PLpro protein inhibitor, method for producing the same, and use

Abstract

The present invention discloses a PLPro protease inhibitor, its preparation method and use. The PLPro protease inhibitor can be used as a PLPro inhibitor in combination with one or more pharma- ceutically acceptable auxiliary materials or one or more other active ingredients to treat a disease or disorder caused by or associated with a viral infection. The auxiliary materials can be carriers, diluents, adhesives, lubricants, wetting agents, etc. The protease inhibitor has high inhibitory activity and is particularly useful as a broad-spectrum antiviral agent for coronaviruses, such as HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU, SARS-CoV, MERS-CoV, SARS-CoV-2, and especially SARS-CoV, MERS-CoV, SARS-CoV-2 viruses.

Description

[Technical Field]

[0001] The present invention relates to the pharmaceutical technology, and more particularly to PLPro protein inhibitors, methods for producing the same, and uses thereof. [Background technology]

[0002] PLpro is one of two key proteases that cleave the polyproteins pp1a and pp1ab expressed through the translational mechanisms of host cells (PLpro is responsible for cleaving nsp1, nsp2, and nsp3). It can cleave Lys48-bound polyubiquitin and ubiquitin-like molecules modified by interferon-stimulated gene 15 (ISG15) with high activity to achieve immune evasion. Inhibition of PLpro results in a reduction of viral load and recovery of the host's innate immune system. Due to its multiple roles in viral replication and host cell regulation, PLpro is considered a potential antiviral target. [Overview of the project] [Means for solving the problem]

[0003] The present invention provides compounds or pharmaceutically acceptable salts, stereoisomers, esters, prodrugs, solvates, and deuterated compounds having the following structures. TIFF0007893516000001.tif32170

[0004] (Here, Ar 1 is a substituted naphthyl, or a substituted or unsubstituted non-naphthalene aromatic group. Ar 2 It is an aryl or heteroaryl, B is heterocyclyl, -S(O) t NR 15 Selected from halogen, -NH2, TIFF0007893516000002.tif15170W2 is selected from C, N, and O, and if W2 is N, then R1 ’ If there is no such thing as and W2 is O, then R1, R1’ does not exist, W4 does not exist, or is selected from C or S, and when W4 does not exist, R1 and R2 do not exist. R1, R1 ’ , R2, R2 ’ are independently selected from H, D, (=O), -C1-C6 alkyl, -X, -CH2X, -CHX2, -CX3, -OH, -NH2, -COOH, -O(C1-C6 alkyl). R2 ’’ is selected from H, C1-C6 alkyl, -OH, -(C1-C6 alkylene)-COOR 21 , -(C1-C6 alkylene)-OR 21 , -(C1-C6 alkylene)-CONR 21 R 22 and is selected from <0000Q21>R3 is selected from H or C1-C6 alkyl. L1 does not exist, or is selected from TIFF0007893516000003.tif16170 or -N(R^3)-. L3 and L5 do not exist, or are independently selected from alkylene, heteroalkylene, cycloalkylene, heterocyclylene, and the carbonyl may be optionally substituted. L4 is -NR 15 C(O)-, -NR 15 S(O) t -, -C(O)-, -C(O)O-, -NR 15 -, -C(O)NR 15 -, -S(O) t NR 15 -, is selected from TIFF000T893516000004.tif21170. L6 does not exist, or is C1-C6 alkylene, -SO2-, -NR 15 C(O)-, -NR 15 S(O) t -, -C(O)-, -C(O)O-, -NR 15 -, -C(O)NR 15 -, -S(O) t NR 15 -, It should be noted that there may be some inaccuracies in the original text, especially in some unclear or inconsistent notations. The translation is based on the best understanding of the provided text.Selected from TIFF0007893516000005.tif21170, R 15 is selected from H, D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, hydroxy, alkoxy, or R 15 It forms a heterocycline with the nitrogen atom bonded to it and L3 or L5, and may be optionally substituted. t is either 1 or 2. R 21 is H or C1-C6 alkyl, R 22 is H or C1-C6 alkyl, R 23 or R 23’ is selected from H or C1-C6 alkyl groups. X is selected from F, Cl, Br, and I.

[0005] In embodiments of the present invention, L6 is TIFF0007893516000006.tif14170 is also acceptable.

[0006] In embodiments of the present invention, L6 is TIFF0007893516000007.tif14170 is also acceptable.

[0007] Preferably, the substituted naphthyl is selected from the following: TIFF0007893516000008.tif40170

[0008] (Here, R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 represents a substituent on the ring, independently of H, D, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C1-C6 alkyl), and -NO2-RL -COR', -R L -C(O)OR', -R L -C(O)NR'R'', -R L -CH=NR', -R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO2, -R L -N=CR'R'' can be selected and may be replaced by any other option, and R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 It cannot be H at the same time, t is either 1 or 2. R L It does not exist, or C1-C6 alkylene, C3-C6 heteroalkylene, C3-C6 cycloalkylene, C3-C6 heterocyclene, -NR4C(O)-, -NR4S(O) t -, -C(O)-, -C(O)O-, -NR4-, -C(O)NR4-, -S(O) t Selected from NR4-, and may be replaced by optional selection. R' and R'' are independently selected from H, D, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, and halogen, and may be optionally substituted. R4 is selected from H, D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, hydroxy, and alkoxy. Comfortable, R L It does not exist, or it is selected from -CH2-, -CH2CH2-, and -CH(CH3)CH2-. More preferably, R' and R'' are selected from H, -CH3, -CH2CH3, and -CH(CH3)CH3. More preferably, R4 is selected from H, -CH3, -CH2CH3, and -CH(CH3)CH3. Comfortable, R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 The following are independently selected from H, D, -CH3, -X, -CH2F, -CHF2, -CF3, -OH, -CN, -OCH3, -OCH2X, -OCHX2, -OCX3, -NH2, -NH(C1~C6 alkyl), -N(C1~C6 alkyl)(C1~C6 alkyl), -NO2, -COO(C1~C6 alkyl), -COOH, -CN, -Si(CH3)3, -NHSO2(C1~C6 alkyl), -SO2NH2, -SO2(C1~C6 alkyl), -N(C1~C6 alkyl)SO2(C1~C6 alkyl), -SO2NH(C1~C6 alkyl), -SO2N(C1~C6 alkyl)(C1~C6 alkyl), and also R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 It cannot be H at the same time, More preferably, the substituted naphthyl is Selected from TIFF0007893516000009.tif58170.

[0009] More preferably, the R 42 , R 43 , R 45 , R 46is independently selected from H, -F, -D, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -COOH, -CN, -COOCH3, -NH2, -NHCH3, -N(CH3)2, -NO2, -OCH3, -OH, -TMS, -SO2CH3, -NHSO2CH3, -SO2NH2.

[0010] The non-naphthalene aromatic group is selected from the following. phenyl, substituted phenyl, TIFF0007893516000010.tif69170

[0011] (where L2 is absent or is selected from -O-, C1-C6 alkylene (including methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, etc.), -CO-, -CONR 53 -, -NR 53 -, -NR 53 CO-, -(C1-C6 alkylene)-O-, -(C1-C6 alkylene)-CO-, -(C1-C6 alkylene)-CONR 53 -, -(C1-C6 alkylene)-NR 53 -, -(C1-C6 alkylene)-NR 53 CO- and is selected from R 53 is selected from H, D or C1-C6 alkyl, R 51 is selected from H, D, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C1-C6 alkyl), -NO2-R L -COR’, -R L -C(O)OR’, -R L -C(O)NR’R’’, -R L -CH=NR’, -R L -CN, -R L -OR’, -R L -OC(O)R’, -R L -S(O) t -NR’R’’, -R L -S(O) t -R’, -R L-NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO2, -R L -N=CR'R'' can be selected and replaced by any choice. t is either 1 or 2. R L It does not exist, or C1-C6 alkylene, C3-C6 heteroalkylene, C3-C6 cycloalkylene, C3-C6 heterocyclene, -NR4C(O)-, -NR4S(O) t -, -C(O)-, -C(O)O-, -NR4-, -C(O)NR4-, -S(O) t Selected from NR4-, and may be replaced by optional selection. R' and R'' are independently selected from H, D, amino, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, and halogen, and may be optionally substituted. Preferably, R 51 The following are selected from H, -D, -CH3, -X, -CF3, -OH, -OCH3, -OCH2X, -OCHX2, -OCX3, -NH2, -NH(C1~C6 alkyl), -N(C1~C6 alkyl)(C1~C6 alkyl), -NO2, -COO(C1~C6 alkyl), -COOH, -CN, -Si(CH3)3, -NHSO2(C1~C6 alkyl), -SO2NH2, -SO2(C1~C6 alkyl), -N(C1~C6 alkyl)SO2(C1~C6 alkyl), -SO2NH(C1~C6 alkyl), and -SO2N(C1~C6 alkyl)(C1~C6 alkyl). Ar 3 This is selected from substituted or unsubstituted phenyl, substituted or unsubstituted oxygen-containing 5-membered or 6-membered heterocycline, substituted or unsubstituted nitrogen-containing 5-membered or 6-membered heterocycline, and substituted or unsubstituted sulfur-containing 5-membered or 6-membered heterocycline. Preferably, Ar 3This is selected from phenyl, C1-C6 alkyl-substituted phenyl, furyl, pyrrolyl, thienyl, pyridyl, pyrimidinyl, thiazolyl, imidazolyl, and oxazolyl, and may be optionally substituted, more preferably Ar 3 This is selected from phenyl, tert-butylphenyl, thienyl, and pyridyl, and may be optionally substituted. W3 is selected from N or CH. R6 is H, D, C1-C6 alkyl, -OH, -(C1-C6 alkylene)-COOR 61 , -(C1~C6 alkylene)-OR 61 -(C1~C6 alkylene)-CONR 61 Selected from, R 61 is H, D, or C1-C6 alkyl, Preferably, W3 is N, and R6 is H, D, CH3, -CH2COOH, -CH2COOCH3. R 62 H, D, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C1-C6 alkyl), -N3, -B(OH)2, -NO2-R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', -R L -CH=NR', -R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO2, -R L -N=CR'R'' can be selected and replaced by any choice. T1, T2, T3, T4, T5, T6, T7 are independent of O, C-R7, Selected from TIFF0007893516000011.tif16170 or N, X' is N, O, S, In some embodiments of the present invention, when there is a single bond between T4 and T5, both T4 and T5 are -CONR8-, and T 6、 T7 is independently selected from C-R7 or N. In some embodiments of the present invention, when there is a single bond between T6 and T7, both T6 and T7 are -CONR8-. When T1~T7 are selected from C-R7, R7 can be independently H, O, -D, -CH3, -X, -CF3, -OH, -OCH3, -OCH2X, -OCHX2, -OCX3, -NH2, -NH(C1~C6 alkyl), -N(C1~C6 alkyl)(C1~C6 alkyl), -NO2, -COO(C1~C6 alkyl), -COOH, -CN, -Si(CH3)3, -NHSO2(C1~C6 alkyl), -SO2NH2, -SO2(C1~C6 alkyl), -N(C1~C6 alkyl)SO2(C1~C6 alkyl), -SO2NH(C1~C6 alkyl), -SO2N(C1~C6 alkyl)(C1~C6 alkyl), -O(C1~C6 alkyl)NH(C1~C6 alkyl), Selected from TIFF0007893516000012.tif22170, R8 is H, D, C1-C6 alkyl, -(C1-C6 alkylene)-COOR 61 , -(C1~C6 alkylene)-OR 61 -(C1~C6 alkylene)-CONR 61 Selected from, S3 is O, S, NR 91 , CR 92 R 93 Selected from, S1, S2, S4, S5, S6, and S7 are independent of N and CR. 94 Selected from, Here, R 92 , R 93 , R 94These are independently: bonded to H, D, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C1-C6 alkyl), -NO2-R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', -R L -CH=NR', -R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO2, -R L -N=CR'R'', Selected from TIFF0007893516000013.tif22170, and may be replaced by any other selection. Preferably, R 92 , R 93 , R 94 These are independently bonded to H, D, -CH3, -F, -CF3, -OH, -OCH3, -NH2, -NH(C1~C6 alkyl), -N(C1~C6 alkyl)(C1~C6 alkyl), -NO2, -COO(C1~C6 alkyl), -COOH, -CN, -Si(CH3)3, -NHSO2(C1~C6 alkyl), -SO2NH2, -SO2(C1~C6 alkyl), -N(C1~C6 alkyl)SO2(C1~C6 alkyl), -SO2NH(C1~C6 alkyl), -SO2N(C1~C6 alkyl)(C1~C6 alkyl), Selected from TIFF0007893516000014.tif22170, R 91 The bond is H, -D, C1~C6 alkyl, -OH, -(C1~C6 alkylene)-COOR 61, -(C1~C6 alkylene)-OR 61 -(C1~C6 alkylene)-CONR 61 , Selected from TIFF0007893516000015.tif22170, Y1, Y2, Y3, Y4, Y5, Y6, Y7 are independently N or CR 11 Selected from, R 11 The bonds are H, D, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C1-C6 alkyl), -NO2-R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', -R L -CH=NR', -R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO2, -R L -N=CR'R'' can be selected and replaced by any choice. Preferably, R 11The following are independently selected from the following bonds: H, -D, -CH3, -F, -CF3, -OH, -OCH3, -NH2, -NH(C1~C6 alkyl), -N(C1~C6 alkyl)(C1~C6 alkyl), -NO2, -COO(C1~C6 alkyl), -COOH, -CN, -Si(CH3)3, -NHSO2(C1~C6 alkyl), -SO2NH2, -SO2(C1~C6 alkyl), -N(C1~C6 alkyl)SO2(C1~C6 alkyl), -SO2NH(C1~C6 alkyl), -SO2N(C1~C6 alkyl)(C1~C6 alkyl), R 72 , R 73 These are independently selected from H, -D, -CH3, -X, -CF3, -OH, -OCH3, -NH2, -NH(C1~C6 alkyl), -N(C1~C6 alkyl)(C1~C6 alkyl), -N3, -B(OH)2, -NO2, -COO(C1~C6 alkyl), -COOH, -CN, -Si(CH3)3, -NHSO2(C1~C6 alkyl), -SO2NH2, -SO2(C1~C6 alkyl), -N(C1~C6 alkyl)SO2(C1~C6 alkyl), -SO2NH(C1~C6 alkyl), and -SO2N(C1~C6 alkyl)(C1~C6 alkyl). R 31 is N or CR 36 And R 32 , NR 37 Or -N=CR 38 -and, R 35 or R 37 These are independently H, -D, C1~C6 alkyl, -OH, -(C1~C6 alkylene)-COOR 61 , -(C1~C6 alkylene)-OR 61 -(C1~C6 alkylene)-CONR 61 Selected from, R 33 , R 34 , R 36 , R 38These are independently H, -D, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C1-C6 alkyl)3, -N3, -B(OH)2, -NO2-R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', -R L -CH=NR', -R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO2, -R L -N=CR'R'' can be selected and replaced by any choice. Preferably, R 33 , R 34 , R 36 , R 38 These are independently selected from H, -D, -CH3, -F, -CF3, -OH, -OCH3, -NH2, -NH(C1~C6 alkyl), -N(C1~C6 alkyl)(C1~C6 alkyl), -NO2, -COO(C1~C6 alkyl), -COOH, -CN, -Si(CH3)3, -NHSO2(C1~C6 alkyl), -SO2NH2, -SO2(C1~C6 alkyl), -N(C1~C6 alkyl)SO2(C1~C6 alkyl), -SO2NH(C1~C6 alkyl), and -SO2N(C1~C6 alkyl)(C1~C6 alkyl). R 24 It does not exist, or CR 23 , NR 27 Selected from, R 25 CR 28 , NR 29 Selected from, R 23 , R 26 , R 28 These are independently H, -D, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C1-C6 alkyl)3, -N3, -B(OH)2, -NO2-R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', -R L -CH=NR', -R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO2, -R L -N=CR'R'' can be selected and replaced by any choice. Preferably, R 23 , R 26 , R 28 These are independently selected from H, -D, -CH3, -F, -CF3, -OH, -OCH3, -NH2, -NH(C1~C6 alkyl), -N(C1~C6 alkyl)(C1~C6 alkyl), -NO2, -COO(C1~C6 alkyl), -COOH, -CN, -Si(CH3)3, -NHSO2(C1~C6 alkyl), -SO2NH2, -SO2(C1~C6 alkyl), -N(C1~C6 alkyl)SO2(C1~C6 alkyl), -SO2NH(C1~C6 alkyl), and -SO2N(C1~C6 alkyl)(C1~C6 alkyl). R 27 , R 29 These are independently H, C1-C6 alkyl, -OH, -(C1-C6 alkylene)-COOR 61, -(C1~C6 alkylene)-OR 61 -(C1~C6 alkylene)-CONR 61 (Selected from the above.) More preferably, the non-naphthalene aromatic group is It is TIFF0007893516000016.tif17170, More preferably, the non-naphthalene aromatic group is The filename is TIFF0007893516000017.tif33170.

[0012] Comfortable, R 51 , R 52 These are independently selected from H, D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -COOH, -CN, -COOCH3, -NH2, -NHCH3, -NO2, -OCH3, -OH, -TMS, -SO2CH3, -NHSO2CH3, and -SO2NH2.

[0013] More preferably, the non-naphthalene aromatic group is TIFF0007893516000018.tif29170, and more preferably, the non-naphthalene aromatic group is The filename is TIFF0007893516000019.tif41170.

[0014] Comfortable, R 61 , R 62 These are independently selected from H, -D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -COOH, -CN, -COOCH3, -NH2, -NHCH3, -NO2, -OCH3, -OH, -TMS, -SO2CH3, -NHSO2CH3, and -SO2NH2.

[0015] More preferably, the non-naphthalene aromatic group is The filename is TIFF0007893516000020.tif240170.

[0016] More preferably, R7, R7', R7'', R7'''', R7α , R 7β The element is independently selected from H, -D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -COOH, -CN, -COOCH3, -NH2, -NHCH3, -NO2, -OCH3, -OH, -TMS, -SO2CH3, -NHSO2CH3, -SO2NH2, a substituted or unsubstituted morpholine ring, with the unsubstituted morpholine ring being particularly preferred.

[0017] More preferably, R8' is selected from H or methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, etc.

[0018] More preferably, the non-naphthalene aromatic group is The filename is TIFF0007893516000021.tif146170.

[0019] More preferably, S1, S2, S4, S5, S6 are CR 94 That is the case.

[0020] More preferably, the R 94 The following are selected from H, -D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -COOH, -CN, -COOCH3, -NH2, -NHCH3, -NO2, -OCH3, -OH, -TMS, -SO2CH3, -NHSO2CH3, and -SO2NH2.

[0021] Preferably, the non-naphthalene aromatic group is The filename is TIFF0007893516000022.tif22170.

[0022] In embodiments of the present invention, the non-naphthalene aromatic group is The filename is TIFF0007893516000023.tif20170.

[0023] Preferably, the non-naphthalene aromatic group is The filename is TIFF0007893516000024.tif23170.

[0024] Furthermore, Y1, Y2, Y3, Y4, Y5, and Y6 are CR 11 That is the case.

[0025] More preferably, the R 11 The following are selected from H, D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -COOH, -CN, -COOCH3, -NH2, -NHCH3, -NO2, -OCH3, -OH, -TMS, -SO2CH3, -NHSO2CH3, and -SO2NH2.

[0026] More preferably, the non-naphthalene aromatic group is The filename is TIFF0007893516000025.tif22170.

[0027] More preferably, the R 72 , R 73 The following are selected from H, D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -COOH, -CN, -COOCH3, -NH2, -NHCH3, -NO2, -OCH3, -OH, -TMS, -SO2CH3, -NHSO2CH3, and -SO2NH2.

[0028] More preferably, the non-naphthalene aromatic group is The filename is TIFF0007893516000026.tif26170.

[0029] More preferably, the R 33 The following are selected from H, -D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -COOH, -CN, -COOCH3, -NH2, -NHCH3, -NO2, -OCH3, -OH, -TMS, -SO2CH3, -NHSO2CH3, and -SO2NH2.

[0030] More preferably, the R 34 , R 35 , R 37The element is selected from H, D, or methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, etc.

[0031] Preferably, the non-naphthalene aromatic group is The filename is TIFF0007893516000027.tif23170.

[0032] More preferably, the R 27 , R 29 This is independently selected from H, D, or methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, etc.

[0033] More preferably, the R 26 , R 28 These are independently selected from H, D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -COOH, -CN, -COOCH3, -NH2, -NHCH3, -NO2, -OCH3, -OH, -TMS, -SO2CH3, -NHSO2CH3, and -SO2NH2.

[0034] Preferably, W1 is C and W2 is C, or W1 is C and W2 is N, or W1 is C and W2 is O.

[0035] Preferably, R1 and R2 are independently selected from H, (=O), C1-C3 alkyl, -COOH, -CF3, and hydroxyl, and preferably, both R1 and R2 are H.

[0036] Preferably, TIFF0007893516000028.tif18170 Preferably, TIFF0007893516000029.tif15170

[0037] Preferably, Ar 2 It has the following structure: TIFF0007893516000030.tif24170

[0038] (Here, n is either 0 or 1. T 11 ~T 16 These are independently selected from C, N, O, and S. T 17 -R represents one or more independent substituents on the ring, including H, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, and -R. L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', -R L -CH=NR', -R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO2, -R L -N is selected from CR'R'' and may be replaced by any other option.

[0039] t is either 1 or 2. R L These are monovalent atoms, alkylenes, heteroalkylenes, cycloalkylenes, heterocyclylenes, -NR4C(O)-, -NR4S(O) t -, -C(O)-, -C(O)O-, -NR4-, -C(O)NR4-, -S(O) t Selected from NR4-, and may be replaced by optional selection. R4 is selected from H, D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, hydroxy, and alkoxy. R' and R'' are independently selected from H, D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, and halogen, and may be optionally substituted.

[0040] In some embodiments of the present invention, Ar 2 teeth, The filename is TIFF0007893516000031.tif19170.

[0041] In a specific embodiment of the present invention, the compound has the following structure. TIFF0007893516000032.tif31170

[0042] In a specific embodiment of the present invention, the compound has the following structure. TIFF0007893516000033.tif29170

[0043] (L6 is either absent or selected from a monovalent atomic group, -NH-, -N(CH3)-, -N(CH3)C(O)-, or -NHC(O)-.)

[0044] Preferably, B has the following structure.

[0045] -F, -Cl, -Br, -I, -NH2, -S(O) t NR 15 , TIFF0007893516000034.tif119170(t is 1 or 2, Here, Z2~Z6 are independently selected from C, N, O, and S. Z1 is selected from C and N. Z7 is either absent or selected from a bond, C, N, O, S, C1-C6 alkylene. m1 to m4 are independently selected from integers between 0 and 5. R 12-R represents one or more independent substituents on the ring, including H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, and -R. L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', TIFF0007893516000035.tif14170-R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO2, -R L -N=CR'R'' can be selected and replaced by any choice. R''' is H, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, Selected from TIFF0007893516000036.tif13170, R 13 and R 13 ' are, independently, H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -N3, -B(OH)2, -R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', TIFF0007893516000037.tif14170-R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O)t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -R L -N(S(O) t R')(S(O) t R''), -NR'-R L -NR''R''', -R L -NO2, -R L -N=CR'R'', -R L -R'R'' can be selected and may be replaced by any other option. R 14 and R 14 ' represents one or more independent substituents on the ring, and each of these is represented by H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', TIFF0007893516000038.tif15170-R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO2, -R L -N is selected from CR'R'' and may be replaced by any other option.

[0046] More preferably, B has the following structure.

[0047] -F, -Cl, -Br, -I, -NH2, -S(O) t NR 15 , TIFF0007893516000039.tif78170(where Z1 and Z4 are independently selected from C, N, O, and S, and if Z4 is O or S, R9 does not exist, t is either 1 or 2. Z7 is either absent or selected from a bond, C, N, O, S, C1-C3 alkylene. m1 and m2 are independently selected from integers between 0 and 5. If Z4 is S, then R 13 It does not exist, or it is a carbonyl, R 14 It is a carbonyl, R''' is H, D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, Selected from TIFF0007893516000040.tif14170, R 83、 R 84 H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', TIFF0007893516000041.tif15170-R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -R L -N(S(O) t R')(S(O) tR''), -NR'-R L -NR''R''', -R L -NO2, -R L -N=CR'R'' can be selected and replaced by any choice. Or, R 83、 R 84 Along with the N atoms between them Form TIFF0007893516000042.tif23170, Z9 is S, NR 85 Selected from O, m5 is selected from 1, 2, or 3. R 85 H, (=O), D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', TIFF0007893516000043.tif15170-R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -R L -N(S(O) t R')(S(O) t R''), -NR'-R L -NR''R''', -R L -NO2, -R L -N is selected from CR'R'' and may be replaced by any other option.

[0048] Preferably, B has the following structure.

[0049] -F, -Cl, -Br, -I, -NH2, -S(O)t NR 15 , TIFF0007893516000044.tif255162(t is either 1 or 2) In some embodiments of the present invention, B is TIFF0007893516000045.tif24170 In some embodiments of the present invention, B is selected from -F, -Cl, -Br, -I, and -NH2.

[0050] In some embodiments of the present invention, B is TIFF0007893516000046.tif18170 more preferably, R 14 and R 14 ' is independently H or C1-C6 alkyl, D, amino, The filename is TIFF0007893516000047.tif15170.

[0051] Comfortable, R 13 and R 13 Each of these is independently selected from the following structures.

[0052] -H, -D, (=O), F, Cl, Br, I, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, -CF3, -CH2D, -OH, -N3, -B(OH)2, TIFF0007893516000048.tif145170 The present invention further provides the following specific compounds. TIFF0007893516000049.tif230170TIFF0007893516000050.tif239170TIFF0007893516000051.tif235170TIFF0007893516000052.tif244170TIFF0007893516000053.tif228170TIFF0007893516000054.tif241170TIFF0007893516000055.tif244170TIFF0007893516000056.tif216170TIFF0007893516000057.tif236170TIFF0007893516000058.tif255163

[0053] The present invention also provides a pharmaceutical composition comprising the above compound or a pharmaceutically acceptable salt, stereoisomer, ester, prodrug, solvate, and deuterated compound thereof, and one or more pharmaceutically acceptable auxiliary materials.

[0054] The pharmaceutical composition may contain one or more other co-active ingredients.

[0055] For example, the auxiliary materials may be carriers, diluents, adhesives, lubricants, wetting agents, etc.

[0056] The compounds of the present invention may be manufactured as pharmaceutical compositions in the form of syrups, elixirs, suspensions, powders, granules, tablets, capsules, troches, solutions, creams, ointments, lotions, gels, emulsions, etc.

[0057] The pharmaceutical preparation is preferably in unit dosage form. In this form, the preparation is divided into unit doses containing an appropriate amount of the active ingredient. The unit dosage form may be a packaged preparation containing individual amounts of the preparation, such as tablets, capsules, and powders packaged in vials or ampoules. The amount of the active ingredient in the unit dosage preparation varies or is adjusted from 0.001 mg to 1000 mg according to the specific use and efficacy of the active ingredient.

[0058] The present invention also provides the use of the above-mentioned compounds and their pharmaceutically acceptable salts, stereoisomers, esters, prodrugs, solvates, and deuterated compounds, and the above-mentioned pharmaceutical compositions, as PLpro inhibitors, for example, as antiviral agents.

[0059] The present invention also provides the use of the above-mentioned compounds and their pharmaceutically acceptable salts, stereoisomers, esters, prodrugs, solvates, and deuterated compounds, as well as the above-mentioned pharmaceutical compositions, in drugs that reduce and / or inhibit coronavirus replication.

[0060] The present invention also provides the use of the above-mentioned compounds and their pharmaceutically acceptable salts, stereoisomers, esters, prodrugs, solvates, and deuterated compounds, as well as the above-mentioned pharmaceutical compositions, in the manufacture of drugs that reduce and / or inhibit coronavirus replication.

[0061] The present invention also provides the use of the above-mentioned compounds and their pharmaceutically acceptable salts, stereoisomers, esters, prodrugs, solvates, and deuterated compounds in the manufacture of drugs for preventing and / or treating diseases or disorders caused by or associated with viral infections, and the above-mentioned pharmaceutical compositions.

[0062] Specifically, in the use described above, the compounds and pharmaceutical compositions have the definitions described in this invention.

[0063] In one embodiment of the present invention, the above-mentioned virus is a coronavirus, such as HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU, SARS-CoV, MERS-CoV, SARS-CoV-2, and in particular SARS-CoV, MERS-CoV, and SARS-CoV-2.

[0064] Specifically, the diseases or disorders mentioned above are diseases or disorders caused by or associated with coronavirus infection, such as COVID-19, SARS, or MERS.

[0065] The present invention also provides a method for preventing and / or treating a disease or disorder caused by a viral infection or associated with a viral infection, which comprises administering to a subject an effective amount of the compound or a pharmaceutically acceptable salt, stereoisomer, ester, prodrug, solvate, and deuterated compound according to the present invention, or the pharmaceutical composition according to the present invention.

[0066] Specifically, in the above method, the compound, the pharmaceutical composition, the disease or disorder have the definitions described in the present invention.

[0067] In particular, the above-mentioned disease or disorder is a disease or disorder caused by a coronavirus infection or associated with a coronavirus infection, such as COVID-19, SARS, MERS, etc.

[0068] Specifically, the above-mentioned subject is an animal. In one embodiment of the present invention, the above-mentioned subject is a mammal, such as a human, a monkey, a cat, a dog, a mouse, a bat, etc. In another embodiment of the present invention, the above-mentioned subject is a bird.

Brief Description of the Drawings

[0069] [Figure 1] Shows the inhibition rate curve of compound C21. [Figure 2] Shows the inhibition rate curve of compound C14. [Figure 3] Shows the inhibition rate curve of compound C24. [Figure 4] Shows the inhibition rate curve of compound C16. [Figure 5] Shows the inhibition rate curve of compound C17. [Figure 6] Shows the inhibition rate curve of compound C18. [Figure 7] Shows the inhibition rate curve of compound C26. [Figure 8] Shows the inhibition rate curve of compound C75. [Figure 9] Shows the inhibition rate curve of compound C76.

Embodiments for Carrying Out the Invention

[0070] Unless otherwise defined, all scientific and technical terms used in this invention have the same meaning as those generally understood by those skilled in the art.

[0071] The term "alkyl" refers to a linear or branched hydrocarbon chain radical that does not contain unsaturated bonds and is linked to the rest of the molecule by single bonds. Typical alkyl groups include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, neopentyl, tert-pentyl, n-hexyl, and isohexyl, which contain 1 to 12 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) carbon atoms. When an alkyl group is substituted with a cycloalkyl group, a "cycloalkylalkyl" radical is obtained, such as cyclopropylmethyl, cyclopropylethyl, cyclobutylmethyl, cyclopentylmethyl, and cyclohexylmethyl. When an alkyl group is substituted with an aryl group, an "aralkyl" radical is obtained, such as benzyl, diphenylmethyl, or phenethyl. When an alkyl group is substituted with a heterocyclyl group, a "heterocyclylalkyl" radical is obtained. "Alkylene" usually refers to an alkanediyl having two free valence bonds. Typical alkylenes include methylene, ethylene, propylene, and butylene, which contain 1 to 12 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) carbon atoms.

[0072] The term "alkoxy" refers to substituents formed by substituting a hydrogen atom of a hydroxyl group with an alkyl group. Typical alkoxys, such as methoxy, ethoxy, propoxy, and butoxy, contain 1 to 12 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) carbon atoms.

[0073] The term "cycloalkyl" refers to a saturated or partially saturated (especially saturated) monocyclic or polycyclic group, which contains 1 to 4 monocyclic and / or fused rings and 3 to 18, preferably 3 to 10 (e.g., 3, 4, 5, 6, 7, 8, 9, 10) carbon atoms, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, or adamantyl.

[0074] The term "aryl" refers to monocyclic or polycyclic radicals, including polycyclic radicals containing monoaryl and / or fused aryl groups, for example, 1 to 3 monocyclic or fused rings and 6 to 18 (e.g., 6, 8, 10, 12, 14, 16, 18) carbocyclic atoms. Typical aryls include phenyl, naphthyl, biphenyl, and indenyl, which contain 6 to 12 carbocyclic atoms. "Arylene" refers to a divalent group derived by removing two hydrogen atoms from an aromatic hydrocarbon.

[0075] The term "heterocyclyl" includes heteroaromatic and heteroalicyclic groups containing 1 to 3 monocyclic and / or fused rings and 3 to about 18 ring atoms. Preferred heteroaromatic and heteroalicyclic groups contain 5 to about 10 ring atoms. Suitable heteroaryls in the compounds of the present invention contain 1, 2, or 3 heteroatoms selected from N, O, or S atoms. Examples of heteroaryl groups include, but are not limited to, coumarin (containing 8-coumarin), quinolyl (containing 8-quinolyl), isoquinolyl, pyridyl, pyrazinyl, pyrazolyl, pyrimidinyl, furyl, pyrrolyl, thienyl, thiazolyl, isothiazolyl, triazolyl, tetrazolyl, isoxazolyl, oxazolyl, imidazolyl, indolyl, isoindolyl, indazolyl, indolidinyl, phthalazinyl, pteridinyl, purinyl, oxadiazolyl, thiadiazolyl, flazanyl, pyridazinyl, triazinyl, sinnolinyl, benzimidazolyl, benzofuryl, benzoflazanyl, benzothienyl, benzothiazolyl, benzoxazolyl, quinazolinyl, quinoxalinyl, naphthilidinyl, and phlopyridinyl. Suitable heteroalicyclic groups in the compounds of the present invention include 1, 2, or 3 heteroatoms selected from N, O, or S atoms. Examples of heteroalicyclic groups include pyrrolidinyl, tetrahydrofuranil, dihydrofuranil, tetrahydrothiophenyl, tetrahydrothiopyranil, piperidinyl, morpholinil, thiomorpholinil, oxathianil, piperazinil, azetidinil, oxetanil, thietanil, homopiperidinyl, oxyranil, thyranil, azepinil, oxoazepanil, diazepinil, triazepinil, 1,2,3,6-tetrahydropyridinyl, 2- This includes, but is not limited to, pyrrolinil, 3-pyrrolinil, indolinil, 2H-pyranil, 4H-pyranil, dioxanil, 1,3-dioxolanil, pyrazolinil, dithianil, dithiolanil, dihydropyranil, dihydrothienyl, pyrazolidinil, imidazolinil, imidazolidinil, 3-azabicyclo[3.1.0]hexyl, 3-azabicyclo[4.1.0]heptyl, 3H-indolyl, and quinolidinil.

