DUX4 RNA silencing using RNA-targeting CRISPR-Cas13b

A recombinant gene editing complex with Cas13 and gRNA delivered via AAV targets and silences DUX4, addressing the lack of treatments for FSHD and DUX4-related cancers by reducing DUX4 expression and its toxic effects.

KR102991281B1Active Publication Date: 2026-07-15RES INTITUTE AT NATIONWIDE CHILDRENS HOSPITAL
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Filing Date
2019-12-31
Publication Date
2026-07-15

AI Technical Summary

Technical Problem

Current treatments are lacking for muscle dystrophies such as FSHD and cancers associated with DUX4 expression, as there is no effective method to inhibit the harmful effects of the DUX4 gene.

Method used

A recombinant gene editing complex using Cas13 protein and a guide RNA (gRNA) is delivered via an adeno-associated virus (AAV) to specifically target and inhibit DUX4 gene expression, reducing its toxic effects in cells.

Benefits of technology

The method effectively silences DUX4 expression, providing therapeutic benefits for muscle dystrophies like FSHD and reducing the severity of DUX4-related cancers by inhibiting the toxic protein production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure R1020217023871_ABST
    Figure R1020217023871_ABST
Patent Text Reader

Abstract

An RNA interference-based product and method for inhibiting the expression of the double homeobox 4 (DUX4) gene on human chromosome 4q35 are disclosed. The invention comprises the silencing of the Cas13 protein of RNA, wherein Cas13 is specifically targeted to a DUX4 region of interest using a sequence-specific guide RNA (gRNA). The recombinant adeno-associated virus of the invention is constructed with a Cas13 direct repeat sequence and delivers DNA encoding an inhibitory gRNA that knocks down DUX4 expression. The method is applicable to the treatment of muscular dystrophy, including but not limited to facial-scapulohumeral muscle dystrophy (FSHD), and other disorders, including cancer, associated with elevated DUX4 expression.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention relates to a CRISPR / Cas13 product and a method for silencing or inhibiting the expression of the double homeobox 4 (DUX4) gene on human chromosome 4q35. The present invention provides a recombinant gene editing complex comprising a recombinant gene editing protein, namely Cas13, and a nucleic acid encoding a guide RNA (gRNA) that specifically hybridizes to a target nucleic acid sequence encoding a region of the DUX4 gene, wherein binding of the complex to said target nucleic acid sequence inhibits DUX4 gene expression. The recombinant adeno-associated virus of the present invention delivers DNA encoding such gRNA that knocks down DUX4 expression. The present method is applicable to the treatment of muscular dystrophy, including but not limited to facial-scapulohumeral muscle dystrophy (FSHD), and other disorders such as cancer in which DUX4 inhibition occurs.

[0002] Cited as a reference in the sequence list

[0003] The present application comprises, as a separate part of the present invention, a sequence list in computer-readable form (filename: 53307A_Seqlisting.txt; 34,420 bytes - ASCII text file created on December 30, 2019), the entirety of which is cited by reference. Background Technology

[0004] Muscle dystrophy (MD) is a group of genetic diseases. This group of disorders is characterized by the progressive weakening and degeneration of skeletal muscles that control movement. Some forms of MD occur in infancy or childhood, while others may not appear until after middle age. The disorder varies in terms of the distribution and extent of muscle weakness (some forms of MD also affect the heart muscle), age of onset, rate of progression, and pattern of inheritance.

[0005] Facial-scapulohumeral muscular dystrophy (FSHD) is a hereditary muscular degenerative disease characterized by the gradual wasting of muscles, with the muscles of the face, scapula, and upper arm being the most affected. Originally named Landouzy-Dejerine, FSHD is generally autosomal dominant and is a hereditary form of muscular dystrophy (MD) that initially affects the skeletal muscles of the face, scapula, and upper arm. FSHD is the third most common genetic disease of skeletal muscle, present in approximately 4 to 12 people per 100,000. Historically, FSHD was classified as the third most common MD, affecting 1 in 20,000 people worldwide. However, recent data suggest that FSHD is the most common MD in Europe, indicating that the global incidence may be underestimated.

[0006] Symptoms can occur during childhood, typically become noticeable in the teens, and 95% of affected individuals show signs of the disease by age 20. Progressive skeletal muscle weakness usually occurs in other parts of the body as well and is often asymmetrical. Life expectancy can be threatened due to respiratory failure, and up to 20% of affected individuals become severely disabled, requiring wheelchairs or mobility scooters. Since there is currently no cure for this severe disability, patients have no choice but to manage their symptoms.

[0007] There are two clinically indistinguishable forms of FSHD, referred to as FSHD1 and FSHD2. Most cases (approximately 95%) are classified as FSHD1, while the remainder are classified as FSHD2 or exhibit typical FSHD findings but have not yet been genetically characterized. Simply put, both forms of FSHD are caused by the derepression of the virulent DUX4 gene. The DUX4 open frame is encoded within the D4Z4 repeat sequence located in the human chromosome 4q subtelomere. Humans can possess different copy numbers of D4Z4 repeat sequences on both 4q alleles. More than 10 D4Z4 arrays are typically contained within heterochromatin, and consequently, the DUX4 gene located at each repeat sequence is repressed.

[0008] FSHD1 is caused by an innate reduction in the number of D4Z4 repeat sequences (1 to 10 copies of D4Z4) in a single allele, which in turn interferes with the epigenetic silencing of the corresponding region. FSHD2 is generated by mutations in chromatin modifyer genes (SMCHD1, DNMT3B), which also induce epigenetic disrepression of the D4Z4 repeat sequence. In both cases, the DUX4 gene can be transcribed into DUX4 mRNA. However, the reduction in epigenetic gene silencing of DUX4 is insufficient to induce FSHD because individual repeat sequences lack the polyA signaling necessary to stabilize the DUX4 transcript. To cause FSHD, the inheritance of a specific chromosomal background called 4qA, which includes the pLAM region adjacent to the last repeat sequence, is required. The pLAM region provides polyA signaling to the last copy of DUX4. Therefore, when DUX4 transcription occurs in the 4qA haploid type, the full-length DUX4 transcript located closest to the telomere is stabilized and translated into a DUX4 protein that is toxic to muscle. Treatments and products and methods for these muscle dystrophies, including FSHD, are still needed in the industry. Likewise, because DUX4 is associated with various cancers, treatments for cancers associated with DUX4 expression, where inhibition of DUX4 is therapeutic, are still required in the industry. The problem to be solved

[0009] The present invention provides a product and a method for treating muscle dystrophy that has been harmfully affected by the expression or overexpression of dual homeobox 4 (DUX4). In some embodiments, the muscle dystrophy is FSHD. means of solving the problem

[0010] The present invention provides a nucleic acid, a composition, and a viral vector comprising a nucleic acid designed to inhibit DUX4 expression with the help of Cas13, a method of using these products to inhibit and / or interfere with the expression of the DUX4 gene in cells, a method of treating a subject suffering from muscular dystrophy, and a recombinant gene editing complex comprising at least one nucleic acid comprising a nucleotide sequence encoding Cas13 or a Cas13 ortholog or variant, and at least one nucleic acid comprising a nucleotide sequence encoding a guide RNA (gRNA) that specifically hybridizes to a target nucleic acid sequence encoding a DUX4 and Cas13b direct repeat sequence, wherein binding of the complex to the target nucleic acid sequence inhibits DUX4 gene expression.

[0011] In some embodiments, the present invention provides a nucleic acid encoding a guide RNA (gRNA) encoding DUX4 comprising a nucleotide sequence described in any one of SEQ ID NOs 3 to 13 and 51 to 54.

[0012] In some embodiments, the present invention provides a nucleic acid encoding a gRNA encoding DUX4 that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence described in any one of SEQ ID NOs 14 to 24 and 55 to 58.

[0013] In some embodiments, the nucleic acid further comprises a Cas13b direct repeat sequence. In some embodiments, the Cas13b direct repeat sequence is located downstream of or at the 3' end of the nucleic acid encoding the gRNA encoding DUX4. In some embodiments, the Cas13b direct repeat sequence comprises the nucleotide sequence described in SEQ ID NO. 37 or a variant thereof having at least about 90% identity with the nucleotide sequence described in SEQ ID NO. 37.

[0014] In some embodiments, the present invention provides at least one nucleic acid comprising a nucleotide sequence described in any one of SEQ ID NOs 25 to 35 and 59 to 62 or a variant thereof having at least about 90% identity with the nucleotide sequence described in any one of SEQ ID NOs 25 to 35 and 59 to 62.

[0015] In some embodiments, the nucleic acid of the present invention further comprises a promoter sequence. In some embodiments, the promoter is any U6, U7, tRNA, H1, minimal CMV, T7, EF1-alpha, minimal EF1-alpha, or skeletal muscle-specific promoter. In some embodiments, the muscle-specific promoter is unc45b, tMCK, minimal MCK, CK6, CK7, MHCK7, or CK1.

[0016] In some embodiments, the present invention provides at least one nucleic acid comprising a nucleotide sequence described in any one of SEQ ID NOs 38 to 48 and 63 to 66 or a variant thereof having at least about 90% identity with the nucleotide sequence described in any one of SEQ ID NOs 38 to 48 and 63 to 66.

[0017] In some embodiments, the present invention provides an adeno-associated virus (AAV) comprising any one or more nucleic acids provided in the present invention. In some embodiments, the AAV comprises multiple copies of the same nucleic acid. For example, in some embodiments, the AAV comprises multiple copies of the same gRNA. In some embodiments, the AAV comprises multiple copies of different nucleic acids. For example, in some embodiments, the AAV comprises multiple copies of gRNA combinations. In some embodiments, the virus comprises rep and cap genes. In some embodiments, the virus lacks rep and cap genes. In some embodiments, the adeno-associated virus is a recombinant AAV (rAAV). In some embodiments, the adeno-associated virus is a self-complementary recombinant AAV (scAAV). In some embodiments, AAV is AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, or AAV rh.74. In some embodiments, AAV is AAV-9.

[0018] The present invention also provides any one or more nucleic acids of the present invention and any one or more AAVs of the present invention as a composition. In some embodiments, the composition also comprises a diluent, an excipient and / or an acceptable carrier. In some embodiments, the carrier is a pharmaceutically acceptable carrier or a physiologically acceptable carrier.

[0019] In some embodiments, the present invention provides an adeno-associated virus or composition comprising: a nucleic acid comprising a nucleotide sequence described in any one of SEQ ID NOs 3 to 13 and 51 to 54; 25 to 35 and 59 to 62; and 38 to 48 and 63 to 66; and / or a nucleic acid encoding a gRNA encoding DUX4 that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence described in any one of SEQ ID NOs 14 to 24 and 55 to 58; and a nucleic acid encoding a Cas13 protein or a Cas13 ortholog or a variant thereof. In some embodiments, the Cas13 protein is Cas13b or a Cas13b ortholog or a variant thereof. In some embodiments, the Cas13b protein is encoded by the nucleotide sequence described in SEQ ID NO. 36 or a variant thereof having at least about 80% identity with the sequence described in SEQ ID NO. 36. In some embodiments, the method further comprises the step of contacting a cell with an adeno-associated virus comprising a nucleic acid encoding DUX4 repressive RNA. In some embodiments, the expression of the nucleic acid encoding DUX4 repressive RNA is under the control of a U6 promoter, U7 promoter, T7 promoter, tRNA promoter, H1 promoter, minimal EF1-alpha promoter, minimal CMV promoter, CMV promoter, muscle creatine kinase (MCK) promoter, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or desmin promoter.

[0020] In some embodiments, the present invention provides a method for treating a subject suffering from muscular dystrophy, comprising: an adeno-associated virus or composition comprising a nucleic acid comprising a nucleotide sequence described in any one of SEQ ID NOs 3 to 13 and 51 to 54; 25 to 35 and 59 to 62; and 38 to 48 and 63 to 66, and / or a nucleic acid encoding a gRNA encoding DUX4 that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence described in any one of SEQ ID NOs 14 to 24 and 55 to 58; and administering to said subject an effective amount of an adeno-associated virus comprising a nucleic acid encoding a Cas13 protein or a Cas13 ortholog or a variant thereof. In some embodiments, said Cas13 protein is Cas13b or a Cas13b ortholog or a variant thereof. In some embodiments, the Cas13b protein is encoded by the nucleotide sequence described in SEQ ID NO. 36 or a variant thereof having at least about 80% identity with the sequence described in SEQ ID NO. 36. In some embodiments, the method further comprises the step of contacting a cell with an adeno-associated virus comprising a nucleic acid encoding DUX4 repressive RNA. In some embodiments, the expression of the nucleic acid encoding DUX4 repressive RNA is under the control of a U6 promoter, U7 promoter, T7 promoter, tRNA promoter, H1 promoter, minimal EF1-alpha promoter, minimal CMV promoter, CMV promoter, muscle creatine kinase (MCK) promoter, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or desmin promoter. In various embodiments, the muscle dystrophy is FSHD.

[0021] In some embodiments, the present invention provides a method for treating muscular dystrophy in a subject requiring treatment, comprising administering an effective amount of an adeno-associated virus to the subject, wherein the genome of the adeno-associated virus comprises: (a) at least one nucleic acid encoding a guide RNA (gRNA) encoding a double homeobox 4 (DUX4) comprising a nucleotide sequence described in any one of SEQ ID NOs 3 to 13 and 51 to 54; (b) at least one nucleic acid encoding a guide RNA (gRNA) encoding a DUX4 that specifically hybridizes to a target nucleic acid encoding a DUX4 comprising a nucleotide sequence described in any one of SEQ ID NOs 14 to 24 and 55 to 58; and (c) at least one nucleic acid comprising a nucleotide sequence described in any one of SEQ ID NOs 25 to 35 and 59 to 62, or a variant thereof comprising at least about 90% identity with a nucleotide sequence described in any one of SEQ ID NOs 25 to 35 and 59 to 62. (d) at least one nucleic acid comprising a nucleotide sequence described in any one of SEQ ID NOs 38 to 48 and 63 to 66, or a variant thereof comprising at least about 90% identity with a nucleotide sequence described in any one of SEQ ID NOs 38 to 48 and 63 to 66; or (e) any combination of these (a) to (d), the present invention provides a method comprising. In some embodiments, the present invention further comprises administering an effective amount of an adeno-associated virus comprising a nucleic acid encoding a Cas13 protein or a Cas13 ortholog or variant to said subject. In some embodiments, said Cas13 protein is Cas13b or a Cas13b ortholog or a variant thereof. In some embodiments, said Cas13b protein is encoded by a nucleotide sequence described in SEQ ID NO. 36 or a variant thereof comprising at least about 80% identity with a sequence described in SEQ ID NO. 36.In some embodiments, the method further comprises the step of contacting a cell with an adeno-associated virus comprising a nucleic acid encoding DUX4 repressive RNA. In some embodiments, the expression of the nucleic acid encoding DUX4 repressive RNA is under the control of a U6 promoter, U7 promoter, T7 promoter, tRNA promoter, H1 promoter, minimal EF1-alpha promoter, minimal CMV promoter, CMV promoter, muscle creatine kinase (MCK) promoter, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or desmin promoter. In various embodiments, muscle dystrophy is FSHD.

