Primer set for detecting chimeric antigen receptor

Abstract

Provided is a primer set that contains a primer having the base sequence of SEQ ID NO: 1 and a primer having the base sequence of SEQ ID NO: 2.

Description

Primer set for detecting chimeric antigen receptors

[0001] Techniques relating to the detection of chimeric antigen receptors are disclosed.

[0002] Research into cancer therapy using gene-transduced T cells began in the 1990s, with the first clinical applications reported in the 2000s. First-generation chimeric antigen receptors (CARs) consist of the T cell receptor subunit TCRζ (CD3ζ) as the antigen recognition and T cell activation domain. Second-generation CARs consist of antigen recognition, costimulatory domains, and CD3ζ. The antigen recognition domain is a single-chain variable fragment (scFv), which connects the variable domains of the antibody heavy and light chains with a peptide linker. Costimulatory domains include TNF receptor family members such as 4-1BB, OX40, and CD27, as well as CD28 family members such as CD28 and inducible T cell costimulator (ICOS). Further CAR development is ongoing. Costimulatory domains are incorporated to improve the cytotoxic activity, proliferation, and persistence of CAR-T cells.

[0003] CAR-T cells recognize and activate antigens via scFv, without the need for human leukocyte antigen (HLA) involvement, and are expected to be effective even if HLA down-modulation of cancer cells, which is one of the mechanisms of cancer immune escape, occurs. CAR-T cells also exert their antitumor effects by releasing cytotoxic substances such as TNF, perforin, and granzymes, and by inducing Fas-induced apoptosis in tumor cells.

[0004] In Japan, manufacturing and marketing approval was granted in 2019 for CAR-T therapy targeting relapsed or refractory CD19-positive B-cell acute lymphoblastic leukemia (B-ALL) and relapsed or refractory CD19-positive diffuse large B-cell lymphoma (DLBCL) (Non-Patent Document 1). Since then, development of CAR-T therapies targeting multiple antigens, including CD19, has progressed, and quantitative evaluation of the time course of CAR-T proliferation and disappearance in vivo is expected to clarify the relationship between dosage, therapeutic effect or side effects, and CAR-T pharmacokinetics.

[0005] Drug Delivery System 35-1, 71-75, 2020Nature Medicine 23, 12, 2007, 1436-1443

[0006] While CAR-T cell therapy is being actively developed, one of the challenges is to provide a method for detecting CARs.

[0007] As a result of extensive research to solve the above problems, we have discovered that CAR can be detected by using specific primers, and have provided the following representative inventions.

[0008] Item 1: A primer set for detecting a nucleic acid encoding a chimeric antigen receptor, comprising a primer having the nucleotide sequence of SEQ ID NO: 1 and a primer having the nucleotide sequence of SEQ ID NO: 2. Item 2: The primer set according to item 1, wherein the nucleic acid comprises a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 1 and a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 2. Item 3: The primer set according to item 1 or 2, wherein the chimeric antigen receptor comprises CD28 and CD3ζ. Item 4: The primer set according to item 3, wherein the nucleotide sequence encoding CD28 comprises the nucleotide sequence of SEQ ID NO: 5. Item 5: The primer set according to item 3 or 4, wherein the nucleotide sequence encoding CD3ζ comprises the nucleotide sequence of SEQ ID NO: 6. Item 6: The primer set according to any of items 1 to 5, wherein the detection is performed using quantitative PCR. Item 7: The primer set according to any of items 1 to 6, wherein the chimeric antigen receptor is a chimeric antigen receptor for multiple myeloma. Item 8: The primer set according to item 7, wherein the chimeric antigen receptor for multiple myeloma is a chimeric antigen receptor that targets integrin β7. Item 9. A primer set for detecting a nucleic acid encoding a chimeric antigen receptor, comprising a primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a primer consisting of the nucleotide sequence of SEQ ID NO: 2. Item 10. A kit for detecting a nucleic acid encoding a chimeric antigen receptor, comprising the primer set of any of Items 1 to 9. Item 11. The kit of Item 10, further comprising a probe having the nucleotide sequence of SEQ ID NO: 9. Item 12. The kit of Item 11, wherein the probe consists of the nucleotide sequence of SEQ ID NO: 9. Item 13. The primer set of any of Items 1 to 9 or the kit of any of Items 10 to 12, for detecting a nucleic acid encoding a chimeric antigen receptor present in a biological sample from a subject.

[0009] Item A1: A method for detecting a nucleic acid encoding a chimeric antigen receptor in a biological sample, comprising: extracting DNA from the biological sample; and performing PCR using the extracted DNA as a template with a primer having the nucleotide sequence of SEQ ID NO: 1 and a primer having the nucleotide sequence of SEQ ID NO: 2. Item A2: The method according to Item A1, wherein the nucleic acid comprises a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 1 and a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 2. Item A3: The method according to Item A1 or A2, wherein the chimeric antigen receptor comprises CD28 and CD3ζ. Item A4: The method according to Item A3, wherein the nucleotide sequence encoding CD28 comprises the nucleotide sequence of SEQ ID NO: 4. Item A5: The method according to Item A3 or A4, wherein the nucleotide sequence encoding CD3ζ comprises the nucleotide sequence of SEQ ID NO: 5. Item A6: The method according to any one of Items A1 to A5, wherein the PCR is quantitative PCR. Item A7: The method according to any one of Items A1 to A6, further comprising contacting the PCR amplification product with a probe having the nucleotide sequence of SEQ ID NO: 9. Item A8 The method according to any one of Items A1 to A7, wherein the biological sample is blood. Item A9 The method according to Item A8, wherein the blood is blood collected from a patient to whom chimeric antigen receptor T cells have been administered. Item A10 The method according to Item A9, wherein the patient requires administration of T cells expressing a chimeric antigen receptor comprising CD28 and CD3ζ.

