below) and administer to each animal at a dose of 9 mg / kg in a volume of 1 ml / kg. The n days before administration were defined as Dn, the day of administration as D1, and the nth day after administration as D n was defined as n.

[0467] (2-1) Detection of PCSK9 mRNA in liver tissue For D-7 and D15, assign Complex 1, Complex 2, Complex 4, Complex 5, or Complex 7 to each group. Liver aspiration was performed on the administered cynomolgus monkeys, and liver tissue samples of approximately 2 x 2 x 8 mm were taken each time. 3 Collect the sample and add 1 ml of RNAlater preservation solution (Sigma Aldrich). Store in a 5 mL sterile EP tube, let stand in a 4°C refrigerator for 24 hours, then transfer to -80°C. I stored it there.

[0468] Subsequently, liver tissue was homogenized using a tissue homogenizer, and then Trizol (The Using RMO Fisher, extract the total RNA according to the procedure described in the instructions. We extracted the total RNA from the liver tissue.

[0469] For the total RNA extracted from the liver tissue of each animal, 1 μg of total RNA was reverse transcribed. As a template, the Goldenstar reverse transfer kit TM RT6 cDNA Sy nthesis Kit (Purchased from Beijing▲Qin▼Kexinye Biotechnology Co., Ltd., number TSK3 From the reagents provided by 01M), Goldenstar TM Oligo (dT)1 Select 7 as the primer and perform a reverse transfer according to the reverse transfer procedure in the kit instructions. A 20 μl solution was placed in the solution, and reverse transcription was performed on the total RNA of each liver. The conditions for reverse transcription and Then, each reverse transcription reaction system was heated at 50°C for 50 minutes, then at 85°C for 5 minutes, and finally at 4°C for 30 minutes. After culturing and the reaction is complete, add 80 μl of DEPC-treated water to each reverse transcription reaction system and cDN A solution containing A was obtained.

[0470] For each reverse transcription reaction system, 5 μl of the solution containing the above cDNA is added to the qPCR template. The rate is NovoStart® SYBR qPCR SuperMix. Provided from the Plus kit (purchased from Jingan Protein Technology Co., Ltd., item number E096-01B). A 20 μl qPCR reaction system was prepared using the reagents provided. Here, the target gene PCSK9 Table 7 shows the PCR primer sequences for amplifying the endogenous reference gene GAPDH. The final concentration of each primer was 0.25 μM. Each qPCR reaction system was subjected to the ABI Step. The device was placed in a OnePlus Real-Time PCR instrument, and amplification was performed using a three-stage method. The procedure involves pre-denaturation at 95°C for 10 minutes, followed by denaturation at 95°C for 30 seconds, and then animate at 60°C for 30 seconds. The material is then stretched at 72°C for 30 seconds, and the above process of modification, annealing, and stretching is repeated a total of 40 times. Afterward, the product W containing the amplified target gene PCSK9 and the endogenous reference gene GAPDH is produced. We obtained the following. Immediately afterward, the product W was heated at 95°C for 15 s, 60°C for 1 min, and 95°C for 15 s in sequence. The cells were cultured, and the target genes in product W were identified using a real-time fluorescence quantitative PCR instrument. We obtained thawing curves for the offspring PCSK9 and the endogenous reference gene GAPDH, and analyzed the target gene PCSK9 and We also obtained the Ct value for the endogenous reference gene GAPDH.

[0471] [Table 7]

[0472] Using the comparative Ct (ΔΔCt) method, the expression levels of the target gene PCSK9 (D15 and D-7) were compared. Relative quantitative calculations were then performed, and the calculation method is as follows. ΔCt(D15) = Ct(D15 target gene) - Ct(D15 endogenous reference gene) ΔCt(D-7) = Ct(D-7 target gene) - Ct(D-7 endogenous reference gene) ΔΔCt(D15)=ΔCt(D15)-ΔCt(D-7 average) ΔΔCt(D-7)=ΔCt(D-7)-ΔCt(D-7 average)

[0473] Here, ΔCt(D-7 mean) is the arithmetic mean of ΔCt(D-7) for each animal before administration. Therefore, each animal has one ΔΔCt(D15) and ΔΔCt(D-7) It is compatible.

[0474] Using D-7 of one animal as a reference, the expression level of D15 PCSK9 mRNA in that animal The expression level was normalized, and the expression level of D-7 PCSK9 mRNA was defined as 100%. .