[0022] In some embodiments, the present invention provides a method for treating a subject suffering from cancer associated with DUX4 expression or an elevation of DUX4 expression, comprising: an adeno-associated virus or composition comprising a nucleic acid comprising a nucleotide sequence described in any one of SEQ ID NOs 3 to 13 and 51 to 54; 25 to 35 and 59 to 62; and 38 to 48 and 63 to 66, and / or a nucleic acid encoding a gRNA encoding DUX4 that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence described in any one of SEQ ID NOs 14 to 24 and 55 to 58; and administering to said subject an effective amount of an adeno-associated virus comprising a nucleic acid encoding a Cas13 protein or a Cas13 ortholog or a variant thereof. In some embodiments, said Cas13 protein is Cas13b or a Cas13b ortholog or a variant thereof. In some embodiments, the Cas13b protein is encoded by the nucleotide sequence described in SEQ ID NO. 36 or a variant thereof having at least about 80% identity with the sequence described in SEQ ID NO. 36. In some embodiments, the method further comprises the step of contacting a cell with an adeno-associated virus comprising a nucleic acid encoding DUX4 repressive RNA. In some embodiments, the expression of the nucleic acid encoding DUX4 repressive RNA is under the control of a U6 promoter, U7 promoter, T7 promoter, tRNA promoter, H1 promoter, minimal EF1-alpha promoter, minimal CMV promoter, CMV promoter, muscle creatine kinase (MCK) promoter, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or desmin promoter. In various embodiments, the cancer is a DUX4+ cancer.In various forms, the cancer is bladder cancer, breast cancer, cervical cancer, endometrial cancer, esophageal cancer, lung cancer, kidney cancer, ovarian cancer, rhabdomyosarcoma (or rhabdomyosarcoma), sarcoma, stomach cancer, testicular cancer, thymoma, melanoma or metastatic melanoma.

[0023] In some embodiments, the present invention provides a method for treating cancer associated with DUX4 expression or an elevation of DUX4 expression in a subject requiring treatment, comprising administering an effective amount of an adeno-associated virus to the subject, wherein the genome of the adeno-associated virus comprises: (a) at least one nucleic acid encoding a guide RNA (gRNA) encoding a double homeobox 4 (DUX4) comprising a nucleotide sequence described in any one of SEQ ID NOs 3 to 13 and 51 to 54; and (b) at least one nucleic acid encoding a guide RNA (gRNA) encoding a DUX4 that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence described in any one of SEQ ID NOs 14 to 24 and 55 to 58. (c) at least one nucleic acid comprising a nucleotide sequence described in any one of SEQ ID NOs 25 to 35 and 59 to 62, or a variant thereof comprising at least about 90% identity with the nucleotide sequence described in any one of SEQ ID NOs 25 to 35 and 59 to 62; (d) at least one nucleic acid comprising a nucleotide sequence described in any one of SEQ ID NOs 38 to 48 and 63 to 66, or a variant thereof comprising at least about 90% identity with the nucleotide sequence described in any one of SEQ ID NOs 38 to 48 and 63 to 66; or (e) any combination of these (a) to (d), the present invention provides a method comprising, in some embodiments, administering to said subject an effective amount of an adeno-associated virus comprising a nucleic acid encoding a Cas13 protein or a Cas13 ortholog or variant. In some embodiments, the Cas13 protein is Cas13b or Cas13b ortholog or a variant thereof.In some embodiments, the Cas13b protein is encoded by the nucleotide sequence described in SEQ ID NO. 36 or a variant thereof having at least about 80% identity with the sequence described in SEQ ID NO. 36. In some embodiments, the method further comprises the step of contacting a cell with an adeno-associated virus comprising a nucleic acid encoding DUX4 repressive RNA. In some embodiments, the expression of the nucleic acid encoding DUX4 repressive RNA is under the control of a U6 promoter, U7 promoter, T7 promoter, tRNA promoter, H1 promoter, minimal EF1-alpha promoter, minimal CMV promoter, CMV promoter, muscle creatine kinase (MCK) promoter, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or desmin promoter. In various embodiments, the cancer is a DUX4+ cancer. In various forms, the cancer is bladder cancer, breast cancer, cervical cancer, endometrial cancer, esophageal cancer, lung cancer, kidney cancer, ovarian cancer, rhabdomyosarcoma (or rhabdomyosarcoma), sarcoma, stomach cancer, testicular cancer, thymoma, melanoma or metastatic melanoma.

[0024] In some embodiments, the present invention provides a recombinant gene editing complex comprising at least one nucleic acid comprising a nucleotide sequence encoding Cas13 or a Cas13 ortholog or variant, and at least one nucleic acid comprising a nucleotide sequence encoding a gRNA that specifically hybridizes to a target nucleic acid sequence encoding a DUX4 and Cas13b direct repeat sequence, wherein binding of the complex to said target nucleic acid sequence inhibits DUX4 gene expression. In some embodiments, the present invention provides a recombinant gene editing complex comprising: (a) at least one nucleic acid encoding a guide RNA (gRNA) encoding a double homeobox 4 (DUX4) comprising a nucleotide sequence described in any one of SEQ ID NOs 3 to 13 and 51 to 54; and (b) at least one nucleic acid encoding a gRNA encoding DUX4 that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence described in any one of SEQ ID NOs 14 to 24 and 55 to 58. (c) at least one nucleic acid comprising a nucleotide sequence described in any one of SEQ ID NOs 25 to 35 and 59 to 62, or a variant thereof comprising at least about 90% identity with the nucleotide sequence described in any one of SEQ ID NOs 25 to 35 and 59 to 62; (d) at least one nucleic acid comprising a nucleotide sequence described in any one of SEQ ID NOs 38 to 48 and 63 to 66, or a variant thereof comprising at least about 90% identity with the nucleotide sequence described in any one of SEQ ID NOs 38 to 48 and 63 to 66; or (e) a nucleotide sequence encoding a gRNA and a Cas13b direct repeat sequence, comprising any combination of (a) to (d).In some embodiments, the recombinant gene editing complex further comprises an adeno-associated virus comprising a nucleic acid encoding a Cas13 protein, or a Cas13 ortholog or variant. In some embodiments, the Cas13 protein is Cas13b or a Cas13b ortholog or a variant thereof. In some embodiments, the Cas13b protein is encoded by the nucleotide sequence described in SEQ ID NO. 36 or a variant thereof having at least about 80% identity with the sequence described in SEQ ID NO. 36. In some embodiments, the recombinant gene editing complex further comprises an adeno-associated virus comprising a nucleic acid encoding a DUX4 inhibitory RNA. In some embodiments, the expression of the nucleic acid encoding the DUX4 repressive RNA is under the control of the U6 promoter, U7 promoter, T7 promoter, tRNA promoter, H1 promoter, minimal EF1-alpha promoter, minimal CMV promoter, CMV promoter, muscle creatine kinase (MCK) promoter, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or desmin promoter. In various embodiments, the recombinant gene editing complex is used for the treatment of muscle dystrophy or for the production of a drug for the treatment of muscle dystrophy. In some embodiments, the recombinant gene editing complex is used for the treatment of FSHD or for the production of a drug for the treatment of FSHD.

[0025] In some embodiments, the present invention provides the use of the nucleic acid and recombinant gene editing complex described herein for the production of a drug to reduce DUX4 expression and / or DUX4 overexpression in cells and / or for the treatment of muscle dystrophy. In some embodiments, muscle dystrophy is FSHD.

[0026] Other features and advantages of the present invention will become apparent from the following detailed description. However, while the detailed description and detailed embodiments represent preferred embodiments of the present invention, they should be understood as being provided merely as examples, as various changes and modifications within the spirit and scope of the present invention will become apparent to those skilled in the art from this detailed description. Brief explanation of the drawing

[0027] Figures 1a and 1b show the targeting sites of each Cas13b gRNA in DUX4 mRNA. Gray boxes represent DUX4 exons 1, 2, and 3. Introns 1, 2, and 3 act as 3' UTRs of DUX4. The miRNA reads targeting DUX4 are indicated by arrows. The miRNAs position-matched gRNAs are indicated by lines. Guide RNAs 1 through 11 are presented in Figure 1a. Guide RNAs 1 through 11 and 13 through 16 are presented in Figure 1b. Figures 2a to 2d show the screening results of CRISPR-Cas13b gRNA sequences designed to silence the DUX4 gene in HEK293 cells. Figure 2a shows the results of a Western blot test on the ability of each gRNA (gRNA 1 to 12 described herein) to efficiently silence the DUX4 gene at the protein level. Alpha-tubulin was used as a loading control. Figure 2b shows the Caspase 3 / 7 apoptosis assay at 48 hours after transfection. DUX4 induces apoptosis, and cells expressing DUX4 alone show elevated Caspase 3 / 7 activity, indicating that the cells are undergoing apoptosis. In contrast, all DUX4 transfected cells conferred with Cas13b along with effective guide RNAs (gRNA 1 to 12) were protected from apoptosis, displaying baseline-level Caspase 3 / 7 activity. Figure 2c shows the results of a cell viability assay validating the data in Figure 2b. Compared to samples treated with DUX4 alone, there were significantly more living cells in DUX4 transfected samples treated with Cas13b and gRNA. Figure 2d shows the results of a control experiment using Western blot to demonstrate that Cas13b itself does not reduce DUX4 protein expression without guide RNA. Figures 3a through 3e show RNAscope images of treated and untreated myotubes. Figure 3a shows an untreated FSHD myotube. Figure 3b shows an untreated healthy myotube. Figure 3c shows a Cas13b-transfected FSHD myotube. Figure 3d shows a FSHD myotube treated with Cas13b + gRNA3. Figure 3e shows a FSHD myotube treated with Cas13b + gRNA9. DUX4 mRNA foci are detected as dark perforations indicated by arrows. DUX4 RNA foci were reduced in CRISPR-Cas13b gRNA-treated samples (Figures 3d and 3e). Figure 4 shows the expression of the DUX4-related biomarker PRAME family member 12 (PRAMEF12) in FSHD myotubes treated with Cas13b + gRNA or the control group. DUX4 is a transcription factor known to activate multiple downstream genes, including PRAMEF12. FSHD myotubes treated with CRISPR-Cas13b gRNA1, gRNA2, gRNA3, and gRNA9 showed significantly reduced PRAMEF12 expression compared to cells treated with Cas13b alone or Cas13b + gRNA12. These results indicate that the decrease in DUX4 expression is associated with a decrease in DUX4-activated biomarkers. Each individual assay was performed twice for each condition. FIG. 5 shows DUX4 targeting sequences of gRNAs 1 to 11 and 13 to 16 (SEQ ID NOs 14 to 24 and 55 to 58) as disclosed in various embodiments of the present invention, and gRNA 1 to 11 and 13 to 16 expression cassettes (SEQ ID NOs 38 to 48 and 63 to 66) comprising a human U6 promoter, gRNAs (as described in SEQ ID NOs 3 to 13 and 51 to 54), and Cas13b direct repeat sequences (SEQ ID NO. 37). Figures 6a to 6c show the qRT-PCR results of DUX4 activity inhibition following transfection with Cas13b and various gRNA plasmids, as indicated by the decrease in the relative expression levels of various DUX4 targets (biomarkers), namely TRIM43 (Fig. 6a), MBD3L2 (Fig. 6b), and PRAMEF12 (Fig. 6c), in relation to DUX4 activity. RPL13A ...was used as a reference gene. The expression levels of these biomarkers were normalized to Cas13b-transfected myotubes alone as a negative control. The expression levels of each of the three biomarkers decreased after transfection with Cas13b and gRNA compared to Cas13b-transfected cells alone. Fig. 7 is In vitro The results of the gene silencing assay are shown. All gRNAs targeted DUX4 and were able to reduce renilla luciferase expression. The most significant silencing observed with this specific assay was achieved by gRNA1, 2, and 15. Figure 8 shows the measurement of the decrease in DUX4 expression using mCherry expression as a marker. In vitro The results of the fluorescence assay are shown. mCherry expression was significantly reduced in cells treated with gRNA1 and 2 compared to cells transfected with non-targeting gRNA (gRNA12) or Cas13b alone. FIGS. 9a to 9c show the TIC-DUX4 mouse model In vivoThe results of the experiment are shown. Figure 9a indicates that TIC-DUX4 mice treated with tamoxifen alone can be induced to develop mild progressive muscle pathology over time, as indicated by the relative expression of WAP 4 disulfide core domain protein 3 (WFDC3) in mouse muscles (anterior tibial (TA), gastrocnemius (GAS), and triceps (TRI)). Figure 9b shows increased DUX4 expression and tissue damage in the TA and GAS muscles of TIC-DUX4 mice after administration of 1 mg / kg tamoxifen three times a week over time (without administration of gRNA targeting DUX4). Figures 9c to 9e show the results of neonatal mouse intramuscular injection of AAV-CRISPR-Cas13 (containing gRNA1) in TIC-DUX4 mice. Neonatal TIC-DUX4 mice (1 to 2-day-old neonatal mice) were co-injected with 5e10 AAV.Cas13 and AAV.gRNA1 unilaterally on days 1 to 2. After 4 weeks, the mice were initiated with a tamoxifen protocol (1 mg / kg, 3 times a week for 4 weeks). WFDC3 expression was reduced in mice treated with gRNA1 and Cas13b. Figure 10 shows that gRNAs 1 to 11 and 13 to 16 reduce the toxicity of DUX4 and protect cells from apoptosis using the caspase 3 / 7 assay. Figure 11 shows the decrease in DUX4 mRNA and protein (as indicated by the relative expression of WFDC3) 3 weeks after co-injecting sAAV6-Cas13b and scAAV6-gRNA1 (5e10) into mouse TAs and then injecting DUX4 (1e9). Specific details for implementing the invention

[0028] Since the expression of DUX4 in muscle is known to cause muscle dystrophy, including but not limited to facial-scapulohumeral muscle dystrophy (FSHD), the present invention provides a novel strategy for achieving dual homeobox protein 4 (DUX4) gene silencing at the mRNA level using CRISPR / Cas13. Accordingly, in some embodiments, the product and method described herein are used for the treatment of FSHD.

[0029] The emergence of DUX4 as an important prospective therapeutic target for FSHD has lowered the barriers to pursuing translational studies on FSHD. By using guide RNA that targets DUX4 mRNA according to the Cas13b system to reduce DUX4 expression, there is a capability to provide treatment for the disease. The present invention provides evidence that DUX4 gene silencing triggered by an artificial guide RNA engineered in conjunction with the adoption of the Cas13 system downregulates DUX4 expression to protect against apoptosis, and provides a promising therapeutic approach to treating muscle dystrophies such as FSHD.

[0030] The DUX4 gene encodes a protein of approximately 45 kDA. See UniProtKB-Q9UBX2 (DUX4_HUMAN). Disrepression of the DUX4 gene is involved in the pathogenesis of FSHD. Disrepression can occur through two known mechanisms: D4Z4 repeat shrinkage or mutations in the chromatin modifyer genes SMCHD1 or DNMT3B. In the former case, the D4Z4 array consists of 11 to 100 repeats in unaffected subjects, whereas in FSHD1 patients, the array is reduced to 1 to 10 repeats (PubMed: 19320656). Either condition induces DNA hypomethylation at chromosome 4q35, thereby creating a chromosomal environment that permits DUX4 expression.

[0031] DUX4 is located on the D4Z4 giant satellite chromosome, which is epigenetically repressed in somatic tissues. D4Z4 chromatin unwinding in FSHD1 induces inefficient epigenetic repression of DUX4 and diversified patterns of DUX4 protein expression in a subset of skeletal muscle nuclei. Ectopic expression of DUX4 in skeletal muscle activates the expression of stem cell and germline genes, and when overexpressed in somatic cells, DUX4 can ultimately induce apoptosis.

[0032] Each D4Z4 repeat unit contains an open reading frame (named DUX4) encoding two homeoboxes, and the repeat array and ORF are conserved in other mammals. The encoded protein has been reported to function as a transcriptional activator for numerous genes, including some genes considered FSHD disease biomarkers such as ZSCAN4, PRAMEF12, TRIM43, and MBD3L2 (PMID: 24861551). The contraction of the giant satellite repeat sequence causes autosomal dominant FSHD. Alternative splicing generates multiple transcriptomic variants.

