Composition for inducing immunotolerance
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Filing Date
- 2023-05-23
- Publication Date
- 2026-06-02
AI Technical Summary
Current methods for inducing immune tolerance, particularly in pregnant women, are inadequate in managing gestational hypertension syndrome and other immune-related disorders, as they fail to effectively regulate immune responses and maintain fetal tolerance.
The use of Leaverin, a glycoprotein that induces IDO1 and PD-L1 expression, promoting immune tolerance by stimulating ISG gene expression and modulating the immune response, thereby creating an immunosuppressive environment.
Leaverin effectively induces immune tolerance by enhancing ISG15 and IDO1 expression, reducing inflammation, and promoting a favorable immune environment for fetal development, potentially alleviating gestational hypertension syndrome and other immune-related disorders.
Abstract
Description
Composition for inducing immune tolerance
[0001] This application claims priority to Japanese Patent Application No. 2022-113357, the entire contents of which are incorporated herein by reference. The present disclosure includes compositions for inducing immune tolerance, methods for inducing immune tolerance, methods for treating cells, compositions for cell transplantation therapy, antiviral agents, methods for treating viral diseases, compositions for inducing dendritic cells, methods for preparing dendritic cells, methods for determining a disease or the risk of developing the disease, methods for evaluating the effectiveness of a therapeutic agent, and the like.
[0002] Liebelin is a unique glycoprotein expressed in extravillous trophoblasts (EVTs) of the placenta. EVTs are cells that infiltrate the maternal endometrium and are able to invade into the myometrium without being attacked by maternal immune cells, making them immunologically tolerant. Liebelin has been reported to be involved in the invasion of EVTs, but the mechanism by which EVTs are immunologically tolerant remains unclear.
[0003] Japanese Patent Application Laid-Open No. 2005-160473
[0004] Fujiwara H, et. al., Promoting Roles of Embryonic Signals in Embryo Implantation and Placentation in Cooperation with Endocrine and Immune Systems. Int J Mol Sci. 2020 Mar 10;21(5):1885. doi: 10.3390 / ijms21051885.Horie A, et. al., Laeverin / aminopeptidase Q induces trophoblast invasion during human early placentation. Hum Reprod. 2012 May;27(5):1267-76. doi: 10.1093 / humrep / des068.Fujiwara H, et. al., Human extravillous trophoblasts express laeverin, a novel protein that belongs to membrane-bound gluzincin metallopeptidases. Biochem Biophys Res Commun. 2004 Jan 23;313(4):962-8.Maruyama M, et. al., Histidine 379 of human laeverin / aminopeptidase Q, a nonconserved residue within the exopeptidase motif, defines its distinctive enzymatic properties. J Biol Chem. 2009 Dec 11;284(50):34692-702. doi: 10.1074 / jbc.M109.066712.Maruyama M, et. al., Laeverin / aminopeptidase Q, a novel bestatin-sensitive leucine aminopeptidase belonging to the M1 family of aminopeptidases. J Biol Chem.2007 Jul 13;282(28):20088-96. doi: 10.1074 / jbc.M702650200.Imakawa K, et. al., Interferon-like sequence of ovine trophoblast protein secreted by embryonic trophectoderm. Nature. 1987 Nov 26-Dec 2;330(6146):377-9. doi: 10.1038 / 330377a0.
[0005] The present inventors have found that liebelin induces IDO1 and PD-L1, which are involved in immune tolerance, and induces the expression of IFN-β and the ISG genes induced thereby. Furthermore, they have found that pregnant women with diseases such as pregnancy-induced hypertension have lower ISG15 expression levels, IDO1 expression levels, and IDO1 / ISG15 ratios in peripheral blood mononuclear cells stimulated with liebelin, and a higher proportion of liebelin-positive T cells in peripheral blood mononuclear cells, compared to normal pregnant women. Based on these findings, the present invention has been completed.
[0006] In one aspect, the present disclosure relates to a composition for inducing immune tolerance comprising liebelin.
[0007] In one aspect, the present disclosure relates to a method of inducing immune tolerance, comprising administering to a subject in need thereof an effective amount of liebelin.
[0008] In one aspect, the present disclosure relates to a method for treating cells, the method comprising culturing immune cells or a cell population comprising the same in the presence of liebelin.
[0009] In one aspect, the present disclosure relates to a cell transplantation therapy composition comprising liebelin-expressing cells containing a transgene encoding liebelin.
[0010] In one aspect, the present disclosure relates to an antiviral agent comprising liebelin.
[0011] In one aspect, the present disclosure relates to a method of treating a viral disease, comprising administering to a subject in need thereof an effective amount of liebelin.
[0012] In one aspect, the present disclosure relates to a composition for inducing dendritic cells, comprising liebelin.
[0013] In one aspect, the present disclosure relates to a method for preparing dendritic cells, the method comprising culturing monocytes or a cell population comprising same in the presence of liebelin.
[0014] In one aspect, the present disclosure relates to a method for determining a disease or the risk of developing the disease, the method comprising: culturing peripheral blood mononuclear cells collected from a subject in the presence of liebelin; and comparing the ISG15 expression level, IDO1 expression level, or IDO1 / ISG15 ratio in the peripheral blood mononuclear cells after culturing with a reference value.
[0015] In one aspect, the present disclosure relates to a method for evaluating the effect of a therapeutic agent, the method comprising: culturing peripheral blood mononuclear cells collected from a subject with a disease after administration of the therapeutic agent in the presence of liebelin; and comparing the ISG15 expression level, IDO1 expression level, or IDO1 / ISG15 ratio in the cultured peripheral blood mononuclear cells with a reference value.
[0016] In one aspect, the present disclosure relates to a method for determining a disease or the risk of developing the disease, the method comprising comparing the amount or ratio of liebelin-positive T cells in peripheral blood collected from a subject with a reference value.
[0017] In one aspect, the present disclosure relates to a method for evaluating the effectiveness of a therapeutic agent, the method comprising comparing the amount or ratio of liebelin-positive T cells in peripheral blood collected from a subject with a disease after administration of the therapeutic agent with a reference value.
[0018] Figure 1A shows the results of gene ontology analysis of genes induced by recombinant LVRN in peripheral blood mononuclear cells (PBMCs). Figure 1B shows the expression of interferon-inducible genes (OAS2, IFIT1, IFIT3, and ISG15), IDO1, and PD-L1 in PBMCs stimulated with rLVRN. Statistical analysis was performed using Welch's two-sample t-test. *p<0.05, **p<0.01. Figure 1C shows the results of an experiment in which rLVRN was absorbed by beads. Statistical analysis was performed using a multiple comparison test with Bonferroni's correction. **p<0.01. Figure 1D shows gene induction in PBMCs following direct or indirect culture with LVRN-overexpressing Swan71 cells. Statistical analysis was performed using Welch's two-sample t-test. *p<0.05, **p<0.01. Figure 1E shows gene induction in PBMCs by enzyme-inactive rLVRN. Statistical analysis was performed using Welch's two-sample t-test. *p<0.05, **p<0.01. Figure 2A shows induction of IFN expression in PBMCs by rLVRN. Statistical analysis was performed using Welch's two-sample t-test. **p<0.01. Figure 2B shows the time to manifestation of the gene induction effect of rLVRN in PBMCs. Statistical analysis was performed using ANOVA and Dunnett's multiple comparison test. *p<0.05, **p<0.01, ***p<0.001. Figure 2C shows the effective concentration of IFN-β relative to rLVRN (1.5 μg / mL). Figure 2D shows the effect of an IFN-β neutralizing antibody (aIFNb) on gene induction by IFN-β. Statistical analysis was performed using a multiple comparison test with Bonferroni correction. **p<0.01. Figure 2E shows the effect of an IFN-β neutralizing antibody (aIFNb) and a type I IFN receptor neutralizing antibody (aIFNabR) on gene induction by rLVRN. Statistical analysis was performed using a multiple comparison test with Bonferroni correction. **p<0.01. Figure 2F shows the effect of a JAK1,2 inhibitor (Ruxo) on gene induction by rLVRN in PBMCs. Statistical analysis was performed using a multiple comparison test with Bonferroni correction. *p<0.05, **p<0.01. Figure 2G shows a comparison of the ISG15- and IDO1-inducing effects of IFN-β and rLVRN in PBMCs.Statistical analysis was performed using Welch's two-sample t-test. *p<0.05, **p<0.01. Figure 3A shows the expression of ISG15 and IDO1 after stimulation with rLVRN in PBMCs from normal non-pregnant (non-pregnancy), normal pregnant (normal pregnancy), and pregnant women with hypertensive disorders of pregnancy (HDP). Figure 3B shows the expression of ISG15 and IDO1 after stimulation with IFNβ or rLVRN in PBMCs from normal pregnant women. Statistical analysis was performed using Welch's two-sample t-test. *p<0.05, **p<0.01. Figure 3C shows the association between fetal growth and the IDO1 / ISG15 ratio. Figure 3D shows the proportion of LVRN-positive T cells in non-pregnant, normal pregnant, pregnant women with hypertensive disorders of pregnancy, and pregnant women with immune disorders. Figure 4A shows FACS analysis of ISG15 protein expression in lymphocyte and monocyte fractions of PBMCs after rLVRN stimulation. Figure 4B shows cell staining of ISG15 protein expression in CD14-positive monocytes, CD4-positive T lymphocytes, CD8-positive T lymphocytes, and CD19-positive B lymphocytes in PBMCs after rLVRN stimulation. Figure 4C shows FACS analysis of the binding or uptake of labeled rLVRN to the lymphocyte and monocyte fractions of PBMCs. Figure 4D shows cell staining analysis of the binding or uptake of labeled rLVRN to the monocyte fraction of PBMCs. Figure 4E shows gene induction in CD4-positive and CD8-positive T lymphocytes after rLVRN stimulation. Statistical analysis was performed using Welch's two-sample t-test. *p<0.05, **p<0.01. Figure 4F shows microarray analysis of rLVRN-induced genes in CD14-positive monocytic cells. Figure 4G shows gene induction in CD14-positive monocytic cells by rLVRN. Statistical analysis was performed using Welch's two-sample t-test. *p<0.05, **p<0.01. Figure 4H shows induction of differentiation of CD14-positive monocytic cells into dendritic cells (DCs) by rLVRN. Statistical analysis was performed using Welch's two-sample t-test. *p<0.05, **p<0.01. Figure 4I shows induction of differentiation of CD14-positive monocytic cells into CD11c-positive / CD123-positive DCs by rLVRN. Figure 5A shows IDO1 expression in PMA-activated or non-activated THP-1 cells after rLVRN stimulation.Statistical analysis was performed using Welch's two-sample t-test with Bonferroni correction for multiple testing. *p<0.05. Figure 5B shows Western blot analysis of IDO1 protein in PMA-activated THP-1 cells after rLVRN stimulation. Statistical analysis was performed using Welch's two-sample t-test. *p<0.05. Figure 5C shows the effect of rLVRN on IDO1 induction in PMA-activated THP-1 cells. Statistical analysis was performed using one-way ANOVA compared with time 0 and post hoc Dennett's multiple comparison test. ***p<0.001. Figure 5D shows Western blot analysis of IDO1 protein in PMA-activated THP-1 cells after rLVRN stimulation. Figure 6 shows changes in tryptophan levels and kynurenine / tryptophan ratio by rLVRN in PMA-activated THP-1 cells. Statistical analysis was performed using the Welch two-sample test with Bonferroni correction for multiple testing. *p<0.05.
[0019] Unless otherwise specified, terms used in this disclosure have the meanings commonly understood by those skilled in the art of organic chemistry, medicine, pharmacology, molecular biology, microbiology, etc. Below, definitions of some terms used in this disclosure are provided, but these definitions take precedence over common understandings in this disclosure.
[0020] Liebelin (herein, also referred to as LVRN) is a glycoprotein identified as a cell surface antigen of extravillous trophoblast cells (EVT) of the placenta. Liebelin is a membrane-bound protein with M1 peptidase activity and has a membrane-binding site at the N-terminus. The amino acid sequence of liebelin can be obtained from the website of a data bank provided by a public institution.
