Composition for predicting or diagnosing hearing loss

Abstract

The present invention relates to: a composition and system for predicting or diagnosing hearing loss disorders, the composition including an agent for detecting point mutations in a plurality of genes or copy number variations; and an information provision method. In an aspect, the present invention comprises an agent capable of detecting: point mutations in a plurality of genes; or a copy number variation of at least one gene selected from the group consisting of STRC and TOOTA, thereby enabling simultaneous screening of a plurality of mutations on the basis of real-time PCR instead of NGS, thus having an excellent effect of predicting or diagnosing hearing loss in a short time at a low cost.

Description

Composition for predicting or diagnosing hearing loss

[0001] Disclosed herein are compositions, systems and information providing methods for predicting or diagnosing hearing loss, comprising agents for detecting point mutations or copy number variations in multiple genes.

[0002] Sensorineural hearing loss becomes increasingly common with age, with approximately one-third of people in their 60s experiencing significant hearing loss. Left untreated, sensorineural hearing loss can lead to significant aftereffects and social consequences, including difficulties with language and brain development in children and increased rates of depression and dementia in adults. Approximately 60% of sensorineural hearing loss is caused by genetic mutations, and the number of genes contributing to hearing loss in humans is currently known to exceed 100, demonstrating extreme diversity, or heterogeneity.

[0003] Most treatments for hearing loss remain limited to auditory rehabilitation, which is broadly divided into hearing aids and cochlear implants. Identifying the genes responsible for hearing loss plays a crucial role in determining the appropriate timing of auditory rehabilitation and cochlear implant surgery, and is also central to the upcoming development of gene therapy for hearing loss.

[0004] Next-generation sequencing (NGS) is currently being clinically implemented. Genetic diagnosis of hearing loss using NGS, while cost-effective depending on the circumstances of each hospital's laboratory medicine department, typically costs at least 700,000 won per patient and requires an average turnaround time of about two months. Furthermore, analysis requires significant manpower, errors are inevitable, and the interpretation of the results can vary significantly depending on the genetics knowledge of the clinicians reviewing the results. Therefore, only a very small number of hospitals with a robust patient pool and fully equipped systems are willing to tolerate a turnaround time of two to three months (the time between testing and reporting the results).

[0005] Therefore, despite the introduction of NGS, genetic diagnosis for hearing loss has not yet become widespread. Therefore, there is a need for a mutation screening system that is easy to implement, affordable, and easily readable for both patients and healthcare professionals.

[0006] In particular, given the homogeneous nature of the Korean population, while the genes causing hearing loss remain diverse, the spectrum of mutations is considerably more limited than in other multi-ethnic countries, creating a genetic foundation for the success of mutation screening kits. Currently, real-time PCR-based screening kits exist for mutations in 10 to 22 genes commonly responsible for congenital hearing loss in Korean children. However, screening kits for other genetic mutations, which account for the majority of all hearing loss gene mutations, do not exist.

[0007] In addition, for copy number variation (CNV) of the STRC gene, which is the most important cause of moderate hearing loss in Koreans, there is no other way than 1) performing a separate MLPA method or 2) analyzing it through very complex software using NGS results, so it is not easy to apply clinically. In addition, there is a limitation that two different testing methods must be used to examine point mutations in other hearing loss genes together.

[0008] Meanwhile, G-scanning, a newborn chromosomal abnormality screening test, includes a hearing loss gene screening test as an optional test. However, this kit includes approximately 270 mutations in five hearing loss genes, but the number of hearing loss genes is severely limited, and it cannot detect gene copy number mutations in the STRC gene. In addition, there is a serious problem that it includes many mutations with unclear pathogenic potential, causing confusion among clinicians. Above all, this G-scanning has a bigger limitation in that it is not intended to find the cause in hearing loss patients, but to screen all newborns for hearing loss along with other congenital metabolic diseases.

[0009] Accordingly, the inventors of the present invention conducted research on a method for predicting or diagnosing hearing loss by simultaneously detecting point mutations and gene copy number variations related to hearing loss more quickly and at a lower cost than NGS in order to popularize genetic diagnosis of hearing loss, and completed the present invention.

