Treatment methods for Gaucher disease and GBA-Parkinson's disease

Abstract

An expression cassette for expressing a transplant gene in cells is provided herein, wherein the transplant gene encodes a Gcase polypeptide. Additionally, a method for treating Gaucher disease or GBA-PD is provided. Additionally, a vector (e.g., rAAV vector), viral particles, pharmaceutical compositions, and kits for expressing the GCase polypeptide in individuals requiring such expression are provided herein.

Description

Technology Field

[0001] Cross-reference regarding related applications

[0002] This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 599,430 filed November 15, 2023, the full text of said application incorporated by reference.

[0003] Reference to the electronic sequence list

[0004] The electronic sequence list (159792018740seqlist.xml; size: 100,264 bytes; and date of creation November 13, 2024) is incorporated herein by reference in its entirety.

[0005] Technology field

[0006] The present invention relates to a method for treating Gaucher disease or GBA-PD in patients requiring treatment for Gaucher disease or GBA-PD. Background Technology

[0007] Gaucher disease (GD) is an autosomal recessive lysosomal storage disorder caused by mutations in GBA1, the gene encoding glucocerebrosidase (GCase). A decrease or loss of GCase activity leads to the accumulation of toxic lipid substrates, disrupting cellular homeostasis. Patients with GD type 1 (GD1) typically exhibit splenomegaly, hepatomegaly, and anemia or thrombocytopenia, whereas patients with GD type 3 (GD3) exhibit severe neurological symptoms and associated systemic symptoms of GD1. Patients with GD1 typically rely on enzyme replacement therapy (ERT) for symptom management. Although ERT is administered via bi-weekly infusions, it fails to alleviate neurological symptoms in GD3 patients.

[0008] Furthermore, heterozygous mutations in GBA1 are a major risk factor for Parkinson's disease (PD), and one million PD patients worldwide are GBA-PD patients. Clinically, GBA-PD patients develop the disease at an earlier age and experience more rapid cognitive decline. Approximately 5 to 10% of Parkinson's disease (PD) patients, or roughly 0.5 to 1 million patients, are carriers of a mutation on one of the alleles of the GBA1 gene. GBA1 is It is a very important target in GBA-PD. Current treatment options include levodopa and / or dopamine agonists for symptom management, but most patients experience a decrease in the effectiveness of these drugs over time. Therefore, as with sporadic PD, there is currently no disease-modifying therapy available to treat GBA-PD.

[0009] Therefore, there is an urgent need to develop treatments to treat and / or alleviate symptoms associated with GD and GBA-PD. means of solving the problem

[0010] The present disclosure provides a method for treating or improving symptoms associated with Gaucher disease (GD) or GBA-PD in a patient requiring treatment for symptoms associated with Gaucher disease (GD) or GBA-PD, said method comprising the step of administering to the patient (1) an rAAV vector comprising an expression cassette for expressing a glucocerebrosidase (GCase) enzyme (wherein the expression cassette comprises a gene encoding a GCase enzyme operably linked to a promoter and optionally an enhancer), and (2) a recombinant adeno-associated virus (rAAV) particle comprising a capsid protein as described herein. In some embodiments, (a) a vector encoding the enzyme glucocerebrosidase (GCase); and (b) a recombinant adeno-associated virus (rAAV) particle comprising a capsid protein as described herein. The GCase enzyme will also be referred to herein as the GCase polypeptide.

[0011] In some embodiments, the capsid protein of the rAAV particle is an AAV9 capsid protein or a modified AAV capsid protein. In some embodiments, the modified AAV capsid protein is a modified AAV9 capsid protein as disclosed herein. In some embodiments, a modified AAV9 capsid protein comprising a targeting peptide comprising SEQ ID NO. 16.

[0012] In some embodiments, the present disclosure provides a vector encoding a signal peptide and a GCase polypeptide. In some embodiments, the nucleotide sequences encoding the signal peptide and the GCase polypeptide are transcriptionally regulated under the same promoter. In some embodiments, the nucleic acid sequences encoding the signal peptide and the GCase polypeptide are codon-optimized. In some embodiments, the GCase polypeptide and the signal peptide are encoded by the nucleic acid sequence of SEQ ID NO. 3. In some embodiments, the GCase polypeptide and the signal peptide are encoded by the nucleic acid sequence of SEQ ID NO. 4. In some embodiments, the GCase polypeptide and the signal peptide are encoded by the nucleic acid sequence of SEQ ID NO. 5. In some embodiments, the GCase polypeptide and the signal peptide are encoded by the nucleic acid sequence of SEQ ID NO. 6. In some embodiments, the GCase polypeptide and the signal peptide are encoded by the nucleic acid sequence of SEQ ID NO. 7.

[0013] In some embodiments, the GCase polypeptide and the signal peptide comprise the amino acid sequence of SEQ ID NO. 25. In some embodiments, the GCase polypeptide and the signal peptide have the amino acid sequence of SEQ ID NO. 25. In some embodiments, the GCase polypeptide and the signal peptide comprise the amino acid sequence of SEQ ID NO. 26. In some embodiments, the GCase polypeptide and the signal peptide have the amino acid sequence of SEQ ID NO. 26. In some embodiments, the GCase polypeptide and the signal peptide comprise the amino acid sequence of SEQ ID NO. 27. In some embodiments, the GCase polypeptide and the signal peptide have the amino acid sequence of SEQ ID NO. 27. In some embodiments, the GCase polypeptide and the signal peptide comprise the amino acid sequence of SEQ ID NO. 28. In some embodiments, the GCase polypeptide and the signal peptide have the amino acid sequence of SEQ ID NO. 28. In some embodiments, the GCase polypeptide and the signal peptide comprise the amino acid sequence of SEQ ID NO. 29. In some embodiments, the GCase polypeptide and the signal peptide have the amino acid sequence of SEQ ID NO. 29.

[0014] In some embodiments, the vector comprises an expression cassette for expressing a glucocerebrosidase (GCase) enzyme, the expression cassette comprising a gene encoding the GCase enzyme and a signal peptide. In some embodiments, the signal peptide comprises the amino acid sequence of SEQ ID NO. 30. In some embodiments, the signal peptide has the amino acid sequence of SEQ ID NO. 30. In some embodiments, the signal peptide comprises the amino acid sequence of SEQ ID NO. 31. In some embodiments, the signal peptide has the amino acid sequence of SEQ ID NO. 31. In some embodiments, the signal peptide comprises the amino acid sequence of SEQ ID NO. 32. In some embodiments, the signal peptide has the amino acid sequence of SEQ ID NO. 32. In some embodiments, the signal peptide comprises the amino acid sequence of SEQ ID NO. 33. In some embodiments, the signal peptide has the amino acid sequence of SEQ ID NO. 33. In some embodiments, the signal peptide comprises the amino acid sequence of SEQ ID NO. 34. In some embodiments, the signal peptide has the amino acid sequence of SEQ ID NO. 34.

[0015] In some embodiments, the method provided herein provides an AAV vector encoding a human GCase protein engineered for cross-correction by attaching a signal peptide and a polypeptide derived from a promoter (e.g., human GBA1). In some embodiments, the signal peptide is not a signal peptide endogenous to GBA1. In some embodiments, the signal peptide does not have the amino acid sequence of SEQ ID NO. 30.

[0016] In some embodiments, a signal peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO. 30, SEQ ID NO. 31, SEQ ID NO. 32, SEQ ID NO. 33, and SEQ ID NO. 34, and a polypeptide comprising a Gcase polypeptide are provided herein. In some embodiments, a signal peptide comprising a GCase polypeptide and an amino acid sequence selected from the group consisting of SEQ ID NOs. 25 to 29.

[0017] In some embodiments, the therapeutic methods and compositions provided herein increase the efficiency of AAV-mediated GCase supplementation by enabling cross-correction of therapeutic transplanted gene products. AAV-mediated therapeutic agents currently in preclinical development or clinical trials are limited by AAV biodistribution and function only in individual cells that take and express the AAV vector genome, thereby restoring GCase proteins. By manipulating the human GBA1 transplanted gene as described herein, it is possible to enable GCase secretion from primary cells that actively express the AAV vector genome, as well as uptake of GCase by secondary cells that may or may not express the AAV vector genome. In some embodiments, the AAV method provided herein enables Gcase to be observed in untransduced cells. In some embodiments, the polypeptide (e.g., GCase) is observed in the cerebellum. In some embodiments, the cerebellum is not transduced, but the AAV-expressed protein is observed. In some embodiments, the cross-corrected tissue region showed a decrease in total Lyso-GL compared to the control-treated sample. In some embodiments, the cross-corrected tissue region is associated with the treatment of Gaucher disease.

[0018] In some embodiments, the vector encodes a Gcase enzyme (polypeptide) comprising or having the sequence of SEQ ID NO. 1. In some embodiments, the vector encodes a GCase enzyme (polypeptide) comprising or having a sequence having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% homology with the sequence of SEQ ID NO. 1. SEQ ID NO. 1 is the wild-type amino acid sequence of glucocerebrosidase (GCase). The sequence comprises an N-terminal 39-amino acid signaling peptide that is cleaved after protein expression, thereby producing a mature protein having the amino acid sequence of SEQ ID NO. 2. In some embodiments, the vector encodes a GBA1 enzyme (polypeptide) comprising the amino acid sequence of SEQ ID NO. 2. In some embodiments, the vector encodes a GBA1 polypeptide comprising or having an amino acid sequence homologous to the sequence of SEQ ID NO. 2 by at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%. In some embodiments, the vector encodes a GBA1 enzyme (polypeptide) comprising or having the amino acid sequence of SEQ ID NO. 2 after cleavage (removal) of the signal transduction peptide. In some embodiments, the vector encodes a GBA1 enzyme (polypeptide) comprising or having a sequence homologous to SEQ ID NO. 2 by at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% after cleavage (removal) of the signal transduction peptide.

[0019] As disclosed herein, the human GBA1 gene can be engineered to express a GCase enzyme (polypeptide) having a signal transduction peptide different from the wild-type (endogenous) sequence of SEQ ID NO. 1. Upon cleavage of the signal transduction peptide, an identical mature protein, e.g., a GCase enzyme having the sequence of SEQ ID NO. 2, is produced. It has been found that a specific GCase enzyme having a specific signal transduction peptide is more readily secreted than the wild-type GCase enzyme having the sequence of SEQ ID NO. 1.

[0020] In some embodiments, the sequence used to express the GCase enzyme is a codon-optimized sequence. In some embodiments, the codon-optimized nucleic acid sequence has the sequence of SEQ ID NO. 3. In some embodiments, the codon-optimized nucleic acid sequence has the sequence of SEQ ID NO. 4 (also referred to herein as SS1-GBA1). In some embodiments, the codon-optimized nucleic acid sequence has the sequence of SEQ ID NO. 5 (also referred to herein as SS2-GBA1). In some embodiments, the codon-optimized nucleic acid sequence has the sequence of SEQ ID NO. 6 (also referred to herein as SS3-GBA1). In some embodiments, the codon-optimized nucleic acid sequence has the sequence of SEQ ID NO. 7 (also referred to herein as SS4-GBA1). The nucleic acid sequence of SEQ ID NO. 3 expresses a wild-type human GCase enzyme (e.g., the enzyme having SEQ ID NO. 1) containing an endogenous signaling peptide. The polynucleotides of SEQ ID NOs 4 to 7 express variant GCase enzymes having different signal transduction peptides.

[0021] In some embodiments, the expression cassette comprises the nucleic acid sequence of SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22, or SEQ ID NO. 23.

[0022] In some embodiments, the AAV virus particle comprises a capsid protein. In some embodiments, the capsid protein comprises an AAV serotype. In some embodiments, the AAV serotype is 1, 2, 5, 8, 9, or recombinant human (rh)10. In some embodiments, the capsid protein is a modified capsid protein. In some embodiments, the modified capsid protein comprises a sequence comprising SEQ ID NO. 16.

[0023] In some embodiments, the AAV capsid protein of the AAV virus particle comprises a targeting peptide inserted into the capsid that alters the transduction of GBA1 and / or endosome release after administration to a patient.

[0024] In some embodiments, the modified AAV9 capsid protein of an AAV virus particle comprises a targeting peptide inserted into the AAV9 capsid that alters the transduction of GBA1 and / or endosome release after administration to a patient. An rAAV particle comprising the modified AAV9 capsid protein as disclosed herein comprises three structural capsid proteins, namely VP1, VP2, and VP3. The three capsid proteins are alternative splice variants. In some embodiments, the targeting peptide is inserted into the VP1, VP2, and VP3 capsid proteins within the rAAV particle.

[0025] In certain embodiments, the targeting peptide of the modified AAV9 capsid is inserted after residue 588 of the AAV9 structural protein (numbering is based on the VP1 numbering of AAV9). In some embodiments, the targeting peptide has SEQ ID NO. 16. In some embodiments, the targeting peptide is adjacent to a linker sequence on the N-terminal and C-terminal ends of the targeting peptide. In some embodiments, the linker sequence on the N-terminal side has the sequence AAA. In some embodiments, the linker sequence on the C-terminal side is AS. In some embodiments, the entire sequence inserted after residue 588 of the AAV9 capsid structural protein has SEQ ID NO. 17. In some embodiments, the entire modified AAV9 capsid structural protein has SEQ ID NO. 18. In some embodiments, the entire modified AAV9 capsid structural protein is at least 90% identical to SEQ ID NO. 18 (e.g., at least 92%, at least 95%, at least 98%, at least 98.5%, at least 99%, at least 99.2%, at least 99.5%, or at least 99.8%), and the modified AAV9 structural capsid comprises the targeting peptide of SEQ ID NO. 16. The capsid having SEQ ID NO. 18 will also be referred to herein as SAN006.

[0026] In some embodiments, rAAV virus particles are used to treat GD type 3 or GD type 2. In some embodiments, rAAV virus particles may be administered into the cerebrospinal fluid (CSF) of a patient with GD type 3 or GD type 2. In some embodiments, the virus particles are administered directly to a patient with GD type 3 or GD type 2 by administration into the CSF. In some embodiments of the above embodiments, rAAV is administered to a patient with GD type 3 or GD type 2 via direct injection into the spinal cord, intrathecal injection, or intrasacral injection. In some embodiments, rAAV is administered to more than one location in the spinal cord or logarithmic cistern of a patient with GD type 3 or GD type 2. In some embodiments, rAAV is administered to more than one location in the spinal cord of a patient with GD type 3 or GD type 2. In some embodiments, rAAV is administered into one or more of the lumbar subarachnoid space, thoracic subarachnoid space, and cervical subarachnoid space of the spinal cord of a patient with GD type 3 or GD type 2. In some embodiments, rAAV is administered into the alveolar cistern of a patient with GD type 3 or GD type 2. In some embodiments, the method may include a step of treating GD type 3 in a patient requiring treatment for GD type 3. In other embodiments, the method may include a step of treating GD type 2 in a patient requiring treatment for GD type 2. In additional embodiments, an expression cassette of viral particles may induce transplant gene expression in the central nervous system and peripheral nervous system to treat GD type 3 or GD type 2. In some embodiments, administration of rAAV particles improves symptoms associated with GD2 or GD3. For example, administration of viral particles may reduce or hinder the progression of brainstem and corticosteroid dysfunction, seizures, and cognitive deficits. In some embodiments, administration of viral particles reduces or removes toxic lipid substrates (e.g., Lyso-GL1) accumulated in the brains of patients with GD type 3 or GD type 2.

[0027] In another embodiment, rAAV virus particles are used to treat GD type 1. In certain embodiments, rAAV virus particles may be administered parenterally (e.g., intravenously, subcutaneously, or intramuscularly) to patients with GD type 1. In some embodiments, rAAV virus particles may be administered intravenously to patients with GD type 1. In some embodiments, administration of rAAV virus particles reduces splenomegaly in patients with GD type 1. In some embodiments, administration of rAAV virus particles reduces hepatomegaly in patients with GD type 1. In some embodiments, administration of rAAV virus particles reduces anemia in patients with GD type 1. In some embodiments, administration of rAAV virus particles reduces thrombocytopenia in patients with GD type 1. In some embodiments, administration of virus particles reduces or removes toxic lipid substrates (e.g., Lyso-GL1) accumulated in peripheral organs such as the liver, spleen, kidneys, and / or lungs. In some embodiments, administration of virus particles reduces or removes toxic lipid substrates (e.g., Lyso-GL1) accumulated in muscle tissues such as the heart, diaphragm, quadriceps, and gastrocnemius.

[0028] In other embodiments, rAAV viral particles are used to treat GBA-PD. In some embodiments, rAAV viral particles may be administered into the cerebrospinal fluid (CSF) of a GBA-PD patient. In some embodiments, the viral particles are administered directly by administration into the CSF of a GBA-PD patient. In some embodiments, rAAV is administered to a GBA-PD patient via direct injection into the spinal cord, via intrathecal injection, or via intrasacral injection. In some embodiments, rAAV is administered to more than one location in the spinal cord or logarithmic cistern of a GBA-PD patient. In some embodiments, rAAV is administered to more than one location in the spinal cord of a GBA-PD patient. In some embodiments, rAAV is administered to one or more of the lumbar subarachnoid space, thoracic subarachnoid space, and cervical subarachnoid space of the spinal cord of a GBA-PD patient. In some embodiments, rAAV is administered to the logarithmic cistern of a GBA-PD patient. In some embodiments, rAAV viral particles are administered to patients with early-stage PD. In some of these embodiments, administration of viral particles reduces cognitive decline and disease progression of PD. In some embodiments, administration of viral particles reduces or removes toxic lipid substrates (e.g., Lyso-GL1) accumulated in the brains of GBA-PD patients. In some embodiments, administration of viral particles reduces α-synuclein in the brains of GBA-PD patients.

[0029] In some embodiments, transplant gene expression is further enhanced by adding a Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). In some embodiments, the vector comprises a chicken β-actin (CBA) promoter. In some embodiments, the vector comprises a WPRE element and a CBA promoter.

[0030] In some embodiments, the method may include the use of SAN006-CBA-SS3-GBA1-WPRE. In some embodiments, the method may include using SAN006-CBA-SS3-GBA1-WPRE for the treatment of GBA-PD and / or Gaucher disease type 3 via administration into the CSF. In some embodiments, the method may include using SAN006-CBA-SS3-GBA1-WPRE for the treatment of Gaucher disease type 1 via administration into the vein. In some embodiments, the method may include a vector expressing a codon-optimized and / or engineered human GBA1 gene for the treatment of GBA-PD and / or Gaucher disease.

[0031] In some embodiments, the rAAV vector particle may include pAAV-CBA-GBA-WPRE-bGH. In some embodiments, the rAAV vector particle may include SAN006-CBA-GBA-WPRE-bGH.

[0032] In some embodiments, the rAAV vector particle may include pAAV-CBA-SS1-GBA-WPRE-bGH. In some embodiments, the rAAV vector particle may include SAN006-CBA-SS1-GBA1-WPRE. In some embodiments, the rAAV vector particle may include SAN006-CBA-SS1-GBA-WPRE.

[0033] In some embodiments, the rAAV vector particle may include pAAV-CBA-SS2-GBA-WPRE-bGH. In some embodiments, the rAAV vector particle may include SAN006-CBA-SS2-GBA1-WPRE. In some embodiments, the rAAV vector particle may include SAN006-CBA-SS2-GBA-WPRE.

[0034] In some embodiments, the rAAV vector particle may include pAAV-CBA-SS3-GBA-WPRE-bGH. In some embodiments, the rAAV vector particle may include SAN006-CBA-SS3-GBA1-WPRE. In some embodiments, the rAAV vector particle may include SAN006-CBA-SS3-GBA-WPRE.

[0035] In some embodiments, the rAAV vector particle may include pAAV-CBA-SS4-GBA-WPRE-bGH. In some embodiments, the rAAV vector particle may include SAN006-CBA-SS4-GBA1-WPRE. In some embodiments, the rAAV vector particle may include SAN006-CBA-SS4-GBA-WPRE.