[0475] Relative expression level of PCSK9 mRNA = 2^(-ΔΔCt(D15)) × 100% Repression rate of PCSK9 mRNA by the complex = (1-2^(-ΔΔCt(D15 ))) × 100%

[0476] In the group administered the same complex, the complex suppressed PCSK9 mRNA. The suppression rate is the arithmetic mean of the corresponding suppression rates for each animal in this group.

[0477] Table 8 shows the inhibition rates of each complex against liver PCSK9 mRNA.

[0478] [Table 8]

[0479] As can be seen from Table 8, a single dose of 9 mg / kg resulted in a difference between the period 7 days prior to administration and the period after administration. On day 15, the inhibition rate of PCSK9 mRNA by the siRNA complex was 5% in all cases. The percentage is higher than 6%, and in particular, PCSK9 m in NHP liver tissue due to complex 1 and complex 4. The suppression rates for RNA reached as high as 79% and 81%, respectively.

[0480] (2-2) Detection of PCSK9 protein content in serum For NHP patients who received Complex 4, the following conditions were observed prior to administration: D-15, D-9, and D1, respectively. Perform one venous blood draw, and then perform venous blood draws on D3, D8, D14, D22, and D29 respectively after administration. This procedure was performed once, and then blood samples were taken once a week for 18 weeks, until day 127.

[0481] For NHP patients who received complex 1 or 7, the pre-administration D-14, D-7, and D1 are as follows: Each person will have a single venous blood sample taken, and after administration, venous blood samples will be taken on D4, D8, D15, D22, and D29 respectively. A pulse blood sample was taken once, and then blood samples were taken once a week for 12 weeks until day 85.

[0482] For each sample obtained, serum was isolated at room temperature.

[0483] (2-2-1) PCSK9 protein content in serum of cynomolgus monkeys administered complex 4. Quantity detection Complex 4 was administered to D-9, D8, D14, D85, D92, D99, D106 and D Select 120 serum samples and apply Human Proprotein Convertase 9 / PCSK9 Quantikine ELISA Kit (US R&D System) S Company, number DPC900) Calibrator Diluent RD5P ( Using the reagent (1:5 dilution), dilute the serum obtained at each of the above time points 25 times and follow the instructions in the kit manual. According to the operating procedure, a fully automated microplate reader (SYNERGY TM MX The absorbance values ​​of each diluted serum at 450 nm were detected using a Biotek (Biotec) kit. From the various dilution concentrations of the standard samples and their corresponding absorbance values, Graphpad 5. The software's linear regression function constructs a standard curve and the corresponding linear equation: Y=aX We obtain +b, where a is the slope of the fitted line and b is when X=0. This is the corresponding Y value (intercept). Substitute the absorbance values ​​of each measured diluted serum into the above equation. This allows us to calculate the PCSK9 protein content in diluted serum, and from the dilution factor, we can determine the content at each time point. The PCSK9 protein content in serum was obtained. Standardized PCSK9 protein level = (PCSK9 protein content after administration / pre-administration) PCSK9 protein content) Suppression rate of PCSK9 protein expression = (1 - PCSK9 protein content after administration / P before administration) (CSK9 protein content) × 100%

[0484] Here, the PCSK9 protein content before administration is the PCSK9 protein content of D-9. .

[0485] Using the pre-administration baseline, the PCSK9 protein content at each time point after administration was normalized to the pre-administration baseline. The PCSK9 protein level is defined as 100%, represented as D0 in Figure 2, and 9 in cynomolgus monkeys. After administering a single dose of complex 4 (mg / kg) by subcutaneous injection, serum targets at different time points were measured. The standardized PCSK9 protein levels are shown in Figure 2.

[0486] (2-2-2) PCSK9 protein in cynomolgus monkey serum administered with complex 1 or 7 Detection of content (1)D-14, D-7, D8, D15, D22, D29, D36, D43, D50, Select serum from D57, D64, and D85, and (2) the PCSK9 protein content before administration is Other than being the arithmetic mean of the PCSK9 protein content of two samples, D-14 and D-7, ( 2-2-1) The same method was used to determine PC in cynomolgus monkey serum administered with complex 1 or 7. SK9 protein content was detected. Cynomolgus monkeys were administered 9 mg / kg of complex 1 or 7 subcutaneously. After a single injection, the standardized PCSK9 protein in serum at different time points... Kleber is shown in Figure 2.