[0010] [Cross-reference to related applications]

[0011] This application claims the benefit and priority of Korean Patent Application No. 10-2023-0075676, filed June 13, 2023, entitled “Composition for Predicting or Diagnosing Hearing Loss,” the entire contents of which are incorporated herein by reference.

[0012] The present inventors have confirmed that hearing loss can be predicted or diagnosed by detecting point mutations in multiple genes associated with hearing loss in real-time PCR; or copy number variations in one or more genes selected from the group consisting of STRC and OTOA.

[0013] Accordingly, in one aspect, an object of the present invention is to provide a composition, a system, and an information providing method for predicting or diagnosing hearing loss.

[0014] In one aspect, the present invention provides a composition for predicting or diagnosing hearing loss, wherein the composition comprises MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, A composition for predicting or diagnosing hearing loss is provided, comprising an agent for detecting a point mutation in one or more genes selected from the group consisting of COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9; or a copy number variation (CNV) in one or more genes selected from the group consisting of STRC and OTOA.

[0015] In another aspect, the present invention provides a system for predicting or diagnosing hearing loss comprising the composition for predicting or diagnosing hearing loss.

[0016] In another aspect, the present invention provides a method for providing information for predicting or diagnosing hearing loss, wherein the method comprises: providing MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, A method for providing information is provided, comprising the step of detecting a point mutation in one or more genes selected from the group consisting of BCAP31, CHD7, COCH, COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9; or a copy number variation (CNV) in one or more genes selected from the group consisting of STRC and OTOA.

[0017] In one aspect, the present invention provides MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, COL2A1, By including an agent capable of detecting a point mutation in one or more genes selected from the group consisting of COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9; or a copy number variation in one or more genes selected from the group consisting of STRC and OTOA, multiple mutations can be simultaneously screened based on real-time PCR rather than NGS, thereby having an excellent effect of predicting or diagnosing hearing loss in a short period of time at low cost.

[0018]

[0019] Hereinafter, the present invention will be described in detail.

[0020] In one aspect of the present invention, "predicting hearing loss" may mean predicting or diagnosing whether a subject is likely to develop hearing loss, whether the likelihood of developing hearing loss is relatively high, what the causative factor of hearing loss is, or whether hearing loss has already developed. Furthermore, in one aspect of the present invention, "diagnosing hearing loss" may mean confirming the presence or characteristics of a pathological condition in a subject, and for the purposes of one aspect of the present invention, diagnosis may mean confirming whether hearing loss has developed. The composition and system according to one aspect of the present invention may be used to delay or prevent the onset of hearing loss through special and appropriate management in any specific subject, specifically an animal subject, and more specifically a subject at high risk of developing hearing loss. Furthermore, "predicting or diagnosing hearing loss" may mean predicting or diagnosing the genetic cause of hearing loss. Furthermore, the composition and system according to one aspect of the present invention may be clinically used to diagnose hearing loss early and determine treatment by selecting the most appropriate treatment method.

[0021]

[0022] In one aspect, the present invention provides MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, COL2A1, A composition for predicting or diagnosing hearing loss is provided, comprising an agent for detecting a point mutation in one or more genes selected from the group consisting of COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9; or a copy number variation (CNV) in one or more genes selected from the group consisting of STRC and OTOA.

[0023] A composition according to one aspect of the present invention may be used for polymerase chain reaction (real-time PCR).

[0024] A composition according to one aspect of the present invention comprises MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, The composition may include an agent that detects a point mutation in one or more genes selected from the group consisting of COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9. According to one aspect of the present invention, when a point mutation in the gene is detected in a sample of the subject, the composition may be used to predict or diagnose the subject as having a gene copy number variation, and specifically, to predict or diagnose the subject as having hearing loss.

[0025] A point mutation according to one aspect of the present invention may be one or more mutations selected from Table A below.