[0036] In some embodiments of the above aspects, the rAAV particle comprises a vector containing an expression cassette attached to one or more AAV inverted terminal repeat (ITR) sequences. In some embodiments, the expression cassette is attached to two AAV ITRs. In some embodiments, the AAV ITR is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV serotype ITR. In some embodiments, the AAV ITR is an AAV2 ITR. In some embodiments, the vector is a self-complementary vector. In some embodiments, the vector comprises a first nucleic acid sequence encoding a GBA1 polypeptide and a second nucleic acid sequence encoding the complement of the GBA1 polypeptide, wherein the first nucleic acid sequence may form intrastrand base pairs with the second nucleic acid sequence along most or all of its length. In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are linked by a mutant AAV ITR, wherein the mutant AAV ITR includes a deletion in the D region and a mutation in the terminal degradation sequence.

[0037] In some embodiments, the present disclosure provides a composition comprising any rAAV particles described herein. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0038] In some embodiments, the present disclosure provides a cell comprising any rAAV particle described herein. In some embodiments, the present disclosure provides a method for producing a GCase enzyme comprising the step of culturing a cell as described herein under conditions for producing a GBA1 polypeptide. In some embodiments, the method further comprises the step of purifying the GBA1 polypeptide.

[0039] In some embodiments, the present disclosure provides a method for treating an individual requiring treatment for GBA-PD and / or GD, comprising the step of administering rAAV particles as described herein to the individual. In some embodiments, the present disclosure provides a method for treating an individual requiring treatment for GBA-PD and / or GD, comprising the step of administering a composition as described herein to the individual. In some embodiments, the present disclosure provides a method for treating an individual requiring treatment for GBA-PD and / or GD, comprising the step of administering cells as described herein to the individual. In some embodiments, the individual lacks GCase activity.

[0040] In some embodiments, the present disclosure provides a method for increasing GCase activity by at least about 5% in an individual requiring an increase in GCase activity, comprising the step of administering rAAV particles as described herein to an individual. In other embodiments, the present disclosure provides a method for increasing GCase activity by at least about 10% in an individual requiring an increase in GCase activity, comprising the step of administering rAAV particles as described herein to an individual. In other embodiments, the present disclosure provides a method for increasing GCase activity by at least about 20% in an individual requiring an increase in GCase activity, comprising the step of administering rAAV particles as described herein to an individual. In other embodiments, the present disclosure provides a method for increasing GCase activity by at least about 30% in an individual requiring an increase in GCase activity, comprising the step of administering rAAV particles as described herein to an individual. In another embodiment, the present disclosure provides a method for increasing GCase activity by at least about 50% in an individual requiring an increase in GCase activity, comprising the step of administering rAAV particles as described herein to the individual.

[0041] In some embodiments of the above aspects, rAAV particles are administered only once to a patient who requires them. In some embodiments, rAAV particles are administered multiple times to a patient who requires them (e.g., over a period of one month or more than one year). In other embodiments, rAAV particles are administered once a year to a patient who requires them. In other embodiments, rAAV particles are administered twice a year to a patient who requires them.

[0042] In some embodiments, the present disclosure provides a kit comprising any one of rAAV particles, compositions, or cells as described herein. In some embodiments, the kit further comprises instructions for use; a buffer and / or pharmaceutically acceptable excipients; and / or a bottle, vial, and / or syringe. Brief explanation of the drawing

[0043] FIGS. 1a to 1b Is This document illustrates the strategy for generating engineered GBA1 variants and the in vitro verification of the activity of the constructs. Fig. 1a This describes a strategy for generating a secreted GBA1 variant. The endogenous signal sequence of human GBA1 was replaced with a signal sequence from a highly secreted protein. The top four signal sequences (SS) were narrowed down using an in silico tool that predicts strong secretion as well as high (over 98%) cleavage potential at the signal sequence ends (e.g., cleavage sites). Fig. 1b Figure 1 shows the lysation of cells transfected with GBA containing the indicated SS variants and the determination of GCase enzyme activity in the cell lysates. Mean ± SEM, each color represents a data point from a single experiment. Untransfected ("Utx") vs. all GBA1 constructs and transfected GFP vs. all GBA1 constructs: ***p < 0.001; one-way ANOVA using Tukey's multiple comparison test. FIGS. 2a to 2b It indicates potent secretion and parenchymal spread of GBA1 protein from the in vivo AAV.SAN006 GBA1 virus. Fig. 2a This shows the vector biodistribution with in situ hybridization for WPRE (upper panel) and huGBA1 immunohistochemistry (lower panel) in thalamic sections of WT mice injected with the AAV.SAN006-GBA1 variant (bilateral ICV, 1e11 VG / mouse, 5 μl per hemisphere) and analyzed 4 weeks after expression. Fig. 2bFigure 2a shows high-magnification images of WPRE mRNA and GBA1 protein in SS3-GBA1-injected mice. The images correspond to the purple boxes in Figure 2a. Representative cells positive for both WPRE mRNA and GBA1 protein are indicated by red arrows (e.g., AAV-transfected cells), while mRNA-negative and GBA1 protein-positive cells are indicated in green (e.g., cross-corrected cells). FIGS. 3a to 3c This indicates efficient substrate clearance by the SS3-GBA1 variant in multiple brain regions far from the AAV injection site. Fig. 3a represents WPRE mRNA in situ hybridization, which indicates the distribution of AAV around the ventricles. FIGS. 3b to 3c lyso-GL1 in the cerebellum, hindbrain, and midbrain of injected mice (e.g., 4-month-old wild-type mice injected with 1 e11 VG each of the AAV.SAN006-GBA1 variant were intraperitoneally injected with 100 mg / kg CBE (conduritol β-epoxide) 24 hours prior to necropsy) Fig. 3b ) and total GL-1( Fig. 3a ...represents ). In the graph shown, the "no CBE" group consists of control mice that did not receive any virus or CBE injection. N=8 mice per group. ***p < 0.001, **p < 0.01, *p < 0.05; One-way analysis of variance (ANOVA) using Tukey's multiple comparison test comparing all groups to the CBE-treated vehicle-injected group. FIGS. 4a to 4e It shows the development of a conduritol-β-epoxide (CBE)-induced lipid flux model in NHP. Fig. 4a This illustrates an example of a study design for CBE administration in NHP. Fig. 4b Figure 1 plots Lyso-GL1 levels in plasma samples before CBE administration and 24 hours after CBE administration (left), ( Fig. 4c ) illustrates that Lyso-GL1 levels increase in a dose-dependent manner in liver tissue homogenates (right). Figures 4d-4e The dose-dependent increase of Lyso-GL1 in 47 gray matter punches of the NHP brain, representing 20 gray matter regions ( Fig. 4d ) and concomitant decrease in GCase enzyme activity ( Fig. 4e Plots ). N=1 NHP per dose. Median within the interquartile range across 47 punches. ***p < 0.001; Two-way ANOVA using Tukey's multiple comparison test in all groups compared to the 0 mg / kg CBE group or the group without CBE. FIGS. 5a to 5e It illustrates the effective reduction of GL1 lipids in SS3-GBA1-treated NHP. Fig. 5a This shows Lyso-GL1 in plasma spiked across all NHPs after CBE administration. FIGS. 5b to 5c Figure 1 illustrates the vector genome and huGBA1 transplant gene expression in NHPs treated with vehicle, WT-GBA1, and SS3-GBA1 NHPs, respectively. Three NHPs from the vehicle and WT-GBA1 groups and four NHPs from the SS3-GBA1 group. NHPs were administered 1.25 e13 VG via ICM at 6 weeks of age and injected with 30 mg / kg CBE (IV administration) 48 hours prior to autopsy. Data are presented as median and interquartile ranges, with each data point representing the mean value of all NHPs within the group obtained from 64 brain tissue samples (17 gray matter regions and 7 white matter regions). FIGS. 5d to 5e Figures 1 and 2 plot Lyso-GL1 and C18 GL1 in 47 gray matter brain tissue samples, respectively. Each data point is the mean value of all within-group NHPs for the corresponding sample. ***p < 0.001; Two-way ANOVA using Tukey's multiple comparison test. The purple line represents lipid levels under physiological conditions. FIGS. 6a to 6b It shows active secretion and diffusion of SS3-GBA1 in brain tissue sections of NHPs administered with SS3-GBA1 ICM. Fig. 6aThis shows low-magnification images of WPRE mRNA in situ hybridization (ISH; top panel) and huGBA1 immunohistochemistry (IHC; bottom panel) in representative NHP brain tissue sections. Fig. 6b is of mRNA (left) and GBA1 protein (right). Fig. 6a High magnification of the insert from is shown. Cells positive for both WPRE mRNA and GBA1 protein are indicated by red arrows (e.g., AAV-transfected cells), while mRNA-negative and GBA1 protein-positive cells are indicated in green (e.g., cross-corrected cells). FIGS. 7a to 7b This illustrates effective lipid removal in mice injected intravenously with SS3-GBA1. Fig. 7a Figure 3 illustrates the intravenous injection of 4 e13 VG / kg of vehicle or SS3-GBA1 into 3-month-old WT mice. After expressing AAV for 4 weeks, 100 mg / kg CBE was injected intraperitoneally 24 hours prior to necropsy. Lyso-GL1 was quantified across major peripheral tissues such as the liver, spleen, kidney, and lung. Fig. 7b Figure 1 illustrates the quantification of Lyso-GL1 across multiple muscles investigated, such as the heart, diaphragm, quadriceps, and gastrocnemius. In the graph presented, the "no CBE" group consists of control mice that did not receive any virus or CBE injection. N=8 mice per group. ***p < 0.001; one-way analysis of variance (ANOVA) using Tukey's multiple comparison test comparing all groups to the vehicle group. Fig. 8 This shows the extensive biodistribution of AAV.SAN006-GFP in peripheral tissues of NHPs at 3 weeks after intravenous administration. The vector genome was quantified per cell (e.g., VG / cell) across multiple peripheral tissues. Data are mean ± SEM. Each data point is a tissue from one NHP, and a total of 4 NHPs participated in the study. FIGS. 9a to 9bThis illustrates the extensive expression of transplanted genes and proteins in peripheral tissues of NHPs injected intravenously with AAV.SAN006-GFP. Fig. 9a It plots the GFP mRNA transcript level. Fig. 9b is the corresponding GFP ELISA from peripheral tissues of NHPs. Data are mean ± SEM. Each data point is tissue from one NHP, and a total of four NHPs participated in the study. Fig. 10 It shows the SnapGene Map file image of pAAV-CBA-GBA-WPRE-bGH. Fig. 11 It shows the SnapGene Map file image of pAAV-CBA-SS1-GBA-WPRE-bGH. Fig. 12 This shows the SnapGene Map file image of pAAV-CBA-SS2-GBA-WPRE-bGH. Fig. 13 It shows the SnapGene Map file image of pAAV-CBA-SS3-GBA-WPRE-bGH. Fig. 14 This shows the SnapGene Map file image of pAAV-CBA-SS4-GBA-WPRE-bGH. FIGS. 15a to 15b It demonstrates the increased efficacy of engineered lysosomal proteins in the distal region of the CNS. Fig. 15a represents WPRE mRNA in situ hybridization (e.g., WPRE ISH) indicating the distribution of AAV in brain tissue. Cortical, hindbrain, and cerebellar regions are indicated by circles. Fig. 15b represents the quantification of AAV transduction (e.g., vector genome per cell) and Lyso-GL1 in the corresponding region of the injected mice. 4-month-old WT mice were injected with 1 e11 VG each of AAV.SAN006-GBA1 variants (e.g., WT-GBA, SS1-GBA, SS2-GBA, SS3-GBA, and SS4-GBA), and 100 mg / kg of CBE (conduritol β-epoxide) was injected intraperitoneally 24 hours before necropsy. FIGS. 16a to 16eThis indicates that cross-correction upon systemic AAV administration promotes lipid removal in peripheral tissues, muscles, and bone marrow. FIGS. 16a to 16c Quantification of the vector genome per cell (e.g., VG / cel1) in samples from 3-month-old mice 4 weeks after intravenous AAV encoding engineered lysosomal protein (4e13 VG / kg) or vehicle (e.g., Ctrl-AAV or AAV expressing SS3-GBA); Fig. 16a ), GBA protein levels ( Fig. 16b ), and lipid removal rate ( Fig. 16c It represents ). Quantification of liver, heart, and spleen samples was performed. Fig. 16d represents the quantification of Lyso-GL1 in soleus muscle (e.g., muscle tissue) and bone marrow. The "no CBE" group consists of control mice that did not receive any virus or CBE injection. N=8 mice per group. ***p < 0.001; one-way analysis of variance (ANOVA) using Tukey's multiple comparison test comparing all groups to the vehicle group. Fig. 16e This shows chromogenic double in situ hybridization and immunohistochemistry for the co-detection of WPRE mRNA and huGBA1 protein on FFPE sections of liver tissue. FIGS. 17a to 17e This indicates that engineered therapeutic proteins (e.g., huGBA1) are secreted in the NHP brain and absorbed by untransduced cells. AAV-transduced cells (e.g., green WPRE mRNA) and huGBA1 protein-positive cells (red) were co-detected using multiplex imaging in the NHP brain. Magenta NeuN is a neuronal marker. Low-magnification image showing a whole brain slab of NHP treated with SS3-GBA1 via ICM administration at 1.25e13 VG. The magnified image is a representative image of the motor cortex. Yellow arrows indicate AAV-transduced cells, and red arrows indicate cross-corrected cells. FIGS. 18a to 18dThis indicates the confirmation of MED of SS3-GBA1 in NHP from a dose-range search (DRF) study. Fig. 18a This shows the quantification of vector genomes per cell in NHPs treated with three doses (e.g., 2.5e12, 7.5e12, or 2.5e13) in the DRF study. Data from 5 NHPs per group are included across 47 gray matter punches and 19 white matter punches of the brain. Fig. 18b It represents vector genome data plotted across various brain regions. Fig. 18c plasma Lyso-GL1 data, Fig. 18d Lyso-GL1 data from all 47 gray matter punches are shown. All scatter plots are displayed with median and interquartile range. ***p < 0.0001; Two-way ANOVA using Tukey's multiple comparison test FIGS. 19a to 19f represents the histopathological analysis in the NHP DRF study. Histopathological findings and severity scores were reported across both the central nervous system and peripheral tissues. The scores are for the brain ( Fig. 19a ), peripheral organs( Fig. 19b ), sciatic nerve ( Fig. 19c ), spinal cord (C), DRG( Fig. 19d and Fig. 19e ) and sciatic nerve ( Fig. 19f ...was reported for ). Data are mean ± SEM. Each point is a score for an individual NHP. 5 NHPs per treatment group. FIGS. 20a to 20e ... demonstrates long-term efficacy and persistence against AAV.SAN006 SS3-GBA1. Cerebral cortex ( Fig. 20a ) and cerebellum ( Fig. 20b The vector genome of ) was quantified in longitudinal pharmacological studies performed in vivo at 3, 6, and 9 months after AAV administration. The cerebral cortex is located proximal to the injection site, and the cerebellum is located distal to the injection site. The cerebral cortex of all mice participating in this study ( Fig. 20c ), cerebellum( Fig. 20d ) and plasma( Fig. 20eIt represents the Lyso-GL1 removal rate in ). Specific details for implementing the invention

[0044] In some embodiments, the present disclosure provides a pharmaceutical composition comprising rAAV viral particles encapsulating an rAAV vector containing a transplant gene capable of encoding a GCase enzyme (polypeptide). In some embodiments, the transplant gene further encodes a signal peptide. In some embodiments, the signal peptide is not inherent in the transplant gene. In some embodiments, the present disclosure provides a method for treating GD or GBA-PD by administering the rAAV viral particles of the present disclosure. In another embodiment, the present disclosure provides a kit for treating GD or GBA-PD in an individual using the viral particles of the present disclosure.

[0045] definition

[0046] As used herein, "vector" refers to a recombinant plasmid or virus containing nucleic acid that is delivered to a host cell in vitro or in vivo.

[0047] The terms “polypeptide” and “protein” are used interchangeably to refer to polymers of amino acid residues and are not limited to the minimum length. Such polymers of amino acid residues may include natural or non-natural amino acid residues and include, but are not limited to, peptides, oligopeptides, dimers, trimers, and multimers of amino acid residues. Both full-length proteins and fragments thereof are included in the above definitions. The term also includes post-expression modifications of polypeptides, e.g., glycosylation, sialylation, acetylation, phosphorylation, etc. Additionally, for the purposes of this disclosure, “polypeptide” refers to a protein that includes modifications such as deletions, additions, and substitutions (generally practically conserved) to the natural sequence, provided that the protein retains the desired activity. Such modifications may be intentional, such as through site-specific mutagenesis, or accidental, such as through mutations in the host producing the protein or errors resulting from PCR amplification.

[0048] "Recombinant viral vector" refers to a recombinant polynucleotide vector containing one or more heterogeneous sequences (i.e., nucleic acid sequences that are not of viral origin). In the case of a recombinant AAV vector, the recombinant nucleic acid is flanked by at least one, and depending on the embodiment, two, inversion terminal repeat sequences (ITRs).

[0049] "Recombinant AAV vector (rAAV vector)" refers to a polynucleotide vector comprising one or more heterogeneous sequences (i.e., nucleic acid sequences not of AAV origin) flanked by at least one, or in some embodiments, two, AAV inversion terminal repeat sequences (ITRs). Such rAAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that is infected with an appropriate helper virus (or expresses an appropriate helper function) and expresses AAV rep and cap gene products (i.e., AAV Rep and Cap proteins). When an rAAV vector is incorporated into a larger polynucleotide (e.g., a chromosome, or another vector such as a plasmid used for cloning or transfection), such rAAV vectors may be referred to as a "pro-vector" that can be "recovered" by replication and capsidization in the presence of an AAV packaging function and an appropriate helper function. The rAAV vector may be any of a number of forms, including linear artificial chromosomes, plasmids, which are complexed with lipids, encapsulated within liposomes, and capsidized onto viral particles, particularly AAV particles. The rAAV vector can be packaged into an AAV viral capsid to produce "recombinant adeno-associated virus particles (rAAV particles)".

[0050] "Heterogeneous" means derived from an organism that is genotype-distinguishable from the remainder of the organism being compared or introduced or incorporated into it. For example, polynucleotides introduced into various cell types by genetic engineering techniques are heterogeneous polynucleotides (if expressed, they may encode heterogeneous polypeptides). Similarly, cell sequences (e.g., genes or parts thereof) incorporated into a viral vector are heterogeneous nucleotide sequences relative to the vector.

[0051] The term "transplant gene" refers to a polynucleotide that can be introduced into a cell, transcribed into RNA, and, if necessary, translated and / or expressed under appropriate conditions. Depending on the mode, it provides characteristics required of the introduced cell or induces required therapeutic or diagnostic outcomes.

[0052] The "chicken β-actin (CBA) promoter" refers to the chicken β-actin gene (e.g., represented by GenBank Entrez Gene ID 396526). Gallus It refers to a polynucleotide sequence derived from beta-actin. As used herein, "chicken β-actin promoter" refers to a promoter containing the cytomegalovirus (CMV) early enhancer element, the promoter of the chicken β-actin gene and the first exon and intron, and the splice receptor of the rabbit beta-globin gene, e.g., [Miyazaki, J. et al. (1989) Gene It may refer to the sequences described in [79(2):269-77]. The term "CAG promoter" as used herein may be used interchangeably. The term "CMV early enhancer / chicken beta-actin (CAG) promoter" as used herein may be used interchangeably.