[0033] In some embodiments, the nucleic acid encoding human DUX4 is presented in the nucleotide sequence described in SEQ ID NO. 1. In some embodiments, the amino acid sequence of human DUX4 is presented in the amino acid sequence disclosed in SEQ ID NO. 2. In various embodiments, the method of the present invention also targets isoforms and variants of the nucleotide sequence described in SEQ ID NO. 1. In some embodiments, the variant comprises 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, and 70% identity with the nucleotide sequence described in SEQ ID NO. 1. In some embodiments, the method of the present invention targets isoforms and variants of nucleic acids comprising a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO. 2. In some embodiments, the variant comprises 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, and 70% identity with the nucleotide sequence encoding the amino acid sequence described in SEQ ID NO. 2.

[0034] To date, there is no cure for FSHD, and despite its relative prevalence among muscle dystrophies, few translation studies targeting FSHD have been published. Although several candidate genes for FSHD have been identified, many recent studies support the fact that the primary cause of the FSHD pathogenesis is the pro-apoptotic DUX4 gene, which encodes a transcription factor. Therefore, simply put, DUX4 overexpression is the primary pathogenic attack underlying FSHD.

[0035] The present invention includes, but is not limited to, the use of CRISPR / Cas13 to silencing or downregulating DUX4 expression to improve or / or treat subjects with muscular dystrophy, including FSHD or other disorders induced by a mutated DUX4 gene and altered mRNA versions resulting therefrom. The CRISPR-Cas adaptive immune system defends against microorganisms against foreign nucleic acids through RNA-guided endonucleases. The Cas13 enzyme plays a rapid key role in the CRISPR field for precise RNA editing (Cox et al. , RNA editing with CRISPR-Cas13, Science 358 (6366): 1019-27, 2017). Therefore, CRISPR / Cas13 is a gene regulation mechanism in eukaryotic cells that has been considered for the treatment of various diseases.

[0036] The present invention includes the use of CRISPR / Cas13 to silence or downregulate DUX4 expression to improve or / or treat subjects with cancer expressing DUX4. DUX4, an early embryonic transcription factor typically silenced in normal tissues, has been reported to be re-expressed in many solid tumors of the bladder, breast, lung, kidney, stomach, and other organ sites (Chew et al. , Developmental Cell 50 (5): 658-71.e7 (2019). DUX4 is also associated with melanoma and metastatic melanoma. Interpersonal communication. DUX4 is generally expressed during embryonic formation and development, but is later epigenetically repressed and silencing in somatic tissues. Furthermore, DUX4 has been reported to play a role in the processes of tumorigenesis and metastasis in sarcomas (Okimoto et al., J. Clin. Invest. 2019, 129 (8): 3401-3406). Generally, DUX4 is associated with bladder cancer, breast cancer, cervical cancer, endometrial cancer, esophageal cancer, lung cancer, renal cancer, ovarian cancer, rhabdomyocarcinoma (or rhabdomyosarcoma), sarcoma, gastric cancer, testicular cancer, thymoma, melanoma, or metastatic melanoma. With the advancement of cancer immunotherapy, it is important to identify genes that modulate antigen presentation and tumor immune interactions. It has been demonstrated that DUX4 expression blocks interferon-γ-mediated induction of MHC class I, implying suppressed antigen presentation in DUX4-mediated immune evasion. Clinical data from metastatic melanoma have verified that DUX4 expression is associated with a significant reduction in progression-free survival and overall survival in response to anti-CTLA-4. Therefore, as described herein, methods to inhibit DUX4 expression or DUX4 overexpression are therapeutic in the treatment and prevention of DUX4-related tumors or cancers.

[0037] Nucleic acid editing is used to treat genetic diseases, particularly at the RNA level, where disease-related sequences can generate functional protein products. Type VI CRISPR-Cas systems include the programmable single-effector RNA-guided ribonuclease Cas13. To engineer a robust knockdown-capable Cas13 ortholog, Type VI systems were profiled, and RNA editing was demonstrated in mammalian cells by using catalytically inactive Cas13 (dCas13) to guide adenosine-inosine deaminase activity by ADAR2 (an adenosine deaminase acting on RNA type 2) into the transcriptome. Referred to as RNA editing for programmable A-to-I substitution (repair), these systems can be used to edit the entire transcriptome containing pathogenic mutations (Cox et al. , above).

[0038] In some embodiments, the present invention uses a Type VI CRISPR-Cas system comprising a programmable single-effector RNA-guided RNase Cas13. In some embodiments, the present invention uses Cas13b (Smargon), a CRISPR-associated RNA-guided RNase having two crRNA variants. et al. Cas13b (Molecular Cell 65: 618-30, 2017) is used. Cas13b processes its own CRISPR array containing long and short direct repeat sequences, cleaves target RNA, and exhibits incidental RNase activity.

[0039] The present invention comprises various nucleic acids comprising, essentially composed of, or composed of the various nucleotide sequences described herein. In some embodiments, the nucleic acid comprises a nucleotide sequence. In some embodiments, the nucleic acid is essentially composed of a nucleotide sequence. In some embodiments, the nucleic acid is composed of a nucleotide sequence.

[0040] The present invention comprises Cas13, Cas13 orthologs and Cas13 variants, and methods using said Cas13, Cas13 orthologs and Cas13 variants. Accordingly, in some embodiments, Cas13 is Cas13a, Cas13b, or Cas13c. In some embodiments, Cas13a, Cas13b, or Cas13c is an optimized mammalian codon. In some embodiments, Cas13b is PspCas13b (catalog number pC0046, https: / / www.addgene.org / 103862 / ; also Cox et al.(See Science 24: 358(6366): 1019-1027, 2017). In exemplary embodiments, Cas13 is Cas13b comprising the nucleotide sequence described in SEQ ID NO. 36 or a variant thereof comprising at least about 70%, about 75%, about 80%, about 85%, about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the sequence described in SEQ ID NO. 36. In some embodiments, Cas13 is inserted into a mammalian expression vector comprising a viral vector for expression in cells. In some embodiments, a mammalian gRNA for the Cas13a, Cas13b, or Cas13c ortholog is cloned into a mammalian expression vector comprising a viral vector for expression in cells. In some embodiments, guide RNA and / or DNA encoding Cas13 is under the expression of a promoter. In some embodiments, the promoter is the U6 promoter.

[0041] In some embodiments, Cas13 DUX4 RNA silencing is superior to DNA-induced editing strategies due to the production of shortened arrays of D4Z4 repeat sequences in which the DUX4 gene is embedded within the same D4Z4 DNA repeat sequence, and even single-site DNA editing strategies can induce derepression of DUX4 by excising the entire end of chromosome 4 or by altering the epigenetic state of chromosome 4. Importantly, the present invention provides a Cas13-specific guide RNA that significantly reduces DUX4 expression.

[0042] In some embodiments, the present invention provides a DUX4 RNA-targeting guide RNA (gRNA). More specifically, the present invention provides a nucleic acid encoding a DUX4-encoding guide RNA (gRNA) comprising a nucleotide sequence described in any one of SEQ ID NOs. 3 to 13 and 51 to 54. These sequences comprise the antisense "guide" strand sequences of the invention of various sizes. The antisense guide strand is a strand of a mature miRNA duplex that becomes the RNA component of an RNA-induced silencing complex responsible for sequence-specific gene silencing. See Section 7.3 of Chapter 7, Muscle Gene Therapy, Springer Science + Business Media, LLC (2010).

[0043] For example, the first antisense guide strand, i.e., the gRNA of SEQ ID NO. 3, corresponds to the DUX4 sequence described in SEQ ID NO. 14 (it is its inverse complement and binds to it). See FIG. 5 and Table 1, which show the binding gRNA sequence and the DUX4 target sequence. The second antisense guide strand, i.e., the gRNA of SEQ ID NO. 4, binds to the DUX4 sequence described in SEQ ID NO. 14, etc.

[0044] Accordingly, the present invention comprises a nucleic acid encoding a guide RNA (gRNA) encoding DUX4, comprising a nucleotide sequence described in any one of SEQ ID NOs 3 to 13 and 51 to 54. In various embodiments, the present invention provides these gRNAs as gRNAs 1 to 11 and 13 to 16, respectively. In some embodiments, the present invention provides gRNA12 used as a control. gRNA12 is a Cas13b non-targeting gRNA (Cox et al. , Science 24, 358 (6366): 1019-27, 2017).

[0045] In various embodiments, the present invention comprises a nucleic acid encoding a gRNA encoding DUX4 that specifically hybridizes to a target nucleic acid encoding DUX4, comprising a nucleotide sequence described in any one of SEQ ID NOs 14 to 24 and 55 to 58. Additionally, the present invention comprises a nucleic acid further comprising a nucleotide sequence encoding a Cas13b direct repeat sequence (e.g., SEQ ID NO. 37 or a variant thereof having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the sequence described in SEQ ID NO. 37). In some embodiments, the Cas13b direct repeat sequence is located downstream of the gRNA or at the 3' end. Accordingly, in some embodiments, the nucleic acid comprises, is essentially composed of, or is composed of the nucleotide sequence described in any one of SEQ ID NOs 25 to 35 and 59 to 62. In some embodiments, the nucleic acid is a variant having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity with the nucleotide sequence described in any one of SEQ ID NOs 25 to 35 and 59 to 62. In some embodiments, the present invention comprises a nucleic acid comprising a promoter, gRNA, and a Cas13 direct repeat sequence comprising the nucleotide sequence described in any one of SEQ ID NOs 38 to 48 and 63 to 66. In some embodiments, the nucleic acid comprises a variant having at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleotide sequence described in any one of SEQ ID NOs 38 to 48 and 63 to 66.As described herein, such functional gRNAs and structures containing gRNAs are designed to target DUX4 RNA.

[0046] The present invention comprises a composition comprising any nucleic acid described herein in combination with a diluent, an excipient, or a buffer. In some embodiments, the present invention comprises a vector comprising any nucleic acid described herein.

[0047] Delivery of such gRNA containing a Cas13b direct repeat sequence along with a vector expressing a Cas13 enzyme (e.g., Cas13b) causes degradation of DUX4 mRNA, thereby reducing DUX4 protein. In some embodiments, the nucleic acid encoding the Cas13b enzyme comprises a variant thereof having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleotide sequence described in SEQ ID NO. 36 or the sequence described in SEQ ID NO. 36 or its biologically active fragment. In some embodiments, the Cas13b gene sequence is the pC0046-EF1a-PspCas13b-NES-HIV plasmid (Adgene).

[0048] In some embodiments, for the targeting of the DUX4 gene, one or more Cas13 construct(s) are co-transfected into the cells of interest along with one or more gRNA construct(s). In additional embodiments, one or more Cas13 construct(s) are co-transfected with one or more gRNA construct(s) and one or more microRNAs (miRNAs) designed to inhibit DUX4 gene expression in the cells of interest.

[0049] In some embodiments, the present invention involves the use of RNA interference to downregulate or inhibit DUX4 expression. RNA interference (RNAi) is a gene regulation mechanism in eukaryotic cells that has been considered for the treatment of various diseases. RNAi refers to the post-transcriptional regulation of gene expression mediated by miRNAs. miRNAs are small (21 to 25 nucleotides) non-coding RNAs that share sequence homology and base pairs with the 3' untranslated region of homologous messenger RNA (mRNA). Interactions between miRNAs and mRNAs guide a cellular gene silencing mechanism that prevents the translation of mRNA.

[0050] In an exemplary embodiment, the present invention includes the use of gRNA to interfere with DUX4 expression. In a further embodiment, the present invention includes the use of other inhibitory RNAs used in combination with the gRNA described herein to further reduce or block DUX4 expression.

[0051] As the understanding of natural RNAi pathways has advanced, researchers have designed artificial shRNAs and snRNAs used to regulate the expression of target genes for treating diseases. Several classes of small RNAs, including short (or small) interfering RNA (siRNA), short (or small) hairpin RNA (shRNA), and microRNA (miRNA), are known to trigger RNAi processes in mammalian cells, constituting similar classes of vector-expressed triggers [Davidson et al ., Nat. Rev. Genet. 12: 329-40, 2011; Harper, Arch. Neurol. 66: 933-8, 2009]. shRNA and miRNA from plasmids or virus-based vectors In vivo It is expressed in, and long-term gene silencing can be achieved with a single dose as long as the vector is present in the target cell nucleus and the driving promoter is active (Davidson et al. , Methods Enzymol. 392: 145-73, 2005). Importantly, while this vector-expressed approach leverages decades of progress already made in the field of muscle gene therapy, instead of expressing protein-coding genes, the vector load in RNAi therapy strategies is an artificial shRNA or miRNA cassette targeting the disease gene of interest. This strategy is used to express natural miRNAs. Each shRNA / miRNA is based on the hsa-miR-30a sequence and structure. The natural miR-30a mature sequence is replaced by unique sense and antisense sequences derived from the target gene.

[0052] As described above in this invention, the invention includes the use of other repressive RNAs in combination with the gRNAs described herein to further reduce or block DUX4 expression. Accordingly, in some embodiments, the products and methods of the invention also include short hairpin RNA or small hairpin RNA (shRNA) that affect DUX4 expression (e.g., knock down or repress expression). Short hairpin RNA (shRNA / hairpin vector) is an artificial RNA molecule having a tight hairpin turn that can be used to silence target gene expression via RNA interference (RNAi). shRNA is an advantageous medium for RNAi in that it has relatively low degradation and conversion rates, but it requires the use of an expression vector. Once the vector is transduced into the host genome, the shRNA is transcribed in the nucleus by polymerase II or polymerase III depending on promoter selection. The product mimics pre-microRNA (pri-miRNA) and is processed by Drosha. The generated pro-shRNA is extransported from the nucleus by expotin 5. Next, this product is processed by Dicer and loaded into an RNA-induced silencing complex (RISC). The sense (passenger) strand is degraded. The antisense (guide) strand guides the RISC to the mRNA having a complementary sequence. In the case of complete complementarity, the RISC cleaves the mRNA. In the case of incomplete complementarity, the RISC represses the translation of the mRNA. In both of these cases, the shRNA induces target gene silencing. In some embodiments, the present invention involves the production and administration of an AAV vector expressing a DUX4 antisense sequence via shRNA. The expression of shRNA is regulated by the use of various promoters. Promoter selection is essential to achieve robust shRNA expression. In various embodiments, polymerase II promoters such as U6 and H1 and polymerase III promoters are used. In some embodiments, U6 shRNA is used.

[0053] Accordingly, in some embodiments, the present invention uses U6 shRNA molecules to further repress, knockdown, or interfere with DUX4 gene expression. Traditional small / short hairpin RNA (shRNA) sequences are typically transcribed inside the cell nucleus from a vector containing a Pol III promoter, such as U6. The endogenous U6 promoter regulates the expression of U6 RNA, a small nuclear RNA (snRNA) normally involved in splicing, and has been well characterized [Kunkel et al. , Nature 322(6074): 73-7 (1986); Kunkel et al. , Genes Dev. 2(2): 196-204 (1988); Paule et al. [ , Nucleic Acids Res. 28(6): 1283-98 (2000)]. In some embodiments, the U6 promoter is used to regulate vector-based expression of shRNA molecules in mammalian cells [Paddison et al. , Proc. Natl. Acad. Sci. USA 99(3): 1443-8 (2002); Paul et al. [, Nat. Biotechnol. 20(5): 505-8 (2002)], this is because (1) the promoter is recognized by RNA polymerase III (Poly III) to regulate high levels of constitutive expression of shRNA, and (2) the promoter is active in most mammalian cell types. In some embodiments, the promoter is a type III Pol III promoter in that all elements necessary to regulate shRNA expression are located upstream of the transcription start site (Paule et al. , Nucleic Acids Res. 28(6): 1283-98). (2000)). The present invention includes both mouse and human U6 promoters. shRNA containing sense and antisense sequences from a loop-linked target gene moves from the nucleus to the cytoplasm, where Dicer processes it into small / short interfering RNA (siRNA).