[0487] As can be seen in Figure 2, on day 14 after a single dose, complex 4 mediated P in NHP serum. The suppression rate of CSK9 protein expression was higher than 90%, and up to 12 weeks after administration, complex 4 The suppression rate of PCSK9 protein expression by this method was consistently maintained at over 50%.

[0488] For complex 7, PCSK9 protein activity in NHP serum was observed 22 days after single administration. The current suppression rate is 82%, and PCSK9 protein expression by complex 7 is suppressed up to 9 weeks after administration. The suppression rate against [the disease] was consistently maintained at over 66%.

[0489] For complex 1, PCSK9 protein activity in NHP serum was observed 15 days after single administration. The current suppression rate is 83%, and PCSK9 protein expression by complex 7 is suppressed up to 7 weeks after administration. The suppression rate against [the disease] was consistently maintained at over 65%.

[0490] (2-3) Detection of serum lipid (LDL-c and CHO) content (2-3-1) Serum lipids (LDL-c and CHO) of cynomolgus monkeys administered complex 4 ) Detection of content (2-2) After administering complex 4, select the serum obtained at each time point, and L DL-C measurement kit (DENUO CH7538, Shanghai Dingcheng Biological Technology Co., Ltd.) or CH Using the OL measurement kit (DENUO CH7532, Shanghai Zhicheng Biotechnology Co., Ltd.), Following the operating instructions in the manual, the fully automated biochemical analyzer (Hitachi 7060) was used to measure the results at each point in time. The serum lipid content (LDL-c or CHO) was detected. Standardized lipid level = (lipid content after administration / lipid content before administration) × 100% Lipid suppression rate = (1 - lipid content after administration / lipid content before administration) × 100%

[0491] Here, the pre-administration lipid content is the arithmetic mean of the three lipids D-15, D-9, and D1. In this context, lipids refer to LDL-c or CHO.

[0492] Using the pre-administration level as a baseline, the lipid content at each time point after administration is normalized, and the pre-administration lipid level is calculated. It was defined as 100% and represented as D0 in Figures 3 and 4.

[0493] After administering a single dose of Complex 4 at 9 mg / kg subcutaneously to cynomolgus monkeys, they were evaluated at different time points. Standardized LDL-c levels and standardized CHO levels in serum were measured separately. This is shown in Figures 3 and 4.

[0494] (2-3-2) Serum lipids (LDL-c and CHO) of cynomolgus monkeys administered complex 7 ) Detection of content (1)(2-2) After administering complex 7, select the serum obtained at each time point and then select the lipids (2) The pre-administration lipid content was found to be the same for three lipids: D-14, D-7, and D1. Except for being the arithmetic mean, the same method as in (2-3-1) was used to determine which cells were administered with complex 7. Lipid content (LDL-c and CHO) in cynomolgus monkey serum was detected. 9m After administering a single dose of g / kg of complex 7 by subcutaneous injection, the standard serum values ​​at different time points were measured. Figures 3 and 4 show the standardized LDL-c levels and the standardized CHO levels, respectively. .

[0495] As can be seen in Figure 3, complex 4 shows a significant effect on LDL-c from day 14 after a single administration. It showed significant suppression, and in particular, on day 22 after administration, the LDL-c suppression rate by complex 4 was 64%. The rate of LDL-c suppression by complex 4 was consistently high from week 2 to week 11 after administration. It was maintained at over 50%, and over a long observation period of 127 days, N who received complex 4 showed better results. HP's serum LDL-c levels were consistently lower than before administration.

[0496] For complex 7, the LDL-c suppression rate was 36% on day 22 after a single dose. From the second to the fourth week after administration, the LDL-c suppression rate was maintained at approximately 30%. Over a long observation period of one week, serum LDL-c levels in NHP patients treated with complex 7 consistently remained high. It was lower than before.

[0497] As can be seen in Figure 4, from day 14 after a single administration, complex 4 also showed significant effects on CHO. It showed suppression, and in particular, the CHO suppression rate by complex 4 was 38% on day 22 after administration. From week 2 to week 8 after administration, the suppression rate of CHO by complex 4 was consistently above 30%. This was maintained, and over a long observation period of 127 days, serum CH of NHP administered with complex 4 was maintained. O levels were consistently lower than before administration.

[0498] For complex 7, the suppression rate of CHO was 38% on day 22 after a single dose. From the second to the eighth week onward, the suppression rate of CHO was generally maintained at over 30%. Over a long observation period of one week, serum CHO levels in NHP patients treated with complex 7 were consistently higher than pre-treatment levels. was low.

