Recombinant adeno-associated virus vectors having a CD14 promoter and their use
The use of a CD14 promoter in rAAV vectors addresses off-target gene expression issues by specifically inducing gene expression in CD14-expressing cells, enhancing safety and efficacy in gene therapy.
Patent Information
- Application Number
- JP2023523665
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-10-15
- Filing Date
- 2021-10-14
- Publication Date
- 2026-07-02
- Estimated Expiration
- 2041-10-14
AI Technical Summary
Constitutive promoters in recombinant adeno-associated virus (rAAV) vectors lead to unwanted off-target gene expression in non-target cells, posing safety risks and reducing treatment efficacy.
Employing a CD14 promoter operably linked to an exogenous nucleic acid sequence in rAAV vectors to specifically induce gene expression in CD14-expressing cells like monocytes and dendritic cells, reducing off-target effects.
Enhances treatment safety and efficacy by targeting gene expression to specific cell types, minimizing harmful side effects and improving therapeutic accuracy.
Smart Images

Figure 0007883997000003 
Figure 0007883997000004 
Figure 0007883997000005
Abstract
Description
Technical Field
[0001] Description of the Sequence Listing The sequence listing related to this application is provided in text format instead of paper medium and is incorporated herein by reference. The name of the text file containing the sequence listing is 100239_401WO_SEQUENCE_LISTING.txt. The text file is 7.6 KB, was created on September 15, 2021, and was submitted electronically via EFS-Web.
[0002] Background Technical Field The present invention relates to the fields of molecular biology, immunology, immunotherapy, and gene therapy. Specifically, the present invention relates to a recombinant adeno-associated virus vector having a CD14 promoter region and its practical uses.
Background Art
[0003] Description of Related Technologies The adeno-associated virus (AAV) type 2 genome is constructed of single-stranded deoxyribonucleic acid (ssDNA) approximately 4.7 kilobases in length. The AAV genome contains inverted terminal repeat (ITR) sequences (145 bases) at both ends of the AAV DNA strand and two open reading frames (ORFs): the rep gene and the cap gene. On the left side of the AAV genome are the p5, p19, and p40 promoters, from which two overlapping mRNAs of different lengths can be produced.
[0004] Because AAV is a non-pathogenic virus, it has been used as a viral vector for gene therapy and immunotherapy. AAV and recombinant adeno-associated virus (rAAV) have the ability to widely infect (transduce) various human cells such as somatic cells, nerve cells, and blood cells. rAAV can express exogenous RNA that can be translated into polypeptides. This infectious property of rAAV has advantages in the gene therapy of many diseases. However, rAAV vectors usually contain constitutive promoters such as the AAV promoter, CMV promoter, and SV40 early promoter, and can promote gene expression in all or many tissues. rAAV with a constitutive promoter may cause unwanted off-target effects by infecting non-target cells and expressing the products of exogenous genes in non-target cells. Therefore, in clinical treatment, rAAV with a constitutive promoter can bring harmful reactions or side effects unrelated to the treatment purpose, including the potential risk of toxic effects. Therefore, there is a need in the art for rAAV vectors with improved treatment safety, accuracy, and efficacy. Summary of the Invention Means for Solving the Problems
[0005] Brief Summary This disclosure provides a polynucleotide comprising a recombinant adeno-associated virus (rAAV) vector encoding two reverse-terminal repeat (ITR) sequences and a CD14 promoter operably ligated to an exogenous nucleic acid sequence, wherein the CD14 promoter specifically induces the expression of the exogenous nucleic acid in CD14-expressing cells. In some embodiments, the CD14 promoter is a human CD14 promoter sequence. In some embodiments, the CD14 promoter comprises SEQ ID NO: 1. In some embodiments, the CD14 promoter comprises at least nucleotides at positions 378-386, 404-410, and 533-538 of SEQ ID NO: 1. In some embodiments, the CD14-expressing cells are monocytes, macrophages, or dendritic cells. In some embodiments, the rAAV vector comprises a first ITR, a CD14 promoter operably ligated to an exogenous nucleic acid sequence, a polyadenylation signal sequence, and a second ITR, in the 5'→3' direction. In some embodiments, the exogenous nucleic acid sequence includes a sequence encoding a multiple cloning site (MCS), a restriction enzyme target sequence, and / or a polypeptide. In some embodiments, the polypeptide-encoding sequence encodes all or part of a tumor antigen, tumor-associated antigen, oncogene product, viral antigen, bacterial antigen, cytokine, or any combination thereof.
[0006] In some embodiments, the disclosure provides an rAAV virion comprising a polynucleotide containing two ITR sequences and a CD14 promoter operably linked to an exogenous nucleic acid sequence, wherein the CD14 promoter specifically induces the expression of the exogenous nucleic acid in CD14-expressing cells. In some embodiments, the rAAV virion comprises a capsid protein of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or any combination thereof.
[0007] In some embodiments, the Disclosure provides a method for producing rAAV virions, comprising the step of introducing an rAAV vector disclosed herein into packaging cells, wherein the packaging cells include one or more nucleic acid sequences encoding helper genes. In some embodiments, the helper genes include the AAV Rep and Cap genes, as well as the adenovirus VA, E2A, E3, and E4 genes. In some embodiments, the method for producing rAAV virions includes the step of co-transfecting the packaging cells with the helper genes together with the rAAV vector disclosed herein. In some embodiments, the packaging cells are HEK293, HeLa, or HT1080 cells.
[0008] In some embodiments, the disclosure provides a population of isolated cells containing one of the rAAV vectors disclosed herein. In some embodiments, the cells express CD14. In some embodiments, the cells are monocytes, dendritic cells, or macrophages.
[0009] In some embodiments, this disclosure refers to isolated rAAV transducer CD14 as disclosed herein. + The present invention provides a pharmaceutical composition comprising cells, wherein the cells are effective in activating T cells to generate an antigen-specific immune response to a polypeptide encoded by an exogenous nucleic acid sequence. In some embodiments, the polypeptide is a tumor antigen, tumor-associated antigen, oncogene product, viral antigen, or bacterial antigen. In some embodiments, the cells are monocytes, dendritic cells, or macrophages.
[0010] In some embodiments, the present disclosure provides a pharmaceutical composition comprising antigen-specific T cells that target cells expressing polypeptides encoded by exogenous nucleic acid sequences disclosed herein, wherein the T cells are activated by any one of the rAAV-transduced CD14+ cells disclosed herein.
[0011] In some embodiments, the present disclosure relates to a pharmaceutical composition comprising human peripheral blood mononuclear cells (PBMCs), wherein the PBMCs are transduced to rAAV-transformed CD14 as disclosed herein. + The present invention provides a pharmaceutical composition containing antigen-specific T cells activated by cells.
[0012] In some embodiments, the present disclosure provides an immunotherapy method comprising the step of administering a population of isolated cells or a pharmaceutical composition disclosed herein to a subject requiring administration thereof, thereby stimulating an immune response. In some embodiments, the subject is human.
[0013] In some embodiments, the present disclosure provides an immunotherapy method comprising: a. infecting a target PBMC with the rAAV virion disclosed herein to generate infected PBMCs; b. adding differentiation cytokines to differentiate the monocytes of the infected PBMCs into dendritic cells (DCs); c. adding activating cytokines to activate cytotoxic T lymphocytes (CTLs) of the infected PBMCs to generate activated CTLs; d. optionally isolating activated CTLs from the infected PBMCs; and e. administering an effective amount of activated CTLs or the isolated activated CTLs to the infected PBMCs.
[0014] In some embodiments, the present disclosure is a method for producing modified antigen-presenting cells (APCs), i) CD14 + Steps to provide cells, and ii) CD14 + The steps are: iii) bringing the cells into contact with the rAAV virion disclosed herein for a sufficient amount of time to express the polypeptide-coding sequence; and iii) CD14 of step ii) for a sufficient amount of time to express the polypeptide. + The present invention provides a method for producing modified antigen-presenting cells (APCs), comprising the step of culturing cells. In some embodiments, CD14 +The cells are monocytes or dendritic cells. In some embodiments, the monocytes are in a population of PBMCs. In some embodiments, the monocytes are isolated monocytes. In some embodiments, the monocytes are further differentiated into dendritic cells. In some embodiments, the monocytes are differentiated into dendritic cells by contact with exogenous cytokines. In some embodiments, the exogenous cytokines are GM-CSF, IL-4, TNF-α, or any combination thereof.
[0015] In some embodiments, the present disclosure provides a method for producing antigen-specific T cells, comprising the steps of i) providing naive T cells, ii) contacting the naive T cells with a modified APC produced as disclosed herein, and iii) contacting the T cells from step ii) with an activating cytokine. In some embodiments, the activating cytokine is IL-2, IL-7, or both. In some embodiments, the antigen-specific T cells are CD4 + T cells or CD8 + These are T cells.
[0016] Some embodiments of this disclosure are shown as examples and are not limited by the accompanying drawings. In embodiments of the present invention, for example, the following items are provided. (Item 1) A polynucleotide comprising a recombinant adeno-associated virus (rAAV) vector encoding two reverse-terminal repeat (ITR) sequences and a CD14 promoter operably ligated to an exogenous nucleic acid sequence, wherein the CD14 promoter specifically induces the expression of the exogenous nucleic acid in CD14-expressing cells. (Item 2) The polynucleotide described in item 1, wherein the CD14 promoter is a human CD14 promoter sequence. (Item 3) The polynucleotide according to item 1 or 2, wherein the CD14 promoter includes SEQ ID NO: 1. (Item 4) The polynucleotide according to item 1 or 2, wherein the CD14 promoter includes at least nucleotides at positions 378-386, 404-410, and 533-538 of SEQ ID NO: 1. (Item 5) The polynucleotide according to any one of items 1 to 4, wherein the CD14-expressing cell is a monocyte, macrophage, or dendritic cell. (Item 6) The polynucleotide according to any one of items 1 to 5, wherein the rAAV vector comprises a first ITR, the CD14 promoter operably linked to the exogenous nucleic acid sequence, a polyadenylation signal sequence, and a second ITR in the 5'→3' direction. (Item 7) A polynucleotide as described in any one of items 1 to 6, wherein the aforementioned ITR sequence is AAV-2 ITR. (Item 8) The polynucleotide described in item 6, wherein the first ITR sequence and the second ITR sequence are AAV-2 ITRs. (Item 9) The rAAV vector is a plasmid, and the polynucleotide is one of the items listed in any one of items 1 to 8. (Item 10) The polynucleotide described in item 9, wherein the plasmid comprises a human CD14 transcription promoter, an AAV2 type reverse terminal repeat (ITR) sequence, a multicloning site (MCS) sequence, an SV40 late polyA sequence, an antibiotic resistance gene, and a gene element that enables the plasmid to replicate in a host cell. (Item 11) The polynucleotide according to any one of items 1 to 10, wherein the rAAV vector further comprises an enhancer region. (Item 12) The polynucleotide according to any one of items 1 to 11, wherein the exogenous nucleic acid sequence includes a multicloning site (MCS), a restriction enzyme target sequence, and / or a sequence encoding a polypeptide. (Item 13) The polynucleotide according to item 12, wherein the exogenous nucleic acid sequence comprises a sequence encoding a polypeptide, and the polypeptide comprises all or part of a tumor antigen, tumor-associated antigen, oncogene product, viral antigen, bacterial antigen, cytokine, or any combination thereof. (Item 14) The exogenous nucleic acid sequence includes a sequence encoding a tumor antigen, tumor-associated antigen, or oncogene product, wherein the tumor antigen, tumor-associated antigen, or oncogene product is α-fetoprotein (AFP), B melanoma antigen (BAGE / CT2.1), differentiation antigen group 20 (CD20), CD269, G250 (carbonic anhydrase IX / CA IX), HM1.24, CD154, prostate cancer-associated antigen, breast cancer-associated tumor-associated antigen, a member of the cancer-testis antigen (CT) family, a member of the human melanoma-associated antigen (MAGE) family, MART 1, or SAGE. 1. Polynucleotides as described in item 13, comprising carcinoembryonic antigen (CEA), HER-2 / neu, cytokeratin 19 (CK19, K19, cyfra21-1), survivor, mucin-1 (MUC-1, CA15-3), squamous cell carcinoma (SCC) antigen, or any antigenic fragments and / or combinations thereof. (Item 15) (a) The prostate cancer-related antigen is prostate-specific antigen (PSA), prostate-specific membrane antigen (PSMA), prostate stem cell antigen (PSCA), or prostatic acid phosphatase (PAP) antigen, or any antigen fragment and / or combination thereof. (b) The breast cancer-related tumor-related antigen is breast epithelial antigen 46 (BA46, lactoadherin) or any antigenic fragment thereof, (c) The member of the cancer testicular antigen (CT) family is New York esophageal squamous cell carcinoma-1 (NY-ESO-1) (CT6.1), ADAM2 (CT15), SPA17 (CT22), or SPANX-A 1 (CT11.1), or any antigenic fragment and / or combination thereof, (d) The polynucleotide described in item 14, wherein the member of the human melanoma-associated antigen (MAGE) family is MAGE-A1 / CT1.1, MAGE-A2 / CT1.2, MAGE-A3 / CT1.3, MAGE-A4 / CT1.4, MAGE-B1 / CT3.1, MAGE-C1 / CT7.1, MAGE-C2 / CT10, MAGE-C3 / CT7.2, or MAGE-E1, or any antigenic fragment and / or combination thereof. (Item 16) The polynucleotides described in item 14 or 15, wherein the tumor antigen, tumor-associated antigen, or oncogene product is PSA, PSMA, PAP, PSCA, BA46, CEA, HER-2 / neu, CK19, Survivin, MUC-1, SCC, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-C2, NY-ESO-1, ADAM2, SPA17, or SPANX-A1, or any antigenic fragment and / or combination thereof. (Item 17) The polynucleotide according to item 13, wherein the exogenous nucleic acid sequence comprises a sequence encoding a viral antigen, the viral antigen being hepatitis B virus (HBV) antigen, hepatitis C virus (HCV) antigen, human