[0076] The above groups may be replaced by one or more suitable groups at one or more available positions, for example, OR', =O, SR', SOR', SO2R', OSO2R', OSO3R', NO2, NHR', N(R')2, =N-R', N(R')COR', N(COR')2, N(R')SO2R', N(R')C(=NR')N(R')R', N3, CN, halogen, COR', COOR', OCOR', OCOOR', OCONHR', OCON(R')2, CONHR', CON(R')2, CON(R')OR', CON(R')SO2R', PO(OR')2, PO(OR')R', PO(OR')(N(R')R'), C1~C 12 Alkyl, C3~C 10 Cycloalkyl, C2~C 12 Alkenyl, C2~C 12 These are alkynyl, aryl, and heterocyclyl groups, where the R' group is independently hydrogen, OH, NO2, NH2, SH, CN, halogen, COH, COalkyl, COOH, C1-C 12 Alkyl, C3~C 10 Cycloalkyl, C2~C 12 Alkenyl, C2~C 12 Selected from alkynyl, aryl, and heterocyclyl groups. Here, these groups themselves are substituted, and the substituents may be selected from the aforementioned list.

[0077] "Halogen" refers to bromine, chlorine, iodine, or fluorine. Haloalkyl refers to a group in which a hydrogen atom on an alkyl group is replaced by a halogen atom (F, Cl, Br, I), such as -CH2Rh, -CHRh2, or -CRh3, where Rh is F, Cl, Br, or I, for example, -CF3.

[0078] The term "pharmaceutically acceptable salt" refers to an acidic or basic salt that is theoretically free from toxicity, irritation, and allergens, and that can achieve or provide clinically acceptable pharmacokinetic, absorption, distribution, and metabolic properties of a drug molecule, thereby achieving its intended purpose. The salts described in this invention include pharmaceutically acceptable acidic or basic salts of the acidic, basic, or amphoteric groups of a compound. For a list of suitable salts, see SMBirge, et al., J. Pharm. Sci., 66, 1-19 (1977).

[0079] The pharmaceutically acceptable salts described in this invention include acid addition salts and base addition salts.

[0080] The aforementioned acid addition salts include, but are not limited to, salts from inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, and phosphonic acid, as well as salts from organic acids such as aliphatic monocarboxylic acids and dicarboxylic acids, phenyl-substituted alkano acids, hydroxyalkano acids, alkanedioic acids, aromatic acids, and salts of aliphatic sulfonic acids and aromatic sulfonic acids. Therefore, these salts include, but are not limited to, salts of sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, nitrates, phosphates, monohydrogen phosphates, dihydrogen phosphates, metaphosphates, pyrophosphates, hydrochlorides, hydrobroms, iodates, acetates, propions, octanates, isobutyrates, oxalates, malonates, succinates, suberates, sebacinates, fumarates, maleates, mandelates, benzoates, chlorobenzoates, methylbenzoates, dinitrobenzoates, phthalates, benzenesulfonates, tosylates, phenylacetates, citrates, lactates, maleates, tartrates, methanesulfonates, and salts of amino acids such as arginine salts, glucons, and galacturonates. Acid addition salts can be produced by conventional methods by contacting the free base form with a sufficient amount of the desired acid to form a salt. The salt form may be brought into contact with a base to regenerate the free base form, and this free base may be separated by conventional methods.

[0081] The base addition salts described in this invention refer to salts formed with metals such as alkali metal and alkaline earth metal hydroxides, or amines, or organic amines. Examples of metals used as cations include, but are not limited to, sodium, potassium, magnesium, and calcium. Examples of suitable amines include, but are not limited to, N,N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine (ethane-1,2-diamine), N-methylglucosamine, and procaine. Base addition salts can be produced by contacting a free acid form with a sufficient amount of the desired base to form a salt in the conventional manner. The free acid form may be regenerated by contacting the salt form with the acid, and this free acid may be separated in the conventional manner.

[0082] The term "solvate" should be understood to mean any form of the compound of the present invention in which the compound is linked to another molecule (usually a polar solvent) by a non-covalent bond, particularly including hydrates and alkoxides, such as methanolate. The preferred solvate is the hydrate.

[0083] The term "prodrug" is used in its broadest sense and includes derivatives that can be converted in vivo to the compounds of the present invention. Examples of prodrugs include, but are not limited to, derivatives and metabolites of compounds containing a biohydrolyzable moiety, such as biohydrolyzable amides, biohydrolyzable esters, biohydrolyzable carbamates, biohydrolyzable carbonates, biohydrolyzable ureids, and biohydrolyzable phosphate ester analogs. Preferably, prodrugs having a carboxyl functional group are lower alkyl esters of carboxylic acids. The carboxylic acid esters are obtained by esterifying any carboxylic acid moiety present in the molecule. Prodrugs can usually be produced by conventional methods, such as those described in Burger's "Medicinal Chemistry and Drug Discovery, 6th Edition" (Donald J. Abraham ed., 2001, Wiley) and "Design and Applications of Prodrugs" (H. Bundgaard ed., 1985, Harwood Academic Publishers).

[0084] The term "does not exist" refers to the fact that this linking group is a linking bond, for example, In the structure TIFF0007893516000059.tif24170, the absence of L6 means that Ar 2 This shows that it is directly linked to B, and also, for example, -R L -CH=NR' L The absence of this group indicates that the group in question is -CH=NR'.

[0085] All compounds relating to this specification are intended to represent a particular compound or any variation or form thereof. In particular, the compounds referred to herein have a chiral center and therefore may exist in different enantiomer or diastereomer forms. Thus, any given compound relating to this specification represents any one racemate, one or more enantiomer forms, one or more diastereomer forms, and mixtures thereof. Similarly, stereoisomers or geometric isomers of double bonds may also exist, and in some cases the molecule may exist as an (E)-isomer or (Z)-isomer (trans and cis isomer). If a molecule contains multiple double bonds, each double bond has its own stereoisomerism, which may be the same as or different from the stereoisomerism of the other double bonds in the molecule. Furthermore, the compounds relating to this specification may exist as atropisomers. All stereoisomers of the compounds relating to this specification, including enantiomers, diastereoisomers, geometric isomers and atropisomers, and mixtures thereof, are within the scope of the present invention.

[0086] Example 1: TIFF0007893516000060.tif21170C1: 11H NMR (600 MHz, DMSO-d6) δ 9.23 (s, 1H), 9.07 (s, 1H), 8.74 (dd, J = 9.4, 5.7 Hz, 1H), 7.84 (d, J = 8.2 Hz, 1H), 7.78 (d, J = 7.0 Hz, 1H), 7.73 (dd, J = 10.3, 2.7 Hz, 1H), 7.54 - 7.46 (m, 2H), 6.99 (d, J = 8.4 Hz, 1H), 6.81 (dd, J = 8.4, 2.8 Hz, 1H), 6.56 (d, J = 2.7 Hz, 1H), 4.08 (s, 2H), 3.50 (d, J = 12.2 Hz, 2H), 2.99 (t, J = 10.3 Hz, 2H), 1.95 (dd, J = 8.8, 4.3 Hz, 2H), 1.89 (d, J = 10.1 Hz, 5H), 1.36 (d, J = 5.0 Hz, 2H), 1.19 (d, J = 5.8 Hz, 2H). 13 13C NMR (151 MHz, DMSO-d6) δ 170.03, 160.14 (d, J = 243.6 Hz), 147.99, 138.34 (d, J = 18.6 Hz), 134.86, 131.30, 129.40, 128.68 (d, J = 8.6 Hz), 128.34, 127.64 (d, J = 5.2 Hz), 126.84, 125.53, 116.17, 116.00, 115.80, 113.51, 111.77 (d, J = 20.0 Hz), 54.19, 51.08, 34.58, 25.82, 18.27, 14.59. MS (ESI, m / z): C27H28FN3O, [M+H]+ 430.229.

[0087] Example 2: TIFF0007893516000061.tif25170C2: 11H NMR (600 MHz, DMSO-d6) δ 9.09 - 9.06 (m, 1H), 8.73 (d, J = 8.5 Hz, 1H), 8.08 (d, J = 8.2 Hz, 1H), 7.80 (dd, J = 8.0, 5.6 Hz, 1H), 7.67 (dt, J = 26.1, 7.3 Hz, 2H), 7.29 (dd, J = 10.6, 7.9 Hz, 1H), 7.01 (d, J = 8.4 Hz, 1H), 6.90 (dd, J = 8.4, 2.7 Hz, 1H), 6.65 (d, J = 3.0 Hz, 1H), 3.25 (dt, J = 8.6, 4.3 Hz, 4H), 3.16 (dd, J = 8.8, 4.6 Hz, 4H), 1.92 (s, 3H), 1.37 (d, J = 5.8 Hz, 2H), 1.19 (d, J = 5.6 Hz, 2H). 13 13C NMR (151 MHz, DMSO-d6) δ 169.93, 157.71 (d, J = 249.7 Hz), 148.11, 138.27, 134.47, 133.49, 131.44, 129.12 (d, J = 8.3 Hz), 127.36, 126.68 (d, J = 5.3 Hz), 125.84, 123.42 (d, J = 16.2 Hz), 120.85 (d, J = 5.4 Hz), 117.54, 115.14, 109.02 (d, J = 19.2 Hz), 46.17, 43.01, 34.14, 18.40, 14.58. MS (ESI, m / z): C25H26FN3O, [M+H]+ 404.212.

[0088] Example 3: TIFF0007893516000062.tif26170C3: 1H NMR (600 MHz, DMSO-d6) δ 9.03 (s, 1H), 8.72 (d, J = 8.4 Hz, 1H), 8.08 (d, J = 8.2 Hz, 1H), 7.79 (dd, J = 8.2, 5.6 - m 7), 2H), 7.29 (dd, J = 10.6, 7.8 Hz, 1H), 6.96 (dd, J = 8.7, 2.7 Hz, 1H), 6.79 - 6.74 (m, 1H), 6.51 (d, J = 3.2 Hz, 3. 2H4), = 10.2 Hz, 2H), 2.80 (d, J = 11.6 Hz, 2H), 1.89 (s, 3H), 1.79 (d, J = 14.5 Hz, 4H), 1.35 (t, J = 3.3 Hz, 2H), 1.8 Hz (d). 13 C NMR (151 MHz, DMSO-d6) δ 170.17, 157.70 (d, J = 249.4 Hz), 148.49, 138.16, 134.49, 133.48, 131.22, 18.d39 J =07 ( 126.67, 125.84, 123.43 (d, J = 15.6 Hz), 120.85, 115.36, 113.12, 109.01 (d, J = 19.1 Hz), 54.13, 12.12, 27.18, 34 14.52. MS (ESI, m / z):C27H28FN3O, [M+H]+430.229.

[0089] Chapter 4: TIFF0007893516000063.tif26170C4: 1H NMR (600 MHz, DMSO-d6) δ 9.46 (s, 1H), 9.01 (d, J = 2.7 Hz, 1H), 7.56 (dd, J = 12.5, 3.4 Hz, 2H), 7.52 - 7.57.t (m. 2H), 7.32 - 7.57. 1H), 7.18 - 7.14 (m, 1H), 7.11 (dd, J = 8.6, 5.5 Hz, 2H), 6.90 (d, J = 6.0 Hz, 2H), 4.14 (s, 2H), 3.62 (d, J = 1.2), 3.2.2. 10.6 Hz, 2H), 2.24 (s, 3H), 2.05 - 1.90 (m, 4H), 1.32 (s, 2H), 1.31 - 1.29 (m, 2H). 13 C NMR (151 MHz, DMSO-d6) δ 170.34, 148.14, 144.99, 137.92, 133.87, 131.56, 129.50, 128.96, 123.19, 122.63, 115.99, 113.68, 54.17, 51.10, 34.59, 25.90, 18.84, 18.79. MS (ESI, m / z):C27H29N3OS, [M+H]+444.209.

[0090] Chapter 5: TIFF0007893516000064.tif26170C5: 11H NMR (600 MHz, DMSO-d6) δ 11.09 (d, J = 15.0 Hz, 1H), 9.02 (s, 1H), 7.60 - 7.54 (m, 2H), 7.52 - 7.47 (m, 2H), 7.35 (t, J = 7.7 Hz, 1H), 7.16 (t, J = 4.4 Hz, 1H), 7.11 (t, J = 8.7 Hz, 2H), 6.91 (d, J = 6.3 Hz, 2H), 4.06 (t, J = 3.4 Hz, 2H), 3.69 (dd, J = 12.7, 2.7 Hz, 2H), 3.32 (dd, J = 26.5, 12.7 Hz, 2H), 2.74 (d, J = 5.0 Hz, 3H), 2.24 (s, 3H), 2.21 (dd, J = 8.9, 4.4 Hz, 2H), 1.98 (t, J = 6.7 Hz, 2H), 1.32 (s, 2H), 1.30 (s, 2H). 13 13C NMR (151 MHz, DMSO-d6) δ 170.32, 147.80, 144.99, 144.08, 137.97, 133.86, 131.55, 129.50, 128.96, 126.12, 125.89, 124.06, 123.90, 123.17, 122.63, 116.02, 113.73, 62.39, 51.63, 38.65,  34.58, 23.97, 18.83, 18.80. MS (ESI, m / z):C28H31N3OS, [M+H]+458.224.

[0091] Example 6: TIFF0007893516000065.tif26170C6: 11H NMR (600 MHz, DMSO-d6) δ 9.41 (s, 1H), 9.03 (s, 1H), 7.57 (d, J = 5.1 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.52 - 7.48 (m, 2H), 7.36 (t, J = 7.7 Hz, 1H), 7.18 - 7.13 (m, 2H), 7.11 (d, J = 7.9 Hz, 1H), 7.00 (d, J = 7.5 Hz, 2H), 3.44 - 3.37 (m, 4H), 3.22 (p, J = 4.6 Hz, 4H), 2.26 (s, 3H), 1.36 - 1.30 (m, 4H). 13 13C NMR (151 MHz, DMSO-d6) δ 170.20, 148.22, 144.98, 144.07, 137.94, 133.89, 131.71, 129.50, 128.96, 127.12, 126.12, 124.07, 123.94, 123.20, 122.59, 117.87, 115.37, 46.27, 42.97, 34.60, 18.95, 18.80. MS (ESI, m / z): C25H27N3OS, [M+H]+ 418.193.

[0092] Example 7: TIFF0007893516000066.tif25170C7: 11H NMR (600 MHz, DMSO-d6) δ 9.34 (s, 1H), 8.92 (s, 1H), 7.34 (d, J = 2.3 Hz, 1H), 7.25 - 7.18 (m, 2H), 7.11 (d, J = 8.4 Hz, 1H), 6.96 (dd, J = 7.0, 2.2 Hz, 1H), 6.92 - 6.85 (m, 2H), 4.14 (s, 2H), 3.61 (dd, J = 12.7, 2.8 Hz, 2H), 3.10 (d, J = 12.0 Hz, 2H), 2.23 (s, 3H), 1.99 (dt, J = 12.5, 5.3 Hz, 2H), 1.97 - 1.90 (m, 2H), 1.28 (d, J = 1.9 Hz, 9H), 1.24 (dd, J = 5.8, 3.8 Hz, 4H). 13 13C NMR (151 MHz, DMSO-d6) δ 170.16, 150.54, 148.08, 143.49, 138.03, 131.54, 128.30, 125.92, 122.88, 122.10, 121.67, 115.97, 113.71, 54.22, 51.13, 34.72, 31.67, 25.88, 18.78, 18.72. MS (ESI, m / z): C27H25N3O, [M+H]+ 418.284.

[0093] Example 8: TIFF0007893516000067.tif25170C8: 11H NMR (600 MHz, DMSO-d6) δ 8.94 - 8.90 (m, 1H), 7.34 (d, J = 1.8 Hz, 1H), 7.23 - 7.20 (m, 2H), 7.11 (d, J = 8.2 Hz, 1H), 6.96 (dt, J = 6.9, 1.8 Hz, 1H), 6.92 - 6.89 (m, 1H), 6.87 (d, J = 2.7 Hz, 1H), 4.07 (s, 2H), 3.68 (d, J = 12.2 Hz, 2H), 3.34 - 3.24 (m, 2H), 2.75 (dt, J = 8.1, 3.6 Hz, 3H), 2.26 - 2.18 (m, 5H), 1.97 (t, J = 6.9 Hz, 2H), 1.28 (d, J = 1.2 Hz, 9H), 1.22 - 1.29 (m, 4H). 13 13C NMR (151 MHz, DMSO-d6) δ 170.14, 150.53, 147.71, 143.48, 138.08, 131.53, 128.30, 125.93, 122.89, 122.11, 121.68, 116.00, 113.78, 62.44, 51.74, 38.66, 34.73, 31.68, 23.91, 18.77, 18.72. MS (ESI, m / z):C28H37N3O, [M+H]+432.299.

[0094] [[ID=?]]Example 9: TIFF0007893516000068.tif20170C9: 1H NMR (600 MHz, DMSO-d6) δ 9.07 (s, 1H), 8.74 (dd, J = 9.3, 5.7 Hz, 1H), 7.84 (d, J = 8.2 Hz, 1H), 7.79 (d, J = 7.1 ( 7.1 Hz), Jdd ,2, 2.7 Hz, 1H), 7.54 - 7.46 (m, 2H), 6.98 (d, J = 8.2 Hz, 1H), 6.42 (dd, J = 8.2, 2.6 Hz, 1H), 6.19 (d, J = 2.6 (t 4 . 1H), 4 . 1H J = 7.9 Hz, 2H), 3.83 (dd, J = 8.8, 5.4 Hz, 2H), 2.75 (s, 6H), 1.91 (s, 3H), 1.35 (q, J = 4.3 Hz, 2H), 1.19 (H, J = 2H). 13 C NMR (151 MHz, DMSO-d6) δ 169.93, 160.15 (d, J = 243.5 Hz), 148.98, 138.35 (d, J = 11.8 Hz), 134.85, 131.2.24. = 12,6 Hz), 128.40, 127.65 (d, J = 5.1 Hz), 126.85, 124.40, 116.12 (d, J = 24.7 Hz), 113.16, 111.77 (d, J = 16,50.7 Hz), 1 34.52, 6.41, 14.65. MS (ESI, m / z):C26H28FN3O, [M+H]+418.228.

[0095] Chapter 10: TIFF0007893516000069.tif21170C10: 1H NMR (600 MHz, DMSO-d6) δ 9.06 (s, 1H), 8.64 (dd, J = 13.2, 8.2 Hz, 1H), 8.02 (dd, J = 11.7, 8.5 Hz, 1H), J 7.86, 81 (d, J = Hz), 7.1 Hz, 1H), 7.51 (t, J = 7.7 Hz, 1H), 6.93 (d, J = 8.2 Hz, 1H), 6.35 (dd, J = 8.2, 2.5 Hz, 1H), 6.12 (d, J = 2.8 Hz (J = 2.6 Hz), J0. 3, 2H), 3.42 (d, J = 13.2 Hz, 2H), 3.13 (s, 1H), 2.08 (s, 6H), 1.91 (s, 3H), 1.36 - 1.30 (m, 2H), 1.18 (q, J = 4.8). 13 C NMR (151 MHz, DMSO-d6) δ 170.15, 150.03, 138.63 - 136.56 (m), 131.18, 129.44 (d, J = 26.9 Hz), 127.62, 1.26 (d, J = 4), 123.19, 114.92 (d, J = 15.9 Hz), 112.77, 112.21 (d, J = 17.4 Hz), 110.39, 56.29, 41.94, 34.50, 18.33. MS (ESI, m / z):C26H27F2N3O, [M+H]+436.219.

[0096] Chapter 11: TIFF0007893516000070.tif25170C11: 11H NMR (600 MHz, DMSO-d6) δ 9.08 (s, 1H), 8.77 - 8.72 (m, 1H), 8.26 - 8.20 (m, 1H), 7.80 (d, J = 7.6 Hz, 1H), 7.75 - 7.69 (m, 2H), 7.68 (d, J = 7.7 Hz, 1H), 6.99 (d, J = 8.2 Hz, 1H), 6.42 (dd, J = 8.2, 2.6 Hz, 1H), 6.19 (d, J = 2.6 Hz, 1H), 4.15 - 4.09 (m, 1H), 4.00 (t, J = 8.0 Hz, 2H), 3.79 (td, J = 11.7, 10.3, 5.7 Hz, 3H), 2.76 (s, 6H), 1.91 (s, 3H), 1.40 - 1.33 (m, 2H), 1.21 (d, J = 5.4 Hz, 2H). 13 13C NMR (151 MHz, DMSO-d6) δ 170.01, 148.98, 138.22, 137.85, 133.46, 131.25, 130.50, 129.38, 127.57, 127.26, 126.34, 125.98, 124.72, 124.43, 113.22, 110.82, 55.73, 54.52, 34.27, 25.97, 18.43, 14.67. MS (ESI, m / z): C26H28ClN3O, [M+H]+434.199.

[0097] Example 12: TIFF0007893516000071.tif25170C12: 11H NMR (600 MHz, DMSO-d6) δ 8.94 (s, 1H), 8.63 (d, J = 8.5 Hz, 1H), 8.18 (d, J = 8.3 Hz, 1H), 7.73 (d, J = 7.9 Hz, 1H), 7.58 (ddd, J = 8.3, 6.7, 1.4 Hz, 1H), 7.50 (dd, J = 8.3, 6.8 Hz, 1H), 6.91 (d, J = 8.1 Hz, 2H), 6.33 (dd, J = 8.2, 2.5 Hz, 1H), 6.11 (d, J = 2.6 Hz, 1H), 3.97 (s, 3H), 3.80 (t, J = 7.0 Hz, 2H), 3.41 (t, J = 6.5 Hz, 2H), 3.18 - 3.10 (m, 1H), 2.08 (s, 6H), 1.91 (s, 3H), 1.35 - 1.26 (m, 2H), 1.12 (d, J = 5.4 Hz, 2H). 13 13C NMR (151 MHz, DMSO-d6) δ 170.00, 154.62, 149.98, 138.22, 133.06, 131.08, 129.32, 125.53, 125.22, 123.26, 122.35, 112.63, 110.47, 103.71, 56.68, 56.27, 56.00, 46.02, 41.92, 34.12, 18.44, 14.62. MS (ESI, m / z): C27H31N3O2, [M+H]+ 430.249.

[0098] Example 13: TIFF0007893516000072.tif26170C13: 11H NMR (600 MHz, DMSO-d6) δ 9.06 (s, 1H), 8.77 - 8.71 (m, 1H), 8.22 - 8.16 (m, 1H), 7.86 (d, J = 7.7 Hz, 1H), 7.73 (d, J = 7.7 Hz, 1H), 7.72 - 7.67 (m, 2H), 6.92 (d, J = 8.2 Hz, 1H), 6.34 (dd, J = 8.2, 2.6 Hz, 1H), 6.11 (d, J = 2.6 Hz, 1H), 3.81 (t, J = 7.0 Hz, 2H), 3.42 (s, 2H), 3.15 (s, 1H), 2.25 - 2.02 (m, 6H), 1.89 (s, 3H), 1.38 - 1.34 (m, 2H), 1.19 (d, J = 5.7 Hz, 2H). 13 13C NMR (151 MHz, DMSO-d6) δ 170.22, 149.98, 138.57, 137.94, 133.60, 131.72, 131.13, 129.80, 129.71, 127.80, 127.43, 127.21, 126.41, 123.24, 121.77, 112.75, 110.43, 56.65, 56.27, 41.91, 34.33, 18.41, 14.59. MS (ESI, m / z):C26H28BrN3O, [M+H]+478.149.

[0099] Example 14: TIFF0007893516000073.tif24170C14: 1H NMR (600 MHz, DMSO-d6) δ 8.98 (s, 1H), 8.72 - 8.66 (m, 1H), 8.06 - 8.00 (m, 1H), 7.69 (d, J = 7.2 Hz, 1H), 7.61 - 7.53 (m, 2H), 7.31 (dd, J = 7.2, 1.1 Hz, 1H), 6.91 (d, J = 8.2 Hz, 1H), 6.34 (dd, J = 8.2, 2.6 Hz, 1H), 6.11 (d, J = 2.6 Hz, 1H), 3.80 (t, J = 7.0 Hz, 2H), 3.42 (t, J = 6.6 Hz, 2H), 3.15 (s, 1H), 2.64 (s, 3H), 2.10 (s, 6H), 1.91 (s, 3H), 1.33 (q, J = 3.1 Hz, 2H), 1.14 (q, J = 4.5 Hz, 2H). 13C NMR (151 MHz, DMSO-d6) δ 170.03, 149.96, 138.14, 136.33, 133.91, 132.87, 132.33, 131.09, 128.56, 126.16, 125.79, 125.09, 123.31, 112.67, 110.51, 56.65, 56.26, 41.90, 34.48, 19.58, 18.47, 14.63. MS (ESI, m / z): C27H31N3O, [M+H]+414.254. Figure 2 shows the inhibition rate curve of compound C14.

[0100] Example 15: TIFF0007893516000074.tif25170C15: 1H NMR (600 MHz, DMSO-d6) δ 9.03 (s, 1H), 8.72 (d, J = 8.4 Hz, 1H), 8.12 (d, J = 8.4 Hz, 1H), 8.12 (d, J 7, = 8.14). 7.9 Hz, 1H), 7.71 - 7.62 (m, 2H), 7.55 - 7.29 (m, 1H), 7.27 (d, J = 7.9 Hz, 1H), 6.92 (d, J = 8.1 Hz, 1H), 4, J = 1.8 ( 6.12 (d, J = 2.5 Hz, 1H), 3.80 (t, J = 7.0 Hz, 2H), 3.40 (t, J = 6.6 Hz, 2H), 3.11 (p, J = 6.3 Hz (s), 1H), 2.07 (s. 1, 35H), 2.07. 2H), 1.18 - 1.15 (m, 2H). 13C NMR (151 MHz, DMSO-d6) δ 170.18, 150.02, 146.55, 131.13, 128.76, 127.21, 126.73, 125.87, 1217.8.8 =, 225.87, 112.65, 110.44, 56.75, 56.30, 41.98, 14.58. MS (ESI, m / z):C27H29F2N3O, [M+H]+466.230.

[0101] Chapter 16: TIFF0007893516000075.tif27170C16: 1H NMR (400 MHz, DMSO-d6) δ 9.02 (s, 1H), 8.72 (d, J = 6.5 Hz, 1H), 8.07 (d, J = 6.5 Hz, 1H), 7.78 (s, 1H), 7.67 (t, J = 8.7 Hz, 2H), 7.28 (t, J = 8.5 Hz,1H), 6.90 (d, J = 7.6 Hz, 1H), 6.34 (d, J = 7.2 Hz, 1H), 6.11 (s, 1H), 3.79 (s, 2H), 3.10 (s, 1H), 2.06 (s, 6H), 1.87 (s, 3H), 1.33 (s, 2H), 1.23 (s, 2H), 1.16 (s, 2H). 13 C NMR (101 MHz, DMSO-d6) δ 169.69, 153.27 (d, J H-F = 245.2 Hz), 149.57, 137.55, 132.64 (d, J H-F = 23.8 Hz), 130.65, 129.11, 128.66, 128.57, 125.41, 126.87, 126.21, 125.40 (d, J H-F = 15.2 Hz), 122.73, 112.24, 109.94, 56.30, 55.84, 41.53, 33.64, 17.93, 14.08. MS (ESI, m / z): C 26 H 28 FN3O, [M+H] +418.221. Figure 4 shows the inhibition rate curve of compound C16.

[0102] Example 17: TIFF0007893516000076.tif26170C17: 1H NMR (400 MHz, Methanol-d4) δ 8.61 (d, J = 8.4 Hz, 1H), 8.26 (d, J = 8.6 Hz, 1H), 8.02 (d, J = 7.2 Hz, 1H), 7.84 - 7.37 (m, 3H), 7.01 (d, J = 7.9 Hz, 1H), 6.48 (d, J = 7.9 Hz, 1H), 6.26 (s, 1H), 4.07 (d, J = 8.4 Hz, 2H), 3.81 (s, 2H), 3.33 (s, 6H), 2.82 (s, 3H), 1.98 (s, 2H), 1.48 (s, 2H). 13 C NMR (100 MHz, Methanol-d4) δ 168.39, 147.15, 134.48, 133.47, 133.09, 132.97, 132.49, 132.11, 130.49, 127.97, 126.87, 125.47, 125.09, 125.04, 123.29, 116.05, 112.55, 61.03, 49.74, 42.05, 35.70, 20.80, 18.80. MS(ESI, m / z): C26H28ClN3O, [M+H]+434.191. Figure 5 shows the inhibition rate curve of compound C17.

[0103] Example 18: TIFF0007893516000077.tif26170C18: 1 H NMR (400 MHz, Methanol-d4) δ 8.42 (d, J = 8.5 Hz, 1H), 8.02 (dd, J = 28.6, 7.7 Hz, 2H), 7.65 - 7.44 (m, 2H), 7.23 (t, J = 9.1 Hz, 1H), 6.97 (d, J = 8.1 Hz, 1H), 6.44 (d, J = 8.2 Hz, 1H), 6.24 (s, 1H), 3.96 (t, J = 7.3 Hz, 2H), 3.70 - 3.41 (m, 3H), 3.33 (s, 3H), 2.45 (s, 6H), 1.96 (s, 2H), 1.46 (s, 2H).13 C NMR (100 MHz, Methanol-d4) δ 168.39, 161.79, 159.27, 147.15, 134.48, 134.38, 134.35, 132.97, 132.11, 132.03, 130.49, 126.98, 126.90, 125.47, 125.44, 123.77, 123.57, 123.53, 123.45, 121.61, 121.58, 116.05, 112.69, 112.55, 112.49, 61.03, 49.74, 42.05, 35.98, 20.80, 18.80. MS(ESI, m / z): C26H28FN3O, [M+H]+418.223. Figure 6 shows the inhibition rate curve of compound C18.

[0104] Example 19: TIFF0007893516000078.tif22170C19: 1 H NMR (600 MHz, DMSO-d6) δ 8.88 (s, 1H), 7.30 (t, J = 7.6 Hz, 2H), 7.26 - 7.20 (m, 2H), 7.18 (t, J = 7.5 Hz, 1H), 7.06 (d, J = 8.3 Hz, 1H), 6.47 (d, J = 6.8 Hz, 2H), 4.03 (s, 2H), 3.79 (s, 2H), 3.47 (s, 1H), 2.20 (s, 3H), 1.24 (s, 4H). 13 C NMR (151 MHz, DMSO-d6) δ 170.20, 143.96, 137.91, 131.41, 128.85, 128.50, 126.83, 126.01, 125.11, 124.57, 113.17, 110.89, 55.97, 54.13, 52.84, 34.63, 19.58, 18.92, 18.67. MS (ESI, m / z):C22H27N3O, [M+H]+350.222.

[0105] Example 20: TIFF0007893516000079.tif23170C20: 1 H NMR (600 MHz, DMSO-d6) δ 9.11 (s, 1H), 8.32 (d, J = 8.0 Hz, 1H), 7.96 (d, J = 8.0 Hz, 1H), 7.67 (s, 1H), J, 7.81 (t, J = Hz), 7.73, 71.5 (t, J = Hz). 7.7 Hz, 1H), 7.00 (d, J = 8.2 Hz, 1H), 6.43 (dd, J = 8.1, 2.6 Hz, 1H), 6.27 (d, J = 2.6 Hz, 1H), 4.18 (d, J = 8.1. Hz), J = 8. Hz, 2H), 3.91 (dd, J = 8.6, 5.6 Hz, 2H), 2.71 (s, 6H), 2.51 (d, J = 4.5 Hz, 3H), 1.98 (s, 3H), 1.21 (d, J = 4.2 Hz, J. = 2. Hz). 13 C NMR (151 MHz, DMSO-d6) with δ 169.94, 148.98, 140.23, 123.41, 113.14, 110.90, 55.19, 54.27, 40.52, 40.08, 30.79, 18.55, 14.13. MS (ESI, m / z):C24H27N3OS, [M+H]+406.194.

[0106] Chapter 21: TIFF0007893516000080.tif20170C21: 1H NMR (600 MHz, DMSO-d6) δ 8.68 (s, 1H), 7.40 (dd, J = 7.6, 1.4 Hz, 1H), 7.01 (t, J = 7.5 Hz, 1H), 6.95 (dd, J = 14.7, 7.9 Hz, 2H), 6.37 (dd, J = 8.2, 2.5 Hz, 1H), 6.20 (d, J = 2.5 Hz, 1H), 3.87 (t, J = 7.1 Hz, 2H), 3.49 (t, J = 6.5 Hz, 2H), 3.23 (s, 1H), 2.97 (t, J = 6.2 Hz, 2H), 2.74 (t, J = 6.2 Hz, 2H), 2.15 (s, 6H), 2.03 (s, 3H), 1.75 (ddt, J = 18.6, 11.3, 3.7 Hz, 4H), 1.12 (q, J = 4.7, 4.2 Hz, 2H), 1.01 (t, J = 3.5 Hz, 2H). 13 C NMR (151 MHz, DMSO-d6) δ 169.95, 149.94, 139.85, 138.19, 137.24, 136.73, 131.11, 129.08, 128.34, 124.73, 123.43, 112.65, 110.58, 56.56, 56.28, 41.85, 34.82, 29.84, 26.33, 23.28, 23.08, 18.50, 14.59. MS (ESI, m / z): C26H33N3O, [M+H]+404.269. Figure 1 shows the inhibition rate curve of compound C21.

[0107] Example 22: TIFF0007893516000081.tif34170C22: 11H NMR (600 MHz, DMSO-d6) δ 8.92 (s, 1H), 7.70 - 7.64 (m, 2H), 7.63 - 7.59 (m, 2H), 7.50 - 7.40 (m, 2H), 7.35 (td, J = 7.3, 1.3 Hz, 1H), 7.34 - 7.30 (m, 2H), 7.04 (d, J = 8.1 Hz, 1H), 6.47 (d, J = 2.5 Hz, 1H), 6.43 (dd, J = 8.1, 2.5 Hz, 1H), 3.93 (t, J = 7.0 Hz, 2H), 3.54 (t, J = 6.4 Hz, 2H), 3.20 (s, 1H), 2.21 (s, 3H), 2.13 (s, 6H), 1.31 - 1.26 (m, 4H). 13 13C NMR (151 MHz, DMSO-d6) δ 170.41, 150.16, 143.40, 140.42, 137.88, 137.74, 131.37, 129.44, 129.38, 127.66, 126.93, 126.81, 125.70, 123.65, 112.91, 110.64, 56.79, 56.36, 4​​​​​​​1H NMR (400 MHz, Chloroform-d) δ 7.61 - 7.51 (m, 4H), 7.47 - 7.29 (m, 6H), 7.03 (d, J = 8.2 Hz, 1H), 6.55 - 6.40 (m, 3H), 3.96 (t, J = 6.9 Hz, 2H), 3.70 - 3.62 (m, 2H), 3.28 (q, J = 6.3 Hz, 1H), 3.10 (q, J = 7.4 Hz, 22H), 2.32 (s, 3H), 2.23 (s, 6H), 1.39 (s, 4H). MS (ESI, m / z): C28H31N3O, [M+H]+ 426.254.