[0010] Item 1B A primer set comprising a primer having the nucleotide sequence of SEQ ID NO: 1 and a primer having the nucleotide sequence of SEQ ID NO: 2. Item 2B The primer set according to Item 1B, wherein the primer set is used for detecting a nucleic acid encoding a chimeric antigen receptor. Item 3B The primer set according to Item 2B, wherein the nucleic acid consists of the nucleotide sequence of SEQ ID NO: 1 or a complementary nucleotide sequence thereof and the nucleotide sequence of SEQ ID NO: 2 or a complementary nucleotide sequence thereof. Item 4B The primer set according to Item 2B or 3B, wherein the chimeric antigen receptor comprises CD28 and CD3ζ. Item 5B The primer set according to Item 4B, wherein the nucleotide sequence encoding CD28 comprises the nucleotide sequence of SEQ ID NO: 5. Item 6B The primer set according to Item 4B or 5B, wherein the nucleotide sequence encoding CD3ζ comprises the nucleotide sequence of SEQ ID NO: 6. Item 7B The primer set according to any one of items 2B to 6B, wherein the detection is performed using quantitative PCR, and the primer having the nucleotide sequence of SEQ ID NO: 1 is used as a forward primer and the primer having the nucleotide sequence of SEQ ID NO: 2 is used as a reverse primer. Item 8B: The primer set according to any one of claims 2B to 7B, wherein the chimeric antigen receptor is a chimeric antigen receptor for an antigen against multiple myeloma. Item 9B: The primer set according to any one of claims 2B to 8B, wherein the nucleic acid is contained in one or more types of cells selected from PBMCs, T cells, NK cells, and NK-T cells. Item 10B: A kit for detecting a nucleic acid encoding a chimeric antigen receptor, comprising the primer set according to any one of claims 1B to 9B. Item 11B: The kit according to claim 10B, further comprising a probe having the nucleotide sequence of SEQ ID NO: 9, which is used to detect or quantify a nucleic acid encoding a chimeric antigen receptor. Item 12B: The primer set according to any one of claims 2B to 9B or the kit according to claim 10B or 11B, wherein the chimeric antigen receptor is present in a biological sample.Item 13B A method for quantitatively detecting chimeric antigen receptor cells that express CD28 and CD3ζ (simultaneously / together) in a biological sample, comprising the steps of: (1) collecting a biological sample from a patient to whom chimeric antigen receptor cells that express CD28 and CD3ζ have been administered, (2) extracting DNA from the biological sample, and (3) performing quantitative PCR using the extracted DNA as a template, in combination with a primer having the nucleotide sequence of SEQ ID NO: 1 and a primer having the nucleotide sequence of SEQ ID NO: 2, and a probe having the nucleotide sequence of SEQ ID NO: 9. Item 14B The method according to claim 13B, wherein the patient requires treatment for multiple myeloma. Item 15B A method for evaluating the efficacy of chimeric antigen receptor cell therapy in a patient in need of chimeric antigen receptor cell therapy, comprising the steps of: (1) collecting a biological sample from a patient to whom chimeric antigen receptor cells expressing CD28 and CD3ζ have been administered, (2) extracting DNA from the biological sample, and (3) using the extracted DNA as a template, performing quantitative PCR using a primer having the nucleotide sequence of SEQ ID NO: 1 and a primer having the nucleotide sequence of SEQ ID NO: 2 in combination with a probe having the nucleotide sequence of SEQ ID NO: 9 to measure the amount of chimeric antigen receptor cells in the biological sample. Item 16B A method for determining a treatment plan for a patient based on the results of the evaluation method of Item 15B.

[0011] This enables detection of the target nucleic acid. In one embodiment, the target nucleic acid is a nucleic acid encoding a chimeric antigen receptor. In one embodiment, the target nucleic acid is a nucleic acid encoding a polypeptide in which CD28 and CD3ζ are directly or indirectly linked.

[0012] 1 shows the results of quantitative PCR in Example 2. NGMC are non-transfected T cells, and activating integrin β7 (aITGB7) CAR-T are CAR gene-transfected T cells. The results of quantitative PCR measured at each blood collection time point are shown.

[0013] The nucleotide sequence of SEQ ID NO: 1 is CCACCCGCAAGCATTACC, which corresponds to a portion of the nucleotide sequence encoding the costimulatory molecule CD28. Therefore, a primer having the nucleotide sequence of SEQ ID NO: 1 can bind (hybridize) to a complementary strand of a DNA strand encoding CD28. The nucleotide sequence of SEQ ID NO: 2 is CGCTCCTGCTGAACTTCACTCT, which is complementary to a portion of the nucleotide sequence encoding CD3ζ. Therefore, a primer having the nucleotide sequence of SEQ ID NO: 2 can bind to a DNA strand encoding CD3ζ. A DNA strand encoding a polypeptide in which CD28 and CD3ζ are linked can be detected by using a combination of a primer having the nucleotide sequence of SEQ ID NO: 1 and a primer having the nucleotide sequence of SEQ ID NO: 2 (primer set). In one embodiment, a DNA strand encoding a polypeptide in which CD28 and CD3ζ are linked can be amplified by PCR using a combination of a primer having the nucleotide sequence of SEQ ID NO: 1 and a primer having the nucleotide sequence of SEQ ID NO: 2 (primer set), and the DNA strand can be detected using the presence of an amplification product as an indicator.

[0014] The number of nucleotides constituting a primer having the nucleotide sequence of SEQ ID NO: 1 is arbitrary. In one embodiment, the number of nucleotides constituting a primer having the nucleotide sequence of SEQ ID NO: 1 is 15 to 25, preferably 16 to 25, and preferably 18 to 20. The primer having the nucleotide sequence of SEQ ID NO: 1 is preferably complementary as a whole to the complementary strand of a DNA strand encoding CD28. The number of nucleotides constituting a primer having the nucleotide sequence of SEQ ID NO: 2 is arbitrary. In one embodiment, the number of nucleotides constituting a primer having the nucleotide sequence of SEQ ID NO: 2 is 15 to 25, preferably 18 to 25. The primer having the nucleotide sequence of SEQ ID NO: 2 is preferably complementary as a whole to the DNA strand encoding CD3ζ. In this primer set, the number of nucleotides constituting each primer is preferably set in the range of 18 to 25, in order to facilitate preparation for PCR. A nucleotide number below the above range does not exhibit sufficient specificity, resulting in reduced accuracy, including increased background. On the other hand, a nucleotide number exceeding this range increases the difficulty of use, including increased design costs, and is therefore undesirable from a practical standpoint.

[0015] In the present invention, the nucleotide length of the primer encoding CD28 is set to a ratio of 1:1 to 1.5, preferably 1:1.1 to 1.3, and more preferably 1:1.15 to 1.25, when comparing the lengths of the primers encoding CD3ζ. This nucleotide length is set according to the DNA strand to be recognized, even when CD28 and CD3ζ are reversed. Specifically, when the primer having the base sequence of SEQ ID NO: 1 contains 15 nucleotides, the number of nucleotides constituting the primer having the base sequence of SEQ ID NO: 2 is selected from 15 to 23; when the primer contains 18 nucleotides, the number is selected from 18 to 25; when the primer contains 20 nucleotides, the number is selected from 20 to 25; and when the primer contains 25 nucleotides, the number is 25. However, this does not apply when a non-complementary sequence (base) is added to the 5'- or 3'-end for the purpose of modification or the like.