papillomavirus (HPV) antigen, human immunodeficiency virus (HIV) antigen, or any combination thereof. (Item 18) The polynucleotide described in item 17, wherein the HPV antigen is either the E6 antigen or the E7 antigen. (Item 19) The polynucleotide described in item 18, wherein the E6 antigen or E7 antigen is derived from HPV serotypes 16, 18, 30, 31, 33, 35, 39, 45, 51, 52, 56, 58, 61, or any combination thereof. (Item 20) The exogenous nucleic acid sequence includes a sequence encoding a cytokine, wherein the cytokine is GM-CSF, TNF-α, TNF-β, IL-2, IL-4, IL-5, IL-7, IL-9, TGF-β, IFNγ, IL-10, IL-13, IL-15, IL-18, IL-25, IL-27, and amphiregulin, or any combination thereof. , the polynucleotides listed in item 13. (Item 21) A recombinant adeno-associated virus (rAAV) virion containing a polynucleotide as described in any one of items 1 through 20. (Item 22) The rAAV virion described in item 21, wherein the virion comprises a capsid protein of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or any combination thereof. (Item 23) The rAAV virion described in item 21 or 22, wherein the virion contains the AAV2 capsid protein. (Item 24) The virion is an rAAV virion as described in any of items 21 to 23, wherein the virion does not contain one or more promoters other than the CD14 promoter and AAV structural genes. (Item 25) The rAAV virion described in item 24, in which the AAV structural gene includes the Rep and Cap genes of AAV2. (Item 26) A method for producing rAAV virions, comprising the step of introducing a polynucleotide described in any one of items 1 to 20 into a packaging cell, wherein the packaging cell contains one or more nucleic acid sequences encoding helper genes. (Item 27) The method according to item 26, wherein the helper genes include the AAV Rep and Cap genes and the adenovirus VA, E2A, E3, and E4 genes. (Item 28) The method according to item 26 or 27, wherein the packaging cells stably express the helper gene. (Item 29) The method according to any one of items 26-28, wherein the helper gene is encoded on a single plasmid. (Item 30) The method according to any one of items 26 to 28, wherein the helper gene is contained in two or more plasmids. (Item 31) The method according to item 28, wherein the Rep and Cap genes are encoded on a first helper plasmid, and the VA, E2A, E3, and E4 genes are encoded on a second helper plasmid. (Item 32) The method according to any one of items 29 to 31, wherein the helper gene is co-transfected to the packaging cell with the polynucleotide described in any one of items 1 to 20. (Item 33) The method according to item 26, wherein the rAAV vector is co-transfected with a plasmid containing the Rep and Cap genes, and the packaging cells are infected with adenovirus. (Item 34) The method according to any one of items 26-33, wherein the packaging cells are HEK 293, HeLa, or HT1080 cells. (Item 35) A population of isolated cells containing any one of the polynucleotides described in item 1 through 20. (Item 36) A population of isolated cells as described in item 35, wherein the cells express CD14. (Item 37) A population of isolated cells according to item 35 or 36, wherein the cells express the exogenous nucleic acid sequence encoding the polypeptide. (Item 38) A population of isolated cells as described in any one of items 35-37, wherein the cells are monocytes, dendritic cells, or macrophages. (Item 39) A population of isolated cells as described in item 35, wherein the aforementioned cells are packaging cells. (Item 40) A population of isolated cells as described in item 35 or 39, wherein the aforementioned cells are HEK293 cells. (Item 41) A pharmaceutical composition comprising isolated cells as described in any one of items 35 to 38, wherein the cells are effective in activating T cells to produce an antigen-specific immune response to the polypeptide encoded by the exogenous nucleic acid sequence. (Item 42) The pharmaceutical composition according to item 41, wherein the polypeptide is a tumor antigen, a tumor-associated antigen, an oncogene product, a viral antigen, or a bacterial antigen. (Item 43) The pharmaceutical composition according to item 42, wherein the polypeptide is a tumor antigen, tumor-associated antigen, or oncogene product, and the tumor antigen, tumor-associated antigen, or oncogene product is alpha-fetoprotein (AFP), B melanoma antigen (BAGE / CT2.1), differentiation antigen group 20 (CD20), CD269, G250 (carbonic anhydrase IX / CA IX), HM1.24, CD154, prostate cancer-associated antigen, breast cancer-associated tumor-associated antigen, a member of the cancer-testis antigen (CT) family, a member of the human melanoma-associated antigen (MAGE) family, MART 1, SAGE 1, carcinoembryonic antigen (CEA), HER-2 / neu, cytokeratin 19 (CK19, K19, cyfra21-1), survivin, mucin-1 (MUC-1, CA 15-3), squamous cell carcinoma (SCC) antigen, or any antigenic fragment and / or combination thereof. (Item 44) (a) The prostate cancer-related antigen is prostate-specific antigen (PSA), prostate-specific membrane antigen (PSMA), prostate stem cell antigen (PSCA), or prostatic acid phosphatase (PAP) antigen, or any antigenic fragment and / or combination thereof. (b) The breast cancer-related tumor-related antigen is breast epithelial antigen 46 (BA46, lactoadherin) or any antigenic fragment thereof, (c) The member of the cancer testicular antigen (CT) family is New York esophageal squamous cell carcinoma-1 (NY-ESO-1) (CT6.1), ADAM2 (CT15), SPA17 (CT22), or SPANX-A 1 (CT11.1), or any antigenic fragment and / or combination thereof, (d) The pharmaceutical composition according to item 43, wherein the member of the human melanoma-associated antigen (MAGE) family is MAGE-A1 / CT1.1, MAGE-A2 / CT1.2, MAGE-A3 / CT1.3, MAGE-A4 / CT1.4, MAGE-B1 / CT3.1, MAGE-C1 / CT7.1, MAGE-C2 / CT10, MAGE-C3 / CT7.2, or MAGE-E1, or any antigenic fragment and / or combination thereof. (Item 45) The pharmaceutical composition according to item 43 or 44, wherein the tumor antigen, tumor-associated antigen, or oncogene product is PSA, PSMA, PAP, PSCA, BA46, CEA, HER-2 / neu, CK19, Survivin, MUC-1, SCC, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-C2, NY-ESO-1, ADAM2, SPA17, or SPANX-A1, or any antigenic fragment and / or combination thereof. (Item 46) The pharmaceutical composition according to item 42, wherein the polypeptide is a viral antigen, and the viral antigen is hepatitis B virus (HBV) antigen, hepatitis C virus (HCV) antigen, human papillomavirus (HPV) antigen, human immunodeficiency virus (HIV) antigen, or any combination thereof. (Item 47) The pharmaceutical composition according to item 46, wherein the HPV antigen is the E6 antigen or the E7 antigen. (Item 48) The pharmaceutical composition according to item 47, wherein the E6 antigen or E7 antigen is derived from HPV serotypes 16, 18, 30, 31, 33, 35, 39, 45, 51, 52, 56, 58, 61, or any combination thereof. (Item 49) The pharmaceutical composition according to any one of items 41 to 48, wherein the cells are monocytes, dendritic cells, or a combination thereof. (Item 50) A method of immunotherapy comprising the step of administering a population of isolated cells as described in items 35-38 or a pharmaceutical composition as described in any one of items 41-49 to a subject requiring administration thereof, thereby stimulating an immune response. (Item 51) The immunotherapy method described in item 50, wherein the subject is a human. (Item 52) The immunotherapy method according to item 50 or 51, wherein the population of isolated cells was derived from the subject. (Item 53) A pharmaceutical composition comprising antigen-specific T cells that target cells expressing a polypeptide encoded by an exogenous nucleic acid sequence described in any one of items 1 to 20, wherein the T cells are activated by cells described in any one of items 35 to 38. (Item 54) A method of immunotherapy comprising the step of administering a pharmaceutical composition described in any one of item 53 to a subject in need of administration thereof. (Item 55) The immunotherapy method described in item 54, wherein the subject is a human. (Item 56) The immunotherapy method according to item 54 or 55, wherein the antigen-specific T cells were derived from the subject. (Item 57) A pharmaceutical composition comprising human peripheral blood mononuclear cells (PBMCs), wherein the PBMCs comprise antigen-specific T cells activated by cells described in any one of items 35 to 38. (Item 58) A method of immunotherapy comprising the step of administering a pharmaceutical composition described in item 57 to a subject requiring administration thereof. (Item 59) The immunotherapy method described in item 58, wherein the subject is a human. (Item 60) The immunotherapy method described in item 58 or 59, wherein the PBMC was derived from the subject. (Item 61) It is a method of immunotherapy. a. A step of generating infected PBMCs by infecting target peripheral blood mononuclear cells (PBMCs) with an rAAV virion described in any of items 21-25, b. A step of differentiating the monocytes of the infected PBMC into dendritic cells (DCs) by adding differentiation cytokines, c. A step of adding an activating cytokine to activate cytotoxic T lymphocytes (CTLs) of the infected PBMC to generate activated CTLs, d. If necessary, the step of isolating activated CTLs from the infected PBMCs, e. The step of administering to the subject an effective amount of the infected PMBC, which contains activated CTLs or isolated activated CTLs. Methods that include... (Item 62) A method for producing modified antigen-presenting cells (APCs), i) CD14 + The step of providing cells, ii) The CD14 + The step of contacting the cells with rAAV as described in any one of items 21-25, in an amount sufficient to express a polypeptide-encoding sequence, iii) For a sufficient amount of time to express the polypeptide, the CD14 of step ii) + The step of culturing cells and Methods that include... (Item 63) The method according to item 62, wherein the CD14+ cells are monocytes or dendritic cells. (Item 64) The method according to item 63, wherein the monocytes are located in a population of peripheral blood mononuclear cells (PBMCs). (Item 65) The method according to item 63, wherein the monocyte is an isolated monocyte. (Item 66) The method described in any one of items 63 to 65, for further differentiating the monocytes into dendritic cells. (Item 67) The method according to item 66, wherein the monocytes are differentiated into dendritic cells by contacting them with exogenous cytokines. (Item 68) The method according to item 67, wherein the monocytes are differentiated into dendritic cells by introducing a polynucleotide encoding an exogenous cytokine into the monocytes, thereby causing the monocytes to express the exogenous cytokine. (Item 69) The method according to item 68, wherein the polynucleotide encoding the exogenous cytokine is a plasmid or an rAAV virion. (Item 70) The method according to item 69, wherein the rAAV virion is an rAAV virion described in any one of items 21 to 25. (Item 71) The method according to item 67, wherein the exogenous cytokine is added to the cell culture. (Item 72) The method according to any one of items 67 to 71, wherein the exogenous cytokine is GM-CSF, IL-4, TNF-α, or any combination thereof. (Item 73) The method according to any one of items 63 to 72, wherein the exogenous cytokine is GM-CSF, IL-4, and TNF-α. (Item 74) A method for producing antigen-specific T cells, i) A step of providing naive T cells, ii) The step of contacting the naive T cells with a modified APC produced by any one of the methods described in items 62 to 73, iii) the step of bringing the T cells of step ii) into contact with the activating cytokine Methods that include... (Item 75) The method according to item 74, wherein the activating cytokine is IL-2, IL-7, or both. (Item 76) Antigen-specific T cells are CD4 + T cells or CD8 + The method described in item 74 or 75, which is a T cell. [Brief explanation of the drawing]
[0017] [Figure 1] Figure 1 shows a schematic diagram of an exemplary AAV / human CD14 promoter vector (exemplary pAAV-CD14p) for expressing an exogenous gene.
[0018] [Figure 2] Figure 2 shows the gel electrophoresis results after amplification of human CD14 promoter DNA by high-fidelity PCR.
[0019] [Figure 3] Figure 3 shows the gel electrophoresis results after amplification of late-stage poly-A DNA of SV40 by high-fidelity PCR.
[0020] [Figure 4] Figure 4 shows the gel electrophoresis results after digestion of an exemplary pAAV-CD14p plasmid with restriction endonuclease.
[0021] [Figure 5] Figure 5 shows the alignment of the human CD14 promoter DNA (SEQ ID NO: 1) sequence in an exemplary pAAV-CD14p plasmid compared to the reference wild-type sequence (GenBank accession number HQ199230.1).
[0022] [Figure 6]Figure 6 shows a schematic diagram of an exemplary process for preparing infectious virus particles.
[0023] [Figure 7] Figure 7A shows the rAAV virus titer (copies / ml) of rAAV-CD14p / exogenous gene viruses expressing prostate-specific antigen (PSA) or prostate-specific membrane antigen (PSMA). Figure 7B shows the rAAV virus titer of rAAV-CD14p / exogenous gene viruses expressing IL-4 or IL-12.
[0024] [Figure 8] Figure 8A shows CD14 promoter-driven enhanced green fluorescent protein (eGFP) expression in peripheral blood lymphocytes, monocytes, and dendritic cells. Figure 8B shows the lack of CD14 promoter-driven eGFP expression in HEK 293 cells.
[0025] [Figure 9] Figure 9 shows the results of flow cytometry detection of antigens expressed in monocytes and dendritic cells (DCs) transduced with rAAV-CD14p / antigen rAAV on day 3 of cell culture. PAP: prostatic acid phosphatase antigen; CEA: carcinoembryonic antigen; CK19: cytokeratin 19 antigen; MAGE-A3: melanoma antigen family A3 antigen; Muc-1: mucin 1 antigen.
[0026] [Figure 10] Figure 10 shows the results of flow cytometry detection of cytokines in DCs transduced by each rAAV-CD14p / cytokine rAAV on day 5 of cell culture. GM-CSF: Granulocyte-macrophage colony-stimulating factor.
[0027] [Figure 11] Figure 11 shows the results of flow cytometry detection of CD1a, CD40, CD80, and CD86 markers in DC cells transduced with rAAV-CD14p / antigen rAAV. SP17: sperm protein 17.
[0028] [Figure 12] Figure 12 shows a comparison of flow cytometry detection of IL-12 and IL-10 expression levels in dendritic cells transduced with rAAV. PSCA: prostate stem cell antigen; HPV16 E6-E7: human papillomavirus type 16 E6 and E7 antigens.
[0029] [Figure 13] Figure 13 shows the results of flow cytometry detection of the number of monocytes remaining on day 6 of DC culture. SCC: Squamous cell carcinoma antigen; NY-ESO-1: New York esophageal squamous cell carcinoma-1 antigen.
[0030] [Figure 14] Figure 14 shows the IFN-γ expression levels of T lymphocytes primed with DCs transduced with rAAV-CD14p / rAAV antigen compared with DCs transduced with rAAV-CMVp / rAAV antigen. HPV18 E6-E7: Human papillomavirus type 18 E6 and E7 antigens; MAGE-C2: Melanoma antigen family C2 antigen.