[0109] Example 24: TIFF0007893516000083.tif21170C24: 1H NMR (600 MHz, DMSO-d6) δ 9.04 (s, 1H), 8.00 (d, J = 2.2 Hz, 1H), 7.46 (d, J = 8.1 Hz, 1H), 7.34 (d, J = 2.2 Hz, 1H), 7.30 (d, J = 7.5 Hz, 1H), 7.24 (t, J = 7.8 Hz, 1H), 6.97 (d, J = 8.2 Hz, 1H), 6.39 (dd, J = 8.2, 2.6 Hz, 1H), 6.26 (d, J = 2.6 Hz, 1H), 3.88 (t, J = 7.1 Hz, 2H), 3.52 (t, J = 6.3 Hz, 2H), 2.88 (s, 1H), 2.17 (s, 6H), 2.02 (s, 3H), 1.23 (q, J = 2.5 Hz, 4H). 13C NMR (151 MHz, DMSO-d6) δ 170.05, 154.97, 149.94, 145.67, 137.98, 136.48, 131.20, 126.61, 124.13, 123.48, 122.29, 112.78, 110.52, 110.26, 106.70, 56.27, 41.83, 34.48, 18.55, 16.96, 15.04. MS (ESI, m / z):C24H27N3O2, [M+H]+390.217. Figure 3 shows the inhibition rate curve of compound C24.

[0110] Example 25: TIFF0007893516000084.tif22170C25: 11H NMR (600 MHz, DMSO-d6) δ 8.56 (s, 1H), 7.79 (d, J = 7.7 Hz, 1H), 7.19 (td, J = 7.2, 2.2 Hz, 1H), 7.15 - 7.09 (m, 2H), 6.91 (d, J = 8.2 Hz, 1H), 6.33 (dd, J = 8.2, 2.6 Hz, 1H), 6.26 (t, J = 4.6 Hz, 1H), 6.10 (d, J = 2.5 Hz, 1H), 3.81 (t, J = 7.0 Hz, 2H), 3.42 (t, J = 6.5 Hz, 2H), 3.17 (s, 1H), 2.65 (t, J = 8.0 Hz, 2H), 2.22 (td, J = 8.0, 4.6 Hz, 2H), 2.11 (s, 6H), 1.92 (s, 3H), 1.08 (q, J = 4.6 Hz, 2H), 0.95 (q, J = 4.7 Hz, 2H). 13C NMR (151 MHz, DMSO-d6) δ 169.96, 149.94, 138.36, 136.76, 136.45, 134.00, 131.02, 128.08, 127.76, 126.86, 126.37, 124.66, 123.36, 112.55, 110.51, 56.70, 56.29, 43.52, 41.92, 34.25, 27.87, 22.96, 19.04, 18.28, 13.49. MS (ESI, m / z):C26H31N3O, [M+H]+402.254..

[0111] Example 26: TIFF0007893516000085.tif25170C26: 1H NMR (400 MHz, DMSO) δ 9.13 (dt, J = 8.7, 1.7 Hz, 1H), 9.05 (s, 1H), 8.98 (dd, J = 4.2, 1.6 Hz, 1H), 7.85 (dd, J = 8.1, 5.1 Hz, 1H), 7.71 (dd, J = 8.7, 4.1 Hz, 1H), 7.54 (dd, J = 10.8, 8.0 Hz, 1H), 6.91 (d, J = 8.2 Hz, 1H), 6.34 (dd, J = 8.1, 2.6 Hz, 1H), 6.12 (d, J = 2.5 Hz, 1H), 3.81 (t, J = 7.0 Hz, 2H), 3.40 (dd, J = 7.4, 5.7 Hz, 2H), 3.11 (p, J = 6.1 Hz, 1H), 2.06 (s, 6H), 1.86 (s, 3H), 1.35 (q, J = 4.7 Hz, 2H), 1.27 - 1.16 (m, 2H). 19 F NMR (376 MHz, DMSO) δ -126.10. MS (ESI, m / z)C25H27F4O[M+H]+ 419.217 Figure 7 shows the inhibition rate curve of compound C26.

[0112] Example 27: TIFF0007893516000086.tif22170C27: 11H NMR (600 MHz, DMSO) δ 9.20 (d, J = 5.1 Hz, 1H), 8.88 (d, J = 4.4 Hz, 1H), 8.67 (d, J = 8.4 Hz, 1H), 8.05 (d, J = 8.4 Hz, 1H), 7.77 (ddd, J = 8.4, 6.8, 1.5 Hz, 1H), 7.70 (d, J = 4.4 Hz, 1H), 7.69 - 7.64 (m, 1H), 6.95 (d, J = 8.2 Hz, 1H), 6.39 (dd, J = 8.2, 2.6 Hz, 1H), 6.18 (d, J = 2.6 Hz, 1H), 3.91 (d, J = 7.0 Hz, 2H), 3.66 (s, 2H), 3.07 (dp, J = 7.7, 4.0 Hz, 1H), 2.42 (s, 6H), 1.88 (s, 3H), 1.42 - 1.32 (m, 2H), 1.28 - 1.23 (m, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.31, 150.66, 149.45, 148.73, 146.85, 137.83, 131.20, 130.11, 129.37, 127.44, 126.63, 125.90, 123.87, 123.01, 113.04, 110.63, 55.72, 55.39, 45.95, 40.96, 40.53, 33.94, 18.38, 14.07, 8.98. MS (ESI, m / z): C25H28N4O, [M+H]+ 401.234.<> <>

[0113] <> Example 28:[[ID=*7]]<> TIFF0007893516000087.tif22170C28:<> 11H NMR (600 MHz, DMSO) δ 9.20 (d, J = 7.8 Hz, 1H), 8.88 (d, J = 4.4 Hz, 1H), 8.66 (d, J = 8.4 Hz, 1H), 8.06 (d, J = 8.4 Hz, 1H), 7.80 - 7.74 (m, 1H), 7.74 - 7.64 (m, 2H), 6.98 (dd, J = 8.3, 2.1 Hz, 1H), 6.42 (dd, J = 7.9, 2.5 Hz, 1H), 6.20 (d, J = 2.5 Hz, 1H), 4.11 (s, 1H), 3.98 (t, J = 7.5 Hz, 2H), 3.89 - 3.78 (m, 2H), 2.69 (s, 6H), 1.90 (d, J = 2.5 Hz, 3H), 1.37 (q, J = 5.0 Hz, 2H), 1.26 (q, J = 5.1 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.24, 150.67, 149.08, 148.72, 146.83, 137.94, 131.25, 130.11, 129.40, 127.44, 126.67, 125.88, 123.06, 113.24, 110.78, 54.54, 33.94, 18.39, 14.11. MS (ESI, m / z): C25H28N4O, [M+H]+ 401.233.

[0114] Example 29: TIFF0007893516000088.tif26170C29: 1H NMR (600 MHz, DMSO) δ 9.16 (dd, J = 8.6, 1.6 Hz, 1H), 9.11 (d, J = 2.8 Hz, 1H), 9.05 (dd, J = 4.1, 1.6 Hz, 1H), 7.7 Hz (d (d, J = 7.7 Hz, 1H), 7.73 (dd, J = 8.6, 4.1 Hz, 1H), 6.96 (d, J = 8.2 Hz, 1H), 6.39 (dd, J = 8.2, 2.6 Hz, 1H), 6.3, J = 2.16 (d J = 7.2 Hz, 2H), 3.64 (s, 2H), 2.51 - 2.38 (m, 6H), 1.88 (s, 3H), 1.39 - 1.33 (m, 2H), 1.22 (q, J = 4.7 Hz, 2H). 13 C NMR (151 MHz, DMSO) δ 123.74, 122.43, 113.03, 110.52, 55.90, 55.48, 33.72, 18.36, 14.46, 9.09. MS (ESI, m / z):C25H27ClN4O, [M+H]+435.195.

[0115] Chapter 30: TIFF0007893516000089.tif27170C30: 11H NMR (600 MHz, DMSO) δ 9.11 (s, 1H), 8.80 (d, J = 4.3 Hz, 1H), 8.17 (d, J = 8.5 Hz, 1H), 7.71 (d, J = 4.3 Hz, 1H), 7.56 (t, J = 8.1 Hz, 1H), 7.18 (d, J = 7.7 Hz, 1H), 6.93 (d, J = 8.2 Hz, 1H), 6.36 (dd, J = 8.2, 2.5 Hz, 1H), 6.15 (d, J = 2.5 Hz, 1H), 3.96 (s, 3H), 3.84 (t, J = 7.2 Hz, 2H), 3.48 (s, 2H), 3.24 (s, 1H), 2.18 (s, 6H), 1.88 (s, 3H), 1.34 (t, J = 3.4 Hz, 2H), 1.22 (q, J = 5.0 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.34, 156.19, 149.86, 148.87, 146.49, 140.70, 137.77, 131.15, 128.58, 123.53, 123.43, 117.33, 112.86, 110.49, 108.25, 56.18, 56.11, 41.49, 34.24, 18.38, 14.11. MS (ESI, m / z): C26H30N4O2, [M+H]+ 431.244.

[0116] Example 31: TIFF0007893516000090.tif24170C31: 11H NMR (600 MHz, DMSO) δ 9.07 (s, 1H), 8.74 (d, J = 8.4 Hz, 1H), 8.08 (d, J = 8.2 Hz, 1H), 7.80 (dd, J = 8.0, 5.5 Hz, 1H), 7.72 - 7.62 (m, 2H), 7.29 (dd, J = 10.6, 7.9 Hz, 1H), 7.00 (d, J = 8.5 Hz, 1H), 6.90 (dd, J = 8.3, 2.6 Hz, 1H), 6.66 (d, J = 2.7 Hz, 1H), 3.82 - 3.76 (m, 1H), 3.46 - 3.41 (m, 1H), 3.22 (s, 1H), 2.82 (d, J = 11.2 Hz, 1H), 2.73 (s, 6H), 2.60 (t, J = 10.5 Hz, 1H), 2.06 (s, 1H), 1.93 (s, 3H), 1.83 - 1.77 (m, 1H), 1.55 (h, J = 6.9 Hz, 2H), 1.37 (q, J = , 2H), 1.18 (d, J = 5.4 Hz, 2H). 13 13C NMR (MHz, DMSO) δ 170.01, 158.54, 156.88, 148.56, 138.21, (d, J = 4.0 Hz), 133.52 (d, J = 4.6 Hz), 131.40, 129.12 (d, J = 8.3 Hz), 127.36, 126.69, 126.11, 125.85, 123.42 (d, J = 16.0 Hz), 120.85 (d, J = 5.3 Hz), 117.95, 115.71, 109.08, 108.96, 60.98, 49.72, 49.55, 34.14, 24.55, 23.25, 18.42, 14.59. MS (ESI, m / z): C28H32FN3O, [M+H]+ 446.260.

[0117] Example 32: TIFF0007893516000091.tif24170C32: 11H NMR (600 MHz, DMSO) δ 9.19 (s, 1H), 8.88 (d, J = 4.4 Hz, 1H), 8.68 (d, J = 8.4 Hz, 1H), 8.06 (d, J = 8.4 Hz, 1H), 7.77 (ddd, J = 8.4, 6.7, 1.4 Hz, 1H), 7.71 (d, J = 4.4 Hz, 1H), 7.66 (ddd, J = 8.3, 6.7, 1.3 Hz, 1H), 7.01 (d, J = 8.4 Hz, 1H), 6.92 (dd, J = 8.4, 2.6 Hz, 1H), 6.67 (d, J = 2.8 Hz, 1H), 3.75 (d, J = 11.8 Hz, 1H), 3.44 (d, J = 12.3 Hz, 1H), 3.24 (s, 1H), 2.83 (t, J = 11.0 Hz, 2H), 2.76 (s, 6H), 2.63 (t, J = 11.3 Hz, 2H), 2.07 - 2.03 (m, 1H), 1.92 (s, 3H), 1.81 (dd, J = 10.3, 6.0 Hz, 1H), 1.64 - 1.49 (m, 3H), 1.39 (q, J = 4.0 Hz, 2H), 1.26 (q, J = 4.3 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.26, 150.67, 148.74, 148.59, 146.84, 137.94, 131.44, 130.14, 129.37, 127.45, 126.64, 126.17, 125.87, 123.04, 118.09, 115.73, 61.08, 49.72, 49.55, 40.53, 33.99, 24.54, 23.17, 18.39, 14.09. MS (ESI, m / z): C27H32N4O, [M+H]+ 429.265.

[0118] Example 33: TIFF0007893516000092.tif24170C33: 11H NMR (600 MHz, DMSO) δ 9.17 (s, 1H), 8.88 (d, J = 4.3 Hz, 1H), 8.66 (dd, J = 8.5, 1.4 Hz, 1H), 8.06 (dd, J = 8.4, 1.2 Hz, 1H), 7.77 (ddd, J = 8.3, 6.7, 1.4 Hz, 1H), 7.70 (d, J = 4.3 Hz, 1H), 7.65 - 7.57 (m, 1H), 7.01 (d, J = 8.4 Hz, 1H), 6.95 (dd, J = 8.4, 2.7 Hz, 1H), 6.68 (d, J = 2.7 Hz, 1H), 3.70 - 3.65 (m, 4H), 3.10 (dd, J = 6.7, 3.7 Hz, 4H), 1.91 (s, 3H), 1.39 (t, J = 3.5 Hz, 2H), 1.27 (q, J = 4.4 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.1, 13 150.7, 13 148.7, 13 146.9, 13 145.7, 13 138.0, 13 131.7, 13 130.2, 13 129.4, 13 127.4, 13 126.7, 13 126.1, 13 125.8, 13 122.9, 13 117.4, 13 114.9, 13 50.2, 13 47.4, 13 34. 13 0, 13 18.3, 13 14.0. MS (ESI, m / z): C24H25N3O3S, [M+H]+436.169.

[0119] Example 34: TIFF0007893516000093.tif24170C34: 11H NMR (600 MHz, DMSO) δ 9.16 (d, J = 5.1 Hz, 1H), 8.87 (d, J = 4.4 Hz, 1H), 8.66 (d, J = 8.6 Hz, 1H), 8.05 (d, J = 8.4 Hz, 1H), 7.77 (ddd, J = 8.3, 6.8, 1.4 Hz, 1H), 7.70 (d, J = 4.4 Hz, 1H), 7.67 (ddd, J = 8.3, 6.9, 1.3 Hz, 1H), 6.86 (d, J = 8.3 Hz, 1H), 6.50 (d, J = 8.4 Hz, 1H), 6.28 (d, J = 2.7 Hz, 1H), 3.61 (d, J = 7.6 Hz, 1H), 3.47 (d, J = 11.7 Hz, 1H), 3.08 (s, 1H), 3.01 (s, 1H), 2.69 (d, J = 12.8 Hz, 1H), 2.00 (d, J = 4.5 Hz, 1H), 1.92 (s, 1H), 1.87 (s, 3H), 1.79 (s, 1H), 1.72 (s, 1H), 1.53 (s, 1H), 1.35 (s, 2H), 1.25 (s, 2H), 1.23 (dd, J = 7.2, 4.6 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.62, 150.65, 148.73, 146.87, 145.39, 138.20, 131.33, 130.10, 129.37, 127.46, 126.70, 125.88, 123.01, 122.20, 113.49, 111.69, 53.25, 47.69, 46.22, 45.71, 40.53, 33.85, 23.90, 22.62, 18.24, 17.81, 14.11. MS (ESI, m / z): C27H30N3O, [M+H]+ 427.249.

[0120] Example 35: TIFF0007893516000094.tif24170C35: 11H NMR (600 MHz, DMSO) δ 9.04 (s, 1H), 8.71 (d, J = 8.5 Hz, 1H), 8.10 - 8.06 (m, 1H), 7.79 (dd, J = 8.0, 5.6 Hz, 1H), 7.71 (ddd, J = 8.4, 6.8, 1.4 Hz, 1H), 7.65 (ddd, J = 8.1, 6.8, 1.1 Hz, 1H), 7.29 (dd, J = 10.7, 7.9 Hz, 1H), 7.00 (d, J = 8.4 Hz, 1H), 6.94 (dd, J = 8.4, 2.7 Hz, 1H), 6.66 (d, J = 2.7 Hz, 1H), 3.69 - 3.64 (m, 4H), 3.09 (dd, J = 6.7, 3.7 Hz, 4H), 1.92 (s, 3H), 1.36 (t, J = 3.0 Hz, 2H), 1.19 (q, J = 4.8 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 169.88, 158.54, 156.89, 145.70, 138.35, 134.48, 134.45, 133.50, 133.47, 131.69, 129.05 (d, J = 8.4 Hz), 127.40, 126.72, 126.10, 125.76, 123.44 (d, J = 16.3 Hz), 120.88 (d, J = 5.4 Hz), 117.26, 114.97, 109.01 (d, J = 19.3 Hz), 50.19, 47.39, 40.53, 34.20, 18.33, 14.51. MS (ESI, m / z): C₂₅H₂₅FN₂O₃S, [M+H]+ 453.164.

[0121] Example 36: TIFF0007893516000095.tif24170C₃₆: 11H NMR (600 MHz, DMSO) δ 9.16 (s, 1H), 8.87 (d, J = 4.3 Hz, 1H), 8.67 (d, J = 8.4 Hz, 1H), 8.05 (d, J = 8.4 Hz, 1H), 7.77 (dd, J = 8.5, 6.8 Hz, 1H), 7.71 - 7.63 (m, 2H), 6.93 (d, J = 8.1 Hz, 1H), 6.37 (dd, J = 8.2, 2.6 Hz, 1H), 6.16 (d, J = 2.5 Hz, 1H), 3.59 (q, J = 7.6 Hz, 4H), 3.16 (s, 3H), 2.69 (s, 1H), 1.88 (s, 3H), 1.44 (s, 3H), 1.37 (q, J = 5.1 Hz, 2H), 1.25 (q, J = 5.1 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.35, 150.62, 149.73, 148.70, 146.92, 137.63, 131.18, 130.09, 129.38, 127.44, 126.61, 125.89, 123.44, 122.95, 113.05, 110.65, 73.24, 62.57, 62.53, 53.83, 50.68, 33.98, 22.52, 18.47, 18.39, 17.18, 14.04. MS (ESI, m / z): C25H27N3O2, [M+H]+402.218.

[0122] Example 37: TIFF0007893516000096.tif24170C37: 11H NMR (600 MHz, DMSO) δ 9.15 (s, 1H), 8.87 (d, J = 4.4 Hz, 1H), 8.66 (dd, J = 8.5, 1.4 Hz, 1H), 8.05 (dd, J = 8.5, 1.3 Hz, 1H), 7.76 (ddd, J = 8.3, 6.7, 1.4 Hz, 1H), 7.70 (d, J = 4.4 Hz, 1H), 7.66 (ddd, J = 8.3, 6.7, 1.3 Hz, 1H), 6.85 (d, J = 8.3 Hz, 1H), 6.51 (dd, J = 8.2, 2.6 Hz, 1H), 6.32 (d, J = 2.6 Hz, 1H), 3.82 (qd, J = 10.9, 5.6 Hz, 2H), 3.31 - 3.27 (m, 1H), 3.16 (dd, J = 13.4, 7.5 Hz, 1H), 2.97 - 2.85 (m, 1H), 1.86 (s, 3H), 1.35 (t, J = 3.7 Hz, 2H), 1.24 (q, J = 5.4 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 173.08, 170.65, 150.59, 148.65, 147.02, 146.28, 138.00, 131.30, 130.02, 129.40, 127.46, 126.70, 125.88, 122.99, 122.12, 113.​​​​​​​1H NMR (600 MHz, DMSO) δ 9.14 (dt, J = 8.7, 1.5 Hz, 1H), 9.05 (s, 1H), 8.98 (dd, J = 4.1, 1.6 Hz, 1H), 7.85 (dd, J = 8.0, 5.0 Hz, 1H), 7.71 (dd, J = 8.6, 4.1 Hz, 1H), 7.54 (dd, J = 10.8, 8.0 Hz, 1H), 6.92 (d, J = 8.2 Hz, 1H), 6.36 (dd, J = 8.2, 2.6 Hz, 1H), 6.14 (d, J = 2.6 Hz, 1H), 3.58 (q, J = 7.7 Hz, 4H), 3.15 (s, 3H), 1.87 (s, 3H), 1.43 (s, 3H), 1.34 (t, J = 3.2 Hz, 2H), 1.20 (q, J = 4.8 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 173.08, 170.65, 150.59, 148.65, 147.02, 146.28, 138.00, 131.30, 130.02, 129.40, 127.46, 126.70, 125.88, 122.99, 122.12, 113.07, 111.37, 47.03. 13 13C NMR (151 MHz, DMSO) δ 170.16, 157.95, 156.26, 150.67, 149.77, 138.35, 138.27, 137.88, 134.92, 134.89, 134.05, 131.17, 129.20, 129.15, 128.83, 123.30, 122.50, 112.98, 112.93, 112.81, 110.52, 73.24, 62.57, 50.68, 40.53, 38.72, 33.63, 22.52, 18.35, 14.39. MS (ESI, m / z): C25H26FN3O2, [M+H]+ 420.208.

[0124] Example 39: TIFF0007893516000098.tif24170C39: 11H NMR (699 MHz, dmso) δ 9.11 (d, J = 8.6 Hz, 1H), 9.00 (s, 1H), 8.95 (d, J = 4.2 Hz, 1H), 7.82 (dd, J = 8.0, 4.8 Hz, 1H), 7.68 (dd, J = 8.6, 4.1 Hz, 1H), 7.52 (dd, J = 10.6, 7.9 Hz, 1H), 6.79 (d, J = 8.2 Hz, 1H), 6.40 (dd, J = 8.3, 2.5 Hz, 1H), 6.21 (d, J = 2.5 Hz, 1H), 3.21 (s, 1H), 3.03 (t, J = 11.5 Hz, 1H), 2.70 (s, 1H), 2.58 (s, 1H), 2.31 (d, J = 14.0 Hz, 1H), 1.88 (d, J = 2.9 Hz, 1H), 1.82 (s, 3H), 1.76 - 1.72 (m, 1H), 1.66 (s, 1H), 1.52 (s, 1H), 1.41 (s, 1H), 1.29 (s, 2H), 1.17 (dd, J = 12.5, 7.6 Hz, 4H). MS (ESI, m / z):C27H29FN4O, [M+H]+445.240.

[0125] Example 40: TIFF0007893516000099.tif24170C40: 11H NMR (600 MHz, DMSO) δ 9.17 (dt, J = 8.6, 1.6 Hz, 1H), 9.12 (s, 1H), 8.98 (dd, J = 4.1, 1.6 Hz, 1H), 7.85 (dd, J = 8.0, 5.0 Hz, 1H), 7.71 (dd, J = 8.7, 4.1 Hz, 1H), 7.54 (dd, J = 10.7, 8.0 Hz, 1H), 6.99 (d, J = 8.4 Hz, 1H), 6.89 (dd, J = 8.4, 2.7 Hz, 1H), 6.66 (d, J = 2.7 Hz, 1H), 3.79 (d, J = 11.8 Hz, 1H), 3.49 - 3.43 (m, 1H), 3.06 (s, 1H), 2.79 - 2.70 (m, 2H), 2.65 (s, 6H), 2.58 (ddd, J = 11.8, 8.6, 2.5 Hz, 2H), 2.06 - 2.02 (m, 1H), 1.91 (s, 3H), 1.79 (dt, J = 9.4, 3.3 Hz, 1H), 1.38 (q, J = 3.7 Hz, 2H), 1.20 (q, J = 4.3 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.07, 157.96, 156.27, 150.66, 148.68, 138.36, 138.28, 138.03, 134.93, 134.89, 134.07, 131.42, 129.23, 129.18, 128.85, 125.83, 122.52, 117.86, 115.49, 112.93, 112.81, 60.84, 50.10, 49.53, 33.66, 24.88, 23.40, 18.38, 14.41. MS (ESI, m / z): C27H31FN4O, [M+H]+ 447.248.

[0126] Example 41: TIFF0007893516000100.tif24170C41: 11H NMR (600 MHz, DMSO) δ 9.12 (dt, J = 8.7, 1.6 Hz, 1H), 9.07 (s, 1H), 8.98 (dd, J = 4.1, 1.6 Hz, 1H), 7.85 (dd, J = 8.0, 5.0 Hz, 1H), 7.73 (dd, J = 8.6, 4.1 Hz, 1H), 7.54 (dd, J = 10.7, 8.0 Hz, 1H), 7.01 (d, J = 8.4 Hz, 1H), 6.94 (dd, J = 8.4, 2.8 Hz, 1H), 6.67 (d, J = 2.8 Hz, 1H), 3.69 - 3.64 (m, 4H), 3.11 - 3.06 (m, 4H), 1.90 (s, 3H), 1.42 - 1.35 (m, 2H), 1.22 (q, J = 4.9 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 169.93, 157.97, 156.28, 150.71, 145.76, 138.37, 138.30, 134.88, 134.85, 133.96, 131.70, 129.17, 129.12, 128.82, 125.96, 122.53, 117.28, 114.86, 112.94, 112.81, 50.20, 47.39, 40.53, 33.71, 18.27, 14.38. MS (ESI, m / z):C24H24FN3O3S, [M+H]+454.153.

[0127] Example 42: TIFF0007893516000101.tif20170C42: 11H NMR (699 MHz, dmso) δ 9.17 (s, 1H), 8.86 (d, J = 4.3 Hz, 1H), 8.64 (d, J = 8.5 Hz, 1H), 8.04 (d, J = 8.4 Hz, 1H), 7.75 (t, J = 7.5 Hz, 1H), 7.68 (d, J = 4.4 Hz, 1H), 7.64 (t, J = 7.7 Hz, 1H), 7.02 (d, J = 8.2 Hz, 1H), 6.91 (d, J = 8.5 Hz, 1H), 6.64 (s, 1H), 3.72 (d, J = 13.0 Hz, 3H), 3.46 (d, J = 10.9 Hz, 4H), 3.08 (d, J = 11.7 Hz, 1H), 2.86 (d, J = 12.7 Hz, 1H), 1.90 (s, 3H), 1.35 (s, 2H), 1.26 (d, J = 6.6 Hz, 6H), 1.25 - 1.24 (m, 2H). MS (ESI, m / z):C27H32N4O, [M+H]+429.265.

[0128] Example 43: TIFF0007893516000102.tif20170C43: 11H NMR (699 MHz, dmso) δ 9.14 (s, 1H), 8.85 (d, J = 4.3 Hz, 1H), 8.64 (d, J = 8.4 Hz, 1H), 8.03 (d, J = 8.4 Hz, 1H), 7.75 (t, J = 7.7 Hz, 1H), 7.67 (d, J = 4.4 Hz, 1H), 7.63 (t, J = 7.6 Hz, 1H), 6.93 (d, J = 8.3 Hz, 1H), 6.82 - 6.80 (m, 1H), 6.57 (s, 1H), 2.94 (s, 3H), 2.60 (s, 3H), 1.87 (s, 3H), 1.61 (s, 1H), 1.35 (q, J = 5.0 Hz, 3H), 1.23 (s, 3H), 0.41 (s, 2H), 0.31 (s, 2H). MS (ESI, m / z):C27H30N4O, [M+H]+427.249.

[0129] Example 44: TIFF0007893516000103.tif24170C44: 11H NMR (699 MHz, dmso) δ 9.78 (s, 1H), 9.11 (d, J = 8.7 Hz, 1H), 9.08 (s, 1H), 8.96 (d, J = 4.1 Hz, 1H), 7.83 (dd, J = 7.9, 4.8 Hz, 1H), 7.69 (dd, J = 8.6, 4.1 Hz, 1H), 7.53 (dd, J = 10.6, 7.9 Hz, 1H), 7.01 (d, J = 8.4 Hz, 1H), 6.90 (dd, J = 8.3, 2.7 Hz, 1H), 6.63 (d, J = 2.8 Hz, 1H), 3.71 (d, J = 12.9 Hz, 2H), 3.49 (d, J = 9.8 Hz, 1H), 3.44 (d, J = 12.0 Hz, 2H), 3.05 (t, J = 10.9 Hz, 2H), 2.92 (t, J = 12.5 Hz, 2H), 1.88 (s, 3H), 1.33 (d, J = 5.0 Hz, 2H), 1.27 (d, J = 6.6 Hz, 6H), 1.19 (s, 2H). MS (ESI, m / z):C27H31FN4O, [M+H]+447.256.

[0130] Example 45: TIFF0007893516000104.tif24170C45: 11H NMR (699 MHz, dmso) δ 9.11 (d, J = 8.6 Hz, 1H), 9.03 (s, 1H), 8.95 (d, J = 4.0 Hz, 1H), 7.82 (dd, J = 7.8, 4.7 Hz, 1H), 7.68 (dd, J = 8.6, 4.1 Hz, 1H), 7.52 (dd, J = 10.8, 8.1 Hz, 1H), 6.93 (d, J = 8.3 Hz, 1H), 6.80 (dd, J = 8.3, 2.6 Hz, 1H), 6.56 (d, J = 2.8 Hz, 1H), 2.95 (d, J = 5.0 Hz, 4H), 2.60 (d, J = 5.0 Hz, 4H), 1.85 (s, 3H), 1.60 (s, 1H), 1.33 (s, 2H), 1.18 (d, J = 5.1 Hz, 2H), 0.41 (d, J = 6.5 Hz, 2H), 0.30 (s, 2H). MS (ESI, m / z):C27H29FN4O, [M+H]+445.239.

[0131] Example 46: TIFF0007893516000105.tif20170C46: 1 1H NMR (699 MHz, dmso) δ 9.07 (d, J = 8.5 Hz, 1H), 9.05 (s, 1H), 8.90 (d, J = 4.0 Hz, 1H), 7.92 (d, J = 8.4 Hz, 1H), 7.85 (d, J = 7.1 Hz, 1H), 7.69 (t, J = 7.7 Hz, 1H), 7.57 (dd, J = 8.6, 4.1 Hz, 1H), 6.94 (d, J = 8.3 Hz, 1H), 6.81 (s, 1H), 6.56 (s, 1H), 2.94 (s, 3H), 2.60 (s, 2H), 1.87 (s, 4H), 1.60 (s, 1H), 1.34 (s, 3H), 1.18 (s, 3H), 0.41 (s, 2H), 0.30 (s, 2H). MS (ESI, m / z):C27H30N4O, [M+H]+427.249.

[0132] Example 47: TIFF0007893516000106.tif24170C47: 1 H NMR (699 MHz, dmso) δ 8.98 - 8.93 (m, 1H), 7.82 (h, J = 8.1 Hz, 2H), 7.75 - 7.70 (m, 1H), 7.44 (dq, J = 17.2, 8.1 Hz, 2H), 7.37 (q, J = 8.4 Hz, 1H), 7.01 (q, J = 8.1 Hz, 1H), 6.47 - 6.42 (m, 1H), 6.42 - 6.37 (m, 1H), 3.90 (t, J = 8.5 Hz, 2H), 3.54 (s, 1H), 2.46 (s, 4H), 2.21 - 1.97 (m, 9H), 1.36 - 1.31 (m, 2H), 1.30 - 1.25 (m, 2H). MS (ESI, m / z):C26H29N3O, [M+H]+400.238.

[0133] Example 48: TIFF0007893516000107.tif24170C48: 11H NMR (600 MHz, DMSO) δ 9.08 (d, J = 4.9 Hz, 1H), 8.72 (d, J = 8.5 Hz, 1H), 8.09 (d, J = 8.2 Hz, 1H), 7.80 (dd, J = 7.9, 5.5 Hz, 1H), 7.72 - 7.62 (m, 2H), 7.30 (dd, J = 10.6, 7.9 Hz, 1H), 7.03 (d, J = 8.4 Hz, 1H), 6.92 (dd, J = 8.6, 2.9 Hz, 1H), 6.66 (d, J = 2.7 Hz, 1H), 3.72 (s, 2H), 3.48 (s, 2H), 3.46 (s, 1H), 3.09 (q, J = 10.6 Hz, 2H), 2.99 (s, 1H), 2.92 (t, J = 12.4 Hz, 1H), 1.93 (s, 3H), 1.36 (s, 2H), 1.29 (d, J = 6.6 Hz, 6H), 1.21 - 1.16 (m, 2H). MS (ESI, m / z):C28H32FN3O, [M+H]+446.260.

[0134] Example 49: TIFF0007893516000108.tif24170C49: 11H NMR (699 MHz, dmso) δ 9.00 (d, J = 3.9 Hz, 1H), 8.71 - 8.67 (m, 1H), 8.04 (dd, J = 8.5, 3.7 Hz, 1H), 7.76 (d, J = 8.1 Hz, 1H), 7.65 (d, J = 8.5 Hz, 1H), 7.62 (d, J = 8.0 Hz, 1H), 7.26 (d, J = 10.1 Hz, 1H), 6.93 - 6.89 (m, 1H), 6.78 (d, J = 8.3 Hz, 1H), 6.54 (s, 1H), 2.93 (d, J = 6.3 Hz, 4H), 2.58 (d, J = 5.5 Hz, 4H), 1.87 (d, J = 3.8 Hz, 3H), 1.59 (s, 1H), 1.32 (s, 2H), 1.14 (s, 2H), 0.40 (t, J = 5.3 Hz, 2H), 0.29 (s, 2H). MS (ESI, m / z):C28H30FN3O, [M+H]+444.244 [[ID=​​​​​​​​​​​TIFF0007893516000110.tif24170C51: 1 1H NMR (600 MHz, DMSO) δ 9.13 (dt, J = 8.7, 1.6 Hz, 1H), 9.03 (s, 1H), 8.98 (dd, J = 4.1, 1.6 Hz, 1H), 7.85 (dd, J = 8.0, 5.0 Hz, 1H), 7.71 (dd, J = 8.6, 4.1 Hz, 1H), 7.54 (dd, J = 10.7, 8.0 Hz, 1H), 6.83 (d, J = 8.2 Hz, 1H), 6.48 (dd, J = 8.2, 2.5 Hz, 1H), 6.26 (d, J = 2.5 Hz, 1H), 5.45 (s, 1H), 3.24 (s, 1H), 3.06 (s, 2H), 2.58 (s, 1H), 2.49 (s, 3H), 1.89 (d, J = 12.4 Hz, 2H), 1.85 (s, 3H), 1.47 (s, 1H), 1.32 (q, J = 4.6 Hz, 2H), 1.19 (q, J = 4.8 Hz, 2H). MS (ESI, m / z): C26H29FN4O, [M+H]+433.232.