[0021] A representative amino acid sequence of human Liebelin is shown in SEQ ID NO: 1, and the nucleotide sequence encoding it is shown in SEQ ID NO: 2. In SEQ ID NO: 1, amino acids 14-36 are the membrane binding site, and amino acids 415-438 are the Zn binding site, HEXXH(X). 18The E motif is an enzyme active site called the gluzincin motif. Liebelin is known to exist in a secreted form, and the cleavage site is between the 64th and 65th amino acids in SEQ ID NO: 1 (Non-Patent Document 5). In this specification, liebelin may be either a membrane-bound or secreted form. Liebelin may lack peptidase activity, for example, it may have a mutation in the enzyme active site.
[0022] In one embodiment, Liebelin is a polypeptide comprising or consisting of an amino acid sequence having 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity with the amino acid sequence of SEQ ID NO: 1. In one embodiment, Liebelin is a polypeptide comprising or consisting of an amino acid sequence in which 1 to 200, 1 to 150, 1 to 100, 1 to 90, 1 to 80, 1 to 70, 1 to 60, 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, or 1 to 2 amino acid residues have been altered in the amino acid sequence of SEQ ID NO: 1. In a further embodiment, Liebelin is a polypeptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1.
[0023] In one embodiment, Liebelin is a polypeptide comprising or consisting of an amino acid sequence having 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity with the amino acid sequence of amino acids 65 to 990 of SEQ ID NO: 1. In one embodiment, Liebelin is a polypeptide comprising or consisting of an amino acid sequence in which 1 to 200, 1 to 150, 1 to 100, 1 to 90, 1 to 80, 1 to 70, 1 to 60, 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, or 1 to 2 amino acid residues are altered in the amino acid sequence of amino acids 65 to 990 of SEQ ID NO: 1. In a further embodiment, Liebelin is a polypeptide comprising or consisting of the amino acid sequence of amino acids 65 to 990 of SEQ ID NO: 1.
[0024] In one embodiment, Liebelin is a polypeptide comprising or consisting of an amino acid sequence encoded by a nucleotide sequence having 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity to the nucleotide sequence of SEQ ID NO: 2. In one embodiment, Liebelin is a polypeptide comprising or consisting of an amino acid sequence encoded by a nucleotide sequence in which 1 to 600, 1 to 500, 1 to 400, 1 to 300, 1 to 200, 1 to 100, 1 to 90, 1 to 80, 1 to 70, 1 to 60, 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, or 1 to 2 nucleotides have been altered in the nucleotide sequence of SEQ ID NO: 2. In a further embodiment, Liebelin is a polypeptide comprising or consisting of the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 2.
[0025] In one embodiment, Liebelin is a polypeptide comprising or consisting of an amino acid sequence encoded by a nucleotide sequence having 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity to the nucleotide sequence of positions 193 to 2970 of SEQ ID NO: 2. In one embodiment, Liebelin is a polypeptide comprising or consisting of a nucleotide sequence in which 1 to 600, 1 to 500, 1 to 400, 1 to 300, 1 to 200, 1 to 100, 1 to 90, 1 to 80, 1 to 70, 1 to 60, 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, or 1 to 2 nucleotides are altered in the nucleotide sequence of positions 193 to 2970 of SEQ ID NO: 2. In a further embodiment, Liebelin is a polypeptide comprising or consisting of the amino acid sequence encoded by nucleotides 193 to 2970 of SEQ ID NO:2.
[0026] In one embodiment, the amino acid length of Liebelin is 700-1200, 800-1100, or 900-1000 amino acids.
[0027] As used herein, amino acid or nucleotide modifications include deletion, substitution, insertion, and addition of amino acids or nucleotides, and combinations thereof. Amino acid or nucleotide modifications may be made at any position.
[0028] As used herein, sequence identity refers to the percentage of amino acids or nucleotides that match between two sequences that are optimally aligned (maximum match) across the entire region of the sequences being compared. Additions or deletions (e.g., gaps) may be present in the optimal alignment of two sequences. Sequence identity can be calculated using programs such as FASTA, BLAST, and CLUSTAL W available from public databases (e.g., DDBJ (http: / / www.ddbj.nig.ac.jp)). Alternatively, it can be determined using commercially available sequence analysis software (e.g., Vector NTI® software, GENETYX® ver. 12).
[0029] In one embodiment, liebelin is a polypeptide functionally equivalent to a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 or a polypeptide consisting of the amino acid sequence of positions 65 to 990 of SEQ ID NO: 1. "Functionally equivalent to a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 or a polypeptide consisting of the amino acid sequence of positions 65 to 990 of SEQ ID NO: 1" means having the same quality of activity as the polypeptide. In one embodiment, a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 or a polypeptide functionally equivalent to a polypeptide consisting of the amino acid sequence of positions 65 to 990 of SEQ ID NO: 1 has one or more activities selected from immune tolerance-inducing activity, antiviral activity, and dendritic cell-inducing activity.
[0030] Liebelin can be produced by conventional methods used for producing polypeptides, such as genetic recombination and chemical synthesis. For example, in the case of genetic recombination, liebelin can be produced by introducing a vector containing a sequence encoding liebelin into a host cell and obtaining a transformant that expresses liebelin. Examples of vectors include plasmid vectors, phage vectors, and viral vectors. Viral vectors include retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated viral vectors, and baculoviral vectors. Host cells include Escherichia coli, yeast, insect cells, animal cells, and plant cells. In addition to the sequence encoding liebelin, vectors usually contain regulatory sequences such as a promoter that regulate its expression. The regulatory sequences are selected to be suitable for expression in the host cell. The vector may further contain other elements, such as a sequence encoding a selectable marker for selecting transformants, or a sequence encoding a tag such as a histidine (His) tag or a glutathione S-transferase (GST) tag. The vector can be introduced into host cells by electroporation, lipofection, the calcium phosphate method, the DEAE-dextran method, or the like. Liebelin can be isolated from the resulting transformant or its culture medium. Liebelin can be isolated and purified by methods commonly used for isolating and purifying polypeptides, such as ammonium sulfate precipitation, gel filtration chromatography, ion exchange chromatography, and affinity chromatography.
[0031] Liebelin may be a fusion polypeptide with a tag or other sequence attached, or may be bound to a support such as beads. Liebelin may also be incorporated into an artificial lipid bilayer (https: / / bio-med.jp / projects / hanayama / ; Drug Delivery System 35-1, p35-46, 2020).
[0032] Liebelin has been shown to induce IDO1 (Indoleamine 2,3-dioxygenase 1) and PD-L1 (Programmed Death-Ligand 1), which are involved in immune tolerance, in peripheral blood mononuclear cells, and to induce IDO1 more strongly in pregnant subjects, who require immune tolerance to the embryo or fetus, than in non-pregnant subjects. IDO1 metabolizes tryptophan, an amino acid essential for cell survival, and converts it into kynurenine and other metabolites with immunosuppressive effects. Therefore, increased IDO1 expression in immune cells induces immunosuppression. Furthermore, when PD-1 expressed on activated T cells binds to PD-L1 or PD-L2 expressed on cancer cells or antigen-presenting cells, T cell activation is suppressed, leading to immune escape of cancer cells (Song X, Si Q, Qi R, Liu W, Li M, Guo M, Wei L, Yao Z. Indoleamine 2,3-Dioxygenase 1: A Promising Therapeutic Target in Malignant Tumor. Front Immunol. 2021 Dec 23;12:800630. doi: 10.3389 / fimmu.2021.800630. PMID: 35003126; PMCID: PMC8733291; Kythreotou A, Siddique A, Mauri FA, Bower M, Pinato DJ. PD-L1. J Clin Pathol. 2018 Mar;71(3):189-194. doi: 10.1136 / jclinpath-2017-204853. Epub 2017 Nov 2. PMID: 29097600). Therefore, Liebelin, which can induce IDO1 and PD-L, can be used to induce immune tolerance.
[0033] As used herein, immune tolerance refers to a state in which a specific immune response to a specific antigen does not occur or is reduced. In one embodiment, Liebelin is used to induce immune tolerance in a subject. In another embodiment, Liebelin is used to induce immune tolerance in cells. For example, Liebelin can be used to treat a subject in need of immune tolerance induction or to treat cells in need of immune tolerance induction.
[0034] In one embodiment, Liebelin is administered to a patient with an autoimmune disease, such as systemic lupus erythematosus (SLE), rheumatoid arthritis, Sjogren's syndrome, Hashimoto's disease, type 1 diabetes, autoimmune myositis, systemic sclerosis, glomerulonephritis, Graves' disease, etc. In one aspect, the present disclosure provides a composition for treating an autoimmune disease, comprising Liebelin.
[0035] In one embodiment, Liebelin is administered to an organ transplant recipient. During organ transplantation, immunosuppressants are used to prevent the recipient's immune system from rejecting the transplanted organ. However, these immunosuppressants also suppress immune functions necessary for maintaining homeostasis, raising concerns about increased risk of infection and cancer development due to suppressed cancer immunity. By inducing immune tolerance in organ transplant recipients, it is expected that they will be able to withdraw from immunosuppressants.
[0036] In one embodiment, Liebelin is administered intrauterinely prior to embryo transfer after in vitro fertilization. Liebelin is a molecule involved in the induction of immune tolerance by the fetus, and administration of Liebelin can make the immune environment of the endometrium suitable for implantation, thereby improving the implantation rate of embryo transfer.
[0037] In one embodiment, Liebelin is used to treat immune cells or cell populations containing immune cells. Examples of immune cells include T cells (including CD4-positive T cells and CD8-positive T cells), B cells, NK cells, monocytes, macrophages, dendritic cells, or a combination thereof, with monocytes being preferred. Examples of cell populations containing immune cells include peripheral blood mononuclear cells. Peripheral blood mononuclear cells can be isolated from peripheral blood by conventional methods, for example, by density gradient centrifugation. The immune cells or cell populations containing immune cells may be immune cells or cell populations containing immune cells collected from a subject in need of immune tolerance induction. For example, immune cells or cell populations containing immune cells can be collected from a subject in need of immune tolerance induction, treated with Liebelin, and then returned to the subject. Examples of subjects in need of immune tolerance induction include autoimmune disease patients and organ transplant recipients. In in vitro fertilization, autoimmune transplantation therapy, in which autoimmune cells extracted from the body are activated with the embryo signal human chorionic gonadotropin (HCG) and then administered intrauterinely followed by embryo transfer, has been reported to improve implantation rates, and numerous follow-up studies have confirmed its therapeutic efficacy (Yoshioka et al., Hum Reproduction, Vol. 21, No. 12, pp. 3290-3294, 2006). Liebelin can be used as an alternative embryo signal to HCG in this autoimmune transplantation therapy. Therefore, subjects requiring immune tolerance induction also include embryo transfer recipients.
[0038] Treatment of cells or cell populations with liebelin can be carried out by culturing the cells or cell populations in the presence of liebelin. The medium can be a medium commonly used for culturing animal cells, such as RPMI 1640, MEM, IMDM, or DMEM. Liebelin can be added to the medium at a final concentration of, for example, 1 ng / mL to 10 μg / mL, 5 ng / mL to 5 μg / mL, 10 ng / mL to 1 μg / mL, 20 ng / mL to 500 ng / mL, or 100 ng / mL to 500 ng / mL, e.g., 1.5 μg / mL. In addition to liebelin, the medium may contain substances such as serum, serum substitutes, antibiotics, amino acids, 2-mercaptoethanol, and growth factors. The medium may be serum-free. The culture period is not limited to, but may be, for example, 1 to 30 days, 1 to 20 days, 1 to 14 days, or 1 to 10 days, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days.