[0031] [Figure 15] Figure 15 shows the number of CD69+ / CD8+ T lymphocytes primed by DCs transduced with rAAV-CD14p / antigen rAAV, DCs transduced with rAAV-p5 / antigen rAAV, or DCs transduced with rAAV-CMVp / antigen rAAV. BA46: Breast epithelial antigen 46 (lactoadherin).
[0032] [Figure 16] Figure 16 shows the killing activity of cytotoxic T lymphocytes (CTLs) induced by DCs transduced with rAAV-CD14p / antigen rAAV or rAAV transduced with anti-MHC class I antibodies. The killing rates of K562, HeLa, THP-1, or HEK 293 cells are the average values of these cells killed by CTLs exposed to three different rAAV-CD14p / antigen rAAV transduced DCs.
[0033] [Figure 17] Figure 17 shows a comparison of the killing activity of CTLs induced by DCs transduced with rAAV-CD14p / antigen rAAV and DCs transduced with rAAV-CMVp / antigen rAAV.
[0034] [Figure 18] Figure 18 shows the percentage of CD3+ T lymphocytes in peripheral blood mononuclear cells (PBMCs) before rAAV transduction and on day 14 after transduction with rAAV-CD14p / CK19, rAAV-p5 / CK19, rAAV-CD14p / muc-1, and rAAV-CMVp / muc-1, respectively. [Modes for carrying out the invention]
[0035] Detailed explanation CD14 cells such as monocytes or dendritic cells (DCs) + This specification provides recombinant adeno-associated virus (rAAV) vectors comprising a cluster of differentiation antigen 14 (CD14) promoter capable of promoting the targeting and / or specific expression of operablely linked polynucleotides in cells. Exogenous genes and / or coding sequences can be inserted into the rAAV vector. CD14 + It infects cells and introduces exogenous genes and / or coding sequences that are operablely linked to the CD14 promoter, thereby CD14 +Also provided are rAAV virions (e.g., rAAV-CD14p) that can promote the targeting and / or specific expression of exogenous genes and / or coding sequences in cells. Examples of exogenous genes and / or coding sequences include, but are not limited to, sequences encoding wild-type, truncated, or mutant tumor antigen genes, tumor-associated antigens, viral antigens, bacterial antigens, cytokines, and other polypeptides of interest. The rAAV vectors and virions disclosed herein are useful for transducing monocytes and DCs to induce immune responses that can be used to treat or prevent malignancies, viral or bacterial infectious diseases, and other diseases. Using tissue or cell-specific CD14 promoters, the rAAV vectors, compositions, and methods disclosed herein promote CD14 expression while reducing the complications that may result from expression in non-target cells. + This provides the advantage of targeting and / or specific expression of a desired polynucleotide sequence in cells.
[0036] definition In this specification, any concentration range, percentage range, ratio range, or integer range should be understood to include any value or subrange within the listed range unless otherwise indicated. Where used herein, the term “approximately” means ±20% of the indicated range or value unless otherwise indicated.
[0037] Furthermore, it should be noted that the term "or" is generally used in its sense of "and / or" (i.e., meaning one of the options, both, or any combination thereof) unless otherwise indicated in the context.
[0038] Furthermore, as used herein and in the appended claims, the singular forms "a," "an," and "the" refer to multiple subjects unless otherwise indicated by the context.
[0039] The terms "include," "have," and "comprise," and their variations, should be used synonymously and interpreted as non-restrictive.
[0040] As used herein, the term “a combination thereof” refers to all possible combinations of the items listed before the term. For example, “A, B, C, or a combination thereof” is intended to refer to any one of A, B, C, AB, AC, BC, or ABC. Similarly, as used herein, the term “combinations thereof” refers to all possible combinations of the items listed before the term. For example, “A, B, C, and a combination thereof” is intended to refer to all of A, B, C, AB, AC, BC, and ABC.
[0041] As used herein, the terms “polynucleotide,” “nucleotide,” “nucleotide sequence,” “nucleic acid,” and “oligonucleotide” are interchangeable and refer to deoxyribonucleotides or ribonucleotide polymers in linear or cyclic conformations, in either single-stranded or double-stranded form. Non-limiting examples of polynucleotides include coding or non-coding regions of genes or gene fragments, loci (locus) as defined by linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. For the purposes of this disclosure, these terms should not be construed as limiting with respect to polymer length. These terms may encompass known analogues of natural nucleotides, as well as nucleotides modified at the base, sugar, and / or phosphate moieties (e.g., phosphorothioate backbone). Generally, analogs of a particular nucleotide have the same base pairing specificity; that is, analogs of A pair with T.
[0042] As used herein, the terms “polypeptide,” “peptide,” and “protein” are used interchangeably to refer to polymers of amino acid residues. The term also applies to amino acid polymers in which one or more amino acids are chemical analogues or modified derivatives of the corresponding naturally occurring amino acids.
[0043] Generally, as used herein, the term “vector” refers to a polynucleotide capable of transporting another polynucleotide to which it is linked. Examples of vectors include, but are not limited to, polynucleotide molecules that are single-stranded, double-stranded, or partially double-stranded; polynucleotide molecules containing one or more free ends; polynucleotide molecules without free ends (e.g., circular); polynucleotide molecules containing DNA, RNA, or both; and various other polynucleotides known in the art. One type of vector is a “plasmid,” which refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted by standard molecular cloning techniques, for example. Another type of vector is a viral vector, in which a viral DNA or RNA sequence is present in the vector for packaging with a virus (e.g., adeno-associated virus). Viral vectors also include polynucleotides carried by a virus for transduction into a host cell.
[0044] The terms "transfection" and "transduction" are interchangeable and refer to the process by which an exogenous DNA sequence is introduced into a eukaryotic cell. Transfection can be achieved by any one of several methods, including electroporation, microinjection, gene gun delivery, lipofection, and superfection. Transduction generally refers to the introduction of an exogenous DNA sequence into a eukaryotic cell achieved by a viral vector, such as AAV, retrovirus, lentivirus, or adenovirus vector.
[0045] As used herein, “gene” includes a DNA sequence encoding a polynucleotide or polypeptide. Thus, a gene may include, but is not limited to, a cDNA sequence, genomic sequence, and smaller engineered gene segments that express or are adapted to express proteins, polypeptides, domains, peptides, fusion proteins, and / or variants.
[0046] As used herein, “expression” refers to the process by which polynucleotides are transcribed from a DNA template (into mRNA or other RNA transcripts, etc.) and / or the process by which the transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. The transcripts and encoded polypeptides may collectively be referred to as “expression products.”
[0047] As used herein, “specific expression,” “targeted expression,” and “specifically expressed” are interchangeable and refer to the expression of a polynucleotide or polypeptide in a specific target tissue or target cell type, but which is absent or undetectable in non-target tissues or non-target cell types. Specific expression is typically driven by a “tissue-specific promoter” or a “cell-specific promoter.” A “tissue-specific promoter” expresses a gene under its control in one or a few target tissues, but not in other tissues. A “cell-specific promoter” expresses a gene under its control in one or a few specific cell types, but not in other cell types. Both tissue-specific and cell-specific promoters may be referred to as “specific promoters” as used herein. A specific promoter contains a specific DNA sequence that interacts with one or more specific transcription factors that can act as activators and / or repressors of transcription. A specific promoter drives the expression of a polynucleotide only in specific cell types and / or tissues. For example, a specific promoter can drive the specific expression of a polynucleotide in monocytes and / or DCs, rather than in T cells or epithelial cells. An example of a specific promoter is the CD14 promoter.
[0048] As used herein, “operatably linked” means that the nucleotide sequence of interest is linked to a regulatory element, such as a promoter, in a manner that enables the expression of the nucleotide sequence in the host cell, for example, when the vector is introduced into the host cell.
[0049] The term “regulatory elements” is intended to include promoters, enhancers, internal ribosome entry sites (IRESs), and other expression regulatory elements (e.g., transcription termination signals such as polyadenylation signals and poly-U sequences). Such regulatory elements are described, for example, in Goeddel (1990) Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. Regulatory elements include those that direct tissue-specific expression.
[0050] As used herein, the terms “rAAV virion” or “rAAV particle” refer to an infectious viral particle containing a capsid comprising at least one AAV capsid protein that capsids an rAAV vector as described herein. Preferably, the vector comprises an exogenous and / or heterologous nucleic acid sequence that is expressed after the rAAV virion infects (transduces) a target cell.
[0051] As used herein, “exogenous” means a nucleic acid sequence or polypeptide that is not normally present in a cell or virus but can be introduced into the cell or virus by one or more genetic, biochemical, or other means. For example, an exogenous nucleic acid sequence may be part of an infectious viral vector, plasmid, or episome introduced into a cell. A further example of an exogenous nucleic acid sequence is a mammalian polynucleotide introduced into a viral polynucleotide sequence. Another example of an exogenous nucleic acid sequence or polypeptide is a nucleic acid sequence or polypeptide introduced into a cell that is not normally expressed at a detectable level in comparable cells, or a variant and / or cleaved form of a wild-type polynucleotide or polypeptide.
[0052] As used herein, the term “antigen” refers to a molecule containing one or more epitopes that can be bound by one or more MHC receptors, antibodies, or other antigen-binding moieties. For example, when an antigen is presented, it can stimulate the host’s immune system to trigger a cell-antigen-specific immune response. Antigens can also have the ability to induce a cellular immune response, either by themselves or in combination with other molecules. For example, tumor cell antigens can be recognized by T cell receptors (TCRs). Antigens can be wild-type, mutant, or cleaved versions of proteins. Furthermore, antigens can originate from recombinant DNA or genomic DNA. It is recognized in the art that nucleotide sequences or partial nucleotide sequences of the genome of a pathogenic organism, or expressed DNA containing genes or gene fragments of proteins that trigger an immune response, can result in the synthesis of antigens. Furthermore, this disclosure is not limited to the use of entire nucleic acid sequences of genes or cDNA. Thus, the use of two or more partial nucleic acid sequences of genes or cDNA is contemplated herein, and these nucleic acid sequences are arranged in various combinations to induce a desired immune response.
[0053] The term “antigen-presenting cell” or “APC” refers to any of the various cells capable of displaying, acquiring, or presenting at least one antigen or antigen fragment on (or on) its cell surface. Such cells can be identified using methods disclosed herein and known in the art. As will be understood by those skilled in the art and as used herein, in certain embodiments, a cell that displays or presents an antigen to an immune cell, for example, together with a class II major histocompatibility molecule or complex (MHCII), is an antigen-presenting cell.
[0054] As used herein, the terms "CD14 positive" or "CD14 + "Cells" refer to cells that naturally express the CD14 gene. +Examples of cells include monocytes, DCs, and macrophages. CD14 expression can be detected using any method known in the art for detecting gene expression, such as flow cytometry, immunohistochemistry, fluorescence microscopy, Western blotting, Northern blotting, and reverse transcription PCR. When detected by flow cytometry, a cell population that is "positive" for the marker refers to a cell population that shows uniform monoclonal antibody staining above the level found for staining with isotype controls. In some embodiments, an increase of at least twofold in MFI compared to a reference population indicates that cells are positive for marker expression. For example, cell populations positive for a marker may show MFIs of 2-4 times, 4-10 times, 10-100 times, and 100-1,000 times, 1,000-10,000 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 25 times, 30 times, 35 times, 40 times, 50 times, 100 times, 200 times, 300 times, 400 times, 500 times, 600 times, 700 times, 800 times, 900 times, 1,000 times, 5,000 times, 10,000 times or higher compared to isotype controls.
[0055] Monocytes are immune cells that express the marker CD14 and can differentiate into dendritic cells or macrophages. In addition to CD14, monocytes express at least one of CD11b, CCR2, and CD16.
[0056] Dendritic cells, or DCs, are antigen-presenting cells that exist in vivo, in vitro, or ex vivo, or in a host or target, or may originate from monocytes or hematopoietic stem cells. Dendritic cells and their precursors can be isolated from peripheral blood and bone marrow, as well as various lymphoid organs, such as the spleen and lymph nodes. DCs have a characteristic morphology with thin sheets (lamellipodia) that extend in multiple directions away from the dendritic cell body. DCs are potent professional antigen-presenting cells for both MHC class II and MHC class I-restricted systems (Santambrogio et al., PNAS 96(26):15050-55, 1999). Typically, dendritic cells express high levels of MHC and costimulatory (e.g., B7-1 and B7-2) molecules. Dendritic cells can induce antigen-specific differentiation of T cells and initiate cytotoxic T lymphocyte responses in vitro and in vivo.
[0057] As used herein, the term “differentiation cytokine” refers to cytokines that can promote the differentiation of monocytes into dendritic cells. Examples of cytokines that promote differentiation include, but are not limited to, GM-CSF, IL-4, and TNF-α.
[0058] As used herein, the term “activating cytokine” refers to cytokines that can promote the activation of antigen-specific T lymphocytes, such as cytotoxic T lymphocytes. Examples of cytokines that activate include, but are not limited to, IL-2 and IL-7.
[0059] The terms “cancer” and “tumor” are used interchangeably herein and refer to the overgrowth of cells resulting in uncontrolled growth, lack of differentiation, local tissue invasion, and / or metastasis.
[0060] As used herein, the terms “treatment,” “to treat,” “treated,” or “to treat” may include reversing, mitigating, or inhibiting the progression of a disease, disorder, or condition to which such terms apply, or preventing or reducing the likelihood of such disease, disorder, or condition. For example, as used in reference to cancer, the term generally refers to reversing, mitigating, or inhibiting the progression of the disease and / or symptoms. As used in reference to infectious diseases, for example, the term may refer to post-infection treatments of a subject to combat infection, such as reducing or eliminating infection, or preventing the infection from worsening, as well as preventive treatments that increase a subject's resistance to infection by a pathogen, or in other words, reduce the likelihood of showing signs of an illness resulting from infection.
[0061] "Effective dose" or "therapeutic effective dose" means an amount of the composition described herein that, when administered to a subject (e.g., a human), is sufficient to assist in the treatment of a disease. The amount of composition constituting the "therapeutic effective dose" will vary depending on the cells and / or rAAV preparation, the symptoms and their severity, the mode of administration, and the body weight and age of the subject being treated, but a person skilled in the art can routinely determine this in consideration of their knowledge and this disclosure.