[0137] Example 52: TIFF0007893516000111.tif24170C52: 11H NMR (600 MHz, DMSO) δ 9.16 (d, J = 8.6 Hz, 1H), 9.07 (s, 1H), 8.98 (t, J = 6.4 Hz, 1H), 7.84 (dd, J = 8.2, 4.7 Hz, 1H), 7.70 (td, J = 8.4, 4.2 Hz, 1H), 7.57 - 7.51 (m, 1H), 7.06 (d, J = 8.2 Hz, 1H), 6.94 (d, J = 8.4 Hz, 1H), 6.79 - 6.74 (m, 1H), 6.46 (d, J = 17.9 Hz, 1H), 3.78 (d, J = 12.4 Hz, 1H), 3.25 (d, J = 12.8 Hz, 2H), 2.87 (t, J = 12.5 Hz, 2H), 2.61 (s, 3H), 1.88 (s, 5H), 1.62 (d, J = 13.1 Hz, 2H), 1.36 (s, 2H), 1.20 (d, J = 6.1 Hz, 2H). MS (ESI, m / z): C26H29FN4O, [M+H]+433.232.

[0138] Example 53: TIFF0007893516000112.tif24170C53: 1 1H NMR (600 MHz, DMSO) δ 9.16 (s, 1H), 9.08 (s, 1H), 8.99 (dt, J = 4.2, 2.3 Hz, 1H), 7.86 (ddd, J = 8.3, 4.8, 2.1 Hz, 1H), 7.74 (dq, J = 7.6, 4.1 Hz, 1H), 7.60 - 7.52 (m, 2H), 6.93 - 6.86 (m, 2H), 6.52 (s, 1H), 6.30 (s, 1H), 1.87 (s, 3H), 1.34 (t, J = 2.9 Hz, 3H), 1.20 (dd, J = 6.9, 4.8 Hz, 3H). MS (ESI, m / z):C24H25FN4O, [M+H]+405.208.

[0139] Example 54: TIFF0007893516000113.tif24170C54: 1 1H NMR (600 MHz, DMSO) δ 9.03 (singlet, 1H), 8.76 - 8.70 (multiplet, 1H), 8.07 (doublet, J = 8.2 Hz, 1H), 7.78 (triplet, J = 6.7 Hz, 1H), 7.69 - 7.61 (multiplet, 1H), 7.33 - 7.22 (multiplet, 1H), 7.06 (singlet, 1H), 6.92 (doublet, J = 8.5 Hz, 1H), 6.77 - 6.73 (multiplet, 1H), 6.44 (doublet, J = 2.9 Hz, 1H), 3.02 (singlet, 3H), 2.73 - 2.65 (multiplet, 3H), 2.14 (doublet, J = 9.4 Hz, 2H), 2.09 - 1.99 (multiplet, 2H), 1.90 (singlet, 3H), 1.35 (singlet, 2H), 1.17 (singlet, 2H). MS (ESI, m / z): C28H32FN3O, [M+H]+446.767.

[0140] Example 55: TIFF0007893516000114.tif24170C55: 11H NMR (600 MHz, DMSO) δ 8.98 (s, 1H), 8.72 (d, J = 8.3 Hz, 1H), 8.07 (d, J = 8.1 Hz, 1H), 7.79 (dd, J = 7.9, 5.6 Hz, 1H), 7.70 - 7.66 (m, 1H), 7.64 (t, J = 7.5 Hz, 1H), 7.28 (dd, J = 10.6, 7.9 Hz, 1H), 6.80 (d, J = 8.3 Hz, 1H), 6.45 (dd, J = 8.3, 2.5 Hz, 1H), 6.24 (d, J = 2.5 Hz, 1H), 5.33 (d, J = 8.2 Hz, 1H), 2.98 - 2.92 (m, 2H), 2.54 (d, J = 11.8 Hz, 2H), 1.86 (s, 3H), 1.78 (dd, J = 13.1, 3.5 Hz, 2H), 1.32 (s, 2H), 1.15 (d, J = 5.5 Hz, 2H), 0.89 - 0.80 (m, 2H). MS (ESI, m / z): C26H28FN3O, [M+H]+418.222. TIFF0007893516000115.tif24170

[0141] Example 56: C56: 11H NMR (600 MHz, DMSO) δ 9.13 (dd, J = 8.7, 1.6 Hz, 1H), 9.01 (s, 1H), 8.98 (dd, J = 4.1, 1.7 Hz, 1H), 7.84 (dd, J = 8.1, 4.9 Hz, 1H), 7.70 (dd, J = 8.7, 4.1 Hz, 1H), 7.53 (dd, J = 10.7, 8.0 Hz, 1H), 6.80 (d, J = 8.2 Hz, 1H), 6.44 (dd, J = 8.3, 2.5 Hz, 1H), 6.23 (s, 1H), 5.28 (d, J = 8.2 Hz, 1H), 3.08 (d, J = 9.4 Hz, 1H), 2.88 (dt, J = 12.5, 3.7 Hz, 2H), 2.46 - 2.40 (m, 2H), 1.84 (s, 3H), 1.74 (dd, J = 13.0, 3.6 Hz, 2H), .32 (q, J = 4.5 Hz, 2H), 1.19 (d, J = 5.4 Hz, 2H), 1.11 (dd, J = 10.6, 3.2 Hz, 2H). MS (ESI, m / z): C25H27FN4O, [M+H]+419.217.

[0142] Example 57: TIFF00078935160001.tif21170C57: 11H NMR (400 MHz, Methanol-d4) δ 7.78 (dd, J = 7.9, 1.2 Hz, 1H), 7.62 (dd, J = 7.3, 1.1 Hz, 1H), 7.60 (d, J = 5.5 Hz, 1H), 7.44 (d, J = 5.5 Hz, 1H), 7.36 (t, J = 7.6 Hz, 1H), 6.99 (d, J = 8.2 Hz, 1H), 6.46 (dd, J = 8.2, 2.6 Hz, 1H), 6.41 (d, J = 2.5 Hz, 1H), 3.95 (dd, J = 7.7, 6.7 Hz, 2H), 3.59 (dd, J = 7.6, 5.8 Hz, 2H), 3.29 (q, J = 6.2 Hz, 1H), 2.25 (s, 6H), 2.07 (s, 3H), 1.36 (q, J = 2.4 Hz, 4H). 13 13C NMR (101 MHz, Methanol-d4) δ 172.81, 149.54, 140.40, 139.14, 136.76, 135.41, 130.73, 125.79, 124.48, 124.11, 123.89, 123.77, 122.42, 112.83, 110.33, 56.23, 55.94, 40.54, 35.28, 16.99, 13.67. MS (ESI, m / z): C24H27N3OS, [M+H]+ 406.1948.

[0143] Example 58: TIFF0007893516000117.tif25170C58: 11H NMR (400 MHz, DMSO-d6) δ 9.17 (dd, J = 8.6, 1.6 Hz, 1H), 9.08 (s, 1H), 9.04 (dd, J = 4.2, 1.6 Hz, 1H), 7.93 (d, J = 8.0 Hz, 1H), 7.77 (dd, J = 7.9, 1.4 Hz, 1H), 7.74 (dd, J = 8.6, 4.2 Hz, 1H), 6.92 (d, J = 8.2 Hz, 1H), 6.35 (dd, J = 8.2, 2.5 Hz, 1H), 6.13 (d, J = 2.5 Hz, 1H), 3.81 (t, J = 7.0 Hz, 2H), 3.41 (dd, J = 7.4, 5.6 Hz, 2H), 3.11 (p, J = 6.1 Hz, 1H), 2.07 (s, 6H), 1.86 (s, 3H), 1.37 (q, J = 4.9, 4.3 Hz, 2H), 1.25 (t, J = 3.4 Hz, 2H). 13 13C NMR (101 MHz, DMSO-d6) δ 170.31, 151.39, 150.05, 143.87, 141.28, 138.62, 137.80, 134.24, 131.15, 128.85, 128.73, 123.08, 122.60, 120.88, 119.66, 112.77, 110.26, 56.73, 56.30, 41.97, 33.76, 18.29, 14.39. MS (ESI, m / z):C26H27F3N4O2, [M+H]+485.2159.

[0144] Example 59: TIFF0007893516000118.tif25170C59: 11H NMR (400 MHz, DMSO-d6) δ 9.14 (dt, J = 8.7, 1.6 Hz, 1H), 9.11 (s, 1H), 8.97 (dd, J = 4.2, 1.6 Hz, 1H), 7.85 (dd, J = 8.1, 5.1 Hz, 1H), 7.70 (dd, J = 8.7, 4.1 Hz, 1H), 7.53 (dd, J = 10.8, 8.0 Hz, 1H), 6.93 (d, J = 8.2 Hz, 1H), 6.37 (dd, J = 8.2, 2.5 Hz, 1H), 6.15 (d, J = 2.5 Hz, 1H), 4.39 (p, J = 6.3 Hz, 1H), 4.07 (dd, J = 7.5, 5.8 Hz, 2H), 3.80 (t, J = 7.3 Hz, 2H), 2.87 (s, 6H), 1.86 (s, 3H), 1.35 (q, J = 4.8, 4.4 Hz, 2H), 1.19 (q, J = 4.9 Hz, 2H). 13 13C NMR (101 MHz, DMSO-d6) δ 170.22, 150.64, 150.02, 137.98, 134.95, 134.05, 131.02, 128.84, 123.31, 122.48, 112.93, 112.76, 110.47, 64.45, 56.78, 55.36, 52.36, 33.61, 18.24, 14.40. MS (ESI, m / z):C25H27FN4O2, [M+H]+435.2191.

[0145] Example 60: TIFF0007893516000119.tif25170C60: 11H NMR (400 MHz, Methanol-d4) δ 8.78 (dd, J = 9.9, 1.7 Hz, 1H), 7.62 (dd, J = 8.4, 5.0 Hz, 1H), 7.34 (dd, J = 10.7, 8.4 Hz, 1H), 6.99 (d, J = 8.3 Hz, 1H), 6.75 (d, J = 9.9 Hz, 1H), 6.45 (dd, J = 8.3, 2.6 Hz, 1H), 6.26 (d, J = 2.5 Hz, 1H), 3.94 (t, J = 7.1 Hz, 2H), 3.56 (dd, J = 7.5, 5.7 Hz, 2H), 3.26 (p, J = 6.3 Hz, 1H), 2.22 (s, 6H), 2.03 (s, 3H), 1.45 - 1.39 (m, 2H), 1.29 (t, J = 3.5 Hz, 2H). MS (ESI, m / z):C25H27FN4O2, [M+H]+435.2191.

[0146] Example 61: TIFF0007893516000120.tif2617061: 1 1H NMR (400 MHz, DMSO-d6) δ 9.29 (s, 1H), 9.07 (d, J = 8.5 Hz, 1H), 8.37 (d, J = 7.1 Hz, 1H), 8.20 (s, 1H), 8.05 - 7.94 (m, 1H), 6.94 (d, J = 8.3 Hz, 1H), 6.37 (dd, J = 8.1, 2.5 Hz, 1H), 6.14 (d, J = 2.5 Hz, 1H), 3.82 (t, J = 7.1 Hz, 2H), 3.43 (t, J = 6.5 Hz, 2H), 3.18 (d, J = 5.2 Hz, 1H), 2.11 (s, 6H), 1.89 (s, 3H), 1.44 (q, J = 2.3 Hz, 2H), 1.24 (q, J = 3.7, 3.1 Hz, 2H). MS (ESI, m / z):C27H26F6N4O, [M+H]+537.2084.

[0147] Example 62: TIFF0007893516000121.tif24170C62: 1 H NMR (400 MHz, DMSO-d6) δ 9.37 (dd, J = 8.9, 1.6 Hz, 1H), 9.10 (s, 1H), 8.04 - 7.91 (m, 2H), 7.68 (dd, J = 10.7, 8.0 Hz, 1H), 7.18 (t, J = 54.6 Hz, 1H), 6.96 (d, J = 8.2 Hz, 1H), 6.39 (dd, J = 8.2, 2.5 Hz, 1H), 6.16 (d, J = 2.5 Hz, 1H), 3.92 (t, J = 7.3 Hz, 2H), 3.66 (d, J = 7.0 Hz, 2H), 3.44 (dt, J = 9.3, 4.6 Hz, 1H), 2.49 (s, 6H), 1.88 (s, 3H), 1.37 (q, J = 4.9, 4.3 Hz, 2H), 1.25 (t, J = 3.3 Hz, 2H). 13 C NMR (101 MHz, DMSO-d6) δ 170.14, 155.74, 149.39, 137.99, 137.24, 136.61, 135.13, 131.22, 130.99, 129.27, 123.83, 118.17, 114.49, 114.20, 114.02, 113.05, 110.53, 56.49, 55.96, 55.37, 49.06, 41.02, 33.60, 19.02, 18.31, 14.43. MS (ESI, m / z):C26H27F3N4O, [M+H]+469.2210.

[0148] Example 63: TIFF0007893516000122.tif26170C63: 11H NMR (400 MHz, DMSO-d6) δ 9.15 (dt, J = 8.7, 1.6 Hz, 1H), 9.04 (s, 1H), 8.98 (dd, J = 4.2, 1.5 Hz, 1H), 7.85 (dd, J = 8.1, 5.1 Hz, 1H), 7.70 (dd, J = 8.7, 4.1 Hz, 1H), 7.54 (dd, J = 10.8, 8.0 Hz, 1H), 6.94 (d, J = 8.4 Hz, 1H), 6.82 (dd, J = 8.4, 2.7 Hz, 1H), 6.58 (d, J = 2.6 Hz, 1H), 4.64 (d, J = 4.2 Hz, 1H), 3.58 (dq, J = 9.0, 4.5 Hz, 1H), 3.48 - 3.34 (m, 2H), 2.72 (ddd, J = 12.9, 10.1, 3.0 Hz, 2H), 1.88 (s, 3H), 1.76 (dd, J = 13.1, 4.1 Hz, 2H), 1.46 - 1.38 (m, 2H), 1.36 (q, J = 4.7 Hz, 2H), 1.20 (q, J = 4.9 Hz, 2H). 13 [[ID=​​​​​​​1H NMR (400 MHz, DMSO-d6) δ 9.15 - 8.84 (m, 2H), 7.66 (dd, J = 8.1, 5.0 Hz, 1H), 7.46 (dd, J = 10.9, 8.1 Hz, 1H), 7.18 (d, J = 9.1 Hz, 1H), 6.92 (d, J = 8.2 Hz, 1H), 6.34 (dd, J = 8.1, 2.6 Hz, 1H), 6.12 (d, J = 2.6 Hz, 1H), 4.01 (s, 3H), 3.81 (t, J = 7.0 Hz, 2H), 3.41 (dd, J = 7.4, 5.6 Hz, 2H), 3.11 (p, J = 6.2 Hz, 1H), 2.06 (s, 6H), 1.88 (s, 3H), 1.32 (q, J = 4.8, 4.4 Hz, 2H), 1.22 - 1.07 (m, 2H). 13 13C NMR (101 MHz, DMSO-d6) δ 170.11, 162.14, 157.09, 154.60, 150.06, 137.98, 137.52, 136.14, 136.02, 134.93, 134.88, 131.13, 126.82, 126.74, 125.86, 125.83, 123.08, 113.89, 113.67, 113.49, 112.71, 110.25, 56.77, 56.30, 53.80, 41.98, 33.73, 18.33, 14.45. MS (ESI, m / z):C26H29FN4O2, [M+H]+449.2347.

[0150] Example 65: TIFF0007893516000124.tif24170C65: 11H NMR (400 MHz, DMSO-d6) δ 9.14 (dt, J = 8.7, 1.7 Hz, 1H), 9.06 (s, 1H), 8.97 (dd, J = 4.1, 1.5 Hz, 1H), 7.85 (dd, J = 8.0, 5.1 Hz, 1H), 7.71 (dd, J = 8.7, 4.1 Hz, 1H), 7.54 (dd, J = 10.8, 8.0 Hz, 1H), 6.89 (d, J = 8.2 Hz, 1H), 6.31 (dd, J = 8.2, 2.5 Hz, 1H), 6.08 (d, J = 2.5 Hz, 1H), 4.34 (s, 1H), 3.66 (t, J = 7.6 Hz, 2H), 3.55 (t, J = 6.9 Hz, 2H), 2.72 - 2.60 (m, 1H), 1.85 (s, 3H), 1.35 (q, J = 4.7, 4.3 Hz, 2H), 1.20 (t, J = 3.2 Hz, 2H), 1.03 (s, 6H). 13 13C NMR (101 MHz, DMSO-d6) δ 170.31, 158.36, 155.83, 150.64, 150.35, 138.37, 138.26, 137.88, 134.96, 134.91, 134.07, 131.01, 129.20, 129.13, 128.84, 128.82, 122.47, 112.95, 112.77, 112.44, 109.96, 68.17, 53.03, 33.61, 27.11, 26.81, 18.31, 14.39. MS (ESI, m / z): C26H28FN3O2, [M+H]+ 434.2238.

[0151] Example 66: TIFF0007893516000125.tif26170C66: 11H NMR (400 MHz, DMSO-d6) δ 9.19 (d, J = 8.7 Hz, 1H), 9.06 (s, 1H), 9.00 (dd, J = 4.2, 1.5 Hz, 1H), 8.45 (d, J = 4.7 Hz, 3H), 7.86 (dd, J = 8.0, 5.0 Hz, 1H), 7.74 (dd, J = 8.6, 4.2 Hz, 1H), 7.56 (dd, J = 10.8, 8.0 Hz, 1H), 6.91 (d, J = 8.3 Hz, 1H), 6.49 (dd, J = 8.4, 2.6 Hz, 1H), 6.26 (d, J = 2.6 Hz, 1H), 3.48 (d, J = 9.5 Hz, 2H), 3.08 (d, J = 9.1 Hz, 2H), 2.39 - 2.31 (m, 1H), 2.09 (d, J = 2.8 Hz, 2H), 1.87 (s, 3H), 1.40 (s, 3H), 1.36 (q, J = 5.0 Hz, 2H),​​​​​​​​​1H NMR (400 MHz, DMSO) δ 9.16 (s, 1H), 8.93 (d, J = 4.4 Hz, 1H), 8.47 (d, J = 8.3 Hz, 1H), 7.79 (d, J = 4.4 Hz, 1H), 7.70 - 7.52 (m, 2H), 6.92 (d, J = 8.2 Hz, 1H), 6.35 (dd, J = 8.2, 2.5 Hz, 1H), 6.14 (d, J = 2.5 Hz, 1H), 3.81 (t, J = 7.0 Hz, 2H), 3.42 (t, J = 6.4 Hz, 2H), 3.13 (t, J = 6.4 Hz, 1H), 2.08 (s, 6H), 1.86 (s, 3H), 1.42 - 1.33 (m, 2H), 1.27 (q, J = 5.7, 5.1 Hz, 2H). 13C NMR (101 MHz, DMSO) δ 170.45, 159.56, 157.03, 150.87, 150.01, 147.02 (d, J = 2.7 Hz), 138.76 (d, J = 11.3 Hz), 137.61, 131.16, 129.27, 126.53 (d, J = 8.4 Hz), 123.61 (d, J = 81.9 Hz), 121.89 (d, J = 4.8 Hz), 113.50 (d, J = 18.4 Hz), 112.82, 110.37, 56.68, 56.29, 41.94, 34.16, 18.31, 14.09. MS (ESI, m / z):C25H27FN4O, [M+H]+419.217.

[0153] Example 68: TIFF0007893516000127.tif29170C68: 11H NMR (400 MHz, DMSO) δ 9.03 (s, 1H), 8.72 (d, J = 8.2 Hz, 1H), 8.16 - 8.06 (m, 1H), 7.81 (d, J = 7.9 Hz, 1H), 7.72 - 7.60 (m, 2H), 7.50 (d, J = 74.0 Hz, 1H), 7.26 (d, J = 7.8 Hz, 1H), 6.91 (d, J = 8.2 Hz, 1H), 6.34 (dd, J = 8.1, 2.5 Hz, 1H), 6.11 (d, J = 2.5 Hz, 1H), 3.80 (t, J = 7.0 Hz, 2H), 3.40 (t, J = 6.5 Hz, 2H), 3.11 (p, J = 6.2 Hz, 1H), 2.06 (s, 6H), 1.90 (s, 3H), 1.35 (t, J = 3.6 Hz, 2H), 1.17 (d, J = 5.1 Hz, 2H). 13C NMR (101 MHz, DMSO) δ 170.17, 150.01, 146.57 (d, J = 3.0 Hz), 137.99, 135.39, 133.33, 131.12, 128.75, 127.19, 126.71, 126.18, 125.88, 123.22, 121.98, 119.88, 117.32, 112.69, 110.44, 56.72, 56.30, 41.96, 34.18, 18.42, 14.58. MS (ESI, m / z):C27H29F2N3O2, [M+H]+466.223.

[0154] Example 69: TIFF0007893516000128.tif29170C69: 11H NMR (400 MHz, DMSO) δ 9.15 (dd, J = 8.6, 1.7 Hz, 1H), 9.06 (s, 1H), 8.99 (dd, J = 4.2, 1.6 Hz, 1H), 7.87 (d, J = 8.0 Hz, 1H), 7.71 (dd, J = 8.6, 4.1 Hz, 1H), 7.59 (d, J = 42.5 Hz, 1H), 7.52 - 7.25 (m, 1H), 6.92 (d, J = 8.2 Hz, 1H), 6.35 (dd, J = 8.2, 2.6 Hz, 1H), 6.12 (d, J = 2.5 Hz, 1H), 3.81 (t, J = 7.0 Hz, 2H), 3.41 (dd, J = 7.4, 5.6 Hz, 2H), 3.11 (p, J = 6.1 Hz, 1H), 2.07 (s, 6H), 1.88 (s, 3H), 1.36 (q, J = 4.7, 4.2 Hz, 2H), 1.20 (q, J = 4.9 Hz, 2H). 13C NMR (101 MHz, DMSO) δ 170.41, 151.48, 150.13, 146.72, 138.29, 138.12, 136.74, 134.41, 131.16, 129.40, 128.82, 123.26, 122.33, 118.90, 117.33, 113.82, 111.35, 60.08, 55.79, 42.69, 33.69, 17.61, 13.10. MS (ESI, m / z):C26H28F2N4O2, [M+H]+467.218.

[0155] Example 70: TIFF0007893516000129.tif29170C70: 11H NMR (400 MHz, DMSO) δ 9.15 (s, 1H), 8.86 - 8.76 (m, 1H), 8.20 - 8.09 (m, 2H), 7.94 (d, J = 7.5 Hz, 1H), 7.86 - 7.72 (m, 2H), 6.91 (d, J = 8.2 Hz, 1H), 6.34 (dd, J = 8.2, 2.5 Hz, 1H), 6.12 (d, J = 2.6 Hz, 1H), 3.80 (t, J = 7.0 Hz, 2H), 3.40 (dd, J = 7.4, 5.7 Hz, 2H), 3.11 (p, J = 6.2 Hz, 1H), 2.07 (s, 6H), 1.86 (s, 3H), 1.40 (q, J = 4.7, 4.2 Hz, 2H), 1.25 (q, J = 4.8 Hz, 2H). 13C NMR (101 MHz, DMSO) δ 170.39, 150.01, 144.24, 137.72, 133.05, 132.46, 131.92, ...... 110.38, 108.84, 56.70, 56.29, 41.95, 34.66, 18.34, 14.56. MS (ESI, m / z):C27H28N4O, [M+H]+425.226

[0156] Example 71 TIFF0007893516000130.tif22170C71: 1H NMR (400 MHz, DMSO-d6) δ 8.86 (s, 1H), 8.20 (s, 1H), 7.38 (t, J = 7.9 Hz, 2H), 7.32 (t, J = 8.2 Hz, 1H), 7.12 (t, J = 7.4 Hz, 1H), 7.01 (t, J = 7.3 Hz, 3H), 6.97 - 6.91 (m, 2H), 6.85 - 6.79 (m, 1H), 6.42 (dd, J = 8.2, 2.3 Hz, 1H), 6.35 (d, J = 2.2 Hz, 1H), 3.96 - 3.89 (m, 2H), 3.63 - 3.57 (m, 2H), 3.18 - 3.10 (m, 1H), 2.32 (s, 6H), 2.12 (s, 3H). MS (ESI, m / z):C28H31N3O2, [M+H]+442.242.

[0157] Example 72 TIFF0007893516000131.tif27170C72: 1 H NMR (400 MHz, DMSO-d6) δ 8.96 (s, 1H), 8.13 - 8.06 (m, 2H), 7.57 (d, J = 8.2 Hz, 1H), 7.55 - 7.41 (m, 3H), 7.22 - 7.16 (m, 1H), 7.05 - 6.99 (m, 1H), 6.43 (s, 2H), 3.94 - 3.89 (m, 2H), 3.55 - 3.50 (m, 2H), 3.21 - 3.16 (m, 1H), 2.19 (s, 3H), 2.11 (s, 6H), 1.32 - 1.29 (m, 2H), 1.25 - 1.22 (m, 2H). MS (ESI, m / z):C29H32N4O, [M+H]+453.258.

[0158] Example 73 TIFF0007893516000132.tif27170C73: 11H NMR (400 MHz, DMSO-d6) δ 11.25 (s, 1H), 8.88 (s, 1H), 8.38 - 8.17 (m, 2H), 7.84 - 7.71 (m, 1H), 7.58 - 7.46 (m, 1H), 7.39 - 7.29 (m, 1H), 6.91 (d, J = 7.2 Hz, 1H), 6.41 - 6.28 (m, 1H), 6.20 - 6.09 (m, 1H), 3.86 - 3.74 (m, 2H), 3.16 - 3.04 (m, 1H), 2.06 (s, 6H), 1.92 (s, 3H), 1.26 - 1.13 (m, 2H), 1.11 - 0.98 (m, 2H). MS (ESI, m / z):C25H28N4O2, [M+H]+417.221.

[0159] Example 74 TIFF0007893516000133.tif29170C74: 1 1H NMR (400 MHz, DMSO-d6) δ 9.03 (s, 1H), 8.59 (d, J = 8.3 Hz, 1H), 8.26 (s, 1H), 8.20 (d, J = 8.2 Hz, 1H), 7.83 (t, J = 7.5 Hz, 1H), 7.63 (t, J = 7.4 Hz, 1H), 6.91 (d, J = 8.1 Hz, 1H), 6.34 (d, J = 7.8 Hz, 1H), 6.13 (s, 1H), 4.05 (s, 3H), 3.81 (t, J = 6.7 Hz, 2H), 3.20 (s, 1H), 3.03 (dd, J = 14.3, 7.1 Hz, 2H), 2.11 (s, 6H), 1.90 (s, 3H), 1.30 (s, 2H), 1.14 (s, 2H). MS (ESI, m / z):C26H30N4O2, [M+H]+431.237.

[0160] Example 75 TIFF0007893516000134.tif26170C75: 1H NMR (400 MHz, DMSO-d6) δ 9.09 (d, J = 8.2 Hz, 1H), 9.06 - 8.99 (m, 1H), 8.98 - 8.92 (m, 1H), 7.75 (d, J = 7.1 Hz, 1H), 7.67 - 7.54 (m, 2H), 6.92 (d, J = 8.0 Hz, 1H), 6.34 (d, J = 7.5 Hz, 1H), 6.11 (s, 1H), 3.80 (t, J = 6.6 Hz, 2H), 3.44 - 3.37 (m, 2H), 3.11 (s, 1H), 2.70 (s, 3H), 2.06 (s, 5H), 1.89 (s, 3H), 1.38 - 1.29 (m, 2H), 1.20 - 1.12 (m, 2H). MS (ESI, m / z): C26H30N4O, [M+H]+415.242. Figure 8 shows the inhibition rate curve of compound C75.

[0161] Example 76 TIFF0007893516000135.tif29170C76: 1 H NMR (400 MHz, DMSO-d6) δ 9.05 (dd, J = 8.6, 1.5 Hz, 1H), 8.96 (s, 1H), 8.85 (dd, J = 4.0, 1.5 Hz, 1H), 7.78 (d, J = 8.0 Hz, 1H), 7.60 (dd, J = 8.6, 4.1 Hz, 1H), 7.13 (d, J = 8.1 Hz, 1H), 6.91 (d, J = 8.3 Hz, 1H), 6.34 (dd, J = 8.2, 2.4 Hz, 1H), 6.11 (d, J = 2.4 Hz, 1H), 3.96 (s, 3H), 3.85 - 3.76 (m, MS (ESI, m / z):C26H30N4O2, [M+H]+431.237. Figure 9 shows the inhibition rate curve of compound C76.

[0162] Example 77 TIFF0007893516000136.tif23170C77: 1 H NMR (400 MHz, DMSO-d6) δ 8.48 (s, 1H), 7.02 (dd, J = 6.0, 3.2 Hz, 1H), 6.96 (d, J = 8.2 Hz, 1H), 6.76 - 6.70 (m, 2H), 6.37 (dd, J = 8.2, 2.4 Hz, 1H), 6.28 (d, J = 2.4 Hz, 1H), 4.32 - 4.27 (m, 2H), 4.26 - 4.20 (m, 2H), 3.90 - 3.85 (m, 2H), 3.52 - 3.46 (m, 2H), 3.21 - 3.13 (m, 1H), 2.11 (s, 6H), 2.08 (s, 3H), 1.08 (d, J = 3.2 Hz, 4H). MS (ESI, m / z): C24H29N3O3, [M+H]+408.221.

[0163] Example 78 TIFF0007893516000137.tif22170C78: 1 H NMR (400 MHz, DMSO-d6) δ 8.82 (s, 1H), 7.01 (d, J = 8.6 Hz, 1H), 6.88 (dd, J = 7.4, 1.9 Hz, 1H), 6.82 - 6.75 (m, 2H), 6.44 - 6.39 (m, 2H), 5.96 (s, 2H), 3.94 - 3.87 (m, 2H), 3.55 - 3.48 (m, 2H), 3.21 - 3.13 (m, 1H), 2.16 (s, 3H), 2.11 (s, 6H), 1.43 - 1.38 (m, 2H), 1.17 - 1.12 (m, 2H). MS (ESI, m / z):C23H27N3O3, [M+H]+394.205.

[0164] Example 79 TIFF0007893516000138.tif27170C79: 1 1H NMR (400 MHz, CDCl3) δ 9.02 (d, J = 4.0 Hz, 1H), 8.45 (d, J = 8.6 Hz, 1H), 7.93 (s, 1H), 7.72 (s, 1H), 7.61 - 7.55 (m, 1H), 7.53 - 7.48 (m, 1H), 7.48 - 7.42 (m, 1H), 7.36 - 7.31 (m, 1H), 6.92 (d, J = 8.1 Hz, 1H), 1.93 (s, 3H), 1.83 - 1.75 (m, 2H), 1.49 - 1.41 (m, 2H). MS (ESI, m / z):C20H16BrFN2, [M+H]+383.048.

[0165] Example 80 TIFF0007893516000139.tif27170C80: 1 1H NMR (400 MHz, DMSO-d6) δ 9.00 (d, J = 4.0 Hz, 1H), 8.44 (d, J = 8.5 Hz, 1H), 7.71 (s, 1H), 7.70 - 7.60 (m, 3H), 6.90 (d, J = 8.2 Hz, 1H), 6.70 (d, J = 2.4 Hz, 1H), 6.40 - 6.35 (m, 1H), 3.89 - 3.82 (m, 2H), 3.47 - 3.42 (m, 2H), 3.16 - 3.10 (m, 1H), 2.08 (s, 6H), 1.83 (s, 3H), 1.66 - 1.62 (m, 2H), 1.45 - 1.40 (m, 2H). MS (ESI, m / z):C25H27FN4, [M+H]+402.222.

[0166] Example 81 TIFF0007893516000140.tif27170C81: 11H NMR (400 MHz, CDCl3) δ 9.10 - 9.04 (m, 1H), 9.02 (s, 1H), 7.96 - 7.89 (m, 1H), 7.63 - 7.56 (m, 1H), 7.46 - 7.36 (m, 1H), 7.30 (s, 1H), 7.00 - 6.92 (m, 1H), 6.41 - 6.33 (m, 2H), 6.24 - 6.19 (m, 1H), 3.92 - 3.84 (m, 2H), 3.52 - 3.44 (m, 2H), 2.98 - 2.91 (m, 2H), 2.77 - 2.66 (m, 1H), 2.07 (d, J = 4.7 Hz, 3H), 1.65 - 1.58 (m, 2H), 1.42 - 1.35 (m, 2H). MS (ESI, m / z): C24H25FN4O, [M+H]+ 405.201.

[0167] Example 82 TIFF0007893516000141.tif27170C82: 1 1H NMR (400 MHz, DMSO-d6) δ 9.23 (d, J = 8.6 Hz, 1H), 8.93 (d, J = 3.8 Hz, 1H), 7.87 - 7.77 (m, 1H), 7.64 (dd, J = 8.6, 4.1 Hz, 1H), 7.54 - 7.42 (m, 1H), 6.77 (d, J = 8.2 Hz, 1H), 6.45 - 6.37 (m, 1H), 6.31 - 6.27 (m, 1H), 4.06 - 4.00 (m, 1H), 3.85 - 3.76 (m, 1H), 3.09 - 3.01 (m, 1H), 2.70 - 2.55 (m, 2H), 1.88 (s, 3H), 1.75 - 1.67 (m, 1H), 1.26 - 1.20 (m, 2H), 1.12 - 1.07 (m, 2H), 1.06 (s, 3H), 0.93 (s, 3H). MS (ESI, m / z): C26H29FN4O, [M+H]+ 432.233.

[0168] Example 83 TIFF0007893516000142.tif27170C83: 1 1H NMR (400 MHz, DMSO-d6) δ 9.14 (d, J = 8.6 Hz, 1H), 9.07 (s, 1H), 8.97 (d, J = 3.3 Hz, 1H), 7.90 - 7.82 (m, 1H), 7.75 - 7.69 (m, 1H), 7.59 - 7.50 (m, 1H), 6.92 (d, J = 8.2 Hz, 1H), 6.36 - 6.28 (m, 1H), 6.11 (d, J = 2.1 Hz, 1H), 3.89 - 3.82 (m, 2H), 3.43 - 3.37 (m, 3H), 3.00 - 2.92 (m, 1H), 2.85 (s, 2H), 2.40 (s, 7H), 1.86 (s, 3H), 1.38 - 1.32 (m, 2H), 1.22 - 1.17 (m, 2H). MS (ESI, m / z):C26H29FN4O, [M+H]+432.233.

[0169] Example 84 TIFF0007893516000143.tif27170C84: 1 1H NMR (400 MHz, DMSO-d6) δ 9.09 - 9.03 (m, 1H), 8.99 - 8.95 (m, 1H), 7.68 (dd, J = 8.6, 4.1 Hz, 1H), 7.56 - 7.43 (m, 2H), 7.26 (d, J = 1.9 Hz, 1H), 7.22 - 7.17 (m, 1H), 6.95 (d, J = 8.1 Hz, 1H), 3.47 (s, 2H), 1.91 (s, 3H), 1.20 - 1.13 (m, 2H), 0.95 - 0.89 (m, 2H). MS (ESI, m / z):C20H18BrFN2, [M+H]+385.064.