[0026]

[0027] [Table A]

[0028]

[0029]

[0030]

[0031]

[0032]

[0033]

[0034] A composition according to one aspect of the present invention may be capable of predicting or diagnosing a subject as having hearing loss when one or more of the point mutations in Table A are detected in a sample of the subject.

[0035] A point mutation according to one aspect of the present invention may be one or more mutations selected from Table B below.

[0036]

[0037] [Table B]

[0038]

[0039]

[0040]

[0041]

[0042] A composition according to one aspect of the present invention may be capable of predicting or diagnosing a subject as having hearing loss when one or more of the point mutations in Table B are detected in a sample of the subject.

[0043] A composition according to one aspect of the present invention may further comprise an agent for detecting a point mutation in one or more genes selected from the group consisting of MPZL2, MT-RNR1, MT-TL1, OTOG, GSDME, PTPN11, ATP1A3, ILDR1, CD164, COL1A1, COL4A4, HARS2, MT-TS1, P2RX2, PJVK, POLD1, SLC26A5, TMEM43, TMTC4, TWNK, USH1C, and USH1G. A composition according to one aspect of the present invention may be used to predict or diagnose a subject as having hearing loss when a point mutation in the gene is detected in a sample of the subject.

[0044] A point mutation according to one aspect of the present invention may be one or more mutations selected from Table C below.

[0045]

[0046] [Table C]

[0047]

[0048]

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063] A composition according to one aspect of the present invention may be capable of predicting or diagnosing a subject as having hearing loss when one or more of the point mutations in Table C are detected in a sample of the subject.

[0064] A composition according to one aspect of the present invention may include an agent for detecting copy number variation (CNV) of one or more genes selected from the group consisting of STRC and OTOA.

[0065] According to one aspect of the present invention, a composition can be used to predict or diagnose a subject as having a gene copy number mutation, and specifically, to predict or diagnose a subject as having hearing loss, if the value calculated by dividing the copy number of one or more genes selected from the group consisting of STRC and OTOA measured in a sample of a subject by the copy number of a standard gene of EFTUD2 is less than 0.8 or greater than 1.2. Specifically, if the value calculated by dividing the copy number of one or more genes selected from the group consisting of STRC and OTOA measured in the subject's sample by the copy number of the standard gene EFTUD2 is less than 0.8, 0.7 or less, 0.6 or less, 0.5 or less, 0.4 or less, 0.3 or less, 0.2 or less, or 0.1 or less, or greater than 1.2, 1.3 or more, 1.4 or more, 1.5 or more, 1.6 or more, or 1.7 or more, the subject may be predicted or diagnosed as having a gene copy number mutation, and more specifically, may be predicted or diagnosed as having hearing loss. According to one embodiment of the present invention, when the value calculated by dividing the copy number of one or more genes selected from the group consisting of STRC and OTOA measured in a sample of a subject by the copy number of the standard gene of EFTUD2 is greater than 1.2, it is interpreted as normal if it is 0.8 to 1.2, allele 1 copy loss if it is 0.3 to 0.7, allele 2 copy loss if it is 0 to 0.2, and allele 1 copy gain if it is 1.3 to 1.7, and as a result, when the value is not in the normal range of 0.8 to 1.2, it is possible to predict or diagnose the subject as having a gene copy number mutation, and more specifically, it is possible to predict or diagnose the subject as having hearing loss.

[0066] Hearing loss according to one aspect of the present invention may be sensorineural hearing loss, conductive hearing loss, or mixed hearing loss.

[0067] Hearing loss according to one aspect of the present invention may be moderate hearing loss.

[0068] Hearing loss according to one aspect of the present invention may be hearing loss caused by a gene copy number mutation or point mutation, or hearing loss caused by a gene copy number mutation or point mutation.

[0069] The detection agent according to one aspect of the present invention may be a primer or a probe.