[0039] Since membrane-bound liebelin is also effective, immune cells or a cell population containing such immune cells may be cultured together with liebelin-expressing cells. The term "liebelin-treated cells" as used herein also encompasses cells co-cultured with liebelin-expressing cells. Liebelin-expressing cells may be cells into which a sequence encoding liebelin has been introduced, i.e., cells containing a transgene encoding liebelin. Such liebelin-expressing cells can be produced by introducing a vector containing the liebelin-encoding sequence described herein into cells. Those skilled in the art can appropriately select cells into which the vector is introduced; for example, Swan 71 cells can be used.
[0040] It has been shown that co-culturing liebelin-expressing cells with PBMCs enhances IDO1 expression in PBMCs, indicating that liebelin-expressing cells can evade immune defenses. Therefore, by introducing and expressing a liebelin coding sequence into cells to be transplanted in cell transplantation therapy, the ability to evade host rejection can be enhanced. Therefore, liebelin-expressing cells containing a transgene encoding liebelin can be used in cell transplantation therapy. The transgene may encode any of the liebelins described herein. Cells into which the liebelin coding sequence is introduced include iPS cells or transplant cells derived from iPS cells. This is particularly useful when allogeneic iPS cells are used for therapy.
[0041] Liebelin has been shown to induce the expression of IFN-β and the ISG gene cluster induced by it, and to induce the APOBEC3 family in peripheral blood mononuclear cells. Interferons are cytokines produced by immune cells in vivo during viral infection and have antiviral activity. IFN-β is widely used clinically as a therapeutic agent for viral hepatitis, such as hepatitis B and hepatitis C. Furthermore, the APOBEC3 family is a cytidine deaminase known to inhibit viral replication and have antiviral activity. Therefore, Liebelin can be used as an antiviral agent. Target viruses include hepatitis B virus, hepatitis C virus, human immunodeficiency virus (HIV), and human papillomavirus (HPV). Target viral diseases include hepatitis B virus, hepatitis C virus, HIV infection, and HPV infection. Furthermore, when liebelin is expressed in transplant cells, the cells themselves have the ability to promote the secretion of IFN-β in immune cells, so by expressing liebelin, it is possible to create transplant cells that are resistant to infectious diseases and the like.
[0042] Liebelin has been shown to induce dendritic cells from monocytes. Therefore, Liebelin can be used to prepare dendritic cells. Dendritic cells can be prepared by culturing monocytes or cell populations containing monocytes in the presence of Liebelin. Monocytes can be identified by CD14 expression and can also be isolated from cell populations containing monocytes. Examples of cell populations containing monocytes include peripheral blood mononuclear cells. Peripheral blood mononuclear cells can be peripheral blood mononuclear cells collected from a subject to which the prepared dendritic cells will be administered. Media typically used for culturing animal cells can be used, such as RPMI 1640, MEM, IMDM, and DMEM. Liebelin can be added to the medium at a final concentration of, for example, 1 ng / mL to 10 μg / mL, 5 ng / mL to 5 μg / mL, 10 ng / mL to 1 μg / mL, 20 ng / mL to 500 ng / mL, or 100 ng / mL to 500 ng / mL, e.g., 1.5 μg / mL. In addition to liebelin, the medium may contain substances such as serum, serum substitutes, antibiotics, amino acids, 2-mercaptoethanol, and growth factors. The medium may be serum-free. The culture period is not limited, and may be, for example, 1 to 30 days, 1 to 20 days, 1 to 14 days, or 1 to 10 days, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days. The presence of dendritic cells can be confirmed by detecting cell surface markers. Dendritic cell markers include CD11b, CD11c, CD123, CD38, CD80, and HLA-DR, and the induction of dendritic cells can be confirmed by detecting one or more markers selected from these. In one embodiment, the dendritic cells are CD11c / CD123 double-positive cells. Thus, in one aspect, the present disclosure provides a method for preparing dendritic cells, the method comprising culturing a cell population containing monocytes in the presence of liebelin. Dendritic cells can be used in dendritic cell therapy for diseases such as cancer, autoimmune diseases, and allergic diseases.
[0043] The composition may contain liebelin, liebelin-treated cells, or liebelin-expressing cells as an active ingredient. The composition may contain one or more pharmaceutically acceptable carriers in addition to liebelin or cells. In this disclosure, a pharmaceutically acceptable carrier refers to any substance other than the active ingredient that does not impair the efficacy of the active ingredient and is highly safe for the subject. Pharmaceutically acceptable carriers include excipients, stabilizers, buffers, preservatives, suspending agents, isotonic agents, etc. When the composition contains cells, the pharmaceutically acceptable carrier may be, for example, water, culture medium, saline, an isotonic solution containing glucose, etc., or phosphate-buffered saline (PBS). The composition may contain other active ingredients to the extent that they do not impair the efficacy of liebelin or the cells.
[0044] The composition may be in solid or liquid form.Dosage forms include, but are not limited to, capsules, tablets, powders, liquids, suspensions, injections, ointments, creams, and suppositories.The composition can be prepared according to known methods.In one embodiment, the composition is an injection.Injections include aqueous injections, non-aqueous injections, suspension injections, emulsion injections, and solid injections that are dissolved or suspended when used.
[0045] Liebelin, liebelin-treated cells, liebelin-expressing cells, or compositions containing the same can be administered to a subject by known administration methods, including oral administration and parenteral administration, such as intravenous administration, intrauterine administration, intramuscular administration, transdermal administration, and subcutaneous administration.
[0046] The subject may be a human or a non-human mammal. Non-human mammals include, for example, rodents such as mice, rats, guinea pigs, and hamsters; non-human primates such as chimpanzees; even-toed ungulates such as cows, goats, and sheep; perissodactyls such as horses; and companion animals such as rabbits, dogs, and cats. In one embodiment, the subject is a human or a non-human primate (e.g., chimpanzees, monkeys, gorillas, gibbons, and orangutans). In a further embodiment, the subject is a human.
[0047] The dosage of liebelin or cells is appropriately determined depending on factors such as the age, weight, and condition of the subject, and the purpose of treatment. When liebelin is administered to a subject, the dosage of liebelin can be, for example, 1 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, or 50 mg or more, or 10,000 mg, 5,000 mg, 4,500 mg, 4,000 mg, 3,500 mg, 3,000 mg, 2,500 mg, 2,000 mg, 1,500 mg, or 1,000 mg or less per day for an adult. In one embodiment, the dosage of liebelin is 15 mg to 4,500 mg. When liebelin-treated cells or liebelin-expressing cells are administered to a subject, the number of cells administered can be, for example, 1 to 10 per day for an adult. 10 cells, 10-10 9 cells, 10 2 ~10 8 cells, or 10 3 ~10 7 The cells may be administered as a single dose or in multiple doses per day. The administration period may be, but is not limited to, one day or several days (e.g., 2, 3, 4, 5, or 6 days), one week or several weeks (e.g., 2, 3, 4, 5, or 6 weeks), one month or several months (e.g., 2, 3, 4, 5, or 6 months), or longer. Administration may be daily, or once every several days (e.g., 2, 3, 4, 5, or 6 days), one week or several weeks (e.g., 2, 3, 4, 5, or 6 weeks), or one month or several months (e.g., 2, 3, 4, 5, or 6 months).
[0048] Compared with normal pregnant women, women with pregnancy-induced hypertension have been shown to have lower ISG15 and IDO1 expression levels stimulated by liebelin in peripheral blood mononuclear cells, as well as a lower ratio of ISG15 to IDO1 expression levels (referred to as the IDO1 / ISG15 ratio), suggesting a relationship between these and disease. Furthermore, women with pregnancy-complicated hypertension or systemic lupus erythematosus (SLE) have been shown to have a higher proportion of liebelin-positive T cells, suggesting a relationship between liebelin-positive T cells and disease. Therefore, based on the ISG15 expression level, IDO1 expression level, or IDO1 / ISG15 ratio in a subject's peripheral blood mononuclear cells, or the amount or proportion of liebelin-positive T cells, it is possible to determine a disease or its risk of developing, or evaluate the therapeutic effect of a therapeutic drug. Examples of such diseases include pregnancy-induced hypertension and immune-related diseases such as SLE.
[0049] In one embodiment, the method of the present disclosure involves culturing peripheral blood mononuclear cells collected from a subject in the presence of liebelin, and then comparing the ISG15 expression level, IDO1 expression level, or IDO1 / ISG15 ratio in the peripheral blood mononuclear cells with corresponding reference values. The medium may be a medium typically used for culturing animal cells, such as RPMI 1640, MEM, IMDM, or DMEM. Liebelin may be added to the medium at a final concentration of, for example, 1 ng / mL to 10 μg / mL, 5 ng / mL to 5 μg / mL, 10 ng / mL to 1 μg / mL, 20 ng / mL to 500 ng / mL, or 100 ng / mL to 500 ng / mL, e.g., 1.5 μg / mL. In addition to liebelin, the medium may contain substances such as serum, serum substitutes, antibiotics, amino acids, 2-mercaptoethanol, and growth factors. The medium may be serum-free. The culture time is not limited, but may be, for example, 4 to 24 hours, 6 to 24 hours, 8 to 24 hours, 10 to 24 hours, or 12 to 24 hours. Collection of peripheral blood mononuclear cells from a subject and measurement of the expression levels of ISG15 and IDO1 can be performed by conventional methods. For example, the expression levels of ISG15 and IDO1 can be measured by polymerase chain reaction (PCR), microarray, or the like. The method of the present disclosure may include comparing two or more selected from the ISG15 expression level, the IDO1 expression level, and the IDO1 / ISG15 ratio with their corresponding reference values.
[0050] In one embodiment, the method of the present disclosure comprises comparing the amount or ratio of liebelin-positive T cells in peripheral blood collected from a subject with a reference value. The ratio of liebelin-positive T cells in peripheral blood refers to the ratio of liebelin-positive T cells among peripheral blood mononuclear cells contained in the peripheral blood. Collection of peripheral blood and peripheral blood mononuclear cells from a subject and measurement of liebelin-positive T cells can be performed by a conventional method. For example, liebelin-positive T cells in peripheral blood can be measured by flow cytometry using an anti-CD3 antibody and an anti-liebelin antibody against peripheral blood mononuclear cells.
[0051] The reference value may be a value of the ISG15 expression level, the IDO1 expression level, the IDO1 / ISG15 ratio, or the amount or proportion of liebelin-positive T cells that can statistically significantly separate a group of subjects known to have a disease from a group of subjects without the disease (e.g., a group of healthy individuals). Statistical significance can be analyzed using a test method such as a chi-square test, a generalized Wilcoxon test, a Wilcoxon signed-rank test, a Mann-Whitney test, a log-rank test, or a Cox proportional hazards test. The reference value may be set based on sensitivity and / or specificity. Sensitivity refers to the true positive rate, and specificity refers to the true negative rate. For example, a value that shows a high positive rate in a group of subjects known to have a disease and a high negative rate in a group of subjects without the disease may be set as the reference value.
[0052] In one embodiment, if the ISG15 expression level, IDO1 expression level, or IDO1 / ISG15 ratio in peripheral blood mononuclear cells collected from a subject and cultured in the presence of liebelin is lower than a standard value, or if the amount or ratio of liebelin-positive T cells in peripheral blood collected from the subject is higher than a standard value, the subject is determined to have a disease or to be at risk of developing a disease.
[0053] When evaluating the effect of a therapeutic agent on a disease, peripheral blood or peripheral blood mononuclear cells are collected from a subject with the disease after administration of the therapeutic agent. In one embodiment, if the ISG15 expression level, IDO1 expression level, or IDO1 / ISG15 ratio in peripheral blood mononuclear cells collected from a subject with the disease after administration of the therapeutic agent is higher than a reference value, or if the amount or proportion of liebelin-positive T cells in peripheral blood collected from a subject with the disease after administration of the therapeutic agent is lower than a reference value, the therapeutic agent is determined to be effective. In this case, the reference value may be, in addition to the reference value set as described above, the ISG15 expression level, IDO1 expression level, or IDO1 / ISG15 ratio in peripheral blood mononuclear cells collected from the same subject before administration of the therapeutic agent, or the amount or proportion of liebelin-positive T cells in peripheral blood collected from the same subject before administration of the therapeutic agent.