[0053] The terms “genome particle (gp),” “genome equivalent,” or “genome copy” used in relation to viral titer refer to the number of virions containing a recombinant AAV DNA genome, regardless of infectivity or functionality. The number of genome particles within a specific vector preparation is in the examples of the present invention, or, for example, in the literature [Clark et al . (1999) Hum. Gene Ther ., 10:1031-1039]; Literature [Veldwijk et al . (2002) Mol. Ther It can be measured by the procedure as described in ., 6:272-278.

[0054] As used herein, the term "vector genome (vg)" may refer to one or more polynucleotides comprising a set of polynucleotide sequences of a vector, for example, a viral vector. The vector genome may be capsidized into a viral particle. Depending on the specific viral vector, the vector genome may comprise single-stranded DNA, double-stranded DNA, or single-stranded RNA, or double-stranded RNA. The vector genome may comprise endogenous sequences associated with the specific viral vector and / or any heterogeneous sequence inserted into the specific viral vector through recombinant technology. For example, a recombinant AAV vector genome may comprise at least one ITR sequence flanking the promoter, a stuffer, a sequence of interest (e.g., RNAi), and a polyadenylation sequence. A complete vector genome may comprise a complete set of polynucleotide sequences of the vector. In some embodiments, the nucleic acid titer of the viral vector may be measured in units of vg / ml. Suitable methods for measuring such titers are known in the art (e.g., quantitative PCR).

[0055] The terms "infectious unit (iu)," "infectious particle," or "replication unit" used in relation to viral titer are, for example, in the literature [McLaughlin et al . (1988) J. Virol It refers to the number of infectious and replicating recombinant AAV vector particles measured by the infection center test, also known as the replication center test, as described in ., 62:1963-1973.

[0056] The term "transduction unit (tu)" used in relation to viral titer is described in the embodiments of this application, or, for example, in the literature [Xiao et al . (1997) Exp. Neurobiol ., 144:113-124] or literature[Fisher et al . (1996) J. Virol.It refers to the number of infectious recombinant AAV vector particles that result in the production of a functional transplanted gene product, as measured by a functional assay such as that described in [70:520-532](LFU assay).

[0057] "Inverse terminal repeat" or "ITR" sequences are terms widely understood in the industry to refer to relatively short sequences found at the ends of oppositely oriented viral genomes.

[0058] The "AAV reverse end repeat (ITR)" sequence, a term widely understood in the art, is an approximately 145-nucleotide sequence located at both ends of a native single-stranded AAV genome. The outermost 125 nucleotides of the ITR can exist in one of two alternative orientations, which results in heterogeneity between different AAV genomes and between the two ends of a single AAV genome. The outermost 125 nucleotides also contain several short self-complementary regions (named the A, A', B, B', C, C', and D regions), which enable intrastrand base pairing to occur within these parts of the ITR.

[0059] "Terminal degradation sequences" or "trs" are sequences within the D region of AAV ITR that are cleaved by the AAV rep protein during viral DNA replication. Mutant terminal degradation sequences are resistant to cleaving by the AAV rep protein.

[0060] "AAV helper function" refers to a function that enables AAV to be replicated and packaged by host cells. The AAV helper function may be provided in any of several forms containing helper viruses or helper virus genes that assist in AAV replication and packaging, without limitation. Other AAV helper functions, such as genotoxic agents, are known in the art.

[0061] "Helper viruses" for AAV refer to viruses that enable AAV (a defective parvovirus) to be replicated and packaged by a host cell. Helper viruses provide a "helper function" that enables the replication of AAV. Numerous such helper viruses have been identified, including adenoviruses, herpesviruses, and poxviruses, such as vaccinia and baculovirus. Although adenoviruses include many different subgroups, adenovirus type 5 (Ad5) of subgroup C is the most commonly used. Several adenoviruses of human, non-human mammalian, and avian origin are known and are available from depositary institutions such as ATCC. Viruses of the herpes family, also available from depositary institutions such as ATCC, include, for example, herpes simplex virus (HSV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), and pseudorabies virus (PRV). Examples of adenovirus helper functions for AAV replication include the E1A function, E1B function, E2A function, VA function, and E4orf6 function. Baculoviruses available from depositary institutions are Autographa californica Includes nuclear polyhedral-forming viruses.

[0062] rAAV preparations have a ratio of infectious AAV particles to infectious helper virus particles of at least about 10 2 :l; At least about 10 4 :l, at least about 10 6 :l; or at least about 10 8:l or greater, it is stated that the helper virus is "substantially absent." In some embodiments, the preparation is also absent from an equivalent amount of helper virus protein (i.e., protein that would be present as a result of such a level of helper virus if the aforementioned helper virus particle impurities were present in a damaged form). Viral and / or cellular protein contamination can generally be observed as the presence of Coomassie staining bands on an SDS gel (e.g., the appearance of bands other than those corresponding to AAV capsid proteins VPl, VP2, and VP3).

[0063] The "effective dose" is an amount sufficient to produce a beneficial or desired outcome, including clinical outcomes (e.g., improvement of symptoms, achievement of clinical endpoints, etc.). The effective dose may be administered in one or more doses. In terms of disease state, the effective dose is an amount sufficient to alleviate, stabilize, or delay the onset of the disease.

[0064] "Individual" or "object" is a mammal. Mammals include, but are not limited to, domestic animals (e.g., cattle, sheep, cats, dogs, and horses), primates (e.g., non-human primates such as humans and monkeys), rabbits, and rodents (e.g., mice and rats). In certain embodiments, the individual or object is a human.

[0065] As used herein, “treatment” refers to an approach to obtain a beneficial or desired clinical outcome. For the purposes of this disclosure, beneficial or desired clinical outcomes include, but are not limited to, relief of symptoms, whether detectable or indetectable; reduction of disease severity; a stabilized state of disease (e.g., not worsening); prevention of disease spread (e.g., metastasis); delay or slowing of disease progression; remission or temporary suppression of disease state; and remission (partial or total). Additionally, “treatment” may mean survival extended compared to survival expected without treatment.

[0066] As used herein, the term "preventive treatment" refers to treatment for an individual known or suspected of having a disability or being at risk of having a disability, but exhibiting no symptoms or minimal symptoms of the disability. Individuals receiving preventive treatment may be treated before the onset of symptoms.

[0067] References to values ​​or parameters attached with "about" in this document include (and describe) embodiments relating to the value or parameter itself. For example, a description of "about X" includes a description of "X".

[0068] The singular form used herein includes multiple referents unless otherwise indicated.

[0069] The aspects and embodiments of the present disclosure described herein are understood to include those that "comprising" the aspects and embodiments, "consisting" of the aspects and embodiments, and / or "essentially consisting" of the aspects and embodiments.

[0070] Expression Cassette

[0071] In some embodiments, the transplant gene encoding the GCase enzyme is codon-optimized. In some embodiments, the transplant gene encoding the GCase enzyme is codon-optimized for expression in specific cells, such as eukaryotic cells. Eukaryotic cells may be cells of specific organisms, such as mammals including humans, mice, rats, rabbits, dogs, or non-human primates, without limitation, or cells derived from such organisms. Generally, codon optimization refers to the process of modifying a nucleic acid sequence to enhance expression in a host cell of interest by replacing at least one codon of the natural sequence with a codon that is used more frequently or most frequently in the gene of the host cell of interest, while maintaining the natural amino acid sequence. Various species exhibit specific biases toward a given codon of a specific amino acid. Codon usage tables are readily available, for example, from "codon usage databases," and these tables can be adjusted in various ways (e.g., literature [Nakamura, Y. et al. (2000) Nucleic Acids Res. [See 28:292]). Computer algorithms for codon-optimizing specific sequences for expression in specific host cells, such as Gene Forge (Aptagen; Jacobus, Pa.), DNA2.0, GeneArt (GA), or Genscript (GS), and GS algorithms combined with reduced CpG content are also available. In some embodiments, a transplant gene encoding a GCase enzyme is codon-optimized using the GA algorithm.

[0072] In some embodiments, the vector encodes a Gcase enzyme comprising or having the sequence of SEQ ID NO. 1. In some embodiments, the vector encodes a GCase enzyme comprising or having a sequence of at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% homology to the sequence of SEQ ID NO. 1. SEQ ID NO. 1 is the wild-type amino acid sequence of glucocerebrosidase (GCase). The sequence comprises an N-terminal 39-amino acid signaling peptide that is cleaved after protein expression, thereby producing a mature protein having the amino acid sequence of SEQ ID NO. 2. In some embodiments, the vector encodes a GCase enzyme comprising the amino acid sequence of SEQ ID NO. 2. In some embodiments, the vector encodes a GCase enzyme comprising or having an amino acid sequence of at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% homology to the sequence of SEQ ID NO. 2. In some embodiments, the vector encodes a GCase enzyme having or comprising the amino acid sequence of SEQ ID NO. 2 after cleavage (removal) of the signal transduction peptide. In some embodiments, the vector encodes a GCase enzyme having or comprising a sequence having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% homology with SEQ ID NO. 2 after cleavage (removal) of the signal transduction peptide.

[0073] As disclosed herein, the human GBA1 gene can be engineered to express a GCase enzyme (polypeptide) having a signaling peptide different from the wild-type (endogenous) sequence of SEQ ID NO. 1. Upon cleavage of the signaling peptide, an identical mature protein, e.g., a GCase enzyme having the sequence of SEQ ID NO. 2, is produced. It has been found that a specific GCase enzyme having a specific signaling peptide is more readily secretable than a wild-type GCase enzyme having the sequence of SEQ ID NO. 1. In certain embodiments, a GCase enzyme having a signaling peptide different from the wild-type peptide provides a higher level of transplanted gene expression than a wild-type GCase enzyme.

[0074] In some embodiments, the sequence used to express the GCase enzyme is a codon-optimized sequence. In some embodiments, the codon-optimized nucleic acid sequence has the sequence of SEQ ID NO. 3. In some embodiments, the codon-optimized nucleic acid sequence has the sequence of SEQ ID NO. 4 (also referred to herein as SS1-GBA1). In some embodiments, the codon-optimized nucleic acid sequence has the sequence of SEQ ID NO. 5 (also referred to herein as SS2-GBA1). In some embodiments, the codon-optimized nucleic acid sequence has the sequence of SEQ ID NO. 6 (also referred to herein as SS3-GBA1). In some embodiments, the codon-optimized nucleic acid sequence has the sequence of SEQ ID NO. 7 (also referred to herein as SS4-GBA1). The nucleic acid sequence of SEQ ID NO. 3 expresses a wild-type human GCase enzyme (e.g., the enzyme having SEQ ID NO. 1) containing an endogenous signaling peptide. In some embodiments, the polynucleotides of SEQ ID NOs 4 to 7 express variant GCase enzymes having different signal transduction peptides.

[0075] In some embodiments, the expression cassette further comprises introns. Various introns for use in this disclosure are known to those skilled in the art and include MVM introns, F IX cleavage intron 1, β-globin SD / immunoglobulin heavy chain SA, adenovirus SD / immunoglobulin SA, SV40 late SD / SA (19S / 16S), and hybrid adenovirus SD / IgG SA. (Reference [Wu et al. 2008, Kurachi et al ., 1995, Choi et al . 2014, Wong et al ., 1985, Yew et al [H. 1997, Huang and Gorman (1990)]). In some embodiments, the intron is a chicken β-actin (CBA) / rabbit β-globin hybrid intron. In some embodiments, the intron is a chicken β-actin (CBA) / rabbit β-globin hybrid promoter and intron from which all ATG sites have been removed to minimize incorrect translation initiation sites. In some embodiments, the intron is an MVM intron, F IX cleavage intron 1, β-globin SD / immunoglobin heavy chain SA, adenovirus SD / immunoglobin SA, SV40 late SD / SA (19S / 16S), or hybrid adenovirus SD / IgG SA. In some embodiments, the intron is a chicken β-actin (CBA) / rabbit β-globin hybrid intron.

[0076] In some embodiments, the expression cassette further includes a polyadenylation signal. In some embodiments, the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or an HSV TK pA. In some embodiments, the polyadenylation signal is [Levitt, N et al . (1989), Genes Develop It is a synthetic polyadenylation signal as described in . 3:1019-1025.

[0077] In some embodiments, the expression cassette comprises a stuffer nucleic acid. In some embodiments, the stuffer nucleic acid may comprise a sequence encoding a reporter polypeptide. As understood by those skilled in the art, the stuffer nucleic acid may be located in various regions within the nucleic acid and may consist of a continuous sequence within the nucleic acid (e.g., a single stuffer nucleic acid at a single position) or multiple sequences (e.g., two or more stuffer nucleic acids at two or more positions (e.g., two positions, three positions, etc.)). In some embodiments, the stuffer nucleic acid may be located downstream of the transplant gene encoding the GCase enzyme. In some embodiments, the stuffer nucleic acid is upstream of the transplant gene encoding the GCase enzyme ( for example It may be located between the promoter and the transplanted gene. As is also understood by those skilled in the art, various nucleic acids may be used as stuffer nucleic acids. In some embodiments, the stuffer nucleic acid comprises all or part of a human alpha-1-antitrypsin (AAT) stuffer sequence or a C16 P1 chromosome 16 P1 clone (human C16) stuffer sequence. In some embodiments, the stuffer sequence comprises all or part of a gene. For example, the stuffer sequence comprises a part of the human AAT sequence. Those skilled in the art will recognize that different parts of a gene (e.g., the human AAT sequence) may be used as stuffer fragments. For example, the stuffer fragment may be derived from the 5' end of the gene, the 3' end of the gene, the middle of the gene, the non-coding part of the gene (e.g., an intron), the coding region of the gene (e.g., an exon), or a mixture of the non-coding and coding parts of the gene. Additionally, those skilled in the art will recognize that all or part of the stuffer sequence may be used as a stuffer sequence. In some embodiments, the stuffer sequence is modified to remove an internal ATG codon.

[0078] In some embodiments, the expression cassette is incorporated into a vector. In some embodiments, the expression cassette is incorporated into a viral vector. In some embodiments, the viral vector is an rAAV vector as described herein.

[0079] Vectors and Virus Particles

[0080] In certain embodiments, an expression cassette for expressing a GCase enzyme is contained within a vector (e.g., a wild-type human GCase enzyme or a GCase enzyme having a mutated signaling peptide). In some embodiments, the present disclosure considers the use of a recombinant viral genome to introduce a nucleic acid sequence encoding a GCase enzyme for packaging into a viral particle, e.g., the viral particle described below. The recombinant viral genome may include any elements for establishing the expression of the GCase enzyme, e.g., a promoter, an ITR, a ribosomal binding element, a termination factor, an enhancer, a screening marker, an intron, a poly-A signal, and / or a replication origin. Exemplary viral genome elements and methods for delivering viral particles are described in more detail below.

[0081] Non-viral delivery system

[0082] Conventional nonviral gene delivery methods may be used to introduce nucleic acids into cells or target tissues. A nonviral vector delivery system comprises a DNA plasmid, an unmodified nucleic acid, and a nucleic acid complexed in the delivery system. For example, the vector may form a complex with lipids (e.g., cationic or neutral lipids), liposomes, polyvalent cations, nanoparticles, or enhancers of the intracellular uptake of nucleic acids. The vector may form a complex with a preparation suitable for any of the delivery methods described herein. In some embodiments, the nucleic acid comprises one or more viral ITRs (e.g., AAV ITRs).

[0083] Virus particles

[0084] In some embodiments, GCase enzyme ( for example, A vector comprising an expression cassette for expressing a wild-type human GCase enzyme (or a GCase enzyme having a mutated signaling peptide) is a recombinant viral vector. Some examples of recombinant viral vectors include AAVs, lentiviruses, and adenoviruses. In one embodiment, the viral vector is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the expression cassette for expressing a GCase enzyme (e.g., a wild-type human GCase enzyme or a GCase enzyme having a mutated signaling peptide) is adjacent to one or more AAV inversion terminal repeat (ITR) sequences. In some embodiments, the viral particle is a recombinant AAV particle comprising an expression cassette for expressing a GCase enzyme adjacent to one or two ITRs. In some embodiments, the expression cassette for expressing a GCase enzyme is adjacent to two AAV ITRs.

[0085] In some embodiments, an expression cassette for expressing the GCase enzyme of the present disclosure forms the expression cassette by a regulatory sequence comprising a component operably linked in the transcriptional direction, a transcription initiation sequence, and a termination sequence. The expression cassette is flanked by at least one functional AAV ITR sequence at the 5' and 3' ends. "Functional AAV ITR sequence" means that the ITR sequence functions as intended for the recovery, replication, and packaging of AAV virions. The full text of the literature incorporated herein by reference [Davidson et al ., PNAS , 2000, 97(7)3428-32; Passini et al. , J. Virol ., 2003, 77(12):7034-40; and Pechan et al ., Gene Ther[See ., 2009, 16:10-16]. To carry out some aspects of the present disclosure, a recombinant vector comprises at least all sequences of an AAV essential for physical structure and capsidization for infection by rAAV. The AAV ITR for use in the vector of the present disclosure does not need to have a wild-type nucleotide sequence (e.g., literature [Kotin, Hum. Gene Ther As described in [., 1994, 5:793-801]), it can be altered by the insertion, deletion, or substitution of nucleotides, or AAV ITRs can originate from any of the various AAV serotypes. Currently, more than 40 AAV serotypes are known, and new serotypes and variants of existing serotypes continue to be identified. Literature [Gao et al ., PNAS , 2002, 99(18): 11854-6; Gao et al ., PNAS , 2003, 100(10):6081-6]; and literature[Bossis et al ., J. Virol See ., 2003, 77(12):6799-810.

[0086] The use of any AAV serotype is considered to be within the scope of the present disclosure. In some embodiments, the rAAV vector is a vector derived from an AAV serotype including, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, goat AAV, bovine AAV, or mouse AAV ITR. In some embodiments, the nucleic acid of the AAV includes the ITR of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, goat AAV, bovine AAV, or mouse AAV ITR. In a specific embodiment, the AAV ITR is the AAV2 ITR.

[0087] In some embodiments, the vector may include a stuffer nucleic acid. In some embodiments, the stuffer nucleic acid may encode a green fluorescent protein (GFP). In some embodiments, the stuffer nucleic acid may be located at the 3' position for an expression cassette for expressing the GCase enzyme of the present disclosure.

[0088] In some embodiments, the present disclosure provides a viral particle comprising a single-stranded genome. In some embodiments, the present disclosure provides a viral particle comprising a recombinant self-complementary genome. In some embodiments, the vector is a self-complementary vector. AAV viral particles having a self-complementary genome and methods of using a self-complementary AAV genome are described in U.S. Patents 6,596,535; 7,125,717; 7,765,583; 7,785,888; 7,790,154; 7,846,729; 8,093,054; and 8,361,457; and literature [Wang Z., et al ., (2003) Gene Ther[10:2105-2111] is described, and the full text of each of these is incorporated herein by reference. rAAV containing a self-complementary genome will rapidly form a double-stranded DNA molecule due to its partially complementary sequences (e.g., complementary coding and non-coding strands of the transplant gene). In some embodiments, the present disclosure provides an AAV virus particle containing an AAV genome, wherein the rAAV genome comprises a first heterogeneous polynucleotide sequence (e.g., the coding strand of the GBA1 polypeptide of the present disclosure) and a second heterogeneous polynucleotide sequence (e.g., the non-coding or antisense strand of the GBA1 polypeptide of the present disclosure), and the first heterogeneous polynucleotide sequence may form intrastrand base pairs with the second polynucleotide sequence along most or all of its length.

[0089] In some embodiments, the first heterogeneous polynucleotide sequence and the second heterogeneous polynucleotide sequence are connected by a sequence that facilitates intrastrand base pair formation, e.g., a hairpin DNA structure. For example, in siRNA molecules, a hairpin structure is known in the art. In some embodiments, the first heterogeneous polynucleotide sequence and the second heterogeneous polynucleotide sequence are connected by a mutant ITR (e.g., a right-side ITR). The mutant ITR includes a deletion of the D region containing a terminal cleavage sequence. Consequently, upon replication of the AAV viral genome, the rep protein will not be able to cleave the viral genome at the mutant ITR, and thus, a recombinant viral genome comprising the following in the order of 5' to 3' will be packaged in the viral capsid: an AAV ITR, a first heterogeneous polynucleotide sequence containing a regulatory sequence, a mutant AAV ITR, a second heterogeneous polynucleotide reversed relative to the first heterogeneous polynucleotide, and a third AAV ITR.