[0016] The primer having the base sequence of SEQ ID NO: 1 and the primer having the base sequence of SEQ ID NO: 2 can be prepared by artificial chemical synthesis or isolation.

[0017] The nucleic acid (DNA strand) detectable by the primer set is arbitrary as long as it has a region to which each primer can bind. In one embodiment, the DNA strand detectable by the primer set preferably has the nucleotide sequence of SEQ ID NO: 1 or a complementary nucleotide sequence thereof and the nucleotide sequence of SEQ ID NO: 2 or a complementary nucleotide sequence thereof. In one embodiment, such a DNA strand may be a DNA strand encoding a chimeric antigen receptor comprising CD28 and CD3ζ. The chimeric antigen receptor preferably comprises scFv, CD28, and CD3ζ, which are preferably linked in this order, optionally via a linker. When a CAR construct configured in the order of scFv-CD28-CD3ζ is employed, it is preferable to use a set of primers having the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2 for detection.

[0018] The amino acid sequence of the scFv and the nucleotide sequence encoding it are arbitrary. In one embodiment, the chimeric antigen receptor is preferably specific to multiple myeloma. Such a chimeric antigen receptor preferably has an scFv that specifically binds to multiple myeloma. Such a chimeric antigen receptor is disclosed, for example, in WO2017 / 026331. In one embodiment, a polynucleotide encoding a light chain variable region (VL) constituting an scFv that specifically binds to multiple myeloma preferably has the following nucleotide sequence: CAAATTGTTCTCCCAGTCTCCAGCAATCCTGTCTGCATCTCCAGGGGAGAAGGTCACAATGACTTGCAGGGCCAGCTCAAGTGTAGGTTACATGCACTGGTTCCAGCAGAAGCCAGGATCCTCCCCCAAACCCTGGATTTATGCCACATCCAACCTGGCTTC TGGAGTCCCTGCTCGCTTCAGTGGCAGTGAGTCTGGGACCTCTTACTCTCTCACAATCAGCAGAGTGGAGGCTGAAGATGCTGCCACTTATTACTGCCAGCAGTGGAGTAGTGACCCACCGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAACGG (SEQ ID NO: 3)

[0019] In one embodiment, a polynucleotide encoding a heavy chain variable region (VH) constituting an scFv that specifically binds to multiple myeloma preferably has the following nucleotide sequence: CAGGTTCAGCTGCAGCAGTCTGGAGCTGAGCTGATGAAGCCTGGGGCCTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACATTCAGTAGCTACTGGATAGAGTGGGTAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGAGAGATGTTACCTGGAAGTGGTAGTTCTAACTACAATGAGAAGTTCAAGGGCAAGGCCACATTCACTGCAGATACATCCTCCAACACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCCGTCTATTACTGTGCAAGGGGGGATGGTAACTACTGGTACTTCGATGTCTGGGGCGCAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 4).

[0020] The nucleotide sequence encoding the amino acid sequence of CD28 constituting the chimeric antigen receptor preferably comprises the nucleotide sequence of SEQ ID NO: 1. In one embodiment, the nucleotide sequence encoding the amino acid sequence of CD28 preferably comprises the following nucleotide sequence: ATTGAAGTTATGTATCCTCCTCCTTACCTAGACAATGAGAAGAGCAATGGAACCATTATCCATGTGAAAGGGAAACACCTTTGTCCAAGTCCCCTATTTCCCGGACCTTCTAAGCCCTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCC (SEQ ID NO: 5) The underlined region in the above sequence is identical to the nucleotide sequence of SEQ ID NO: 1.

[0021] CD3ζ (TCRζ, CD247) constituting the chimeric antigen receptor preferably has a region encoded by a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 2. In one embodiment, the nucleotide sequence encoding the amino acid sequence of CD3ζ preferably comprises the following nucleotide sequence: AGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGC (SEQ ID NO: 6) The underlined region in the above sequence is complementary to the nucleotide sequence of SEQ ID NO: 2.

[0022] The VL and VH of the scFv may be linked via any linker. In one embodiment, the nucleotide sequence encoding the linker linking the VL and VH preferably comprises GGCTCCACTAGCGGTTCCGGCAAACCTGGCAGCGGAGAAGGCAGC (SEQ ID NO: 7). CD28 and CD3ζ may be linked via any linker. In one embodiment, the nucleotide sequence encoding the linker linking CD28 and CD3ζ preferably comprises GCGGCCGCA.

[0023] A polynucleotide encoding a chimeric antigen receptor preferably further comprises a region encoding a signal peptide at the N-terminus of the region encoding the scFv. The base sequence encoding the signal peptide is arbitrary, but preferably comprises ATGGATTTTCAAGTGCAGATTTTCAGCTTCCTGCTAATCAGTGCTTCAGTCATAATGTCCAGAGGA (SEQ ID NO: 8).

[0024] In one embodiment, the polynucleotide encoding the chimeric antigen receptor comprising a signal peptide, scFv, CD28, and CD3ζ may be one described in WO2017 / 026331 or Nature Medicine 23 12 2007 1436. The chimeric antigen receptor, the nucleic acid encoding it, and T cells containing (or expressing) the nucleic acid can be prepared by known techniques.

[0025] The nucleic acid detected by the primer set may be single-stranded or double-stranded. In one embodiment, the nucleic acid is preferably double-stranded. When the nucleic acid is double-stranded, it is preferable that one strand constituting the double strand has a base sequence complementary to the base sequence of SEQ ID NO: 1, and the other strand has a base sequence complementary to the base sequence of SEQ ID NO: 2. The nucleic acid detected by the primer set may be DNA or RNA, and in one embodiment, the nucleic acid is preferably DNA.

[0026] Detection of the target nucleic acid using the above primer set is preferably carried out using PCR. In PCR, the primer having the nucleotide sequence of SEQ ID NO: 1 is preferably used as a forward primer, and the primer having the nucleotide sequence of SEQ ID NO: 2 is preferably used as a reverse primer. In one embodiment, PCR can be used qualitatively, but quantitative PCR is preferred. Quantitative PCR, also known as real-time PCR, is generally a method for monitoring the generation of amplification products over time in PCR. In detection using quantitative PCR, the amplification products from the PCR reaction are usually detected by optical means. Detection of the amplification products may be carried out at or after the completion of the PCR reaction, or may be carried out in parallel with the PCR reaction process. When carried out in parallel, detection of the amplification products can be carried out, for example, over time. Time-dependent detection (monitoring) may be, for example, continuous or discontinuous (intermittent). Furthermore, the target nucleic acid contained in a sample can be quantified by counting the number of PCR cycles at which a predetermined amount of amplification product is obtained. Furthermore, the copy number in a sample can also be quantified using a calibration curve calculated from a standard.