[0054] Exemplary embodiments of the present disclosure are described below. [1] A composition for inducing immune tolerance, comprising liebelin. [2] The composition described in 1 above, which is administered to a patient with an autoimmune disease. [3] The composition described in 1 above, which is administered to a recipient of an organ transplant. [4] The composition described in 1 above, which is administered intrauterinely prior to embryo transfer after in vitro fertilization. [5] The composition described in 1 above, which is used for ex vivo treatment of immune cells or a cell population containing the immune cells. [6] The composition described in 5 above, wherein the immune cells or a cell population containing the immune cells are cells collected from a patient with an autoimmune disease. [7] The composition described in 5 above, wherein the immune cells or a cell population containing the immune cells are cells collected from a recipient of an organ transplant. [8] The composition described in 5 above, wherein the immune cells or a cell population containing the immune cells are cells collected from a recipient of an embryo transplant. [9] The composition according to any one of 1 to 8, wherein liebelin is a polypeptide comprising or consisting of an amino acid sequence having 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity with the amino acid sequence of SEQ ID NO: 1.
[10] The composition according to 9, wherein liebelin is a polypeptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1.
[11] The composition according to any one of 1 to 8, wherein liebelin is a polypeptide comprising or consisting of an amino acid sequence having 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity with the amino acid sequence of amino acids 65 to 990 of SEQ ID NO: 1.
[12] The composition according to 11, wherein liebelin is a polypeptide comprising or consisting of the amino acid sequence of amino acids 65 to 990 of SEQ ID NO: 1.
[0055]
[13] A method for inducing immune tolerance, comprising administering an effective amount of liebelin to a subject in need thereof.
[14] The method according to 13, wherein the subject is a patient with an autoimmune disease.
[15] The method according to 13, wherein the subject is a recipient of an organ transplant.
[16] The method according to 13, wherein the subject is a recipient of an embryo transplant.
[0056]
[17] A method for treating cells, comprising culturing immune cells or a cell population containing the same in the presence of liebelin.
[18] The method according to 17 above, wherein the cell population is peripheral blood mononuclear cells.
[0057]
[19] A composition for cell transplantation therapy, comprising liebelin-expressing cells containing a transgene encoding liebelin.
[0058]
[20] An antiviral agent containing liebelin.
[0059]
[21] A method for treating a viral disease, comprising administering an effective amount of Liebelin to a subject in need thereof.
[0060]
[22] A composition for inducing dendritic cells, comprising liebelin.
[0061]
[23] A method for preparing dendritic cells, the method comprising culturing monocytes or a cell population containing same in the presence of liebelin.
[24] The method according to 23 above, wherein the cell population is peripheral blood mononuclear cells.
[0062]
[25] A method for determining a disease or the risk of developing a disease, comprising: culturing peripheral blood mononuclear cells collected from a subject in the presence of liebelin; and comparing the ISG15 expression level, IDO1 expression level, or IDO1 / ISG15 ratio in the cultured peripheral blood mononuclear cells with a standard value.
[26] A method for evaluating the effect of a therapeutic drug, comprising: culturing peripheral blood mononuclear cells collected from a subject with a disease after administration of the therapeutic drug in the presence of liebelin; and comparing the ISG15 expression level, IDO1 expression level, or IDO1 / ISG15 ratio in the cultured peripheral blood mononuclear cells with a standard value.
[27] The method described in 25 or 26, wherein the disease is pregnancy-induced hypertension.
[0063]
[28] A method for determining a disease or a risk of developing the disease, comprising comparing the amount or ratio of liebelin-positive T cells in peripheral blood collected from a subject with a reference value.
[29] A method for evaluating the effect of a therapeutic drug, comprising comparing the amount or ratio of liebelin-positive T cells in peripheral blood collected from a subject with a disease after administration of the therapeutic drug with a reference value.
[30] The method according to 28 or 29, wherein the disease is pregnancy-induced hypertension.
[0064] The present invention will be further explained below with reference to examples, but the present invention is not limited to these examples in any sense.
[0065] I. Methods 1. Construction of Recombinant Lieberlin (rLVRN) cDNA encoding full-length human lieberin (LVRN) (1-990) with a C-terminal hexahistidine (His6) tag was constructed by PCR. The amplified cDNA was cloned into the EcoRI-XhoI sites of the baculovirus transfer vector pFastBac1 (Invitrogen). The constructed transfer vector was then introduced into Escherichia coli DH10Bac cells harboring the baculovirus genome (bacmid) and a transposition helper vector (Invitrogen) to construct recombinant bacmid DNA containing the LVRN cDNA. Subsequently, bacmid DNA was introduced into Sf9 insect cells using Cellfectin® Reagent (Invitrogen), and after 72 hours of culture, the recombinant baculovirus was collected. Expression of rLVRN was measured using Sf9 cells (2.0 × 10 6 / ml) (multiplicity of infection = approximately 1-3) in 8.0 ppm O 2The cells were cultured for 72 hours at 27°C in 3 liters of SFM-900III medium (Invitrogen) supplemented with Ni-2000 (Cellmaster-1700, WAKENYAKU CO., LTD., Kyoto, Japan). The medium containing soluble rLVRN was collected by centrifugation and applied to a hydroxyapatite column (2.5 x 10 cm, Nacalai Tesque, Kyoto, Japan) equilibrated with 50 mM Tris / HCl buffer (pH 7.5), followed by elution with 100 mM sodium phosphate buffer (pH 7.5). The eluate was collected by Ni-2000 (Cellmaster-1700, WAKENYAKU CO., LTD., Kyoto, Japan). 2+ The resulting mixture was applied to a chelating Sepharose column (1.0 × 10 cm) (GE Healthcare Bio-Science, Piscataway, NJ) preloaded with LVRN and eluted with 200 mM imidazole. Secreted LVRN with a His6 tag at the C-terminus (LVRN(65-990)+His6) was recovered.
[0066] 2. Construction of Enzyme-Inactive rLVRN Enzyme-inactive rLVRN (E416Q rLVRN) was constructed by site-directed mutagenesis. cDNA encoding E416Q rLVRN was constructed using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, LaJolla, CA). To express it as a soluble protein, the coding sequence for the cytoplasmic and transmembrane domains (Met1-Gln64) of the enzyme was replaced with the human trypsin II signal peptide (MNLLLILTFVAAVAA) (SEQ ID NO: 3), and a His6 tag was added to the C-terminus. The amplified cDNA was cloned into the BssHII-XhoI sites of the baculovirus transfer vector pFastbac-1 (Invitrogen). To generate recombinant bacmid DNA containing the E416Q rLVRN cDNA, the constructed transfer vector was transformed into Escherichia coli DH10Bac cells carrying the baculovirus genome (bacmid) and a transposition helper vector (Invitrogen). The bacmid DNA was introduced into Sf9 insect cells using Cellfectin® Reagent (Invitrogen), and after 72 hours of culture, the recombinant baculovirus was collected. Expression of E416Q rLVRN was confirmed in Sf9 cells (2.0 × 10 cells) infected with the recombinant baculovirus. 6 / ml) (multiplicity of infection = approximately 1-3) with 8.0 ppm O 2 The cells were cultured for 72 hours at 27°C in 3 liters of SFM-900III medium (Invitrogen) supplemented with Ni-2000 (Cellmaster-1700, WAKENYAKU CO., LTD., Kyoto, Japan). The medium containing E416Q rLVRN was collected by centrifugation and applied to a hydroxyapatite column (2.5 x 10 cm) (Nacalai Tesque, Kyoto, Japan) equilibrated with 50 mM Tris / HCl buffer (pH 7.5), followed by elution with 100 mM sodium phosphate buffer (pH 7.5). The eluate was collected by Ni-2000 (Cellmaster-1700, WAKENYAKU CO., LTD., Kyoto, Japan). 2+The solution was applied to a chelating Sepharose column (1.0 x 10 cm) (GE Healthcare Bio-Science, Piscataway, NJ) and eluted with 200 mM imidazole.
[0067] 3. Microarray Analysis and Gene Ontology Analysis Microarray-based gene expression array analysis was performed according to the manufacturer's instructions. Specifically, labeled cDNA was prepared from 0.2 μg of RNA using a Low Input Quick Amp Labeling Kit (Agilent Technologies, Santa Clara, CA, USA). Samples were printed on a SurePrint G3 Human GE microarray 8 × 60 K Ver. The samples were hybridized to a 3.0 (G4845A#72363, Agilent Technologies) and scanned with an Agilent DNA Microarray Scanner (G2539A) using one-color scan settings with 1x60k array slides (Agilent Technologies). Scanned images were analyzed using Feature Extraction Software 11.0.1.1 (Agilent). Data were normalized and filtered with three filters using GeneSpring software 12.1 (Agilent Technologies). Differentially expressed genes were extracted from the normalized microarray intensity data using the weighted average difference (WAD) ranking method (Kadota K, Nakai Y, Shimizu K., A weighted average difference method for detecting differentially expressed genes from microarray data. Algorithms Mol Biol. 2008 Jun 26;3:8. doi: 10.1186 / 1748-7188-3-8. PMID: 18578891; PMCID: PMC2464587). This method is a statistical approach based on the fold-change method that utilizes not only gene expression differences but also microarray signal intensities. The identified genes with increased or decreased expression were subjected to gene ontology analysis using Database for Annotation, Visualization and Integrated Discovery (DAVID) with a threshold of P value <0.05.
[0068] 4. Collection and isolation of peripheral blood mononuclear cells (PBMCs) Blood was collected under heparin from healthy men and non-pregnant women, normal pregnant women, and pregnant women with complications. TM PBMCs were isolated from collected blood using PLUS (Cytiva, density 1.077±0.001 g / mL). The isolated PBMCs were frozen and stored in a liquid nitrogen tank using CELLBANKER1. PBMCs from healthy, non-pregnant women were used in the experiments, unless otherwise specified.
[0069] 5. Quantitative PCR Total RNA was extracted from cells using the RNeasy mini kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. TM cDNA was reverse transcribed using an RT-PCR kit (Takara Bio Inc., Shiga, Japan). β-actin (ACTB) was used as a control. cDNA was amplified using forward (Fd) and reverse (Rs) primers specific to each gene (Table 1). PCR was performed using a two-step PCR protocol. Cycling conditions included an initial denaturation at 95°C for 30 seconds, denaturation at 95°C for 5 seconds, and annealing / extension at 60°C for 30 seconds for 40-45 cycles. Quantitative real-time PCR analysis was performed using the AriaMX Real-Time PCR System (Agilent Stratagene, LaJolla, CA, USA) according to the manufacturer's instructions. Mean values ± SD from three to five independent experiments are shown.
[0070] 6. Flow cytometry PBMCs or Swan71 cells were incubated with FITC-conjugated anti-LVRN antibody (clone 5-23) or FITC-conjugated mouse IgG antibody (clone: P3.6.2.8.1 LOT: 2067148 Invitrogen) as a control for 30 minutes at 4°C. Cell surface labeling was analyzed using a BD FACS Aria. TM Analysis was carried out by fluorescence detection using a Fusion cell sorter.