[0170] Example 85 TIFF0007893516000144.tif27170C85: 11H NMR (400 MHz, DMSO-d6) δ 9.06 (d, J = 8.6 Hz, 1H), 9.00 - 8.94 (m, 1H), 7.72 - 7.65 (m, 1H), 7.57 - 7.52 (m, 1H), 7.52 - 7.46 (m, 1H), 6.78 (d, J = 8.0 Hz, 1H), 6.18 - 6.10 (m, 2H), 3.76 - 3.69 (m, 2H), 3.41 (s, 2H), 3.11 - 3.04 (m, 1H), 2.06 (s, 6H), 1.81 (s, 3H), 1.19 - 1.13 (m, 2H), 0.94 - 0.88 (m, 2H). MS (ESI, m / z):C25H29FN4, [M+H]+405.238.

[0171] Example 86 TIFF0007893516000145.tif27170C86: 1 1H NMR (400 MHz, CDCl3) δ 9.08 - 9.02 (m, 1H), 8.92 - 8.85 (m, 1H), 7.60 - 7.51 (m, 2H), 7.41 - 7.33 (m, 1H), 6.86 - 6.80 (m, 1H), 6.49 - 6.41 (m, 2H), 3.49 (s, 2H), 1.89 (s, 3H), 1.28 - 1.23 (m, 2H), 1.06 - 0.99 (m, 2H). MS (ESI, m / z):C20H20FN3, [M+H]+322.164.

[0172] Example 87 TIFF0007893516000146.tif27170C87: 11H NMR (400 MHz, DMSO-d6) δ 9.25 - 9.12 (m, 1H), 9.10 - 8.95 (m, 2H), 7.94 - 7.84 (m, 1H), 7.78 - 7.67 (m, 1H), 7.61 - 7.49 (m, 1H), 7.24 (s, 1H), 6.76 (d, J = 7.9 Hz, 1H), 6.55 - 6.41 (m, 1H), 6.28 (s, 1H), 4.90 (s, 2H), 1.84 (s, 3H), 1.37 - 1.29 (m, 2H), 1.22 - 1.14 (m, 2H). MS (ESI, m / z):C20H18FN3O, [M+H]+336.143.

[0173] Example 88: TIFF0007893516000147.tif27170C88: 1 1H NMR (400 MHz, DMSO) δ 8.93 (s, 1H), 8.71 - 8.61 (m, 1H), 8.24 - 8.14 (m, 1H), 7.72 (d, J = 7.7 Hz, 1H), 7.59 - 7.47 (m, 2H), 7.06 (d, J = 7.8 Hz, 1H), 6.91 (d, J = 8.2 Hz, 1H), 6.33 (dd, J = 8.2, 2.4 Hz, 1H), 6.12 (d, J = 2.4 Hz, 1H), 3.79 (t, J = 7.0 Hz, 2H), 3.48 - 3.37 (m, 2H), 3.17 - 3.05 (m, 1H), 2.81 (s, 6H), 2.06 (s, 6H), 1.94 (s, 3H), 1.32 (s, 2H), 1.12 (s, 2H). 1313C NMR (151 MHz, DMSO) δ 170.00, 150.41, 149.98, 138.13, 133.45, 132.62, 131.09, 129.06, 128.77, 126.11, 125.84, 125.01, 124.72, 123.26, 113.53, 112.61, 110.51, 56.72, 56.30, 45.37, 41.96, 34.33, 18.49, 14.70. MS (ESI, m / z): C28H34N4O, [M+H]+ 443.273.

[0174] Example 89: TIFF0007893516000148.tif25170C89: 1 1H NMR (400 MHz, DMSO-d6) δ 9.03 - 8.96 (m, 2H), 7.75 (dd, J = 8.1, 5.0 Hz, 1H), 7.58 (d, J = 8.8 Hz, 1H), 7.46 (dd, J = 10.9, 8.0 Hz, 1H), 6.93 (d, J = 8.2 Hz, 1H), 6.36 (dd, J = 8.1, 2.5 Hz, 1H), 6.13 (d, J = 2.5 Hz, 1H), 3.86 (d, J = 7.5 Hz, 2H), 3,52 (d, J = 14.5 Hz, 2H), 2.69 (s, 4H), 2.29 (s, 6H), 1.87 (s, 3H), 1.32 (q, J = 4.9 Hz, 2H), 1.16 (td, J = 5.0, 2.5 Hz, 2H). 13 13C NMR (101 MHz, MeOD) δ 173.88, 160.82, 150.73, 138.44, 135.60, 132.18, 129.83, 125.25, 124.33, 114.27, 113.88, 113.69, 111.13, 57.66, 56.86, 41.78, 34.62, 24.57, 18.22, 14.96. MS (ESI, m / z): C26H29FN4O, [M+H]+ 433.240.

[0175] Rate 90: TIFF0007893516000149.tif26170C90: 1 H NMR (400 MHz, Methanol-d4) δ 9.20 (dt, J = 8.9, 1.6 Hz, 1H), 8.93 (dd, J = 4.3, 1.6 Hz, 1H), 8.00 (dd, J = 8.1, 5.0 Hz, 1H), 7.78 - 7.67 (m 1H), 7.49 (dd, J = 10.6, 8.1 Hz, 1H), 6.96 (d, J = 8.3 Hz, 1H), 6.44 (dd, J = 8.2, 2.6 Hz, 1H), 6.23 (d, J = 2.5 Hz, 1H), 3.22 (s, 1H), (s, 6H), 1.94 (s, 3H), 1.52 - 1.45 (m, 2H), 1.38 - 1.31 (m, 2H). 13 C NMR (101 MHz, MeOD) δ 173.98, 159.65, 157.11, 151.12, 151.07, 146.30, 139.25; 132.12, 130.82, 130.74, 130.27, 126.34, 124.90, 123.39, 120.09, 114.24, 113.92, 113.73, 111.10, 57.19, 42.02, 18.22, MS (ESI, m / z):C25H23D4FN4O, [M+H]+423.249.

[0176] Page 91: TIFF0007893516000150.tif25170C91: 1H NMR (400 MHz, Methanol-d4) δ 7.30 (t, J = 7.0 Hz, 2H), 7.20 (d, J = 3.2 Hz, 1H), 7.14 (t, J = 7.7 Hz, 1H), 7.04 (d, J = 8.2 Hz, 1H), 6.85 (d, J = 3.2 Hz, 1H), 6.48 (dd, J = 8.2, 2.6 Hz, 1H), 6.36 (d, J = 2.6 Hz, 1H), 4.14 - 4.01 (m, 2H), 3.83 (s, 5H), 3.37 (s, 1H), 2.85 (s, 6H), 2.09 (s, 3H), 1.36 - 1.26 (m, 4H). 13 C NMR (101 MHz, MeOD) 13C NMR (101 MHz, DMSO-d6) δ 169.19, 148.54, 137.97, 136.63, 134.07, 130.77, 128.83, 127.08, 124.15, 120.43, 118.59, 112.59, 110.57, 108.48, 99.98, 55.33, 54.92, 54.20, 34.39, 32.56, 18.21, 14.30, [M+H]+403.249.

[0177] Manufacturing of compounds (1) Preparation of substituted naphthyl-cyclopropylamine intermediate (1-(substituted naphthalene-1-yl)cyclopropylamine) The synthesis scheme is as follows: TIFF0007893516000151.tif41170

[0178] Substituted naphthonitrile (1, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Next, tetraisopropyl titanate (10 mmol, 1.1 eq) was added, and the reaction system was lowered to -78°C. Then, ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was complete, the reaction system was raised to room temperature and reacted for 1.5 hours. Next, boron trifluoride ether (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was complete, the reaction was stirred at room temperature for 3 hours. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, and quetzing was carried out for 20 minutes with stirring. Then, an excess saturated sodium hydroxide solution was added. Ethyl acetate was added for extraction, and the organic phase was collected. After evaporation and drying in a rotary evaporator, the mixture was separated by silica gel column chromatography to obtain substituted naphthyl-cyclopropylamine intermediate 2.

[0179] (2) Preparation of the compounds of Examples 1-3 The synthesis scheme is as follows: TIFF0007893516000152.tif105170

[0180] Methyl 2-methyl-5-bromobenzoate (3, 2 mmol, 1.0 eq) was placed in a 50 mL sealed tube, and amine compound 4 containing nitrogen and hydrogen (3 mmol, 1.5 eq), tris(dibenzylideneacetone)dipalladium (0.04 mmol, 0.02 eq), X-PHOS ligand (0.08 mmol, 0.04 eq), and cesium carbonate (4 mmol, 2.0 eq) were added. Next, toluene solvent (10 mL) was added, the reaction system was protected with argon, the sealed tube was heated to 110°C, and the reaction was allowed to proceed with stirring overnight. When the substrate conversion was detected by thin-layer chromatography, the organic solvent was evaporated using a rotary evaporator, and the intermediate 5 was purified by column chromatography separation.

[0181] Intermediate 5 (1.0 eq) was placed in a round-bottom flask, and tetrahydrofuran:water = 2:1 was added as a solvent. Next, lithium hydroxide (4.0 eq) was added to the reaction system, and the mixture was stirred at 60°C for 6 hours. After that, the reaction system was acidified with 2N hydrochloric acid, and ethyl acetate was added to precipitate a white solid. The solid was filtered by suction and dried to obtain intermediate 6.

[0182] Intermediate 6 and the three-membered cyclic amine intermediate 2 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain product 7.

[0183] If the amine compound 6 was protected with Boc(tert-butoxycarbonyl), the tert-butoxycarbonyl was removed from compound 7 with hydrochloric acid to obtain the final product.

[0184] (3) Preparation of the compounds of Examples 4-6 The synthesis scheme is as follows: TIFF0007893516000153.tif55170

[0185] 1-(3-bromophenyl)cyclopropanamine (8, 10 mmol, 1.0 eq) was placed in a 100 mL round-bottom flask, 50 mL of dichloromethane solvent was added, then di-tert-butyl dicarbonate (40 mmol, 4.0 eq) was added, and the mixture was stirred at room temperature and reacted for 4 hours. The organic solvent was then evaporated using a rotary evaporator, and the mixture was purified by column chromatography to obtain intermediate 9.

[0186] Intermediate 9 (4 mmol, 1.0 eq) was placed in a 50 mL sealed tube, and thiophene-2-boronic acid pinacol ester (6 mmol, 1.5 eq), tris(dibenzylideneacetone)dipalladium (0.08 mmol, 0.02 eq), X-PHOS ligand (0.16 mmol, 0.04 eq), and potassium phosphate (10 mmol, 2.5 eq) were added. Next, DMF:ethanol:water = (10 mL:10 mL:5 mL) was added as the solvent, the reaction system was protected with argon, and the sealed tube was heated to 95°C and stirred overnight to allow the reaction to proceed. When the substrate conversion was complete as detected by thin-layer chromatography, the organic solvent was evaporated using a rotary evaporator, the organic phase was extracted with ethyl acetate, and the intermediate 10 was obtained by purification by column chromatography.

[0187] Intermediate 10 (4 mmol, 1.0 eq) was dissolved in 20 mL of dichloromethane solvent, 2 mL of 4N hydrochloric acid-dioxane solution was added, and the mixture was stirred at room temperature for 2 hours to precipitate a white solid. The solid was filtered by suction and dried to obtain intermediate 11.

[0188] Intermediate 11 and the carboxylic acid intermediate 6 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain product 12.

[0189] If the amine compound 6 was protected with Boc(tert-butoxycarbonyl), the tert-butoxycarbonyl was removed from compound 7 with hydrochloric acid to obtain the final product.

[0190] (4) Preparation of the compounds of Examples 7 and 8 The synthesis scheme is as follows: TIFF0007893516000154.tif34170

[0191] 3-tert-butylbenzonitrile (16, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Next, tetraisopropyl titanate (10 mmol, 1.1 eq) was added, and the reaction system was lowered to -78°C. Then, ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was complete, the reaction system was raised to room temperature and reacted for 1.5 hours. Next, boron trifluoride ether (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was complete, the reaction was stirred at room temperature for 3 hours. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, and quetzing was carried out for 20 minutes with stirring. Then, an excess of saturated sodium hydroxide solution was added. The mixture was extracted using ethyl acetate, the organic phase was collected, evaporated and dried using a rotary evaporator, and then separated by silica gel column chromatography to obtain 3-tert-butylphenyl-cyclopropylamine intermediate 17.

[0192] The 3-tert-butylbenzene-cyclopropylamine intermediate 17 and the carboxylic acid intermediate 6 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain product 18.

[0193] In Example 7, since amine compound 6 has a Boc(tert-butoxycarbonyl) protection, the tert-butoxycarbonyl was removed from compound 18 with hydrochloric acid to obtain the final product.

[0194] (5) Preparation of the compounds of Examples 9 to 18 The synthesis scheme is as follows: TIFF0007893516000155.tif64170

[0195] Methyl 2-methyl-5-bromobenzoate (3, 10 mmol, 1.0 eq) was placed in a 350 mL sealed tube, and azetidine-3-yldimethylamine (19, 15 mmol, 1.5 eq), tris(dibenzylideneacetone)dipalladium (0.2 mmol, 0.02 eq), X-PHOS ligand (0.4 mmol, 0.04 eq), and cesium carbonate (50 mmol, 5.0 eq) were added. Next, toluene solvent (60 mL) was added, the reaction system was protected with argon, the sealed tube was heated to 110°C, and the reaction was allowed to proceed with stirring overnight. After detection by thin-layer chromatography, when the substrate conversion was complete, the organic solvent was evaporated using a rotary evaporator, and the intermediate 20 was purified by column chromatography separation.

[0196] Intermediate 20 (1.0 eq) was placed in a round-bottom flask, and tetrahydrofuran:water = 2:1 was added as the solvent. Next, potassium hydroxide (4.0 eq) was added to the reaction system, and the mixture was stirred at 60°C and reacted for 6 hours. The organic solvent was then evaporated using a rotary evaporator. Next, 2N hydrochloric acid was added to the excess aqueous solution to acidify it and adjust the pH to 1. Next, the aqueous solution was evaporated using a rotary evaporator, and methanol solution was added to extract the organic matter. The residue was removed by suction filtration, the filtrate was collected, and the filtrate was evaporated using a rotary evaporator to obtain intermediate 21 as a white solid.

[0197] Intermediate 21 and the three-membered cyclic amine intermediate 2 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain product 22. The final product 22 is the product of this example.

[0198] (6) Preparation of the compound of Example 19 The synthesis scheme is as follows: TIFF0007893516000156.tif35170

[0199] Benzonitrile (23, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Next, tetraisopropyl titanate (10 mmol, 1.1 eq) was added, and the reaction system was lowered to -78°C. Then, ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was complete, the reaction system was raised to room temperature and reacted for 1.5 hours. Next, boron trifluoride ether (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was complete, the reaction was stirred at room temperature for 3 hours. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, and quetzing was carried out for 20 minutes with stirring. Then, an excess saturated sodium hydroxide solution was added. Ethyl acetate was added for extraction, and the organic phase was collected. After evaporation and drying in a rotary evaporator, the mixture was separated by silica gel column chromatography to obtain 3-tert-butylphenyl-cyclopropylamine intermediate 24.

[0200] Cyclopropylamine intermediate 24 and the carboxylic acid intermediate 21 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain product 25. The final product 25 is C19.

[0201] (7) Preparation of the compound of Example 20 The synthesis scheme is as follows: TIFF0007893516000157.tif35170

[0202] Benzo[B]thiophene-3-carbonitride (26, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Next, tetraisopropyl titanate (10 mmol, 1.1 eq) was added, and the reaction system was lowered to -78°C. Then, ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was complete, the reaction system was raised to room temperature and reacted for 1.5 hours. Next, boron trifluoride ether (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was complete, the reaction was stirred at room temperature for 3 hours. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, and quetzing was carried out for 20 minutes with stirring. Then, an excess of saturated sodium hydroxide solution was added. The mixture was extracted using ethyl acetate, the organic phase was collected, evaporated and dried using a rotary evaporator, and then separated by silica gel column chromatography to obtain 3-tert-butylphenyl-cyclopropylamine intermediate 27.

[0203] Cyclopropylamine intermediate 27 and the carboxylic acid intermediate 21 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain product 28. The final product 28 is C20.

[0204] (8) Preparation of the compound of Example 21 The synthesis scheme is as follows: TIFF0007893516000158.tif34170

[0205] 5,6,8,9-tetrahydro-1-cyanonaphthalene (29, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Next, tetraisopropyl titanate (10 mmol, 1.1 eq) was added, and the reaction system was lowered to -78°C. Then, ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was complete, the reaction system was raised to room temperature and reacted for 1.5 hours. Next, boron trifluoride ether (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was complete, the reaction was stirred at room temperature for 3 hours. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, and quetzing was carried out for 20 minutes with stirring. Then, an excess of saturated sodium hydroxide solution was added. The mixture was extracted using ethyl acetate, the organic phase was collected, evaporated and dried using a rotary evaporator, and then separated by silica gel column chromatography to obtain 3-tert-butylphenyl-cyclopropylamine intermediate 30.

[0206] Cyclopropylamine intermediate 30 and the carboxylic acid intermediate 21 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain product 31. The final product 31 is C21.

[0207] (9) Preparation of the compound of Example 22 The synthesis scheme is as follows: TIFF0007893516000159.tif41170

[0208] 4-Cyanobiphenyl (32, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Next, tetraisopropyl titanate (10 mmol, 1.1 eq) was added, and the reaction system was lowered to -78°C. Then, ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was complete, the reaction system was raised to room temperature and reacted for 1.5 hours. Next, boron trifluoride ether (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was complete, the reaction was stirred at room temperature for 3 hours. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, and quetzing was carried out for 20 minutes with stirring. Then, an excess of saturated sodium hydroxide solution was added. The mixture was extracted using ethyl acetate, the organic phase was collected, evaporated and dried using a rotary evaporator, and then separated by silica gel column chromatography to obtain 3-tert-butylphenyl-cyclopropylamine intermediate 33.

[0209] Cyclopropylamine intermediate 33 and the carboxylic acid intermediate 21 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain product 34. The final product 34 is the same as in Example C22.

[0210] (10) Preparation of the compound of Example 23 The synthesis scheme is as follows: TIFF0007893516000160.tif41170

[0211] 3-Cyanobiphenyl (35, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Next, tetraisopropyl titanate (10 mmol, 1.1 eq) was added, and the reaction system was lowered to -78°C. Then, ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was complete, the reaction system was raised to room temperature and reacted for 1.5 hours. Next, boron trifluoride ether (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was complete, the reaction was stirred at room temperature for 3 hours. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, and quetzing was carried out for 20 minutes with stirring. Then, an excess of saturated sodium hydroxide solution was added. The mixture was extracted using ethyl acetate, the organic phase was collected, evaporated and dried using a rotary evaporator, and then separated by silica gel column chromatography to obtain 3-tert-butylphenyl-cyclopropylamine intermediate 36.

[0212] Cyclopropylamine intermediate 36 and the carboxylic acid intermediate 21 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain product 37. The final product 37 is C23.

[0213] (11) Preparation of the compound of Example 24 The synthesis scheme is as follows: TIFF0007893516000161.tif37170

[0214] Benzofuran-4-carbonitrate (38, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Next, tetraisopropyl titanate (10 mmol, 1.1 eq) was added, and the reaction system was lowered to -78°C. Then, ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was complete, the reaction system was raised to room temperature and reacted for 1.5 hours. Next, boron trifluoride ether (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was complete, the reaction was stirred at room temperature for 3 hours. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, and quetzing was carried out for 20 minutes with stirring. Then, an excess of saturated sodium hydroxide solution was added. The mixture was extracted using ethyl acetate, the organic phase was collected, evaporated and dried using a rotary evaporator, and then separated by silica gel column chromatography to obtain 3-tert-butylphenyl-cyclopropylamine intermediate 39.

[0215] Cyclopropylamine intermediate 39 and the carboxylic acid intermediate 21 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain product 40. The final product 40 is C24.

[0216] (12) Preparation of the compound of Example 25 The synthesis scheme is as follows: TIFF0007893516000162.tif64170

[0217] 1-Tetralone (41, 20 mmol, 1.0 eq), trimethylsilyl cyanide (24 mmol, 1.2 eq), and zinc iodide (0.5 mmol, 0.025 eq) were placed in a 250 mL round-bottom flask, 100 mL of toluene was added as a solvent, and the mixture was stirred at room temperature for 8 hours. After detection by thin-layer chromatography, it was determined that the reaction was complete. The organic solvent was evaporated using a rotary evaporator, and the mixture was purified by silica gel column chromatography to obtain intermediate 42. Intermediate 42 (15 mmol, 1.0 eq) was placed in a 250 mL round-bottom flask, 50 mL of pyridine was added, and then phosphorus oxychloride (45 mmol, 3.0 eq) was added dropwise at room temperature. After the addition was complete, the temperature was raised to 80°C and the mixture was reacted for 8 hours. After the reaction was complete, the organic solvent was evaporated using a rotary evaporator to neutralize the reaction system. The organic phase was then extracted with ethyl acetate, evaporated using a rotary evaporator, and purified by silica gel column chromatography to obtain intermediate 43.

[0218] Intermediate 43 (10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Next, tetraisopropyl titanate (10 mmol, 1.1 eq) was added, and the reaction system was lowered to -78°C. Then, ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was complete, the reaction system was raised to room temperature and reacted for 1.5 hours. Next, boron trifluoride ether (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was complete, the reaction was stirred at room temperature for 3 hours. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, and quetzing was carried out for 20 minutes with stirring. Then, an excess saturated sodium hydroxide solution was added. Ethyl acetate was added for extraction, and the organic phase was collected. After evaporation and drying in a rotary evaporator, the mixture was separated by silica gel column chromatography to obtain 3-tert-butylphenyl-cyclopropylamine intermediate 44.

[0219] Cyclopropylamine intermediate 44 and the carboxylic acid intermediate 21 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain product 45. The final product 45 is C25.

[0220] (13) Preparation of the compound of Example 26 The synthesis scheme is as follows: TIFF0007893516000163.tif39170

[0221] 8-Fluoroquinoline-4-carbonitride (71, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Next, tetraisopropyl titanate (10 mmol, 1.1 eq) was added, and the reaction system was lowered to -78°C. Then, ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was complete, the reaction system was raised to room temperature and reacted for 1.5 hours. Next, boron trifluoride ether (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was complete, the reaction was stirred at room temperature for 3 hours. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, and quetzing was carried out for 20 minutes with stirring. Then, an excess of saturated sodium hydroxide solution was added. The mixture was extracted using ethyl acetate, the organic phase was collected, evaporated and dried using a rotary evaporator, and then separated by silica gel column chromatography to obtain 8-fluoroquinolyl-cyclopropylamine intermediate 72.

[0222] Cyclopropylamine intermediate 72 and the carboxylic acid intermediate 21 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain product 73. The final product 73 is C26.

[0223] (14) Preparation of the compound of Example 27 The overall synthesis scheme is as follows: The manufacturing method for sub-scheme step 1 of TIFF0007893516000164.tif37170 is as follows: TIFF0007893516000165.tif29170

[0224] 1.64 g (25 mmol, 2.5 eq.) of zinc powder was weighed and washed three times with 2 M hydrochloric acid, or washed with 0.5 M hydrochloric acid for 5 minutes with stirring, then washed three times each with anhydrous ethanol and anhydrous ether, and dried by stirring in an oil bath at 140°C for 2 hours using a vacuum pump. The activated zinc powder was placed in a three-necked flask, and under the protection of Ar, ultra-dried tetrahydrofuran (5 mL) was added, followed by 173 μL (2 mmol, 0.2 eq.) of 1,2-dibromoethane. The mixture was refluxed and heated to 75°C, and when a large amount of bubbles were observed, the reaction was continued for 30 minutes. After natural cooling to room temperature, 255 μL (2 mmol, 0.2 eq.) of trimethylchlorosilane was slowly added, and when a large amount of bubbles were observed, the reaction was continued for 15 minutes. The mixture was heated to 65°C, and 1.04 mL of methyl 1-bromocyclopropanecarboxylate (10 mmol, 1.0 eq) was dissolved in 15 mL of ultra-dried tetrahydrofuran and slowly added dropwise to the reaction system. The mixture was incubated at 65°C for 4 hours (for large quantities, the mixture may be allowed to react overnight to ensure complete reaction) to obtain intermediate 27-2, which was then added directly to step 2 without any workup.

[0225] The manufacturing method for sub-scheme step 2 is as follows: TIFF0007893516000166.tif32170

[0226] Preparation of intermediate 27-4a The synthesis scheme is as follows: TIFF0007893516000167.tif34170

[0227] 2080 mg (10 mmol, 1.0 eq.) of 5-bromoquinoline 27-3a was weighed, and 391.5 mg (0.1 mmol, 0.01 eq.) of Pd2 (dba) and 71 mg (0.1 mmol, 0.01 eq.) of Qphos were added. The mixture was dissolved in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, intermediate 27-2 Reformatsky reagent (20 mmol, 1N, 2.0 eq.) dissolved in 20 mL of tetrahydrofuran was added. The mixture was stirred at room temperature for 30 min. After detection, it was confirmed that the reaction and conversion were complete. The solvent was evaporated using a rotary evaporator, then dissolved in ethyl acetate, washed three times with water, and once with saturated brine. The organic phase was collected and dried over anhydrous sodium sulfate. The mixture was purified by column chromatography to obtain product intermediate 27-4a.

[0228] Preparation of intermediate 27-4b The synthesis scheme is as follows: TIFF0007893516000168.tif34170

[0229] 2080 mg (10 mmol, 1.0 eq.) of 4-bromoquinoline 27-3b was weighed, and 391.5 mg (0.1 mmol, 0.01 eq.) of Pd2 (dba) and 71 mg (0.1 mmol, 0.01 eq.) of Qphos were added. The mixture was dissolved in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, intermediate 27-2 Reformatsky reagent (20 mmol, 1N, 2.0 eq.) dissolved in 20 mL of tetrahydrofuran was added. The mixture was stirred at room temperature for 30 min. After detection, it was confirmed that the reaction and conversion were complete. The solvent was evaporated using a rotary evaporator, then dissolved in ethyl acetate, washed three times with water, and once with saturated brine. The organic phase was collected and dried over anhydrous sodium sulfate. The mixture was purified by column chromatography to obtain product intermediate 27-4b.

[0230] Preparation of intermediate 27-4c The synthesis scheme is as follows: TIFF0007893516000169.tif34170

[0231] 2410 mg (10 mmol, 1.0 eq.) of 4-bromo-8-chloroquinoline 27-3c was weighed, and 391.5 mg (0.1 mmol, 0.01 eq.) of Pd2 (dba) and 71 mg (0.1 mmol, 0.01 eq.) of Qphos were added. The mixture was dissolved in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, the intermediate 27-2 Reformatsky reagent (20 mmol, 1N, 2.0 eq.) dissolved in 20 mL of tetrahydrofuran was added. The mixture was stirred at room temperature for 30 min. After detection, it was confirmed that the reaction and conversion were complete. The solvent was evaporated using a rotary evaporator, then dissolved in ethyl acetate, washed three times with water, and once with saturated brine. The organic phase was collected and dried over anhydrous sodium sulfate. The mixture was purified by column chromatography to obtain the product intermediate 27-4c.

[0232] Preparation of intermediate 27-4d The synthesis scheme is as follows: TIFF0007893516000170.tif34170

[0233] 2370 mg (10 mmol, 1.0 eq.) of 4-bromo-8-methoxyquinoline 27-3d was weighed, and 391.5 mg (0.1 mmol, 0.01 eq.) of Pd2 (dba) and 71 mg (0.1 mmol, 0.01 eq.) of Qphos were added. The mixture was dissolved in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, the intermediate 27-2 Reformatsky reagent (20 mmol, 1N, 2.0 eq.) dissolved in 20 mL of tetrahydrofuran was added. The mixture was stirred at room temperature for 30 min. After detection, it was confirmed that the reaction and conversion were complete. The solvent was evaporated using a rotary evaporator, then dissolved in ethyl acetate, washed three times with water, and once with saturated brine. The organic phase was collected and dried over anhydrous sodium sulfate. The mixture was purified by column chromatography to obtain the product intermediate 27-4d.

[0234] Preparation of intermediate 27-4e The synthesis scheme is as follows: TIFF0007893516000171.tif32170

[0235] 2239 mg (10 mmol, 1.0 eq.) of 1-bromo-4-fluoronaphthalene 27-3e was weighed, and 391.5 mg (0.1 mmol, 0.01 eq.) of Pd2 (dba) and 71 mg (0.1 mmol, 0.01 eq.) of Qphos were added. The mixture was dissolved in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, the intermediate 27-2 Reformatsky reagent (20 mmol, 1N, 2.0 eq.) dissolved in 20 mL of tetrahydrofuran was added. The mixture was stirred at room temperature for 30 min. After detection, it was confirmed that the reaction and conversion were complete. The solvent was evaporated using a rotary evaporator, then dissolved in ethyl acetate, washed three times with water, and once with saturated brine. The organic phase was collected and dried over anhydrous sodium sulfate. The mixture was purified by column chromatography to obtain the product intermediate 27-4e.

[0236] Production of intermediate 27-4f The synthesis scheme is as follows: TIFF0007893516000172.tif34170

[0237] 2249 mg (10 mmol, 1.0 eq.) of 5-bromo-8-fluoroquinoline 27-3f was weighed, and 391.5 mg (0.1 mmol, 0.01 eq.) of Pd2 (dba) and 71 mg (0.1 mmol, 0.01 eq.) of Qphos were added. The mixture was dissolved in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, the intermediate 27-2 Reformatsky reagent (20 mmol, 1N, 2.0 eq.) dissolved in 20 mL of tetrahydrofuran was added. The mixture was stirred at room temperature for 30 min. After detection, it was confirmed that the reaction and conversion were complete. The solvent was evaporated using a rotary evaporator, then dissolved in ethyl acetate, washed three times with water, and once with saturated brine. The organic phase was collected and dried over anhydrous sodium sulfate. The mixture was purified by column chromatography to obtain the product intermediate 27-4f.

[0238] Preparation of 27-4g of intermediate The synthesis scheme is as follows: TIFF0007893516000173.tif34170

[0239] 27-3 g of 2-bromonaphthalene (2059 mg, 10 mmol, 1.0 eq.) was weighed, and 391.5 mg of Pd2 (dba), 0.1 mmol, 0.01 eq., and 71 mg of Qphos, 0.1 mmol, 0.01 eq. were added. The mixture was then dissolved in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, the intermediate 27-2 Reformatsky reagent (20 mmol, 1 N, 2.0 eq.), dissolved in 20 mL of tetrahydrofuran, was added. The mixture was stirred at room temperature for 30 min. After detection, it was confirmed that the reaction and conversion were complete. The solvent was evaporated using a rotary evaporator, then dissolved in ethyl acetate, washed three times with water, and once with saturated brine. The organic phase was collected and dried over anhydrous sodium sulfate. The mixture was purified by column chromatography to obtain product intermediate 27-4 g.

[0240] The manufacturing method for sub-scheme step 3 is as follows: TIFF0007893516000174.tif106170

[0241] Production of intermediate 27-5a The synthesis scheme is as follows: TIFF0007893516000175.tif25170

[0242] 2518 mg (11.09 mmol, 1.0 eq) of intermediate 27-4a was weighed and dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 65 mL), and 2484 mg (44.37 mmol, 4.0 eq) of potassium hydroxide was added. The reaction was carried out at 50°C for 8 hours. Upon detection, it was confirmed that the reactants had completely converted. The pH was adjusted to 3 by adding 2N HCl solution, and the entire solvent was evaporated using a rotary evaporator. Then, 25 mL of methanol was added, the mixture was filtered, and the filtrate was collected. The filtrate was evaporated using a rotary evaporator to obtain a gray solid. Finally, the gray solid was washed repeatedly with DCM / PE to obtain the white solid product 27-5a. TIFF0007893516000176.tif62170

[0243] The scheme for intermediates 27-5b to 27-5g is the same as the method for producing intermediate 27-5a.

[0244] The manufacturing scheme for sub-scheme step 4 is as follows: TIFF0007893516000177.tif99170

[0245] Preparation of intermediate 27-6a The synthesis scheme is as follows: TIFF0007893516000178.tif29170

[0246] Intermediate 27-5a 426 mg (2 mmol, 1.0 eq) was weighed and dissolved in 25 mL of ultra-dried toluene. 0.611 mL of triethylamine (4.4 mmol, 2.2 eq) was added, and under Ar protection, 0.516 mL of DPPA (2.4 mmol, 1.2 eq) was added. The mixture was stirred at room temperature for 30 min until all the carboxylic acid starting materials were converted to acyl azides. The mixture was then heated to 75°C and reacted for 4 hours until most of the acyl azides were converted to isocyanates. Excess hydrochloric acid (2 M aqueous solution, >4.0 eq) was added, the temperature was reduced to 60°C, and the mixture was reacted overnight. After adjusting the pH to alkaline with sodium bicarbonate solution, ethyl acetate was added for extraction to obtain the organic phase. This was added to 2.5 ml of HCl (4 M HCl in Dioxane, 10 mmol, 2.0 eq) solution, filtered through a sand core funnel, and washed multiple times with petroleum ether and ethyl acetate to obtain the white powder product 27-6a. TIFF0007893516000179.tif67170

[0247] The scheme for intermediates 27-6b to 27-6g is the same as the method for producing intermediate 27-6a.

[0248] The manufacturing scheme for sub-scheme step 5 is as follows: TIFF0007893516000180.tif34170

[0249] Preparation of intermediate 27-9a The synthesis scheme is as follows: TIFF0007893516000181.tif46170

[0250] 4580 mg (20 mmol, 1.0 eq) of methyl 2-methyl-5-bromobenzoate 27-8, 3740 mg (22 mmol, 1.1 eq) of 3-(dimethylamino)azetidine dihydrochloride 27-7a, 3370 mg (0.4 mmol, 0.02 eq) of Pd2(dba), 760 mg (1.6 mmol, 0.08 eq) of XPhos, and 26080 mg (80 mmol, 4.0 eq) of cesium carbonate were weighed, dissolved in 100 mL of toluene, placed in a sealed tube, heated to 110°C under the protection of Ar, and left overnight. The mixture was washed with water and ethyl acetate to obtain the organic phase. The product intermediate 27-9a was obtained by column chromatography.