[0062] As used herein, the term “induces an immune response” refers to the ability to activate and / or promote an antigen-specific cell-mediated immune response. For example, the compositions of this disclosure can enhance and / or activate an immune response. The immune response can be induced ex vivo and / or in vivo.
[0063] As used herein, “Subject” or “Patient” means one or more individuals that require to receive the procedures, treatments, cell compositions, and / or rAAV compositions disclosed herein. Subjects that may be treated in accordance with this disclosure are generally human. However, further subjects include non-human primates, cattle, horses, sheep, goats, pigs, dogs, cats, mice, rabbits, rats, or guinea pigs. Subjects may be male or female and may be of any appropriate age, including infants, young, adolescent, adult, and elderly subjects.
[0064] As used herein, the term “pharmaceutically or pharmacologically acceptable” refers to molecular entities and compositions that, when administered to animals or humans, do not cause harmful, allergic, or other adverse reactions. As used herein, “pharmaceutically acceptable carrier” includes all kinds of solvents, dispersions, coatings, antimicrobial and antifungal agents, isotonic agents and absorption retarders, etc. The use of such media and agents for pharmaceutically active substances is well known in the art. Unless any conventional culture medium or agent is compatible with the vector or cells of the present invention, its use in the therapeutic composition is intended. Auxiliary active ingredients may also be incorporated into the composition.
[0065] As used herein, “sample” refers to a cell source (e.g., living tissue) from which a population of cells can be isolated, enriched, or depleted. In some embodiments, the sample is generally untreated or minimally treated. For example, the sample may be non-mobilized blood, non-mobilized apheresis products, mobilized peripheral blood, mobilized apheresis products, bone marrow, umbilical cord blood, peripheral blood mononuclear cells (PBMCs), or any combination thereof. In some embodiments, the sample is prepared or minimally treated by density gradient, Ficoll, Percoll, erythrocyte hypotonic lysis, treatment with ammonium chloride-potassium (ACK) buffer, washing to pH-equipped isotonic buffer, or any combination thereof. In some embodiments, the sample is provided by a single tissue sample. In some embodiments, the sample is provided by one or more tissue samples.
[0066] Recombinant AAV vectors The AAV vectors provided herein are engineered to deliver the target gene by deleting the internal non-repeatable regions of the AAV genome by deleting the internal Cap and Rep genes and other endogenous DNA regions and inserting exogenous nucleic acid sequences between ITRs. The exogenous gene is CD14 expression (CD14 + ) is operably ligated to a CD14 promoter that can drive specific expression in target cells. Accordingly, the present disclosure relates to a polynucleotide comprising a recombinant adeno-associated virus (rAAV) vector encoding two ITR sequences and a CD14 promoter operably ligated to an exogenous nucleic acid sequence, wherein the CD14 promoter is CD14 +The present invention provides polynucleotides that induce the specific expression of exogenous nucleic acids in cells. The CD14 promoter may be any mammalian CD14 promoter that specifically drives the expression of exogenous nucleic acid sequences in CD14-positive cells. In some embodiments, the CD14 promoter is a human CD14 promoter sequence. The human CD14 promoter contains SEQ ID NO: 1 or has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 1, while also containing CD14 + It can drive specific expression in cells. Referring to the position in SEQ ID NO: 1, the CD14 promoter includes a TATA box (positions 481-486), a C / EBP site (positions 378-386), an Sp1 binding site (positions 404-410 and 533-538), a Myb site (positions 42-47 and 457-463), an AP-1 site (positions 113-121, 127-133, and 288-293), an AP-2 site (positions 276-283 and 356-364), and a CDP (CCATT substitute protein) site (positions 164-168). In certain embodiments, the CD14 promoter includes a C / EBP site and an Sp1 site that regulate tissue-specific expression of CD14. In some embodiments, the CD14 promoter includes at least nucleotides at positions 378–386, 404–410, and 533–538 of SEQ ID NO: 1. Examples of CD14-expressing cells include monocytes, dendritic cells, and macrophages.
[0067] In some embodiments, the rAAV vector comprises a first ITR, a CD14 promoter operably linked to an exogenous nucleic acid sequence, a polyadenylation signal sequence, and a second ITR, arranged in the 5'→3' direction. In some embodiments, the ITR sequence is or is derived from an AAV-2 ITR sequence. In some embodiments, the first and second ITR sequences are or are derived from an AAV-2 ITR. In some embodiments, the ITR sequence is derived from any other AAV serotype, e.g., AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAVrh.10. While not wishing to be bound by theory, it is considered desirable for the ITR sequence to be bilaterally symmetrical for efficient multiplication of the sequence sandwiched between the first and second ITRs. Examples of polyadenylation signal sequences include the SV40 late polyadenylation signal, the human growth hormone polyadenylation signal, and the bovine growth hormone polyadenylation signal. In some embodiments, the rAAV vector further includes an enhancer sequence. Enhancers are well known in the art and are genetic elements that increase transcription from the promoter. The enhancer sequence does not significantly affect the specificity of expression driven by the CD14 promoter. Examples of enhancers include, but are not limited to, the Simian virus 40 (SV40) enhancer, the cytomegalovirus (CMV) early enhancer, and the HACNS1 (CENTG2) enhancer.
[0068] In some embodiments, the rAAV vector is a plasmid vector also called "pAAV-CD14p" (i.e., a plasmid containing the AAV ITR sequence and the CD14 promoter). In some embodiments, the plasmid vector contains a human CD14 transcription promoter, an AAV2 type reverse terminal repeat (ITR) sequence, a multicloning site (MCS) sequence, a late SV40 polyA sequence, and an antibiotic resistance gene, such as a β-lactamase gene (ampicillin resistance gene, Amp r), and a gene element (such as DH5α) that allows the plasmid to replicate in E. coli. An exemplary plasmid vector is shown in Figure 1. In some embodiments, the plasmid contains the sequence of Sequence ID No. 2. In some embodiments, the rAAV vector is capsid-formed into an AAV virion.
[0069] In certain embodiments, the exogenous nucleic acid sequence includes multiple cloning sites (MCS). MCS sequences are well known in the art and are sometimes called polylinkers. An MCS sequence is typically a short segment of DNA containing several unique sequences known as restriction sites that can be targeted by restriction endonucleases (also known as restriction enzymes). An MCS may contain up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more unique restriction sites. Any restriction site known in the art may be used. Examples of restriction sites include AbsI, AscI, AvrII, BclI, BstZ17I, BstBI, Bst98I, BmgBI, BglII, ClaI, FseI, MluI, MreI, NdeI, NheI, NsiI, SnaBI, EcoRI, EcoRII, BamHI, HindIII, TaqI, NotI, HinFI, Sau3AI, PvuII, SmaI, HaeIII, Hgal, Alul, EcoRV, EcoP15I, KpnI, PstI, PmeI, RsrII, SacI, SalI, ScaI, SpeI, SphI, StuI, SgrDI, SrfI, XhoI, and XbaI. Further restriction sites and restriction enzymes are listed in the REBASE database, which is incorporated herein by reference in its entirety.
[0070] In some embodiments, the exogenous nucleic acid sequence includes a sequence encoding RNA and / or polypeptides. In certain embodiments, the RNA and / or polypeptide-encoding sequence is inserted into the MCS. Examples of RNA include mRNA, small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), and ribozymes. In some embodiments, the exogenous nucleic acid sequence encodes an antigen polypeptide. Examples of antigen polypeptides include tumor antigens, tumor-associated antigens, oncogene products, viral antigens, bacterial antigens, or any combination thereof. In certain embodiments, the antigen polypeptide may be a full-length protein, an antigenic fragment of a protein, a cleaved protein, and / or a variant form of a protein.
[0071] Cells, including dendritic cells, spontaneously produce a repertoire of peptides from virtually any cell translation product (e.g., proteins) and present these peptides on the cell surface via peptide / MHC complexes. Proteolysis of endogenous and / or exogenous proteins produces smaller peptides that can bind to MHC molecules to form peptide / MHC complexes. These peptide / MHC complexes are then transported to the cell surface. T cell receptors (TCRs) on the surface of circulating cytotoxic T cells probe peptide / MHC complexes for the presence of peptides such as tumor antigens or viral proteins that trigger a T cell-targeted immune response. Cellular processes for peptide production and presentation on the cell surface are described, for example, in "Janeway's Immunobiology" 9. th It is summarized in Ed. (2016).
[0072] In some embodiments, tumor antigens, tumor-associated antigens, or oncogene products may be any such antigen polypeptide or fragment thereof known in the Art. Examples of tumor antigens, tumor-associated antigens, or oncogene products include alpha-fetoprotein (AFP), B melanoma antigen (BAGE / CT2.1), differentiation antigen group 20 (CD20), CD269, G250 (carbonic anhydrase IX / CA IX), HM1.24, CD154, prostate cancer-associated antigens (e.g., prostate-specific antigen (PSA), prostate-specific membrane antigen (PSMA), prostate stem cell antigen (PSCA), and prostatic acid phosphatase (PAP) antigen), breast cancer-associated tumor-associated antigens (e.g., mammary epithelial antigen 46 (BA46, lactoadherin)), and cancer-testicular antigen (CT) family (e.g., New York esophageal squamous cell carcinoma-1 (NY-ESO-1) (CT6.1), ADAM2 (CT15)). Examples include, but are not limited to, SPA17 (SP17, CT22), SPANX (e.g., Spanx-A1 (CT11.1)), the human melanoma-associated antigen (MAGE) family (e.g., MAGE-A1 / CT1.1, MAGE-A2 / CT1.2, MAGE-A3 / CT1.3, MAGE-A4 / CT1.4, MAGE-B1 / CT3.1, MAGE-C1 / CT7.1, MAGE-C2 / CT10, MAGE-C3 / CT7.2, MAGE-E1), MART1, SAGE 1, carcinoembryonic antigen (CEA), HER-2 / neu, cytokeratin 19 (CK19, K19, cyfra21-1), Survivin, mucin-1 (MUC-1, CA15-3), squamous cell carcinoma (SCC) antigen, or any antigen fragments and / or combinations thereof.
[0073] In some embodiments, the viral antigen may be any viral antigen known in the art. Examples of viral antigens include, but are not limited to, hepatitis B virus (HBV) antigen, hepatitis C virus (HCV) antigen, human papillomavirus (HPV) antigen, human immunodeficiency virus (HIV) antigen, cytomegalovirus (CMV), Epstein-Barr virus (EBV), influenza virus, parainfluenza virus, respiratory syncytial virus (RSV), herpes simplex virus (HSV), papillomavirus, measles virus, rotavirus, or any antigenic fragments and / or combinations thereof. In some embodiments, the HPV antigen is an E6 polypeptide, an E7 polypeptide, or any antigenic fragment thereof. In certain embodiments, the exogenous nucleic acid sequence includes a sequence encoding an E6 polypeptide and an E7 polypeptide, or an antigenic fragment thereof. In certain embodiments, the E6 or E7 antigen is derived from HPV serotypes 16, 18, 30, 31, 33, 35, 39, 45, 51, 52, 56, 58, 61, or any antigenic fragment and / or combination thereof. In some embodiments, the HBV antigen is HBsAg, HBeAg, HBcAg, and / or HBxAg. In some embodiments, the HCV antigen is C, E1, E2, NS1, NS2, NS3, NS4, and / or NS5 antigen. In some embodiments, the HIV antigen is gag antigen, pol antigen, and / or env antigen. In some embodiments, the CMV antigen is pp65 antigen, pp150 antigen, and / or gB antigen. In some embodiments, the EBV antigen is LMP-1 antigen, LMP-2A antigen, LMP-2B antigen, EAR antigen, EAD antigen, VCA antigen, MA antigen, EBNA1 antigen, EBNA2 antigen, EBNA3 antigen, EBNA3B antigen, and / or EBNA3C antigen.
[0074] In some embodiments, the bacterial antigen may be any bacterial antigen known in the art. Examples of bacteria that can induce bacterial antigens include, but are not limited to, Mycobacterium tuberculosis, Helicobacter, Campylobacter, Clostridium species, Corynebacterium diphtheriae, Bordetella pertussis, Borrelia burgdorfei, Plasmodium species, Vibrio cholera, Escherichia coli, Shigella, Salmonella typhi, and Neisseria gonorrhea. In certain embodiments, the Mycobacterium tuberculosis antigen may be MPT44 antigen, MPT45 antigen, MPT59 antigen, MPT64 antigen, Ag85B antigen, Rv3117 antigen, and / or ESAT-6 antigen.
[0075] Table 1 provides a list of representative antigens and UniProtUK accession numbers available at the time of filing. The version number refers to the version of the sequence provided to the database. UniProtUK accession numbers for known and predicted isoforms are also provided.
[0076] [Table 1-1] [Table 1-2]
[0077] In some embodiments, the exogenous nucleic acid sequence encodes a cytokine. The cytokine may be an interleukin, interferon, tumor necrosis factor, granulocyte-macrophage colony-stimulating factor (GM-CSF), or any combination thereof. Examples of cytokines include, but are not limited to, GM-CSF, TNF-α, IL-4, IL-7, IL-12, IL-15, IL-18, TGF-β, other Th1 cytokines known in the art, e.g., IFNγ, IL-2, IL-10, IL-18, and IL-27, other Th2 cytokines known in the art, e.g., IL-5, IL-9, IL-10, IL-13, IL-25, and amphiregulin, and / or any combination thereof.
[0078] In certain embodiments, the rAAV vector further comprises an internal ribosome entry site (IRES) sequence. The IRES sequence can be used to create multiple genes or polycistronic messages. The IRES sequence can be operably ligated to an exogenous nucleic acid sequence encoding RNA and / or polypeptides. Multiple exogenous nucleic acid sequences can be transcribed together, each separated by the IRES to create a polycistronic message. Thanks to the IRES sequence, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter to transcribe a single message encoding at least two RNA and / or polypeptides (see U.S. Patents 5,925,565 and 5,935,819, each incorporated by reference).