[0070] Specifically, the primer refers to a single-stranded polynucleotide that can act as an initiation point in a nucleotide polymerization reaction by a polymerase. For example, the primer may be a single-stranded polynucleotide that can act as an initiation point for template-directed DNA synthesis under suitable conditions, i.e., in the presence of four different nucleoside triphosphates and a polymerase, at a suitable temperature and in a suitable buffer. The suitable length of the primer may vary depending on various factors, such as temperature and the purpose of the primer. The primer may be 15 to 30 nucleotides in length. For example, the shorter the length of the primer, the more stable a hybridization complex can be formed with the template at a lower annealing temperature. The length of the primer may be about 5 to about 100 nucleotides (hereinafter referred to as 'nt'), about 10 to about 80 nt, about 10 to about 60 nt, about 10 to about 50 nt, about 10 to about 40 nt, about 10 to about 30 nt, or about 10 to about 20 nt.

[0071] Specifically, the probe refers to an oligonucleotide capable of specifically binding to a target nucleic acid. The probe may be linked to a labeling substance. The probe may have a length of about 50 nt to about 400 nt, about 100 nt to about 350 nt, about 150 nt to about 300 nt, or about 200 nt to about 250 nt.

[0072] The above probes or primers can be chemically synthesized using the phosphoramidite solid support method or other well-known methods. Such nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, "capping," substitution with one or more homologs of a natural nucleotide, and modification between nucleotides, such as modification with uncharged linkers (e.g., methyl phosphonate, phosphotriester, phosphoroamidate, carbamate, etc.) or charged linkers (e.g., phosphorothioate, phosphorodithioate, etc.).

[0073] A composition according to one aspect of the present invention may be applied to a sample of a subject, wherein the sample comprises MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, A point mutation in one or more genes selected from the group consisting of BCAP31, CHD7, COCH, COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, MYH9, MPZL2, MT-RNR1, MT-TL1, OTOG, GSDME, PTPN11, ATP1A3, ILDR1, CD164, COL1A1, COL4A4, HARS2, MT-TS1, P2RX2, PJVK, POLD1, SLC26A5, TMEM43, TMTC4, TWNK, USH1C, and USH1G; Or, it means any sample obtained from an individual capable of detecting a copy number variation of one or more genes selected from the group consisting of STRC and OTOA, and specifically, the sample may be one or more selected from the group consisting of saliva, biopsy, blood, tissue, liquid culture, feces and urine, but is not limited thereto, and may be prepared by processing by a method commonly used in the technical field of the present invention.

[0074] A primer according to one aspect of the present invention may include a primer for detecting a gene copy number variation.

[0075] A primer for detecting a gene copy number variation according to one aspect of the present invention may include one or more primer sets selected from the group consisting of a first primer set of SEQ ID NOs: 1 and 2, a second primer set of SEQ ID NOs: 3 and 4, a third primer set of SEQ ID NOs: 5 and 6, a fourth primer set of SEQ ID NOs: 7 and 8, a fifth primer set of SEQ ID NOs: 9 and 10, and a sixth primer set of SEQ ID NOs: 11 and 12.

[0076]

[0077] In another aspect, the present invention provides a system for predicting or diagnosing hearing loss, comprising the composition for predicting or diagnosing hearing loss. The description of the composition for predicting or diagnosing hearing loss can be applied to the system. above hearing loss, MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, MYH9, MPZL2, MT-RNR1, MT-TL1, OTOG, GSDME, PTPN11, ATP1A3, ILDR1, CD164, COL1A1, COL4A4, HARS2, MT-TS1, P2RX2, PJVK, POLD1, SLC26A5, TMEM43, TMTC4, TWNK, USH1C, USH1G, point mutation, gene copy number variation, detection agent, prediction or diagnosis of hearing loss are as described above.

[0078] A system according to one aspect of the present invention may be an RT-PCR system or a microarray system.

[0079] Specifically, the RT-PCR system may include each primer pair capable of amplifying a nucleic acid containing the point mutation or gene copy number variation site, and may also include a test tube or other appropriate container, a reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq polymerase and reverse transcriptase, DNase, RNAse inhibitor, DEPC-water, sterile water, etc. It may also include a primer pair specific for a gene used as a quantitative control.