[0251] Preparation of intermediate 27-9b The synthesis scheme is as follows: TIFF0007893516000182.tif45170

[0252] 1700 mg (7.4 mmol, 1.0 eq) of methyl 2-methyl-5-bromobenzoate 27-8, 1000 mg (7.8 mmol, 1.05 eq) of 3-dimethylaminopiperidine 27-7b, 3204 mg (0.22 mmol, 0.03 eq) of Pd2(dba), 425 mg (0.89 mmol, 0.12 eq) of XPhos, and 9600 mg (29.72 mmol, 4.0 eq) of cesium carbonate were weighed and dissolved in 45 mL of toluene. The mixture was placed in a sealed tube and heated to 110°C under the protection of Ar, and reacted overnight. The mixture was washed with water and ethyl acetate to obtain the organic phase. The product intermediate 27-9b was obtained by column chromatography.

[0253] Production of intermediate 27-9c The synthesis scheme is as follows: TIFF0007893516000183.tif45170

[0254] 2290 mg (10 mmol, 1.0 eq) of methyl 2-methyl-5-bromobenzoate 27-8, 1480 mg (11 mmol, 1.1 eq) of thiomorpholine-1,1-dioxide 27-7c, 3274.5 mg (0.3 mmol, 0.03 eq) of Pd2(dba), 572 mg (1.2 mmol, 0.12 eq) of XPhos, and 1304 mg (40 mmol, 4.0 eq) of cesium carbonate were weighed and dissolved in 60 mL of toluene. The mixture was placed in a sealed tube and heated to 110°C under the protection of Ar, and reacted overnight. The mixture was washed with water and ethyl acetate to obtain the organic phase. The product intermediate 27-9c was obtained by column chromatography.

[0255] Preparation of intermediate 27-9d The synthesis scheme is as follows: TIFF0007893516000184.tif45170

[0256] 2290 mg (10 mmol, 1.0 eq) of methyl 2-methyl-5-bromobenzoate 27-8, 2190 mg (11 mmol, 1.1 eq) of 3-aminoquinuclidine hydrochloride 27-7d, 392 mg (0.1 mmol, 0.01 eq) of Pd2(dba), 1431 mg (0.3 mmol, 0.03 eq) of XPhos, and 1304 mg (40 mmol, 4.0 eq) of cesium carbonate were weighed and dissolved in 60 mL of toluene. The mixture was placed in a sealed tube and heated to 110°C under the protection of Ar, and reacted overnight. The mixture was washed with water and ethyl acetate to obtain the organic phase. The product intermediate 27-9d was obtained by column chromatography.

[0257] Production of intermediate 27-9e The synthesis scheme is as follows: TIFF0007893516000185.tif41170

[0258] 1420 mg (6.2 mmol, 1.0 eq) of methyl 2-methyl-5-bromobenzoate 27-8, 936 mg (11 mmol, 1.1 eq) of 27-7e, 356 mg (0.1 mmol, 0.01 eq) of Pd2(dba), 118 mg (0.4 mmol, 0.04 eq) of XPhos, and 8300 mg (40 mmol, 4.0 eq) of cesium carbonate were weighed and dissolved in 50 mL of toluene. The mixture was placed in a sealed tube and heated to 110°C under the protection of Ar, and reacted overnight. The mixture was washed with water and ethyl acetate to obtain the organic phase. The product intermediate 27-9e was obtained by column chromatography.

[0259] Production of intermediate 27-9f The synthesis scheme is as follows: TIFF0007893516000186.tif40170

[0260] 2290 mg (10.0 mmol, 1.0 eq) of methyl 2-methyl-5-bromobenzoate 27-8, 1.5 mL (11 mmol, 1.1 eq) of 27-7f, 391.5 mg (0.1 mmol, 0.01 eq) of Pd2(dba), 190 mg (0.4 mmol, 0.04 eq) of XPhos, and 16300 mg (50 mmol, 5.0 eq) of cesium carbonate were weighed and dissolved in 50 mL of toluene. The mixture was placed in a sealed tube and heated to 110°C under the protection of Ar, and reacted overnight. The mixture was washed with water and ethyl acetate to obtain the organic phase. The product intermediate 27-9f was obtained by column chromatography.

[0261] Production of 27-9g of intermediate The synthesis scheme is as follows: TIFF0007893516000187.tif46170

[0262] 2290 mg (10.0 mmol, 1.0 eq) of methyl 2-methyl-5-bromobenzoate 27-8, 1388 mg (11 mmol, 1.1 eq) of 27-7 g, 391.5 mg (0.1 mmol, 0.01 eq) of Pd2(dba), 190 mg (0.4 mmol, 0.04 eq) of XPhos, and 16300 mg (50 mmol, 5.0 eq) of cesium carbonate were weighed and dissolved in 50 mL of toluene. The mixture was placed in a sealed tube and heated to 110°C under the protection of Ar, and reacted overnight. The mixture was washed with water and ethyl acetate to obtain the organic phase. 27-9 g of the product intermediate was obtained by column chromatography.

[0263] Production of intermediate 27-9h The synthesis scheme is as follows: TIFF0007893516000188.tif45170

[0264] 2290 mg (10.0 mmol, 1.0 eq) of methyl 2-methyl-5-bromobenzoate 27-8, 2 mL (11 mmol, 1.1 eq) of 27-7h, 3274 mg (0.3 mmol, 0.03 eq) of Pd2(dba), 571 mg (1.2 mmol, 0.12 eq) of XPhos, and 13040 mg (50 mmol, 5.0 eq) of cesium carbonate were weighed and dissolved in 50 mL of toluene. The mixture was placed in a sealed tube and heated to 110°C under the protection of Ar, and reacted overnight. The mixture was washed with water and ethyl acetate to obtain the organic phase. The product intermediate 27-9h was obtained by column chromatography.

[0265] Manufacturing of intermediate 27-9i The synthesis scheme is as follows: TIFF0007893516000189.tif37170

[0266] 2290 mg (10.0 mmol, 1.0 eq) of methyl 2-methyl-5-bromobenzoate 27-8, 2 mL (11 mmol, 1.1 eq) of 27-7i, 392 mg (0.1 mmol, 0.01 eq) of Pd2(dba), 190 mg (0.4 mmol, 0.04 eq) of XPhos, and 13040 mg (50 mmol, 5.0 eq) of cesium carbonate were weighed and dissolved in 50 mL of toluene. The mixture was placed in a sealed tube and heated to 110°C under the protection of Ar, and reacted overnight. The mixture was washed with water and ethyl acetate to obtain the organic phase. The product intermediate 27-9i was obtained by column chromatography.

[0267] Manufacturing of intermediate 27-9j The synthesis scheme is as follows: TIFF0007893516000190.tif37170

[0268] 2290 mg (10.0 mmol, 1.0 eq) of methyl 2-methyl-5-bromobenzoate 27-8, 2350 mg (11 mmol, 1.1 eq) of 27-7j, 392 mg (0.1 mmol, 0.01 eq) of Pd2(dba), 190 mg (0.4 mmol, 0.04 eq) of XPhos, and 13040 mg (50 mmol, 5.0 eq) of cesium carbonate were weighed and dissolved in 50 mL of toluene. The mixture was placed in a sealed tube and heated to 110°C under the protection of Ar, and reacted overnight. The mixture was washed with water and ethyl acetate to obtain the organic phase. The product intermediate 27-9j was obtained by column chromatography. TIFF0007893516000191.tif37170

[0269] 2290 mg (10.0 mmol, 1.0 eq) of methyl 2-methyl-5-bromobenzoate 27-8, 2200 mg (11 mmol, 1.1 eq) of 27-7k, 392 mg (0.1 mmol, 0.01 eq) of Pd2(dba), 190 mg (0.4 mmol, 0.04 eq) of XPhos, and 13040 mg (50 mmol, 5.0 eq) of cesium carbonate were weighed and dissolved in 50 mL of toluene. The mixture was placed in a sealed tube and heated to 110°C under the protection of Ar, and reacted overnight. The mixture was washed with water and ethyl acetate to obtain the organic phase. The product intermediate 27-9k was obtained by column chromatography.

[0270] The manufacturing method for sub-scheme step 6 is as follows: TIFF0007893516000192.tif89170

[0271] Production of intermediate 27-10a The synthesis scheme is as follows: TIFF0007893516000193.tif42170

[0272] Intermediate 27-9a (10 mmol, 1 eq.) was weighed and dissolved in a mixed solution of 25 mL of methanol and 25 mL of water. Potassium hydroxide (40 mmol, 4 eq.) was added, and the mixture was heated at 60°C and stirred overnight. After the reaction was complete, excess hydrochloric acid was added to adjust the pH of the reaction solution to acidity (it should not be excessively acidic due to the risk of cyclization of the product). The solvent was completely evaporated using a rotary evaporator (after the first evaporation using the rotary evaporator, small amounts of methanol were added in several stages, and the mixture was evaporated using the rotary evaporator to remove as much water as possible). After adding methanol and stirring, the mixture was filtered by suction. If the filtered solid contained a large amount of product, the solid was dissolved multiple times with methanol and filtered by suction until no more solid was dissolved (no fluorescence was detected by UV detection using thin-layer chromatography). The filtrate was collected and concentrated, and then recrystallized with dichloromethane to obtain product intermediate 27-10a. TIFF0007893516000194.tif56170

[0273] The scheme for intermediates 27-10b to 27-10l is the same as the method for producing intermediate 27-10a.

[0274] The method for producing the final product using sub-scheme step 7 is as follows: TIFF0007893516000195.tif32170

[0275] Example 27: Preparation of the compound The synthesis scheme is as follows: TIFF0007893516000196.tif37170

[0276] 184 mg (1 mmol, 1.0 eq) of amine intermediate 27-6a, 234 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 27-10a, and 869 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of DMF, and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq) of HATU was added, and the reaction was allowed to proceed at room temperature for 3 hours. Once the reaction starting materials were completely converted, the reaction mixture was washed with water and ethyl acetate to remove the DMF, and the organic phase was collected. The crude product was evaporated using a rotary evaporator and purified by passing it through a column to obtain the compound of Example 27, which is the final product FS41.

[0277] (15) Preparation of the compound of Example 28 The synthesis scheme is as follows: TIFF0007893516000197.tif40170

[0278] 30 mg (0.154 mmol, 1.0 eq) of amine intermediate 28-6b, 36 mg (0.154 mmol, 1.0 eq) of carboxylic acid intermediate 28-10a, and 133 μL (0.77 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 87 mg (0.231 mmol, 1.5 eq) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the final product FS42, which is the compound of Example 28.

[0279] (16) Preparation of the compound of Example 29 The synthesis scheme is as follows: TIFF0007893516000198.tif40170

[0280] 132 mg (0.58 mmol, 1.0 eq) of amine intermediate 29-6c, 135 mg (0.58 mmol, 1.0 eq) of carboxylic acid intermediate 29-10a, and 504 μL (2.9 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of THF, and stirred until completely dissolved. 330 mg (0.87 mmol, 1.5 eq) of HATU was added and the mixture was reacted at room temperature for 4 hours. Once the reaction materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was removed, and the crude product was evaporated using a rotary evaporator. The crude product was then purified by passing it through a column to obtain the final product FS43, which is the compound of Example 29.

[0281] (17) Preparation of the compound of Example 30 The synthesis scheme is as follows: TIFF0007893516000199.tif39170

[0282] Amine intermediate 30-6d (0.38 mmol, 1.0 eq), carboxylic acid intermediate 30-10a (106 mg, 0.45 mmol, 1.0 eq), and DIPEA (1.9 mmol, 5.0 eq) were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 216 mg of HATU (0.57 mmol, 1.5 eq) was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction starting materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the final product FS44, which is the compound of Example 30.

[0283] (18) Preparation of the compound of Example 31 The synthesis scheme is as follows: TIFF0007893516000200.tif37170

[0284] 118 mg (0.5 mmol, 1.0 eq) of amine intermediate 31-6e, 158 mg (0.6 mmol, 1.2 eq) of carboxylic acid intermediate 31-10b, and 434 μL (2.5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of DMF, and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction starting materials were completely converted, the reaction mixture was washed with water and ethyl acetate to remove the DMF, and the organic phase was collected. The crude product was evaporated using a rotary evaporator and purified by passing it through a column to obtain the compound of Example 31, which is the final product FS45.

[0285] (19) Preparation of the compound of Example 32 The synthesis scheme is as follows: TIFF0007893516000201.tif37170

[0286] 115 mg (0.5 mmol, 1.0 eq) of amine intermediate 32-6b, 157 mg (0.6 mmol, 1.2 eq) of carboxylic acid intermediate 32-10b, and 434 μL (2.5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of THF, and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the final product FS46, which is the compound of Example 32.

[0287] (20) Preparation of the compound of Example 33 The synthesis scheme is as follows: TIFF0007893516000202.tif40170

[0288] 92 mg (0.5 mmol, 1.0 eq) of amine intermediate 33-6b, 161 mg (0.6 mmol, 1.2 eq) of carboxylic acid intermediate 33-10c, and 434 μL (2.5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of THF, and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the compound of Example 33, which is the final product FS47.

[0289] (21) Preparation of the compound of Example 34 The synthesis scheme is as follows: TIFF0007893516000203.tif39170

[0290] 92 mg (0.5 mmol, 1.0 eq) of amine intermediate 34-6b, 143 mg (0.55 mmol, 1.1 eq) of carboxylic acid intermediate 34-10d, and 434 μL (2.5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of THF, and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the compound of Example 34, which is the final product FS48.

[0291] (22) Preparation of the compound of Example 35 The synthesis scheme is as follows: TIFF0007893516000204.tif39170

[0292] 100.5 mg (0.5 mmol, 1.0 eq) of amine intermediate 35-6e, 134 mg (0.5 mmol, 1.0 eq) of carboxylic acid intermediate 35-10c, and 434 μL (2.5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of DMF, and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq) of HATU was added and the mixture was reacted at room temperature for 4 hours. Once the reaction starting materials were completely converted, the reaction mixture was washed with water and ethyl acetate to remove the DMF, the organic phase was collected, and the crude product was evaporated using a rotary evaporator. The crude product was then purified by passing it through a column to obtain the compound of Example 35, which was the final product FS50.

[0293] (23) Example 36 Preparation of compound The synthesis scheme is as follows: TIFF0007893516000205.tif39170

[0294] 92 mg (0.5 mmol, 1.0 eq) of amine intermediate 36-6a, 129 mg (0.55 mmol, 1.1 eq) of carboxylic acid intermediate 36-10e, and 434 μL (2.5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of THF, and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction starting materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the compound of Example 36, which is the final product FS52.

[0295] (24) Preparation of the compound of Example 37 The synthesis scheme is as follows: TIFF0007893516000206.tif53170

[0296] Intermediate 37-8: 4240 mg (20 mmol, 1.0 eq) and lithium hydroxide: 1920 mg (80 mmol, 4.0 eq.) were weighed and dissolved in H2O / MeOH / THF = 1 / 2 / 2 (75 mL). The mixture was reacted overnight at 50°C. After the reaction was complete, methanol and tetrahydrofuran were evaporated using a rotary evaporator. The reaction mixture was washed with ethyl acetate and water to obtain the aqueous phase. 2N HCl solution was added to adjust the pH of the aqueous solution to acidity. The reaction mixture was washed with EA and water to obtain the organic phase. The mixture was evaporated using a rotary evaporator to obtain intermediate 37-11.

[0297] 276 mg (1.5 mmol, 1.0 eq) of amine intermediate 37-6a, 322 mg (1.5 mmol, 1.0 eq) of carboxylic acid intermediate 37-11, and 1304 μL (7.5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of THF, and stirred until completely dissolved. 855 mg (2.25 mmol, 1.5 eq) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain intermediate 37-12.

[0298] Intermediate 37-12 220 mg (0.58 mmol, 1.0 eq.) was weighed, and 35.3 mg (0.058 mmol, 0.01 eq.) of Pd2 (dba), 11 mg (0.023 mmol, 0.01 eq.) of Xphos, and 756 mg (2.32 mmol, 4.0 eq.) of cesium carbonate were added. This mixture was dissolved in 5 mL of toluene, placed in a sealed tube, and heated to 110°C under the protection of Ar, and left overnight. Once the reaction mixture cooled to room temperature, the toluene was evaporated using a rotary evaporator. Next, the reaction mixture was washed with 2N HCl solution and ethyl acetate to obtain the aqueous phase. Then, the pH of the aqueous solution was adjusted to alkaline with saturated sodium bicarbonate aqueous solution, and then washed with water and ethyl acetate to obtain the organic phase. After evaporating the organic phase using a rotary evaporator, the compound of Example 37, which is product FS53, was obtained by column chromatography.

[0299] (25) Preparation of the compound of Example 38 The synthesis scheme is as follows: TIFF0007893516000207.tif41170

[0300] 113 mg (0.56 mmol, 1.4 eq.) of amine intermediate 38-6f, 94 mg (0.4 mmol, 1.0 eq.) of carboxylic acid intermediate 38-10e, and 139 μL (0.8 mmol, 2.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 182 mg (0.48 mmol, 1.2 eq.) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the compound of Example 38, which is the final product FS54.

[0301] (26) Preparation of the compound of Example 39 The synthesis scheme is as follows: TIFF0007893516000208.tif39170

[0302] 101 mg (0.5 mmol, 1.0 eq.) of amine intermediate 39-6f, 143 mg (0.55 mmol, 1.0 eq.) of carboxylic acid intermediate 39-10d, and 434 μL (2.5 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq.) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction starting materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the compound of Example 39, which is the final product FS55.

[0303] (27) Preparation of the compound of Example 40 The synthesis scheme is as follows: TIFF0007893516000209.tif40170

[0304] 101 mg (0.5 mmol, 1.0 eq.) of amine intermediate 40-6f, 157 mg (0.6 mmol, 1.2 eq.) of carboxylic acid intermediate 40-10b, and 434 μL (2.5 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq.) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction starting materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the compound of Example 40, which is the final product FS56.

[0305] (28) Preparation of the compound of Example 41 The synthesis scheme is as follows: TIFF0007893516000210.tif38170

[0306] 101 mg (0.5 mmol, 1.0 eq.) of amine intermediate 41-6f, 148 mg (0.55 mmol, 1.1 eq.) of carboxylic acid intermediate 41-10c, and 434 μL (2.5 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq.) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction starting materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the compound of Example 41, which is the final product FS57.

[0307] (29) Preparation of the compound of Example 42 The synthesis scheme is as follows: TIFF0007893516000211.tif42170

[0308] 92 mg (0.5 mmol, 1.0 eq.) of amine intermediate 42-6a, 144 mg (0.55 mmol, 1.1 eq.) of carboxylic acid intermediate 42-10f, and 434 μL (2.5 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq.) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the compound of Example 42, which is the final product FS59.

[0309] (30) Preparation of the compound of Example 43 The synthesis scheme is as follows: TIFF0007893516000212.tif44170

[0310] 92 mg (0.5 mmol, 1.0 eq.) of amine intermediate 43-6b, 143 mg (0.55 mmol, 1.1 eq.) of carboxylic acid intermediate 43-10 g, and 434 μL (2.5 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq.) of HATU was added, and the mixture was reacted at room temperature for 4 hours. Once the reaction starting materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the compound of Example 43, which is the final product FS60.

[0311] (31) Preparation of the compound of Example 44 The synthesis scheme is as follows: TIFF0007893516000213.tif40170

[0312] 101 mg (0.5 mmol, 1.0 eq.) of amine intermediate 44-6f, 144 mg (0.55 mmol, 1.1 eq.) of carboxylic acid intermediate 44-10f, and 434 μL (2.5 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq.) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction starting materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the final product F61, which is the compound of Example 44.

[0313] (32) Preparation of the compound of Example 45 The synthesis scheme is as follows: TIFF0007893516000214.tif44170

[0314] 101 mg (0.5 mmol, 1.0 eq.) of amine intermediate 45-6f, 143 mg (0.55 mmol, 1.1 eq.) of carboxylic acid intermediate 45-10g, and 434 μL (2.5 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq.) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction starting materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the final product F62, the compound of Example 45.

[0315] (33) Preparation of the compound of Example 46 The synthesis scheme is as follows: TIFF0007893516000215.tif43170

[0316] 184 mg (1.0 mmol, 1.0 eq.) of amine intermediate 46-6a, 572 mg (1.1 mmol, 1.1 eq.) of carboxylic acid intermediate 46-10 g, and 870 μL (5.0 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq.) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction starting materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the final product F63, which is the compound of Example 46.

[0317] (34) Preparation of the compound of Example 47 The synthesis scheme is as follows: TIFF0007893516000216.tif40170

[0318] 92 mg (0.5 mmol, 1.0 eq.) of amine intermediate 47-6g, 129 mg (0.55 mmol, 1.1 eq.) of carboxylic acid intermediate 47-10a, and 434 μL (2.5 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq.) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the compound of Example 47, which is the final product FS64.

[0319] (35) Preparation of the compound of Example 48 The synthesis scheme is as follows: TIFF0007893516000217.tif42170

[0320] 201 mg (1.0 mmol, 1.0 eq.) of amine intermediate 48-6e, 288 mg (1.1 mmol, 1.1 eq.) of carboxylic acid intermediate 48-10f, and 870 μL (5.0 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq.) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction starting materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the compound of Example 48, which is the final product FS65.

[0321] (36) Preparation of the compound of Example 49 The synthesis scheme is as follows: TIFF0007893516000218.tif42170

[0322] 201 mg (1.0 mmol, 1.0 eq.) of amine intermediate 49-6e, 286 mg (1.1 mmol, 1.1 eq.) of carboxylic acid intermediate 49-10 g, and 870 μL (5.0 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF, and the mixture was stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq.) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction starting materials were completely converted, the THF was evaporated using a rotary evaporator, and the reaction mixture was washed with water and ethyl acetate to obtain the organic phase. The crude product was evaporated using a rotary evaporator and purified by passing it through a column to obtain the compound of Example 49, which is the final product FS66.

[0323] (37) Preparation of the compound of Example 50 The synthesis scheme is as follows: TIFF0007893516000219.tif36170

[0324] 201 mg (1.0 mmol, 1.0 eq.) of amine intermediate 50-6e, 321 mg (1.0 mmol, 1.0 eq.) of carboxylic acid intermediate 50-10h, and 870 μL (5.0 mmol, 5.0 eq.) of DIPEA were dissolved in 3 mL of THF and stirred until completely dissolved. 570 mg of HATU (1.5 mmol, 1.5 eq.) was added and the mixture was reacted at room temperature for 4 hours. Once the reaction starting materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was removed, and the crude product FS69-Boc was evaporated using a rotary evaporator. Next, it was dissolved in 2 mL of DCM and stirred until completely dissolved. CF3COOH (10 mmol, 10 eq.) was added and the mixture was stirred at room temperature for 2 hours. After the reaction was complete, the reaction mixture was washed with DCM / H2O, the aqueous phase was collected, the pH of the aqueous phase was adjusted to alkaline, and the organic phase was extracted with ethyl acetate. The organic phase was then purified by passing it through a column to obtain the final product FS69, which is the compound of Example 50.

[0325] (38) Preparation of the compound of Example 51 The synthesis scheme is as follows: TIFF0007893516000220.tif43170

[0326] 202 mg (1.0 mmol, 1.0 eq.) of amine intermediate 51-6f, 372 mg (1.5 mmol, 1.5 eq.) of carboxylic acid intermediate 51-10i, and 870 μL (5.0 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq.) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction starting materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the compound of Example 51, which was the final product FS70.

[0327] (39) Preparation of the compound of Example 52 The synthesis scheme is as follows: TIFF0007893516000221.tif35170

[0328] 202 mg (1.0 mmol, 1.0 eq.) of amine intermediate 52-6f, 522 mg (1.5 mmol, 1.5 eq.) of carboxylic acid intermediate 52-10j, and 870 μL (5.0 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq.) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction starting materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, and evaporated using a rotary evaporator to obtain the crude product FS71-Boc. Next, it was dissolved in 2 mL of DCM, and stirred until completely dissolved. CF3COOH (10 mmol, 10 eq.) was added, and the reaction was allowed to proceed at room temperature for 2 hours. After the reaction was complete, the reaction mixture was washed with DCM / H2O, the aqueous phase was collected, the pH of the aqueous phase was adjusted to alkaline, and the organic phase was extracted with ethyl acetate. The organic phase was then purified by passing it through a column to obtain the final product FS71, which is the compound of Example 52.

[0329] (40) Preparation of the compound of Example 53 The synthesis scheme is as follows: TIFF0007893516000222.tif36170

[0330] 303 mg (1.5 mmol, 1.0 eq.) of amine intermediate 53-6f, 481 mg (1.5 mmol, 1.0 eq.) of carboxylic acid intermediate 53-10h, and 1303 μL (7.5 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 855 mg (2.25 mmol, 1.5 eq.) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, and evaporated using a rotary evaporator to obtain the crude product FS72-Boc. Next, it was dissolved in 2 mL of DCM, and stirred until completely dissolved. CF3COOH (10 mmol, 10 eq.) was added, and the reaction was allowed to proceed at room temperature for 2 hours. After the reaction was complete, the reaction mixture was washed with DCM / H2O, the aqueous phase was collected, the pH of the aqueous phase was adjusted to alkaline, and the organic phase was extracted with ethyl acetate. The organic phase was then purified by passing it through a column to obtain the final product FS72, which is the compound of Example 53.

[0331] (41) Preparation of the compound of Example 54 The synthesis scheme is as follows: TIFF0007893516000223.tif42170

[0332] 202 mg (1.0 mmol, 1.0 eq.) of amine intermediate 54-6e, 370 mg (1.5 mmol, 1.5 eq.) of carboxylic acid intermediate 54-10l, and 870 μL (5.0 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq.) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction starting materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the compound of Example 54, which is the final product FS74.

[0333] (42) Preparation of the compound of Example 55 The synthesis scheme is as follows: TIFF0007893516000224.tif35170

[0334] 201 mg (1.0 mmol, 1.0 eq.) of amine intermediate 55-6e, 334 mg (1.0 mmol, 1.0 eq.) of carboxylic acid intermediate 55-10k, and 870 μL (5.0 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq.) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was removed, and the crude product FS76-Boc was evaporated using a rotary evaporator. Next, it was dissolved in 2 mL of DCM, and stirred until completely dissolved. CF3COOH (10 mmol, 10 eq.) was added, and the reaction was allowed to proceed at room temperature for 2 hours. After the reaction was complete, the reaction mixture was washed with DCM / H2O, the aqueous phase was collected, the pH of the aqueous phase was adjusted to alkaline, and the organic phase was extracted with ethyl acetate. The organic phase was then purified by passing it through a column to obtain the final product FS76, which is the compound of Example 55.

[0335] (43) Preparation of the compound of Example 56 The synthesis scheme is as follows: TIFF0007893516000225.tif36170

[0336] 101 mg (0.5 mmol, 1.0 eq.) of amine intermediate 56-6f, 167 mg (0.5 mmol, 1.0 eq.) of carboxylic acid intermediate 56-10k, and 434 μL (2.5 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq.) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction starting materials were completely converted, the THF was evaporated using a rotary evaporator, and the reaction mixture was washed with water and ethyl acetate to obtain the organic phase. This was evaporated using a rotary evaporator to obtain the crude product FS77-Boc. Next, it was dissolved in 2 mL of DCM, and stirred until completely dissolved. CF3COOH (10 mmol, 10 eq.) was added, and the reaction was allowed to proceed at room temperature for 2 hours. After the reaction was complete, the reaction mixture was washed with DCM / H2O, the aqueous phase was collected, the pH of the aqueous phase was adjusted to alkaline, and the organic phase was extracted with ethyl acetate. The organic phase was then purified by passing it through a column to obtain the final product FS77, which is the compound of Example 56.

[0337] (44) Preparation of the compound of Example 57 The synthesis scheme is as follows: TIFF0007893516000226.tif30170

[0338] 7-bromobenzo[b]thiophene (57-3, 10 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 50 mL of dry DMF. Then, potassium ferrocyanide (5 mmol, 0.5 eq), Pd2(dba)3 (0.5 mmol, 0.05 eq), and cesium carbonate (15 mmol, 1.5 eq) were added, and the mixture was heated to 120°C under the protection of argon and stirred for 12 hours. After the reaction was complete, 50 mL of water was added to the reaction system, and ethyl acetate was added for extraction. The organic phase was collected, evaporated dry in a rotary evaporator, and then separated by silica gel column chromatography to obtain benzo[b]thiophene-7-carbonitride intermediate 57-4.

[0339] Benzo[b]thiophene-7-carbonitride (2, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Next, tetraisopropyl titanate (10 mmol, 1.1 eq) was added, and the reaction system was lowered to -78°C. Then, ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was complete, the reaction system was raised to room temperature and reacted for 1.5 hours. Next, boron trifluoride ether (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was complete, the system was stirred at room temperature and reacted for 3 hours. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, and quetzing was carried out for 20 minutes with stirring. Then, an excess saturated sodium hydroxide solution was added. Ethyl acetate was added for extraction, and the organic phase was collected. After evaporation and drying in a rotary evaporator, the mixture was separated by silica gel column chromatography to obtain intermediate 57-5.

[0340] Intermediate 57-5 and the carboxylic acid intermediate 57-6 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 50°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain product 57-7. The final product 57-7 is the compound of Example 57.

[0341] (45) Preparation of the compound of Example 58 The synthesis scheme is as follows: TIFF0007893516000227.tif731705-Bromo-8-trifluoromethoxyquinoline (58-8, 10 mmol, 1.0 eq), Pd2(dba)3 (0.1 mmol, 0.01 eq), and QPhos 71 mg (0.1 mmol, 0.01 eq) were placed in a round-bottom flask and dissolved in 20 mL of anhydrous tetrahydrofuran. Under the protection of argon, intermediate 58-2 Reformatsky Reagent (20 mmol, 1N, 2.0 eq) dissolved in 20 mL of tetrahydrofuran was added. The mixture was stirred at room temperature for 30 min. After detection confirmed that the reaction and conversion were complete, the solvent was evaporated using a rotary evaporator, dissolved in ethyl acetate, washed three times with water, washed once with saturated brine, and the organic phase was collected and dried over anhydrous sodium sulfate. Purification by column chromatography yielded product intermediate 58-9.

[0342] Intermediate 58-9 (10 mmol, 1.0 eq) was dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 50 mL), and potassium hydroxide (40 mmol, 4.0 eq) was added. The reaction was carried out at 50°C for 8 hours. Upon detection, it was confirmed that the reactants had completely converted. The pH was adjusted to 3 by adding 2N HCl solution, and the entire solvent was evaporated using a rotary evaporator. Then, 25 mL of methanol was added, the mixture was filtered, and the filtrate was collected. The filtrate was evaporated using a rotary evaporator to obtain a pale yellow solid. Finally, the pale yellow solid was repeatedly washed with DCM / PE to obtain the white solid product 58-10.

[0343] Intermediate 58-10 (2 mmol, 1.0 eq) was dissolved in 25 mL of ultra-dried toluene, triethylamine (4.4 mmol, 2.2 eq) was added, and under the protection of argon, DPPA (2.4 mmol, 1.2 eq) was added. The mixture was stirred at room temperature for 30 min until all the carboxylic acid starting materials were converted to acyl azides. The mixture was then heated to 75°C and reacted for 4 hours until most of the acyl azides were converted to isocyanates. Excess hydrochloric acid (2 M aqueous solution, >4.0 eq) was added, the temperature was reduced to 60°C, and the mixture was reacted overnight. After adjusting the pH to alkaline with sodium bicarbonate solution, ethyl acetate was added for extraction, and the organic phase was collected. After evaporation-drying in a rotary evaporator, the mixture was separated by silica gel column chromatography to obtain intermediate 58-11.

[0344] Intermediate 58-11 and the carboxylic acid intermediate 58-6 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 50°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain product 58-12. The final product 58-12 is the compound of Example 58.

[0345] (46) Preparation of the compound of Example 59 The synthesis scheme is as follows: TIFF0007893516000228.tif32170

[0346] The products 59-13 (10 mmol, 1.0 eq) and mCPBA (12 mmol, 1.2 eq) obtained above were placed in a round-bottom flask and dissolved in 30 mL of DCM. The mixture was stirred at room temperature for 12 hours. When detection confirmed that the reaction and conversion were complete, triphenylphosphine (5 mmol, 0.5 eq) was added, and the mixture was stirred at room temperature for a further 4 hours. The solvent was evaporated using a rotary evaporator, and the mixture was purified by column chromatography to obtain product 59-14. The final product 59-14 is the compound of Example 59.

[0347] (47) Preparation of the compound of Example 60 The synthesis scheme is as follows: TIFF0007893516000229.tif53170

[0348] The products 60-15 (10 mmol, 1.0 eq) and mCPBA (12 mmol, 1.2 eq) obtained above were placed in a round-bottom flask and dissolved in 30 mL of DCM. The mixture was stirred at room temperature for 12 hours. When detection confirmed that the reaction and conversion were complete, triphenylphosphine (5 mmol, 0.5 eq) was added, and the mixture was stirred at room temperature for a further 4 hours. The solvent was evaporated using a rotary evaporator, and the mixture was purified by column chromatography to obtain intermediate product 60-16.

[0349] Intermediate product 60-16 (3 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 30 mL of DCM. Phosphorus oxychloride (3.6 mmol, 1.2 eq) was added dropwise while stirring under an ice bath, followed by the addition of DMF (1.5 mmol, 0.5 eq). The mixture was stirred at room temperature for 12 hours. Once detection confirmed that the reaction and conversion were complete, saturated sodium bicarbonate solution was added dropwise under an ice bath to adjust the pH of the solution to 8. The mixture was extracted, the organic phase was washed twice with water, and then once with saturated brine. The organic phase was collected and evaporated dry using a rotary evaporator to obtain intermediate product 60-17 without purification.

[0350] Intermediate product 60-17 (3 mmol, 1.0 eq) was placed in a round-bottom flask, dissolved in 30 mL of anhydrous methanol, and sodium methanol (5 M, 30 mmol, 10 e.q.) was added. The mixture was stirred under reflux at 70°C for 12 hours. Upon detection, it was determined that the reaction and conversion were complete. The solvent was evaporated using a rotary evaporator, and appropriate amounts of ethyl acetate and saturated ammonium chloride solution were added for extraction. The organic phase was extracted once with saturated brine, and the organic phase was collected and evaporated using a rotary evaporator to obtain intermediate product 60-18 without purification.

[0351] Intermediate product 60-18 (3 mmol, 1.0 eq) was dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 50 mL), and potassium hydroxide (12 mmol, 4.0 eq) was added. The reaction was carried out at 50°C for 8 hours. Upon detection, it was confirmed that the reactants had completely converted. The pH was adjusted to 3 by adding 2N HCl solution, and the entire solvent was evaporated using a rotary evaporator. Then, 25 mL of methanol was added, the mixture was filtered, and the filtrate was collected. The filtrate was evaporated using a rotary evaporator to obtain a pale yellow solid. Finally, the pale yellow solid was repeatedly washed with DCM / PE to obtain the white solid product 60-19.