[0079] According to this disclosure, rAAV plasmid vectors are named according to the formula “pAAV-[promoter] / [payload]”. Therefore, “pAAV-CD14p / exogenous gene” refers to an rAAV plasmid vector containing a CD14 promoter operably ligated to an exogenous nucleic acid sequence, where the CD14 promoter and exogenous nucleic acid sequence are flanked by ITR sequences located in the 5' and 3' regions of the sequence. Further examples include pAAV-CD14p / antigen and pAAV-CD14p / cytokine, which refer to rAAV plasmid vectors, where the CD14 promoter is functionally ligated to a nucleic acid sequence encoding an antigen or cytokine, respectively. Furthermore, rAAV plasmid vectors containing an exogenous sequence encoding a specific polypeptide include the name of the exogenous sequence. For example, an rAAV plasmid vector containing a CD14 promoter operably ligated to an exogenous nucleic acid encoding PSA is called “pAAV-CD14p / PSA”.Examples of rAAV plasmid vectors include pAAV-CD14p / AFP, pAAV-CD14p / BA46, pAAV-CD14p / CT2.1, pAAV-CD14p / CEA, pAAV-CD14p / CD20, pAAV-CD14p / CD269, pAAV-CD14p / CK19, pAAV-CD14p / G250, and pAAV-CD14p / HP. V16-E6, pAAV-CD14p / HPV16-E7, pAAV-CD14p / HPV16-E6-E7, pAAV-CD14p / HPV18-E6, pAAV-CD14p / HPV18-E7, pAAV-CD14p / HPV18-E6-E7, pAAV-CD14p / HER2, pAAV-CD14p / HM1.24, pAAV-CD14p / LMP -1, pAAV-CD14p / MAGE-A1, pAAV-CD14p / MAGE-A2, pAAV-CD14p / MAGE-A4, pAAV-CD14p / MAGE-B1, p AAV-CD14p / MAGE-C1, pAAV-CD14p / MAGE-E1, pAAV-CD14p / MART1, pAAV-CD14p / MUC-1, pAAV-CD14p Examples include / CT6.1, pAAV-CD14p / PSA, pAAV-CD14p / PAP, pAAV-CD14p / PSMA, pAAV-CD14p / PSCA, pAAV-CD14p / SAGE1, pAAV-CD14p / SCC, pAAV-CD14p / SPANX, pAAV-CD14p / SPA17, and pAAV-CD14p / Survivin.
[0080] rAAV Billion In a particular embodiment, an rAAV virion comprising a CD14 promoter operably linked to an exogenous nucleic acid sequence, wherein the CD14 promoter is CD14 +Disclosed herein are rAAV virions that specifically induce the expression of exogenous nucleic acids in cells. The rAAV virions may include any of the polynucleotide sequences disclosed in the embodiments and examples provided herein. In some embodiments, the rAAV virion includes a nucleic acid sequence encoding an antigen polypeptide, such as a tumor antigen, tumor-associated antigen, oncogene product, viral antigen, bacterial antigen, or any combination thereof, as disclosed herein. In some embodiments, the rAAV virion includes a capsid protein of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.10, AAV11, or any combination thereof. In certain embodiments, the rAAV virion includes a capsid protein of AAV2, AAV3, AAV5, AAV6, or any combination thereof. In certain embodiments, the rAAV virion includes a capsid protein of AAV2. In some embodiments, chimeric rAAV virions are used in which the viral origin of the ITR sequence of the rAAV vector is heterologous to the viral origin of the capsid sequence. Examples include chimeric viruses having an ITR derived from AAV2 and a capsid derived from AAV5, AAV6, AAV8, or AAV9 (i.e., AAV2 / 5, AAV2 / 6, AAV2 / 8, and AAV2 / 9, respectively). In certain embodiments, the rAAV virion does not contain any promoter other than the CD14 promoter. In certain embodiments, the rAAV virion does not contain AAV structural genes, i.e., Rep and / or Cap genes. According to this disclosure, rAAV virions are named according to the formula "rAAV-[promoter] / [payload]".rAAV-CD14p / AFP、rAAV-CD14p / BA46、rAAV-CD14p / CT2.1、rAAV-CD14p / CEA、rAAV-CD14p / CEA、rAAVビリオンAAV-CD14p / CD20、rAAV-CD14p / CD269、rAAV-CD14p / CK19、rAAV-CD14p / G250、rAAV-CD14p / HPV16 -E6、rAAV-CD14p / HPV16-E7、rAAV-CD14p / HPV16-E6-E7、rAAV-CD14p / HPV18-E6、rAAV-CD14p / HP V18-E7、rAAV-CD14p / HPV18-E6-E7、rAAV-CD14p / HER2、rAAV-CD14p / HM1.24、rAAV-CD14p / LMP-1 、rAAV-CD14p / MAGE-A1、rAAV-CD14p / MAGE-A2、rAAV-CD14p / MAGE-A4、rAAV-CD14p / MAGE-B1、rAA V-CD14p / MAGE-C1、rAAV-CD14p / MAGE-E1、rAAV-CD14p / MART1、rAAV-CD14p / MUC-1、rAAV-CD14p / CT6.1、rAAV-CD14p / PSA、rAAV-CD14p / PAP、rAAV-CD14p / PSMA、rAAV-CD14p / PSCA、rAAV-CD14p / SAGE1、rAAV-CD14p / SCC、rAAV-CD14p / SPANX、rAAV-CD14p / SPA17、rAAV-CD14p / サバイバン are listed.
[0081] In one embodiment, a method for producing rAAV virions is disclosed herein, comprising the step of introducing a pAAV-CD14p / exogenous plasmid into packaging cells, wherein the packaging cells contain one or more nucleic acid sequences encoding helper genes. To produce infectious rAAV virions, a suitable packaging cell line can be transfected with a plasmid containing any of the rAAV vectors disclosed herein. The packaging cell line contains other AAV genes, namely Rep and Cap, but lacking an ITR sequence, as helper plasmids. The packaging cell line also contains helper virus genes, such as plasmids encoding adenovirus genes necessary for the production of infectious virions. For example, the helper plasmid may contain adenovirus genes, such as the VA, E2A, E3, and E4 genes of adenovirus type 5. The helper virus genes facilitate the replication of the rAAV vector and the expression of AAV genes from the helper plasmid. The helper plasmid is not packaged in significant quantities due to the lack of an ITR sequence. In certain embodiments, the helper genes are contained on a single plasmid. In other embodiments, the helper gene is contained on two or more plasmids (e.g., two plasmids). In some embodiments, the pAAV-CD14p / exogenous plasmid is co-transfected into packaging cells with one or more plasmids containing the helper gene. Alternatively, the packaging cell line may be infected with adenovirus as a helper. In some embodiments, the pAAV-CD14p / exogenous plasmid is co-transfected into packaging cells with plasmids containing the Rep and Cap genes, thereby infecting the cells with adenovirus. Adenovirus contamination can be reduced, for example, by heat treatment in which the adenovirus is more susceptible than AAV. In some embodiments, the packaging cells are mammalian cells. Examples of packaging cells that can be used to produce rAAV virions include, but are not limited to, HEK293, HeLa, and HT1080 cells.In some embodiments, the packaging cells are HEK293T cells. The packaging cell line can also be stably transfected or transduced with one or more vectors containing the AAV Rep and Cap genes as well as the adenovirus VA, E2A, E3, and E4 genes. Further methods for the delivery of polynucleotides to cells are known in the art. The rAAV virions disclosed herein cannot replicate and form progeny-infecting virions in target cells (e.g., monocytes and DCs) because the target cells lack the Rep and Cap genes as well as the adenovirus helper genes.
[0082] Method for producing modified antigen-presenting cells and method for producing antigen-specific T cells Exogenous nucleic acid sequences are CD14 + Methods for using the rAAV vector provided herein to specifically express in target cells are disclosed herein. In some embodiments, methods for producing a modified APC, i) CD14 + Steps to provide cells, and ii) CD14 + The steps are: iii) contacting the cells with one of the rAAV vectors disclosed herein in an amount sufficient to express an exogenous nucleic acid sequence encoding a polypeptide; and iii) CD14 for a sufficient time to express the polypeptide. + A method is provided for producing modified APCs, which include the step of culturing cells. + The cells may be monocytes or dendritic cells. The rAAV vector may be an rAAV virion or an rAAV plasmid as disclosed in any of the embodiments herein. + Sufficient time for cell transduction, CD14 + By co-culturing cells with rAAV virions, CD14 +Cells can be brought into contact with rAAV virions. Alternatively, CD14+ cells can be transfected with rAAV plasmids.
[0083] In some embodiments, monocytes are present in a population of peripheral blood mononuclear cells (PBMCs). In some embodiments, monocytes are isolated monocytes. In some embodiments, isolated monocytes are isolated from a sample. In some embodiments, isolated monocytes are isolated from a population of PBMCs. Monocytes can be isolated from a population of PBMCs using any method known in the art. For example, PBMCs can be obtained from a blood sample by density gradient centrifugation. Monocytes can then be sorted using an anti-CD14 antibody (and / or other suitable monocyte marker) linked to a tag, label, or bead. Monocytes can then be sorted or isolated using, for example, fluorescence-activated cell sorting (FACS) or magnetic bead separation. Alternatively, monocytes can be separated from PBMCs using an anti-CD3 antibody to sort and remove non-monocytes from a PBMC sample. Monocytes can then be isolated using adherent culture separation techniques known in the art. + It can also be isolated from lymphocytes.
[0084] In some embodiments, step ii) above further includes differentiating monocytes into dendritic cells. In some embodiments, monocytes are differentiated into dendritic cells by exposing them to cytokines for a sufficient amount of time to differentiate them into dendritic cells. In some embodiments, cytokines are added to the cell culture. In some embodiments, monocytes are differentiated into dendritic cells by introducing a polynucleotide encoding an exogenous cytokine into the monocytes, thereby causing the monocytes to express the exogenous cytokine. The nucleic acid encoding the exogenous cytokine may be a plasmid or an rAAV virion. In some embodiments, the nucleic acid encoding the exogenous cytokine is operably ligated to a CD14 promoter. The cytokine added to the culture medium or encoded in the nucleic acid sequence may be GM-CSF, IL-4, TNF-α, or any combination thereof. The amount of time sufficient to differentiate monocytes into dendritic cells can be easily determined by those skilled in the art. In some embodiments, the amount of time sufficient to differentiate monocytes into dendritic cells is 1–8 days, 2–7 days, or 3–6 days. In some embodiments, the time required to differentiate monocytes into dendritic cells is at least 1, 2, 3, 4, 5, 6, 7, or 8 days. Alternatively, any known method for differentiating monocytes into dendritic cells in this technique may be used.
[0085] Methods for producing antigen-specific T cells are also provided herein. In some embodiments, the method for producing antigen-specific T cells comprises the steps of i) providing naive T cells, ii) contacting the naive T cells with any modified APC as described herein in the embodiments and examples, and iii) contacting the T cells from step ii) with an activating cytokine. Preferably, the modified APC is a modified dendritic cell that specifically expresses an exogenous nucleic acid encoding an antigen polypeptide. The activating cytokine can be added to the T cells in the culture medium. The activating cytokine may be IL-2, IL-7, or both. In some embodiments, the antigen-specific T cells are CD4 + T cells, CD8 +T cells, or mixtures thereof. In some embodiments, the modified dendritic cells further comprise an rAAV vector containing a CD14 promoter functionally linked to a nucleic acid sequence encoding IL-12 and expressing an IL-12 polypeptide, thereby CD8 + It enhances T cell proliferation.
[0086] In some embodiments, the method for producing antigen-specific T cells is i) CD14 + Monocytes and CD3 + ii) providing a population of PBMCs containing T cells; ii) contacting the population of PBMCs with one of the rAAV vectors disclosed herein in an amount sufficient to express an exogenous nucleic acid sequence encoding a polypeptide; iii) differentiating monocytes in the PBMCs into dendritic cells by contacting monocytes with cytokines and culturing them for a sufficient time to differentiate the monocytes into dendritic cells; and iv) differentiating dendritic cells and CD3 + T cells are brought into contact with activating cytokines, differentiated dendritic cells and CD3 + The process includes the step of culturing T cells for a sufficient time to produce antigen-specific T cells. In some embodiments, monocytes are differentiated into dendritic cells by contacting them with cytokines. The cytokines may be GM-CSF, IL-4, TNF-α, or any combination thereof. In some embodiments, the time sufficient to differentiate monocytes into dendritic cells is 1–8 days, 2–7 days, or 3–6 days. In some embodiments, the time sufficient to differentiate monocytes into dendritic cells is at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, or 8 days. The activated cytokines may be IL-2, IL-7, or both. In some embodiments, differentiated dendritic cells and CD3 +The time required to produce antigen-specific T cells by culturing T cells is 1–12 days, 2–10 days, or 3–6 days. In some embodiments, the time required to produce antigen-specific T cells by culturing differentiated dendritic cells and CD3+ T cells is at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, or 12 days. Antigen-specific T cells are CD4 + T cells, CD8 + It may be a T cell, or a mixture thereof.
[0087] Pharmaceutical composition and treatment method Pharmaceutical compositions and methods for treating diseases are also provided herein. In some embodiments, pharmaceutical compositions are provided comprising a population of modified APCs, wherein the modified APCs are any of the modified APCs disclosed herein, and are effective in activating T cells to produce an antigen-specific immune response to polypeptides encoded by exogenous nucleic acid sequences operably linked to a CD14 promoter, and a pharmaceutically acceptable carrier. The modified APCs may be monocytes, dendritic cells, or a combination thereof. In some embodiments, the modified APCs are dendritic cells differentiated from monocytes. In some embodiments, the modified APCs are isolated monocytes. In some embodiments, the modified APCs are isolated dendritic cells. In some embodiments, the modified APCs are in a mixture of PBMCs. In some embodiments, the modified APCs are CD3 + It is contained in a mixture with T cells. In some embodiments, the pharmaceutical composition comprises a mixture of modified APC and antigen-specific T cells. In some embodiments, the antigen-specific T cells are CD4+ T cells, CD8+ T cells, or a mixture thereof.
[0088] In some embodiments, the modified APC of the pharmaceutical composition specifically expresses tumor antigens, tumor-associated antigens, oncogene products, viral antigens, or bacterial antigens.