[0054] In some embodiments, the product and method of the present invention comprise small nuclear ribonucleic acid (snRNA), commonly also referred to as U-RNA, to knock down or further inhibit DUX4 gene expression. snRNA is a class of small RNA molecules found in splicing spots and within casal bodies of the cell nucleus in eukaryotic cells. Small nuclear RNA is associated with a specific set of proteins, and the complex is referred to as small nuclear ribonucleoproteins (snRNP, often pronounced "snurps"). Each snRNP particle consists of an snRNA component and several snRNP-specific proteins (including Sm proteins, which are part of the nuclear protein family). SnRNA, together with associated proteins, forms a ribonucleoprotein complex (snRNP) that binds to a specific sequence on a precursor-mRNA substrate. These are transcribed by either RNA polymerase II or RNA polymerase III. snRNAs are often divided into two classes based on both common sequence characteristics and related protein factors, such as RNA-binding LSm proteins. The first class, known as Sm class snRNAs, consists of U1, U2, U4, U4atac, U5, U7, U11, and U12. Sm class snRNAs are transcribed by RNA polymerase II. The second class, known as Lsm class snRNAs, consists of U6 and U6atac. Unlike Sm class snRNAs, Lsm class snRNAs are transcribed by RNA polymerase III and do not leave the nucleus. In some embodiments, the present invention comprises the production and administration of an AAV vector containing U7 snRNA for the delivery of a DUX4 antisense sequence.

[0055] In some embodiments, the present invention uses a U7 snRNA molecule to further inhibit, knockdown, or interfere with DUX4 gene expression. U7 snRNA is normally involved in histone precursor-mRNA 3' end processing, but in some embodiments, it is converted into a multi-purpose tool for splicing coordination or as an antisense RNA that is continuously expressed in the cell [Goyenvalle et al. [Science 306 (5702): 1796-9 (2004)]. RNA generated by replacing the wild-type U7 Sm binding site with a common sequence derived from splicosomal snRNA is assembled with seven Sm proteins found in splicosomal snRNA (Fig. 7). Consequently, these U7 Sm OPT RNAs accumulate more efficiently in the nucleoplasm and can still bind to histone precursor-mRNA and act as competitive inhibitors of wild-type U7 snRNP, but will no longer mediate histone precursor-mRNA cleavage. By further replacing the sequence binding to downstream histone elements with one complementary to the specific target in the splicing substrate, U7 snRNAs capable of modulating specific splicing processes can be generated. An advantage of using U7 derivatives is that the antisense sequence is embedded in a small nuclear ribonucleoprotein (snRNP) complex. Furthermore, when inserted into a gene therapy vector, these small RNAs can be permanently expressed inside target cells after a single injection [Levy et al. , Eur. J. Hum. Genet. 18(9): 969-70 (2010); Wein et al. , Hum. Mutat. 31(2): 136-42, (2010); Wein et al. , Nat. Med. 20(9): 992-1000 (2014)]. The potential of the U7snRNA system in neuromuscular disorders using an AAV approach is In vivo It has been investigated in (AAV.U7) [Levy et al., Eur. J. Hum. Genet. 18(9): 969-70 (2010); Wein et al. , Hum. Mutat. 31(2): 136-42 (2010); Wein et al. [ , Nat. Med. 20(9): 992-1000 (2014)]. A single injection of this AAV9.U7, targeting defective RNA in a mouse model of Duechen muscle dystrophy, corrects disease in all muscles, including the heart and diaphragm, over the long term. Since DM1 patients exhibit cardiac abnormalities, the ability to target the heart is truly important.

[0056] U7 snRNA is normally involved in histone precursor mRNA 3' end processing, but it is also used as a versatile tool for splicing coordination or as an antisense RNA that is continuously expressed in cells. An advantage of using U7 derivatives is that the antisense sequence is embedded in a small nuclear ribonucleoprotein (snRNP) complex. Furthermore, when inserted into a gene therapy vector, these small RNAs can be permanently expressed within target cells after a single injection.

[0057] Embodiments of the present invention deliver a polynucleotide encoding the DUX4 repressive RNA and DUX4 gRNA disclosed herein using a vector (e.g., a viral vector such as an adeno-associated virus (AAV), adenovirus, retrovirus, lentivirus, equine-associated virus, alphavirus, poxvirus, herpesvirus, poliovirus, sindbis virus, and vaccinia virus). In some embodiments, each gRNA and each Cas13b are individually cloned within the vector. Thus, in some embodiments, the present invention comprises a vector comprising one or more of the nucleotide sequences described herein in the present invention. In some embodiments, the vector is an AAV vector. In some embodiments, the vector is a single-stranded AAV vector. In some embodiments, the AAV is a recombinant AAV (rAAV). In some embodiments, the rAAAV lacks the rep and cap genes. In some embodiments, the rAAV is a self-complementary (sc) AAV.

[0058] In some embodiments, the present invention utilizes an adeno-associated virus (AAV) to deliver nucleic acids encoding inhibitory RNA, including gRNA targeting DUX4 mRNA, to knock down or inhibit DUX4 expression. In some embodiments, the AAV is used to deliver nucleic acids encoding Cas13 or Cas13 orthologs or variants. The AAV is a replication-defective parvovirus, and its single-stranded DNA genome is approximately 4.7 kb in length, containing 145 nucleotide inverted terminal repeats (ITRs). A number of serotypes of the AAV exist. The nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV-1 is provided at GeneBank accession number NC_002077; the complete genome of AAV-2 is provided at GeneBank accession number NC_001401 and Srivastava et al., J. Virol., 45: 555-564 (1983); the complete genome of AAV-3 is provided at GeneBank accession number NC_1829; the complete genome of AAV-4 is provided at GeneBank accession number NC_001829; the genome of AAV-5 is provided at GeneBank accession number AF085716; the complete genome of AAV-6 is provided at GeneBank accession number NC_001862; and at least parts of the genomes of AAV-7 and AAV-8 are provided at GeneBank accession numbers AX753246 and AX753249, respectively (see also U.S. Patents 7,282,199 and 7,790,449 regarding AAV-8); the genome of AAV-9 is Gao et al., J. Virol., The AAV-10 genome is provided in 78: 6381-6388 (2004); the AAV-11 genome is provided in Mol. Ther., 13(1): 67-76 (2006); and the AAV-11 genome is provided in Virology, 330(2): 375-383 (2004). Cis-action sequences that induce viral DNA replication (rep), capsidization / packaging, and incorporation into the host cell chromosome are contained within the AAV ITR. Three AAV promoters (referred to as p5, p19, and p40 for their relative map positions) drive the expression of two AAV internal open readframes encoding the rep and cap genes. Two rep promoters (p5 and p19) coupled with differential splicing of a single AAV intron (nucleotides 2107 and 2227) produce four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. Rep proteins possess multienzymatic characteristics that act as the ultimate cause of viral genome replication. The cap gene is expressed from the p40 promoter and encodes three capsid proteins, VP1, VP2, and VP3. Alternative splicing and non-common translation initiation sites are involved in the production of the three related capsid proteins. A single common polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158: 97-129 (1992).

[0059] AAV possesses unique characteristics that make it a suitable candidate as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cultured cells is non-cytotoxic, and natural infections in humans and other animals are silent and asymptomatic. Furthermore, AAV In vivoIt infects many mammalian cells, where there is potential to target many different tissues. Furthermore, AAVs slowly transduce dividing and non-dividing cells and can maintain them as nuclear episomes (extrachromosomal elements) that are essentially transcriptionally active throughout the cell's lifespan. The AAV proviral genome is inserted as DNA cloned within a plasmid, which enables the construction of a recombinant genome. Additionally, because signals directing AAV replication, genomic envelope formation, and assimilation are contained within the ITR of the AAV genome, part or all of the internal approximately 4.3 kb of the genome (encoding the replication and structural capsid protein, rep-cap) can be replaced by foreign DNA. The rep and cap proteins can be provided in trans. Another important feature of AAV is that it is a highly stable and robust virus. This allows it to easily withstand the conditions used to inactivate adenoviruses (56°C to 65°C for several hours), thereby reducing the importance of cryopreservation for AAV. AAV can be lyophilized, and AAV-infected cells are not resistant to superinfection. In some embodiments, AAV is used to deliver repressive RNA, including gRNA, under the control of the U6 promoter. In some embodiments, AAV is used to deliver repressive RNA under the control of the U7 promoter. In some embodiments, AAV is used to deliver both gRNA and other repressive RNA under the control of the U7 and U6 promoters. In some embodiments, AAV is used to deliver gRNA, repressive RNA, and Cas13 (or Cas13 orthologs or variants) under the control of the U6 promoter.

[0060] The recombinant AAV genome of the present invention comprises one or more AAV ITRs adjacent to at least one DUX4-targeted polynucleotide construct. In some embodiments, the polynucleotide is gRNA. In some embodiments, the gRNA is administered together with another polynucleotide construct targeting DUX4. In various embodiments, the gRNA is expressed under various promoters, including but not limited to U6, U7, tRNA, H1, minimal CMV (e.g., miniCMV), T7, EF1-alpha, minimal EF1-alpha, and skeletal muscle-specific promoters. In some embodiments, these muscle-specific promoters include but are not limited to unc45b, tMCK, minimal MCK, CK6, CK7, MHCK7, and CK1. Specifically, in various embodiments, this strategy is used to achieve more efficient expression of the same gRNA in multiple copies of a single backbone. The AAV DNA of the rAAV genome may be derived from any AAV serotype from which the recombinant virus may be derived, including but not limited to AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAV rh.74. As described above in this document, the nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0061] The DNA plasmid of the present invention comprises the rAAV genome of the present invention. The DNA plasmid is delivered to a cell that is allowed to be infected with an AAV helper virus (e.g., adenovirus, E1-deleted adenovirus, or herpesvirus) in order to assemble the rAAV genome into an infectious viral particle. The technology for producing rAAV particles in which the AAV genome, rep and cap genes, and helper virus function are provided to the cell is standard in the industry. The production of rAAV requires that the following components—the rAAV genome, the AAV rep and cap genes separated from the rAAV genome (i.e., not present within the genome), and the helper virus function be present within a single cell (referred to herein as the packaging cell). The AAV rep gene may come from any AAV serotype from which the recombinant virus may originate, and may come from an AAV serotype different from the rAAV genome ITR, including but not limited to AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAV rh.74. In some embodiments, the AAV DNA of the rAAV genome is derived from any AAV serotype from which the recombinant virus may originate, including but not limited to AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAV rh.74. Other types of rAAV variants, for example, rAAVs having capsid mutations, are also included in the invention. For example, Marsic et al.See , Molecular Therapy, 22 (11): 1900-1909 (2014). As mentioned above, nucleotide sequences of the genomes of various AAV serotypes are known in the art. The uses of homologous components are specifically considered. The production of gaseous type rAAV is disclosed, for example, in International Patent Application WO 01 / 83692, the full text of which is cited herein by reference.

[0062] The recombinant AAV genome of the present invention comprises, for example, one or more AAV ITRs adjacent to polynucleotides encoding one or more DUX4 repressive RNAs. Commercial suppliers, such as Ambion Inc. (Austin, TX), Darmacon Inc. (Lafayette, CO), InvivoGen (San Diego, CA), and Molecular Research Laboratories, LLC (Herndon, VA), produce custom repressive RNA molecules. Additionally, commercial kits are available to produce custom siRNA molecules, such as the Silencerze siRNA production kit (Ambion Inc., Austin, TX) or the psiRNA system (InvivoGen, San Diego, CA). An embodiment comprises an rAAV genome comprising a nucleic acid comprising the nucleotide sequences described in any SEQ ID NOs 25 to 36 and 59 to 62.

[0063] The method for generating packaging cells is to create a cell line that stably expresses all the components necessary for AAV particle production. For example, an rAAV genome lacking the AAV rep and cap genes, AAV rep and cap genes isolated from the rAAV genome, and a plasmid (or multiple plasmids) containing selectable markers, such as a neomycin resistance gene, are incorporated into the cell genome. GC tailing of the AAV genome (Samulski et al. , 1982, Proc. Natl. Acad. S6. USA, 79: 2077-2081), addition of a synthetic linker containing a restriction endonuclease cleavage site (Laughlin et al. It was introduced into bacterial plasmids by procedures such as those described in *Senapathy & Carter, 1984, J. Biol. Chem., 259: 4661-4666* (*Senapathy & Carter, 1984, J. Biol. Chem., 259: 4661-4666*). Next, the packaging cell line is infected with a helper virus, such as an adenovirus. The advantage of this method is that the cells are selectable and suitable for the mass production of rAAV. Another example of a suitable method is to use adenoviruses or baculoviruses rather than plasmids to introduce the rAAV genome and / or rep and cap genes into packaging cells.

[0064] The general principles of rAAV production are reviewed, for example, in Carter, 1992, Current Opinions in Biotechnology, 1533–539; and Muzyczka, 1992, Curr. Topics in Microbial. and Immunol., 158: 97–129. Various approaches are Ratschin et al. , Mol. Cell. Biol. 4: 2072 (1984); Hermonat et al. , Proc. Natl. Acad. Sci. USA, 81: 6466 (1984); Tratschin et al. , Mo1. Cell. Biol. 5: 3251 (1985); McLaughlin et al. , J. Virol., 62: 1963 (1988); and Lebkowski et al. , 1988 Mol. Cell. Biol., 7: 349 (1988); Samulski et al.(1989, J. Virol., 63: 3822-3828); U.S. Patent US 5,173,414; International Patent Application WO 95 / 13365 and corresponding U.S. Patent US 5,658,776; International Patent Application WO 95 / 13392; WO 96 / 17947; PCT / US98 / 18600; WO 97 / 09441 (PCT / US96 / 14423); WO 97 / 08298 (PCT / US96 / 13872); WO 97 / 21825 (PCT / US96 / 20777); WO 97 / 06243 (PCT / FR96 / 01064); WO 99 / 11764; Perrin et al. (1995) Vaccine 13: 1244-1250; Paul et al. (1993) Human Gene Therapy 4: 609-615; Clark et al. (1996) Gene Therapy 3: 1124-1132; U.S. Patents US 5,786,211; US ​​5,871,982; and US 6,258,595. The foregoing literature is incorporated herein by reference in its entirety, with particular emphasis on the relevant sections of literature regarding rAAV production.

[0065] Accordingly, the present invention provides a packaging cell that produces an infectious rAAV. In one embodiment, the packaging cell is a stably transformed cancer cell such as HeLa cells, 293 cells, and PerC.6 cells (homologous 293 lineage). In another embodiment, the packaging cell is a non-transformed cancer cell, such as a low passage 293 cell (human fetal kidney cell transformed with adenovirus E1), MRC-5 cell (human fetal fibroblast), WI-38 cell (human fetal fibroblast), Vero cell (monkey kidney cell), and FRhL-2 cell (rhesus monkey fetal lung cell).