[0352] Intermediate 60-19 (2 mmol, 1.0 eq) was dissolved in 25 mL of ultra-dried toluene, triethylamine (4.4 mmol, 2.2 eq) was added, and under the protection of argon, DPPA (2.4 mmol, 1.2 eq) was added. The mixture was stirred at room temperature for 30 min until all the carboxylic acid starting materials were converted to acyl azides. The mixture was then heated to 75°C and reacted for 4 hours until most of the acyl azides were converted to isocyanates. Excess hydrochloric acid (2 M aqueous solution, >4.0 eq) was added, the temperature was reduced to 60°C, and the mixture was reacted overnight. After adjusting the pH to alkaline with sodium bicarbonate solution, ethyl acetate was added for extraction, and the organic phase was collected. After evaporation-drying in a rotary evaporator, the mixture was separated by silica gel column chromatography to obtain intermediate 60-20.

[0353] Intermediate 60-20 and the carboxylic acid intermediate 60-6 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 50°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain product 60-21. The final product 60-21 is the compound of Example 60.

[0354] (48) Preparation of the compound of Example 61 The synthesis scheme is as follows: TIFF0007893516000230.tif74170

[0355] 4-Bromo-2,8-bis(trifluoromethyl)quinoline (61-22, 10 mmol, 1.0 eq), Pd2(dba)3 (0.1 mmol, 0.01 eq), and QPhos 71 mg (0.1 mmol, 0.01 eq) were placed in a round-bottom flask and dissolved in 20 mL of anhydrous tetrahydrofuran. Under the protection of argon, intermediate 61-2 Reformatsky Reagent (20 mmol, 1N, 2.0 eq), dissolved in 20 mL of tetrahydrofuran, was added. The mixture was stirred at room temperature for 30 min. After detection confirmed that the reaction and conversion were complete, the solvent was evaporated using a rotary evaporator, dissolved in ethyl acetate, washed three times with water, and washed once with saturated brine to obtain the organic phase, which was dried over anhydrous sodium sulfate. The mixture was purified by column chromatography to obtain product intermediate 61-23.

[0356] Intermediate 61-23 (10 mmol, 1.0 eq) was dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 50 mL), and potassium hydroxide (40 mmol, 4.0 eq) was added. The reaction was carried out at 50°C for 8 hours. Upon detection, it was confirmed that the reactants had completely converted. The pH was adjusted to 3 by adding 2N HCl solution, and the entire solvent was evaporated using a rotary evaporator. Then, 25 mL of methanol was added, the mixture was filtered, and the filtrate was collected. The filtrate was evaporated using a rotary evaporator to obtain a pale yellow solid. Finally, the pale yellow solid was repeatedly washed with DCM / PE to obtain the white solid product 61-24.

[0357] Intermediate 61-24 (2 mmol, 1.0 eq) was dissolved in 25 mL of ultra-dried toluene, triethylamine (4.4 mmol, 2.2 eq) was added, and under the protection of argon, DPPA (2.4 mmol, 1.2 eq) was added. The mixture was stirred at room temperature for 30 min until all the carboxylic acid starting materials were converted to acyl azides. The mixture was then heated to 75°C and reacted for 4 hours until most of the acyl azides were converted to isocyanates. Excess hydrochloric acid (2 M aqueous solution, >4.0 eq) was added, the temperature was reduced to 60°C, and the mixture was reacted overnight. After adjusting the pH to alkaline with sodium bicarbonate solution, ethyl acetate was added for extraction, and the organic phase was collected. After evaporation and drying in a rotary evaporator, the mixture was separated by silica gel column chromatography to obtain intermediate 61-25.

[0358] Intermediate 61-25 and the carboxylic acid intermediate 61-6 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 50°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain product 61-26. The final product 61-26 is the compound of Example 61.

[0359] (49) Preparation of the compound of Example 62 The synthesis scheme is as follows: TIFF0007893516000231.tif62170

[0360] Intermediate 62-16 (4.4 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 40 mL of DCM. Methyl trifluoromethanesulfonate (4.4 mmol, 1.0 eq) was added dropwise while stirring at room temperature, and the mixture was stirred at room temperature for 1 hour. The solvent was evaporated using a rotary evaporator, and 20 mL of anhydrous acetonitrile was added to dissolve it. The mixture was stirred under a dry ice acetone bath, and difluorobromomethyltrimethylsilane (19.8 mmol, 4.5 eq) and triphenylphosphine (13.2 mmol, 3.0 eq) were added in sequence. Next, HMPA was added dropwise, and the mixture was stirred for 3 hours. The ice bath was removed, and the mixture was stirred at room temperature for 15 minutes. The mixture was further stirred under a dry ice acetone bath, and triethylamine (22.0 mmol, 5.0 eq) and 20 mL of water were added in sequence. The ice bath was removed, and the mixture was stirred at room temperature for 12 hours. Upon detection, if the reaction and conversion were complete, an appropriate amount of water and MTBE were added for extraction, washed once with saturated brine, and the organic phase was collected and dried over anhydrous sodium sulfate. Purification by column chromatography yielded product intermediate 62-27.

[0361] Intermediate 62-27 (10 mmol, 1.0 eq) was dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 50 mL), and potassium hydroxide (40 mmol, 4.0 eq) was added. The reaction was carried out at 50°C for 8 hours. Upon detection, it was confirmed that the reactants had completely converted. The pH was adjusted to 3 by adding 2N HCl solution, and the entire solvent was evaporated using a rotary evaporator. Then, 25 mL of methanol was added, the mixture was filtered, and the filtrate was collected. The filtrate was evaporated using a rotary evaporator to obtain a pale yellow solid. Finally, the pale yellow solid was repeatedly washed with DCM / PE to obtain the white solid product 62-28.

[0362] Intermediate 62-28 (2 mmol, 1.0 eq) was dissolved in 25 mL of ultra-dried toluene, triethylamine (4.4 mmol, 2.2 eq) was added, and under the protection of argon, DPPA (2.4 mmol, 1.2 eq) was added. The mixture was stirred at room temperature for 30 min until all the carboxylic acid starting materials were converted to acyl azides. The mixture was then heated to 75°C and reacted for 4 hours until most of the acyl azides were converted to isocyanates. Excess hydrochloric acid (2 M aqueous solution, >4.0 eq) was added, the temperature was reduced to 60°C, and the mixture was reacted overnight. After adjusting the pH to alkaline with sodium bicarbonate solution, ethyl acetate was added for extraction, and the organic phase was collected. After evaporation and drying in a rotary evaporator, the mixture was separated by silica gel column chromatography to obtain intermediate 62-29.

[0363] Intermediate 62-29 and carboxylic acid intermediate 6 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 50°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain product 62-30. The final product 62-30 is the compound of Example 62.

[0364] (50) Preparation of the compound of Example 63 The synthesis scheme is as follows: TIFF0007893516000232.tif63170

[0365] Methyl 2-methyl-5-bromobenzoate 63-36 (10 mmol, 1.0 eq), piperidone-4-ethylene ketal (10 mmol, 1.0 eq)Pd2(dba)3 (0.2 mmol, 0.02 eq), XPhos (0.8 mmol, 0.08 eq), and cesium carbonate (40 mmol, 4.0 eq) were dissolved in 50 mL of toluene, placed in a sealed tube, and heated to 110°C under the protection of Ar, and reacted overnight. The mixture was washed with water and ethyl acetate, and the organic phase was removed. The product intermediate 63-37 was obtained by column chromatography. Intermediate product 63-37 (10 mmol, 1.0 eq) was placed in a round-bottom flask, dissolved in 30 mL of acetone, and 10 mL of 5N hydrochloric acid was added. The mixture was heated at 60°C for 4 hours under reflux and stirred, and then stirred overnight at room temperature. After the reaction was complete, the solvent was evaporated using a rotary evaporator, and the organic phase was obtained by extraction with water and ethyl acetate. The product intermediate 63-38 was obtained by column chromatography.

[0366] Intermediate product 63-38 (3.3 mmol, 1.0 eq) was placed in a round-bottom flask, dissolved in 15 mL of anhydrous methanol, and sodium borohydride (3.7 mmol, 1.1 eq) was added while stirring under an ice bath. Then, the ice bath was removed and the mixture was stirred at room temperature for 6 hours. After the reaction was complete, the solvent was evaporated using a rotary evaporator, and the organic phase was obtained by extraction with water and ethyl acetate. The product intermediate 63-39 was obtained by column chromatography.

[0367] Intermediate 63-39 (2.0 mmol, 1.0 eq) was dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 50 mL), and potassium hydroxide (8 mmol, 4.0 eq) was added. The reaction was carried out at 50°C for 8 hours. Upon detection, it was confirmed that the reactants had completely converted. The solvent was evaporated using a rotary evaporator, 2N HCl solution was added to adjust the pH to 1, ethyl acetate was added for extraction, the organic phase was extracted once with saturated brine, and the organic phase was collected and evaporated using a rotary evaporator to obtain the white solid product 63-40.

[0368] Intermediate 63-40 and the amine intermediate 63-41 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 50°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain product 63-42. The final product 63-42 is the compound of Example 63.

[0369] (51) Preparation of the compound of Example 64 The synthesis scheme is as follows: TIFF0007893516000233.tif72170

[0370] The products 64-13 (10 mmol, 1.0 eq) and mCPBA (12 mmol, 1.2 eq) obtained above were placed in a round-bottom flask and dissolved in 30 mL of DCM. The mixture was stirred at room temperature for 12 hours. When detection confirmed that the reaction and conversion were complete, triphenylphosphine (5 mmol, 0.5 eq) was added, and the mixture was stirred at room temperature for a further 4 hours. The solvent was evaporated using a rotary evaporator, and the mixture was purified by column chromatography to obtain intermediate product 64-43.

[0371] Intermediate product 64-43 (10 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 30 mL of DCM. Phosphorus oxychloride (12 mmol, 1.2 eq) was added dropwise while stirring under an ice bath, followed by the addition of DMF (5 mmol, 0.5 eq). The mixture was stirred at room temperature for 12 hours. Once detection confirmed that the reaction and conversion were complete, saturated sodium bicarbonate solution was added dropwise under an ice bath to adjust the pH of the solution to 8. The mixture was extracted, the organic phase was washed twice with water, and then once with saturated brine. The organic phase was collected and evaporated dry using a rotary evaporator to obtain intermediate product 64-44 without purification.

[0372] Intermediate product 64-44 (10 mmol, 1.0 eq) was placed in a round-bottom flask, dissolved in 30 mL of anhydrous methanol, and sodium methanol (5 M, 100 mmol, 10 e.q.) was added. The mixture was stirred under reflux at 70°C for 12 hours. Upon detection, it was determined that the reaction and conversion were complete. The solvent was evaporated using a rotary evaporator, and appropriate amounts of ethyl acetate and saturated ammonium chloride solution were added for extraction. The organic phase was extracted once with saturated brine, and the organic phase was collected and evaporated using a rotary evaporator to obtain intermediate product 64-45 without purification.

[0373] Intermediate product 64-45 (10 mmol, 1.0 eq), 3-(dimethylamino)azetidine (10 mmol, 1.0 eq)Pd2(dba)3 (0.2 mmol, 0.02 eq), XPhos (0.8 mmol, 0.08 eq), and cesium carbonate (40 mmol, 4.0 eq) were dissolved in 50 mL of toluene, placed in a sealed tube, and heated to 110°C under the protection of Ar, and reacted overnight. Water and ethyl acetate were added to wash, and the organic phase was removed. Product 64-46 was obtained by column chromatography. The final product 64-46 is Example 64.

[0374] (52) Preparation of the compound of Example 65 The synthesis scheme is as follows: TIFF0007893516000234.tif41170

[0375] Intermediate product 65-13 (10 mmol, 1.0 eq), 2-(azetidine-3-yl)propan-2-ol (10 mmol, 1.0 eq)Pd2(dba)3 (0.2 mmol, 0.02 eq), XPhos (0.8 mmol, 0.08 eq), and cesium carbonate (40 mmol, 4.0 eq) were dissolved in 50 mL of toluene, placed in a sealed tube, and heated to 110°C under the protection of Ar for 6 hours. The mixture was washed with water and ethyl acetate to obtain the organic phase. Product 65-47 was obtained by column chromatography. The final product 65-47 is the compound of Example 65.

[0376] (53) Preparation of the compound of Example 66 The synthesis scheme is as follows: TIFF0007893516000235.tif30170

[0377] Intermediate product 66-13 (10 mmol, 1.0 eq), (3-azabicyclo[3.1.0]-6-hexyl)-carbamate tert-butyl (10 mmol, 1.0 eq)Pd2(dba)3 (0.2 mmol, 0.02 eq), XPhos (0.8 mmol, 0.08 eq), and cesium carbonate (40 mmol, 4.0 eq) were dissolved in 50 mL of toluene, placed in a sealed tube, and heated to 110°C under the protection of Ar for 6 hours. The mixture was washed with water and ethyl acetate to obtain the organic phase. Intermediate product 66-48 was obtained by column chromatography.

[0378] Intermediate product 66-48 (10 mmol, 1.0 eq) was placed in a round-bottom flask, dissolved in 50 mL of DCM, and then dioxane hydrochloride solution (4.0 M, 40 mmol, 4.0 eq) was added. The mixture was stirred overnight at room temperature. Once the reaction was complete, the solvent was evaporated using a rotary evaporator, and saturated sodium carbonate solution and DCM were added for extraction. The organic phase was dried over anhydrous magnesium sulfate, filtered by suction, and the solvent was evaporated using a rotary evaporator. Finally, the mixture was slurryed with DCM / cyclohexane to obtain product 66-49 as a yellow solid. The final product 66-49 is the compound of Example 66.

[0379] The manufacturing method for sub-scheme step 2 is as follows: TIFF0007893516000236.tif34170

[0380] Manufacturing of intermediate 66-4i The synthesis scheme is as follows: TIFF0007893516000237.tif34170

[0381] 2260 mg (10 mmol, 1.0 eq.) of 4-bromo-8-fluoroquinoline 66-3i was weighed, and 91.5 mg (0.1 mmol, 0.01 eq.) of Pd2(dba)3 and 71 mg (0.1 mmol, 0.01 eq.) of Qphos were added. The mixture was dissolved in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, the intermediate 66-2 Reformatsky reagent (20 mmol, 1N, 2.0 eq.) dissolved in 20 mL of tetrahydrofuran was added. The mixture was stirred at room temperature for 30 min. After detection, it was confirmed that the reaction and conversion were complete. The solvent was evaporated using a rotary evaporator, then dissolved in ethyl acetate, washed three times with water, and once with saturated brine. The organic phase was collected and dried over anhydrous sodium sulfate. The mixture was purified by column chromatography to obtain the product intermediate 66-4i.

[0382] Manufacturing of intermediate 66-4j The synthesis scheme is as follows: TIFF0007893516000238.tif35170

[0383] 2730 mg (10 mmol, 1.0 eq.) of 1-bromo-4-(difluoromethoxy)naphthalene 66-3j was weighed, and 91.5 mg (0.1 mmol, 0.01 eq.) of Pd2(dba)3 and 71 mg (0.1 mmol, 0.01 eq.) of Qphos were added. The mixture was dissolved in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, the intermediate 66-2 Reformatsky reagent (20 mmol, 1N, 2.0 eq.) dissolved in 20 mL of tetrahydrofuran was added. The mixture was stirred at room temperature for 30 min. After detection, it was confirmed that the reaction and conversion were complete. The solvent was evaporated using a rotary evaporator, then dissolved in ethyl acetate, washed three times with water, and once with saturated brine. The organic phase was collected and dried over anhydrous sodium sulfate. The mixture was purified by column chromatography to obtain the product intermediate 66-4j.

[0384] Production of intermediate 66-4k The synthesis scheme is as follows: TIFF0007893516000239.tif35170

[0385] 2740 mg (10 mmol, 1.0 eq.) of 5-bromo-8-(difluoromethoxy)quinoline 66-3k was weighed, and 91.5 mg (0.1 mmol, 0.01 eq.) of Pd2(dba)3 and 71 mg (0.1 mmol, 0.01 eq.) of Qphos were added. The mixture was dissolved in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, the intermediate 66-2 Reformatsky reagent (20 mmol, 1N, 2.0 eq.) dissolved in 20 mL of tetrahydrofuran was added. The mixture was stirred at room temperature for 30 min. After detection, it was confirmed that the reaction and conversion were complete. The solvent was evaporated using a rotary evaporator, then dissolved in ethyl acetate, washed three times with water, and once with saturated brine. The organic phase was collected and dried over anhydrous sodium sulfate. The mixture was purified by column chromatography to obtain the product intermediate 66-4k.

[0386] Production of intermediate 66-4l The synthesis scheme is as follows: TIFF0007893516000240.tif34170

[0387] 2320 mg (10 mmol, 1.0 eq.) of 4-bromo-1-naphthonitrile 66-3L was weighed, and 91.5 mg (0.1 mmol, 0.01 eq.) of Pd2(dba)3 and 71 mg (0.1 mmol, 0.01 eq.) of Qphos were added. The mixture was dissolved in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, the intermediate 66-2 Reformatsky reagent (20 mmol, 1N, 2.0 eq.) dissolved in 20 mL of tetrahydrofuran was added. The mixture was stirred at room temperature for 30 min. After detection, it was confirmed that the reaction and conversion were complete. The solvent was evaporated using a rotary evaporator, then dissolved in ethyl acetate, washed three times with water, and once with saturated brine. The organic phase was collected and dried over anhydrous sodium sulfate. The mixture was purified by column chromatography to obtain the product intermediate 66-4L.

[0388] The manufacturing method for sub-scheme step 3 is as follows: TIFF0007893516000241.tif76170

[0389] Manufacturing of intermediate 66-5i The synthesis scheme is as follows: TIFF0007893516000242.tif29170

[0390] Intermediate 66-4i 2450 mg (10 mmol, 1.0 eq) was weighed and dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 65 mL), and potassium hydroxide 2240 mg (40 mmol, 4.0 eq) was added. The reaction was carried out at 50°C for 8 hours. Upon detection, it was confirmed that the reactants had completely converted. The pH was adjusted to 3 by adding 2N HCl solution, and the entire solvent was evaporated using a rotary evaporator. Then, 25 mL of methanol was added, the mixture was filtered, and the filtrate was collected. The filtrate was evaporated using a rotary evaporator to obtain a gray solid. Finally, the gray solid was washed repeatedly with DCM / PE to obtain the white solid product 66-5i. TIFF0007893516000243.tif39170

[0391] The scheme for producing intermediates 66-5j to 66-5l is the same as the method for producing intermediate 66-5i. The manufacturing scheme for sub-scheme step 4 is as follows: TIFF0007893516000244.tif79170

[0392] Manufacturing of intermediate 66-6i The synthesis scheme is as follows: TIFF0007893516000245.tif29170

[0393] 462 mg (2 mmol, 1.0 eq) of intermediate 66-5i was weighed and dissolved in 25 mL of ultra-dried toluene. 0.611 mL (4.4 mmol, 2.2 eq) of triethylamine was added, and under Ar protection, 0.516 mL (2.4 mmol, 1.2 eq) of DPPA was added. The mixture was stirred at room temperature for 30 min until all the carboxylic acid starting materials were converted to acyl azides. The mixture was then heated to 75°C and reacted for 4 hours until most of the acyl azides were converted to isocyanates. Excess hydrochloric acid (2 M aqueous solution, >4.0 eq) was added, the temperature was reduced to 60°C, and the mixture was reacted overnight. After adjusting the pH to alkaline with sodium bicarbonate solution, ethyl acetate was added for extraction. The organic phase was added to 2.5 ml of HCl (4 M HCl in Dioxane, 10 mmol, 2.0 eq) solution, filtered through a sand core funnel, and washed multiple times with petroleum ether and ethyl acetate to obtain the white powder product 66-6i. TIFF0007893516000246.tif41170

[0394] The intermediate 66-6j to 66-6l scheme is the same as the method for producing intermediate 66-6a. The method for producing the final product using sub-scheme step 7 is as follows: TIFF0007893516000247.tif40170

[0395] (54) Preparation of the compound of Example 67 The synthesis scheme is as follows: TIFF0007893516000248.tif40170

[0396] 202 mg (1 mmol, 1.0 eq) of amine intermediate 67-6i, 234 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 67-10, and 890 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of DMF, and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq) of HATU was added and the mixture was reacted at room temperature for 3 hours. Once the reaction starting materials were completely converted, the reaction mixture was washed with water and ethyl acetate to remove the DMF, and the organic phase was collected. The crude product was evaporated using a rotary evaporator and purified by passing it through a column to obtain the compound of Example 67, which was the final product WSZ390.

[0397] (55) Preparation of the compound of Example 68 The synthesis scheme is as follows: TIFF0007893516000249.tif40170

[0398] 249 mg (1 mmol, 1.0 eq) of amine intermediate 68-6j, 234 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 68-10, and 890 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of DMF, and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq) of HATU was added and the mixture was reacted at room temperature for 3 hours. Once the reaction starting materials were completely converted, the reaction mixture was washed with water and ethyl acetate to remove the DMF, and the organic phase was collected. The crude product was evaporated using a rotary evaporator and purified by passing it through a column to obtain the compound of Example 68, which was the final product WSZ334.

[0399] (56) Preparation of the compound of Example 69 The synthesis scheme is as follows: TIFF0007893516000250.tif40170

[0400] 250 mg (1 mmol, 1.0 eq) of amine intermediate 69-6k, 234 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 69-10, and 890 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of DMF, and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq) of HATU was added and the mixture was reacted at room temperature for 3 hours. Once the reaction starting materials were completely converted, the reaction mixture was washed with water and ethyl acetate to remove the DMF, and the organic phase was collected. The crude product was evaporated using a rotary evaporator and purified by passing it through a column to obtain the final product 3W, which is the compound of Example 69.

[0401] (57) Preparation of the compound of Example 70 The synthesis scheme is as follows: TIFF0007893516000251.tif40170

[0402] 208 mg (1 mmol, 1.0 eq) of amine intermediate 70-6L, 234 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 70-10, and 890 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of DMF, and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq) of HATU was added and the mixture was reacted at room temperature for 3 hours. Once the reaction starting materials were completely converted, the reaction mixture was washed with water and ethyl acetate to remove the DMF, the organic phase was collected, and the crude product was evaporated using a rotary evaporator. The crude product was then purified by passing it through a column to obtain the compound of Example 70, which is the final product WSZ372.

[0403] (58) Preparation of the compounds of Examples 73, 74, 75, 76, 77, 78, 81, 82, and 83 The synthesis scheme is as follows:

[0404] 1. Production of intermediate A-5a The synthesis scheme is as follows: TIFF0007893516000252.tif29170

[0405] Intermediate A-4a 2518 mg (11.09 mmol, 1.0 eq) was weighed and dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 65 mL), and potassium hydroxide 2484 mg (44.37 mmol, 4.0 eq) was added. The reaction was carried out at 50°C for 8 hours. Upon detection, it was confirmed that the reactants had completely converted. 2N HCl solution was added to adjust the pH to 3, and all of the solvent was evaporated using a rotary evaporator. 25 mL of methanol was then added, the mixture was filtered, and the filtrate was collected. The filtrate was evaporated using a rotary evaporator to obtain a gray solid. Finally, the gray solid was washed repeatedly with DCM / PE to obtain the white solid product A-5a. TIFF0007893516000253.tif32170

[0406] The scheme for intermediates A-5b to A-5f is the same as the method for producing intermediate A-5a. 2. The manufacturing scheme for sub-scheme step 4 is as follows: TIFF0007893516000254.tif34170

[0407] 3. Production of intermediate A-6a The synthesis scheme is as follows: TIFF0007893516000255.tif29170

[0408] Intermediate A-5a 426 mg (2 mmol, 1.0 eq) was weighed and dissolved in 25 mL of ultra-dried toluene. Triethylamine 0.611 mL (4.4 mmol, 2.2 eq) was added, and under Ar protection, DPPA 0.516 mL (2.4 mmol, 1.2 eq) was added. The mixture was stirred at room temperature for 30 min until all the carboxylic acid starting materials were converted to acyl azides. The mixture was then heated to 75 °C and reacted for 4 hours until most of the acyl azides were converted to isocyanates. Excess hydrochloric acid (2 M aqueous solution, >4.0 eq) was added, the temperature was reduced to 60 °C, and the mixture was reacted overnight. Sodium bicarbonate solution was added to adjust the pH to alkaline, and then ethyl acetate was added for extraction. Column chromatography yielded the white powder product A-6a. TIFF0007893516000256.tif28170

[0409] 4. Production of intermediate A-6b The synthesis scheme is as follows: TIFF0007893516000257.tif28170

[0410] Intermediate A-5a 426 mg (2 mmol, 1.0 eq) was weighed and dissolved in 25 mL of ultra-dried toluene. Triethylamine 0.611 mL (4.4 mmol, 2.2 eq) was added, and under Ar protection, DPPA 0.516 mL (2.4 mmol, 1.2 eq) was added. The mixture was stirred at room temperature for 30 min until all the carboxylic acid starting materials were converted to acyl azides. The mixture was then heated to 75 °C and reacted for 4 hours until most of the acyl azides were converted to isocyanates. 4 M water was added, the temperature was reduced to 60 °C, and the mixture was reacted overnight. Sodium bicarbonate solution was added to adjust the pH to alkaline, and then ethyl acetate was added for extraction. Column chromatography yielded the gray powder product A-6b.

[0411] The scheme for intermediates A-6c to A-6g is the same as the method for producing intermediate A-6a.

[0412] 5. The manufacturing scheme for sub-scheme step 5 is as follows: TIFF0007893516000258.tif32170

[0413] 6. Production of intermediate A-9a The synthesis scheme is as follows: TIFF0007893516000259.tif45170

[0414] 4580 mg (20 mmol, 1.0 eq) of 2-methyl-5-bromobenzoate methyl A-8, 3740 mg (22 mmol, 1.1 eq) of 3-(dimethylamino)azetidine dihydrochloride A-7a, 3370 mg (0.4 mmol, 0.02 eq) of Pd2(dba), 760 mg (1.6 mmol, 0.08 eq) of XPhos, and 26080 mg (80 mmol, 4.0 eq) of cesium carbonate were weighed and dissolved in 100 mL of toluene. The mixture was placed in a sealed tube, heated to 110°C under the protection of Ar, and left overnight. The mixture was washed with water and ethyl acetate to obtain the organic phase. The product intermediate A-9a was obtained by column chromatography.

[0415] 7. The manufacturing method for sub-scheme step 6 is as follows: TIFF0007893516000260.tif32170

[0416] 8. Production of intermediate A-10a The synthesis scheme is as follows: TIFF0007893516000261.tif41170

[0417] Intermediate A-9a (10 mmol, 1 eq.) was weighed and dissolved in a mixed solution of 25 mL of methanol and 25 mL of water. Potassium hydroxide (40 mmol, 4 eq.) was added, and the mixture was heated at 60°C and stirred overnight. After the reaction was complete, excess hydrochloric acid was added to adjust the pH of the reaction solution to acidity (it should not be excessively acidic due to the risk of cyclization of the product). The solvent was completely evaporated using a rotary evaporator (after the first evaporation using the rotary evaporator, small amounts of methanol were added in several stages and evaporated using the rotary evaporator to remove as much water as possible). After adding methanol and stirring, the mixture was filtered by suction filtration. If the filtered solid contained a large amount of product, the solid was dissolved multiple times with methanol and filtered by suction filtration until no more solid was dissolved (no fluorescence was detected by UV detection in thin-layer chromatography). The filtrate was collected and concentrated, then recrystallized with dichloromethane to obtain product intermediate A-10a.

[0418] 9. The method for producing the final product using sub-scheme step 7 is as follows: TIFF0007893516000262.tif34170

[0419] 10. Preparation of the compound of Example 74 The synthesis scheme is as follows: TIFF0007893516000263.tif40170

[0420] 214 mg (1 mmol, 1.0 eq) of amine intermediate 74-6b, 270 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 74-10a, and 100 8 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 10 mL of DMF, and stirred until completely dissolved. 668 mg (1.5 mmol, 1.5 eq) of HATU was added, and the reaction was allowed to proceed at room temperature for 3 hours. Once the reaction starting materials were completely converted, the reaction mixture was washed with water and ethyl acetate to remove the DMF, and the organic phase was collected. The crude product was evaporated using a rotary evaporator and purified by passing it through a column to obtain the compound of Example 74, which was the final product XCH-96.

[0421] 11. Preparation of the compound of Example 73 The synthesis scheme is as follows: TIFF0007893516000264.tif40170

[0422] 200 mg (1 mmol, 1.0 eq) of amine intermediate 73-6g, 270 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 73-10a, and 100 8 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 10 mL of DMF, and stirred until completely dissolved. 668 mg (1.5 mmol, 1.5 eq) of HATU was added and the mixture was reacted at room temperature for 3 hours. Once the reaction starting materials were completely converted, the reaction mixture was washed with water and ethyl acetate to remove the DMF, the organic phase was collected, and the crude product was evaporated using a rotary evaporator. The crude product was then purified by passing it through a column to obtain the compound of Example 73, which was the final product XCH-95.

[0423] 12. Preparation of the compound of Example 75 The synthesis scheme is as follows: TIFF0007893516000265.tif40170

[0424] 198 mg (1 mmol, 1.0 eq) of amine intermediate 75-6c, 270 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 75-10a, and 100 8 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 10 mL of DMF, and stirred until completely dissolved. 668 mg (1.5 mmol, 1.5 eq) of HATU was added and the mixture was reacted at room temperature for 3 hours. Once the reaction starting materials were completely converted, the reaction mixture was washed with water and ethyl acetate to remove the DMF, and the organic phase was collected. The crude product was evaporated using a rotary evaporator and purified by passing it through a column to obtain the compound of Example 75, which was the final product XCH-118.

[0425] 13. Preparation of the compound of Example 76 The synthesis scheme is as follows: TIFF0007893516000266.tif37170

[0426] 214 mg (1 mmol, 1.0 eq) of amine intermediate 76-6d, 270 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 76-10a, and 100 8 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 10 mL of DMF, and stirred until completely dissolved. 668 mg (1.5 mmol, 1.5 eq) of HATU was added and the mixture was reacted at room temperature for 3 hours. Once the reaction starting materials were completely converted, the reaction mixture was washed with water and ethyl acetate to remove the DMF, and the organic phase was collected. The crude product was evaporated using a rotary evaporator and purified by passing it through a column to obtain the compound of Example 76, which was the final product XCH-120.

[0427] 14. Preparation of the compound of Example 77 The synthesis scheme is as follows: TIFF0007893516000267.tif39170

[0428] 191 mg (1 mmol, 1.0 eq) of amine intermediate 77-6e, 270 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 77-10a, and 100 8 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 10 mL of DMF, and stirred until completely dissolved. 668 mg (1.5 mmol, 1.5 eq) of HATU was added and the mixture was reacted at room temperature for 3 hours. Once the reaction materials were completely converted, the reaction mixture was washed with water and ethyl acetate to remove the DMF, and the organic phase was collected. The crude product was evaporated using a rotary evaporator and purified by passing it through a column to obtain Example 77, which is the final product XCH-130.

[0429] 15. Preparation of the compound of Example 78 The synthesis scheme is as follows: TIFF0007893516000268.tif40170

[0430] 177 mg (1 mmol, 1.0 eq) of amine intermediate 78-6f, 270 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 78-10a, and 100 8 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 10 mL of DMF, and stirred until completely dissolved. 668 mg (1.5 mmol, 1.5 eq) of HATU was added, and the reaction was allowed to proceed at room temperature for 3 hours. Once the reaction starting materials were completely converted, the reaction mixture was washed with water and ethyl acetate to remove the DMF, and the organic phase was collected. The crude product was evaporated using a rotary evaporator and purified by passing it through a column to obtain the compound of Example 78, which was the final product XCH-136.

[0431] The manufacturing method for sub-scheme step 8 is as follows: TIFF0007893516000269.tif37170

[0432] 2-methyl-5-bromobenzoic acid and the three-membered cyclic amine intermediate 78-6a obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 25°C for 3 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. After purification by silica gel column chromatography, intermediate 78-11 was obtained.

[0433] The method for producing the final product using sub-scheme step 9 is as follows: TIFF0007893516000270.tif63170

[0434] 16. Preparation of the intermediate compound XCH-200-Boc compound of Example 81 The synthesis scheme is as follows: TIFF0007893516000271.tif34170

[0435] 399 mg (1 mmol, 1.0 eq) of 81-11, 222 mg (1 mmol, 1.1 eq) of 3-(dimethylamino)azetidine dihydrochloride 81-7a, 323 mg (0.025 mmol, 0.02 eq) of Pd2(dba), 24 mg (0.05 mmol, 0.04 eq) of XPhos, and 1220 mg (80 mmol, 3.0 eq) of cesium carbonate were weighed and dissolved in 10 mL of toluene. The mixture was placed in a sealed tube, heated to 110°C under the protection of Ar, and left overnight. The mixture was washed with water and ethyl acetate to obtain the organic phase. The product intermediate XCH-200-Boc was obtained by column chromatography.

[0436] 17. Preparation of the compound of Example 81 The synthesis scheme is as follows: TIFF0007893516000272.tif34170

[0437] 252 mg (0.5 mmol, 1.0 eq) of XCH-200-Boc was weighed, dissolved in 3 mL of toluene, and 1 mL of trifluoroacetic acid was added. The mixture was placed in a flask and stirred overnight at room temperature. Saturated sodium bicarbonate aqueous solution and ethyl acetate were added for extraction, and the organic phase was obtained. Column chromatography yielded the final product, XCH-200, which is the compound of Example 81.

[0438] 18. Preparation of the intermediate compound XCH-205-Boc of Example 82 The synthesis scheme is as follows: TIFF0007893516000273.tif34170

[0439] 82-11 399 mg (1 mmol, 1.0 eq), 3-(dimethylamino)azetidine dihydrochloride 82-7b 244 mg (1 mmol, 1.1 eq), Pd2(dba) 323 mg (0.025 mmol, 0.02 eq), XPhos 24 mg (0.05 mmol, 0.04 eq), and cesium carbonate 1220 mg (80 mmol, 3.0 eq) were weighed, dissolved in 10 mL of toluene, placed in a sealed tube, heated to 110°C under the protection of Ar, and left overnight. Water and ethyl acetate were added to wash, and the organic phase was obtained. The product intermediate XCH-205-Boc was obtained by column chromatography.