[0089] In some embodiments, tumor antigens, tumor-associated antigens, or oncogene products may be any such antigen polypeptide or fragment thereof known in the Art. Examples of tumor antigens, tumor-associated antigens, or oncogene products include alpha-fetoprotein (AFP), B melanoma antigen (BAGE / CT2.1), differentiation antigen group 20 (CD20), CD269, G250 (carbonic anhydrase IX / CA IX), HM1.24, CD154, prostate cancer-associated antigens (e.g., prostate-specific antigen (PSA), prostate-specific membrane antigen (PSMA), prostate stem cell antigen (PSCA), and prostatic acid phosphatase (PAP) antigen), breast cancer-associated tumor-associated antigens (e.g., mammary epithelial antigen 46 (BA46, lactoadherin)), and cancer-testicular antigen (CT) family (e.g., New York esophageal squamous cell carcinoma-1 (NY-ESO-1) (CT6.1), ADAM2 (CT15)). Examples include, but are not limited to, SPA17 (SP17, CT22), SPANX (e.g., Spanx-A1 (CT11.1)), the human melanoma-associated antigen (MAGE) family (e.g., MAGE-A1 / CT1.1, MAGE-A2 / CT1.2, MAGE-A3 / CT1.3, MAGE-A4 / CT1.4, MAGE-B1 / CT3.1, MAGE-C1 / CT7.1, MAGE-C2 / CT10, MAGE-C3 / CT7.2, MAGE-E1), MART1, SAGE 1, carcinoembryonic antigen (CEA), HER-2 / neu, cytokeratin 19 (CK19, K19, cyfra21-1), Survivin, mucin-1 (MUC-1, CA15-3), squamous cell carcinoma (SCC) antigen, or any antigen fragments and / or combinations thereof.
[0090] In some embodiments, the viral antigen may be any viral antigen known in the art. Examples of viral antigens include, but are not limited to, hepatitis B virus (HBV) antigen, hepatitis C virus (HCV) antigen, human papillomavirus (HPV) antigen, human immunodeficiency virus (HIV) antigen, influenza virus, parainfluenza virus, respiratory syncytial virus (RSV), cytomegalovirus (CMV), Epstein-Barr virus (EBV), herpes simplex virus (HSV), papillomavirus, measles virus, rotavirus, or any antigenic fragments and / or combinations thereof. In some embodiments, the HPV antigen is an E6 polypeptide, an E7 polypeptide, or any antigenic fragment thereof. In certain embodiments, the exogenous nucleic acid sequence includes a sequence encoding an E6 polypeptide and an E7 polypeptide, or an antigenic fragment thereof. In certain embodiments, the E6 or E7 antigen is derived from HPV serotypes 16, 18, 30, 31, 33, 35, 39, 45, 51, 52, 56, 58, 61, or any antigenic fragment and / or combination thereof. In some embodiments, the HBV antigen is HBsAg, HBeAg, HBcAg, and / or HBxAg. In some embodiments, the HCV antigen is C, E1, E2, NS1, NS2, NS3, NS4, and / or NS5 antigen. In some embodiments, the HIV antigen is gag antigen, pol antigen, and / or env antigen. In some embodiments, the CMV antigen is pp65 antigen, pp150 antigen, and / or gB antigen. In some embodiments, the EBV antigen is LMP-1 antigen, LMP-2 A antigen, LMP-2 B antigen, EAR antigen, EAD antigen, VCA antigen, MA antigen, EBNA1 antigen, EBNA2 antigen, EBNA3 antigen, EBNA3B antigen, and / or EBNA3C antigen.
[0091] In some embodiments, the bacterial antigen may be any bacterial antigen known in the art. Examples of bacteria that can induce bacterial antigens include, but are not limited to, Mycobacterium tuberculosis, Helicobacter, Campylobacter, Clostridium species, Mycobacterium diphtheriae, Borrelia burgdorferi, Plasmodium species, Vibrio cholerae, Escherichia coli, Shigella, Salmonella typhi, and Neisseria gonorrhoeae. In certain embodiments, the Mycobacterium tuberculosis antigen may be MPT44 antigen, MPT45 antigen, MPT59 antigen, MPT64 antigen, Ag85B antigen, Rv3117 antigen, and / or ESAT-6 antigen.
[0092] In some embodiments, the exogenous nucleic acid sequence encodes a cytokine. The cytokine may be an interleukin, interferon, tumor necrosis factor, granulocyte-macrophage colony-stimulating factor (GM-CSF), or any combination thereof. Examples of cytokines include, but are not limited to, GM-CSF, TNF-α, IL-12, IL-4, IL-7, IL-12, IL-15, IL-18, TGF-β, other Th1 cytokines known in the art, e.g., IFNγ, IL-2, IL-10, IL-18, and IL-27, other Th2 cytokines known in the art, e.g., IL-5, IL-9, IL-10, IL-13, IL-25, and amphiregulin, and / or any combination thereof.
[0093] The rAAV virions, modified APCs, and activated T cells disclosed herein can be used to treat diseases and disorders. In some embodiments, methods of immunotherapy are provided herein, comprising the step of administering an effective amount of any of the rAAV virions disclosed herein to a subject in need of administration thereof, thereby stimulating an immune response. In some embodiments, methods of immunotherapy are provided, comprising the step of administering an effective amount of any of the rAAV vectors disclosed herein and / or any of the pharmaceutical compositions disclosed herein to a subject in need of administration thereof, thereby stimulating an immune response. In some embodiments, methods of immunotherapy are provided, comprising the step of administering a population of antigen-specific T cells activated by any of the modified APCs described herein and target cells expressing an antigen encoded by any of the rAAV vectors described herein. In some embodiments, an immunotherapy method is provided, comprising the step of administering an effective amount of population PBMCs, wherein the PBMCs comprise antigen-specific T cells activated by one of the modified APCs described herein and target cells expressing an antigen encoded by one of the rAAV vectors described herein. In some embodiments, the subject is human. In some embodiments, the isolated cell population was derived from a sample obtained from the subject being treated or during treatment.
[0094] In some embodiments, peripheral venous blood may be collected from the patient being treated (e.g., a cancer patient) and used to isolate peripheral blood mononuclear cells. The isolated peripheral blood mononuclear cells can be cultured in vitro (e.g., in a cell culture plate or petri dish), and then monocytes in the peripheral blood mononuclear cells can be separated from peripheral blood lymphocytes. The monocytes can then be infected with the rAAV virions provided herein and subsequently differentiated into DCs in the presence of cytokines. After maturation (e.g., cultured for 6 days), the DCs can be collected and added to the peripheral blood lymphocyte culture prepared as described above to produce a mixed culture. After culturing the mixed culture for a sufficient time (e.g., 6-12 days), cytotoxic T lymphocytes (CTLs) from the mixed culture may be collected and administered to the patient (e.g., via intravenous administration).
[0095] In some relevant embodiments, peripheral venous blood may be collected from a patient being treated (e.g., a cancer patient) and used to isolate peripheral blood mononuclear cells. The isolated peripheral blood mononuclear cells (PBMCs) can be infected with the rAAV virions provided herein, and the monocytes of the infected PBMCs can subsequently differentiate into dendritic cells (DCs) in the presence of cytokines (e.g., GM-CSF, IL-4, and TNF-α). Furthermore, cytokines (e.g., IL-2 and IL-7) can be added to cultured PBMCs to activate CTLs. The resulting PBMCs, either containing activated CTLs or those collected from the PBMCs, can then be administered to the patient (e.g., via intravenous administration).
[0096] In some embodiments, the present disclosure relates to a method of immunotherapy, a. A step of infecting target peripheral blood mononuclear cells (PBMCs) with the rAAV virion provided herein to generate infected PBMCs, b. A step of differentiating infected PBMC monocytes into dendritic cells (DCs) by adding differentiation cytokines (e.g., GM-CSF, IL-4, and TNF-α), c. A step of adding activating cytokines (e.g., IL-2 and IL-7) to activate cytotoxic T lymphocytes (CTLs) of infected PBMCs to generate activated CTLs, d. If necessary, the step of isolating activated CTLs from infected PBMCs, e. A step of administering an effective amount of activated CTLs or isolated activated CTLs to infected PMBCs. This provides immunotherapy methods, including [specific examples of immunotherapy methods].
[0097] In some embodiments, the subjects requiring immunotherapy are diagnosed with cancer, tumors, viral infections, or bacterial infections.
[0098] In some embodiments, cancers include acute lymphoblastic cancer, acute myeloid leukemia, alveolar rhabdomyosarcoma, bladder cancer, bone cancer, brain cancer, breast cancer, cancer of the anus, anal canal, rectum, eye cancer, intrahepatic bile duct cancer, joint cancer, cancer of the neck, gallbladder, or pleura, cancer of the nose, nasal cavity, or middle ear, oral cancer, vulvar cancer, chronic lymphoblastic leukemia, chronic myeloid cancer, colon cancer, esophageal cancer, cervical cancer, fibrosarcoma, gastrointestinal carcinoid tumor, and Hodgkin's disease. Lymphoma, hypopharyngeal cancer, kidney cancer, laryngeal cancer, leukemia, liquid tumor, liver cancer, lung cancer, lymphoma, malignant mesothelioma, mast cell tumor, melanoma, multiple myeloma, nasopharyngeal cancer, non-Hodgkin lymphoma, ovarian cancer, pancreatic cancer, peritoneal, reticular, and mesenteric cancer, pharyngeal cancer, prostate cancer, rectal cancer, kidney cancer, skin cancer, small intestine cancer, soft tissue cancer, solid tumor, stomach cancer, testicular cancer, thyroid cancer, ureteral cancer, and / or bladder cancer. In some embodiments, cancers include AFP-positive liver cancer; BA46-positive breast cancer; CT2.1-positive malignant melanoma lung cancer, gastric cancer, or other CT2.1-positive malignant cancers; CEA-positive lung cancer, colon cancer, breast cancer, or other CEA-positive cancers; CD20-positive malignant thymoma, lymphoma, myeloma, and other CD20-positive sarcomas; CD269-positive liver cancer, CK19-positive lung cancer, colon cancer, breast cancer, and other CK19-positive cancers; G250-positive malignant gastrointestinal tumors, kidney cancer, melanoma, and other G250-positive cancers; HPV-16 E6-positive cervical cancer and other HPV-16 E6-positive malignant tumors; HPV-16 E7-positive cervical cancer and other HPV-16 E7-positive malignant tumors; HPV-16 E6 and E7-positive cervical cancer and other HPV-16 E6 and E7-positive malignant tumors; HPV-18 E6-positive cervical cancer and other HPV-18 E6-positive malignancies; HPV-18 E7-positive cervical cancer and other HPV-18 E7-positive malignancies; HPV-18 E6 and E7-positive cervical cancer and other HPV-18 E6 and E7-positive malignancies; HER2 / neu-positive breast cancer, lung cancer, gastrointestinal tumors, kidney cancer, melanoma and other HER2 / neu-positive malignancies; HM1.24-positive multiple myeloma, myeloma, and lymphoma; LMP-1-positive nasopharyngeal cancer and lymphoma; MAGE-A1-positive lung cancer, gastrointestinal tumors, kidney cancer, melanoma, and other MAGE-A1-positive malignancies; MAGE-A2-positive lung cancer, gastrointestinal tumors, kidney cancer, melanoma, and other MAGE-A2-positive malignancies; MAGE-A4-positive lung cancer, gastrointestinal tumors, kidney cancer, melanoma, and other MAGE-A4-positive malignancies; MAGE-B1-positive lung cancer, gastrointestinal tumors, kidney cancer, melanoma, and other MAGE-B1-positive malignancies; MAGE-C1-positive These include lung cancer, gastrointestinal tumors, kidney cancer, melanoma, and other MAGE-C1 positive malignancies; MART1 positive melanoma and other MART1 positive malignancies; MUC-1 positive malignancies; NY-ESO-1 positive malignancies; PSA positive prostate cancer; PAP positive prostate cancer; PSMA positive prostate cancer, lung cancer, breast cancer, kidney cancer, and other PSMA positive malignancies; PSCA positive prostate cancer; SAGE1 positive sarcomas, melanomas, and other SAGE1 malignancies; SCC positive squamous cell carcinoma; SPANX-A1 positive adenocarcinomas, sarcomas, and melanomas; SPA17 positive adenocarcinomas, sarcomas, and melanomas; and Survivin positive malignancies.
[0099] In some embodiments, the viral infection is an infection caused by hepatitis B virus (HBV), hepatitis C virus (HCV), human papillomavirus (HPV), human immunodeficiency virus (HIV), influenza virus, parainfluenza virus, respiratory syncytial virus (RSV), cytomegalovirus (CMV), Epstein-Barr virus (EBV), herpes simplex virus (HSV), papillomavirus, measles virus, or rotavirus.
[0100] In some embodiments, bacterial infections include infections caused by Mycobacterium tuberculosis, Helicobacter, Campylobacter, Clostridium species, Mycobacterium diphtheriae, Borrelia pertussis, Borrelia burgdorferi, Plasmodium species, Vibrio cholerae, Escherichia coli, Shigella, Salmonella typhi, and Neisseria gonorrhoeae. [Examples]
[0101] Example 1 Exemplary production of pAAV-CD14p A common feature of many recombinant adeno-associated virus vectors prior to this disclosure was that their promoters were constitutive promoters, such as the CMV promoter, the SV40 initial promoter, and the AAV p5 promoter. Exogenous genes introduced by previous rAAV vectors can be expressed in a variety of human cells. However, the exemplary pAAV-CD14p vector described herein does not have these promoters. Rather, the rAAV vectors of this disclosure have tissue-specific or cell-specific CD14 promoters. Exogenous genes carried by the rAAV vectors provided herein include CD14 in monocytes and DCs. + It is specifically expressed in cells, but is CD14 negative (CD14 - ) There is no significant and / or detectable expression in the cells.
[0102] Figure 1 provides a schematic diagram of an exemplary AAV / human CD14 promoter vector (exemplary pAAV-CD14p). This rAAV vector contains a human CD14 transcription promoter (614 bp), AAV2 type reverse terminal repeat (ITR) sequences (145 nucleotides each), a multicloning site sequence (MCS), a late SV40 polyA sequence (256 bp), and a β-lactamase gene (ampicillin resistance gene, Amp r It consists of the ), and a genetic element (such as DH 5α) that enables the plasmid to replicate in E. coli.
[0103] An exemplary rAAV vector was prepared as follows: A pCAAV-2 plasmid containing the complete AAV-2 genome was prepared and used as a starting point. Using the AAV-2 genome sequence (GenBank:J01901.1) as a reference, the pCAAV-2 plasmid was digested with two restriction endonucleases (BmgB I and SnaB I) to delete all AAV-2 promoter and structural genes (Rep and Cap) from nt 165 to nt 4493, so that only the viral ITR sequence was retained (nt 1-164 and nt 4494-4675).