[0080] Alternatively, specifically, the microarray chip system may include a microarray having a substrate on which nucleic acids including the point mutation or gene copy number variation site are immobilized. The microarray may be formed as a conventional microarray, except that it includes the polynucleotide, primer, or probe of the present invention. Hybridization of nucleic acids on a microarray and detection of the hybridization result are well known in the art. The detection may be performed, for example, by labeling a nucleic acid sample with a labeling substance capable of generating a detectable signal, such as a fluorescent substance, such as Cy3 and Cy5, and then hybridizing the nucleic acid sample on a microarray and detecting a signal generated from the labeling substance, thereby detecting the hybridization result.

[0081] A system according to one aspect of the present invention may further include instructions.

[0082] According to one aspect of the present invention, the description includes MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, A point mutation in one or more genes selected from the group consisting of COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, MYH9, MPZL2, MT-RNR1, MT-TL1, OTOG, GSDME, PTPN11, ATP1A3, ILDR1, CD164, COL1A1, COL4A4, HARS2, MT-TS1, P2RX2, PJVK, POLD1, SLC26A5, TMEM43, TMTC4, TWNK, USH1C, and USH1G; Alternatively, it may be described that hearing loss is predicted or diagnosed when a copy number variation of one or more genes selected from the group consisting of STRC and OTOA is detected.

[0083] According to one aspect of the present invention, the description may describe that hearing loss is predicted or diagnosed when one or more of the point mutations in Tables A to C are detected from a sample of a subject.

[0084] In one aspect of the present invention, the description may describe that when the copy number of one or more genes selected from the group consisting of STRC and OTOA measured from a sample of a subject is divided by the copy number of a standard gene of EFTUD2 and the value is less than 0.8 or greater than 1.2, the subject can be predicted or diagnosed as having a gene copy number mutation, and specifically, the subject can be predicted or diagnosed as having hearing loss. Specifically, if the value calculated by dividing the copy number of one or more genes selected from the group consisting of STRC and OTOA measured in the subject's sample by the copy number of the standard gene EFTUD2 is less than 0.8, 0.7 or less, 0.6 or less, 0.5 or less, 0.4 or less, 0.3 or less, 0.2 or less, or 0.1 or less, or greater than 1.2, 1.3 or more, 1.4 or more, 1.5 or more, 1.6 or more, or 1.7 or more, the subject may be predicted or diagnosed as having a gene copy number mutation, and more specifically, it may be described that the subject is predicted or diagnosed as having hearing loss.

[0085] A system according to one aspect of the present invention may be applied to a sample of a subject, wherein the sample means any sample obtained from an individual from which a point mutation or a gene copy number variation according to one aspect of the present invention can be detected, and specifically, the sample may be at least one selected from the group consisting of saliva, biopsy, blood, tissue, liquid culture, feces, and urine, but is not limited thereto, and may be prepared by processing by a method commonly used in the technical field of the present invention.

[0086]

[0087] In another aspect, the present invention provides a method for providing information for predicting or diagnosing hearing loss, wherein the method comprises: providing MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, A method for providing information is provided, comprising the step of detecting a point mutation in one or more genes selected from the group consisting of BCAP31, CHD7, COCH, COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9; or a copy number variation (CNV) in one or more genes selected from the group consisting of STRC and OTOA. The detection step may include performing real-time polymerase chain reaction (real-time PCR).above hearing loss, MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12,NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, MYH9, MPZL2, MT-RNR1, MT-TL1, OTOG, GSDME, PTPN11, ATP1A3, ILDR1, CD164, COL1A1, COL4A4, HARS2, MT-TS1, P2RX2, PJVK, POLD1, SLC26A5, TMEM43, TMTC4, TWNK, USH1C, USH1G, point mutation, gene copy number variation, detection agent, primer, probe, and description of prediction or diagnosis of hearing loss are as described above.

[0088] According to one aspect of the present invention, a method for providing information comprises: providing MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, The method may further include a step of detecting a point mutation in one or more genes selected from the group consisting of COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9. The information providing method according to one aspect of the present invention may further include a step of predicting or diagnosing that the subject has hearing loss when a point mutation in the gene is detected in a sample of the subject.