[0027] In one embodiment, the nucleic acid detected or quantified using the primer set is preferably present within a cell. The nucleic acid may be in any form, for example, incorporated into a plasmid or genomic DNA. The type of cell containing the nucleic acid is any, but is preferably one or more selected from PBMC, T cells, NK cells, and NK-T cells. The nucleic acid or the cell containing the nucleic acid is preferably present in a biological sample. The type of biological sample is any, but is preferably blood (e.g., whole blood).

[0028] In one embodiment, detection of the target nucleic acid is preferably performed using any probe that specifically recognizes the product amplified by PCR using the above primer set. Such a probe is not particularly limited as long as it has a sequence located between a primer having the nucleotide sequence of SEQ ID NO: 1 and a primer having the nucleotide sequence of SEQ ID NO: 2. Examples of such probes include, but are not limited to, CACCACGCGACTTCGCAGCCTAT (SEQ ID NO: 9) or an oligonucleotide having a nucleotide sequence complementary thereto. The probe can be prepared by any method (e.g., chemical synthesis). Appropriate commercially available fluorescent probes can be selected and used. For example, fluorescein (FAM) can be used as a fluorescent probe, but this is not limited thereto. Additionally, a non-fluorescent quencher (NFQ) or a minor groove bond (MGB) can be added to the probe.

[0029] When a probe having the base sequence of SEQ ID NO: 9 is used, the number of nucleotides constituting the probe is arbitrary. In one embodiment, the number of nucleotides constituting the probe having the base sequence of SEQ ID NO: 9 is preferably 20 to 25 nucleotides or less. In the present invention, when the probe is used together with a primer having the base sequence of SEQ ID NO: 1 and a primer having the base sequence of SEQ ID NO: 2, the distance in the base sequence between each primer and the probe is set in the range of 5 to 25 nucleotides, preferably 5 to 15 nucleotides or less. A distance of more than 25 nucleotides may result in an increase in reaction time, while a distance of less than 5 nucleotides may affect the level of fluorescence of the probe.

[0030] A kit for detecting a nucleic acid encoding a chimeric antigen receptor preferably comprises the above-described primer set. In addition to the primer set, the kit may also comprise optional components, reagents (e.g., PCR reagents), containers, equipment, etc. In one embodiment, the kit preferably further comprises the above-described probe. Examples of PCR reagents include polymerase, dNTPs (deoxynucleoside triphosphates), intercalators or fluorescently labeled probes, and buffers.

[0031] In one embodiment, quantitative PCR using the above primer set can be used to detect and quantify the amount of a chimeric antigen receptor in a human biological sample (e.g., blood). Specifically, a method comprising the steps of: (1) collecting a biological sample from a patient to whom chimeric antigen receptor cells expressing CD28 and CD3ζ have been administered; (2) extracting DNA from the biological sample; and (3) using the extracted DNA as a template and performing quantitative PCR using a primer having the nucleotide sequence of SEQ ID NO: 1, a primer having the nucleotide sequence of SEQ ID NO: 2, and a probe having the nucleotide sequence of SEQ ID NO: 9 can quantitatively detect the nucleic acid encoding the chimeric antigen receptor in the biological sample, and based on the detection results, can measure the amount of chimeric antigen receptor cells in the biological sample. Thus, in CAR-T cell therapy, a biological sample is collected from a subject after administration of CAR-T cells, and the amount of nucleic acid encoding CAR is measured using the sample, thereby evaluating the dynamics (increase or decrease) of the administered CAR-T cells and further evaluating the efficacy of the CAR-T cell therapy. Furthermore, the evaluation results can be used to determine the patient's subsequent treatment plan, such as predicting drug efficacy and determining the appropriateness of drug administration.

[0032] A patient in need of CAR-T cell therapy is, for example, a patient suffering from cancer, and the cancer can be, for example, a hematological cancer or a solid cancer. The hematological cancer can be, for example, lymphoma, leukemia, or myeloma. In one embodiment, a patient in need of CAR-T cell therapy is a human suffering from multiple myeloma.

[0033] Example 1 1. Extraction of gDNA from CAR-T Cells CAR-T cell-derived genomic DNA for creating a standard curve is extracted from CAR-T cells using the following procedure. This procedure can be performed using a commercially available genomic DNA extraction kit (e.g., DNeasy Blood & Tissue Kit), and the procedure is exemplified below. The CAR-T cells used in this example are aITGB7 CAR-T cells, and the control substance is non-transfected T cells (Takara Bio Inc.) (hereinafter also referred to as NGMC). The transfected aITGB7 CAR was obtained from Osaka University. The aITGB7 CAR employs anti-integrin β7 scFV-CD28-CD3ζ. The aITGB7 CAR-T cells contain the nucleotide sequences of SEQ ID NOs: 4 to 8. (1) Thaw the CAR-T cells in a 37°C water bath. (2) Discard 1 x 10 7 (3) After centrifugation (2000 × g, 5 minutes, room temperature), remove the supernatant. Then, tap the tube, add 400 μL of PBS, mix, and add 40 μL of Proteinase K. (4) Add 8 μL of RNase A (100 mg / mL), mix, and incubate at room temperature for approximately 2 minutes. (5) Add 400 μL of Buffer AL, mix, and incubate at 56°C for 10 minutes. (6) After incubation, divide the solution from (5) above into two tubes (5 × 10 6cells / 424 μL). (7) Add 200 μL of ethanol to each of the solutions in (6) above and mix. (8) Add each solution to a DNeasy mini spin column (hereinafter referred to as the spin column) and centrifuge (6000 × g, 1 minute, room temperature). (9) After centrifugation, remove the flow-through and place the spin column in a new collection tube. (10) Add 500 μL of Buffer AW1 to the spin column and centrifuge (6000 × g, 1 minute, room temperature). (11) After centrifugation, remove the flow-through and place the spin column in a new collection tube. (12) Add 500 μL of Buffer AW2 to the spin column and centrifuge (20000 × g, 3 minutes, room temperature). (13) After removing the flow-through, centrifuge again (20000 × g, 1 minute, room temperature) and remove the flow-through. (14) Place the spin column in a new collection tube and add 50 μL of Buffer AE. (15) Leave to stand at room temperature for approximately 1 minute, then centrifuge (6000 × g, 1 minute, room temperature) to elute. (16) Combine the eluates into one tube and measure the gDNA concentration using a spectrophotometer such as a NanoDrop (ThermoFisher). (17) Dilute the CAR-T cell-derived gDNA with Buffer AE to a concentration of 50,000 pg / μL (standard curve stock solution, S-1), then dispense the solution into aliquots and store frozen in an ultra-low temperature freezer (acceptable temperature range: -90 to -65°C).