[0066] In some embodiments, rAAV is purified by standard methods in the art, such as column chromatography or a cesium chloride gradient. Methods for purifying rAAV vectors from helper viruses are known in the art, for example, Clark et al. Hum. Gene Ther., 10(6): 1031-1039 (1999); Schenpp and Clark, Methods Mol. Med., 69: 427-443 (2002); described in US Patent 6,566,118 and international patent application WO 98 / 09657.

[0067] In another embodiment, the present invention comprises a composition comprising rAAV comprising any of the structures described herein. In some embodiments, the present invention comprises a composition comprising rAAV for delivering gRNA described herein. In some embodiments, the present invention comprises a composition comprising one or more gRNAs described herein together with one or more DUX4 inhibitory RNAs. In some embodiments, the present invention comprises a composition comprising rAAV for delivering gRNA and Cas13 as described herein. In some embodiments, the present invention comprises a composition comprising rAAV and one or more DUX4 inhibitory RNAs for delivering gRNA and Cas13 as described herein. The compositions of the present invention comprise rAAV and one or more pharmaceutically or physiologically acceptable carriers, excipients, or diluents. Acceptable carriers and diluents are non-toxic to the recipient, preferably inactive at the dose and concentration used, and include buffers such as phosphates, citric acid, or other organic acids; antioxidants such as ascorbic acid; low molecular weight polypeptides; Proteins such as serum albumin, gelatin, or immunoglobulin; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrin; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as Tween, Pluronics, or polyethylene glycol (PEG).

[0068] Sterile injectable solutions are prepared by incorporating rAAV in the required amount with various other ingredients listed above into a suitable solvent, and then filter-sterilizing. Generally, dispersants are prepared by incorporating a sterile active ingredient into a basic dispersion medium and a sterile vehicle containing other necessary ingredients from those listed above. For sterile powders for the preparation of sterile injectable solutions, a preferred preparation method is a vacuum drying and freeze-drying technique to obtain a powder of the active ingredient and any additional desired ingredients from a previously sterile filtered solution.

[0069] The potency of rAAV to be administered in the method of the present invention will vary depending, for example, on the specific rAAV, the mode of administration, the therapeutic goal, the individual, and the cell type(s) being targeted, and may be determined by standard methods in the industry. The potency of rAAV is approximately 1 × 10⁻⁶ 6 Pieces, about 1 × 10⁶ 7 Pieces, about 1 × 10⁶ 8 Pieces, about 1 × 10⁶ 9 Pieces, about 1 × 10⁶ 10 Pieces, about 1 × 10⁶ 11 Pieces, about 1 × 10⁶ 12 Pieces, about 1 × 10⁶ 13 Pieces, about 1 × 10⁶ 14 The range of DNase-resistant particles (DRP) per mL can be greater than 1. 7 Pieces vg, 1 × 10 8 Pieces vg, 1 × 10 9 Pieces vg, 1 × 10 10 pieces vg, 1 × 10 11 Pieces vg, 1 × 10 12 Pieces vg, 1 × 10 13 pieces vg, 1 × 10 14 It can be expressed as (vg).

[0070] In some embodiments, the present invention provides a method for delivering any one or more nucleic acids encoding a gRNA encoding DUX4 that specifically hybridizes to a target nucleic acid encoding DUX4, comprising nucleotide sequences described in any one of SEQ ID NOs 3 to 13 and 51 to 54; 25 to 35 and 59 to 62; and 38 to 48 and 63 to 66, or nucleotide sequences described in any one of SEQ ID NOs 14 to 24 and 55 to 58, to a subject who requires the same, comprising administering to the subject the AAV encoding the gRNA encoding DUX4 described herein.

[0071] In some embodiments, the present invention provides AAV transgenic cells for the delivery of DUX4 gRNA. In vivo or In vitro A method for transfecting target cells with rAAV is included in the present invention. The method comprises administering an effective dose or multiple effective doses of a composition containing the rAAV of the present invention to a subject, including an animal (e.g., human) that requires it. If the administration is given prior to the onset of muscular dystrophy, the administration is prophylactic. If the administration is given after the onset of muscular dystrophy, the administration is therapeutic. In embodiments of the present invention, the effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the muscular dystrophy being treated, slows or prevents the progression of muscular dystrophy, reduces the degree of muscular dystrophy, induces regression (partial or total) of muscular dystrophy, and / or prolongs survival. In some embodiments, muscular dystrophy is FSHD.

[0072] Administration of an effective dose of the composition may be by standard routes of the art, including but not limited to intramuscular, parenteral, intravascular, intravenous, oral, buccal, nasal, pulmonary, intracranial, intraventricular, intradural, intraosseous, intraocular, rectal, or vaginal. The administration route and serotype(s) of the AAV component of the rAAV of the present invention (specifically, AAV ITR and capsid protein) may be selected and / or matched by a person skilled in the art with consideration of the disease state of infection and / or the disease state being treated and target cell / tissue(s), such as cells expressing DUX4. In some embodiments, the administration route is intramuscular. In some embodiments, the administration route is intravenous.

[0073] Specifically, the actual administration of rAAV of the present invention can be achieved by using any physical method to deliver the rAAV recombinant vector into the target tissue of an animal. Administration according to the present invention includes, but is not limited to, injection into muscle, bloodstream, central nervous system, and / or directly into the brain or other organs. Simply resuspending rAAV in phosphate-buffered saline has been proven sufficient to provide a vehicle useful for muscle tissue expression, and there are no known limitations regarding carriers or other components that may be co-administered with rAAV (although compositions that degrade DNA should be avoided in the normal manner of using rAAV). The capsid protein of rAAV may be modified so that rAAV targets a specific target tissue of interest, such as muscle. For example, see International Patent Application WO 02 / 053703, which is referenced herein. The pharmaceutical composition may be prepared as an injectable formulation or a topical formulation delivered to the muscle by transdermal delivery. Numerous formulations for both intramuscular injection and transdermal delivery have been previously developed and may be used in the practice of the present invention. rAAV may be used with any pharmaceutically acceptable carrier for easy administration and handling.

[0074] For intramuscular injection, sterile solutions as well as adjuvants such as sesame oil or peanut oil or water-soluble propylene glycol may be used. These water-soluble solutions may be buffered if desired, and the liquid diluent is first made isotonic with saline or glucose. As a free acid, a solution of rAAV (where DNA contains acidic phosphate groups) or a pharmaceutically acceptable salt may be prepared with water appropriately mixed with a surfactant such as hydroxypropylcellulose. Dispersants for rAAV may also be prepared with glycerol, liquid polyethylene glycol, mixtures thereof, and oils. Under normal storage and use conditions, these preparations contain preservatives to prevent microbial growth. In this regard, all sterile water-soluble media used are readily obtainable by standard techniques well known to those skilled in the art.

[0075] Pharmaceutical forms suitable for injection include sterile aqueous solutions or dispersants and sterile powders for the immediate preparation of sterile injectable solutions or dispersants. In all cases, said forms must be sterile and fluid enough to be easily injected. They must be stable under manufacturing and storage conditions and preserved against the action of microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), suitable mixtures thereof, and vegetable oils. In some embodiments, appropriate fluidity may be maintained by the use of a coating agent, for example, lecithin; in the case of dispersants, by maintaining the required particle size; and by the use of a surfactant. Prevention of microbial action may be caused by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, it will be desirable to include an isotonic agent, such as sugar or sodium chloride. Prolonged absorption of the injectable composition may be caused by the use of agents that delay absorption, such as aluminum monostearate and gelatin.

[0076] Sterile injectable solutions are prepared by incorporating rAAV in the required amount with various other ingredients listed above into a suitable solvent, and then filter-sterilizing. Generally, dispersants are prepared by incorporating a sterile active ingredient into a basic dispersion medium and a sterile vehicle containing other necessary ingredients from those listed above. For sterile powders for the preparation of sterile injectable solutions, a preferred preparation method is a vacuum drying and freeze-drying technique to obtain a powder of the active ingredient and any additional desired ingredients from a previously sterile filtered solution.

[0077] The term "transduction" refers to the replication-defective rAAV of the present invention inducing the expression of DUX4 inhibitory RNA by a recipient cell, In vivo or In vitro It is used to describe the administration / delivery of one or more DUX4 inhibitory RNAs, including but not limited to gRNA, and one or more nucleotides encoding Cas13 into a recipient cell.

[0078] In one embodiment, transduction using rAAV is In vitro This is performed in. In one embodiment, the desired target cells are removed from the subject, transfected with rAAV, and reintroduced into the subject. Alternatively, allogeneic or xenogeneic cells may be used where these cells do not generate an inappropriate immune response in the subject.

[0079] Methods suitable for transduction and reintroduction of transduced cells into a subject are known in the art. In one embodiment, cells are combined with rAAV in a suitable medium, for example, and cells containing DNA of interest are screened using conventional techniques such as Southern blotting and / or PCR or using selectable markers. In vitro Transgenic cells may be introduced. Next, the transgenic cells may be formulated into a pharmaceutical composition, and the composition may be introduced into a subject by various techniques, such as intramuscular, intravenous, subcutaneous, and intraperitoneal injection, or, for example, by injection into smooth muscle and cardiac muscle using a catheter.

[0080] The present invention provides a method for administering an effective dose of rAAV (or essentially a dose administered simultaneously or a dose given at intervals) comprising DNA encoding gRNA targeted to interfere with DUX4 expression and DNA encoding Cas13b direct repeat sequence and Cas13 to a subject requiring it.

[0081] Transduction of cells into the rAAV of the present invention induces DUX4 expression and sustained expression of guide RNA targeting the Cas13b direct repeat sequence. Accordingly, the present invention provides a method for administering / delivering rAAV expressing repressive RNA to a subject. Such subject is an animal subject, and in some embodiments, the subject is a human.

[0082] These methods include transfecting blood and vascular systems, central nervous systems and tissues (including, but not limited to, muscle cells and neurons, tissues such as muscles including skeletal muscle, organs such as the heart, brain, skin, and eyes, and endocrine systems and glands such as endocrine glands and salivary glands) with one or more rAAVs of the present invention. In some embodiments, transfection is performed with a gene cassette containing tissue-specific control elements. For example, one embodiment of the present invention [Weintraub], such as the myoD gene family, is not limited thereto but includes actin and myosin gene families [Weintraub et al. [Refer to , Science, 251: 761-766 (1991)], myocyte-specific enhancer binding factor MEF-2 [Cserjesi and Olson, Mol. Cell Biol. 11: 4854-4862 (1991)], regulatory element derived from human skeletal actin gene [Muscat et al. , Mol. Cell Biol., 7: 4089-4099 (1987)], cardiac actin gene, muscle creatine sequence element [Johnson et al. [Refer to , Mol. Cell Biol., 9: 3393-3399 (1989)] and regulatory elements derived from mouse creatine kinase enhancer (mCK) factor, skeletal high-speed switch troponin C gene, low-speed cardiac troponin C gene and low-speed switch troponin I gene: hypozia-inducible nuclear factor [Semenza et al., Proc. Natl. Acad. Sci. USA, 88: 5680-5684 (1991)], steroid-derived elements and promoters including glucocorticoid-responsive elements (GRE) [see Mother and White, Proc. Natl. Acad. Sci. USA, 90: 5603-5607 (1993)], tMCK promoter [Wang et al. [See , Gene Therapy, 15: 1489-1499 (2008)], a CK6 promoter [Wang et al., above] and other regulatory elements are included. A method for transducing muscle cells and muscle tissue driven by muscle-specific regulatory elements is provided.

[0083] Since AAV targets all invaded organs expressing DUX4, the present invention comprises delivering DNA encoding inhibitory RNA to all cells, tissues, and organs of the subject. In some embodiments, the blood and vascular system, central nervous system, muscle tissue, heart, and brain In vivo It is an attractive target for DNA delivery. The present invention comprises the sustained expression of a DUX4 inhibitory gRNA from transfected cells that affect DUX4 expression (e.g., knock down or inhibit expression). In some embodiments, the present invention comprises the sustained expression of a DUX4 inhibitory gRNA from transfected muscle fibers. “Muscle cell” or “muscle tissue” means a cell or group of cells derived from any type of muscle (e.g., skeletal muscle and smooth muscle, e.g. from digestive tract, bladder, blood vessel, or heart tissue). In some embodiments, these muscle cells may be differentiated or undifferentiated, such as myoblasts, myocytes, myotubes, cardiomyocytes, and cardiomyoblasts.

[0084] In another aspect, the present invention provides a method for preventing or inhibiting the expression of a DUX4 gene in a cell, comprising the step of contacting the cell with an rAAV encoding a DUX4 inhibitory gRNA, wherein the gRNA is encoded by a nucleotide sequence described in any one of SEQ ID NOs 3 to 13 and 51 to 54. In some aspects, the gRNA is encoded by a nucleotide sequence having about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the sequence described in any one of SEQ ID NOs 3 to 13 and 51 to 54. In some embodiments, the expression of DUX4 is suppressed to at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100%.

[0085] In another aspect, the present invention provides a method for preventing or inhibiting the expression of a DUX4 gene in a cell, comprising the step of contacting the cell with an rAAV encoding a DUX4 inhibitory gRNA, wherein the gRNA specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence described in any one of SEQ ID NOs 14 to 24 and 55 to 58. In some embodiments, the expression of DUX4 is suppressed to at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100%.

[0086] In another aspect, the present invention provides a method for preventing or inhibiting the expression of a DUX4 gene in a cell, comprising the step of contacting the cell with a vector encoding a DUX4 inhibitory gRNA and a Cas13b direct repeat sequence, e.g., an rAAV vector, wherein the gRNA and the Cas13b direct repeat sequence are encoded by nucleotide sequences described in any one of SEQ ID NOs. 25 to 35 and 59 to 62 or variants thereof. In another aspect, the present invention provides a method for preventing or inhibiting the expression of a DUX4 gene in a cell, comprising the step of contacting the cell with a vector comprising a nucleotide sequence encoding a DUX4 inhibitory gRNA and a Cas13b direct repeat sequence, wherein the nucleotide sequence described in any one of SEQ ID NOs. 38 to 48 and 63 to 66 or variants thereof. In some embodiments, the variants thereof have at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the sequence described in any one of SEQ ID NOs 25 to 35 and 59 to 62 or 38 to 48 and 63 to 66. In some embodiments, the expression of DUX4 is suppressed to at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100%.

[0087] In another aspect, the present invention provides a method for preventing or treating muscle dystrophy (including, but not limited to, FSHD), comprising administering to a subject a vector encoding a polynucleotide sequence comprising a U6 promoter sequence, a gRNA sequence targeting DUX4, and a Cas13b direct repeat sequence, wherein the polynucleotide sequence comprises any one of the nucleotide sequences of SEQ ID NOs. 3 to 13 and 51 to 54, 25 to 35 and 59 to 62, or 38 to 48 and 63 to 66. In some aspects, the Cas13b direct repeat sequence comprises the nucleotide sequence described in SEQ ID NO. 37. In some aspects, the vector is an AAV. In some aspects, the AAV is a recombinant AAV (rAAV). In some aspects, the rAAV lacks the rep and cap genes. In some embodiments, rAAV is a self-complementary (sc) AAV. In some embodiments, AAV is used in conjunction with the RNA-editing Cas13 protein. In some embodiments, Cas13 is specifically guided to a transcript of interest using sequence-specific gRNA.

[0088] In some embodiments, the present invention provides a recombinant gene editing complex comprising a nucleic acid comprising various gRNA nucleotide sequences described herein that are attached to a Cas13b direct repeat sequence delivered in combination with Cas13 (e.g., Cas13b) to edit the DUX4 gene. Such gene editing complexes are used to manipulate the expression of DUX4 and to treat abnormal DUX4 expression, such as muscular dystrophy, in which disease-related sequences such as DUX4 are highly expressed, and specifically related genetic diseases at the RNA level. A Type VI CRISPR-Cas system comprises a programmable single-effector RNA-guided RNase Cas13. The Cas13 enzyme is capable of robust knockdown, and RNA editing into transcripts in mammalian cells can be demonstrated using catalytically inactive Cas13 (Cox et al. , RNA Editing with CRISPR-Cas13, Science. 24, 358 (6366): 1019-1027, 2017).