[0089] An information providing method according to one aspect of the present invention may further include a step of detecting a point mutation in one or more genes selected from the group consisting of MPZL2, MT-RNR1, MT-TL1, OTOG, GSDME, PTPN11, ATP1A3, ILDR1, CD164, COL1A1, COL4A4, HARS2, MT-TS1, P2RX2, PJVK, POLD1, SLC26A5, TMEM43, TMTC4, TWNK, USH1C, and USH1G. An information providing method according to one aspect of the present invention may further include a step of predicting or diagnosing that a subject has hearing loss when a point mutation in the gene is detected in a sample of the subject.

[0090] A point mutation according to one aspect of the present invention may be one or more mutations selected from Tables A to C. An information providing method according to one aspect of the present invention may further include a step of predicting or diagnosing that a subject has hearing loss when the point mutation is detected in a sample of the subject.

[0091] An information providing method according to one aspect of the present invention may include a step of detecting a copy number variation (CNV) of one or more genes selected from the group consisting of STRC and OTOA.

[0092] Detection of copy number variation according to one aspect of the present invention may include the steps of: measuring the copy number of one or more genes selected from the group consisting of STRC and OTOA and a reference gene of EFTUD2 in a sample of a subject; calculating a value by dividing the copy number of the one or more genes selected from the group consisting of STRC and OTOA by the copy number of the reference gene; and providing information that can predict or diagnose the subject as having a gene copy number variation and specifically predict or diagnose the subject as having hearing loss if the calculated value is less than 0.8 or greater than 1.2. Specifically, if the value calculated by dividing the copy number of one or more genes selected from the group consisting of STRC and OTOA measured in the subject's sample by the copy number of the standard gene EFTUD2 is less than 0.8, 0.7 or less, 0.6 or less, 0.5 or less, 0.4 or less, 0.3 or less, 0.2 or less, or 0.1 or less, or greater than 1.2, 1.3 or more, 1.4 or more, 1.5 or more, 1.6 or more, or 1.7 or more, the subject may be predicted or diagnosed as having a gene copy number mutation, and more specifically, the method may include a step of providing information for predicting or diagnosing hearing loss.

[0093] Hearing loss according to one aspect of the present invention may be sensorineural hearing loss, conductive hearing loss, or mixed hearing loss.

[0094] Hearing loss according to one aspect of the present invention may be moderate hearing loss.

[0095] Hearing loss according to one aspect of the present invention may be hearing loss caused by a gene copy number mutation or point mutation, or hearing loss caused by a gene copy number mutation or point mutation.

[0096] The detection step according to one aspect of the present invention may be detection using one or more primer sets selected from the group consisting of a first primer set of SEQ ID NOs: 1 and 2, a second primer set of SEQ ID NOs: 3 and 4, a third primer set of SEQ ID NOs: 5 and 6, a fourth primer set of SEQ ID NOs: 7 and 8, a fifth primer set of SEQ ID NOs: 9 and 10, and a sixth primer set of SEQ ID NOs: 11 and 12.

[0097] According to one aspect of the present invention, the sample of the subject may comprise nucleic acid of the subject, and the nucleic acid may comprise DNA, mRNA, or cDNA synthesized from mRNA.

[0098]

[0099] Hereinafter, the composition and effects of the present invention will be described in more detail with examples. However, the examples below are provided for illustrative purposes only to aid understanding of the present invention and are not intended to limit the scope and scope of the present invention.

[0100]

[0101] [Example 1] Detection of point mutations in hearing-impaired patients

[0102] From 2010 to 2022, DNA was extracted from actual hearing loss patients regardless of age at Bundang Seoul National University Hospital / Sejong Chungnam National University Hospital for 13 years.

[0103] Genes and mutations causing hearing loss were selected by comparison with the reference sequence, and these are shown in Tables 1 to 14 below.