[0071] FACS analysis of ISG15 expression in immune cells by rLVRN was performed as follows. PBMCs were added with 1.5 μg / mL of rLVRN and cultured for 24 hours. The PBMCs were then collected and analyzed by FACS analysis using BD Pharmingen. TM Human BD Fc block TM (Cat# 564220, LOT: 9049805) was used for blocking at 4°C for 30 minutes. FITC-conjugated CD14 (monocyte marker) antibody (FITC mouse IgG1k anti-humana CD14 Clone: HCD14 Cat#325604 LOT:B268830 Biolegend), APC-conjugated anti-CD19 (B cell marker) antibody (APC mouse IgG1k anti-human CD19 Cat#555415 LOT:8296813 BD pharmingen), and BV421-binding CD3 (T cell marker) antibody (BV421 mouse IgG1k anti-human CD3 Clone:UCHT1 Cat#562426 The cells were incubated with a 1% PFA antibody (lot no. 9113553) at 4°C for 1 hour. The antibody was then washed several times and fixed with 1% PFA for 10 minutes. The cells were then permeabilized with 0.1% triton / PBS for 10 minutes. Finally, the cells were incubated with a PE-conjugated anti-ISG15 antibody (anti-hISG15 / UCRP PE conjugated Rat IgG2A Cat# IC8044P, lot no. ADRU0219021, R&D systems) at 4°C for 1 hour. The cells were then analyzed using a BD FACS Aria. TM Analysis was carried out by fluorescence detection using a Fusion cell sorter.
[0072] Analysis of LVRN-expressing T cells in maternal blood was performed as follows. PBMCs were isolated from the collected blood and then purified by BD Pharmingen. TM Human BD Fc block TMBlocking was performed for 30 minutes at 4°C using an FITC-conjugated anti-LVRN antibody (clone 5-23) and a BV421-conjugated CD3 (T cell marker) antibody (BV421 mouse IgG1k anti-human CD3 Clone: UCHT1 Cat# 562426 LOT: 9113553) after washing several times. Double staining was performed for 1 hour at 4°C. Subsequently, after washing the antibodies several times, the cells were analyzed using a BD FACS Aria. TM Analysis was carried out by fluorescence detection using a Fusion cell sorter.
[0073] The differentiation of CD14 cells by rLVRN was analyzed as follows. PBMCs were added with 1.5 μg / mL of rLVRN and cultured for 24 hours. The PBMCs were then collected and analyzed by BD Pharmingen. TM Human BD Fc block TM (Cat# 564220, LOT: 9049805) was used for blocking at 4°C for 30 minutes. After fixation with 1% PFA for 10 minutes, the cells were incubated with FITC-conjugated CD14 (monocyte marker) antibody (FITC mouse IgG1k anti-human CD14 Clone: HCD14 Cat#325604 LOT: B268830 Biolegend), PE-conjugated anti-HLA-DR (antigen-presenting cell marker) antibody (PE mouse IgG2ak anti-human HLA-DR Cat#555812 LOT: 9248092 BD Pharmingen), and APC-conjugated anti-CD11c (dendritic cell marker (mainly moDC)) antibody (APC mouse IgG1k anti-human CD11c Clone: 3.9 Cat#301614 LOT: B276681 Biolegend), and BV421-conjugated anti-CD123 (dendritic cell marker (mainly pDC)) antibody (BV421 mouse IgG2ak anti-human CD123 Clone: 7G3 Cat#563362 LOT: 0279696 BD Horizon) were applied at 4°C for 1 hour, and the cells were analyzed using a BD FACS Aria. TM Analysis was carried out by fluorescence detection using a Fusion cell sorter.
[0074] 7. Preparation of Fluorescently Labeled rLVRN and Analysis of Binding and Cellular Uptake of Fluorescently Labeled rLVRN Fluorescent labeling of rLVRN was performed using the AnaTag HyLite Fluor 488 Microscale Protein Labeling Kit (AnaSpec Inc., Fremont, CA, USA) according to the manufacturer's instructions. After 4 and 24 hours of incubation with 1.5 μg / mL of fluorescently labeled rLVRN, PBMCs were collected and fixed with 4% PFA for 10 minutes. The PBMCs were analyzed using a BD FACS Aria. TM PBMCs were separated into monocyte and lymphocyte fractions using a Fusion cell sorter, and their fluorescence intensities were analyzed.
[0075] 8. rLVRN Absorption Experiment Using Beads An rLVRN inhibition experiment was carried out using beads that recognize the histidine tag of rLVRN. TM One μL of His-Ni magnetic beads (Cat# MHN-102, Lot: 0119) and 4.5 μg of rLVRN were added and stirred at 4°C. After 30 minutes, the beads and the rLVRN that had reacted with the beads were collected using a magnet (6-Tube Magnetic Separation Rack #7017S, Lot: 0001, Cell Signaling), and the supernatant alone was added to PBMCs. The mixture was incubated at 37°C for 24 hours, after which PBMCs were collected and RNA was extracted.
[0076] 9. Preparation of LVRN-Swan71 Cells To establish the LVRN-expressing Swan71 cell line, a cDNA encoding full-length human liebelin (hLVRN-His) with a His6 tag at the C-terminus was inserted into the pTargeT vector (Promega). The resulting rLVRN-His / pTargeT (500 ng) was linearized by cleavage with Psp1406I and transfected into Swan71 cells using FuGeneHD (Promega). Forty-eight hours after transfection, a stable expression line was established and isolated using a medium containing 500 μg / mL G418. To establish NEO-Swan71 cells, the pTargeT vector was transfected in place of rLVRN-His / pTargeT.
[0077] 10. Direct culture with LVRN-Swan71 cells LVRN-Swan71 cells and NEO-Swan71 cells, which had been previously treated with 2 μg / mL of mitomycin for 4 hours, were cultured at 1.5 × 10 cells per well in a 12-well plate for adherent cells. 5 After confirming cell adhesion, the cells were cultured at a concentration of 1.5 × 10 cells / well in RPMI at 1 mL / well. 5 One mL of PBMCs adjusted to a concentration of 1000 cells was replaced with the culture medium of LVRN-Swan71 cells and NEO-Swan71 cells. After 24 hours of incubation at 37°C, the culture plate was agitated for 10 minutes on a shaker. The cells in the supernatant were collected and filtered twice through a 35 μm pore cell strainer. CD45 MicroBeads (Order No: 130-045-801 LOT: 5151027008 Miltenyi Biotec) were then added, and CD45-positive cells were selectively isolated and collected using the Possel program of an autoMACS® Pro Separator (Miltenyi Biotec).
[0078] 11. Indirect culture with LVRN-Swan71 cells LVRN-Swan71 cells and NEO-Swan71 cells, which had been treated with 2 μg / mL mitomycin for 4 hours in advance, were plated in a 6-well plate for adherent cells at a density of 3.0 × 10 5 The cell density was adjusted to 3 mL / well using RPMI, and the cells were cultured at 3 mL / well. After confirming cell adhesion, PBMCs (1.0 × 10 5 After incubation at 37° C. for 24 hours, the PBMCs in the transwells were collected.
[0079] 12. Inhibition experiment using IFN-β neutralizing antibody and type I IFN receptor neutralizing antibody 7x10 51 mL of PBMCs adjusted to a concentration of 100 cells / mL using RPMI were cultured in a 12-well plate for suspension cells, and 1 μg / mL of a type I IFN receptor neutralizing antibody (Interferon alpha / beta Receptor Chain 2 Cat# MAB1155 LOT: 3766724 EMD Millipore Corporation) and 1 μg / mL of an IFN-β neutralizing antibody (anti-hIFN-β Cat# AF814, LOT: BTT0818121) were added. After incubation at 37°C for 10 minutes, 1.5 µg / mL of rLVRN or 100 IU / mL of IFNβ (Interferon Beta, Daiichi Sankyo) was added, and the cells were further incubated at 37°C for 24 hours, after which the cells were harvested.
[0080] 13. Inhibition experiment using JAK1,2 inhibitor ruxolitinib PBMCs were cultured at 1.5 x 10 5 The cell concentration was adjusted to 100 cells / mL using RPMI, and 1 mL of the resulting solution was cultured in a 12-well suspension cell plate. 1 μM of the JAK inhibitor ruxolitinib (INCB18424, Cat# S1378, LOT: S137815, Selleckchem) was added, and the cells were incubated at 37°C for 10 minutes. 1.5 μg / mL of rLVRN was then added, and the cells were further incubated at 37°C for 24 hours, after which the cells were collected and RNA was extracted.
[0081] 14. Method for Separating CD14-Positive Monocyte Fraction, CD4-Positive Fraction, or CD8-Positive Fraction CD14-positive monocytes were separated / collected by reacting them with CD14 microbeads (CD14 MicroBeads, human, Order no: 130-050-201, Lot no: 5210205621, Miltenyi Biotec), and CD45-positive cells were selectively separated and collected using the Possel program of an autoMACS® Pro Separator (Miltenyi Biotec). Separation and recovery of CD4- and CD8-positive cells were similarly performed using CD4 microbeads (CD4 MicroBeads, human, Order no: 130-045-101, Lot no: 5210401362, Miltenyi Biotec) or CD8 microbeads (CD8 MicroBeads, human, Order no: 130-045-201, Lot no: 5210401341, Miltenyi Biotec).
[0082] 15. Cell Staining Swan71 cells were stained by fixation with 4% PFA for 10 minutes, followed by treatment with anti-LVRN antibody clone (5-23), and then treatment with Alexa Fluor 488 goat anti-mouse IgG (H+L) (REF: A11001 LOT: 2220848 Invitrogen). The cells were then embedded and observed under a fluorescence microscope (Olympus BX50 microscope) and photographed with a camera (DP72 Olympus digital camera).
[0083] The expression of ISG15 in immune cells by rLVRN was observed as follows: PBMCs were cultured for 24 hours after addition of rLVRN (1.5 μg / mL), and then collected. The PBMCs were fixed with 4% PFA for 10 minutes, permeabilized with 0.1% triton / PBS for 10 minutes, and blocked with 1% FBS / PBS for 30 minutes. Anti-CD14 (monocyte marker) antibody (CD14 (UCH-M1) mouse mAb sc-1182 LOT:K1308 Santa Cruz), anti-CD19 (B cell marker) antibody (CD19 (EPR5906) rabbit Ab ab134114 LOT:GR3252252-1), anti-CD4 antibody (CD4(BC / 1F6) mouse mAb ab846 LOT:GR235014-1) and anti-CD8 antibody (CD8 Clone C8 / 144B mouse mAb anti-human REF:M7103 LOT:20024879 DAKO), and PE-conjugated anti-ISG15 antibody (anti-hISG15 / UCRP PE conjugated Rat IgG2A Cat# IC8044P LOT: ADRU0219021 R&D systems) were allowed to react at room temperature for 2 hours. Subsequently, the antibody was washed several times, and then Alexa Fluor 488 goat anti-rabbit IgG (H+L) (REF: A11034 LOT: 2286890 Invitrogen) or Alexa Fluor 488 goat anti-mouse IgG (H+L) (REF: A11001 LOT: 2220848 Invitrogen) was allowed to act as a secondary antibody at room temperature for 1 hour. After several washes, the cells were finally stained with 1 μg / mL Hoechst® 33342 for nucleic acid staining. After washing the antibody off several times, the cells were centrifuged, suspended in 20 μL of PBS, and 20 μL of the suspension was dropped onto a glass slide, which was then embedded with a cover glass. The cells were then observed under a fluorescence microscope (Olympus BX50 microscope) and photographed with a camera (DP72 Olympus digital camera).
[0084] The intracellular uptake of rLVRN by CD14 cells was confirmed as follows. TM555 dye-labeled rLVRN (1.5 μg / mL) was added, and after 24 hours of culture, PBMCs were collected and purified by BD Pharmingen. TM Human BD Fc block TM Blocking was performed for 30 minutes at 4°C using a 1% PFA solution (Cat#564220, LOT:9049805). After fixation with 1% PFA for 10 minutes, anti-CD14 antibody (CD14 (UCH-M1) mouse mAb sc-1182, LOT:K1308, Santa Cruz) was applied for 1 hour at 4°C. Subsequently, after washing the antibody several times, the cells were treated with Alexa Fluor 488 goat anti-mouse IgG (H+L) (REF:A11001, LOT:2220848, Invitrogen) as a secondary antibody and Hoechst (registered trademark) 33342 as a nucleic acid stain at room temperature for 2 hours. After washing several times, the cells were centrifuged, suspended in 200 μL of PBS, and 50 μL of the cells were dropped onto a glass slide and embedded with a cover glass. The cells were then observed under a fluorescence microscope (Olympus BX50 microscope) and photographed with a camera (DP72 Olympus digital camera).