[0034] 2. gDNA Extraction from Blood Samples Genomic DNA is extracted from blood samples using the following procedure. This procedure can be performed using a commercially available genomic DNA extraction kit (e.g., DNeasy Blood & Tissue Kit). For example, the procedure is as follows: (1) Take 100 μL of thawed anticoagulated blood. Add 20 μL of Proteinase K and then 100 μL of PBS. Prepare three tubes of this solution per individual sample (No. 1 to No. 3). (2) Add 4 μL of RNase A (100 mg / mL), mix, and incubate at room temperature for approximately 2 minutes. (3) Add 200 μL of Buffer AL, mix, and then incubate at 56°C for 10 minutes. After incubation, add 200 μL of ethanol and mix. (4) Add the mixture to the spin column and centrifuge (6000 × g, 1 minute, room temperature). If the column becomes clogged, perform an additional centrifugation step. (5) After centrifugation, remove the flow-through and place the spin column in a new collection tube. (6) Add 500 μL of Buffer AW1 to the spin column and centrifuge (6000 × g, 1 minute, room temperature). (7) After centrifugation, remove the flow-through and place the spin column in a new collection tube. (8) Add 500 μL of Buffer AW2 to the spin column and centrifuge (20000 × g, 3 minutes, room temperature). (9) After removing the flow-through, centrifuge again (20000 × g, 1 minute, room temperature) and remove the flow-through. (10) Place the spin column in a new collection tube and add 50 μL of Buffer AE to sample No. 1. (11) Leave to stand at room temperature for approximately 1 minute, then centrifuge (20000 × g, 1 minute, room temperature) to elute. (12) Collect the entire eluate from No. 1 and add it to sample No. 2. (13) After leaving the sample at room temperature for approximately 1 minute, centrifuge (20,000 x g, 1 minute, room temperature) to elute. (14) Collect the entire volume of the eluate from No. 2 and add it to sample No. 3. (15) After leaving the sample at room temperature for approximately 1 minute, centrifuge (20,000 x g, 1 minute, room temperature) to elute. (16) Measure the gDNA concentration of the eluate using a spectrophotometer such as a NanoDrop.(17) Dilute the eluate with Buffer AE so that the amount of gDNA per well is equal to or less than 0.0696 μg, after confirming that no matrix effect is observed. If the amount of gDNA in the eluate is less than 0.0696 μg, apply the lowest dilution factor (5x). (18) Use the diluted eluate as the measurement sample, dispense it into aliquots, and store it frozen in an ultra-low temperature freezer (allowable range: -90 to -65°C).

[0035] 3. Preparation of calibration curve samples After thawing the calibration curve stock solution (50,000 pg / μL, S-1) at room temperature, prepare calibration curve samples S-2 to S-6 according to Table 1 below. Use Buffer AE as the NTC sample (No template control). Prepare calibration curve samples immediately before use.

[0036]

[0037] 4. qPCR Quantitative PCR is performed using commercially available quantitative PCR reagents (e.g., LightCycler 480 Probe Master (Roche Diagnostics)). The following describes the use of LightCycler 480 Probe Master as an example. (1) Using the HO (PCR-grade) provided with the LightCycler 480 Probe Master, prepare a Master Mix (enough for one reaction) with the composition shown in Table 2 below just before use.

[0038]

[0039] The sequences of the primers and probes used in the quantitative PCR are shown in Table 3. PCR was performed using a StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific).

[0040]

[0041] (2) Add 12 μL of Master Mix and 8 μL of each sample to a 96-well white plate (total 20 μL). (3) Spin down the 96-well white plate in a centrifuge and place it in a real-time PCR instrument. Set the PCR temperature and cycle conditions, for example, as shown in Table 4 below.

[0042]

[0043] 5. Data Analysis A standard curve is created from the crossing point (Cp value, y-axis) of the standard curve sample and the log concentration (x-axis) of the theoretical concentration (pg / reaction), and the mean squared error (MSE) and efficiency are calculated. The measured Cp value of each well is substituted into the obtained standard curve equation to calculate the regression value of the standard curve and the quantitative value of the measured sample (pg / reaction). All of these calculations can be performed using the analysis software (LightCycler 480 Software, Roche Diagnostics) attached to the real-time PCR instrument.

[0044] 6. Representative calibration curve data Representative calibration curve data obtained by steps 1 to 5 are shown in Table 5 below.

[0045] Example 2 aITGB7 CAR-T cells were administered to severely immunodeficient mice that had been transplanted with human multiple myeloma cells via the tail vein. After administration, changes in the amount of aITGB7 CAR-T cells in the mouse blood were confirmed using primers that specifically recognize aITGB7 CAR-T cells.

[0046] The test substance was aITGB7 CAR-T cells, and the control substance was NGMC. Both T cells were stored in the dark at -80°C.

[0047] On the day of administration, the required amount of test substance or control substance was dissolved in a cell cryopreservation solution and adjusted to the administration concentration. After adjustment, the solution was left standing on ice in the dark.

[0048] The multiple myeloma cell line used was MM.1S, derived from human multiple myeloma. Culture was performed at 37°C in 5% CO2 in RPMI 1640 medium supplemented with 10% fetal bovine serum, 100 units / mL penicillin, and 100 μg / mL streptomycin. The fetal bovine serum was inactivated by heating at 56°C for 30 minutes.

[0049] Twenty NOG mice, 5-6 week old females, were obtained as severely immunodeficient mice and were allowed free access to food and water (autoclaved tap water).

[0050] Test method: 10 days after tail vein transplantation of multiple myeloma cell line MM.1S, 1.33 x 10 5 The mice were administered aITGB7 CAR-T cells / body. Serum-free RPMI 1640 medium was used during transplantation. PK testing in NOG mice was performed at six time points, with three mice assigned to each time point, for a total of 18 mice. Blood was collected at 1 hour, 24 hours, 3 days, 1 week, 2 weeks, and 3 weeks after administration. Blood was collected from the remaining two mice without aITGB7 CAR-T administration to prepare whole blood samples for creating a calibration curve.