[0089] Because Cas13 is of prokaryotic origin and is delivered to target cells using more traditional gene substitution strategies, CRISPR-Cas13 does not rely on endogenous enzymes to achieve target gene silencing. The CRISPR-Cas13 system disclosed herein targeting DUX4 can be used alone or in combination with repressive RNA (RNAi) to enhance silencing. Although RNAi performs DUX4 silencing efficiently, silencing by said RNAi rarely induces 100% silencing of the target DUX4 gene. Accordingly, in some embodiments, the present invention provides the use of both the recombinant gene editing system described herein and the method for targeting the DUX4 gene in combination with other RNAi products.

[0090] "Treating" includes improving or suppressing one or more symptoms of muscular dystrophy, including but not limited to muscle wasting, muscle weakness, muscle tone, skeletal muscle problems, retinal abnormalities, hip weakness, facial weakness, abdominal muscle weakness, joint and spinal abnormalities, lower limb weakness, shoulder weakness, hearing loss, muscle inflammation, and asymmetric weakness.

[0091] Molecular, biochemical, histological, and functional endpoints demonstrate the therapeutic efficacy of RNA interference-based products, including the Cas13 protein editing of RNA to suppress the expression of the DUX4 gene on human chromosome 4q35 and the method disclosed herein. The endpoints considered by the present invention include one or more of the reduction or elimination of DUX4 protein expression, which is applicable to the treatment of muscular dystrophy, including but not limited to FSHD and other disorders associated with elevated DUX4 expression.

[0092] The present invention also provides a kit for use in treating the disorder described herein. Such a kit comprises at least a first sterile composition comprising any nucleic acid described herein or any viral vector described herein within a pharmaceutically acceptable carrier. Another component is a second therapeutic agent for treating the disorder, optionally comprising a container and a vehicle suitable for administering the therapeutic composition. The kit optionally comprises a solution or buffer for suspending, diluting, or delivering the first and second compositions.

[0093] In one embodiment, such a kit contains a nucleic acid or vector in a diluent packaged in a container such as a sealed bottle or dish, along with a label included in the packaging that describes the use of the nucleic acid or vector or is immobilized in the container. In one embodiment, the diluent is present in the container such that the upper space of the container (e.g., the amount of air between the liquid formulation and the top of the container) is very small. Preferably, the amount of upper space is negligible (i.e., almost none).

[0094] In some embodiments, the formulation comprises a stabilizer. The term “stabilizer” refers to a substance or excipient that protects the formulation from adverse conditions, such as those occurring during heating or freezing, and / or extends the stability or shelf life of the formulation in a stable state. Examples of stabilizers include, but are not limited to, sugars such as sucrose, lactose, and mannose; sugar alcohols such as mannitol; amino acids such as glycine or glutamic acid; and proteins such as human serum albumin or gelatin.

[0095] In some embodiments, the formulation comprises an antimicrobial preservative. The term “antimicrobial preservative” refers to any substance added to the composition that inhibits the growth of microorganisms that may be introduced upon repeated opening of the vial or container used. Examples of antimicrobial preservatives include, but are not limited to, substances such as timorosal, 2-phenoxyethanol, benzethonium chloride, and phenol.

[0096] In some embodiments, the kit includes a label and / or instructions describing the use of the reagent provided in the kit. The kit also optionally includes a catheter, syringe, or other delivery device for delivering one or more compositions used in the methods described herein.

[0097] The entire application is intended to be associated as an integrated invention, and it should be understood that any combination of features described herein is considered even if such combination of features is not found in the same sentence, paragraph, or section of the application. Furthermore, the invention includes all embodiments of the invention that are, for example, narrower in scope in any way than the variations specifically mentioned above. With respect to aspects of the invention described in the genus, every individual species is considered a separate aspect of the invention. With respect to aspects of the invention described or claimed in the singular form (“a” or “an”), these terms should be understood to mean “one or more” unless the context explicitly requires a more limited meaning. Where an aspect of the invention is described as “comprising” a feature, the embodiment is also considered to be “composed of” or “essentially composed of” said feature.

[0098] All publications, patents, and patent applications cited in this specification are cited herein by reference as indicated so that the full text thereof is specifically and individually cited in accordance with the present invention.

[0099] The embodiments and implementations described herein are for illustrative purposes only, and various modifications and changes will be suggested to those skilled in the art in light of this, and are understood to be included within the spirit and scope of this application and the scope of the appended claims.

[0100] Examples

[0101] Aspects and embodiments of the present invention are illustrated by the following examples, which do not imply that the scope of the invention is limited in any way.

[0102] Example 1

[0103] Design and testing of DUX4-targeted Cas13b-gRNA

[0104] Design of DUX4-targeted Cas13b-gRNA

[0105] A DUX4-targeting Cas13b-gRNA was designed. Prevotella ( Prevotella ) The Cas13b enzyme, P5-125 (PspCas13b), and associated gRNA from the species were used in this study. To design DUX4-specific gRNAs, targeting sequences were selected to be position-matched with miDUX4 constructs, such as mi405, mi406, and mi1155. See U.S. Patent US 9,469,851. The structure of the PspCas13b gRNA and its target site are shown in Figure 1. The gRNA sequence containing the human U6 promoter was synthesized by Integrated DNA Technologies (IDT) (Skokie, IL). A plasmid expressing the human codon-optimized PspCas13b (pc0046) was purchased from Adgene (Cambridge, Massachusetts).

[0106] Western blot test

[0107] HEK293 cells (250,000 cells / well) were seeded into 24-well plates 16 hours prior to transfection. The following morning, cells were co-transfected with 900 ng of PspCas13b and 1800 ng of gRNA plasmid using Lipofectamin 2000 (Thermo Fisher, US). Eight to 10 hours after transfection, the medium was changed, and cells were re-transfected with 180 ng of DUX4 plasmid. Twenty hours after transfection, cells were lysed in RIPA buffer (50 mM Tris, 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate, 1% Triton ×100) supplemented with a cocktail containing protease inhibitors. Protein concentrations were determined using a DC protein assay kit (Bio-Rad Labs). 20 μg of each total protein sample was developed on a 12% SDS-polyacrylamide gel. The molecular weight of the protein bands was measured using GE Healthcare's Rainbow molecular weight marker (Fisher Scientific, USA). Proteins were transferred from the SDS-PAGE gel to a PVDF membrane via a semi-dry transfer method. The membrane was blocked in 5% non-fat milk and then incubated overnight at 4°C with primary monoclonal mouse anti-DUX4 (1:500; P4H2, Novus Biological) or rabbit polyclonal anti-α tubulin antibody (1:1,000; ab15246, Abcam, Cambridge, Massachusetts). The day after washing, the blot was tracked with horseradish peroxidase-conjugated goat anti-mouse or goat anti-rabbit secondary antibody (1:100,000; Jackson ImmunoResearch, West Grove, PA) for 1 hour at room temperature. Relative protein bands were developed on X-ray film after short-term incubation on an Immobilion chemiluminescent HRP substrate (Millipore, Billerica, MA).

[0108] Cell death assay

[0109] HEK293 cells (50,000 cells / well) were co-transfected with plasmids expressing DUX4, Cas13b, and gRNA using Lipofectamine 2000 and plated in 96-well plates. Cell death was measured 48 hours after transfection using the Apo-ONE homogeneous caspase 3 / 7 assay (Promega, Madison, WI) with a fluorescence plate reader (SpectraMax M2, Molecular Devices, Sunnyvale, CA). Each assay was performed in sets of three (n = 3), and data were reported as mean caspase activity compared to a control group transfected with DUX4 alone. The results are shown in Figure 2b.

[0110] Survivability Test Method

[0111] HEK293 cells (250,000 cells / well) were co-transfected with plasmids expressing DUX4, Cas13b, and gRNA using Lipofectamine 2000 and plated in 24-well plates. After incubation for 48 hours at 5% CO2, cells were trypsinized and collected in 1 mL of growth medium. Automated cell counting was performed using Countess® cell screening chamber slides (Thermo Fisher, US). Subsequently, results were validated by traditional cell counting using a hemocytometer and trypan blue staining. Data were reported as the average total number of cells per experiment. Error bars indicate the standard deviation (SD). Results are shown in Figure 2c.

[0112] RNAscope test

[0113] Cas13b and gRNA plasmids, 3 and 6 μg, respectively, were added to FSHD myoblasts [15A] cells (Jones et al.Co-transfected with the Lonza Nucleofector Kit (Lonza, VVPD-1001) in [ , Human Molecular Genetics 21 (20): 4419-30, 2012); 500,000 cells / reaction]. Next, FSHD myoblasts were cultured on glass coverslips in two wells of a 24-well plate containing myoblast growth medium. After 24 hours, the growth medium was replaced with differentiation medium, and cells were differentiated into myotubes for 7 days. Myotubes were fixed in 4% PFA (Fisher Scientific, USA) for 30 minutes at room temperature. Next, they were dehydrated at room temperature by 50%, 70%, and 100% ethyl alcohol gradients every 5 minutes. According to the manufacturer's protocol, cells were stained with a DUX4 probe designed using the RNAscope 2.5 HD brown assay (Advanced Cell Diagnostics). The image was captured using an Olympus DP71 microscope.

[0114] Quantitative Real-Time PCR Analysis of DUX4 Biomarkers

[0115] 3 and 6 μg of Cas13b and gRNA plasmids, respectively, were co-transfected into FSHD myoblasts (15A; 500,000 cells / reaction) using the Lonza Nucleofactor Kit (Lonza, VVPD-1001) and cultured in 12-well plates. After 24 hours, the growth medium was discarded, and fresh differentiation medium was added to the cells to differentiate the myoblasts into myotubes. Cells were differentiated for 7 to 9 days. Total RNA was extracted using Trizol (Fisher, Waltham, MA) according to the manufacturer's protocol. The quality and quantification of the isolated RNA were performed using Nanodrop. TMThe results were investigated by Thermo Fisher Scientific. Next, the isolated RNA was treated with DNase (DNA-free, Ambion, TX) and used for RT-PCR with randomized hexamers (Applied Biosystems cDNA Archive Kit; Applied Biosystems, Foster City, CA). Subsequently, the cDNA samples were used as templates for the Taqman assay using a pre-designed PRAMEF12 (biomarker for DUX4 activity) and human RPL13A control primer / probe set (Applied Biosystems). Each sample was developed in pairs. All data were normalized to samples expressing Cas13b.

[0116] Example 2

[0117] DUX4 mRNA targeting gRNA

[0118] The CRISPR-Cas system, a bacterial immune system, was utilized for the genome or RNA editing of mammalian cells. The goal of this study was to develop a prospective therapeutic agent for muscle dystrophy, such as FSHD, using a DUX4 gene silencing RNA-targeting CRISPR-Cas13 approach. To this end, 11 different Cas13b gRNAs (Fig. 1) targeting human DUX4 mRNA were engineered. Each gRNA sequence was cloned into a U6 promoter-driven expression cassette and , in vitro We performed a screening assay to identify gRNAs targeted at lead DUX4.

[0119] The above Cox et al. According to, the used in this study PrivotellaThe Cas13b enzyme P5-125 (PspCas13b) from the species is a highly efficient Cas13 enzyme for mammalian RNA editing. Although Cas13b gRNA does not have specific protospacer adjacent sequence (PFS) restrictions that interfere in mammalian cells, G bases at the 5' end or at the double 3' and 5' ends can slightly increase the efficiency of the PspCas13b enzyme (Cox et al. (, above). Since there is no strong PFS preference, any desired portion of mRNA can be selected as the target sequence, and the associated inverse complementary sequence can be used for Cas13b gRNA. Previously, researchers used shRNA position-matched gRNA to facilitate a better comparison between the efficiencies of each method (Omar et al. , Nature 550(7675): 280-4, 2017).

[0120] In this experiment, targeting sequences were selected to be position-matched with several miDUX4 RNA sequences, such as mi405, mi406, and mi1155 (see U.S. Patent US 9,469,851). Since these miRNAs showed a significant reduction in the amount of DUX4 mRNA, it was theorized that the target mRNA sequences have good accessibility (open or partially open structure) for targeting miRNAs and subsequently position-matched gRNAs. The target sites of the PspCas13b gRNA are shown in Figures 1a and 1b. The sequences of each gRNA are described in SEQ ID NOs 3 to 13 and 51 to 54. The DUX4 DNA target sequences for each gRNA are described in SEQ ID NOs 14 to 24 and 55 to 58.

[0121] Example 3

[0122] Selection of DUX4 mRNA-targeting gRNAs

[0123] The DUX4 mRNA targeting gRNA sequence disclosed herein was selected for its ability to reduce the DUX4 protein and its toxicity.

[0124] Each gRNA plasmid was transfected into HEK293 cells along with the Cas13b plasmid and the DUX4 plasmid. The ability of each gRNA to silence DUX4 at the protein level was investigated (Fig. 2a). Each gRNA tested was In vitro It was found to reduce DUX4 protein expression.

[0125] Next, each gRNA was tested for its ability to reduce DUX4-induced apoptosis in transfected cells using the Caspase 3 / 7 assay. Each gRNA reduced Caspase 3 / 7 activity compared to cells transfected with DUX4 alone (control) (Fig. 2b). The cell viability assay performed demonstrated that each gRNA increased the viability of treated cells, i.e., reduced DUX4-induced apoptosis (Fig. 2c).

[0126] HEK293 cells were co-transfected with plasmids expressing different ratios of DUX4:Cas13b to determine whether different ratios worked better, and Western blot analysis was performed to investigate the effect on DUX protein expression. All tested ratios showed a decrease in DUX4 protein levels (Fig. 2d).

[0127] Example 4

[0128] RNAscope In place Hybridization demonstrated a significant reduction in DUX4 mRNA levels in treated FSHD myocardial canals.

[0129] To investigate DUX4 silencing at the RNA level, treated FSHD myoblasts differentiated into myotubes and RNAscope In place Hybridization was performed using a specifically designed DUX4 targeted probe.

[0130] While untreated FSHD myocanal showed high levels of DUX4 mRNA (Fig. 3a), all samples treated with gRNA targeting DUX4 via Cas13b exhibited significantly reduced amounts of DUX4 mRNA, as evidenced by brown staining (Figs. 3d and 3e). In fact, samples treated with gRNA targeting DUX4 via Cas13b showed DUX4 mRNA levels similar to those observed in healthy myocanal (Fig. 3b (control)). Treatment with Cas13b alone (control) induced a partial decrease in DUX4 mRNA levels (Fig. 3c), but DUX4 mRNA levels remained higher than in the healthy control group (Fig. 3b), and there was a significant difference between the Cas13b control group (Fig. 3c) and samples treated with DUX4-targeted gRNA-Cas13b (Figs. 3d and 3e).

[0131] Example 5

[0132] A decrease in the expression level of the PRAMEF12 biomarker in treated cells indicates a decrease in DUX4 activity.