[0499] (2-4) Detection of blood routine and coagulation function before and after liver puncture Before and after liver puncture, venous blood was collected from animals administered with complex 4 or 5. Using an automated five-part differential hematology analyzer (ADVIA 2120 / ADVIA 2120i, Siemens AG) and an automated blood coagulation analyzer (CA-7000 / CS-2000i, Sysmex Corporation), blood routine and coagulation function were detected. As can be seen from the results, after administration, there was no significant difference in the effects of each complex on blood routine and coagulation function compared with before administration, indicating the high biological safety of the siRNA complex provided by the present disclosure.

[0500] (Experimental Example 3) Evaluation of toxicity of siRNA complex in rats / mice In this experimental example, the clinical toxic reactions of rats or mice administered with complex 1, 4 or 7 were observed, and indicators such as liver weight, blood routine, blood biochemistry, and lipids were detected. By performing gross dissection and histopathological examination, the toxic reactions of the siRNA complex of the present disclosure in small animals in vivo were evaluated.

[0501] (3-1) Evaluation of rat toxicity (3-1-1) Detection of toxicity of SD rats administered with complex 1 or 4 SPF-level SD rats aged 6-9 weeks and weighing 210-250 g (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., license number: SCXK(Beijing) 2016-0011 or SCXK(Beijing) 2016-0006, both male) were selected and divided into 3 groups of 5 rats per group according to body weight. They were subcutaneously injected with complex 1, complex 4 or 1×PBS (pH 7.4) control, respectively. The dosage is calculated based on body weight, and each complex is dissolved in 1×PBS (pH 7.4) at a concentration of 60 mg / ml. The solution was administered in liquid form, with an administration volume of 5 ml / kg and a dosage of 300 mg / kg.

[0502] After a single subcutaneous administration, the following indicators were detected. (1) Observation of normal conditions: Observation of normal conditions was performed twice a day. (2) Body weight: Before administration D1, after administration D3, D6, D10, D14 and on the day of dissection D15 Their weight was measured. (3) Food intake: Food intake was measured on days D2-3, D6-7, and D12-13. (4) Hematology: On day 15 before dissection, 1.9 ml of blood was collected from the abdominal artery of the rat, and of that... To prevent coagulation in a 1.0 mL blood sample, whole blood was directly sampled. The following hematological indicators (red blood cell count (RBC), white blood cell count (WBC), platelet count) are used. (PLT), hemoglobin (HGB), hematocrit (HCT), mean corpuscular volume ( MCV, mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC) ), reticulocyte count (RET), reticulocyte percentage (RET%), neutrophil (NEU) count and percentage, Lymphocyte (LYM) count and ratio, monocyte (MONO) count and ratio, eosinophil (EOS) count and The ratio, including the number and ratio of basophils (BASOs), was detected. Also, the remaining 0.9 For a mL blood sample, prevent coagulation with sodium citrate, and then apply centrifugal force at 15-25°C. Centrifuge at 1800 x g for 10 minutes to isolate the plasma and measure the coagulation time (prothrombin time (PT)). It was also used to detect activated partial thrombin time (APTT). (5) Blood biochemistry: 0.6 ml of blood was collected from the jugular vein of rats on day 2 after administration, and dissection was performed on day 15. Prior to this, 3 ml of blood was drawn from the abdominal artery of rats, and none of the samples prevented blood clotting. 15-25 Centrifuge at 1800 × g for 10 minutes at °C, isolate the serum, and extract alkaline phosphatase ( ALP, alanine aminotransferase (ALT), aminotran aspartate Spherase (AST), creatine kinase (CK), lactate dehydrogenase (LDH), γ -Glutamyltransferase (GGT), urea, creatinine a) Sodium ion concentration (Na + ), potassium ion concentration (K + ), chloride ions (C l - ), blood glucose (GLU), total bilirubin (TBIL), total protein (TP), albumin Blood biochemical indicators such as albumin (ALB) and albumin / globulin ratio (A / G) were detected. . (6) Gross dissection and histopathological examination: Dissect the animals on D15 and measure the weight of each organ. Then, a histopathological examination was performed.