[0085] 16. Activation of THP-1 Cells. Human acute monocytic leukemia cell line THP-1 (RRID: CVCL_0006) with monocytic properties was purchased from ATCC. THP-1 cells were cultured in RPMI (Nacalai Tesque, Kyoto, Japan) supplemented with 10% FBS (Sigma-Aldrich), 100 μg / mL streptomycin, and 100 IU / mL penicillin under 5% CO. 2 The cells were cultured under 5% CO₂ at 37° C. To activate the THP-1 cells, PMA (phorbol 12-myristate 13-acetate) (Sigma-Aldrich) was added, and the cells were cultured for 48 hours.
[0086] Western blot analysis was performed to examine the expression of IDO1 and ACTB proteins in activated THP-1 cells treated with PBS or rLVRN (1.5 or 7.5 μg / mL) for 12 or 24 hours. Western blot analysis was performed as described previously (Matsumoto, T., Iizuka, T., Nakamura, M., Suzuki, T., Yamamoto, M., Ono, M., Kagami, K., Kasama, H., Wakae, K., Muramatsu, M., et al. (2022). FOXP4 inhibits squamous differentiation of atypical cells in cervical intraepithelial neoplasia via an ELF3-dependent pathway. Cancer Sci. 10.1111 / cas.15489.). Protein lysates were extracted with RIPA Buffer (Cell Signaling Technology Inc., Danvers, MA, USA), electrophoresed on a 10% SDS-PAGE gel, and then transferred to a nitrocellulose membrane. The membrane was incubated overnight at 4°C with primary antibodies against IDO (1:1000, Cell Signaling Technology Cat# 86630, RRID: AB_2636818) or actin (1:5,000, Santa Cruz Biotechnology Cat# sc-1615, RRID: AB_630835). Secondary antibodies, horseradish peroxidase (HRP)-conjugated antibodies, were applied for 1 hour at room temperature. Blots were visualized using an enhanced chemiluminescence system with ECL™ Western Blotting Detection Reagents (GE Healthcare, Buckinghamshire). IDO1 protein levels were determined by calculating the ratio of the band densities of IDO1 and ACTB proteins quantified using ImageJ and normalizing them to ACTB protein levels.In some experiments, IDO1 protein from HeLa cells treated with 10 ng / mL of IFN-γ for 24 hours was used as a positive control.
[0087] 18. High-Performance Liquid Chromatography-Mass Spectrometry (HPLC-MS) Tryptophan and kynurenine levels in the culture medium were quantified by high-performance liquid chromatography with high-resolution mass spectrometry and tandem mass spectrometry (HPLC-MS / MS). To assess the differences between PBS and rLVRN treatments, PMA-activated THP-1 cells were treated with 1.5 or 7.5 μg / mL r-LVRN for 48 hours. The amount of metabolites in the culture medium was then measured by HPLC-MS at the Kanazawa University Genetics Institute as described previously (Dochi, H., Kondo, S., Murata, T., Fukuyo, M., Nanbo, A., Wakae, K., Jiang, WP, Hamabe-Horiike, T., Tanaka, M., Nishiuchi, T., et al. (2022). Estrogen induces the expression of EBV lytic protein ZEBRA, a marker of poor prognosis in nasopharyngeal carcinoma. Cancer Sci 113, 2862-2877. 10.1111 / cas.15440.). The kynurenine / tryptophan ratio was calculated to assess IDO1 activity.
[0088] II. Results 1. Induction of ISGs, IDO1, and PD-L1 genes in PBMCs by liebelin 1A: Gene ontology analysis by microarray rLVRN (1.5 μg / mL) was added to PBMCs and cultured for 24 hours. The gene groups whose expression was altered in PBMCs were compared with a control group without addition using microarray analysis. Figure 1A shows the results of gene ontology analysis of genes whose expression was observed to be induced. An immune response including the Type I interferon signaling pathway was induced.
[0089] 1B: Quantitative PCR analysis of OAS2, IFIT1, IFIT3, ISG15, IDO1, and PD-L1. The interferon-stimulated genes (ISGs) OAS2, IFIT1, IFIT3, and ISG15, which were highly expressed in the microarray analysis, as well as IDO1 (indoleamine 2,3-dioxygenase-1) and PD-L1 (programmed death-ligand 1), which are involved in immune tolerance induction, were confirmed by quantitative PCR in PBMCs cultured for 24 hours in the presence of rLVRN (1.5 μg / mL). The results showed that rLVRN significantly increased the expression of these genes (Figure 1B).
[0090] 1C: rLVRN absorption experiment with beads. To rule out the effect of contaminants introduced during the rLVRN production process, we absorbed rLVRN with anti-His tag antibody-conjugated beads, which adsorb His tag proteins, and performed an experiment to induce the expression of ISGs and IDO1 in PBMCs. The results showed that absorption with beads suppressed the induction of rLVRN, indicating that rLVRN, not contaminants, had the ability to induce the expression of ISGs and IDO1 (Figure 1C).
[0091] 1D: Gene induction in PBMCs by direct or indirect culture with LVRN-expressing Swan71 cells. Swan71 cells are a cell line established from human extravillous trophoblast cells that express LVRN on their cell membranes. However, LVRN expression is lost under standard monolayer culture conditions. Therefore, we first created an LVRN-expressing Swan71 cell line (LVRN-Swan71) by overexpressing LVRN on its cell membrane. LVRN expression was confirmed by cell staining and cell surface expression by flow cytometry (Figure 1D, top). LVRN-Swan71 cells were directly cultured with PBMCs or indirectly cultured using a chamber membrane for 24 hours, and the gene expression induction effect of LVRN in PBMCs was examined and compared with that observed in culture with a mock-expressing cell line (Neo-Swan71). In direct culture, PBMCs were selected using anti-CD45 antibody-conjugated beads to exclude Swan71 cell contamination during collection. The results showed that direct culture had a stronger gene expression induction effect than indirect culture, and confirmed that membrane-bound LVRN also had a similar effect on PBMCs (Fig. 1D, bottom).
[0092] 1E: Gene Induction in PBMCs by Enzyme-Inactive rLVRN. LVRN is a membrane-bound peptidase classified as an M1 peptidase. To investigate whether its enzymatic activity is involved in gene expression, we created E416Q rLVRN, in which the HEXXH(X)18E motif (positions 415-438 of SEQ ID NO: 1), a gluzincin motif, in the Zn-binding enzyme active site was mutated to inactivate the enzyme. The effects on PBMCs were then examined. Similar to enzymatically active LVRN, enzymatically inactive LVRN was found to induce the expression of IFIT1, IFIT3, ISG15, OAS2, and IDO1 genes (Figure 1E).
[0093] 2. Mechanism of ISG gene induction in immune cells 2A: Ability of rLVRN to induce IFN production. Since the induction of ISGs was confirmed in microarray analysis, we examined the ability of rLVRN to induce IFN production in PBMCs by quantitative PCR. The results showed that rLVRN (1.5 μg / mL) induced IFN-β production in PBMCs, but not IFN-α or IFN-γ production (Figure 2A).
[0094] 2B: Examination of the time to manifestation of the gene induction effect of rLVRN in PBMCs. PBMCs were cultured in the presence of rLVRN (1.5 μg / mL) for 30 minutes, 1 hour, or 4 hours, and then the expression of IFIT1, IFIT3, ISG15, OAS2, and IFN-β was analyzed by quantitative PCR. As a result, mRNAs of these genes were observed after 4 hours of culture (Figure 2B).
[0095] 2C: Determination of the effective concentration of IFN-β corresponding to rLVRN (1.5 μg / mL) by titration. PBMCs were stimulated with IFN-β, and the concentration-dependent induction of ISGs was observed. The results were compared with the ISG induction of rLVRN (1.5 μg / mL), and the corresponding IFN-β concentration was set at 10 U / mL (Figure 2C).
[0096] 2D: Effect of IFN-β neutralizing antibodies on the action of IFN-β. We investigated whether IFN-β (100 IU / mL)-induced gene expression in PBMCs could be blocked by IFN-β neutralizing antibodies. As a result, IFN-β-induced upregulation of ISGs, IDO1, and PD-L1 in PBMCs was completely blocked by IFN-β neutralizing antibodies (Figure 2D).
[0097] 2E: Effect of IFN-β neutralizing antibody and type I IFN receptor neutralizing antibody on the action of rLVRN. We investigated whether rLVRN (1.5 μg / mL)-induced gene induction in PBMCs could be blocked by IFN-β neutralizing antibody or type I IFN receptor neutralizing antibody. The results showed that the upregulation of ISGs induced by rLVRN (1.5 μg / mL) corresponding to IFN-β (10 IU / mL) was completely blocked by neutralizing antibodies against type I IFN receptor or IFN-β, whereas the upregulation of IDO1 and PD-L1 was not blocked (Figure 2E). These results suggest that LVRN induces ISG expression through IFN-β production and type I IFN receptor, but its IDO1 induction is mediated by a pathway other than IFN / IFN receptor.
[0098] 2F: Effect of the JAK1,2 inhibitor ruxolitinib on the action of rLVRN. We investigated the effect of a JAK1,2 inhibitor on gene induction by rLVRN in PBMCs. PBMCs were treated with rLVRN (1.5 μg / mL), ruxolitinib (1 μM), or rLVRN (1.5 μg / mL) and ruxolitinib (1 μM). After 24 hours of incubation, the expression of IFIT1, IFIT3, ISG15, OAS2, IDO1, and PD-L1 was confirmed by quantitative PCR. Ruxolitinib inhibited the induction of these genes by rLVRN (Figure 2F). Although the receptor for LVRN is unknown, these results suggest that JAK1 or 2 is involved in its activation.
[0099] 2G: Comparison of ISG15 and IDO1 induction by IFN-β and rLVRN. PBMCs from 12 normal, non-pregnant women were cultured for 24 hours in the presence of IFN-β (10 IU / mL) or rLVRN (1.5 μg / mL), and the induction of ISG15 and IDO1 was examined. The results showed that IFN-β and rLVRN differed in their IDO1 induction, particularly in their IDO1 induction. Comparison of the IDO1 / ISG15 ratio indicated that rLVRN had a stronger IDO1 induction effect than IFN-β (Figure 2G).
[0100] 3. Analysis of Clinical Samples from Normal Pregnancy, Pregnancy-Induced Hypertension, and Pregnancy Complicated by Immunologic Disorders 3A: Analysis of ISG15 and IDO1 Expression in PBMCs from Pregnant Women. PBMCs from 9 normal non-pregnant women, 6 normal pregnant women, and 5 women with pregnancy-induced hypertension (HDP) were cultured in the presence of rLVRN (1.5 μg / mL) for 24 hours, and ISG15 and IDO1 expression was examined by quantitative PCR. Compared to non-pregnant women, ISG15 levels were approximately 5-6 fold higher and IDO1 levels approximately 100 fold higher, with a significantly higher IDO1 / ISG15 ratio, indicating a greater increase in IDO1 activity during pregnancy (Figure 3A). Furthermore, in HDP women, ISG15 levels were 1 / 2-fold lower and IDO1 levels 1 / 6-fold lower than in normal pregnant women, and the IDO1 / ISG15 ratio was also lower in all but one case (Figure 3A).
[0101] 3B: Effects of IFN-β and rLVRN on PBMCs from normal pregnant women. PBMCs from normal pregnant women (n=29) were cultured for 24 hours in the presence of IFN-β (10 IU / mL) or rLVRN (1.5 μg / mL), and the expression of ISG15 and IDO1 was examined by quantitative PCR. The results showed that IDO1 was more strongly induced by rLVRN than by IFN-β, and the IDO1 / ISG15 ratio after rLVRN stimulation was significantly higher than that after IFN-β stimulation (Fig. 3B).