[0133] To determine the reduction in gene expression of the DUX4 target induced by the introduction of gRNA targeting DUX4 with Cas13b, quantitative RT-PCR was performed to measure PRAMEF12 expression (i.e., a biomarker indicating DUX4 activity) in FSHD myotubes treated with the DUX4 mRNA-targeting gRNA-Cas13b sequence using PRAMEF12-specific probes and primers. Human myoblasts (15A) with FSHD invasion were co-transfected with plasmids expressing Cas13b and gRNA and then differentiated into myotubes for more than 7 days. Total RNA was isolated using Trizol (Ambion) according to the manufacturer's protocol. After removing genomic DNA, complementary DNA (cDNA) was generated using a high-performance cDNA reverse transcription kit (Applied Biosystems). Quantitative PCR (qPCR) reactions were performed using the TaqMan gene expression master mix protocol (Thermo Fisher Scientific). The following program, consisting of one cycle of denaturation at 95°C for 10 minutes, 39 cycles of 95°C for 15 seconds followed by 60°C for 1 minute, and one cycle of cooling at 40°C, was used for qPCR analysis. Human ribosomal protein L13A (RPL13A) was used as the reference gene. To calculate relative gene expression, the data were divided into delta-delta-CT(2- △△CT It was analyzed by the algorithm. PRAMEF12 expression was normalized to Cas13b-transfected root canals alone as a negative control.

[0134] FSHD myotubes treated with CRISPR-Cas13b gRNA1, gRNA2, gRNA3, and gRNA9 showed significantly reduced PRAMEF12 expression (up to 80% in cells treated with gRNA3) compared to cells transfected with Cas13b alone or Cas13b + gRNA12 (see Figure 4).

[0135] Example 6

[0136] Determination of effective dose

[0137] Cas13b and gRNA dose escalation experiments were performed to define the effective dose range for DUX4 knockdown. To enhance the efficiency of DUX4 gene silencing using the CRISPR-Cas13 method described herein, combinations of each read gRNA were cloned into the same plasmid backbone, and their ability to suppress DUX4 expression in FSHD patient myoblastic cell lines was tested by investigating DUX4 expression and the expression of various DUX4 biomarkers such as ZSCAN4, PRAMEF12, PRAMEF2, MBD3L2, KHDC1L, TRIM43, and LEUTX. These FSHD myoblastic cell lines include, but are not limited to, Wellstone 17A, 12A, 18A, etc. (Jones et al. , Human Mol. Genetics 21 (20): 4419-30, 2012). DUX4 expression and DUX4 biomarker expression levels are analyzed by qRT-PCR and / or RNAscope in situ hybridization.

[0138] Example 7

[0139] Cas13b and gRNA packaging

[0140] The Cas13b and various gRNAs described herein are In vivo It is packaged within an AAV vector to test the efficacy of DUX4 silencing. In some embodiments, Cas13b and gRNA are packaged within two different AAV vectors. The PspCas13b gene Prevotella Also referred to as species P5-125 (PspCas13b), it is a 3270-nucleotide sequence (Cox et al.RNA Editing with CRISPR-Cas13, Science. 24, 358 (6366): 1019-1027, 2017). The plasmid containing this sequence was purchased from Adgene (catalog number 103862, plasmid name: pC0046-EF1a-PspCas13b-NES-HIV) and is of a size sufficient for packaging within a single-stranded (ss) AAV vector. In various forms, Cas13b gene expression cassettes are constructed using shorter and weaker promoters, such as the miniCMV promoter, or skeletal muscle-specific promoters, such as compact unc45b and minimal MCK promoters, such as CK6 or tMCK. In some embodiments, regulatory sequences such as a Kojak sequence present at the beginning of the Cas13b sequence described herein, a Marmot hepatitis virus (WHP) post-translational regulatory element (WPRE), an HIV nuclear extratransport signal (NES), and an SV40 polyA signal are added to the cassette to increase the efficiency of translation and the stability of the mRNA. For example, Kojak, WPRE, and HIV NES sequences are present in the Cas13b plasmid (see Adgenes (PC0046), SEQ ID NO. 36).

[0141] In various embodiments, gRNAs are expressed under different promoters, such as U6, U7, tRNA, H1, miniCMV, T7, or minimal EF1-alpha. Specifically, this strategy is considered to provide more efficient expression of the same gRNA as multiple copies of a single backbone. AAV proviral plasmids containing multiple copies of each gRNA or a combination of two or more gRNAs are prepared and used to construct AAV particles. Each gRNA is cloned with its own promoter, targeting sequence, Cas13b gRNA direct repeat sequence, and termination signal. These constructs are small enough to be packaged within a self-complementary AAV (scAAV) vector. Different serotypes of AAV vectors, including but not limited to AAV6, AAV9, and AAV2, are produced and tested. As described above, the present invention is not limited to these AAV vectors, as all types of vectors used in the products and methods of the present invention are included. AAV particles containing cassettes expressing Cas13b or gRNA are produced by triple transient transfection of HEK293 cells as described by Rashnonejad et al. and Gao et al. (Rashnonejad et al. , Mol. Biotechnology. 58(1): 30-6, 2016; Gao et al ., Introducing genes into mammalian cells: Viral vectors. In: Green MR, Sambrook J., editors. Molecular cloning: A laboratory manual. Vol. 2. New York: Cold Spring Harbor Laboratory Press; 2012.pp. 1209-1313).

[0142] Example 8

[0143] Test of the DUX4 mouse model

[0144] Cas13b and various gRNAs packaged in AAV vectors were tested in various mouse models, e.g., the recently published TIC-DUX4 mouse model (Giesige et al. , JCI Insight, 3(22): e123538, 2018) and / or previously published iDUX4pA mouse model (Bosnakovski et al. In Nature Commun. 8(1): 550, 2017) In vivo Their efficacy in DUX4 silencing was tested. Intramuscular (IM) or intravascular injection was used to deliver AAV vectors to mice. DUX4 expression is activated by the administration of tamoxifen (TIC-DUX4) or doxycycline (iDUX4pA) via an oral feeding tube. Muscle histology, molecular analysis, physical activity, and physiological analysis of treated mice were performed as described (Giesige et al. , above).

[0145] Example 9

[0146] Test of the DUX4 mouse model

[0147] To determine the safety, toxicology, and efficacy of Cas13b and gRNA vectors, dose-escalation experiments are performed using gRNA, the Cas13 enzyme, and AAV vectors expressing combinations thereof.

[0148] For safety studies, various doses of AAV vectors containing gRNA, Cas13 enzyme, and combinations thereof are administered into wild-type C57BL / 6J mice via intramuscular (IM, 40 μL = TA, 100 μL = GAS) or tail vein injection into adult mice (7 to 8 weeks old). For IV administration, the volume depends on the mouse body weight / blood volume ratio so that the volume does not exceed 10% of the animal's total body weight. In some embodiments, the AAV dose ranges from 1E8 DNAse resistant particles (DRP) to 1E13 DRP or higher, and doses marked as non-toxic in wild-type mice are tested for protective properties in FSHD animals.

[0149] Phenotype, histopathology, muscle degeneration, muscle regeneration, and molecular analysis are measured at different time points. In various modalities, mice injected with phosphate-buffered saline (PBS) are used as controls. Mice are euthanized at different time points after administration of high doses of ketamine / xylazine. Various muscles and organs are excised and isolated for histological, molecular, and pathological analysis.

[0150] DUX4 expression is induced in TIC-DUX4 or / and iDux4pA mice. Several of the highest doses of gRNA and Cas13 that were found to be safe and non-toxic in wild-type mouse dose escalation studies were tested. AAV delivery of CRISPR-Cas components, such as gRNA and Cas13b, is performed in neonatal or juvenile mice. Neonatal injections are administered from day 1 to day 3 after birth. A volume of 10 microliters is used for neonatal injections via intramuscular or tangential intravenous injection. Adult mouse injections are performed via intramuscular or tail vein injection. At various time points following Cas13 / gRNA gene delivery, animals are collected for blood, organ, and limb muscle testing (including measurements of strength and activity parameters) and for various molecular, histological, functional, and physiological analyses to determine therapeutic efficacy.

[0151] Example 10

[0152] DUX4 activity in FSHD myotubes decreased after transfection with Cas13b and gRNA plasmids.

[0153] To determine whether the DUX4 mRNA-targeting gRNA disclosed herein could reduce DUX4 protein activity, 500,000 FSHD myoblasts (15A) were electroporated with 3 νg of Cas13b and 6 νg of gRNA plasmid. Next, the cells were differentiated into myotubes for 7 days after the addition of differentiation medium. Total RNA was isolated using the Trizol® method according to the manufacturer's protocol, and qRT-PCR was performed for three DUX4 activity biomarkers, namely TRIM43, MBD3L2, and PRAMEF12.

[0154] Quantitative Real-Time PCR Analysis of DUX4 Biomarkers

[0155] 3 and 6 μg of Cas13b and gRNA plasmids, respectively, were co-transfected into FSHD myoblasts (15A; 500,000 cells / reaction) using the Lonza Nucleofactor Kit (Lonza, VVPD-1001) and cultured in 12-well plates. After 24 hours, the growth medium was discarded, and fresh differentiation medium was added to the cells to differentiate the myoblasts into myotubes. Cells were differentiated for 7 to 9 days. Total RNA was extracted using Trizol (Fisher, Waltham, MA) according to the manufacturer's protocol. The quality and quantification of the isolated RNA were examined by Nanodrop, then treated with DNase (Mu-DNA, Ambion, TX), and used for RT-PCR with a randomized hexamer (Applied Biosystems cDNA Archive Kit; Applied Biosystems, Foster City, CA). Next, subsequent cDNA samples were used as templates for the Taqman assay using a pre-designed set of TRIM43, MBD3L2, and PRAMEF12 (biomarkers for DUX4 activity) and human RPL13A control primers / probes (Applied Biosystems). Each sample was developed in sets of three, and the experiment was repeated three times. All data were normalized to samples expressing Cas13b.

[0156] Figures 6a to 6c show the qRT-PCR results of the inhibition of DUX4 activity following transfection with Cas13b and various gRNA plasmids, as indicated by the decrease in the relative expression levels of various DUX4 targets (biomarkers), namely TRIM43 (Fig. 6a), MBD3L2 (Fig. 6b), and PRAMEF12 (Fig. 6c). Human RPL13A was used as the reference gene. The expression levels of these biomarkers were normalized to Cas13b-transfected myotubes alone as a negative control. The expression levels of each of the three biomarkers decreased after transfection with Cas13b and gRNA compared to Cas13b-transfected cells alone.

[0157] Compared to Cas13b-transfected cells (control), all tested gRNAs were able to reduce the expression levels of all three biomarkers (Figs. 6a to 6c).

[0158] These experiments demonstrate that the gRNA sequence disclosed herein was successful in reducing DUX4 activity, as indicated by the reduced expression of the biomarker for DUX4. These experiments also indicate that multiple copies of the gRNA sequence in a single AAV vector plasmid are effective in reducing the expression of the DUX4 biomarker.

[0159] Example 11

[0160] Selection of additional DUX4 mRNA-targeting gRNAs

[0161] Additional DUX4 mRNA-targeting gRNA sequences (i.e., gRNA 13 to 16) were designed and selected for the ability to reduce the DUX4 protein and its toxicity.

[0162] Guide RNAs 13 and 14 were designed to target the DUX4 poly-A signal (PLAM):

[0163] gRNA 13 targeting site: TGTGCCCTTGTTCTTCCGTGAAATTCTGGC (SEQ No. 55); and

[0164] gRNA 14 targeting site: GTGCGCACCCCGGCTGACGTGCAAGGGAGC (Sequence No. 56).

[0165] Guide RNAs 15 and 16 were designed to target DUX4 exon 1:

[0166] gRNA 15 targeting site: TCCCGGAGTCCAGGATTCAGATCTGGTTTC (SEQ No. 57); and

[0167] gRNA 16 targeting site: CTGGTTTCAGAATCGAAGGGCCAGGCACCC (SEQ No. 58).

[0168] These additional gRNAs were also tested in the experiments described herein and were found to be effective in reducing DUX4 expression.

[0169] Example 12

[0170] DUX4 mRNA expression silencing by Cas13b and gRNA

[0171] The ability of each gRNA to silence DUX4 is the Luciferase assay and In vitro It was investigated using the fluorescence assay.

[0172] Luciferase test method

[0173] A double luciferase reporter plasmid was modified from Psicheck2 (Promegasa), which contains a firefly luciferase cassette acting as a transfection control, and the human DUX4 gene (3' UTR including coding region + introns) was cloned downstream of the lenilla luciferase stop codon acting as a 3' UTR (Wallace et al., 2018, Pre-clinical Safety and Off-Target Studies to Support Translation of AAV-Mediated RNAi Therapy for FSHD, Mol. Ther. Methods Clin. Dev.). HEK293 cells were co-transfected with the luciferase DUX4 reporter, Cas13b, and individual U6.gRNA expression plasmids in a 1:6:28 molar ratio (Lipofectamin 2000; Invitrogen). DUX4 gene silencing was determined as previously described (Wallace et al. , RNA interference inhibits DUX4-induced muscle toxicity in vivo : implications for a targeted FSHD therapy. Mol. Ther. 2012; 20: 1417-1423). Three sets of data per experiment were averaged, and individual experiments were performed three times. Results were reported as the mean ratio of renilla versus firefly luciferase activity ± SD for all combined experiments.

[0174] All gRNAs targeted DUX4 and were able to reduce renilla luciferase expression. The most significant silencing observed with this specific assay was achieved by gRNA1, 2, and 15 (Fig. 7).

[0175] In vitro fluorescence assay

[0176] HEK293 cells were co-transfected with a plasmid containing the human DUX4 gene (a 3' UTR including the coding region + intron) cloned as a 3' UTR downstream of the mCherry termination codon, and Cas13b and gRNA expression plasmids (gRNA1 and gRNA2). Cell images were taken 48 hours after transfection.

[0177] Compared to cells transfected with non-targeting gRNA (gRNA 12) or Cas13b alone, mCherry expression was significantly reduced in cells treated with gRNA 1 and 2 (as an indicator of DUX4 expression) (Fig. 8).

[0178] Each gRNA tested is In vitro It was found to reduce DUX4 expression.

[0179] Example 13

[0180] Test of newborn TIC-DUX4 mouse models

[0181] TIC-DUX4 mice can develop mild to progressive muscle pathology induced by tamoxifen. Therefore, TIC-DUX4 mice were administered 1 mg / kg tamoxifen three times a week to induce muscle pathology, and the effects of the administration of Cas13 and gRNA of the present invention on muscle pathology were determined. Mice were treated with Cas13 and gRNA 1 and sacrificed at different times after treatment.

[0182] WAP 4-disulfide core domain protein 3 (WFDC3) expression levels increased over time (Fig. 9a) in mouse muscles (anterior tibial (TA), gastrocnemius (GAS), and triceps (TRI)) using tamoxifen treatment alone as a marker of progressive muscle pathology. DUX4-mediated muscle injury increased in mouse muscles (TA and GAS) over time (30, 37, and 44 days) (Fig. 9b).

[0183] TIC-DUX4 pups aged 1 to 2 days received a unilateral co-injection of 5e10 AAV.Cas13 and AAV.gRNA1. After 4 weeks, tamoxifen 1 mg / kg was administered to the mice three times a week for 4 weeks. WFDC3 expression in the treated muscle was normalized to the untreated muscle of the same mice. WFDC3 expression levels (determined by quantitative RT-PCR) in neonatal mouse muscles (TA (Fig. 9c), Quad (Fig. 9d), and Gas (Fig. 9e)) decreased after treatment with Cas13 and gRNA1, showing a significant decrease (* P < 0.02) (Fig. 9d).

[0184] This study In vivo Proving the efficacy of the CRISPR-Cas13-DUX4 system, and In vivo It demonstrates proof of concept for CRISPR-Cas13-mediated DUX4 expression inhibition.