[0104] The human CD14 genome sequence (GenBank:HQ199230.1) was used as a reference for constructing PCR primers targeting the CD14 promoter. The primer sequences are provided below: Upstream primer: 5'- atgacgtg gtgccaacagatgaggttc-3'(Sequence ID 4;nt 2986-3004;BmgB I linker); Downstream primer: 5'- attacgtagcagatctagtctctaga ggtcgataagtcttccgaac-3'(SEQ ID NO: 3;nt 3599-3580;MCS(SnaB I, Bgl II, Xba I) linker).
[0105] The entire DNA was isolated from human monocytes, and the CD14 promoter DNA was amplified by high-fidelity PCR (Figure 2). The purified CD14 promoter DNA was digested with restriction endonucleases BmgB I and SnaB I, and then ligated to restriction endonuclease-digested pCAAV-2 plasmids. Next, the late SV40 poly(A) DNA sequence was inserted into the plasmids (Figure 3) to produce exemplary pAAV-CD14p vectors.
[0106] Insertion of the CD14 promoter into the exemplary pAAV-CD14p plasmid was confirmed by restriction enzyme digestion. Specifically, the exemplary pAAV-CD14p was digested with BmgBI and SnaBI and subjected to gel electrophoresis. Figure 4 shows the appropriately sized band of CD14 promoter DNA. Furthermore, the exemplary pAAV-CD14p was sequenced to confirm that the human CD14 promoter was correctly positioned and no mutations had been introduced (alignment between the CD14 promoter sequence in the vector and the DNA sequence in GenBank: see (HQ199230.1) in Figure 5). The exemplary pAAV-CD14p plasmid provided herein can be appropriately modified to insert an exogenous gene into the MCS (e.g., pAAV-CD14p / exogenous gene).
[0107] Example 2: Production of infectious virions Adeno-associated viruses are non-replicating viruses and require a naturally occurring helper virus (such as adenovirus) to assemble infectious virions. Figure 6 shows a schematic diagram of the preparation of infectious rAAV (rAAV-CD14p / exogenous gene) virions without wild-type helper virus and without contamination with replication-competent AAV-2. A pHelper plasmid was constructed, containing the VA, E2A, E3, and E4 genes of adenovirus type 5, as well as the Rep and Cap genes of AAV type 2, which are necessary for the assembly of AAV virions. The pAAV-CD14 / exogenous gene plasmid was co-transfected into HEK 293 cells with the pHelper plasmid. Infectious rAAV virions were generated 72–96 hours after culturing the transfected cells. The titer of rAAV virions was detected using a dot-blot hybridization assay. rAAV virions were detected using a digoxigenin (DIG)-labeled DNA probe targeting the human CD14 promoter and compared to a loading standard. Figure 7 shows high-titer infectious rAAV virions. Therefore, these data demonstrate that exemplary pAAV-CD14p and pHelper plasmid systems effectively produced rAAV virions in cell culture.
[0108] Example 3 Isolation of monocytes and differentiation into dendritic cells Peripheral venous blood was collected from the subjects. PBMCs were isolated from the peripheral venous blood using Ficoll. In some experiments, monocytes were isolated from PBMCs using a culture method designed to separate adherent cells (monocytes) from non-adherent cells (lymphocytes). Briefly, PBMCs were suspended in cell culture medium (AIM-V medium GIBCO) and added to a tissue culture flask. The PBMCs were then cultured at 37°C and 5% CO2 for 2–4 hours until the monocytes adhered to the bottom of the flask. Non-adherent cells (lymphocytes) were removed and saved for further experiments. Adherent cells (monocytes) were maintained in culture. Alternatively, in some experiments, monocytes were isolated from PBMCs using sterile anti-CD14 antibody-labeled magnetic beads. This process yielded fractions containing monocytes and lymphocytes derived from PBMCs.
[0109] Next, monocytes were differentiated into dendritic cells (DCs) by sequentially adding cytokines including GM-CSF, IL-4, and TNF-α. On day 0, GM-CSF (800 IU / mL) and IL-4 (1000 IU / mL) were added to the culture medium. The medium was replaced with fresh medium and cytokines every two days. On day 5, TNF-α (100 IU / mL) was added to the culture medium. Differentiation culture resulted in mature DCs on day 6 of cell culture.
[0110] Example 4 The CD14 promoter specifically drives exogenous gene expression in CD14-expressing cells. Next, the specificity of the CD14 promoter for the expression of exogenous genes was tested. First, eGFP was cloned into an exemplary pAAV-CD14p plasmid as described in Example 1 to generate pAAV-CD14p / eGFP. Next, infectious virions were generated by co-transfecting HEK 293 cells with pAAV-CD14p / eGFP and pHelper as described above, and rAAV-CD14p / eGFP virions were collected.
[0111] Next, CD14 + Monocytes and DCs were transduced with the AAV-CD14p / eGFP virus. CD14 - Peripheral blood lymphocytes and HEK 293 cells were transduced with rAAV-CD14p / eGFP virus as a control. eGFP expression was evaluated by fluorescence microscopy. 72 hours after cell infection with rAAV-CD14p / eGFP virus, eGFP expression was observed. + It is specifically expressed in monocytes and dendritic cells, and CD14 - It was not expressed in lymphocytes and HEK 293 cells (Figure 8). Therefore, the data indicates that the CD14 promoter is not expressed in CD14 + We have demonstrated that it specifically drives the expression of exogenous gene products in cells.
[0112] Example 5 Antigen expression in monocytes and dendritic cells transduced by rAAV-CD14p / antigen virion To test the expression of cancer antigens, rAAV-CD14p / antigen virions were generated by cloning DNA sequences encoding PSA, PSMA, PAP, CEA, CK19, MAGE-A3, Survivin, or Muc-1, respectively, into the exemplary pAAV-CD14p plasmid described in Example 1 using the method described above. These virions are referred to as rAAV-CD14p / PSA, rAAV-CD14p / PSMA, rAAV-CD14p / PAP, rAAV-CD14p / CEA, rAAV-CD14p / CK19, rAAV-CD14p / MAGE-A3, rAAV-CD14p / Survivin, and rAAV-CD14p / Muc-1, respectively.
[0113] To evaluate the CD14 promoter (CD14p)-mediated expression of the antigen payload in monocytes and dendritic cells (DCs), monocytes were transduced with rAAV-CD14p / antigen virions and differentiated into DCs during culture. First, PBMCs were obtained from the peripheral venous blood of human subjects. As described in Example 3, monocytes were isolated from the PBMCs and cultured in cell culture medium. After monocyte isolation, different rAAV-CD14p / antigen viruses were immediately added, and monocyte cultures were isolated at a MOI of 50. Cytokines were then added to the culture medium as described in Example 3 to induce differentiation of monocytes into DCs.
[0114] Antigen expression in monocytes and dendritic cells transduced with different rAAV-CD14p / antigen virions was evaluated on day 3 of post-transduction cell culture using flow cytometry. Flow cytometry results showed that the antigen expression rate in cells ranged from 79.6% to 91.7% (Figure 9). The data indicate a high rate of antigen expression and high transduction efficiency of the rAAV-CD14p / antigen virion.
[0115] Example 6 Cytokine expression in dendritic cells transduced by rAAV-CD14p / cytokine virion To test cytokine expression, rAAV-CD14p / cytokine virions were generated by cloning DNA sequences encoding GM-CSF or IL-4, respectively, into exemplary pAAV-CD14p plasmids using the method described above. These virions are referred to as rAAV-CD14p / GM-CSF and rAAV-CD14p / IL-4, respectively. Control vectors containing constitutive p5 promoters or CMV promoters instead of CD14 promoters, i.e., rAAV-p5 / GM-CSF and rAAV-CMVp / IL-4, were also produced.
[0116] Monocytes were isolated from PBMCs, transduced with rAAV-CD14p / cytokine virions, and cultured in DC differentiation culture using GM-CSF, IL-4, and TNF-α as described above. Five days after transduction, cytokine gene expression in DCs was detected using routine flow cytometry (Figure 10). The level of cytokine expression in DCs transduced with rAAV-CD14p / cytokine virus was significantly higher than in untransduced controls (p<0.05). Flow cytometry results also demonstrated high transfection efficiency of the rAAV-CD14p / cytokine gene virus. Surprisingly, the transduction efficiency of rAAV virions with constitutive p5 promoters or CMV promoters was significantly lower than that of the rAAV-CD14p / cytokine gene virus (p=0.02~0.04).
[0117] Example 7 Expression of dendritic cell markers on cells transduced with rAAV-CD14p / antigen. The expression of markers important for DC activation of antigen-specific CTLs was evaluated by flow cytometry. Human CD1a, CD40, CD80, and CD86 are markers for DCs. CD1a is a DC marker expressed in the early stages of differentiation. + DCs produce significant amounts of IL-12 p70 upon stimulation, and IFN-γ-producing CD4 + It generates T cells. The CD40, CD80, and CD86 molecules act as important costimulatory molecules for DC stimulation of T cells. Increased expression of CD80, CD86, and CD40 contributes to the generation of a robust CTL response. CD40-CD40L is a costimulatory molecule pair, and their interaction contributes to a successful adaptive immune response, particularly CD8. + It is important for CTL development. CD80 is a key component in DC function and CTL activation. When the MHC class II peptide complex on DCs interacts with receptors on T helper cells, CD80 interacts with DCs and CD8 via CD28. +CD28 enables interaction with T lymphocytes. Interaction via CD28 helps signal the differentiation of T lymphocytes into CTLs. CD86 provides important co-stimulatory signals for T lymphocyte activation and survival.
[0118] Figure 11 shows that CD1a, CD40, CD80, and CD86 levels were very high in DCs transduced with rAAV-CD14p / antigen virion. The high expression levels of CD markers in rAAV-transduced DCs suggest that DCs may function to stimulate an immune response, particularly an antigen-specific CTL response.
[0119] Example 8 Expression of IL-12 and IL-10 in dendritic cells transduced with rAAV. IL-12 and IL-10 expression were measured in dendritic cells (DCs) transduced with rAAV-CD14p / antigen virions. IL-12 and IL-10 are thought to play contrasting roles in DC-mediated immune responses. High expression of IL-12 in DCs is thought to enhance the Th1 response and increase CTL proliferation. Conversely, IL-10 expression is thought to enhance the Th2 response. DCs transduced with rAAV-CD14p / HPV16 E6-E7 or rAAV-CD14p / PSCA virions were compared to virions possessing AAV-type p5 promoters or CMV promoters, i.e., DCs transduced with rAAV-p5 / HPV16 E6-E7 or rAAV-CMVp / PSCA. The p5 promoter or CMV promoter can express exogenous genes in various human cells, including CD14-negative cells. Monocytes were isolated from PBMCs, transduced with rAAV virions, and differentiated into DCs as described above. As shown in Figure 12, the level of IL-12 expressed by rAAV-CD14p / antigen virion transducer DCs was significantly higher than that of the control (p<0.05).
[0120] The data show that after transfecting monocytes and DCs with the rAAV-CD14p / antigen gene virus, IL-12 expression levels were upregulated and IL-10 expression levels were downregulated. DCs transfected with the rAAV-CD14p / antigen virion were more efficient at enhancing the ability to kill antigen-specific CTLs than DCs transfected with rAAV having an AAV type p5 promoter or a CMV promoter.
[0121] Example 9 Monocyte differentiation efficiency to DCs Human CD14 + Monocytes were cultured in the presence of GM-CSF, IL-4, and TNF-α as described above to differentiate the cells into dendritic cells (DCs). A large number of DCs were detected on day 6 of cell culture. To evaluate the differentiation efficiency, the number of surviving monocytes in culture was detected by flow cytometry. The results showed that the number of surviving monocytes transduced by rAAV-CD14p / antigen virion was significantly lower than the number of surviving monocytes transduced by rAAV-p5 / antigen virion or rAAV-CMVp / antigen virion (p<0.05) (Figure 13). These results were unexpected, considering the human CD14 + This study demonstrates that transduction of rAAV-CD14p / antigen virion into monocytes can yield more dendritic cells (DCs).
[0122] Example 10 DC induction of IFN-γ expression in lymphocytes The ability of rAAV-transduced dendritic cells (DCs) to activate the Th1 response was evaluated by co-culturing DC cells with lymphocytes and measuring IFN-γ expression. IFN-γ is an important Th1 cytokine. IFN-γ expression by T lymphocytes is positively correlated with the ability of antigen-specific CTLs to kill antigen-positive target cells.
[0123] Monocytes were transduced with rAAV-CD14p / antigen virions or rAAV-CMVp / antigen virions and cultured for 6 days in differentiation culture as described above. Monocytes were transduced with rAAV-CD14p / HPV18 E6-E7, rAAV-CD14p / CEA, rAAV-CD14p / MAGE-C2, rAAV-CMVp / HPV18 E6-E7, rAAV-CMVp / CEA, or rAAV-CMVp / MAGE-C2. On the 6th day of cell culture, DCs were collected and mixed with lymphocytes collected from the same donor as the monocytes. DCs and lymphocytes were co-cultured in the presence of IL-7 (80 IU / mL) and IL-2 (100 IU / mL). The medium and cytokines were replaced every 2 days. Lymphocytes were collected on the 14th day of cell culture, and the expression level of IFN-γ was measured by flow cytometry.
[0124] The results show that the IFN-γ level expressed by T lymphocytes activated by DCs transfected with rAAV-CD14p / antigen gene virus was significantly higher than the IFN-γ level expressed by T lymphocytes activated by DCs transfected with rAAV-CMVp / antigen gene virus (Figure 14; p < 0.05). This may be because the number of rAAV-CD14p / antigen-transduced DCs was higher compared to the number of rAAV-CMVp / antigen DCs, resulting in an increase in the generation of CTLs. In other words, rAAV having a CD14 promoter is surprisingly more efficient in inducing lymphocytes to express IFN-γ.