[0090] In some embodiments, the first heterogeneous nucleic acid sequence and the second heterogeneous nucleic acid sequence are linked by a mutant ITR (e.g., the right ITR). In some embodiments, the ITR is a polynucleotide sequence 5'-CACTCCCTCTCTGCGCGCT

[0091] It includes CGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCACGCCCGGGCTTTGCCCGGGCG - 3' (SEQ ID No. 24). The mutant ITR includes a deletion of the D region containing the terminal cleavage sequence. Consequently, upon replication of the AAV viral genome, the rep protein will be unable to cleave the viral genome at the mutant ITR, and thus, a recombinant viral genome containing the following in the order of 5' to 3' will be packaged in the viral capsid: an AAV ITR, a first heterogeneous polynucleotide sequence containing the regulatory sequence, a mutant AAV ITR, a second heterogeneous polynucleotide reversed to the first heterogeneous polynucleotide, and a third AAV ITR.

[0092] In some embodiments, the vector is capsidized within the viral particle. In some embodiments, the viral particle is a recombinant AAV viral particle containing a recombinant AAV vector. Different AAV serotypes are used to optimize the transduction of specific target cells or to target specific cell types within specific target tissues (e.g., brain or spinal cord). The rAAV particle may contain viral proteins and viral nucleic acids of the same serotype or a mixed serotype. For example, in some embodiments, the rAAV particle may contain a SAN006 capsid protein and at least one AAV2 ITR, or may contain a SAN006 capsid protein and at least one AAV1 ITR. Any combination of AAV serotypes for the production of the rAAV particle is provided herein as each combination is expressly mentioned herein.

[0093] The capsid encapsulating the vector encoding the GBA1 transgene is a modified AAV9 vector. The AAV9 capsid is known to contain three capsid proteins: VP1 (SEQN 13), VP2 (SEQN 14), and VP3 (SEQN 15). These proteins contain a significant amount of overlapping amino acid sequences and a distinct N-terminal sequence. The AAV9 capsid contains 60 subunits arranged by icosahedral symmetry. AAV9 contains VP1, VP2, and VP3 capsid proteins in a ratio of approximately 5:5:50. The VP proteins of AAV9 are cap The products of the genomic structure protein-coding open reading frame, denoted as VP1 (∼82 kDa) and VP2 (∼73 kDa), and the major capsid protein VP3 (∼61 kDa). Due to the use of alternative splicing and leak scanning, when expressed, individual VPs share a C-terminus encompassing the entire VP3, while VP1 and VP2 are N-terminal extensions of VP3. VP1 and VP2 share a region of approximately 73 amino acids extended from VP1 by an additional 137 amino acids, denoted as the VP1 intrinsic region (VP1u). See [Penzes et al., (2021), Journal of Virology 95(19)e0084321].

[0094] In certain embodiments, the targeting peptide of the modified AAV9 capsid is inserted after residue 588 of the AAV9 structural protein (numbering is based on the VP1 numbering of AAV9). In some embodiments, the targeting peptide has SEQ ID NO. 16. In some embodiments, the targeting peptide is adjacent to a linker sequence on the N-terminal and C-terminal ends of the targeting peptide. In some embodiments, the linker sequence on the N-terminal side has the sequence AAA. In some embodiments, the linker sequence on the C-terminal side is AS. In some embodiments, the entire sequence inserted after residue 588 of the AAV9 capsid structural protein has SEQ ID NO. 17. In some embodiments, the entire modified AAV9 capsid structural protein has SEQ ID NO. 18. In some embodiments, the entire modified AAV9 capsid structural protein is at least 90% identical to SEQ ID NO. 18 (e.g., at least 92%, at least 95%, at least 98%, at least 98.5%, at least 99%, at least 99.2%, at least 99.5%, or at least 99.8%), wherein the modified AAV9 structural capsid comprises the targeting peptide of SEQ ID NO. 16. The capsid having SEQ ID NO. 18 will also be referred to herein as SAN006. Capsid SAN006 is described in U.S. Patent Application Publication No. US 2023 / 0346981, the entirety of which is incorporated herein by reference.

[0095] In some embodiments, the rAAV vector particle may comprise pAAV-CBA-GBA-WPRE-bGH. In some embodiments, the rAAV vector particle may comprise SAN006-CBA-GBA-WPRE-bGH. In some embodiments, SAN006-CBA-GBA-WPRE-bGH may comprise an ITR-ITR sequence. In some embodiments, the ITR-ITR sequence may comprise an annotation. In some embodiments, the ITR-ITR sequence annotation may comprise bp 1:4473, and the residual plasmid sequence 4476:10864 comprises a stuffer sequence for plasmid amplification and a bacterial element having ampicillin resistance to selection.

[0096] In some embodiments, a plasmid for rAAV packaging (e.g., pAAV-CBA-GBA-WPRE-bGH) is Fig. 10 It may include a number of elements as described in [the example]. In some embodiments, pAAV-CBA-GBA-WPRE-bGH may include SEQ ID NO. 19.

[0097] In some embodiments, SAN006-CBA-GBA-WPRE-bGH may contain a flip-oriented WT AAV2 5' ITR element (NCBI reference sequence: NC_001401.2) at base 1:145. In some embodiments, at base 173:553, CBA-GBA-WPRE-bGH may contain a CMV enhancer element (Genbank: K03104.1) (https: / / www.ncbi.nlm.nih.gov / nucleotide / K03104.1?report=genbank&log$=nuclalign&blast_rank=1&RID=G8XBFMKV114). In some embodiments, at base 554:873, pAAV-CBA-GBA-WPRE-bGH may contain a chicken β-actin promoter (NCBI reference sequence: NC_052545.1). In some embodiments, at bases 874:924, SAN006-CBA-GBA-WPRE-bGH may contain exon 1 chicken β-actin (NCBI reference sequence: NM_205518.1). In some embodiments, at bases 925:1799, pAAV-CBA-GBA-WPRE-bGH may contain intron 1 chicken β-actin (NCBI reference sequence: NC_052545.1). In some embodiments, at bases 1808:1848, pAAV-CBA-GBA-WPRE-bGH may contain intron 2 rabbit beta-globin (Genbank: V00882.1). In some embodiments, at base 1849:1902, pAAV-CBA-GBA-WPRE-bGH may contain exon 3 rabbit beta-globin (Genbank: V00882.1). In some embodiments, at base 1909:3519, pAAV-CBA-GBA-WPRE-bGH may contain lysosomal acid glucosylceramidase isoform 1 precursor [Homo sapiens] (NCBI reference sequence: NP_000148.2), codon optimization (GeneArt gene synthesis).In some embodiments, at base 3522:4115, pAAV-CBA-GBA-WPRE-bGH may include a Woodchuck hepatitis virus post-transcriptional regulatory element (e.g., WPRE) (NCBI reference sequence: NC_004107.1). In some embodiments, at base 4119:4321, pAAV-CBA-GBA-WPRE-bGH may include a polyA signal sequence; a bovine growth hormone gene polyadenylation sequence (Genbank: M57764.1). In some embodiments, at base 4329:4473, pAAV-CBA-GBA-WPRE-bGH may include a flip-oriented WT AAV2 3' ITR element (NCBI reference sequence: NC_001401.2).

[0098] In some embodiments, the rAAV vector particle may include pAAV-CBA-SS1-GBA-WPRE-bGH. In some embodiments, the rAAV vector particle may include pAAV-CBA-GBA-WPRE-bGH. In some embodiments, the rAAV vector particle may include pAAV-CBA-GBA-WPRE-bGH.

[0099] In some embodiments, a plasmid for rAAV packaging (e.g., pAAV-CBA-SS1-GBA-WPRE-bGH) is Fig. 11 It may include a number of elements as described in [the example]. In some embodiments, pAAV-CBA-SS1-GBA-WPRE-bGH may include SEQ ID NO. 20.

[0100] In some embodiments, at base 1:145, pAAV-CBA-SS1-GBA-WPRE-bGH may contain a flip-oriented WT AAV2 5' ITR element (NCBI reference sequence: NC_001401.2). In some embodiments, at base 173:553, pAAV-CBA-SS1-GBA-WPRE-bGH may contain a CMV enhancer element (Genbank: K03104.1) (https: / / www.ncbi.nlm.nih.gov / nucleotide / K03104.1?report=genbank&log$=nuclalign&blast_rank=1&RID=G8XBFMKV114). In some embodiments, at base 554:873, pAAV-CBA-SS1-GBA-WPRE-bGH may contain a chicken β-actin promoter (NCBI reference sequence: NC_052545.1). In some embodiments, at base 874:924, pAAV-CBA-SS1-GBA-WPRE-bGH may contain exon 1 chicken β-actin (NCBI reference sequence: NM_205518.1). In some embodiments, at base 925:1799, pAAV-CBA-SS1-GBA-WPRE-bGH may contain intron 1 chicken β-actin (NCBI reference sequence: NC_052545.1). In some embodiments, at base 1808:1848, pAAV-CBA-SS1-GBA-WPRE-bGH may contain intron 2 rabbit beta-globin (Genbank: V00882.1). In some embodiments, at base 1849:1902, pAAV-CBA-SS1-GBA-WPRE-bGH may contain exon 3 rabbit beta-globin (Genbank: V00882.1). In some embodiments, at base 1909:3456, pAAV-CBA-SS1-GBA-WPRE-bGH may contain lysosomal acid glucosylceramidase isoform 1 precursor [Homo sapiens] (NCBI reference sequence: NP_000148.2), which is an endogenous signaling sequence replaced by SS1, and codon optimization (GeneArt gene synthesis).In some embodiments, at bases 3459:4052, pAAV-CBA-SS1-GBA-WPRE-bGH may include a Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (NCBI reference sequence: NC_004107.1). In some embodiments, at bases 4056:4258, pAAV-CBA-SS1-GBA-WPRE-bGH may include a polyA signal sequence; a bovine growth hormone gene polyadenylation sequence (Genbank: M57764.1). In some embodiments, at bases 4266:4410, pAAV-CBA-SS1-GBA-WPRE-bGH may include a flip-oriented WT AAV2 3' ITR element (NCBI reference sequence: NC_001401.2).

[0101] In some embodiments, the rAAV vector particle may include pAAV-CBA-SS2-GBA-WPRE-bGH. In some embodiments, the rAAV vector particle may include SAN006-CBA-SS2-GBA1-WPRE. In some embodiments, the rAAV vector particle may include SAN006-CBA-SS2-GBA-WPRE. In some embodiments, pAAV-CBA-SS2-GBA-WPRE-bGH may include ITR-ITR. In some embodiments, the ITR-ITR sequence may include a sequence annotation including bp 1:4413, and the residual plasmid sequence 4416:10804 includes a stuffer sequence for plasmid amplification and a bacterial element having ampicillin resistance to selection.

[0102] In some embodiments, a plasmid for rAAV packaging (e.g., pAAV-CBA-SS2-GBA-WPRE-bGH) is Fig. 12 It may include a number of elements as described in [the example]. In some embodiments, pAAV-CBA-SS2-GBA-WPRE-bGH may include SEQ ID NO. 21.

[0103] In some embodiments, at base 1:145, pAAV-CBA-SS2-GBA-WPRE-bGH may contain a flip-oriented WT AAV2 5' ITR element (NCBI reference sequence: NC_001401.2); (2) at base 173:553: a CMV enhancer element (GenBank: K03104.1) (https: / / www.ncbi.nlm.nih.gov / nucleotide / K03104.1?report=genbank&log$=nuclalign&blast_rank=1&RID=G8XBFMKV114). In some embodiments, at base 554:873, pAAV-CBA-SS2-GBA-WPRE-bGH may contain a chicken β-actin promoter (NCBI reference sequence: NC_052545.1). In some embodiments, at bases 874:924, pAAV-CBA-SS2-GBA-WPRE-bGH may contain exon 1 chicken β-actin (NCBI reference sequence: NM_205518.1). In some embodiments, at bases 925:1799, pAAV-CBA-SS2-GBA-WPRE-bGH may contain intron 1 chicken β-actin (NCBI reference sequence: NC_052545.1). In some embodiments, at bases 1808:1848, pAAV-CBA-SS2-GBA-WPRE-bGH may contain intron 2 rabbit beta-globin (Genbank: V00882.1). In some embodiments, at base 1849:1902, pAAV-CBA-SS2-GBA-WPRE-bGH may contain exon 3 rabbit beta-globin (Genbank: V00882.1). In some embodiments, at base 1909:3459, pAAV-CBA-SS2-GBA-WPRE-bGH may contain lysosomal acid glucosylceramidase isoform 1 precursor [Homo sapiens] (NCBI reference sequence: NP_000148.2), which is an endogenous signaling sequence replaced by SS2, and codon optimization (GeneArt gene synthesis).In some embodiments, at base 3462:4055, pAAV-CBA-SS2-GBA-WPRE-bGH may include a Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (NCBI reference sequence: NC_004107.1). In some embodiments, at base 4059:4261, pAAV-CBA-SS2-GBA-WPRE-bGH may include a polyA signal sequence; a bovine growth hormone gene polyadenylation sequence (Genbank: M57764.1). In some embodiments, at base 4269:4413, pAAV-CBA-SS2-GBA-WPRE-bGH may include a flip-oriented WT AAV2 3' ITR element (NCBI reference sequence: NC_001401.2).

[0104] In some embodiments, the rAAV vector particle may include pAAV-CBA-SS3-GBA-WPRE-bGH. In some embodiments, the rAAV vector particle may include SAN006-CBA-SS3-GBA1-WPRE. In some embodiments, the rAAV vector particle may include SAN006-CBA-SS3-GBA-WPRE.

[0105] In some embodiments, pAAV-CBA-SS3-GBA-WPRE-bGH may include an ITR-ITR sequence. In some embodiments, pAAV-CBA-SS3-GBA-WPRE-bGH may include an ITR-ITR sequence and may include a sequence annotation including bp 1:4407, and the residual plasmid sequence 4410:10798 includes a stuffer sequence for plasmid proliferation and a bacterial element having ampicillin resistance to selection.

[0106] In some embodiments, a plasmid for rAAV packaging (e.g., pAAV-CBA-SS3-GBA-WPRE-bGH) is Fig. 13It may include a number of elements as described in [the example]. In some embodiments, pAAV-CBA-SS3-GBA-WPRE-bGH may include SEQ ID NO. 22.

[0107] In some embodiments, at base 1:145, pAAV-CBA-SS3-GBA-WPRE-bGH may contain a flip-oriented WT AAV2 5' ITR element (NCBI reference sequence: NC_001401.2). In some embodiments, at base 173:553, pAAV-CBA-SS3-GBA-WPRE-bGH may contain a CMV enhancer element (Genbank: K03104.1) (https: / / www.ncbi.nlm.nih.gov / nucleotide / K03104.1?report=genbank&log$=nuclalign&blast_rank=1&RID=G8XBFMKV114). In some embodiments, at base 554:873, a chicken β-actin promoter (NCBI reference sequence: NC_052545.1) may be included. In some embodiments, at bases 874:924, pAAV-CBA-SS3-GBA-WPRE-bGH may contain exon 1 chicken β-actin (NCBI reference sequence: NM_205518.1). In some embodiments, at bases 925:1799, pAAV-CBA-SS3-GBA-WPRE-bGH may contain intron 1 chicken β-actin (NCBI reference sequence: NC_052545.1). In some embodiments, at bases 1808:1848, pAAV-CBA-SS3-GBA-WPRE-bGH may contain intron 2 rabbit beta-globin (Genbank: V00882.1). In some embodiments, at base 1849:1902, pAAV-CBA-SS3-GBA-WPRE-bGH may contain exon 3 rabbit beta-globin (Genbank: V00882.1). In some embodiments, at base 1909:3453, pAAV-CBA-SS3-GBA-WPRE-bGH may contain lysosomal acid glucosylceramidase isoform 1 precursor [Homo sapiens] (NCBI reference sequence: NP_000148.2), which is an endogenous signaling sequence replaced by SS3, and codon optimization (GeneArt gene synthesis).In some embodiments, at base 3456:4049, pAAV-CBA-SS3-GBA-WPRE-bGH may include WPRE; a Woodchuck hepatitis virus post-transcriptional regulatory element (NCBI reference sequence: NC_004107.1). In some embodiments, at base 4053:4255, pAAV-CBA-SS3-GBA-WPRE-bGH may include a polyA signal sequence; a bovine growth hormone gene polyadenylation sequence (Genbank: M57764.1). In some embodiments, at base 4263:4407, pAAV-CBA-SS3-GBA-WPRE-bGH may include a flip-oriented WT AAV2 3' ITR element (NCBI reference sequence: NC_001401.2).

[0108] In some embodiments, the rAAV vector particle may include pAAV-CBA-SS4-GBA-WPRE-bGH. In some embodiments, the rAAV vector particle may include SAN006-CBA-SS4-GBA1-WPRE. In some embodiments, the rAAV vector particle may include SAN006-CBA-SS4-GBA-WPRE. In some embodiments, pAAV-CBA-SS4-GBA-WPRE-bGH. In some embodiments, the rAAV vector particle may include SAN006-CBA-SS4-GBA1-WPRE and may include an ITR-ITR sequence. In some embodiments, the rAAV vector particle may include SAN006-CBA-SS4-GBA1-WPRE and may include an ITR-ITR sequence, and the ITR-ITR sequence may include an ITR-ITR sequence annotation including bp 1:4410 and / or a remaining plasmid sequence 4413:10801 including a stuffer sequence for plasmid amplification and a bacterial element, and has ampicillin resistance to selection.

[0109] In some embodiments, a plasmid for rAAV packaging (e.g., pAAV-CBA-SS4-GBA-WPRE-bGH) is Fig. 14It may include a number of elements as described in [the example]. In some embodiments, pAAV-CBA-SS4-GBA-WPRE-bGH may include SEQ ID NO. 23.

[0110] In some embodiments, at base 1:145, pAAV-CBA-SS4-GBA-WPRE-bGH may contain a flip-oriented WT AAV2 5' ITR element (NCBI reference sequence: NC_001401.2). In some embodiments, at base 173:553, pAAV-CBA-SS4-GBA-WPRE-bGH may contain a CMV enhancer element (Genbank: K03104.1) (https: / / www.ncbi.nlm.nih.gov / nucleotide / K03104.1?report=genbank&log$=nuclalign&blast_rank=1&RID=G8XBFMKV114). In some embodiments, at base 554:873, pAAV-CBA-SS4-GBA-WPRE-bGH may contain a chicken β-actin promoter (NCBI reference sequence: NC_052545.1). In some embodiments, at base 874:924, pAAV-CBA-SS4-GBA-WPRE-bGH may contain exon 1 chicken β-actin (NCBI reference sequence: NM_205518.1). In some embodiments, at base 925:1799, pAAV-CBA-SS4-GBA-WPRE-bGH may contain intron 1 chicken β-actin (NCBI reference sequence: NC_052545.1). In some embodiments, at base 1808:1848, pAAV-CBA-SS4-GBA-WPRE-bGH may contain intron 2 rabbit beta-globin (Genbank: V00882.1). In some embodiments, at base 1849:1902, pAAV-CBA-SS4-GBA-WPRE-bGH may contain exon 3 rabbit beta-globin (Genbank: V00882.1). In some embodiments, at base 1909:3456, pAAV-CBA-SS4-GBA-WPRE-bGH may contain lysosomal acid glucosylceramidase isoform 1 precursor [Homo sapiens] (NCBI reference sequence: NP_000148.2), which is an endogenous signaling sequence replaced by SS34, and codon optimization (GeneArt gene synthesis).In some embodiments, at bases 3459:4052, pAAV-CBA-SS4-GBA-WPRE-bGH may include a Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (NCBI reference sequence: NC_004107.1). In some embodiments, at bases 4056:4258, pAAV-CBA-SS4-GBA-WPRE-bGH may include a polyA signal sequence; a bovine growth hormone gene polyadenylation sequence (Genbank: M57764.1). In some embodiments, at bases 4266:4410, pAAV-CBA-SS4-GBA-WPRE-bGH may include a flip-oriented WT AAV2 3' ITR element (NCBI reference sequence: NC_001401.2).