[0102] 3C: Relationship between fetal growth and the IDO1 / ISG15 ratio. The standard deviation score (Z-score) of birth weight for gestational age was used as an index of fetal growth (Itabashi K, Miura F, Uehara R, Nakamura Y. New Japanese neonatal anthropometric charts for gestational age at birth. Pediatr Int. 2014;56(5):702-8.). The Pearson correlation coefficient (r) was used to analyze the linear correlation between the fold change in IDO1 and ISG15 mRNA levels and the Z-score of birth weight. The results showed that a high IDO1 / ISG15 ratio was associated with increased fetal weight, whereas a low IDO1 / ISG15 ratio was associated with decreased fetal weight, demonstrating a correlation between the IDO1 / ISG15 ratio and fetal weight (Figure 3C). These results suggest that patients with a low IDO1 / ISG15 ratio have a reduced immune tolerance effect of LVRN and poor placental function.
[0103] 3D: LVRN-positive T cells in non-pregnant, normal pregnant women, women with pregnancy-induced hypertension, and women with immune-complicated pregnancies. LVRN-positive T cells were analyzed by flow cytometry in non-pregnant, normal pregnant women, women with pregnancy-induced hypertension, and women with immune-complicated pregnancies. The results showed that LVRN-positive T cells increased during pregnancy and were higher in women with pregnancy-induced hypertension and pregnancies with systemic lupus erythematosus (SLE) (Figure 3D).
[0104] 4. Analysis of PBMC Cells Responding to rLVRN 4A: FACS Analysis of ISG15 Protein Expression in PBMCs after rLVRN Stimulation PBMCs were cultured in the presence of rLVRN (1.5 μg / mL) for 24 hours, and ISG15-expressing cells in the lymphocyte and monocyte fractions were analyzed by FACS. As a result, ISG15 expression was elevated in most lymphocyte and monocyte fractions (Figure 4A).
[0105] 4B: Analysis of ISG15 protein expression in PBMCs stimulated with rLVRN by cell staining. Expression of ISG15 protein in PBMCs cultured with rLVRN (1.5 μg / mL) for 24 hours was analyzed by cell staining. ISG15 protein expression was observed in CD14-positive monocytes, CD4-positive T lymphocytes, CD8-positive T lymphocytes, and CD19-positive B lymphocytes (Figure 4B).
[0106] 4C: FACS analysis of PBMC binding or uptake of labeled rLVRN. PBMCs were cultured for 4 or 24 hours in the presence of fluorescently labeled rLVRN (1.5 μg / mL) conjugated with HiLyte555 and analyzed by FACS. rLVRN binding or uptake was observed in the monocyte fraction, and its detection increased from 4 to 24 hours, with over 96% of the monocyte fraction being positive after 24 hours (Figure 4C). No rLVRN binding or uptake was observed in the lymphocyte fraction (Figure 4C).
[0107] 4D: Analysis of monocyte uptake of fluorescently labeled rLVRN by cell staining. The uptake of rLVRN into the monocytic fraction of PBMCs after 24-hour incubation with fluorescently labeled rLVRN (1.5 μg / mL) was analyzed by cell staining. The stained cell images showed that fluorescently labeled rLVRN had been incorporated into monocytic cells ( Fig. 4D ).
[0108] 4E: Direct effect of rLVRN on CD4+ and CD8+ T lymphocytes. CD4+ and CD8+ fractions were isolated from PBMCs of one normal non-pregnant woman and one male, and the PBMCs were cultured for 24 hours in the presence of rLVRN (1.5 μg / mL). The results showed that the increase in ISG expression in these lymphocytes was low, with significant differences depending on the sample, suggesting significant individual variability (Figure 4E). Given that ISG15 protein expression was observed in most lymphocyte fractions, it is speculated that CD14+ monocytes in PBMCs first reacted to rLVRN, followed by a secondary response that spread to lymphocytes.
[0109] 4F: Microarray analysis of rLVRN-induced genes in CD14-positive monocytic cells. CD14-positive monocytic cells were isolated from PBMCs and cultured in the presence of rLVRN (1.5 μg / mL) for 24 hours, after which the expressed genes were analyzed by microarray. The results showed a stronger reactivity than PBMCs, with ISGs and IDO1 increased by 70-fold and 177-fold, respectively. In particular, changes in the expression of the following genes were observed:
[0110] 4G: Verification of gene induction effect of rLVRN in CD14-positive monocytic cells. CD14-positive monocytic cells were isolated from PBMCs and cultured in the presence of rLVRN (1.5 μg / mL) for 24 hours. Expression of IFIT1, IFIT3, ISG15, OAS2, IDO1, and PD-L1 was confirmed by quantitative PCR. The results confirmed a significantly stronger gene expression induction effect in CD14-positive cells than in CD4-positive or CD8-positive cells (Figure 4E) (Figure 4G).
[0111] 4H: Induction of CD14-positive monocytic cell differentiation by rLVRN (1) CD14-positive monocytic cells isolated from PBMCs were cultured in the presence of rLVRN (1.5 μg / mL) for 24 hours, and the expression of CD14, CD11c, CD123, CD80, and CD86 was analyzed by quantitative PCR. The results showed that the monocyte marker CD14 decreased, the DC marker CD123 increased, and the DC maturation marker CD80 increased significantly, while CD11c remained unchanged (Figure 4H). These results indicated that rLVRN induces DC differentiation.
[0112] 4I: rLVRN induces differentiation of CD14-positive monocytic cells (2). PBMCs were cultured in the presence of rLVRN (1.5 μg / mL) for 24 hours, and the expression of HLA-DR, CD14, CD11c, and CD123 was analyzed by FACS. The results showed that CD14-positive cells differentiated into CD11c-positive / CD123-positive DCs (Figure 4I).
[0113] 5. Effects of rLVRN on THP-1 Cells 5A: IDO1 Expression after rLVRN Stimulation in PMA-Activated or Non-Activated THP-1 Cells. Because the reactivity of CD14+ monocytes to rLVRN increased during 24-hour culture, we next evaluated whether activated monocytes enhance their reactivity to rLVRN using THP-1 cells, a monocytic cell line. IDO1 mRNA expression levels were examined by quantitative PCR in non-activated and activated THP-1 cells treated with PBS or rLVRN (1.5 μg / mL) for 24 hours. rLVRN treatment had little effect on IDO1 gene induction in non-activated THP-1 cells (Figure 5A). In contrast, IDO1 gene expression was slightly induced in PMA-activated THP-1 cells, and rLVRN treatment further enhanced IDO1 expression (Figure 5A).
[0114] 5B: Dose-dependent IDO1 protein expression in PMA-activated THP-1 cells after rLVRN stimulation. Western blot analysis of PMA-activated THP-1 cells treated with PBS or rLVRN (1.5 or 7.5 μg / mL) for 48 hours confirmed a dose-dependent increase in IDO1 protein by rLVRN treatment (Figure 5B).
[0115] 5C: Effect of rLVRN on IDO1 induction in PMA-activated THP-1 cells. IDO1 mRNA expression levels were examined by quantitative PCR in PMA-activated THP-1 cells treated with rLVRN (1.5 μg / mL) for 0, 4, 8, or 12 hours. rLVRN increased IDO1 gene expression in activated THP-1 cells after 12 hours of treatment (Fig. 5C).
[0116] 5D: Time-dependent IDO1 protein expression in PMA-activated THP-1 cells after rLVRN stimulation. Western blot analysis of PM-activated THP-1 cells treated with PBS or rLVRN (1.5 or 7.5 μg / mL) for 12 or 24 hours confirmed a time-dependent increase in IDO1 protein upon rLVRN treatment (Fig. 5D).
[0117] 6. Changes in tryptophan levels and kynurenine / tryptophan ratio by rLVRN in PMA-activated THP-1 cells. To examine the effect of rLVRN-induced IDO1 production on the conversion of tryptophan to kynurenine, tryptophan levels and the kynurenine / tryptophan ratio in the culture medium of PMA-activated THP-1 cells treated with PBS or rLVRN (1.5 or 7.5 μg / mL) for 48 hours were assessed by HPLC-MS. HPLC-MS results showed that rLVRN treatment decreased tryptophan levels (Fig. 6, left) and increased the kynurenine / tryptophan ratio (Fig. 6, right) in the culture medium from activated THP-1 cells compared with untreated controls. These results suggest that rLVRN promotes tryptophan metabolism and increases kynurenine, which has immunosuppressive effects.
[0118] Accession Number 1 Met Gly Pro Pro Ser Ser Ser Gly Phe Tyr Val Ser His Ala Val Ala Leu Leu Leu Ala Gly Leu Val Ala Ala Leu Leu Leu Ala Leu Ala Val Leu Ala Ala Leu Tyr Gly His Cys Glu Arg Val Pro Pro Ser Glu Leu Pro Gly Leu Arg Asp Ser Glu Ala Glu Ser Ser Pro Pro Leu Arg Gln Lys Pro Thr Pro Thr Pro Lys Pro Ser Ser Ala Arg Glu Leu Ala Val Thr Thr Thr Pro Ser Asn Trp Arg Pro Pro Gly Pro Trp Asp Gln Leu Arg Leu Pro Pro Trp Leu Val Pro Leu His Tyr Asp Leu Glu Leu Trp Pro Gln Leu Arg Pro Asp Glu Leu Pro Ala Gly Ser Leu Pro Phe Thr Gly Arg Val Asn Ile Thr Val Arg Cys Thr Val Ala Thr Ser Arg Leu Leu Leu His Ser Leu Phe Gln Asp Cys Glu Arg Ala Glu Val Arg Gly Pro Leu Ser Pro Gly Thr Gly Asn Ala Thr Val Gly Arg Val Pro Val Asp Asp Val Trp Phe Ala Leu Asp Thr Glu Tyr Met Val Leu Glu Leu Ser Glu Pro Leu Lys Pro Gly Ser Ser Tyr Glu Leu Gln Leu Ser Phe Ser Gly Leu Val Lys Glu Asp Leu Arg Glu Gly Leu Phe Leu Asn Val Tyr Thr Asp Gln Gly Glu Arg Arg Ala Leu Leu Ala Ser Gln Leu Glu Pro Thr Phe Ala Arg Tyr Val PhePro Cys Phe Asp Glu Pro Ala Leu Lys Ala Thr Phe Asn Ile Thr Met Ile His His Pro Ser Tyr Val Ala Leu Ser Asn Met Pro Lys Leu Gly Gln Ser Glu Lys Glu Asp Val Asn Gly Ser Lys Trp Thr Val Thr Thr Phe Ser Thr Thr Pro His Met Pro Thr Tyr Leu Val Ala Phe Val Ile Cys Asp Tyr Asp His Val Asn Arg Thr Glu Arg Gly Lys Glu Ile Arg Ile Trp Ala Arg Lys Asp Ala Ile Ala Asn Gly Ser Ala Asp Phe Ala Leu Asn Ile Thr Gly Pro Ile Phe Ser Phe Leu Glu Asp Leu Phe Asn Ile Ser Tyr Ser Leu Pro Lys Thr Asp Ile Ile Ala Leu Ser Ser Phe Asp Asn His Ala Met Glu Asn Trp Gly Leu Met Ile Phe Asp Glu Ser Gly Leu Leu Leu Glu Pro Lys Asp Gln Leu Thr Glu Lys Lys Thr Leu Ile Ser Tyr Val Val Ser His Glu Ile Gly His Gln Trp Phe Gly Asn Leu Val Thr Met Asn Trp Trp Asn Asn Ile Trp Leu Asn Glu Gly Phe Ala Ser Tyr Phe Glu Phe Glu Val Ile Asn Tyr Phe Asn Pro Lys Leu Pro Arg Asn Glu Ile Phe Phe Ser Asn Ile Leu His Asn Ile Leu Arg Glu Asp His Ala Leu Val Thr Arg Ala Val Ala Met Lys Val Glu Asn Phe Lys Thr Ser Glu Ile Gln Glu Leu