[0440] 19. Preparation of the compound of Example 82 The synthesis scheme is as follows: TIFF0007893516000274.tif34170

[0441] 252 mg (0.5 mmol, 1.0 eq) of XCH-205-Boc was weighed and dissolved in 3 mL of toluene. 1 mL of trifluoroacetic acid was added, and the mixture was placed in a flask and stirred overnight at room temperature. Saturated sodium bicarbonate aqueous solution and ethyl acetate were added for extraction, and the organic phase was obtained. Column chromatography yielded the final product, XCH-205, which is the compound of Example 82.

[0442] 20. Preparation of the compound of Example 83 The synthesis scheme is as follows: TIFF0007893516000275.tif34170

[0443] 399 mg (1 mmol, 1.0 eq) of 83-11, 244 mg (1 mmol, 1.1 eq) of 3-(dimethylamino)azetidine dihydrochloride 83-7c, 323 mg (0.025 mmol, 0.02 eq) of Pd2(dba), 24 mg (0.05 mmol, 0.04 eq) of XPhos, and 1220 mg (80 mmol, 3.0 eq) of cesium carbonate were weighed and dissolved in 10 mL of toluene. The mixture was placed in a sealed tube, heated to 110°C under the protection of Ar, and left overnight. The mixture was washed with water and ethyl acetate to obtain the organic phase. The final product, XCH-208, of Example 83 was obtained by column chromatography.

[0444] (59) Preparation of Compounds in Examples 79 and 80 The synthesis scheme is as follows:

[0445] Example 79: Preparation of the compound The synthesis scheme is as follows: TIFF0007893516000276.tif31170

[0446] 183 mg (1 mmol, 1.0 eq) of 79-1x, 122 mg (1 mmol, 1.0 eq) of 79-2c, 33 μL (1 mmol, 1 eq) of AcOH, and 3635 mg (3 mmol, 3.0 eq) of NaBH(OAc) were weighed and dissolved in 10 mL of THF. The mixture was placed in a flask and stirred overnight under the protection of Ar. The mixture was washed with saturated sodium bicarbonate aqueous solution and ethyl acetate to obtain the organic phase. Column chromatography yielded the compound of Example 79, which was the final product XCH-193. Nuclear magnetic mass spectrometry confirmed that the Schiff base product had been obtained.

[0447] Preparation of the compound in Example 80 The synthesis scheme is as follows: TIFF0007893516000277.tif31170

[0448] 385 mg (1 mmol, 1.0 eq) of XCH-193, the compound of Example 79, 244 mg (1 mmol, 1.1 eq) of 3-(dimethylamino)azetidine dihydrochloride, 323 mg (0.025 mmol, 0.02 eq) of Pd2(dba), 24 mg (0.05 mmol, 0.04 eq) of XPhos, and 1220 mg (80 mmol, 3.0 eq) of cesium carbonate were weighed and dissolved in 10 mL of toluene. The mixture was placed in a sealed tube, heated to 110°C under the protection of Ar, and left overnight. The mixture was washed with water and ethyl acetate to obtain the organic phase. The final product, XCH-199, the compound of Example 80, was obtained by column chromatography.

[0449] (60) Preparation of the compounds of Examples 84, 85, and 86 The synthesis scheme is as follows: TIFF0007893516000278.tif59170

[0450] The manufacturing scheme for sub-scheme step 1 is as follows: TIFF0007893516000279.tif25170

[0451] Manufacturing of intermediate B-2a The synthesis scheme is as follows: TIFF0007893516000280.tif26170

[0452] 1000 mg (5 mmol, 1.0 eq) of intermediate B-1a was weighed and dissolved in 25 mL of dichloromethane. Under ice bath, 30.313 mL (3.3 mmol, 0.6 eq) of PBr was added. The mixture was stirred at room temperature for 30 minutes, and saturated sodium bicarbonate aqueous solution was added to adjust the pH to alkaline. Ethyl acetate was then added for extraction, and product B-2a was obtained by column chromatography.

[0453] The manufacturing process for intermediate B-2b is the same as that for intermediate B-2a.

[0454] The manufacturing scheme for sub-scheme step 2 is as follows: TIFF0007893516000281.tif30170

[0455] Preparation of the compound in Example 84 The synthesis scheme is as follows: TIFF0007893516000282.tif30170

[0456] 271 mg (1 mmol, 1.0 eq) of 84-2, 190 mg (1 mmol, 1.0 eq) of the three-membered cyclic amine intermediate, and 195 mg (1.5 mmol, 1.5 eq) of K2CO3 were weighed and dissolved in 10 mL of THF. The mixture was placed in a flask and stirred overnight at room temperature under the protection of Ar. The mixture was washed with saturated sodium chloride aqueous solution and ethyl acetate to obtain the organic phase. The compound of Example 84, which was the final product XCH-210, was obtained by column chromatography.

[0457] Production of intermediate 84-3b The synthesis scheme is as follows: TIFF0007893516000283.tif30170

[0458] 271 mg (1 mmol, 1.0 eq) of 84-2b, 190 mg (1 mmol, 1.0 eq) of the three-membered cyclic amine intermediate, and 195 mg (1.5 mmol, 1.5 eq) of K2CO3 were weighed and dissolved in 10 mL of THF. The mixture was placed in a flask and stirred overnight at room temperature under the protection of Ar. The solution was washed with saturated sodium chloride aqueous solution and ethyl acetate to obtain the organic phase. Column chromatography was used to obtain intermediate 84-3b.

[0459] Preparation of the compound in Example 86 The synthesis scheme is as follows: TIFF0007893516000284.tif32170

[0460] 351 mg (1 mmol, 1.0 eq) of 84-3b, 109 mg (2 mmol, 2.0 eq) of ammonium chloride, and 558 mg (10 mmol, 10.0 eq) of Fe were weighed and dissolved in a mixed solvent of 5 mL THF, 5 mL EtOH, and 2.5 mL H2O. The mixture was placed in a flask and stirred at 80°C for 5 hours under the protection of Ar. The mixture was filtered through diatomaceous earth and extracted with ethyl acetate to obtain the organic phase. The final product, XCH-224, of Example 86 was obtained by column chromatography.

[0461] Preparation of the compound in Example 85 The synthesis scheme is as follows: TIFF0007893516000285.tif27170

[0462] 385 mg (1 mmol, 1.0 eq) of XCH-210, the compound of Example 84, 244 mg (1 mmol, 1.1 eq) of 3-(dimethylamino)azetidine dihydrochloride, 323 mg (0.025 mmol, 0.02 eq) of Pd2(dba), 24 mg (0.05 mmol, 0.04 eq) of XPhos, and 1220 mg (80 mmol, 3.0 eq) of cesium carbonate were weighed and dissolved in 10 mL of toluene. The mixture was placed in a sealed tube, heated to 110°C under the protection of Ar, and left overnight. The mixture was washed with water and ethyl acetate to obtain the organic phase. The final product, XCH-211, the compound of Example 85, was obtained by column chromatography.

[0463] (61) Preparation of the compound of Example C87 The synthesis scheme is as follows: TIFF0007893516000286.tif36170

[0464] 2-methyl-5-nitrobenzoic acid and three-membered cyclic amine intermediate 87-1 were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 25°C for 3 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. After purification by silica gel column chromatography, intermediate 87-2 was obtained.

[0465] 365 mg (1 mmol, 1.0 eq) of 87-2, 109 mg (2 mmol, 2.0 eq) of ammonium chloride, and 558 mg (10 mmol, 10.0 eq) of Fe were weighed and dissolved in a mixed solvent of 5 mL THF, 5 mL EtOH, and 2.5 mL H2O. The mixture was placed in a flask and stirred at 80°C for 5 hours under the protection of Ar. The mixture was filtered through diatomaceous earth and extracted with ethyl acetate to obtain the organic phase. The compound of Example 87, the final product XCH-226, was obtained by column chromatography.

[0466] (62) Preparation of the compound of Example 88 The synthesis scheme is as follows: TIFF0007893516000287.tif41170

[0467] 86 mg (0.38 mmol, 1.0 eq) of amine intermediate 88-6-lk401, 106 mg (0.45 mmol, 1.0 eq) of carboxylic acid intermediate 88-10a, and 467 μL (1.9 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 3 mL of THF, and stirred until completely dissolved. 216 mg (0.57 mmol, 1.5 eq) of HATU was added, and the reaction was allowed to proceed at room temperature for 4 hours. Once the reaction starting materials were completely converted, the THF was evaporated using a rotary evaporator, the reaction mixture was washed with water and ethyl acetate, the organic phase was collected, evaporated using a rotary evaporator to obtain the crude product, and purified by passing through a column to obtain the final product lk401, the compound of Example 88.

[0468] (63) Preparation of the compound of Example 89 The synthesis scheme is as follows: TIFF0007893516000288.tif59170

[0469] 5-Bromo-8-fluoroquinoline 89-3 (40 mmol, 1.0 eq), Pd2(dba)3 (0.4 mmol, 0.01 eq), and QPhos 366.3 mg (0.4 mmol, 0.01 eq) were placed in a round-bottom flask and dissolved in 80 mL of anhydrous tetrahydrofuran. Under the protection of argon, intermediate 2 Reformatsky Reagent (80 mmol, 1N, 2.0 eq) dissolved in 20 mL of tetrahydrofuran was added. The mixture was stirred at room temperature for 30 min. After detection confirmed that the reaction and conversion were complete, the solvent was evaporated using a rotary evaporator, dissolved in ethyl acetate, washed three times with water, and washed once with saturated brine to obtain the organic phase, which was dried over anhydrous sodium sulfate. The product was purified by column chromatography to obtain intermediate product 89-4.

[0470] The intermediate 89-4 (10 mmol, 1.0 eq) and m-CPBA (12 mmol, 1.2 eq) obtained above were placed in a round-bottom flask and dissolved in 30 mL of DCM. The mixture was stirred at room temperature for 12 hours. When detection confirmed that the reaction and conversion were complete, triphenylphosphine (5 mmol, 0.5 eq) was added, and the mixture was stirred at room temperature for a further 4 hours. The solvent was evaporated using a rotary evaporator, and the mixture was purified by column chromatography to obtain intermediate product 89-5.

[0471] Intermediate product 89-5 (3 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 30 mL of DCM. Phosphorus oxychloride (3.6 mmol, 1.2 eq) was added dropwise while stirring under an ice bath, followed by the addition of DMF (1.5 mmol, 0.5 eq). The mixture was stirred at room temperature for 12 hours. Once detection confirmed that the reaction and conversion were complete, saturated sodium bicarbonate solution was added dropwise under an ice bath to adjust the pH of the solution to 8. The mixture was extracted with ethyl acetate, the organic phase was washed twice with water, and then once with saturated brine. The organic phase was collected and evaporated dry using a rotary evaporator to obtain intermediate product 89-6 without purification.

[0472] Intermediate product 89-6 (3 mmol, 1.0 eq), methylboric acid (6.6 mmol, 2.2 eq), PdCl2 (dppf) (0.3 mmol, 0.1 eq), and K2CO3 (9 mmol, 3.0 eq) were placed in a round-bottom flask and dissolved in 10 mL of toluene. The mixture was heated at 85°C and stirred for 12 hours. After detection confirmed that the reaction and conversion were complete, the solvent was evaporated using a rotary evaporator, dissolved in ethyl acetate, washed three times with water, and washed once with saturated brine to obtain the organic phase. The organic phase was dried over anhydrous sodium sulfate. Purification by column chromatography yielded product intermediate 89-7.

[0473] Intermediate product 89-7 (3 mmol, 1.0 eq) was dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 50 mL), and potassium hydroxide (12 mmol, 4.0 eq) was added. The reaction was carried out at 50°C for 8 hours. Upon detection, it was confirmed that the reactants had completely converted. The pH was adjusted to 3 by adding 2N HCl solution, and the entire solvent was evaporated using a rotary evaporator. Then, 25 mL of methanol was added, the mixture was filtered, and the filtrate was collected. The filtrate was evaporated using a rotary evaporator to obtain a pale yellow solid. Finally, the pale yellow solid was repeatedly washed with DCM / PE to obtain the white solid product 89-8.

[0474] Intermediate 89-8 (2 mmol, 1.0 eq) was dissolved in 25 mL of ultra-dried toluene, triethylamine (4.4 mmol, 2.2 eq) was added, and under the protection of argon, DPPA (2.4 mmol, 1.2 eq) was added. The mixture was stirred at room temperature for 30 min until all the carboxylic acid starting materials were converted to acyl azides. The mixture was then heated to 75°C and reacted for 4 hours until most of the acyl azides were converted to isocyanates. Excess hydrochloric acid (2 M aqueous solution, >4.0 eq) was added, the temperature was reduced to 60°C, and the mixture was reacted overnight. After adjusting the pH to alkaline with sodium bicarbonate solution, ethyl acetate was added for extraction, and the organic phase was collected. After evaporation and drying in a rotary evaporator, the mixture was separated by silica gel column chromatography to obtain intermediate 89-9.

[0475] Intermediate 89-9 and the carboxylic acid intermediate 89-10 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 50°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain the compound of Example 89, which is the final product XLQ-1170.

[0476] (64) Preparation of the compound of Example 90 The synthesis scheme is as follows: TIFF0007893516000289.tif56170

[0477] 3-(dimethylamino)azetidine dihydrochloride 90-11 (6 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 2 mL of 2 M hydrochloric acid. The mixture was stirred at room temperature, and sodium nitrite (7.2 mmol, 1.2 eq) was dissolved in 1 mL of water and then added dropwise to the reaction mixture. The mixture was stirred at room temperature for 1.5 hours. After detection confirmed that the reaction and conversion were complete, the mixture was extracted three times with ethyl acetate, washed once with saturated brine, and the organic phase was collected and dried over anhydrous sodium sulfate. The mixture was purified by column chromatography to obtain the product and intermediate product 90-12.

[0478] Intermediate 90-12 (3 mmol, 1.0 eq) and sodium methanol (3 mmol, 3.0 eq) were placed in a round-bottom flask, and 1.5 mL of heavy water was slowly added dropwise under the protection of argon. The mixture was heated at 80°C and stirred for 10 hours. After detection confirmed that the reaction and conversion were complete, the mixture was extracted three times with ethyl acetate, washed once with saturated brine, and the organic phase was collected and dried over anhydrous sodium sulfate. The mixture was purified by column chromatography to obtain intermediate product 90-13.

[0479] Intermediate 90-13 (2.59 mmol, 1.0 eq) and sodium methanol (7.77 mmol, 3.0 eq) were placed in a round-bottom flask, and under the protection of argon, 2 mL of heavy water and 2 mL of deuterated ethanol (C2H5OD) were slowly added dropwise. The mixture was then heated to 70°C and reacted for 24 hours. After stopping the heating and cooling to room temperature, Al-Ni alloy (810 mg) was added in batches, and the mixture was stirred overnight at room temperature. The solid metal was removed by suction filtration, the filtrate was collected, extracted with ethyl acetate, washed once with saturated brine, and the organic phase was obtained. The organic phase was dried over anhydrous sodium sulfate, the drying agent was removed by filtration, the organic phase was acidified with a 4 M HCl dioxane solution, and the organic solvent was evaporated using a rotary evaporator to obtain solid product 90-14.

[0480] Intermediate 90-14 (3.84 mmol, 1.1 eq), methyl 2-methyl-5-bromobenzoate 90-15 (3.49 mmol, 1.0 eq), Pd2(dba)3 (0.035 mmol, 0.01 eq), XPhos (0.14 mmol, 0.04 eq), and cesium carbonate (13.96 mmol, 4.0 eq) were dissolved in 20 mL of toluene, placed in a sealed tube, and heated to 110°C under the protection of Ar, and reacted overnight. The mixture was washed with water and ethyl acetate, and the organic phase was removed. The product intermediate 90-16 was obtained by column chromatography.

[0481] Intermediate 90-16 (0.44 mmol, 1 e.q.) was weighed and dissolved in a mixed solution of 1.1 mL of methanol and 1.1 mL of water. Potassium hydroxide (1.76 mmol, 4 e.q.) was added, and the mixture was heated at 60°C and stirred overnight. After the reaction was complete, excess hydrochloric acid was added to adjust the pH of the reaction solution to acidity (it should not be made excessively acidic due to the risk of cyclization of the product). The solvent was completely evaporated using a rotary evaporator, dissolved in ethyl acetate, and the organic phase was dried over anhydrous sodium sulfate. The mixture was purified by column chromatography to obtain intermediate product 90-17.

[0482] Intermediate 90-17 and the cyclopropylamine intermediate 90-18 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 50°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain the compound of Example 90, which is the final product XLQ-1196.

[0483] (65) Preparation of the compound of Example 91 The synthesis scheme is as follows: TIFF0007893516000290.tif65170

[0484] 4-bromoindole 91-19 (10 mmol, 1.0 eq), dimethyl carbonate (29 mmol, 2.9 eq), and potassium carbonate (7 mmol, 0.7 eq) were placed in a round-bottom flask and dissolved in 13 mL of DMF. The mixture was heated at 140°C and stirred for 4 hours. After detection confirmed that the reaction and conversion were complete, the solvent was evaporated using a rotary evaporator, dissolved in ethyl acetate, washed three times with water, and once with saturated brine. The organic phase was collected and dried over anhydrous sodium sulfate. Purification by column chromatography yielded intermediate product 91-20.

[0485] Intermediate 91-20 (2 mmol, 1.0 eq), Pd2(dba)3 (0.02 mmol, 0.01 eq), and QPhos 14.1 mg (0.02 mmol, 0.01 eq) were placed in a round-bottom flask and dissolved in 2 mL of anhydrous tetrahydrofuran. Under argon protection, intermediate 91-2 Reformatsky Reagent (4 mmol, 1N, 2.0 eq) dissolved in 6 mL of tetrahydrofuran was added. The mixture was stirred at room temperature for 30 minutes. After detection confirmed that the reaction and conversion were complete, the solvent was evaporated using a rotary evaporator, dissolved in ethyl acetate, washed three times with water, and washed once with saturated brine to obtain the organic phase, which was dried over anhydrous sodium sulfate. The product was purified by column chromatography to obtain intermediate product 91-21.

[0486] Intermediate product 91-21 (1.88 mmol, 1.0 eq) was dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 2.16 mL), and potassium hydroxide (7.52 mmol, 4.0 eq) was added. The reaction was carried out at 50°C for 8 hours. Upon detection, it was confirmed that the reactants had completely converted. The pH was adjusted to 3 by adding 2N HCl solution, and the entire solvent was evaporated using a rotary evaporator. Then, 15 mL of methanol was added, the mixture was filtered, and the filtrate was collected. The filtrate was evaporated using a rotary evaporator to obtain a pale yellow solid. Finally, the pale yellow solid was repeatedly washed with DCM / PE to obtain the white solid product 91-22.

[0487] Intermediate 91-22 (1.49 mmol, 1.0 eq) was dissolved in 6.4 mL of ultra-dried toluene, triethylamine (3.27 mmol, 2.2 eq) was added, and under the protection of argon, DPPA (1.64 mmol, 1.2 eq) was added. The mixture was stirred at room temperature for 30 min until all the carboxylic acid starting materials were converted to acyl azides. The mixture was then heated to 75°C and reacted for 8 hours until most of the acyl azides were converted to isocyanates. An excess of hydrochloric acid (2 M aqueous solution, >4.0 eq) was added, the temperature was reduced to 60°C, and the mixture was reacted overnight. After adjusting the pH to alkaline with sodium bicarbonate solution, ethyl acetate was added for extraction, and the organic phase was collected. After evaporation-drying in a rotary evaporator, the mixture was separated by silica gel column chromatography to obtain intermediate 91-23.

[0488] Intermediate 91-23 and the carboxylic acid intermediate 10 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 50°C for 12 hours. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated and dried using a rotary evaporator. The mixture was then purified by silica gel column chromatography to obtain the compound of Example 91, which is the final product XLQ-1220.

[0489] Experimental Example 1: Detection of PLpro inhibitory activity of compounds prepared in the above examples Biological test conditions 1.Reaction buffer: 20mM HEPE, pH7.5, 100mM NaCl, 1mM TCEP 2. Preparation of mother liquor (1) 20 μM Ub-AMC (Dissolve the dried Ub-AMC powder directly in the reaction buffer, and remove the precipitate by centrifugation before use.) (2) 400 nM PLpro (purify by molecular sieve, store frozen at -80°C, thaw on ice before use, and dilute with reaction buffer) (3) 40 μM of the test compound (dissolve the dry powder of the test compound in 40 mM DMSO, dilute to 400 μM with 50% DMSO, and then dilute to 40 μM with reaction buffer) 3. Single-point inhibition test reaction system: 10 μM Ub-AMC, 100 nM PLpro, 1 μM test compound, total volume 20 μL, react in a 384-well plate.

[0490] 5 μL of PLpro mother liquor and 5 μL of test compound mother liquor were added to a 384-well plate and incubated at 4°C for 30 minutes.

[0491] 10 μL of Ub-AMC mother liquor was added to a 384-well plate and reacted at 37°C for 30 minutes. After that, the fluorescence intensity of AMC was measured (excitation: 360 nm, emission: 460 nm).

[0492] 4. Control group (+ control): The test compound was replaced with DMSO corresponding to the dilution factor.

[0493] Blank group: PLpro was replaced with the reaction buffer. 5. Data processing: Blank values ​​were subtracted from the measured values ​​and normalized based on the DMSO value.

[0494] 6. IC 50 Measurement Concentration gradient (nM) of the test compound: 10000, 5000, 1000, 500, 250, 125, 62.5, 31.25, 15.625, 10, 5, 2, 1, 0.5, 0.1, 0.01 The fluorescence value was measured after 15 minutes of reaction (the enzyme reaction rate was in the linear interval around 15 minutes and in the nonlinear interval at 30 minutes).

[0495] 7. Data fitting: After normalizing the data, it was processed using Sigmaplot (fitting formula: logistic, 3 parameters).

[0496] The results are shown in the table below. [Table 1] TIFF0007893516000292.tif249170TIFF0007893516000293.tif239170TIFF000 7893516000294.tif244170TIFF0007893516000295.tif239170TIFF00078935160 00296.tif234170TIFF0007893516000297.tif234170TIFF0007893516000298.t if229170TIFF0007893516000299.tif249170TIFF0007893516000300.tif199170

[0497] Here, GRL0617 is a positive reference (Ghosh et al., 2009; Ghosh et al., 2010; Ratia et al., 2008). "-" indicates that the measurement was not taken.

[0498] Live virus experiment on the ability of the compound in Example 26 to inhibit cell infection by the novel coronavirus. To verify the anti-SARS-CoV-2 activity of the compound in Example 26, the anti-SARS-CoV-2 activity of the molecule in Example 26 was detected using a Calu-3 cell infection model with live SARS-CoV-2 virus.

[0499] Equal volumes of SARS-CoV-2 were mixed with a 2-fold dilution of Example 26 and 100 TCID50, and Calu-3 cells were added in a solution of 1 × 10⁶ cells. 4 The cells were added to culture plates containing each well. 100 μL of DMEM + 2% FBS medium was added to each well of the cell culture plate, and the plate was placed in a cell culture incubator. After 48 hours of incubation, the cell supernatant was collected.

[0500] Viral RNA extraction and quantitative real-time PCR (qRT-PCR) were performed according to the manufacturer's instructions. Viral RNA was extracted from the cell supernatant using TRIzol LS reagent (Invitrogen). Detection was performed using the One-Step PrimeScrip RT-PCR Kit (Takara, Japan, Cat.#RR064A) according to the manufacturer's instructions. The RT-PCR program was as follows: Reverse transcription: 95°C 10s, 42°C 5min; PCR reaction: (95°C 5s, 56°C 30s·72°C 30s)*40 cycles. Detection was performed using a BioRad fluorescence quantitative PCR instrument. The primer sequences are as follows: SARS-CoV-2-NF(SEQ ID NO:1): GGGGAACTTCTCCTGCTAGAAT, SARS-CoV-2-NR(SEQ ID NO:2): CAGACATTTTG CTCTCAAGCTG, SARS-CoV-2-N-probe(5'-FAM-SEQ ID NO:3-TAMRA-3'): 5'-FAM- TTGCTGCTGCTTGACAGATT-TAMRA-3'.

[0501] Cell supernatant was collected 48 hours after infection, and the viral RNA copy number in the cell culture supernatant was evaluated by RT-qPCR to calculate the in vitro inhibitory effect of the test drug against SARS-CoV-2 (EC 50 and EC 90 (Measure the value).

[0502] The inhibition rates of the compounds in Example 26 against SARS-CoV-2 live virus (Delta strain) infection are as follows: TIFF0007893516000301.tif70170

[0503] The experiment demonstrated that the compound in Example 26 could more effectively inhibit the infection of human cells by live SARS-CoV-2 virus in in vitro experiments.

Claims

1. Compounds or pharmaceutically acceptable salts, stereoisomers, solvates, and deuterated compounds having the following structures. (Here, Ar １ is a substituted naphthyl, or a substituted or unsubstituted non-naphthalene aromatic group. The aforementioned substituted naphthyl is (Here, R ４１ , R ４２ , R ４３ , R ４４ , R ４５ , R ４６ , R ４７ are independently selected from H, -D, -CH ３ , -X, -CH ２ F, -CHF ２ , -CF ３ , -OH, -CN, -OCH ３ , -OCH ２ X, -OCHX ２ , -OCX ３ , -NH ２ , -NH(C １ ~ C ６ alkyl), -N(C １ ~ C ６ alkyl)(C １ ~ C ６ alkyl), -NO ２ , -COO(C １ ~ C ６ alkyl), -COOH, -CN, -Si(CH ３ ) ３ , -NHSO ２ (C １ ~ C ６ alkyl), -SO ２ NH ２ , -SO ２ (C １ ~ C ６ alkyl), -N(C １ ~ C ６ alkyl)SO ２ (C １ ~ C<000004l> alkyl), -SO ２ NH(C １ ~ C ６ alkyl), -SO ２ N(C １ [[ID=go]] ~ C ６ alkyl)(C １ ~ C ６ alkyl), and R ４１ , R ４２ , R ４３ , R ４４ , R ４５ , R ４６ , R ４７ are not H simultaneously) Selected from, The aforementioned non-naphthalene aromatic group is Is it, The aforementioned non-naphthalene aromatic group is Is it, The aforementioned non-naphthalene aromatic group is Is it, The aforementioned non-naphthalene aromatic group is Is it, The aforementioned non-naphthalene aromatic group is Is it, The aforementioned non-naphthalene aromatic group is And, Here, R ５１ and R ５２ These are independently H, D, -F, -Br, -Cl, -I, and -CH ３ ien-CH ２ F, -CHF ２ , -CF ３ , -COOH, -CN, -COOCH ３ , -NH ２ , - NHCH ３ , -NO ２ , -OCH ３ , -OH, -TMS, -SO ２ CH ３ , - NHSO ２ CH ３ , -SO ２ NH ２ Selected from, W ３ N is, R ６ H, D, CH ３ ien-CH ２ COOH, or -CH ２ COOCH ３ And, R ６１ and R ６２ are, independently, H, -D, -F, -Br, -Cl, -I, -CH ３ , -CH ２ F, -CHF ２ , -CF ３ , -COOH, -CN, -COOCH ３ , -NH ２ , -NHCH ３ , -NO ２ , -OCH ３ , -OH, -TMS, -SO ２ CH ３ , -NHSO ２ CH ３ , -SO ２ NH ２ selected from R ７ and R ７ ’ are independently selected from H, -D, -F, -Br, -Cl, -I, -CH ３ , -CH ２ F, -CHF ２ , -CF ３ , -COOH, -CN, -COOCH ３ , -NH ２ , -NHCH ３ , -NO ２ , -OCH ３ , -OH, -TMS, -SO ２ CH ３ , -NHSO ２ CH ３ , -SO ２ NH ２ and are selected from an unsubstituted morpholine ring, R ８ ' is selected from H, methyl, ethyl, propyl, isopropyl, butyl, and tert-butyl. S １ S ２ S ４ S ５ S ６ CR ９４ And, R ９４ These are H, -D, -F, -Br, -Cl, -I, -CH ３ ien-CH ２ F, -CHF ２ , -CF ３ , -COOH, -CN, -COOCH ３ , -NH ２ , - NHCH ３ , -NO ２ , -OCH ３ , -OH, -TMS, -SO ２ CH ３ , - NHSO ２ CH ３ , -SO ２ NH ２ Selected from, R ７２ and R ７３ These are H, D, -F, -Br, -Cl, -I, -CH ３ ien-CH ２ F, -CHF ２ , -CF ３ , -COOH, -CN, -COOCH ３ , -NH ２ , - NHCH ３ , -NO ２ , -OCH ３ , -OH, -TMS, -SO ２ CH ３ , - NHSO ２ CH ３ , -SO ２ NH ２ Selected from, R ９１ H, -D, C １ -C ６ Selected from alkyl groups, Bは、-F、-C-、-Br、-I、-NH ２ ,-S(O) ｔ NR １５ 、 Selected from, R １３ and R １３ ' are, independently, H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -N ３ , -B(OH) ２ , -R Ｌ -COR', -R Ｌ -C(O)OR', -R Ｌ -C(O)NR'R'', -R Ｌ -CN, -R Ｌ -OR', -R Ｌ -OC(O)R', -R Ｌ -S(O) ｔ -NR'R'', -R Ｌ -S(O) ｔ -R', -R Ｌ -NR'R'', -R Ｌ -NR'C(O)R'', -R Ｌ -NR'S(O) ｔ R'', -R Ｌ -N(S(O) ｔ R')(S(O) ｔ R''), -NR'-R Ｌ -NR''R''', -R Ｌ - NO ２ , -R Ｌ -N=CR'R'', -R Ｌ - Selected from R'R'', R １４ and R １４ ' represents one or more independent substituents on the ring, and are H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -R Ｌ -COR', -R Ｌ -C(O)OR', -R Ｌ -C(O)NR'R'', -R Ｌ -CN, -R Ｌ -OR', -R Ｌ -OC(O)R', -R Ｌ -S(O) ｔ -NR'R'', -R Ｌ -S(O) ｔ -R', -R Ｌ -NR'R'', -R Ｌ -NR'C(O)R'', -R Ｌ -NR'S(O) ｔ R'', -NR'-R Ｌ -NR'R'', -R Ｌ - NO ２ , -R Ｌ -N is selected from CR'R'', R ８３ and R ８４ H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -R Ｌ -CR'R'', -R Ｌ -COR', -R Ｌ -C(O)OR', -R Ｌ -C(O)NR'R'', -R Ｌ -CN, -R Ｌ -OR', -R Ｌ -OC(O)R', -R Ｌ -S(O) ｔ -NR'R'', -R Ｌ -S(O) ｔ -R', -R Ｌ -NR'R'', -R Ｌ -NR'C(O)R'', -R Ｌ -NR'S(O) ｔ R'', -R Ｌ -N(S(O) ｔ R')(S(O) ｔ R''), -NR'-R Ｌ -NR''R''', -R Ｌ - NO ２ , -R Ｌ -N is selected from CR'R'', I understand ５ This is selected from 1, 2, or 3. R １ , R １ ’ , R ２ , R ２ ’ These are independently H, D, (=O), and -C. １ ~C ６ Alkyl, -X, -CH ２ Xen-CHX ２ , -CX ３ -OH, -NH ２ , -COOH, -O(C １ ~C ６ Selected from alkyl groups, L １ It does not exist, L ４ -NR １５ C(O)-, L ６ It does not exist, or -NH-, -NR １５ -, -NR １５ C(O)-, -C(O)NR １５ -, and C １ ~C ６ Selected from alkylenes, R １５ H, C １ ~C ６ Selected from alkylenes, t is either 1 or 2. X is selected from F, Cl, Br, and I. T １７ -R represents one or more independent substituents on the ring, including H, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, and -R. Ｌ -COR', -R Ｌ -C(O)OR', -R Ｌ -C(O)NR'R'', -R Ｌ -CH=NR', -R Ｌ -CN, -R Ｌ -OR', -R Ｌ -OC(O)R', -R Ｌ -S(O) ｔ -NR'R'', -R Ｌ -S(O) ｔ -R', -R Ｌ -NR'R'', -R Ｌ -NR'C(O)R'', -R Ｌ -NR'S(O) ｔ R'', -NR'-R Ｌ -NR'R'', -R Ｌ - NO ２ , -R Ｌ -N is selected from CR'R'', R Ｌ It does not exist, or C １ ~C ６ It is alkylene, R' and R'' are independently H, D, and C. １ ~C ６ Alkyl, C １ ~C ６ Haloalkyl, C ３ ~C ６ Selected from cycloalkyl groups, R''' is selected from H, D, and alkyl.

2. The aforementioned substituted naphthyl is A compound according to claim 1, selected from the following.

3. The aforementioned non-naphthalene aromatic group is Is it, The aforementioned non-naphthalene aromatic group is Is it, The aforementioned non-naphthalene aromatic group is Is it, The aforementioned non-naphthalene aromatic group is Is it, The aforementioned non-naphthalene aromatic group is Is it, The aforementioned non-naphthalene aromatic group is The compound according to claim 1.

4. R １ and R ２ These are independently H, -D, O, and C. １ ~C ３ Alkyl, -COOH, -CF ３ A compound according to claim 1, selected from hydroxyl.

5. R １ and R ２ Both are H, or R １ and R ２ The compound according to claim 1, wherein all of them are -D. Claim 6 is, The compound according to claim 1.

7. L ６ It does not exist, or -NH-, -N(CH ３ )-,-N(CH ３ The compound according to claim 1, selected from C(O)- and -NHC(O)-.

8. R １４ and R １４ ' are H, D, and C, respectively, independently. １ ~C ６ Alkyl, amino, - OCH ３ A compound according to claim 1, selected from the following.

9. R １３ and R １３ The compound according to claim 1, wherein each of the following structures is independently selected. -H, D, (=O), F, Cl, Br, I, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, -CF ３ ien-CH ２ D, -OH, -N ３ , -B(OH) ２ ,

10. The following structure: Compounds selected from or their pharmaceutically acceptable salts, stereoisomers, solvates, and deuterated compounds.

11. A pharmaceutical composition comprising a compound according to any one of claims 1 to 10, or a pharmaceutically acceptable salt, stereoisomer, solvate, and deuterated compound thereof, and one or more pharmaceutically acceptable auxiliary materials.

12. A pharmaceutical product for preventing and / or treating a disease or disorder caused by or related to a viral infection, comprising a compound according to any one of claims 1 to 10 or a pharmaceutically acceptable salt, stereoisomer, solvate, and deuterated compound thereof, wherein the virus is a coronavirus.

13. The pharmaceutical product according to claim 12, wherein the virus is selected from HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU, SARS-CoV, MERS-CoV, and SARS-CoV-2.

14. The pharmaceutical product according to claim 13, wherein the disease or disorder is selected from COVID-19, SARS, and MERS.

15. A pharmaceutical agent for reducing and / or inhibiting coronavirus replication, comprising a compound according to any one of claims 1 to 10 or a pharmaceutically acceptable salt, stereoisomer, solvate, and deuterated compound thereof.

Images