[0111] Generation of AAV particles

[0112] Transfection, generation of stable cell lines, and adenovirus-AAV hybrid, herpesvirus-AAV hybrid (Conway, JE et al ., (1997) J. Virology 71(11):8780-8789), and baculovirus-AAV hybrid (Urabe, M. et al ., (2002) Human Gene Therapy 13(16):19351943; Kotin, R. (2011) Hum Mol Genet.20(R1): R2-R6).rAAV generating culture for rAAV virus particle generation requires all of the following: 1) suitable host cells, 2) suitable helper virus function, 3) AAV rep and cap genes and gene products, 4) nucleic acids (e.g., therapeutic nucleic acids) flanked by at least one AAV ITR sequence (e.g., an AAV genome encoding a GCase enzyme), and 5) a medium and medium components suitable for sustaining rAAV generation. In some embodiments, the suitable host cells are primate host cells. In some embodiments, the suitable host cells are human-derived cell lines, e.g., HeLa, A549, 293, or Perc.6 cells. In some embodiments, the suitable helper virus function is provided by wild-type or mutant adenoviruses (e.g., thermophilic adenovirus), herpesvirus (HSV), baculovirus, or plasmid constructs providing helper function. In some embodiments, the AAV rep and cap gene products may be derived from any AAV serotype. Although not absolute, AAV rep gene products generally have the same serotype as the ITR of the rAAV vector genome, insofar as the rep gene products can function as the replication and packaging function of the rAAV genome. Suitable media known in the art may be used for the generation of rAAV vectors. Such media include, without limitation, media produced by Hyclone Laboratories and JRH, including Modified Eagle Medium (MEM), Dulbecco's Modified Eagle Medium (DMEM), custom-made preparations such as those described in U.S. Patent 6,566,118, and Sf-900 II SFM medium such as those described in U.S. Patent 6,723,551 (each patent, in its entirety, is incorporated herein by reference with respect to custom-made medium preparations for use in the generation of recombinant AAV vectors).In some embodiments, the AAV helper function is provided by an adenovirus or HSV. In some embodiments, the AAV helper function is provided by a baculovirus, and the host cell is an insect cell (e.g.,). Spodoptera frugiperda It is a )(Sf9) cell.

[0113] One method for generating rAAV particles is the triple transfection method. Briefly, a plasmid containing the rep gene and the capsid gene, along with a helper adenovirus plasmid, can be transfected into a cell line (e.g., HEK-293 cells) (e.g., using the calcium phosphate method), and the virus can be collected and purified as needed. Thus, in some embodiments, rAAV particles are generated by triple transfecting a host cell with a nucleic acid encoding the rAAV vector, a nucleic acid encoding the AAV rep and cap, and a nucleic acid encoding the AAV helper virus function, and transfecting the host cell with the nucleic acid generates a host cell capable of producing rAAV particles.

[0114] In some embodiments, rAAV particles can be produced by a producer cell line method (reference [Martin et al ., (2013) Human Gene Therapy Methods 24:253-269; U.S. Pre-registration Publication US2004 / 0224411; and Liu, XL et al . (1999) Gene Ther[Refer to . 6:293-299]). Briefly, a cell line (e.g., HeLa, 293, A549, or Perc.6 cell line) can be stably transfected using a plasmid containing a vector genome containing a rep gene, a capsid gene, and a promoter-heterogeneous nucleic acid sequence (e.g., GCase enzyme). The cell line can be screened to select a lead clone for rAAV production, then expanded into a production bioreactor and infected with a helper virus (e.g., adenovirus or HSV) to initiate rAAV production. Subsequently, the virus can be collected, the adenovirus can be inactivated (e.g., inactivated by heat) and / or removed, and the rAAV particles can be purified. Thus, in some embodiments, rAAV particles were produced by a producer cell line containing one or more of the nucleic acid encoding the rAAV vector, the nucleic acid encoding the AAV rep and cap, and the nucleic acid encoding the AAV helper virus function. As described herein, the producer cell line method may be advantageous for generating rAAV particles with a large genome compared to the triple transfection method.

[0115] In some embodiments, the nucleic acid encoding the AAV rep and cap genes and / or the rAAV genome is stably maintained in a producer cell line. In some embodiments, the nucleic acid encoding the AAV rep and cap genes and / or the rAAV genome is introduced into a cell line on one or more plasmids to produce a producer cell line. In some embodiments, the AAV rep, AAV cap, and rAAV genomes are introduced into cells on the same plasmid. In other embodiments, the AAV rep, AAV cap, and rAAV genomes are introduced into cells on different plasmids. In some embodiments, the cell line stably transfected using the plasmid maintains the plasmid for multiple passages of the cell line (e.g., 5, 10, 20, 30, 40, 50, or more than 50 passages). For example, the plasmid(s) may be replicated as the cell replicates, or the plasmid(s) may be incorporated into the cell genome. Various sequences that enable plasmids to replicate independently in cells (e.g., human cells) have been identified (e.g., literature [Krysan, PJ et al . (1989) Mol. Cell Biol.[See 9:1026-1033]). In some embodiments, the plasmid(s) may include a selection marker (e.g., an antibiotic resistance marker) that enables the selection of cells holding the plasmid. Selection markers commonly used in mammalian cells include, without limitation, blasticidin, G418, hygromycin B, zeocin, puromycin, and derivatives thereof. Methods for introducing nucleic acids into cells are known in the art and include, without limitation, viral transduction, cationic transfection (e.g., using cationic polymers such as DEAE-dextran, or cationic lipids such as lipofectamine), calcium phosphate transfection, microinjection, particle bombardment, electroporation, and nanoparticle transfection (for further details, see, for example, the literature [Kim, TK and Eberwine, JH (2010) Anal. Bioanal. Chem. [Refer to 397:3173-3178]).

[0116] In some embodiments, the nucleic acid encoding the AAV rep and cap genes and / or the rAAV genome is stably incorporated into the genome of a producer cell line. In some embodiments, the nucleic acid encoding the AAV rep and cap genes and / or the rAAV genome is introduced into a cell line on one or more plasmids to generate a producer cell line. In some embodiments, the AAV rep, AAV cap, and rAAV genomes are introduced into cells on the same plasmid. In other embodiments, the AAV rep, AAV cap, and rAAV genomes are introduced into cells on different plasmids. In some embodiments, the plasmid(s) may include a selection marker (e.g., an antibiotic resistance marker) that enables the selection of cells to host the plasmid. Methods for stably incorporating nucleic acids into various host cells are known in the art. For example, repetitive selection (e.g., through the use of a selection marker) may be used to select cells to which the nucleic acid containing the selection marker (and the AAV cap and rep genes and / or the rAAV genome) has been incorporated. In another embodiment, nucleic acids can be incorporated into a cell line in a site-specific manner to generate a producer cell line. Some site-specific recombination systems, such as FLP / FRT (e.g., O'Gorman, S. et al (1991) Science See 251:1351-1355), Cre / loxP( for example , literature [Sauer, B. and Henderson, N. (1988) Proc Natl Acad Sci [See 85:5166-5170]), and phi C31-att( for example , literature[Groth, AC et al (2000) Proc Natl Acad Sci [Refer to 97:5995-6000] is announced in this field.

[0117] In some embodiments, the producer cell line is derived from a primate cell line (e.g., a non-human primate cell line such as the Vero or FRhL-2 cell line). In some embodiments, the cell line is derived from a human cell line. In some embodiments, the producer cell line is derived from HeLa, 293, A549, or PERC.6® (Crucell) cells. For example, before introducing the nucleic acid encoding the AAV rep and cap genes and / or the giant rAAV genome into the cell line to generate the producer cell line and / or stably maintaining / integrating it, the cell line is a HeLa, 293, A549, or PERC.6® (Crucell) cell line, or a derivative thereof.

[0118] In some embodiments, producer cell lines are suitable for growth in suspension. As is known in the art, adhesion-dependent cells generally cannot grow in suspension without a substrate such as microcarrier beads. Designing cell lines to grow in suspension may include, for example, growing the cell line in a rotary culture equipped with stirring paddles, using a culture medium free of calcium and magnesium ions (and optionally an antifoamer) to prevent aggregation, using a culture vessel coated with a siliconized compound, and selecting cells from the culture at each passage (rather than large clumps or sides of the vessel). For further explanation, refer, for example, to the ATCC FAQ document (available at www.atcc.org / Global / FAQs / 9 / 1 / Adapting%20a%20monolayer%20cell%20line%20to%20suspension-40.aspx) and the references cited therein.

[0119] In some embodiments, a method for generating any rAAV particle as disclosed herein is provided, comprising: (a) a rAAV pro-vector comprising (i) one or more AAV packaging genes (each said AAV packaging gene encoding an AAV replication and / or capsidization protein), (ii) a nucleic acid encoding a heterogeneous nucleic acid as described herein flanked by at least one AAV ITR, and (iii) a host cell having an AAV helper function, culturing the rAAV particle generated by the host cell under conditions in which the rAAV particle is generated; and (b) a step of recovering the rAAV particle generated by the host cell. In some embodiments, the at least one AAV ITR is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, goat AAV, bovine AAV, or mouse AAV serotype ITRs, etc. For example, in some embodiments, the AAV serotype is AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, or AAVrh10. In certain embodiments, the nucleic acid of the AAV comprises AAV2 ITR. In some embodiments, the capsidized protein is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV1999. It is selected from the group consisting of AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, goat AAV, AAV1 / AAV2 chimera, bovine AAV, mouse AAV capsid, rAAV2 / HBoV1 serotype, AAV-XL32, or AAV-XL32.1 capsid protein or mutants thereof.In some embodiments, the capsidized protein is an AAV8 capsid protein. In some embodiments, the rAAV particle comprises a recombinant genome comprising an AAV2 ITR and a nucleic acid encoding a therapeutic transplant gene / nucleic acid (e.g., an expression cassette for expressing a GCase enzyme) and an AAV9 capsid. In some embodiments, the rAAV particle comprises a recombinant genome comprising an AAV2 ITR and a nucleic acid encoding a therapeutic transplant gene / nucleic acid (e.g., an expression cassette for expressing a GCase enzyme) and a SAN006 capsid.

[0120] Suitable rAAV generating culture media of the present disclosure may be supplemented with serum or serum-derived recombinant protein at levels of 0.5% to 20% (v / v or w / v). Alternatively, as is known in the art, rAAV vectors may be generated under serum-free conditions, which may be referred to as media without animal-derived products. Those skilled in the art will understand that, to increase the titer of rAAV in the generated culture, one or more cell culture components known in the art, including glucose, vitamins, amino acids, and / or growth factors without limitation, may be supplemented to commercial or custom-made media designed to sustain the generation of rAAV vectors.

[0121] rAAV-generating cultures can be grown under various conditions (wide temperature ranges, various durations, etc.) suitable for the specific host cells used. As known in the art, rAAV-generating cultures include attachment-dependent cultures that can be cultured in suitable attachment-dependent vessels, e.g., rotary flasks, hollow fiber filters, microcarriers, and packed-bed or fluidized-bed bioreactors. rAAV-generating cultures may also include suspension-compatible host cells, e.g., HeLa, 293, and SF-9 cells, that can be cultured in various ways, including, e.g., rotary flasks, stirred-tank bioreactors, and disposable systems, e.g., Wave bag systems.

[0122] The rAAV vector particles of the present disclosure may be collected from the rAAV-producing culture by lysing the host cells of the producing culture or by collecting the medium consumed from the producing culture, provided that said cells must be cultured under conditions known in the art for releasing rAAV particles from intact cells into the medium, as more fully described in U.S. Patent No. 6,566,118. Additionally, suitable methods for lysing cells are known in the art and include, for example, a number of freeze / thaw cycles, sonication, microfluidization, and treatment with chemicals, such as detergents and / or proteases.

[0123] In additional embodiments, rAAV particles are purified. As used herein, the term “purification” comprises the production of rAAV particles free from at least some of other components that may be present at the place where the rAAV particles naturally occur or at the place where they were first produced. Accordingly, for example, isolated rAAV particles may be produced using purification techniques that concentrate particles from a source mixture, such as a culture lysate or a generated culture supernatant. Concentration may be measured in various ways, for example, by the ratio of DNase-resistant particles (DRP) or genome copies (gc) present in the solution, or by infectivity, or in relation to a second potential interfering substance present in the source mixture, such as a generated culture contaminant or a contaminant including a helper virus, a medium component, etc.

[0124] In some embodiments, the rAAV-generated culture harvest is clarified to remove host cell debris. In some embodiments, the generated culture harvest is purified by filtration through a series of deep filters, including, for example, a Grade DOHC Millipore Millistak+ HC Pod filter, a Grade A1HC Millipore Millistak+ HC Pod filter, and a 0.2 μm Filter Opticap XL1O Millipore Express SHC hydrophilic membrane filter. Purification may also be achieved by various other standard techniques known in the art, for example, centrifugation or filtration through any cellulose acetate filter with a pore size of 0.2 μm or larger known in the art.

[0125] In some embodiments, the rAAV-producing culture harvest is further treated with Benzonase® to degrade any high molecular weight DNA present in the producing culture. In some embodiments, Benzonase® degradation is performed under standard conditions known in the art, for example, at ambient temperatures to 37°C for a period of 30 minutes to several hours, using Benzonase® at a final concentration of 1 to 2.5 units / ml.

[0126] rAAV particles may be isolated or purified using one or more of the following purification steps: equilibrium centrifugation; flow-through anion exchange filtration; tangential flow filtration (TFF) for the concentration of rAAV particles; rAAV capture by apatite chromatography; thermal inactivation of helper viruses; rAAV capture by hydrophobic interaction chromatography; buffer exchange by size exclusion chromatography (SEC); nanofiltration; and rAAV capture by anion exchange chromatography, cation exchange chromatography, or affinity chromatography. These steps may be used alone, in various combinations, or in various orders. In some embodiments, the method comprises all steps in the order described below. A method for purifying rAAV particles is, for example, described in the literature [Xiao et al It is described in [., (1998) Journal of Virology 72:2224-2232; U.S. Patents 6,989,264 and 8,137,948; and WO 2010 / 148143].

[0127] Treatment methods

[0128] A specific aspect of the present disclosure relates to a method for treating GD and / or GBA-PD and / or increasing GCase enzyme levels in individuals requiring treatment for GD and / or GBA-PD and / or increasing GCase enzyme levels. In some embodiments, the present disclosure provides a method for treating GD and / or GBA-PD by administering an effective amount of an expression cassette for expressing the GBA1 polypeptide of the present disclosure (e.g., an expression cassette delivered via rAAV particles). In some embodiments, the GBA1 polypeptide is a wild-type GBA1 polypeptide. The expression cassette for expressing the GCase enzyme (e.g., an expression cassette delivered via rAAV particles) may be administered via various routes. In some embodiments, administration includes direct spinal injection and / or intracerebral administration. In some embodiments, administration is performed at a site selected from the cerebrum, medulla oblongata, pons, cerebellum, intracranial cavity, peribular meninges, dura mater, arachnoid mater, pia mater, cerebrospinal fluid (CSF) in the peribular subarachnoid space, deep cerebellar nuclei of the cerebellum, ventricular system of the cerebrum, subarachnoid space, striatum, cortex, septum, thalamus, hypothalamus, and parenchyma of the brain. In some embodiments, administration includes an intraventricular injection into at least one lateral ventricle of the brain. In some embodiments, administration includes an intrathecal injection in the cervical, thoracic, and / or lumbar regions. In some embodiments, administration includes an intrastriatal injection. In some embodiments, administration includes an intrathalamic injection. In some embodiments, administration includes parenteral administration, e.g., intravenous administration, subcutaneous administration, or intramuscular administration.

[0129] An effective amount of rAAV (in particle form in some embodiments) is administered according to the therapeutic purpose. For example, if a low percentage of transduction can achieve the desired therapeutic effect, the therapeutic purpose is generally to satisfy or exceed this level of transduction. In some cases, this level of transduction may be achieved by transducing only about 1 to 5 percent of target cells of the desired tissue type, in some embodiments more than about 20 percent of cells of the desired tissue type, in some embodiments more than about 50 percent, in some embodiments more than about 80 percent, in some embodiments more than about 95 percent, and in some embodiments more than about 99 percent of cells of the desired tissue type. The rAAV composition may be administered by one or more doses during the same procedure, or at intervals of days, weeks, months, or years. One or more of any of the administration routes described herein may be used. In some embodiments, multiple vectors may be used to treat humans.

[0130] In some embodiments of the above aspects, rAAV is administered via direct injection into the spinal cord, via intravertebral injection, or via intrasacral injection. In some embodiments, rAAV is administered to more than one location in the spinal cord or the logarithmic cistern. In some embodiments, rAAV is administered to more than one location in the spinal cord. In some embodiments, rAAV is administered to one or more of the lumbar subarachnoid space, thoracic subarachnoid space, and cervical subarachnoid space of the spinal cord. In some embodiments, rAAV is administered to the logarithmic cistern.

[0131] Methods for identifying cells transduced by AAV virus particles are known in the art. For example, markers such as immunohistochemistry or enhanced green fluorescent protein may be used to detect transduction by virus particles (e.g., virus particles containing an rAAV capsid having one or more amino acid substitutions).

[0132] In some embodiments, an effective amount of rAAV particles is administered to two or more sites simultaneously or sequentially. In other embodiments, an effective amount of rAAV particles is administered to a single site two or more times (e.g., repeatedly). In some embodiments, the interval between multiple injections of rAAV virus particles is 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 9 hours, 12 hours, or 24 hours or less.

[0133] In some embodiments, the present disclosure provides a method for treating a human with GD and / or GBA-PD by administering an effective amount of a pharmaceutical composition comprising a recombinant viral vector encoding the GCase enzyme of the present disclosure. In some embodiments, the pharmaceutical composition comprises one or more pharmaceutically acceptable excipients.