[0051] Ten days after the MM.1S cell transplant, the test substance was administered via the tail vein. Blood was collected from the mice at designated time points, and the amount of CAR-T in the blood was quantified by quantitative PCR using DNA isolated from the whole blood. The specific conditions and procedures are as follows:

[0052] Preparation of cell suspension for transplantation: After thawing the cryopreserved cells, the cells were subcultured 3 to 6 times and used for transplantation. 5 -2 x 10 6 The cells were cultured to 1000 cells / mL and centrifuged (240 × g, 4°C, 5 minutes), and the supernatant was removed. The cells were suspended in serum-free medium for transplantation, and the mixture was centrifuged (240 × g, 4°C, 5 minutes), and the supernatant was removed. This procedure was repeated two more times, after which serum-free medium for transplantation was added to suspend the cells. A portion of the cell suspension was mixed with trypan blue solution, and viable cells were counted using a hemocytometer to prepare a cell suspension with the concentration shown in Table 6 below. The prepared cell suspension was kept on ice until transplantation.

[0053]

[0054] Using a 1 mL syringe, 29G x 1 / 2 (Terumo Corporation), 0.1 mL (1 x 10 6 -10 x 10 6A cell suspension of 1000 cells / body was transplanted.

[0055] Using a 1 mL syringe, 0.1 mL (1.33 × 10 5 The administration solution (test substance or control substance) containing 1000 cells / body was transplanted into the tail vein.

[0056] Blood samples were collected from the abdominal vena cava under inhalation anesthesia with isoflurane (Abbott Japan Co., Ltd.) at 1 hour, 24 hours, 3 days, 1 week, 2 weeks, and 3 weeks after administration. Immediately after collection, the blood was transferred to a heparin-containing tube, mixed by inversion, and then placed on ice.

[0057] Genomic DNA was extracted from frozen-thawed aITGB7 CAR-T samples, NGMC samples, and blood samples from tumor-bearing mice administered aITGB7 CAR-T using NucleoSpin™ Blood (MACHEREY-NAGEL). DNA content was measured using NanoDrop™, and the amount of aITGB7 CAR DNA in each sample relative to the total genome content was assessed using a primer set specific for aITGB7 CAR.

[0058] Genomic DNA extraction for analysis of aITGB7 CAR specificity of the detection system Genomic DNA was extracted from frozen-thawed aITGB7 CAR-T and NGMC to analyze the amount of aITGB7 CAR DNA in each sample.

[0059] Preparation of standard curve samples for aITGB7 CAR specificity analysis The aITGB7 CAR plasmid was serially diluted with distilled water to prepare 1-1000 fg / mL dilutions (10-fold common ratio).

[0060] Genomic DNA extraction from whole blood samples To analyze the amount of aITGB7 CAR DNA in each sample, genomic DNA was extracted from blood samples obtained by blood collection from tumor-bearing mice administered aITGB7 CAR-T.

[0061] Preparation of calibration curve samples for whole blood samples: The aITGB7 CAR plasmid was serially diluted with distilled water to prepare dilutions ranging from 0.01 to 100 pg / mL. 2 μL of the diluted CAR plasmid or distilled water was mixed with 198 μL of whole blood collected from untreated mice to prepare whole blood samples for the calibration curve at 0 and 0.1-1000 fg / mL. Genomic DNA was extracted from these samples in the same manner as for whole blood samples, and used as calibration curve samples.

[0062] Measurement of genomic DNA concentration The concentration of the extracted genomic DNA solution was measured. The extracted genomic DNA solution was stored on ice until subjected to real-time PCR. For samples extracted in "Genomic DNA extraction for analysis of aITGB7 CAR specificity of the detection system," after measuring the DNA concentration, the sample was diluted 1000-fold with distilled water at a 10-fold common ratio.

[0063] The primers and probes used in the quantitative PCR were those listed in Table 3.

[0064] The PCR mixture for the CAR gene was prepared by mixing 10 μL of PCR Master Mix (2X), 0.2 μL of forward primer, 0.2 μL of reverse primer, 0.5 μL of probe, and 1.1 μL of distilled water per reaction. The required amount was prepared depending on the number of samples to be measured. 12 μL of the PCR mixture was dispensed into each well of a PCR plate, and 8 μL of the corresponding DNA sample was added. The real-time PCR conditions are shown in Table 7.

[0065] Calculation of aITGB7 CAR DNA Quantity: Ct values ​​were calculated using the built-in analysis software of the real-time PCR instrument, and ΔCt values ​​were calculated according to Equation 1. The relative value (RQ: Relative Quantification) of aITGB7 CAR DNA in the sample solution used for quantitative PCR was calculated according to Equation 2. The RQ values ​​of the standard curve samples were plotted against the plasmid concentrations of the standard curve samples to obtain a linear equation for the approximate line, and the aITGB7 CAR DNA concentration of each sample was calculated. For whole blood samples, the amount of aITGB7 CAR DNA present in a given amount of blood was calculated by dividing by the total isolated genome concentration. ΔCt = Ct,x - Ct,r (Equation 1) (where Ct,x is the average Ct value of the sample, and Ct,r is the average Ct value at the lowest concentration at which a Ct value could be calculated in the standard curve). RQ = 2^(-ΔCt) (Equation 2).

[0066] (4) Results The results of quantitative PCR are shown in Figure 1 and Table 8. Compared with non-transfected NGMC T cells, a genome-dose-dependent increase in fluorescence intensity (depending on the dilution factor) was observed only for aITGB7 CAR-T, demonstrating that the aITGB7 CAR DNA amount can be specifically evaluated.

[0067]

[0068] Figure 2 shows the results of quantitative PCR performed at each blood sampling time point. 5 After administration of aITGB7 CAR-T at cells / body level, aITGB7 CAR DNA was detected in whole blood from 1 hour onward, reaching a maximum level 2 weeks after administration.