PheAsp Ile Phe Thr Tyr Ser Lys Gly Ala Ser Met Ala Arg Met Leu Ser Cys Phe Leu Asn Glu His Leu Phe Val Ser Ala Leu Lys Ser Tyr Leu Lys Thr Phe Ser Tyr Ser Asn Ala Glu Gln Asp Asp Leu Trp Arg His Phe Gln Met Ala Ile Asp Asp Gln Ser Thr Val Ile Leu Pro Ala Thr Ile Lys Asn Ile Met Asp Ser Trp Thr His Gln Ser Gly Phe Pro Val Ile Thr Leu Asn Val Ser Thr Gly Val Met Lys Gln Glu Pro Phe Tyr Leu Glu Asn Ile Lys Asn Arg Thr Leu Leu Thr Ser Asn Asp Thr Trp Ile Val Pro Ile Leu Trp Ile Lys Asn Gly Thr Thr Gln Pro Leu Val Trp Leu Asp Gln Ser Ser Lys Val Phe Pro Glu Met Gln Val Ser Asp Ser Asp His Asp Trp Val Ile Leu Asn Leu Asn Met Thr Gly Tyr Tyr Arg Val Asn Tyr Asp Lys Leu Gly Trp Lys Lys Leu Asn Gln Gln Leu Glu Lys Asp Pro Lys Ala Ile Pro Val Ile His Arg Leu Gln Leu Ile Asp Asp Ala Phe Ser Leu Ser Lys Asn Asn Tyr Ile Glu Ile Glu Thr Ala Leu Glu Leu Thr Lys Tyr Leu Ala Glu Glu Asp Glu Ile Ile Val Trp His Thr Val Leu Val Asn Leu Val Thr Arg Asp Leu Val Ser Glu Val Asn Ile Tyr Asp Ile Tyr Ser Leu LeuLys Arg Tyr Leu Leu Lys Arg Leu Asn Leu Ile Trp Asn Ile Tyr Ser Thr Ile Ile Arg Glu Asn Val Leu Ala Leu Gln Asp Asp Tyr Leu Ala Leu Ile Ser Leu Glu Lys Leu Phe Val Thr Ala Cys Trp Leu Gly Leu Glu Asp Cys Leu Gln Leu Ser Lys Glu Leu Phe Ala Lys Trp Val Asp His Pro Glu Asn Glu Ile Pro Tyr Pro Ile Lys Asp Val Val Leu Cys Tyr Gly Ile Ala Leu Gly Ser Asp Lys Glu Trp Asp Ile Leu Leu Asn Thr Tyr Thr Thr Asn Lys Glu Glu Lys Ile Gln Leu Ala Tyr Ala Met Ser Cys Ser Lys Asp Pro Trp Ile Leu Asn Arg Tyr Met Glu Tyr Ala Ile Ser Thr Ser Pro Phe Thr Ser Asn Glu Thr Asn Ile Ile Glu Val Val Ala Ser Ser Glu Val Gly Arg Tyr Val Ala Lys Asp Phe Leu Val Asn Asn Trp Gln Ala Val Ser Lys Arg Tyr Gly Thr Gln Ser Leu Ile Asn Leu Tyr Tyr Thr Ile Gly Arg Thr Val Thr Thr Asp Leu Gln Ile Val Glu Leu Gln Gln Phe Phe Ser Asn Met Leu Glu Glu His Gln Arg Ile Arg Val His Ala Asn Leu Gln Thr Ile Lys Asn Glu Asn Leu Lys Asn Lys Lys Leu Ser Ala Arg Ile Ala Ala Trp Leu Arg Arg Asn Thr
[0119] SEQ ID NO: 2 atggggcc cccttccagc tcaggcttct atgtgagcca cgcagtggcc ctgctgctgg ctgggttggt agccgccctc ctgctggcgc tggccgtact cgccgccttg tacggtcact gcgagcgcgt cccaccgtcg gagctgcctg gactcaggga ctcggaagcc gagtcttccc ctcccctcag gcagaagccg acgccgaccc cgaaacccag cagtgcacgc gagctagcgg tgacgaccac cccgagcaac tggcgacccc cggggccctg ggaccagcta cgcctgccgc cctggctcgt gccgctgcac tacgatctgg agctgtggcc gcagctgagg cccgacgagc ttccggccgg gtctttgccc ttcactggcc gcgtgaacat cacggtgcgc tgcacggtgg ccacctctcg actgctgctg catagcctct tccaggactg cgagcgcgcc gaggtgcggg gacccctttc cccgggcact gggaacgcca cagtgggccg cgtgcccgtg gacgacgtgt ggttcgcgct ggacacggaa tacatggtgc tggagctcag tgagcccctg aaacctggta gcagctacga gctgcagctt agcttctcgg gcctggtgaa ggaagacctc agggagggac tcttcctcaa cgtctacacc gaccagggcg agcgcagggc cctgttagcg tcccagctgg aaccaacatt tgccaggtat gttttccctt gttttgatga gccagctctg aaggcaactt ttaatattac aatgattcat catccaagtt atgtggccct ttccaacatg ccaaagctag gtcagtctga aaaagaagat gtgaatggaa gcaaatggac tgttacaacc ttttccactacgccccacat gccaacttac ttagtcgcat ttgttatatg tgactatgac cacgtcaaca gaacagaaag gggcaaggag atacgcatct gggcccggaa agatgcaatc gcaaatggaa gtgcagactt tgctttgaac atcacaggtc ccatcttctc ttttctggag gatttgttta atatcagtta ctctcttcca aaaacagata taattgcctt gtctagtttt gacaaccatg caatggaaaa ctggggacta atgatatttg atgaatcagg attgttgttg gaaccaaaag atcaactgac agaaaaaaag actctgatct cctatgttgt ctcccacgag attggacacc agtggtttgg aaacttggtt accatgaatt ggtggaacaa tatctggctc aacgagggtt ttgcatctta ttttgagttt gaagtaatta actactttaa tcctaaactc ccaagaaatg agatcttttt ttctaacatt ttacataata tcctcagaga agatcacgcc ctggtgacta gagctgtggc catgaaggtg gaaaatttca aaacaagtga aatacaggaa ctctttgaca tatttactta cagcaaggga gcgtctatgg cccggatgct ttcttgtttc ttgaatgagc atttatttgt cagtgcactc aagtcatatt tgaagacatt ttcctactca aacgctgagc aagatgatct atggaggcat tttcaaatgg ccatagatga ccagagtaca gttattttgc cagcaacaat aaaaaacata atggacagtt ggacacacca gagtggtttt ccagtgatca ctttaaatgt gtctactggc gtcatgaaac aggagccatt ttatcttgaa aacattaaaa atcggactcttctaaccagc aatgacacat ggattgtccc tattctttgg aaaaaatg gaactacaca acctttagtc tggctagatc aaagcagcaa agtattccca gaatgcaag ttcagattc tgaccatgac tggtgattt tgaatttgaa tatgactga tggaattatattataga taaatcaaca acttgaaag gatcctaagg cgattcctgt tattcacaga ctgcagttga ttgatgatgc cttttccttg tctaaaaaca attatattga gattgaaaca gcacttgagt taaccaagta ccttgctgaa gagatgaaa ttatagtatg tggtagttaagtaacag tctgaggtga acatctatga tatatactca ttattaaaga ggtacctatt aagagactt aatttaatat ggaatattta ttcaactata attcgtgaaa atgtgttggc attacagat gactacttag ctctaatatc actggaaaa cttttgtaa ctcagactgtctccttg aaagaactt ttcgcaaat gggtggatca tccagaaat gaatacctt atccaattta agatgtggtt ttatgttatg gcattgcctt gggaagtgat aaagagtggg acatctgtt aaatacttac actaataca haaaaaggaaga agaaagatt caactgcaagct gactcagcaatgact atatatggag tatgccatca gcacatctcc attcacttct atgaaacaagacttcttag tcaacactg gcaagctgtg agtaaaaggt atggacaca atcattgatt aatctatatat atacaatagg gagaaccgta actacagatt tacagattgt ggaggacac cagtttca gtacatgtt ggaggacac cagaggatca cagatacattacatcatcatcat a gaaaaacaag aagctaagtg ccaggatagc tgcgtggcta aggagaaca ca
Claims
1. A composition for treating a disease in a subject, The composition comprises revelin, revelin-treated cells, or revelin-expressing cells. A composition wherein the disease is a viral disease, infertility due to implantation failure, rheumatoid arthritis, glomerulonephritis, or transplant rejection.
2. The disease is a viral disease, and The composition according to claim 1, wherein the reveline or reveline-expressing cells induce interferon-stimulating genes, or the reveline-treated cells have interferon-stimulating genes induced.
3. The disease is infertility due to implantation failure, rheumatoid arthritis, glomerulonephritis, or transplant rejection, and The composition according to claim 1, wherein the reveline or reveline-expressing cells induce genes related to immune tolerance induction and interferon-stimulating genes, or the reveline-treated cells have interferon-stimulating genes induced.
4. The composition according to any one of claims 1 to 3, wherein the reveline is membrane-bound or soluble.
5. The composition according to any one of claims 1 to 3, wherein the reveline contains an amino acid sequence having 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity with the amino acid sequence of SEQ ID NO: 1, or is a polypeptide consisting of the amino acid sequence.
6. The composition according to any one of claims 1 to 3, wherein the revelin-treated cells are immune cells cultured in the presence of revelin.
7. The composition according to any one of claims 1 to 3, wherein the revelin-expressing cells are cells into which at least one gene encoding revelin has been introduced.
8. The disease is infertility due to implantation failure, The composition comprises soluble reveline or reveline-treated cells, The composition according to claim 1, for intrauterine administration.
9. The disease is rheumatoid arthritis or glomerulonephritis, The composition according to claim 1, wherein the composition comprises soluble reveline or reveline-treated cells.
10. The disease is graft rejection in organ transplantation, The composition according to claim 1, wherein the composition comprises soluble reveline or reveline-treated cells.
11. The disease is graft rejection in cell transplantation, The composition according to claim 1, wherein the composition comprises revelin-expressing cells.
12. The subject is determined to be effective when treated with the composition, The aforementioned determination is, To culture peripheral blood mononuclear cells derived from the aforementioned target in the presence of revelin, To determine the expression level of interferon-stimulated genes in the cultured cells, This includes comparing the determined interferon-stimulated gene expression levels with reference values. The composition according to claim 1, wherein it is determined that treatment of the subject with the composition is effective when the expression level is higher than the reference value.
13. The disease is infertility due to implantation failure, rheumatoid arthritis, glomerulonephritis, or transplant rejection, If the subject is determined to be effectively treated with the composition, The aforementioned determination is, To culture peripheral blood mononuclear cells derived from the aforementioned target in the presence of revelin, To determine the expression levels of interferon-stimulating genes and genes related to immune tolerance in the cultured cells, This includes comparing the determined expression levels of interferon-stimulating genes and genes related to immune tolerance induction with reference values, respectively. The composition according to claim 1, wherein if any of the expression levels are higher than the respective reference values, it is determined that treatment of the subject with the composition is effective.
14. The composition according to claim 2 or 12, wherein the interferon-stimulating gene is at least one selected from the group consisting of interferon-β, OAS2, IFIT1, IFIT3, and ISG15.
15. The interferon-stimulating gene is at least one selected from the group consisting of interferon-β, OAS2, IFIT1, IFIT3, and ISG15. The composition according to claim 3 or 13, wherein the gene associated with inducing immune tolerance is either IDO1 and PD-L1 or both.
16. The composition according to claim 1, 2, or 12, wherein the viral disease is hepatitis B, hepatitis C, HIV infection, or HPV infection.
17. A method for determining a disease or the risk of developing such a disease, comprising comparing the amount or ratio of revelin-positive T cells in peripheral blood collected from a subject with a reference value.
18. A method for evaluating the effectiveness of a therapeutic agent, comprising comparing the amount or ratio of revelin-positive T cells in peripheral blood collected from a subject with a disease after administration of the therapeutic agent with a reference value.
19. The method according to claim 17 or 18, wherein the disease is pre-eclampsia.