[0503] (3-1-2) Detection of toxicity in SD rats administered with complex 7 Instead of complex 4, complex 7 is used, and complex 7 is mixed with 1×PBS (pH 7.4) The solution was prepared at 20 mg / ml and 6 mg / ml, with an administration volume of 5 ml / kg. Except that the concentrations were 100 mg / kg and 30 mg / kg respectively, (3-1-1) and The toxicity of SD rats administered with complex 7 was detected using the same method. Indicator (5) Blood biochemistry For the studies, blood samples were taken before the autopsy on D8 and D15, respectively, after administration.

[0504] As the results show, none of the complexes showed significant toxicity in rats. .

[0505] (3-2) Evaluation of mouse toxicity 5-6 week old SPF level ICR mice (purchased from Sibei Fu (Beijing) Biotechnology Co., Ltd.) ) were selected, with half female and half male, and each group having 10 individuals, each with complex 1 and complex Body 4 or complex 7 was administered by subcutaneous injection. The administration frequency was once a week for two consecutive weeks, for a total of three doses. The medication was administered on D1, D8, and D15, respectively. The dosage was calculated based on body weight, and each complex was administered at 1 × PB. Prepare a 30 mg / ml solution at pH 7.4, and administer at a volume of 10 ml / kg. The dosage was 300 mg / kg.

[0506] After three administrations, the following indicators were detected. (1) Observation of normal conditions: Observation of normal conditions was performed once a day. (2) Body weight: Body weight was measured on D1, D8, D15 before administration and on the day of dissection, D16. (3) Food intake: Measured once a week. (4) Blood biochemistry: On day D16 of the autopsy, the eyeball was removed and 1 ml of blood was collected, and no anticoagulant was used. First, the mixture was cultured at 37°C for 60 minutes, and then centrifuged at 4°C and 3000 rpm for 15 minutes. Serum was obtained, and blood biochemistry was detected. The detection indicator was the blood biochemistry used in the detection of rat toxicity described above. It's the same as the indicator. (5) Gross dissection and histopathological examination: Dissect the animals on D16 and measure the weight of each organ. Then, a histopathological examination was performed.

[0507] As the results show, none of the complexes showed significant toxicity in mice. .

[0508] The results above demonstrate the high level of biological safety of the complex described herein.

[0509] Although several embodiments of this disclosure have been described in detail above, this disclosure is not limited to the embodiments described above. Not limited to physical details, but within the scope of the technical concept of this disclosure, the technical solutions of this disclosure are also applicable. Several types of simple modifications can be made, and all of these simple modifications are protected under the protection of this disclosure. It belongs to the range.

[0510] In addition to the above, there are specific techniques described in the various embodiments described above. Technical features can be combined in any appropriate way, provided there is no contradiction, and unnecessary To avoid unnecessary repetition, this disclosure does not separately describe various possible combinations.

[0511] Furthermore, the various different embodiments of this disclosure can be combined in any way that aligns with the spirit of this disclosure. Unless it deviates from the above, such combinations should also be considered as being disclosed in this disclosure. be.