[0069] Example 3 1. Extraction of Genomic DNA gDNA was extracted from PBMCs obtained from a human donor administered aITGB7 CAR-T cells according to the protocol provided with the QIAamp DNA Mini Kit (QIAGEN). gDNA samples were stored at -20°C as needed. (1) 10 milliliters of PBS was transferred to a 15 mL tube. (2) The PBMCs were thawed in a 37°C water bath and transferred to a 15 mL tube. (3) The tube was centrifuged (300 x g, 10 minutes, room temperature), and the supernatant was removed. (4) After tapping, 1 mL of PBS was transferred to the 15 mL tube to suspend the PBMCs. (5) 20 microliters of the cell suspension was mixed with 20 μL of ViaStain AOPI Staining Solution (Nexcelom Bioscience), and the number of cells was counted using a Cellometer Auto 2000 (Nexcelom Bioscience). (6) After suspending the cells with a pipette, the suspension (5 × 10 ６The cells (cells / tube below) were transferred to a 1.5 mL tube (conical bottom). (7) The tube was centrifuged (2000 x g, 5 minutes, room temperature), and the supernatant was removed. (8) After tapping, 200 μL of PBS was added to suspend the PBMCs (PBMC suspension). (9) 20 microliters of proteinase K was added and mixed thoroughly. (10) 4 microliters of RNase A (100 mg / mL) was added, mixed, and incubated at room temperature for 2 minutes. (11) 200 microliters of Buffer AL was added and vortexed for 15 seconds. The tube was centrifuged briefly. (12) The tube was incubated at 56°C for 10 minutes. The tube was centrifuged briefly. (13) 200 microliters of ethanol (99.5%) was added and vortexed for 15 seconds. The tube was centrifuged briefly. (14) The mixture from step (13) was applied to a QIAamp Mini Spin Column (QIAGEN). (15) The tube was centrifuged at 6,000 x g for 1 minute at room temperature. (16) The column was placed in a new collection tube (2 mL) and 500 μL of Buffer AW1 (QIAGEN) was added. (17) The tube was centrifuged at 6,000 x g for 1 minute at room temperature. (18) The column was placed in a new collection tube (2 mL) and 500 μL of Buffer AW2 (QIAGEN) was added. (19) The tube was centrifuged at 20,000 x g for 3 minutes at room temperature. (20) The column was placed in a new collection tube (2 mL). (21) The tube was centrifuged at 20,000 x g for 1 minute at room temperature. (22) The column was placed in a new collection tube (1.5 mL) and 200 μL of Buffer AE was added. (23) The tube was incubated at room temperature for 5 minutes. (24) The tube was centrifuged at 6,000 × g for 1 minute at room temperature. (25) The eluates were combined into one tube for each donor, and the gDNA concentration was measured using a spectrophotometer. Buffer AE was used as a blank. A NanoDrop 2000 (Thermo Fisher) was used as the spectrophotometer, and measurements were performed under the following conditions.Mode: Nucleic Acid Sample Type: DNA Export Data: Nucleic Acid Concentration, A260nm, A280nm, A260nm / A280nm, A260nm / A230nm.

[0070] 2. Preparation of standard solution Standard plasmid stock solution (1.00 x 10 ８ The standard solutions C1 to C10 were prepared according to Table 9 below. Buffer AE was used as an NTC (no template control) sample. The standard plasmid is a linear plasmid containing a partial base sequence of the DNA harbored by aITGB7 CAR-T cells.

[0071]

[0072] 3. Preparation of test (QC) samples Standard plasmid stock solution (1.00 x 10 ８ After thawing the gDNA (100 ng / μL, SS) at room temperature, test samples H, M, L, LL, and BL were prepared according to Tables 10 and 11 below. Each gDNA extracted in 1 above was thawed at room temperature and diluted with Buffer AE to prepare 50 ng / μL gDNA.

[0073]

[0074] *: 50 ng / μL H, M, L, LL, and BL were used for qPCR. H-1 to H-n, M-1 to M-n, L-1 to L-n, LL-1 to LL-n, and BL-1 to BL-n were prepared according to the number of donors, n.

[0075] 4. Real-time PCR (1) A sufficient amount of PCR Master Mix was prepared on the day of use. The contents of one reaction are listed below. ２ LightCycler 480 Probe Master 10.0 μL 20× Pre-Mixed Primer and Probe 1.0 μL H ２O (PCR grade) 1.0 μL Total 12.0 μL The "Pre Mixed Primer and Probe" contains a forward primer consisting of the base sequence of SEQ ID NO: 1, a reverse primer consisting of the base sequence of SEQ ID NO: 2, and a probe (5'-FAM-CACCACGCGACTTCGCAGCCTATC-NFQ-MGB-3') having the base sequence of SEQ ID NO: 9 (FAM: Fluorescein, NFQ: Non-Fluorescent Quencher, MGB: Minor Groove Binder).

[0076] (2) PCR Master Mix (12 μL) was transferred to each well of a 384-well plate, and template (standard solution and QC sample, 8 μL) was added to each well and mixed (total 20 μL). The test was performed in triplicate (n=3).

[0077] (3) The 384-well plate was sealed and briefly centrifuged. Real-time PCR was performed using a Real-time PCR System LightCycler™ 480II under the following conditions: Fluorescence intensity was measured at the end of step 3 of cycle 2.

[0078]

[0079] 5. Data Analysis Cp values ​​were calculated using the Abs Quant / 2nd Derivative Max method (intersection). A standard curve was plotted using the concentration and Cp value of each standard solution, and then the mean square error (MSE) was calculated. The standard curve is a nonlinear (polynomial) regression line. Reverse regression values ​​were calculated using the Cp values ​​of the standard solutions and the standard curve. Sample concentrations were calculated using the Cp values ​​of the samples and the standard curve. The mean of the reverse regression values, CV, and sample concentrations were calculated. RE (relative error) (%) was calculated using the mean and theoretical value of the reverse regression values ​​according to the following formula: RE (%) = ({mean of reverse regression values ​​(copies / μL) / theoretical value (copies / μL)} - 1) × 100 CV (%) = (SD / mean) × 100

[0080] Cp values, MSE, back-regression values ​​and sample concentrations were calculated using analysis software for the real-time PCR system (LightCycler™ 480 software, Roche Diagnostics).

[0081] 6. Validation Items qPCR was performed in triplicate wells per replicate.

[0082] 6-1 Calibration Curve To determine the linearity of the TaqMan qPCR assay, a standard curve was created using C1 to C10. The acceptance criteria for the calibration standards were as follows: (1) MSE less than 0.2. (2) The CV of the reverse regression values ​​is less than 30% for at least 9 out of 10 points (C1 and C10 must be less than 30%). (3) The RE of the reverse regression values ​​is within ±30% for at least 9 out of 10 points (C1 and C10 must be within ±30%). (4) The Cp value of the NTC is 45.00 or clearly greater than the Cp value of C10.