[0134] In some embodiments, the method comprises the step of administering an effective amount of a pharmaceutical composition comprising a recombinant viral vector encoding the GCase enzyme of the present disclosure to an individual in need of the treatment for GD and / or GBA-PD. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5 × 10 12 Pieces, 6 × 10 12 Pieces, 7 × 10 12 Pieces, 8 × 10 12 Pieces, 9 × 10 12 Pieces, 10 × 10 12 Pieces, 11 × 10 12 Pieces, 15 × 10 12 Pieces, 20 × 10 12 Pieces, 25 × 10 12 Pieces, 30 × 10 12 Pieces, or 50 × 10 12 It is any of the genome copies / mL. In some embodiments, the viral titer of a viral particle (e.g., rAAV particle) is about 5 × 10 12 Pieces up to 6 × 10 12 Pieces, 6 × 1012 Pieces up to 7 × 10 12 Pieces, 7 × 10 12 Pieces up to 8 × 10 12 Pieces, 8 × 10 12 Pieces up to 9 × 10 12 Pieces, 9 × 10 12 Pieces up to 10 × 10 12 Pieces, 10 × 10 12 Pieces up to 11 × 10 12 Pieces, 11 × 10 12 Pieces up to 15 × 10 12 Pieces, 15 × 10 12 Pieces up to 20 × 10 12 Pieces, 20 × 10 12 Pieces up to 25 × 10 12 Pieces, 25 × 10 12 Pieces up to 30 × 10 12 Pieces, 30 × 10 12 Pieces up to 50 × 10 12 Pieces, or 50 × 10 12 Pieces up to 100 × 10 12 It is any of the genome copies / mL. In some embodiments, the viral titer of a viral particle (e.g., rAAV particle) is about 5 × 10 12 Pieces up to 10 × 10 12 Pieces, 10 × 10 12 Pieces up to 25 × 10 12 Pieces, or 25 × 10 12 Pieces up to 50 × 10 12 It is any of the genome copies / mL. In some embodiments, the viral titer of the viral particle (e.g., rAAV particle) is at least about 5 × 10 9 Pieces, 6 × 10 9 Pieces, 7 × 10 9 Pieces, 8 × 10 9 Pieces, 9 × 10 9 Pieces, 10 × 10 9 Pieces, 11 × 10 9 Pieces, 15 × 10 9 Pieces, 20 × 10 9Pieces, 25 × 10 9 Pieces, 30 × 10 9 Pieces, or 50 × 10 9 It is any of the transduction units / mL. In some embodiments, the viral titer of a virus particle (e.g., rAAV particle) is about 5 × 10 9 Pieces up to 6 × 10 9 Pieces, 6 × 10 9 Pieces up to 7 × 10 9 Pieces, 7 × 10 9 Pieces up to 8 × 10 9 Pieces, 8 × 10 9 Pieces up to 9 × 10 9 Pieces, 9 × 10 9 Pieces up to 10 × 10 9 Pieces, 10 × 10 9 Pieces up to 11 × 10 9 Pieces, 11 × 10 9 Pieces up to 15 × 10 9 Pieces, 15 × 10 9 Pieces up to 20 × 10 9 Pieces, 20 × 10 9 Pieces up to 25 × 10 9 Pieces, 25 × 10 9 Pieces up to 30 × 10 9 Pieces, 30 × 10 9 Pieces up to 50 × 10 9 Pieces, or 50 × 10 9 Pieces up to 100 × 10 9 It is any of the transduction units / mL. In some embodiments, the viral titer of a virus particle (e.g., rAAV particle) is about 5 × 10 9 Pieces up to 10 × 10 9 Pieces, 10 × 10 9 Pieces up to 15 × 10 9 Pieces, 15 × 10 9 Pieces up to 25 × 10 9 Pieces, or 25 × 10 9 Pieces up to 50 × 10 9It is any of the transduction units / mL. In some embodiments, the viral titer of the viral particle (e.g., rAAV particle) is at least about 5 × 10 10 Pieces, 6 × 10 10 Pieces, 7 × 10 10 Pieces, 8 × 10 10 Pieces, 9 × 10 10 Pieces, 10 × 10 10 Pieces, 11 × 10 10 Pieces, 15 × 10 10 Pieces, 20 × 10 10 Pieces, 25 × 10 10 Pieces, 30 × 10 10 Pieces, 40 × 10 10 Pieces, or 50 × 10 10 It is any of the infectious units / mL. In some embodiments, the viral titer of the viral particle (e.g., rAAV particle) is at least about 5 × 10 10 Pieces up to 6 × 10 10 Pieces, 6 × 10 10 Pieces up to 7 × 10 10 Pieces, 7 × 10 10 Pieces up to 8 × 10 10 Pieces, 8 × 10 10 Pieces up to 9 × 10 10 Pieces, 9 × 10 10 Pieces up to 10 × 10 10 Pieces, 10 × 10 10 Pieces up to 11 × 10 10 Pieces, 11 × 10 10 Pieces up to 15 × 10 10 Pieces, 15 × 10 10 Pieces up to 20 × 10 10 Pieces, 20 × 10 10 Pieces up to 25 × 10 10 Pieces, 25 × 10 10 Pieces up to 30 × 10 10 Pieces, 30 × 10 10 Pieces up to 40 × 10 10 Pieces, 40 × 10 10 Pieces up to 50 × 1010 Pieces, or 50 × 10 10 Pieces up to 100 × 10 10 It is any of the infectious units / mL. In some embodiments, the viral titer of the viral particle (e.g., rAAV particle) is at least about 5 × 10 10 Pieces up to 10 × 10 10 Pieces, 10 × 10 10 Pieces up to 15 × 10 10 Pieces, 15 × 10 10 Pieces up to 25 × 10 10 Pieces, or 25 × 10 10 Pieces up to 50 × 10 10 It is any of the number of infection units / mL. In some embodiments, the virus particle is an rAAV particle. In some embodiments, the rAAV particle contains a SAN006 capsid protein.

[0135] In some embodiments, the viral titer of the virus particle (e.g., rAAV particle) is at least about 5 × 10 12 Pieces, 6 × 10 12 Pieces, 7 × 10 12 Pieces, 8 × 10 12 Pieces, 9 × 10 12 Pieces, 10 × 10 12 Pieces, 11 × 10 12 Pieces, 15 × 10 12 Pieces, 20 × 10 12 Pieces, 25 × 10 12 Pieces, 30 × 10 12 Pieces, 50 × 10 12 Pieces, 80 × 10 12 Pieces, 90 × 10 12 Pieces, 100 × 10 12 Pieces, 110 × 10 12 Pieces, 120 × 10 12 Piece, 130 × 10 12 Piece, 140 × 10 12 Piece, 150 × 10 12 Piece, 175 × 10 12 Pieces, 200 × 1012 Pieces, 300 × 10 12 Pieces, 400 × 10 12 Pieces, 500 × 10 12 Pieces, 600 × 10 12 Piece, 700 × 10 12 Pieces, 800 × 10 12 Piece, 900 × 10 12 Pieces, or at least 100 × 10 12 It is any of the genome copies / mL. In some embodiments, the viral titer of a viral particle (e.g., rAAV particle) is at least about 100 × 10⁶ 12 Pieces, 200 × 10 12 Pieces, 300 × 10 12 Pieces, or 400 × 10 12 It is any of the genome copies / mL. In some embodiments, the viral particle is an rAAV particle. In some embodiments, the rAAV particle contains the SAN006 capsid protein.

[0136] In some embodiments, the dose of virus particles administered to an individual is at least about 1 × 10 per kg of body weight. 8 Pieces to about 6 × 10 13 It is a genome copy of a dog. In some embodiments, the dose of virus particles administered to an individual is approximately 1 × 10⁶ per kg of body weight. 8 Pieces to about 6 × 10 13 It is a genome copy. In some embodiments, the dose of virus particles administered to an individual is approximately 1 × 10⁶ 10 Pieces, 2 × 10 10 Pieces, 3 × 10 10 Pieces, 4 × 10 10 Pieces, 5 × 10 10 Pieces, 6 × 10 10 Pieces, 7 × 10 10 Pieces, 8 × 10 10 Pieces, 9 × 10 10 Pieces, 1 × 10 11 Pieces, 2 × 10 11 Pieces, 3 × 10 11Pieces, 4 × 10 11 Pieces, 5 × 10 11 Pieces, 6 × 10 11 Pieces, 7 × 10 11 Pieces, 8 × 10 11 Pieces, 9 × 10 11 Pieces, 1 × 10 12 Pieces, 2 × 10 12 Pieces, 13×10 12 Pieces, 4 × 10 12 Pieces, 5 × 10 12 Pieces, 6 × 10 12 Pieces, 7 × 10 12 Pieces, 8 × 10 12 Pieces, 9 × 10 12 Pieces, or 1 × 10⁻⁶ 13 It is a random number between a dog's genome copy / body weight in kg.

[0137] In some embodiments, the total amount of virus particles administered to an individual is at least about 1 × 10⁻⁶ 9 Pieces to about 1 × 10 14 It is a genome copy of a dog. In some embodiments, the total amount of virus particles administered to an individual is approximately 1 × 10⁶ 9 Pieces to about 1 × 10 14 It is a genome copy of a dog. In some embodiments, the total amount of virus particles administered to an individual is 1 × 10⁶ 11 Pieces, 2 × 10 11 Pieces, 3 × 10 11 Pieces, 4 × 10 11 Pieces, 5 × 10 11 Pieces, 6 × 10 11 Pieces, 7 × 10 11 Pieces, 8 × 10 11 Pieces, 9 × 10 11 Pieces, 1 × 10 12 Pieces, 2 × 10 12 Pieces, 3 × 10 12 Pieces, 4 × 10 12 Pieces, 5 × 10 12 Pieces, 6 × 10 12 Pieces, 7 × 10 12 Pieces, 8 × 10 12Pieces, 9 × 10 12 Pieces, 1 × 10 13 Pieces, 2 × 10 13 Pieces, 13×10 13 Pieces, 4 × 10 13 Pieces, 5 × 10 13 Pieces, 6 × 10 13 Pieces, 7 × 10 13 Pieces, 8 × 10 13 Pieces, 9 × 10 13 Pieces, or 1 × 10⁻⁶ 14 It is a random copy of the genome of a dog.

[0138] The composition of the present disclosure (e.g., a recombinant viral particle comprising a vector encoding the GCase enzyme of the present disclosure) may be used alone or in combination with one or more additional therapeutic agents for the treatment of GD and / or GBA-PD. The interval of sequential administration may be in units of minutes, hours, or days or more (or alternatively, less than).

[0139] An effective amount of rAAV (in particulate form in some embodiments) is administered according to the therapeutic purpose. For example, if a low percentage of transduction can achieve the desired therapeutic effect, the therapeutic purpose is generally to satisfy or exceed this level of transduction. In some cases, this level of transduction may be achieved by transducing only about 1 to 5 percent of the target cells, more than about 20 percent of the cells of the desired tissue type in some embodiments, more than about 50 percent in some embodiments, more than about 80 percent in some embodiments, more than about 95 percent in some embodiments, and more than about 99 percent of the cells of the desired tissue type in some embodiments. The rAAV composition may be administered by one or more doses during the same procedure, or at intervals of days, weeks, months, or years. In some embodiments, multiple vectors may be used to treat mammals (e.g., humans).

[0140] In some embodiments, the rAAV composition of the present disclosure may be used for administration to humans. In some embodiments, the rAAV composition of the present disclosure may be used for administration to children. In some embodiments, an effective amount of rAAV (in some embodiments, in particulate form) is administered to a patient less than 1 month, less than 2 months, less than 3 months, less than 4 months, less than 5 months, less than 6 months, less than 7 months, less than 8 months, less than 9 months, less than 10 months, less than 11 months, less than 1 year, less than 13 months, less than 14 months, less than 15 months, less than 16 months, less than 17 months, less than 18 months, less than 19 months, less than 20 months, less than 21 months, less than 22 months, less than 2 years, less than 3 years, less than 5 years, or less than 7 years.

[0141] In some embodiments, the rAAV composition of the present disclosure may be used for administration to adolescents. In some embodiments, an effective amount of rAAV (in some embodiments, in particulate form) is administered to patients under the age of 12, under 13, under 14, under 15, under 16, under 17, under 18, under 19, under 20, under 21, under 22, under 23, under 24, or under 25.

[0142] In some embodiments, rAAV virus particles are used to treat GD type 3 or GD type 2. In some embodiments, rAAV virus particles may be administered into the cerebrospinal fluid (CSF) of a GD type 3 or GD type 2 patient. In some embodiments, the virus particles are administered directly by administration into the CSF of a GD type 3 or GD type 2 patient. In some embodiments of the above embodiments, rAAV is administered via direct injection into the spinal cord of a GD type 3 or GD type 2 patient, via intrathecal injection, or via intrasacral injection. In some embodiments, rAAV is administered to more than one location in the spinal cord or logarithmic cistern of a GD type 3 or GD type 2 patient. In some embodiments, rAAV is administered to more than one location in the spinal cord of a GD type 3 or GD type 2 patient. In some embodiments, rAAV is administered into one or more of the lumbar subarachnoid space, thoracic subarachnoid space, and cervical subarachnoid space of the spinal cord of a patient with GD type 3 or GD type 2. In some embodiments, rAAV is administered into the alveolar cistern of a patient with GD type 3 or GD type 2. In some embodiments, the method may include a step of treating GD type 3 in a patient requiring treatment for GD type 3. In other embodiments, the method may include a step of treating GD type 2 in a patient requiring treatment for GD type 2. In additional embodiments, an expression cassette of viral particles may induce transplant gene expression in the central nervous system and peripheral nervous system to treat GD type 3 or GD type 2. In some embodiments, administration of rAAV particles improves symptoms associated with GD2 or GD3. For example, administration of viral particles may reduce or hinder the progression of brainstem and corticosteroid dysfunction, seizures, and cognitive deficits. In some embodiments, administration of viral particles reduces or removes toxic lipid substrates (e.g., Lyso-GL1) accumulated in the brains of patients with GD type 3 or GD type 2.

[0143] In another embodiment, rAAV virus particles are used to treat GD type 1. In certain embodiments, rAAV virus particles may be administered parenterally (e.g., intravenously, subcutaneously, or intramuscularly) to patients with GD type 1. In some embodiments, rAAV virus particles may be administered intravenously to patients with GD type 1. In some embodiments, administration of rAAV virus particles reduces splenomegaly in patients with GD type 1. In some embodiments, administration of rAAV virus particles reduces hepatomegaly in patients with GD type 1. In some embodiments, administration of rAAV virus particles reduces anemia in patients with GD type 1. In some embodiments, administration of rAAV virus particles reduces thrombocytopenia in patients with GD type 1. In some embodiments, administration of virus particles reduces or removes toxic lipid substrates (e.g., Lyso-GL1) accumulated in peripheral organs such as the liver, spleen, kidneys, and / or lungs. In some embodiments, administration of virus particles reduces or removes toxic lipid substrates (e.g., Lyso-GL1) accumulated in muscle tissues such as the heart, diaphragm, quadriceps, and gastrocnemius.

[0144] In other embodiments, rAAV viral particles are used to treat GBA-PD. In some embodiments, rAAV viral particles may be administered into the cerebrospinal fluid (CSF) of a GBA-PD patient. In some embodiments, the viral particles are administered directly by administration into the CSF of a GBA-PD patient. In some embodiments of the above embodiments, rAAV is administered to a GBA-PD patient via direct injection into the spinal cord, via intrathecal injection, or via intrasacral injection. In some embodiments, rAAV is administered to more than one location in the spinal cord or logarithmic cistern of a GBA-PD patient. In some embodiments, rAAV is administered to more than one location in the spinal cord of a GBA-PD patient. In some embodiments, rAAV is administered to one or more of the lumbar subarachnoid space, thoracic subarachnoid space, and cervical subarachnoid space of the spinal cord of a GBA-PD patient. In some embodiments, rAAV is administered to the logarithmic cistern of a GBA-PD patient. In some embodiments, rAAV viral particles are administered to patients with early-stage PD. In some of these embodiments, administration of viral particles reduces cognitive decline and disease progression of PD. In some embodiments, administration of viral particles reduces or removes toxic lipid substrates (e.g., Lyso-GL1) accumulated in the brains of GBA-PD patients. In some embodiments, administration of viral particles reduces α-synuclein in the brains of GBA-PD patients.

[0145] Kit or manufactured article

[0146] The expression cassettes described herein (e.g., expression cassettes for expressing a GCase enzyme such as a wild-type human GCase enzyme or a GCase enzyme having a mutated signaling peptide), rAAV vectors, particles, and / or pharmaceutical compositions may be contained in a kit or manufactured article designed for use in one of the methods of the present disclosure as described herein, for example.

[0147] Generally, such a system comprises a cannula suitable for use in the method of the present disclosure, one or more (e.g., one, two, three, four or more) syringes, and one or more (e.g., one, two, three, four or more) fluids.

[0148] The syringe may be any suitable syringe as long as it can be connected to a fluid delivery cannula. In some embodiments, the system has one syringe. In some embodiments, the system has two syringes. In some embodiments, the system has three syringes. In some embodiments, the system has four or more syringes. Fluids suitable for use in the method of the present disclosure include one or more fluids each containing an effective amount of one or more vectors as described herein, for example, one or more fluids containing one or more therapeutic agents.

[0149] In some embodiments, the kit comprises a single fluid (a pharmaceutically acceptable fluid containing an effective amount of vector). In some embodiments, the kit comprises two fluids. In some embodiments, the kit comprises three fluids. In some embodiments, the kit comprises four or more fluids. The fluids may comprise diluents, buffers, excipients, or any other liquids described herein or known in the art suitable for the delivery, dilution, stabilization, buffering, or other transport of an expression cassette for expressing the GCase enzyme or rAAV vector composition of the present disclosure. In some embodiments, the kit comprises one or more buffers, for example, an aqueous pH buffer solution. Examples of buffers may include, without limitation, phosphate, citrate, Tris, HEPES, and other organic acid buffers.

[0150] In some embodiments, the kit includes a container. Suitable containers may include, for example, vials, bags, syringes, and bottles. The container may be made of one or more materials such as glass, metal, or plastic. In some embodiments, the container is used to contain the rAAV composition of the present disclosure. In some embodiments, the container may contain fluids and / or other therapeutic agents.

[0151] In some embodiments, the kit comprises an additional therapeutic agent together with the rAAV composition of the present disclosure. In some embodiments, the rAAV composition and the additional therapeutic agent may be mixed. In some embodiments, the rAAV composition and the additional therapeutic agent may be stored separately. In some embodiments, the rAAV composition and the additional therapeutic agent may be contained in the same container. In some embodiments, the rAAV composition and the additional therapeutic agent may be contained in different containers. In some embodiments, the rAAV composition and the additional therapeutic agent may be administered simultaneously. In some embodiments, the rAAV composition and the additional therapeutic agent may be administered on the same day. In some embodiments, the rAAV composition may be administered within 1, 2, 3, 4, 5, 6, 7 days, 2 weeks, 3 weeks, 4 weeks, 2 months, 3 months, 4 months, 5 months, or 6 months after the administration of the additional therapeutic agent.

[0152] In some embodiments, the kit includes a therapeutic agent that temporarily suppresses the immune system prior to AAV administration. In some embodiments, the patient is temporarily immunosuppressed immediately before and after viral injection to suppress the T-cell response to AAV particles (e.g., the literature [Ferreira et al ., Hum. Gene Ther [See . 25:180-188, 2014]). In some embodiments, the kit further provides cyclosporine, mycophenolate mofetil, and / or methylprednisolone.

[0153] Additionally, the rAAV particles and / or compositions of the present disclosure may be packaged in a kit containing instructions for use. In some embodiments, the kit further comprises a device for delivering the rAAV particle composition (e.g., any type of parenteral administration described herein). In some embodiments, the instructions for use include instructions according to one of the methods described herein. In some embodiments, the instructions are printed on a label provided with the container (e.g., attached to the container). In some embodiments, the instructions for use include instructions for administering an effective amount of rAAV particles to an individual (e.g., human) for treating GBA-PD and / or GD in an individual.

[0154] Examples

[0155] The present disclosure will be more fully understood by referring to the following examples. However, these should not be construed as limiting the scope of the present disclosure. The examples and embodiments described herein are merely for illustrative purposes, and it is understood that various modifications or alterations will be suggested to those skilled in the art in this regard and should be included within the spirit and scope of the present application and the scope of the appended embodiments.

[0156] general method

[0157] Administration of conduritol β-epoxide (CBE)

[0158] CBE (Sigma-Aldrich, 234599) was reconstituted with sterile saline to a concentration of 10 mg / mL immediately before use. For rodents, 100 mg / kg of CBE was injected into mice at a concentration of 10 mL / kg via intraperitoneal (IP) injection using a 27 1 / 2 gauge needle 24 hours prior to necropsy. For non-human primates (NHP), a single dose of CBE was administered intravenously (bolus) to 2 to 4-year-old cynomolgus monkeys at a rate of 0.5 mL / min via the saphenous vein 24 to 48 hours prior to necropsy.