Claims

1. An siRNA that suppresses the expression of the PCSK9 gene, The siRNA includes a sense strand and an antisense strand. Each nucleotide in the sense strand and the antisense strand is independently either a fluoromodified nucleotide or an unfluoromodified nucleotide. The sense chain and the antisense chain have the same or different lengths. The sense strand has a length of 19 to 23 nucleotides, and the antisense strand has a length of 19 to 26 nucleotides. The sense strand comprises nucleotide sequence I, and the antisense strand comprises nucleotide sequence II, and nucleotide sequence I and nucleotide sequence II form a double-stranded region that is substantially or completely inversely complementary. The fluoromodified nucleotides are located in nucleotide sequence I and nucleotide sequence II, and in the sense strand, from the 5' end to the 3' end, the nucleotides at positions 7, 8, and 9 of nucleotide sequence I are fluoromodified nucleotides, and the remaining nucleotides in the sense strand are unfluoromodified nucleotides; and in the antisense strand, from the 5' end to the 3' end, the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence II are fluoromodified nucleotides, and the remaining nucleotides in the antisense strand are unfluoromodified nucleotides. Each non-fluoromodified nucleotide is independently selected from nucleotides in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is substituted with a non-fluorine group. A nucleotide in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is replaced with a nonfluorine group is a 2'-alkoxy-modified nucleotide. i) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 3, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 4 5'-AAGCAAGCAGACAUUUAUZ 3-3' (Sequence ID 3), 5'-Z 4 AUAAAUGUCUGCUUGCUU-3' (Sequence ID 4) However, Z4 is selected from A, U, G, or C, and the Z ４ is the first nucleotide at the 5' end of the antisense strand, and Z3 is the first nucleotide at the 3' end of the nucleotide sequence I, or ii) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 63, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 64 5'-UUUGUAGCAUUUUUAUUAZ 7-3' (Sequence ID 63), 5'-Z 8 UAAUAAAAAAUGCUACAAA-3' (Sequence ID 64) However, Z8 is selected from A, U, G, or C, and the Z ８ is the first nucleotide at the 5' end of the antisense strand, and Z7 is the first nucleotide at the 3' end of nucleotide sequence I, or iii) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 123, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 124 5'-GCCUGGAGAGUUUAUUCGGAZ 11-3' (Sequence ID 123), 5'-Z 12 UCCGAAUAAACUCCAGGGC-3' (Sequence ID 124) However, Z12 is selected from A, U, G, or C, and the Z １２ is the first nucleotide at the 5' end of the antisense strand, and Z11 is the first nucleotide at the 3' end of nucleotide sequence I, or iv) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 183, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 184 5'-CUGUUUUGCUUUUGUAACZ 15-3' (Sequence ID 183), 5'-Z 16 GUUACAAAAGCAAAAACAG-3' (Sequence ID 184) However, Z16 is selected from A, U, G, or C, and the Z １６ is the first nucleotide at the 5' end of the antisense strand, and Z15 is the first nucleotide at the 3' end of nucleotide sequence I, or v) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 243, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 244 5'-GGUUUUGUAGCAUUUUUAZ 19-3' (Sequence ID 243), 5'-Z 20 UAAAAAAUGCUACAAAACC-3' (Sequence ID 244) However, Z20 is selected from A, U, G, or C, and the Z ２０ is the first nucleotide at the 5' end of the antisense strand, and Z19 is the first nucleotide at the 3' end of nucleotide sequence I, or vi) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 303, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 304 5'-GUGACUUUUUAAAAAAAZ 23-3' (Sequence ID 303), 5'-Z 24 UUUAUUUUAAAAAAGUCA-3' (Sequence ID 304) However, Z24 is selected from A, U, G, or C, and the Z ２４ A is the first nucleotide at the 5' end of the antisense strand, and Z23 is the first nucleotide at the 3' end of nucleotide sequence I, in this siRNA.

2. The siRNA according to Claim 1, wherein each non-fluoromodified nucleotide is a methoxy-modified nucleotide, and the methoxy-modified nucleotide refers to a nucleotide in which the 2'-hydroxyl group of the ribose group is replaced with a methoxy group.

3. Z ３ However, Z ４ It is a complementary nucleotide, or, Z ７ is a nucleotide complementary to Z ８ or Z １１ However, Z １２ It is a complementary nucleotide, or, Z １５ is, Z １６ It is a complementary nucleotide, or, Z １９ is, Z ２０ It is a complementary nucleotide, or, Z ２３ is, Z ２４ The siRNA according to claim 1, which is a nucleotide complementary to the siRNA.

4. The sense strand further comprises nucleotide sequence III, and the antisense strand further comprises nucleotide sequence IV, wherein the lengths of nucleotide sequence III and nucleotide sequence IV are independently 1 to 4 nucleotides, nucleotide sequence III is attached to the 5' end of nucleotide sequence I, and nucleotide sequence IV is attached to the 3' end of nucleotide sequence II, and nucleotide sequence III and nucleotide sequence IV are of equal length and substantially inversely complementary or completely inversely complementary, wherein substantially inversely complementary means that there is one or fewer base mismatches between the two nucleotide sequences, and completely inversely complementary means that there are no mismatches between the two nucleotide sequences, as described in claim 1. RNA.