[0083] 6-2 Intra-batch reproducibility CV and RE were evaluated by analyzing H, M, L, and LL in triplicate for each level. The acceptance criteria for CV and RE were as follows: CV of QC samples was less than 30%. RE of QC sample values ​​was within ±30%.

[0084] 6-3 Batch-to-batch reproducibility CV and RE were evaluated by analyzing H, M, L, and LL with three replicate tests per level. Batch-to-batch reproducibility was determined using QC samples of four concentrations from three different batches. The results of the batch-to-batch reproducibility were acceptable for use. The acceptance criteria for CV and RE were as follows: CV of QC samples less than 30%. RE of QC sample values ​​within ±30%.

[0085] 6-4 Matrix Effect CV and RE were evaluated by analyzing H, M, L, and LL with one replicate per level. Matrix effect was determined by QC samples of four concentrations from six different donors. The acceptance criteria for CV and RE were as follows: CV of QC samples less than 30%. RE of QC sample values ​​within ±30%.

[0086] 6-5 Selectivity qPCR was performed for selectivity by determining the Cp values ​​of BL in one replicate from six donors. The acceptance criteria for selectivity were as follows: Cp value not determined or clearly greater than the Cp value of C10.

[0087] 6-6 Freeze-thaw stability CV and RE were evaluated by analyzing H and L with one replicate per level. The QC samples were frozen and thawed 0, 1, and 3 times at -20°C, and then qPCR was performed to confirm the freeze-thaw stability. The thawing procedure was performed by leaving the QC samples at RT. The acceptance criteria for freeze-thaw stability were as follows: The CV of the QC samples is less than 30%. The RE of the QC sample values ​​is within ±30%.

[0088] 6-7 Long-term storage stability CV and RE were evaluated by analyzing H and L with one replicate per level. qPCR was performed to confirm the initial concentration (0 months). QC samples were stored at -20°C for 1 month, 3 months, 6 months, and 12 months (±1 week), and then qPCR was performed to confirm long-term storage stability. The acceptance criteria for long-term storage stability are as follows: CV of QC samples is less than 30%. RE of QC sample values ​​is within ±30%.

[0089] 7. Measurement Results 7-1 Calibration Curve For each concentration (C1 to C10) of the calibration curve, the CV ranged from 0% to 17.7%, and the RE ranged from -10.3% to 9.7%. The mean square error was 0.00414 to 0.00820. NTC was not amplified up to 45.00 cycles. The calibration curve met all criteria, so the calibration curve is acceptable.

[0090] 7-2 Intra-batch reproducibility For each QC sample (H, M, L, and LL), the CV ranged from 0.4% to 20.0%, and the RE ranged from -6.5% to 16.0%. Since the QC samples met all the acceptance criteria, the intra-batch reproducibility was acceptable.

[0091] 7-3 Batch-to-batch reproducibility For each QC sample (H, M, L, and LL), the CV ranged from 5.2% to 9.2%, and the RE ranged from -2.9% to 5.2%. Since the QC samples met all the acceptance criteria, the batch-to-batch reproducibility was acceptable.

[0092] 7-4 Matrix Effect For each QC sample (H, M, L, and LL), the CV ranged from 0.5% to 13.2%, and the RE ranged from -12.5% ​​to 5.0%. The matrix effect was acceptable because the QC samples met all the acceptance criteria.

[0093] 7-5 Selectivity None of the BLs from the six donors amplified. Since the BLs met the acceptance criteria, the selectivity was acceptable.

[0094] 7-6 Freeze-thaw stability For each QC sample (H and L), the CV ranged from 0.9% to 3.0%, and the RE ranged from -4.1% to 18.0%. Since the QC samples met the standards, the freeze-thaw stability was determined to be acceptable up to three times at -20°C / room temperature.

[0095] 7-7 Long-term storage stability The CV and RE of the initial concentrations of the QC samples (QCH and QCL) met the acceptance criteria.

[0096] 8. Conclusions The above results confirmed that the assay methods shown in 1 to 4 above are suitable for measuring CAR-T cells containing CD28 and CD3ζ.

[0097] These results demonstrate that when aITGB7 (MMG49) CAR-T composed of aITGB7 scFV-CD28-CD3ζ is administered in vivo, including in clinical settings, the amount of CAR-T in tissue samples can be measured.

[0098] The present invention is not limited to the contents of the above examples.

Claims

1. A primer set comprising a primer having the base sequence of SEQ ID NO: 1 and a primer having the base sequence of SEQ ID NO:

2.

2. The primer set according to claim 1 , wherein the primer set is used to detect a nucleic acid encoding a chimeric antigen receptor.

3. The primer set according to claim 2, wherein the nucleic acid consists of the base sequence of SEQ ID NO: 1 or a complementary base sequence thereof and the base sequence of SEQ ID NO: 2 or a complementary base sequence thereof.

4. The primer set according to claim 2 or 3, wherein the chimeric antigen receptor comprises CD28 and CD3ζ.

5. The primer set according to claim 2 or 3, wherein the detection is performed using quantitative PCR, and a primer having the base sequence of SEQ ID NO: 1 is used as a forward primer and a primer having the base sequence of SEQ ID NO: 2 is used as a reverse primer.

6. The primer set according to claim 2 or 3, wherein the chimeric antigen receptor is a chimeric antigen receptor for multiple myeloma.

7. The primer set according to claim 2 or 3, wherein the nucleic acid is contained in one or more types of cells selected from PBMCs, T cells, NK cells, and NK-T cells.

8. A kit for detecting a nucleic acid encoding a chimeric antigen receptor, comprising the primer set of claim 1.

9. The kit according to claim 8, further comprising a probe having the base sequence of SEQ ID NO: 9, which is used to detect or quantify a nucleic acid encoding a chimeric antigen receptor.

10. The primer set according to claim 2 or the kit according to claim 8 or 9, wherein the chimeric antigen receptor is present in a biological sample.

11. 1. A method for detecting chimeric antigen receptor cells expressing CD28 and CD3ζ in a biological sample, comprising: (1) extracting DNA from a biological sample obtained from a patient to whom chimeric antigen receptor cells expressing CD28 and CD3ζ have been administered; and (2) performing quantitative PCR using the extracted DNA as a template in combination with a primer having the nucleotide sequence of SEQ ID NO: 1, a primer having the nucleotide sequence of SEQ ID NO: 2, and a probe having the nucleotide sequence of SEQ ID NO: 9; A method for detecting chimeric antigen receptor cells, comprising:

12. The method of claim 11 , wherein the patient is in need of treatment for multiple myeloma.