[0159] Bilateral intraventricular (ICV) injection

[0160] Four-month-old C57BL / 6 or 24-inch mice were anesthetized with isoflurane and administered 4 to 5 μL of formulation buffer or AAV.SAN006-GBA1 and variants per site bilaterally into the lateral ventricles using a 10-μL Hamilton syringe at a rate of 1 μL / min (AP: 0.40; ML: ±1.00; DV: 2.70). After the procedure, the injected mice were monitored and supportive care was provided for recovery.

[0161] Intracerebral cistern (ICM) injection

[0162] Synomolgus monkeys were fasted the night before the administration procedure (for at least 8 hours). The animals were anesthetized and placed in a lateral Trendelenburg position at an angle of approximately 15 to 20 degrees. Prior to administration, the administration equipment was prepared with formulation buffer, and the surgeon was guided using fluoroscopic imaging during administration. As a single step, 2.5 mL of formulation buffer or AAV.SAN006-GBA1 (1.25e13 VG per virus) was administered at a rate of 0.125 mL / min. At the end of administration, 0.250 mL of lavage fluid was provided and the needle was left in place for at least 1 to 3 minutes before removal. Veterinary care was provided for recovery after the procedure.

[0163] Intravenous (IV) injection

[0164] For rodent IV studies, 100 μl of formulation buffer or AAV.SAN006 WT GBA1 or AAV.SAN006-SS3-GBA1 virus was injected into the lateral tail vein of 3-month-old C57B BL / 6J mice using a 30-gauge needle. For NHP, AAV.SAN006-GFP was intravenously infused (bolus) into the saphenous vein of 2 to 3-year-old synomolgus monkeys at a dose of 2.5 e13 VG / kg at a rate of 0.5 mL / min.

[0165] Tissue homogenization

[0166] NHP and rodent tissues were homogenized in ice-cold TE buffer, pH 7.4 (Fisher Scientific, BP2476500) in 1.4 mm ceramic bead tubes (Fisher Scientific, 15-340-153) or 2.8 mm ceramic bead tubes (Fisher Scientific, 15-340-154) containing 6.5 mm ceramic beads (OMNI International, 19-682) using Omni Bead Ruptor 12 (OMNI International). After homogenization, tissue homogenate fractions were dispensed for all subsequent analyses.

[0167] Protein extraction

[0168] A pH 7.4 TE buffer (Fisher scientific, BP2476500) containing Nonidet P-40 (Thermo scientific, 28324) and halt protease inhibitor cocktail (Thermo scientific, 87786) was added to the collected tissue homogenate at a final concentration of 0.1% NP-40. The homogenate was mixed / solubilized in a tube revolver (Thermo scientific, 88881001) at 4°C for 15 minutes, followed by centrifugation at 4°C and 18,000 xg for 10 minutes. The clear supernatant was collected and transferred to a 1.5 mL Eppendorf tube (Eppendorf, 22363204).

[0169] Protein quantification

[0170] Total protein concentration was determined using a BCA (bicinconic acid) protein analysis kit (Thermo Scientific, 23225). Colorimetric detection was performed by measuring absorbance at 562 nm using a molecular device SpectraMax 340PC 384 96-well microtiter plate reader and SoftMax Pro version 5.4.4 software.

[0171] Glucosylceramidase activity analysis

[0172] GCase activity was determined using a glucosylceramidase activity assay kit (abcam, ab273339) with protein lysates from rodents and NHPs. Fluorescence excitation at 360 nm and emission at 445 nm were measured using a molecular device SpectraMax M2e 96-well microtiter plate reader and SoftMax Pro version 7 software.

[0173] Enzyme-linked immunosorbent assay (ELISA)

[0174] Human Glucosylceramidase ELISA: 96-well EIA / RIA assay microplates (Corning, 9018) were coated with 2.5 μg / mL GBA recombinant rabbit monoclonal antibody (Invitrogen, MA5-38382) or 1.0 μg / mL mouse GBA monoclonal antibody (Novus biologicals, NBP2-45829) in carbonate buffer (Invitrogen, CB01100) overnight at 4°C. The wells were washed three times with wash buffer (Invitrogen, WB01) and blocked in assay buffer (Invitrogen, DS98200) overnight at 4°C. A standard curve was constructed using recombinant human GBA protein (R&D Systems, 7410-GHB-020) for the quantification of human GBA protein. The standard and sample were reacted twice and incubated at room temperature for 2 hours, washed three times with wash buffer, and then incubated with 2.5 μg / mL recombinant biotin anti-GBA antibody (abcam, ab201496) at room temperature for 2 hours. The wells were washed three times with wash buffer and incubated with conjugated 0.1 μg / mL streptavidin HRP (Thermo Scientific, 21126) at room temperature for 1 hour. Afterward, the wells were washed three times with wash buffer and incubated with TMB substrate (Invitrogen, EB02) for 30 minutes before adding stop solution (Invitrogen, SS04). Human GBA protein was quantified by absorbance at 450 nm using the molecular instrument SpectraMax and Softmax Pro version 7.1.2 software, with wavelength correction set to 540 nm.

[0175] GFP ELISA

[0176] The level of GFP protein was detected using a GFP ELISA kit (abcam, ab171581). The measurement of GFP protein was completed by reading the absorbance at 450 nm using the molecular device SpectraMax 340PC 384 and Softmax Pro version 5.4.4 software.

[0177] lipid extraction

[0178] To quantify GlcSph and / or GlcCer, 20 μl of tissue homogenate (100 mg / mL tissue weight) was aliquoted into a labeled 1.5 ml Eppendorf tube, and 180 μl of internal standard solution (10 ng / ml D5-GlcSph and 20 ng / mL D35-C18GalCer in 30% methanol, 70% acetanitrile containing 5 mM ammonium acetate, and 1% acetic acid) was added.

[0179] The samples were vortexed for 10 minutes and sonicated for 10 minutes. The tubes were left at 4°C for 10 minutes and centrifuged at 13,000 × g for 10 minutes. The supernatant (150 µL) from each tube was transferred to a pre-labeled total recovery MS vial for MS analysis. Calibration curves for GlcSph and GlcCer were prepared from the pooled matrix, with concentration ranges from 0.03 to 1000 ng / ml.

[0180] Lipid mass spectrometry

[0181] Lipids were extracted from rodent and NHP tissue homogenates, and the lipids were injected into an LC / MS / MS system consisting of an Acquity UPLC (Waters, Milford, Massachusetts, USA) and a Sciex Triple Quad 5000 mass spectrometer (Sciex, Toronto, Canada) (5 μl).

[0182] For GlcSph, chromatographic separation (from GalSph) was achieved using Waters Acquity BEH HILIC (2.1 x 100 mm, 1.7 μm particles, Part # 186003461) as the mobile phase: (A) 96% ACN, 2% MeOH, 1% acetic acid, 1% H2O, 5 mM ammonium acetate and (B) 98% MeOH, 1% acetic acid, 1% H2O, 5 mM ammonium acetate.

[0183] The column was maintained at 30°C. GlcSph was eluted with the following gradient: from 5% B to 50% B over 3 minutes, followed by maintaining the mobile phase composition constant for 0.5 minutes, and then rapidly returning to 5% B (0.1 minutes) maintained for 1 minute. All experiments were performed at a flow rate of 0.5 ml / min. Data were analyzed by Analyst (Ab Sciex, Toronto, Canada).

[0184] For GlcCer, chromatographic separation (from GalCer) was achieved using Waters Cortecs HILIC (2.1 x 100 mm 2.7 μm particles, cat#186007427) as the mobile phase: (A) 96% ACN, 2% MeOH, 1% acetic acid, 1% H2O, 5 mM ammonium acetate and (B) 80% MeOH, 1% acetic acid, 20% H2O, 5 mM ammonium acetate.

[0185] The column was maintained at 20°C. GlcCer was eluted at an isobaric flow rate of 2% B for 4.5 minutes. All experiments were performed at a flow rate of 0.5 ml / min. Data were analyzed by an analyst (Ab Sciex, Toronto, Canada).

[0186] In situ hybridization (ISH)

[0187] RNAScope in situ assays for WPRE were performed using the RNAScope 2.0 Brown Detection Kit (ACD, 320497). Rodent and NHP brain FFPE slides were pretreated in EDTA buffer (pH 9.0) at 90°C, followed by protease treatment at 40°C. For the RNAScope WPRE ISH (ACD, 410058) assay, hybridization and amplification from Amp 1 to Amp 4 were performed in a 40°C oven, followed by Amps 5 and 6 at room temperature. The WPRE ISH signal was converted to brown using DAB.

[0188] Immunohistochemistry (IHC)

[0189] GBA IHC: Rodent and NHP brain FFPE slides were treated with EDTA solution (pH 9.0) for antigen recovery, blocked with 3% hydrogen peroxide, and then blocked with 5% horse serum. Subsequently, the slides were incubated with GBA1 antibodies (abcam, ab125065 and Novus, NBP2-45829) in 1:100 and 1:400 dilutions, respectively. Color development of the GBA signal was achieved by brown staining using DAB, and the slides were counterstained with hematoxylin for nuclear staining.

[0190] Vector Genome Evaluation

[0191] gDNA was isolated from rodent or NHP tissue homogenates using the QIAamp 96 DNA QIAcube HT kit (QIAGEN, 51331) according to the manufacturer's protocol. Briefly, tissue homogenates were treated with proteinase K overnight at 56°C and transferred to the S block (QIAGEN, 19585). Samples were placed on the QIAGEN QIAcube HT instrument, and gDNA isolation was performed following the steps in the QIAcube HT manufacturing management software. After gDNA isolation, concentrations were measured using a NANODROP 8000 (Thermo Fisher Scientific), and the vector genome was determined by dPCR using the QIAGEN QIAcube instrument. Vector copy numbers were determined by analyzing gDNA samples from rodent and NHP tissues using primer-probe combinations specific to bGH, transplant genes, and housekeeping gene sequences (integrated DNA technology).

[0192] Transcriptome evaluation

[0193] RNA was isolated from rodent or NHP tissue homogenates using the RNeasy 96 QIAcube HT kit (QIAGEN, 74171) according to the manufacturer's protocol. Briefly, the tissue homogenates were mixed with QIAzol lysis reagent (QIAGEN, 79306) and then with chloroform (Fisher Scientific, C298-1). The mixture was centrifuged at 4°C, and the aqueous phase was transferred to an S block (QIAGEN, 19585) for further RNA isolation. The samples were placed into the QIAcube HT instrument, and RNA isolation was performed according to the steps in the QIAcube HT manufacturing management software, along with in-column DNase (QIAGEN, 79256) treatment. After RNA isolation, concentrations were measured using a NANODROP 8000 (Thermo Fisher Scientific). RT-dPCR was performed to generate cDNA using the QIAcuity One-Step Advanced Probe Kit (QIAGEN, 250132) and to determine the total number of transcripts per RNA input using primer-probe combinations specific to the transplant gene, GFP, and housekeeping gene sequences (integrated DNA technology).

[0194] Color development Original position Hybridization (ISH)

[0195] RNAScope in situ assays for WPRE were performed using the RNAScope 2.0 Brown Detection Kit (ACD, 320497). Rodent and NHP brain FFPE slides were pretreated in EDTA buffer (pH 9.0) at 90°C, followed by protease treatment at 40°C. For the RNAScope WPRE ISH (ACD, 410058) assay, hybridization and amplification from Amp 1 to Amp 4 were performed in a 40°C oven, followed by Amps 5 and 6 at room temperature. The WPRE ISH signal was converted to brown using DAB.

[0196] Colorimetric Immunohistochemistry (IHC)

[0197] Rodent and NHP brain FFPE slides were treated with EDTA solution (pH 9.0) for antigen recovery, blocked with 3% hydrogen peroxide, and then blocked with 5% horse serum. Subsequently, the slides were incubated with human GBA1 antibodies (abcam and Novus) in 1:100 and 1:400 dilutions, respectively. Color development of the GBA signal was achieved by brown staining using DAB, and the slides were counterstained with hematoxylin for nuclear staining.

[0198] Immunofluorescence RNA / Protein Integrated Co-detection Analysis

[0199] Co-detection of WPRE RNA with different cell type markers from payload human GBA protein and NHP brain FFPE slides was performed using a Leica BOND RX automated stainer (Leica Biosystems). A multiplexing protocol was programmed to streamline in situ hybridization and single sequential IHC staining for the co-detection of RNA and protein markers. The RNAscope 2.5 LS multiplex fluorescence kit (ACD, 322800) and the conjugated polymer purification detection kit (Leica Biosystems, DS9800) were used in this newly programmed protocol. After using the WPRE probe (ACD, 410058) in the in situ hybridization step, it was used for detection and visualization using TSA Vivid Fluorophore 570 (Biotechne). In the sequential IHC step, the GBA1 antibody (Novus) 1:6000 and cell type markers were used for the detection of human GBA and the cell type markers. DAPI signal was used as nuclear counterstain.

[0200] statistics

[0201] All statistical analyses were performed using one-way analysis of variance (ANOVA) or two-way analysis of variance (ANOVA) and Tukey multiple comparison test or Student t-test depending on the dataset using GraphPad Prism 9 software (GraphPad, San Diego, CA, USA).

[0202] Example 1. Payload manipulation strategy for generating an easily secretible GBA1 variant

[0203] Human GBA1 (NP_000148.2) was engineered to facilitate secretion. To this end, the endogenous signal sequence at the N-terminus of the GBA1 protein was replaced with the signal sequences of some proteins with high secretion rates. Using a combination of in silico tools, four such signal sequences (SS1 to SS4) were identified that had the highest probability of extracellular secretion and the highest probability of signal sequence cleavage (greater than 98%). do 1a All sequences were human codon-optimized and induced by a hybrid CMV-chicken β-actin (CBA) constitutive promoter. Transplant gene expression was further enhanced by the addition of a Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). Detailed vector maps of all constructs are provided.

[0204] To ensure that GCase activity was not reduced due to signal sequence exchange, HEK293 cells were transfected with various GBA1 constructs, and GCase activity was tested in cell lysates 48 hours after transfection. Significantly increased GCase enzyme activity was observed in WT GBA1-transfected HEK cells compared to untransfected cells. Furthermore, all generated GBA1 variants possessed enzyme activity similar to that of WT GBA1. No statistical differences were observed among the different GBA1 constructs ( Fig. 1b ).

[0205] Example 2: Prudent secretion of certain GBA1 variants in vivo in rodent brain tissue

[0206] To investigate the ability of the engineered construct to be secreted and received by AAV-untransfected cells in vivo, bilateral intraventricular (ICV) injections of AAV (1e11 VG / mouse, 5 µl per hemisphere) were administered to 4-month-old WT mice, and brain sections were analyzed after 4 weeks of AAV expression. In situ hybridization of the 3' UTR of the transplant gene (WPRE) was performed to evaluate the distribution of AAV-transfected cells, and immunohistochemistry for human GBA1 protein was performed on adjacent fixed sections ( Fig. 2a ). Although the virus was generally localized to the perivesticular region in the thalamic slices of all AAV-treated groups, a much greater spread of huGBA1 protein was observed in SS1, SS2, and SS3 compared to WT GBA1. High-magnification imaging of these regions revealed that not only was engineered GBA1 (in this case, SS3-GBA1) potently secreted ( Fig. 2b It was observed that the secreted protein is efficiently absorbed by various cell types in the brain, which can be confirmed by the morphological differences of the cells that absorb the secreted protein (indicated by the green arrow).

[0207] Example 3: Efficient substrate removal rate by in vivo SS3-GBA1 variant in rodent brain tissue

[0208] To demonstrate the efficacy of the GBA1 variant, WT mice were injected with AAV (1e11 VG) for a 4-week expression period, and lipid accumulation was induced by injecting 100 mg / kg CBE (conduritol β-epoxide, IP injection) 24 hours prior to necropsy. The brain was microdissected into smaller areas ( Fig. 3a and Fig. 15a Lyso-GL1 and total GL1 levels were evaluated via lipid mass spectrometry, and vector genomic distribution was also evaluated via dPCR. Under physiological conditions, Lyso-GL1 levels in WT mice (no CBE group) were undetectable or below the LLOQ (lower limit of quantification) depending on specific brain regions, and total GL1 levels were 2 to 3 μg / gm² tissue weights ( Fig. 3c (gray bars in ). Across all investigated regions, a significant increase in lipid levels (both Lyso-GL1 and GL1) was observed in the CBE-treated vehicle injection group, demonstrating the action of CBE inducing lipid accumulation by inhibiting GCase. In the cerebellum, hindbrain, and midbrain, Lyso-GL1 ( Fig. 3b ) and total GL1( Fig. 3c In both cases investigated, it was observed that SS3-GBA1 effectively reduced lipid accumulation. This construct outperformed all other constructs produced, and in some mice, increased Lyso-GL1 with CBE returned to LLOQ, as shown in the data plotted to 0 in the posterior brain and midbrain tissues.

[0209] High levels of AAV genomes near the ventricles and lower levels in the distal regions were observed ( Fig. 15b , upper panel). In the cortex, AAV biodistribution was high depending on the vector genome measured per cell ( Fig. 15b , upper panel). In addition, equivalent clearance of CBE-induced Lyso-GL1 was observed across natural and engineered variants, but ( Fig. 15b , lower panel); removal of Lyso-GL1 by the engineered variant, improved compared to WT, was observed in the more distal region with a lower vector genome distribution.

[0210] Cross-correction in peripheral tissues of mice following intravenous administration of AAV was also evaluated. AAV (4e13 vg / kg) encoding a engineered lysosomal protein (e.g., GBA1) was administered to 3-month-old mice (4e13 vg / kg), and lysosomal dysfunction was induced by CBE (100 mg / kg, IP) after 4 weeks. Peripheral tissues were collected for analysis 1 day after CBE. High levels of hepatic transduction were observed, while transduction in the heart and spleen was significantly lower ( Fig. 16a;(vector genome per cell in mice treated with AAV-Ctrl or AAV-SS3-GBA1). Surprisingly, high levels of the AAV transplanted gene protein human GBA were observed ( Fig. 16b ), powerful removal rate of CBE-induced lipid substrates ( Fig. 16c ) was also observed, which indicates cross-correction from more highly transduced tissues.

[0211] The distribution of AAV-expressed GBA1 in the liver was evaluated. Secretion and uptake were observed in regions containing undetectable AAV transplant gene mRNA ( Fig. 16e In addition, some tissues, such as skeletal muscle and bone marrow, are particularly difficult to treat with standard gene therapy approaches or enzyme replacement therapy. Efficient lipid removal was observed in soleus muscle and bone marrow samples ( Fig. 16d ).

[0212] These data further demonstrate the cross-correction ability of AAVs (e.g., AAV GBA1 with a relevant signal peptide) to target often-unprocessed related tissue types.

[0213] Example 4: Development of a CBE-induced lipid flux model in non-human primates (NHP)

[0214] To develop an efficacy model in NHP, a CBE model was developed in rodents and adapted for NHP to determine the CBE administration regimen. CBE was administered intravenously to cynomolgus monkeys (moritian, 2 to 3 years of age) via the saphenous vein at doses of 3, 10, or 30 mg / kg. Brain, liver, and plasma were collected 24 hours after CBE administration for lipid analysis ( Fig. 4a Lyso-GL1 levels could be detected in the plasma of all NHPs that acquired CBE ( Fig. 4b ), a dose-dependent increase in Lyso-GL1 was observed in the livers of these NHPs ( Fig. 4c). For analysis in the brain, 47 gray matter brain tissue samples corresponding to 17 different gray matter regions were examined. Consistent with liver data, a dose-dependent increase in Lyso-GL1 was observed in all four 10 mg / kg and 30 mg / kg treatment groups, and Lyso-GL1 levels were significantly increased compared to the "CBE non-administration" group ( Fig. 4d In addition, a concomitant decrease in GCase activity was observed in all treatment groups ( Fig. 4e This is consistent with the mechanism of action by which CBE inhibits GCase enzyme activity.