5. i) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 3, the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 4, the nucleotide sequences III and IV are both 1 nucleotide in length and the base of nucleotide sequence III is C, or the nucleotide sequences III and IV are both 2 nucleotides in length and the base sequence of nucleotide sequence III is CC from the 5' end to the 3' end, or the nucleotide sequences III and IV are both 3 nucleotides in length and the base sequence of nucleotide sequence III is CCC from the 5' end to the 3' end, or the nucleotide sequences III and IV are both 4 nucleotides in length and the base sequence of nucleotide sequence III is ACCC from the 5' end to the 3' end, or ii) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 63, the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 64, the nucleotide sequences III and IV are both 1 nucleotide in length and the base of nucleotide sequence III is U, or the nucleotide sequences III and IV are both 2 nucleotides in length and the base sequence of nucleotide sequence III is GU from the 5' end to the 3' end, or the nucleotide sequences III and IV are both 3 nucleotides in length and the base sequence of nucleotide sequence III is GGU from the 5' end to the 3' end, or the nucleotide sequences III and IV are both 4 nucleotides in length and the base sequence of nucleotide sequence III is GGGU from the 5' end to the 3' end, or iii) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 123, the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 124, the nucleotide sequences III and IV are both 1 nucleotide in length and the base of nucleotide sequence III is G, or the nucleotide sequences III and IV are both 2 nucleotides in length and the base sequence of nucleotide sequence III is AG from the 5' end to the 3' end, or the nucleotide sequences III and IV are both 3 nucleotides in length and the base sequence of nucleotide sequence III is UAG from the 5' end to the 3' end, or the nucleotide sequences III and IV are both 4 nucleotides in length and the base sequence of nucleotide sequence III is AUAG from the 5' end to the 3' end, or iv) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 183, the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 184, the nucleotide sequences III and IV are both 1 nucleotide in length and the base of nucleotide sequence III is C, or the nucleotide sequences III and IV are both 2 nucleotides in length and the base sequence of nucleotide sequence III is AC from the 5' end to the 3' end, or the nucleotide sequences III and IV are both 3 nucleotides in length and the base sequence of nucleotide sequence III is GAC from the 5' end to the 3' end, or the nucleotide sequences III and IV are both 4 nucleotides in length and the base sequence of nucleotide sequence III is AGAC from the 5' end to the 3' end, or v) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 243, the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 244, the nucleotide sequences III and IV are both 1 nucleotide in length and the base of nucleotide sequence III is G, or the nucleotide sequences III and IV are both 2 nucleotides in length and the base sequence of nucleotide sequence III is UG from the 5' end to the 3' end, or the nucleotide sequences III and IV are both 3 nucleotides in length and the base sequence of nucleotide sequence III is CUG from the 5' end to the 3' end, or the nucleotide sequences III and IV are both 4 nucleotides in length and the base sequence of nucleotide sequence III is UCUG from the 5' end to the 3' end, or vi) The siRNA according to claim 4, wherein nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 303, nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 304, nucleotide sequences III and IV are both 1 nucleotide in length and the base of nucleotide sequence III is G, or nucleotide sequences III and IV are both 2 nucleotides in length and the base sequence of nucleotide sequence III is UG from the 5' end to the 3' end, or nucleotide sequences III and IV are both 3 nucleotides in length and the base sequence of nucleotide sequence III is AUG from the 5' end to the 3' end, or nucleotide sequences III and IV are both 4 nucleotides in length and the base sequence of nucleotide sequence III is UAUG from the 5' end to the 3' end.

6. The siRNA according to claim 1, wherein the antisense strand further comprises a nucleotide sequence V, the nucleotide sequence V having a length of 1 to 3 nucleotides, being bonded to the 3' end of the antisense strand and constituting the 3' overhang end of the antisense strand, or the nucleotide sequence V having a length of 2 nucleotides, or the nucleotide sequence V being two consecutive thymine deoxyribonucleotides or two consecutive uracil ribonucleotides, or the nucleotide sequence V being complementary to the nucleotide at the corresponding position of the target mRNA.

7. The sense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 5, and the antisense strand includes the nucleotide sequence shown in SEQ ID NO: 6, or the sense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 7, and the antisense strand includes the nucleotide sequence shown in SEQ ID NO:

8. Alternatively, the sense strand of the siRNA may include the nucleotide sequence shown in SEQ ID NO: 65, and the antisense strand may include the nucleotide sequence shown in SEQ ID NO: 66, or the sense strand of the siRNA may include the nucleotide sequence shown in SEQ ID NO: 67, and the antisense strand may include the nucleotide sequence shown in SEQ ID NO:

68. Alternatively, the sense strand of the siRNA may include the nucleotide sequence shown in SEQ ID NO: 125, and the antisense strand of the siRNA may include the nucleotide sequence shown in SEQ ID NO: 126, or the sense strand of the siRNA may include the nucleotide sequence shown in SEQ ID NO: 127, and the antisense strand of the siRNA may include the nucleotide sequence shown in SEQ ID NO:

128. Alternatively, the sense strand of the siRNA may contain the nucleotide sequence shown in SEQ ID NO: 185, and the antisense strand may contain the nucleotide sequence shown in SEQ ID NO: 186, or the sense strand of the siRNA may contain the nucleotide sequence shown in SEQ ID NO: 187, and the antisense strand may contain the nucleotide sequence shown in SEQ ID NO:

188. Alternatively, the sense strand of the siRNA may contain the nucleotide sequence shown in SEQ ID NO: 245, and the antisense strand of the siRNA may contain the nucleotide sequence shown in SEQ ID NO: 246, or the sense strand of the siRNA may contain the nucleotide sequence shown in SEQ ID NO: 247, and the antisense strand of the siRNA may contain the nucleotide sequence shown in SEQ ID NO:

248. Alternatively, the siRNA according to claim 1, wherein the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 305, the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 306, or the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 307, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

308.

8. At least one phosphate ester group in the sense chain or the antisense chain is a phosphate ester group having a modifying group, The siRNA according to claim 1, wherein the phosphate ester group having the modifying group is a thiophosphate ester group in which at least one oxygen atom of the phosphate diester bond in the phosphate ester group is replaced with a sulfur atom, or the phosphate ester group having the modifying group is a thiophosphate ester group having the structure shown in formula (1). 【Chemistry 1】

9. In the siRNA, the thiophosphate ester group is Between the first and second nucleotides from the 5' end of the sense strand, Between the second and third nucleotides from the 5' end of the sense strand, Between the first and second nucleotides from the 3' end of the sense strand, Between the second and third nucleotides from the 3' end of the sense strand, Between the first and second nucleotides from the 5' end of the antisense strand, Between the second and third nucleotides from the 5' end of the aforementioned antisense strand, Between the first and second nucleotides from the 3' end of the antisense strand, and The siRNA according to claim 8, wherein it is bound to at least one selected from the group consisting of the space between the second and third nucleotides from the 3' end of the antisense strand.

10. The 5' terminal nucleotide of the antisense strand of the siRNA is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide. Alternatively, the 5'-phosphate nucleotide is a nucleotide having the structure shown in formula (2), and the 5'-phosphate analog modified nucleotide is selected from nucleotides having the structure shown in any one of formulas (3) to (6). 【Chemistry 2】 The siRNA according to claim 1, wherein R is selected from H, OH, a methoxy group or fluorine, and Base represents a base and is selected from A, U, C, G or T.

11. The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 9, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

10. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 11, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

12. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 69, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

70. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 71, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

72. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 129, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

130. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 131, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

132. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 189, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

190. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 191, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

192. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 249, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

250. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 251, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

252. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 309, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

310. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 311, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

312. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 13, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

14. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 19, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

20. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 73, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

74. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 79, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

80. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 133, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

134. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 139, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

140. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 193, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

194. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 199, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

200. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 253, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

254. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 259, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

260. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 313, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

314. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 319, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

320. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 25, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

26. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 31, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

32. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 85, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

86. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 91, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

92. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 145, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

146. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 151, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

152. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 205, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

206. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 211, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

212. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 265, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

266. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 271, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

272. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 325, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

326. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 331, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

332. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 37, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

38. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 43, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

44. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 49, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

50. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 55, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

56. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 97, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

98. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 103, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

104. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 109, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

110. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 115, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

116. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 157, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

158. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 163, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

164. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 169, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

170. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 175, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

176. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 217, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

218. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 223, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

224. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 229, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

230. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 235, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

236. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 277, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

278. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 283, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

284. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 289, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

290. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 295, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

296. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 337, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

338. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 343, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

344. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 349, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

350. Alternatively, the siRNA according to claim 1, wherein the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 355, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

356.

12. A drug composition comprising the siRNA described in any one of claims 1 to 11 and a pharmaceutically acceptable carrier.

13. A siRNA according to any one of claims 1 to 11 and a siRNA complex comprising a complex group that is bound to the siRNA.

14. A composition for the treatment and / or prevention of a disease or physiological condition caused by abnormal expression of the PCSK9 gene, comprising the siRNA described in any one of claims 1 to 11, the drug composition described in claim 12, and / or the siRNA complex described in claim 13.

15. A composition for suppressing the expression of the PCSK9 gene in hepatocytes, comprising the siRNA described in any one of claims 1 to 11, the drug composition described in claim 12, and / or the siRNA complex described in claim 13.

Images