[0125] Example 11 Lymphocyte Expression of CD69 and CD8 The expression levels of CD69 and CD8 were evaluated in T lymphocytes co-cultured with rAAV-CD14 / antigen virion-transduced DCs. CD69 is a marker of CTL (CD8 +It is a marker for the early activation of T lymphocytes. Monocytes were transfected with rAAV-CD14p / antigen virions, rAAV-CMVp / antigen virions, or rAAV-p5 / antigen virions and cultured in the above differentiation culture for 6 days. More specifically, monocytes were transfected with rAAV-CD14p / HPV16 E6-E7, rAAV-CD14p / CK19, rAAV-CD14p / BA46, rAAV-CMVp / HPV16 E6-E7, rAAV-p5 / CL19 or rAAV-CMVp / BA46. On the 6th day of cell culture, DCs were collected and mixed with lymphocytes collected from the same donor as the monocytes. DCs and lymphocytes were co-cultured in the presence of IL-7 and IL-2 as described above. On the 14th day of DC and T lymphocyte co-culture, flow cytometry was used to detect the number of CD69 + / CD8 + in the T cell population.
[0126] The results showed that the number of CD69 + / CD8 + T lymphocytes activated by DCs transfected with rAAV-CD14p / antigen gene virus was much higher than the number of CD69 + / CD8 + T lymphocytes activated by DCs transfected with rAAV-p5 / antigen gene virus or rAAV-CMVp / antigen gene virus (Figure 15). The data indicate that rAAV-CD14p / antigen virions are more efficient than p5 or CMV-driven virions in the generation of T lymphocytes with strong cytotoxic activity against target cells.
[0127] Example 12 Cytotoxic T Lymphocyte Killing of Target Cells Monocytes were transduced with rAAV virions and differentiated into dendritic cells (DCs) as described above. DCs were co-cultured with donor lymphocytes as described above. Monocytes were transduced with rAAV-CD14p / HPV16 E6-E7, rAAV-CD14p / PSMA, or rAAV-CD14p / MAGE-A3. Cells were harvested on day 14 of co-culture of DCs and T lymphocytes. CTLs were co-cultured with cells isolated from tumor tissue expressing their respective viral antigens or tumor antigens, namely HPV-16 E6 and E7 antigen-positive cervical cancer cells, PSMA-positive prostate cancer cells, and MAGE-A3-positive non-small cell lung adenocarcinoma cells. Routine chromium ( 51 The killing activity of CTLs primed with rAAV-CD14p / antigen-transduced DCs was analyzed using a Cr) release assay.
[0128] Figure 16 shows that the rate of single-pass killing of tumor antigen-positive and viral antigen-positive target cells in CTLs primed with rAAV-CD14p / antigen-transduced DCs was approximately 50.2%–67.2%. In the control experiment, anti-human MHC class I antibody was added to the cell culture 6 hours before co-culturing with CTLs, and the rate of single-pass killing of tumor antigen-positive and viral antigen-positive target cells was approximately 12.3–16.6%. Therefore, the anti-MHC-I antibody dramatically reduced the killing of antigen-positive cells (Figure 16). Furthermore, a series of antigen-negative control cells were not killed (Figure 16). The results demonstrate that rAAV-CD14p / antigen-transduced DC cells were able to activate antigen-specific CTL killing of target cells in an MHC-I-restricted manner.
[0129] Next, we compared CTL killing activated by DCs transduced with rAAV-CD14p / HPV18 E6-E7, rAAV-CD14p / CEA, rAAV-CD14p / PSA, rAAV-CMVp / HPV18 E6-E7, rAAV-CMVp / CEA, or rAAV-CMVp / PSA. Modified DCs were generated and co-cultured with donor lymphocytes as described above. CTLs were co-cultured with cells isolated from tumor tissue expressing their respective viral or tumor antigens, namely HPV-18 E6 and E7 antigen-positive cervical cancer cells, PSA-positive prostate cancer cells, and CEA-positive non-small cell lung adenocarcinoma cells. Co-culture of CTLs with antigen-expressing target cells and 51 Killing activity was evaluated by a Cr release assay. The proportion of target cells killed by CTLs induced by rAAV-CD14p / antigen-transduced DCs was significantly higher than the proportion of target cells killed by CTLs induced by rAAV-CMVp / antigen-transduced DCs (p<0.05) (Figure 17). Surprisingly, the results showed that CTLs activated by rAAV-CD14p / antigen-transduced DCs exhibited stronger antigen-specific killing activity than CTLs activated by rAAV-CMVp / antigen-transduced DCs.
[0130] Example 13 Killing cytotoxic T lymphocytes in target cells Experiments were conducted to evaluate rAAV-CD14p / antigen specificity in mixed cultures of PBMCs. Human PBMCs consist mainly of lymphocytes and a small number of monocytes. CD3 is a marker of T lymphocytes. In this study, human PBMCs were directly infected with rAAV. The rAAV was either rAAV-CD14p / antigen virus, rAAV-CMVp / antigen virus, or rAAV-p5 / antigen virus. More specifically, rAAV-CD14p / CK19, rAAV-CD14p / muc-1, rAAV-p5 / CK19, or rAAV-p5 / muc-1. GM-CSF, IL-4, and TNF-α were added to the PBMC cultures to promote monocyte differentiation into DCs. On day 6 of culture, IL-2 and IL-7 were added as described above. Cell culture medium and cytokines were changed every two days. On day 14, PBMCs were harvested and CD3 was measured. + The number of T lymphocytes was analyzed by flow cytometry.
[0131] The results (Figure 18) show CD3 in rAAV-CD14p / antigen-transformed PBMCs. + The number of T lymphocytes is the CD3 count before transduction on day 0. + The study demonstrates an increase in the number of cells by day 14 compared to the total number of cells. In contrast, CD3 in PBMCs transduced with rAAV-p5 / antigen and rAAV-CMVp / antigen + The number of cells was significantly reduced. CD3 in PBMCs transduced with rAAV-p5 / antigen or rAAV-CMVp / antigen. + The decrease in cell number is thought to be a result of killing not only the target but also other tissues by activated CTLs. Since the p5 promoter and CMV promoter are constitutive promoters, CD3 transduced by rAAV-p5 / antigen or rAAV-CMVp / antigen virions + Cells also express antigens and are targeted by antigen-specific CTLs. In contrast, the CD14 promoter specifically drives antigen expression in DCs. Therefore, the rAAV-CD14p / antigen virion is CD3 + It can infect T lymphocytes, but CD3 +The cells do not express antigens and are not killed by antigen-specific CTLs during culture.
[0132] Therefore, this study not only suggests that the application of rAAV-CD14p / antigen virions in cellular immunotherapy is safer, but also provides a novel and rapid method for preparing CTLs. According to the results of this study, CTLs can be prepared by directly infecting PBMCs with the rAAV-CD14p / antigen gene virus without first isolating monocytes from the PBMCs. In contrast, previous methods for preparing DC-activated CTLs required the initial step of isolating monocytes from the PBMCs.
[0133] Further embodiments can be provided by combining the various embodiments described above. All U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications, and non-patent publications mentioned herein and / or listed in the application datasheet, including U.S. Provisional Patent Application No. 63 / 092,239 filed on October 15, 2020, are incorporated herein by reference in their entirety. The aspects of the embodiments may be modified as needed to use the concepts of various patents, applications, and publications to provide yet another embodiment.
[0134] These and other modifications can be made to embodiments in light of the detailed description above. In general, the terms used in the following claims should not be construed as limiting the claims to specific embodiments disclosed in the specification and claims, but rather as encompassing all possible embodiments, along with the entire scope of equivalents for which such claims are entitled. Thus, the claims are not limited by this disclosure.
Claims
1. A polynucleotide comprising a recombinant adeno-associated virus (rAAV) vector, wherein the rAAV vector comprises two reverse terminal repeat (ITR) sequences and a CD14 promoter operably ligated to an exogenous nucleic acid sequence, the CD14 promoter specifically drives the expression of the exogenous nucleic acid in CD14-expressing cells, and the exogenous nucleic acid sequence is a) Tumor antigen, b) Tumor-associated antigens, c) Oncogene products, d) A viral antigen selected from the group consisting of hepatitis C virus (HCV) antigen, human papillomavirus (HPV) antigen, and human immunodeficiency virus (HIV) antigen, or e) Cytokines selected from the group consisting of TNF-α, TNF-β, IL-2, IL-4, IL-5, IL-7, IL-9, IFNγ, IL-13, IL-15, IL-18, IL-25, IL-27, and amphiregulin. A polynucleotide containing a sequence that codes for [something].
2. The CD14 promoter is a human CD14 promoter sequence, and the CD14 promoter includes sequence number 1, or The polynucleotide according to claim 1, wherein the CD14 promoter comprises at least the nucleotides at positions 378-386, 404-410, and 533-538 of SEQ ID NO:
1.
3. The polynucleotide according to claim 1 or 2, wherein the rAAV vector comprises, in the 5'→3' direction, a first ITR, the CD14 promoter operably linked to the exogenous nucleic acid sequence, a polyadenylation signal sequence, and a second ITR, wherein the first ITR sequence and the second ITR sequence are optionally AAV-2 ITRs.
4. The polynucleotide according to any one of claims 1 to 3, wherein the rAAV vector is a plasmid, and optionally the plasmid comprises a human CD14 transcription promoter, an AAV2 type reverse terminal repeat (ITR) sequence, a multicloning site (MCS) sequence, an SV40 late polyA sequence, an antibiotic resistance gene, and a gene element that enables the plasmid to replicate in a host cell.
5. The polynucleotide according to any one of claims 1 to 4, wherein the tumor antigen, tumor-associated antigen, or oncogene product comprises alpha-fetoprotein (AFP), B melanoma antigen (BAGE / CT2.1), differentiation antigen group 20 (CD20), CD269, G250 (carbonic anhydrase IX / CA IX), HM1.24, CD154, prostate cancer-associated antigen, breast cancer-associated tumor-associated antigen, a member of the carcinometris antigen (CT) family, a member of the human melanoma-associated antigen (MAGE) family, MART 1, SAGE 1, carcinoembryonic antigen (CEA), HER-2 / neu, cytokeratin 19 (CK19, K19, cyfra21-1), survivin, mucin-1 (MUC-1, CA15-3), squamous cell carcinoma (SCC) antigen, or any antigenic fragments and / or combinations thereof.
6. (a) The prostate cancer-related antigen is prostate-specific antigen (PSA), prostate-specific membrane antigen (PSMA), prostate stem cell antigen (PSCA), or prostatic acid phosphatase (PAP) antigen, or any antigenic fragment and / or combination thereof. (b) The breast cancer-related tumor-related antigen is breast epithelial antigen 46 (BA46, lactoadherin) or any antigenic fragment thereof, (c) The member of the CT family is New York esophageal squamous cell carcinoma-1 (NY-ESO-1) (CT6.1), ADAM2 (CT15), SPA17 (CT22), or SPANX-A1 (CT11.1), or any antigenic fragment and / or combination thereof, (d) The member of the human MAGE family is MAGE-A1 / CT1.1, MAGE-A2 / CT1.2, MAGE-A3 / CT1.3, MAGE-A4 / CT1.4, MAGE-B1 / CT3.1, MAGE-C1 / CT7.1, MAGE-C2 / CT10, MAGE-C3 / CT7.2, or MAGE-E1, or any antigenic fragment and / or combination thereof, as necessary The tumor antigen, tumor-associated antigen, or oncogene product is PSA, PSMA, PAP, PSCA, BA46, CEA, HER-2 / neu, CK19, Survivin, MUC-1, SCC, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-C2, NY-ESO-1, ADAM2, SPA17, or SPANX-A1, or any antigenic fragment and / or combination thereof. The polynucleotide according to claim 5.
7. The aforementioned exogenous nucleic acid sequence is a) Viral antigens selected from the group consisting of hepatitis C virus (HCV) antigen, human papillomavirus (HPV) antigen, and human immunodeficiency virus (HIV) antigen, or b) Cytokines selected from the group consisting of TNF-α, TNF-β, IL-2, IL-4, IL-5, IL-7, IL-9, IFNγ, IL-13, IL-15, IL-18, IL-25, IL-27, and amphiregulin. A polynucleotide according to any one of claims 1 to 4, comprising a sequence encoding a polynucleotide.
8. The polynucleotide according to claim 7, wherein the HPV antigen is an E6 antigen or an E7 antigen, and optionally the E6 antigen or E7 antigen is derived from HPV serotypes 16, 18, 30, 31, 33, 35, 39, 45, 51, 52, 56, 58, 61, or any combination thereof.
9. A recombinant adeno-associated virus (rAAV) virion comprising a polynucleotide as described in any one of claims 1 to 8.
10. The aforementioned billions are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or any combination thereof. The rAAV virion according to claim 9, comprising a capsid protein, and optionally the virion comprising the capsid protein of AAV2.
11. A population of isolated cells comprising a polynucleotide according to any one of claims 1 to 8, wherein the cells express CD14 and the exogenous nucleic acid sequence encoding a polypeptide.
12. The population of isolated cells according to claim 11, wherein the cells are dendritic cells.
13. A population of isolated cells comprising polynucleotides according to any one of claims 1 to 8, wherein the cells are packaging cells, and optionally the cells are HEK293 cells.
14. A method for preparing a composition comprising activated cytotoxic T lymphocytes (CTLs), wherein the composition is for use in immunotherapy, and the method is a. A step of generating infected monocytes by infecting monocytes isolated from target peripheral blood mononuclear cells (PBMCs) with the rAAV virion described in claim 9 or claim 10, b. A step of adding differentiation cytokines to the infected monocytes in step a. to differentiate the infected monocytes into dendritic cells (DCs), c. Adding the dendritic cells from step b. to peripheral blood lymphocytes derived from the subject to generate activated CTLs, d. If necessary, the step of isolating the activated CTL generated from step c. e. The step of preparing the composition thereby Methods that include...
15. The method according to claim 14, wherein the differentiation cytokine is GM-CSF, IL-4, TNF-α, or any combination thereof.
Citation Information
Patent Citations
Genetically modified dendritic cells transduced with adeno-associated virus (aav), methods for preparing said cells and uses of said cells
JP2003506095A
Recombinant adenovirus carrying the transgene
JP2020521471A
A method for utilizing engineered dendritic cells to induce gut-homing regulatory t cells and treat gut inflammation
US20180030553A1
Homology directed repair compositions for the treatment of hemoglobinopathies
WO2018200597A1
Methods and compositions for editing nucleotide sequences
WO2020191243A1