[0215] Example 5: Effective reduction of GL1 lipids in SS3-GBA1-treated NHP

[0216] Pharmacological studies were performed on synomolgus NHPs to determine the efficacy of AAVs in CBE-treated NHPs. AAVs (e.g., AAVSAN006 WT GBA1 and AAV.SAN006 SS3-GBA1) were administered intracerebrospinal fluid (intra-CSF) to 2- to 3-year-old NHPs (1.25e 13 VGs / NHP). Viruses were induced for 6 weeks, and 30 mg / kg CBE was injected intravenously into all NHPs 48 hours prior to autopsy. At autopsy, plasma was collected at indicated time points, e.g., pre-AAV, pre-AAV and pre-CBE, and post-CBE. Lyso-GL1 spikes were observed in the plasma of all CBE-treated NHPs at autopsy ( Fig. 5a ).

[0217] Vector genome level ( Fig. 5b Transplant gene expression of ) and huGBA1 mRNA ( Fig. 5c) was similar across the two viral treatment groups (red WT-GBA1 and light brown SS3-GBA1). Data are presented as medians with interquartile ranges, and each data point represents the mean value of all NHPs in the corresponding group for the corresponding tissue sample. Although no significant decrease in Lyso-GL1 levels in AAV-treated NHPs was observed compared to the vehicle injection group ( Fig. 5d ), SS3-GBA1 was able to significantly reduce accumulated C18 GL1, the dominant isoform of GL1 in the brain ( Fig. 5e The purple line represents lipid levels under physiological conditions. Importantly, AAV.SAN006-SS3-GBA1 treatment lowers accumulated C18 GL1 to physiological levels, as observed by the median of the data close to the purple line representing baseline physiological lipid levels.

[0218] In addition, to demonstrate cross-correction of the engineered transplanted gene protein human GBA1 in NHP brains, fluorescent multiplex co-detection of AAV transplanted gene mRNA (e.g., WPRE) and therapeutic protein (e.g., huGBA1) was performed. Human GBA was detected in both AAV-transduced cells and cells lacking AAV transplanted gene mRNA ( FIGS. 17a to 17e) These data indicate that payload manipulation enables potent secretion while preserving endogenous reuptake capacity.

[0219] In summary, this study is as follows: a) similar vector genome and transplant gene expression of WT GBA1 and SS3-GBA1 throughout NHPs; b) increase in Lyso-GL1 in the plasma of all NHPs at autopsy, indicating that CBE works effectively; c) a statistically significant decrease in C18 GL1 in NHPs treated with SS3-GBA1 compared to vehicle and WT-GBA1; and d) histological analysis clearly showed secretion and uptake of SS3-GBA1 in non-transformed cells of NHP brain tissue.

[0220] Example 6: Prudent secretion and diffusion of SS3-GBA1 in the brain regions of SS3-GBA1 iCM-administered NHPs

[0221] WPRE mRNA was hybridized in situ, and huGBA1 immunohistochemistry was performed on 5 μm FFPE NHP brain sections from animals with AAV.SAN006-SS3-GBA1 ( Fig. 6a The results observed in high-magnification images of these images, consistent with previous observations in rodents, indicated that SS3-GBA1 was strongly secreted and taken by untransduced cells, which is indicated by the green arrow ( Fig. 6b ).

[0222] Example 7: SS3-GBA1 effectively promotes substrate clearance from peripheral tissues in intravenously administered WT mice.

[0223] We investigated SS3-GBA1 to determine whether accumulated lipids could be cleared / reduced via the IV administration route, as this would facilitate a treatment strategy for treating Gaucher patients (Type 1) via IV administration using a single virus. Vehicle or AAV.SAN006 SS3-GBA1 was injected intravenously into 3-month-old mice (4e13 VG / kg). After expressing AAV for 4 weeks, 100 mg / kg of CBE was injected IP 24 hours prior to necropsy. Consistent with intracerebrospinal fluid administration studies in mice, across all major peripheral organs ( Fig. 7a ) and all investigated muscles ( Fig. 7b A potent reduction in Lyso-GL1 was observed in ). This establishes the efficacy of AAV.SAN006 SS3-GBA1 across two different in vivo administration routes in mice.

[0224] In summary, when combining the results of studies on rodents and NHPs using both intracerebrospinal fluid and IV administration, the data indicated that SS3-GBA1 is efficiently secreted, taken up by uninfected cells, and promotes the effective removal of accumulated lipids.

[0225] In summary, SS3-GBA1 effectively reduced / removed Lyso-GL1 accumulated in all major peripheral organs, such as the liver, spleen, kidneys, and lungs. Additionally, SS3-GBA1 also reduced / removed Lyso-GL1 accumulated in muscle tissue associated with Gaucher disease. These include the heart, diaphragm, quadriceps, and gastrocnemius muscles.

[0226] Example 8: Extensive transduction and biodistribution of AAV.SAN006 in IV-administered NHP

[0227] To ensure that AAV.SAN006 also targets multiple peripheral tissues in large animal species such as NHPs, IV injection of GFP-expressing AAV.SAN006 in cynomolgus monkeys (female, 2 to 4 years old) (2.5e 13 VG / kg) was performed. Three weeks after administration, NHPs were sacrificed, and multiple tissues were examined for vector genome, mRNA transcriptome, and protein levels. Quantification of vector genome levels across multiple peripheral tissues ( Fig. 8 ) indicates that AAV.SAN006 can transduce various tissues via IV administration. GFP mRNA investigated throughout the tissue ( Fig. 9a ) and ELISA protein expression data( Fig. 9b Extensive transgenic expression was observed in major peripheral organs such as the liver, kidneys, and lungs, as well as in muscles such as the heart, diaphragm, quadriceps, and gastrocnemius. GFP ELISA data across these tissues correlated with mRNA transcriptome data. Taken together, these data suggest that AAV.SAN006 is a suitable capsid for CNS expression via ICM administration as well as for transduction of peripheral organs via IV administration.

[0228] Example 9: Determination of the Minimum Effective Dose of SS3-GBA1 in NHP

[0229] A dose-range determination study was performed on cynomolgus NHPs to determine the minimum effective dose (MED) of AAV-SS3-GBA1 in CBE-treated NHPs. Three different doses of AAV.SAN006 SS3-GBA1 were tested (dose: 1) 2.5e12, 2) 7.5e12, and 3) 2.5e13 total vector genomes). The three tested doses were administered via intracerebrospinal fluid (CSF) infusion to NHPs aged 2 to 3 years. The virus was allowed to be expressed for 8 weeks, and 30 mg / kg CBE was injected intravenously into all NHPs 24 hours prior to necropsy. At all three tested doses, extensive brain transduction of SS3-GBA1 was observed in these NHPs ( FIGS. 18a to 18b ).

[0230] Administration of CBE causes the accumulation of Lyso-GL1 in plasma and tissues. Consistent with previous findings in rodents and NHPs, a potent increase in Lyso-GL1 after CBE injection was observed across both vehicle and AAV-treated groups ( Fig. 18c ).

[0231] Three NHPs were selected from the AAV-treated group for lipid and proteomic mass spectrometry analysis. Forty-seven gray matter tissue samples (five from the vehicle treatment group and three from the AAV treatment groups for each viral dose) taken from the brains of all 14 NHPs were evaluated. A significant decrease in accumulated Lyso-GL1 was observed at AAV-SS3-GBA1 doses 2) 7.5e12 and 3) 2.5e13 ( Fig. 18d Importantly, there was no statistically significant difference between the doses of AAV-SS3-GBA1 2) 7.5e12 and 3) 2.5e13 (e.g., the median and highest doses tested), which statistically suggested that 7.5e12 VG (i.e., the median dose) is the MED. These results are consistent with previous pharmacological studies where the observed efficacy was 1.25e13 VG, which is a lower dose than the highest dose tested, 2.5e13 VG.

[0232] Example 10: Safety evaluation of AAV-SS3-GBA1 in NHP

[0233] Histopathological analysis across all major organs revealed few or no pathological findings across all three doses tested according to Example 9. Brain and major peripheral tissues ( FIGS. 19a to 19b No findings were found in the spinal cord, DRG, and sciatic nerve ( FIGS. 19c to 19f Mild or very small microscopic findings were observed in ). These data indicate the safety of SS3-GBA1 when administered into the CSF via ICM in NHP.

[0234] Example 11: GBA D409V / + Long-term efficacy of SS3-GBA1 in mice

[0235] To demonstrate the long-term efficacy and persistence of a single-dose AAV.SAN006 SS3-GBA1, 3-month-old GBA D409V / + A long-term study was conducted in which mice were injected with AAV via bilateral ICV (total 1.6 e11 VG) and slaughtered at 3, 6, and 9 months after administration. Twenty-four hours prior to necropsy, mice were treated with 100 mg / kg CBE (conduritol β-epoxide, IP injection) to increase lipid accumulation. At each time point, the efficacy of SS3-GBA1 was demonstrated by evaluating lipid clearance in the brain and plasma of the mice. The brain was microdissected to obtain cortical (e.g., proximal to the injection site) and cerebellar (e.g., distal to the injection site) samples, and lipid analysis was performed at all time points to determine the efficacy of SS3-GBA1 for long-term lipid clearance.

[0236] Consistent with both ICV administration routes, viral transduction in the cortex and cerebellum was rarely observed ( FIGS. 20a to 20b CBE administration induced Lyso-GL1 spikes across all mice ( FIGS. 20c to 20eHowever, mice treated with SS3-GBA1 showed a significant decrease in Lyso-GL1 in both the cerebral cortex and cerebellum at all time points ( FIGS. 20c to 20d ).

[0237] The significance of these results is twofold: 1) long-term efficacy for SS3-GBA1 was observed, and 2) this efficacy leads to the widespread distribution of SS3-GBA1 in other regions where the virus was introduced, such as the cerebellum in this case, due to sustained cross-correction of SS3-GBA1. A similar decrease in Lyso-GL1 in the plasma of all mice was observed across all time points compared to vehicle-treated mice ( Fig. 20e ).

[0238] order

[0239]

[0240]

[0241]

[0242]

[0243]

[0244]

[0245]

[0246]

[0247]

[0248]

[0249]

[0250]

[0251]

[0252]

[0253]

[0254]

[0255]

[0256]

[0257]

[0258]

[0259]

[0260]

[0261]

[0262]

[0263]

[0264]

[0265]

[0266]

[0267]

[0268]

[0269]

[0270]

[0271]

[0272]

[0273]

[0274]

[0275]

[0276]

[0277]

[0278]

[0279]

[0280]

[0281]

[0282]

[0283]

[0284]

[0285]

[0286]

Claims

Claim 1 A recombinant adeno-associated virus (rAAV) particle comprising: (1) an expression cassette for expressing a glucocerebrosidase (GCase) enzyme, wherein the expression cassette comprises a gene encoding a GCase enzyme operably linked to a promoter and optionally an enhancer, and (2) a modified AAV9 capsid protein comprising a targeting peptide comprising SEQ ID NO.

16. Claim 2 In claim 1, the GCase enzyme is an rAAV particle comprising the amino acid sequence of SEQ ID NO.

1. Claim 3 In claim 1, the GCase enzyme is an rAAV particle comprising the amino acid sequence of SEQ ID NO.

2. Claim 4 In claim 1, the GCase enzyme comprises an amino acid sequence of SEQ ID NO. 2 and a mutated (i.e., non-endogenous) signal transduction peptide, rAAV particle. Claim 5 In claim 1, the gene encoding the GCase enzyme is a codon-optimized gene, an rAAV particle. Claim 6 In claim 5, the rAAV particle having a nucleic acid sequence selected from the group consisting of SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, and SEQ ID NO. 7, wherein the codon-optimized gene is an rAAV particle. Claim 7 In claim 1, the expression cassette comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22, and SEQ ID NO. 23, an rAAV particle. Claim 8 In any one of claims 1 to 7, the targeting peptide is an rAAV particle adjacent to a linker sequence on its N-terminal end and its C-terminal end. Claim 9 In claim 8, the combined targeting peptide and linker sequence comprises the rAAV particle of SEQ ID NO.

17. Claim 10 rAAV particles according to any one of claims 1 to 9, wherein the modified capsid protein has a sequence at least 98.5% identical to SEQ ID NO.

18. Claim 11 In claim 10, the modified capsid protein comprises a sequence including SEQ ID NO. 18, rAAV particle. Claim 12 rAAV particle according to any one of claims 1 to 11, wherein the rAAV vector comprises the 5' AAV2 ITR of SEQ ID NO. 8 and the 3' AAV2 ITR of SEQ ID NO.

9. Claim 13 In any one of claims 1 to 12, the expression cassette comprises an rAAV particle containing a CMV enhancer element comprising SEQ ID NO.

10. Claim 14 In any one of claims 1 to 13, the expression cassette comprises an rAAV particle containing a chicken β-actin promoter comprising SEQ ID NO.

11. Claim 15 In any one of claims 1 to 14, the rAAV vector further comprises a WPRE element, an rAAV particle. Claim 16 In claim 11, the rAAV particle, wherein the WPRE element comprises the sequence of SEQ ID NO.

12. Claim 17 (1) an rAAV vector comprising an expression cassette for expressing a glucocerebrosidase (GCase) enzyme (wherein the expression cassette comprises a gene encoding a GCase enzyme operably linked to a promoter and optionally an enhancer), (2) a recombinant adeno-associated virus (rAAV) particle comprising a capsid protein, wherein the expression cassette comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22, and SEQ ID NO.

23. Claim 18 A method for treating Gaucher disease (GD) type 3 in a human patient requiring treatment for Gaucher disease (GD) type 3, comprising the step of administering a composition containing an effective amount of recombinant adeno-associated virus (rAAV) virus particles according to any one of claims 1 to 17 into the cerebrospinal fluid (CSF) of said patient. Claim 19 In paragraph 18, the method wherein the composition is administered directly into the CSF of the patient via intraventricular (ICV) administration. Claim 20 In paragraph 18, the method wherein the composition is administered directly to the patient's CSF via direct dCM administration. Claim 21 In claim 18, the method wherein the composition is administered directly into the CSF of the patient by an intravertebral microcatheter (IT-CM). Claim 22 A method according to any one of claims 18 to 21, wherein the composition is administered only once during the lifetime of the patient. Claim 23 A method according to any one of claims 18 to 21, wherein the composition is administered to the patient only once a year. Claim 24 A method according to any one of claims 18 to 23, wherein the administering step increases GCase activity in the patient by at least 5%. Claim 25 A method according to any one of claims 18 to 23, wherein the administering step increases GCase activity in the patient by at least 10%. Claim 26 A method according to any one of claims 18 to 23, wherein the administering step increases GCase activity in the patient by at least 20%. Claim 27 A method according to any one of claims 18 to 23, wherein the administering step increases GCase activity in the patient by at least 30%. Claim 28 A method according to any one of claims 18 to 23, wherein the administering step increases GCase activity in the patient by at least 50%. Claim 29 A method for treating type 1 Gaucher disease (GD) in a human patient requiring treatment for type 1 Gaucher disease, comprising the step of parenterally administering to the patient a composition comprising an effective amount of recombinant adeno-associated virus (rAAV) virus particles according to any one of claims 1 to 17. Claim 30 In paragraph 29, the above parenteral administration is an intravenous administration method. Claim 31 In paragraph 29, the above parenteral administration is a subcutaneous administration method. Claim 32 In paragraph 29, the above parenteral administration is an intramuscular administration method. Claim 33 A method according to any one of claims 29 to 32, wherein the composition is administered only once over the lifetime of the patient. Claim 34 A method according to any one of claims 29 to 32, wherein the composition is administered to the patient only once a year. Claim 35 A method according to any one of claims 29 to 32, wherein the administering step increases GCase activity in the patient by at least 5%. Claim 36 A method according to any one of claims 29 to 32, wherein the administering step increases GCase activity in the patient by at least 10%. Claim 37 A method according to any one of claims 29 to 32, wherein the administering step increases GCase activity in the patient by at least 20%. Claim 38 A method according to any one of claims 29 to 32, wherein the administering step increases GCase activity in the patient by at least 30%. Claim 39 A method according to any one of claims 29 to 32, wherein the administering step increases GCase activity in the patient by at least 50%. Claim 40 A method for treating GBA-PD in a human patient requiring treatment for GBA-PD, comprising the step of administering a composition containing an effective amount of a recombinant adeno-associated virus (rAAV) virus particle of any one of claims 1 to 17 into the cerebrospinal fluid (CSF) of said patient. Claim 41 In paragraph 40, the method wherein the composition is administered directly into the patient's CSF via intraventricular (ICV) administration. Claim 42 In paragraph 40, the method wherein the composition is administered directly to the patient's CSF through direct administration of a large fluid bath (dCM). Claim 43 In claim 40, the method wherein the composition is administered directly into the CSF of the patient by an intrathecal microcatheter (IT-CM). Claim 44 A method according to any one of claims 40 to 43, wherein the composition is administered only once during the lifetime of the patient. Claim 45 A method according to any one of claims 40 to 43, wherein the composition is administered to the patient only once a year. Claim 46 A method according to any one of claims 40 to 45, wherein the administering step increases GCase activity in the patient by at least 5%. Claim 47 A method according to any one of claims 40 to 45, wherein the administering step increases GCase activity in the patient by at least 10%. Claim 48 A method according to any one of claims 40 to 45, wherein the administering step increases GCase activity in the patient by at least 20%. Claim 49 A method according to any one of claims 40 to 45, wherein the administering step increases GCase activity in the patient by at least 30%. Claim 50 A method according to any one of claims 40 to 45, wherein the administering step increases GCase activity in the patient by at least 50%. Claim 51 A method for increasing the expression and / or activity of GCase in an individual requiring increased expression and / or activity of GCase, comprising the step of administering a composition containing an effective amount of a recombinant adeno-associated virus (rAAV) virus particle of any one of claims 1 to 17 into the cerebrospinal fluid (CSF) of said patient. Claim 52 A method for increasing the expression and / or activity of GCase in an individual requiring increased expression and / or activity of GCase, comprising the step of intravenously administering to said patient a composition comprising an effective amount of recombinant adeno-associated virus (rAAV) virus particles according to any one of claims 1 to 17. Claim 53 Use of any one of claims 1 to 17 recombinant adeno-associated virus (rAAV) virus particles for treating GD. Claim 54 In paragraph 53, the above GD is a GD type 1, for use. Claim 55 In paragraph 53, the above GD is a GD type 2, for use. Claim 56 In paragraph 53, the above GD is a GD type 3, for use. Claim 57 Use of any one of claims 1 to 17 recombinant adeno-associated virus (rAAV) virus particles for treating GBA-PD. Claim 58 A plasmid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22, and SEQ ID NO.

23. Claim 59 A codon-optimized human GBA1 sequence comprising a nucleic acid sequence selected from the group consisting of SEQ NO 3, SEQ NO 4, SEQ NO 5, SEQ NO 6, and SEQ NO 7. Claim 60 A signal peptide and a GCase polypeptide encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, and SEQ ID NO.

7. Claim 61 A signal peptide and a GCase polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO. 30, SEQ ID NO. 31, SEQ ID NO. 32, SEQ ID NO. 33, and SEQ ID NO.

34. Claim 62 A signal peptide and a GCase polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 25 to 29. Claim 63 (1) an rAAV vector comprising an expression cassette for expressing a glucocerebrosidase (GCase) enzyme (wherein the expression cassette comprises a gene encoding a GCase enzyme operably linked to a promoter and optionally an enhancer), and (2) a recombinant adeno-associated virus (rAAV) particle comprising a capsid protein. Claim 64 (1) an rAAV vector comprising an expression cassette for expressing a glucocerebrosidase (GCase) enzyme (wherein the expression cassette comprises a gene encoding the GCase enzyme and a signal peptide), and (2) a recombinant adeno-associated virus (rAAV) particle comprising a capsid protein.

Images