[0185] Example 14

[0186] Reduction of DUX4 toxicity and protection of cells from apoptosis

[0187] Next, each gRNA was tested for its ability to reduce DUX4-induced apoptosis in transfected cells using the caspase 3 / 7 assay.

[0188] Cell death assay

[0189] To investigate the gRNA ability to reduce DUX4 toxicity and protect cells from apoptosis, the Caspase 3 / 7 assay was performed. HEK293 cells (50,000 cells / well) were co-transfected with Lipofectamine 2000 using 30 ng DUX4 plasmid, 80 ng Cas13b plasmid, and 350 ng of each gRNA-expressing plasmid, and plated in 96-well plates. Cell death was measured 48 hours after transfection using the Apo-ONE homogeneous Caspase 3 / 7 assay (Promega, Madison, WI) with a fluorescence plate reader (SpectraMax M2, Molecular Devices, Sunnyvale, CA). Three sets of each of the three individual assays were performed (n = 3), and data were reported as mean caspase activity compared to a control group transfected with DUX4 alone.

[0190] Each gRNA reduced caspase 3 / 7 activity compared to cells transfected alone with DUX4 (control) (Fig. 10), indicating that gRNAs 1 to 11 and 13 to 16 reduced the toxicity of DUX4 and protected cells from apoptosis. Cell viability assays performed demonstrated that each gRNA increased the viability of treated cells, i.e., reduced DUX4-induced apoptosis.

[0191] Example 15

[0192] In vivo Inhibition of DUX4 expression in mouse muscles

[0193] To investigate the ability of AAV.CRISPR-Cas13 therapy to target DUX4 in muscle, adult mice were co-injected into TA muscle with DUX4 (1E9), ssAAV6-Cas13b (2.5 E10) and scAAV6-gRNA1 (5E10) or DUX4 alone (1E9).

[0194] Three weeks after injection, mice were sacrificed, TA muscles were excised, and frozen for histological and molecular analysis. As described herein, the DUX4 protein can function as a transcriptional activator for other genes in human and mouse cells. Therefore, any change in the expression level of DUX4 target genes is widely used as an indicator of DUX4 activity in humans and mice.

[0195] The DUX4-activated biomarkers in mice are WFDC3 and TRIM36. In this experiment, QRT-PCR was performed on RNA / cDNA harvested from treated and untreated muscles using WFDC3 probes and primers. Figure 11 shows the expression levels of DUX4-activated biomarkers (as indicated by the relative expression of WFDC3) 3 weeks after co-injection of sAAV6-Cas13b and scAAV6-gRNA1 (5e10) into mouse TAs, followed by injection with DUX4 (1e9). As shown in Figure 11, a decrease of more than 80% in WFDC3 expression levels was detected in treated muscles compared to untreated muscles.

[0196] While the present invention is described in light of specific embodiments, it is understood that variations and modifications will occur to those skilled in the art. Accordingly, only such limitations as set forth in the claims should be included in the present invention.

[0197] All literature mentioned in this application is incorporated herein by reference in its entirety.

[0198] The nucleotide and amino acid sequences disclosed herein are presented in Table 1 below.

[0199]

[0200]

[0201]

[0202]

[0203]

[0204]

[0205]

[0206]

[0207]

Claims

Claim 1 A nucleic acid encoding a double homeobox 4 (DUX4) CRISPR-Cas13 guide RNA (gRNA) comprising the nucleotide sequence described in any one of SEQ ID NOs 3 to 13 and 51 to 54. Claim 2 A nucleic acid encoding a DUX4 CRISPR-Cas13 guide RNA (gRNA) that specifically hybridizes to a target nucleic acid encoding double homeobox 4 (DUX4), wherein the target nucleic acid comprises a nucleotide sequence described in any one of SEQ ID NOs 14 to 24 and 55 to 58. Claim 3 A nucleic acid according to claim 1 or 2, further comprising a Cas13b direct repeat sequence. Claim 4 In claim 3, the Cas13b direct repeat sequence is a nucleic acid located downstream or at the 3' end of the nucleic acid encoding the DUX4 CRISPR-Cas13 gRNA. Claim 5 In claim 3, the above Cas13b direct repeat sequence comprises a nucleotide sequence described in SEQ ID NO. 37 or a nucleotide sequence having at least 90% sequence identity with the nucleotide sequence described in SEQ ID NO. 37, a nucleic acid. Claim 6 In claim 5, a nucleic acid comprising a nucleotide sequence described in any one of SEQ ID NOs 25 to 35 and 59 to 62, or a nucleotide sequence having at least 90% sequence identity with the nucleotide sequence described in any one of SEQ ID NOs 25 to 35 and 59 to 62. Claim 7 A nucleic acid according to claim 1 or 2, further comprising a promoter sequence. Claim 8 In claim 7, the promoter is any U6, U7, tRNA, H1, minimal CMV, T7, EF1-alpha, minimal EF1-alpha, or muscle-specific promoter, nucleic acid. Claim 9 In claim 8, the muscle-specific promoter is a nucleic acid that is unc45b, tMCK, minimal MCK, CK6, CK7, MHCK7, or CK1. Claim 10 In claim 8, a nucleic acid comprising a nucleotide sequence described in any one of SEQ ID NOs 38 to 48 and 63 to 66, or a nucleotide sequence having at least 90% sequence identity with the nucleotide sequence described in any one of SEQ ID NOs 38 to 48 and 63 to 66. Claim 11 An adeno-associated virus vector comprising the nucleic acid of claim 1 or 2. Claim 12 In claim 11, the virus is an adeno-associated virus vector lacking rep and cap genes. Claim 13 In claim 11, the virus is an adeno-associated virus vector that is a recombinant AAV (rAAV) or an auto-complementary recombinant AAV (scAAV). Claim 14 In claim 11, the virus is an adeno-associated virus vector that is AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-ANC80, or AAV Rh.

74. Claim 15 In claim 11, the virus is an adeno-associated virus vector, which is AAV-9. Claim 16 A composition for treating a subject suffering from muscular dystrophy, comprising the adeno-associated virus vector of claim 11 and a pharmaceutically acceptable carrier. Claim 17 (a) the adeno-associated virus vector of claim 11; and (b) a pharmaceutical composition for inhibiting and / or interfering with the expression of the double homeobox 4 (DUX4) gene in cells, comprising an adeno-associated virus vector comprising a nucleic acid encoding the Cas13 protein or the Cas13 ortholog. Claim 18 A pharmaceutical composition according to claim 17, wherein the Cas13 protein is Cas13b or Cas13b ortholog. Claim 19 A pharmaceutical composition according to claim 18, wherein the Cas13b protein is encoded by the nucleotide sequence described in SEQ ID NO. 36 or a nucleotide sequence having at least 90% sequence identity with the sequence described in SEQ ID NO.

36. Claim 20 A pharmaceutical composition according to claim 17, further comprising an adeno-associated virus vector comprising a nucleic acid encoding DUX4 inhibitory RNA. Claim 21 A pharmaceutical composition according to claim 20, wherein the expression of the nucleic acid encoding the DUX4 inhibitory RNA is under the control of a U6 promoter, U7 promoter, T7 promoter, tRNA promoter, H1 promoter, minimal EF1-alpha promoter, minimal CMV promoter, CMV promoter, muscle creatine kinase (MCK) promoter, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or desmin promoter. Claim 22 (a) the adeno-associated virus vector of claim 11; and (b) a pharmaceutical composition for treating a subject suffering from muscular dystrophy, comprising an adeno-associated virus vector comprising a nucleic acid encoding a Cas13 protein or a Cas13 ortholog. Claim 23 A pharmaceutical composition according to claim 22, wherein the Cas13 protein is Cas13b or Cas13b ortholog. Claim 24 A pharmaceutical composition according to claim 23, wherein the Cas13b protein is encoded by the nucleotide sequence described in SEQ ID NO. 36 or a nucleotide sequence having at least 90% sequence identity with the sequence described in SEQ ID NO.

36. Claim 25 A pharmaceutical composition according to claim 22, further comprising an adeno-associated virus vector comprising a nucleic acid encoding DUX4 inhibitory RNA. Claim 26 A pharmaceutical composition according to claim 25, wherein the expression of the nucleic acid encoding the DUX4 inhibitory RNA is under the control of a U6 promoter, U7 promoter, T7 promoter, tRNA promoter, H1 promoter, minimal EF1-alpha promoter, minimal CMV promoter, CMV promoter, muscle creatine kinase (MCK) promoter, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or desmin promoter. Claim 27 A pharmaceutical composition for treating muscular dystrophy in a subject requiring treatment for muscular dystrophy, comprising an adeno-associated virus vector, wherein the genome of the adeno-associated virus vector comprises: (a) at least one nucleic acid encoding a double homeobox 4 (DUX4) CRISPR-Cas13 guide RNA (gRNA) comprising a nucleotide sequence described in any one of SEQ ID NOs 3 to 13 and 51 to 54; (b) at least one nucleic acid encoding a DUX4 CRISPR-Cas13 guide RNA (gRNA) that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence described in any one of SEQ ID NOs 14 to 24 and 55 to 58; and (c) at least one nucleotide sequence comprising a nucleotide sequence described in any one of SEQ ID NOs 25 to 35 and 59 to 62 or a nucleotide sequence having at least 90% sequence identity with a nucleotide sequence described in any one of SEQ ID NOs 25 to 35 and 59 to 62. A pharmaceutical composition comprising: (d) at least one nucleic acid comprising a nucleotide sequence described in any one of SEQ ID NOs 38 to 48 and 63 to 66 or a nucleotide sequence having at least 90% sequence identity with the nucleotide sequence described in any one of SEQ ID NOs 38 to 48 and 63 to 66; or (e) any combination of these (a) to (d). Claim 28 A pharmaceutical composition according to claim 27, further comprising an adeno-associated virus vector comprising a nucleic acid encoding a Cas13 protein or a Cas13 ortholog. Claim 29 A pharmaceutical composition according to claim 28, wherein the Cas13 protein is Cas13b or Cas13b ortholog. Claim 30 A pharmaceutical composition according to claim 28 or 29, wherein the Cas13b protein is encoded by the nucleotide sequence described in SEQ ID NO. 36 or a nucleotide sequence having at least 90% sequence identity with the sequence described in SEQ ID NO.

36. Claim 31 A pharmaceutical composition according to any one of claims 27 to 29, further comprising an adeno-associated virus vector comprising a nucleic acid encoding DUX4 inhibitory RNA. Claim 32 A pharmaceutical composition according to claim 22, wherein the muscle dystrophy is facial-scapulohumeral muscle dystrophy (FSHD). Claim 33 A recombinant gene editing complex comprising: (a) at least one nucleic acid comprising a nucleotide sequence encoding Cas13 or a Cas13 ortholog; and (b) at least one nucleic acid encoding a double homeobox 4 (DUX4) CRISPR-Cas13 guide RNA (gRNA) comprising: i) a nucleic acid specifically hybridizing to a target nucleic acid encoding DUX4 comprising a nucleotide sequence described in any one of SEQ ID NOs 3 to 13 and 51 to 54, and / or a nucleotide sequence described in any one of SEQ ID NOs 14 to 24 and 55 to 58; and ii) a Cas13b direct repeat sequence, wherein binding of the complex to the target nucleic acid sequence inhibits DUX4 gene expression. Claim 34 In claim 33, the nucleic acid comprising a nucleotide sequence encoding the gRNA and Cas13b direct repeat sequence comprises: (a) at least one nucleic acid encoding a double homeobox 4 (DUX4) CRISPR-Cas13 guide RNA (gRNA) comprising a nucleotide sequence described in any one of SEQ ID NOs 3 to 13 and 51 to 54; (b) at least one nucleic acid encoding a DUX4 CRISPR-Cas13 guide RNA (gRNA) that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence described in any one of SEQ ID NOs 14 to 24 and 55 to 58; (c) at least one nucleic acid comprising a nucleotide sequence having at least 90% sequence identity with a nucleotide sequence described in any one of SEQ ID NOs 25 to 35 and 59 to 62; (d) SEQ ID NOs 38 to A recombinant gene editing complex comprising: at least one nucleic acid comprising a nucleotide sequence described in any one of 48 and 63 to 66 or a nucleotide sequence having at least 90% sequence identity with the nucleotide sequence described in any one of SEQ ID NOs 38 to 48 and 63 to 66; or (e) any combination of these (a) to (d). Claim 35 A recombinant gene editing complex according to claim 33 or 34, wherein the Cas13 protein is Cas13b or Cas13b ortholog. Claim 36 In claim 35, the recombinant gene editing complex wherein the Cas13b protein is encoded by the nucleotide sequence described in SEQ ID NO. 36 or a nucleotide sequence having at least 90% sequence identity with the sequence described in SEQ ID NO.

36. Claim 37 A recombinant gene editing complex according to claim 33 or 34, further comprising a nucleic acid encoding DUX4 repressive RNA. Claim 38 A pharmaceutical composition for treating cancer in a subject requiring treatment for cancer, comprising an adeno-associated virus vector, wherein the genome of the adeno-associated virus vector comprises: (a) at least one nucleic acid encoding a double homeobox 4 (DUX4) CRISPR-Cas13 guide RNA (gRNA) comprising a nucleotide sequence described in any one of SEQ ID NOs 3 to 13 and 51 to 54; (b) at least one nucleic acid encoding a DUX4 CRISPR-Cas13 guide RNA (gRNA) that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence described in any one of SEQ ID NOs 14 to 24 and 55 to 58; (c) at least one nucleic acid comprising a nucleotide sequence described in any one of SEQ ID NOs 25 to 35 and 59 to 62 or a nucleotide sequence having at least 90% sequence identity with a nucleotide sequence described in any one of SEQ ID NOs 25 to 35 and 59 to 62; (d) A pharmaceutical composition comprising at least one nucleic acid comprising a nucleotide sequence described in any one of SEQ ID NOs 38 to 48 and 63 to 66 or a nucleotide sequence having at least 90% sequence identity with the nucleotide sequence described in any one of SEQ ID NOs 38 to 48 and 63 to 66; or (e) any combination of these (a) to (d). Claim 39 A pharmaceutical composition according to claim 38, further comprising an adeno-associated virus vector comprising a nucleic acid encoding a Cas13 protein or a Cas13 ortholog. Claim 40 In claim 39, the above-mentioned Cas13 protein is Cas13b or Cas13b ortholog, a pharmaceutical composition. Claim 41 A pharmaceutical composition according to claim 39 or 40, wherein the Cas13b protein is encoded by the nucleotide sequence described in SEQ ID NO. 36 or a nucleotide sequence having at least 90% sequence identity with the sequence described in SEQ ID NO.

36. Claim 42 A pharmaceutical composition according to any one of claims 38 to 40, further comprising an adeno-associated virus vector comprising a nucleic acid encoding a DUX4 inhibitory RNA. Claim 43 A pharmaceutical composition according to any one of claims 38 to 40, wherein the cancer is bladder cancer, breast cancer, cervical cancer, endometrial cancer, esophageal cancer, lung cancer, kidney cancer, ovarian cancer, rhabdomyosarcoma (or rhabdomyosarcoma), sarcoma, gastric cancer, testicular cancer, thymoma, melanoma, or metastatic melanoma.

Citation Information

Patent Citations

  • Recombinant virus products and methods for inhibition of expression of DUX4

    WO2013016352A1

  • Method for determining presence / absence of development of malignant lymphoma or leukemia, and drug for treatment and / or prevention of leukemia

    WO2017073619A1

  • Type vi-b crispr enzymes and systems

    WO2017070605A1

  • Silencing of DUX4 by recombinant gene editing complexes

    WO2018057863A1