[0104] [Table 1]

[0105]

[0106] [Table 2]

[0107]

[0108] [Table 3]

[0109]

[0110] [Table 4]

[0111]

[0112] [Table 5]

[0113]

[0114] [Table 6]

[0115]

[0116] [Table 7]

[0117]

[0118] [Table 8]

[0119]

[0120] [Table 9]

[0121]

[0122] [Table 10]

[0123]

[0124] [Table 11]

[0125]

[0126] [Table 12]

[0127]

[0128] [Table 13]

[0129]

[0130] [Table 14]

[0131]

[0132]

[0133] [Example 2] Detection of copy number variations in hearing-impaired patients

[0134] A primer set for detecting copy number variations in STRC and OTOA was prepared using DNA extracted from the hearing-impaired patient of Example 1 above.

[0135] The kit used for performing real-time PCR was QuantiNova™SYBR® Green PCR kit (QIAGEN, Cat. nos. 208054), and the real-time PCR instrument was Applied Biosystems ViiA®7 Real-Time PCR System. In the instrument program, the experimental design selection menu in the [Setup Experiment Properties] tab was set to 96-Well Block (0.2 ml), Comparative Ct (ΔΔCt), SYBR® Green Reagents, Fast.

[0136] In the [Define] tab of the [Setup] section, gene exons were entered according to the experiment type in the Targets section, and the ID of the experimental sample (i.e., gDNA) was entered in the Samples section. Then, the ID of the reference sample was selected as the Reference sample, and the EFTUD2 gene was selected as the Endogenous control.

[0137] The reference sample (non-mutated gDNA sample) and the test sample for copy number mutation detection were precisely adjusted to 50 ng / ul for mixing with the PCR kit.

[0138] The composition of the PCR kit and the gDNA are as follows. Mix 2x SYBR Green PCR Master Mix 10ul, QN ROX Reference Dye: (1:200) 0.1ul, forward primer (10pmol / ul) 1ul, reverse primer (10pmol / ul) 1ul, RNase-free water 6.9ul, and Template gDNA (50ng / ul) 1ul. Put it in a 0.2ml PCR tube, insert it into the device, and in the Run Method of the device program, set Hold Stage: 95℃ for 2 minutes, PCR Stage: 95℃ for 5 seconds, 59℃ for 20 seconds, and Number of Cycles: 40. Turn on data acquisition and execute Start Run. After the operation is complete, check the analysis report and press Export to move the data to the desired location and analyze the results.

[0139] The RQ (Relative Quantity) value of the reference sample was 1, and the RQ value of the experimental sample was checked. When the value was in the range of 0.8 to 1.2 with 1 as the standard, it was interpreted as normal, when the value was in the range of 0.3 to 0.7, it was interpreted as 1 copy loss of the allele, and when the value was in the range of 0 to 0.2, it was interpreted as 2 copy loss of the allele.

[0140] If a value in the range of 1.3 to 1.7 was obtained, it was interpreted as a 1 copy gain of the allele.

[0141] Subjects whose values ​​are outside the normal range can be identified as having a copy number variation in that gene.

[0142] At this time, real-time PCR was performed using EFTUD2 as the standard gene. The primer sets and sizes of PCR products are shown in Table 15 below.

[0143] [Table 15]

[0144]

[0145]

[0146] The value obtained by dividing the copy number of the STRC or OTOA gene of the present invention by the copy number of the standard gene (EFTUD2) is the same as the ratio in Table 15 above.

[0147] As shown in Table 15 above, copy number variations were detected in the STRC and OTOA genes in patients with hearing loss, and it was confirmed that hearing loss can be predicted or diagnosed when copy number variations of one or more genes selected from the group consisting of STRC and OTOA are detected.

[0148]

[0149] Through this, the composition according to one aspect of the present invention comprises MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, By including an agent capable of detecting a point mutation in one or more genes selected from the group consisting of COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9; or a copy number variation in one or more genes selected from the group consisting of STRC and OTOA, it was confirmed that it has an excellent effect of predicting or diagnosing hearing loss in a short period of time at a low cost by allowing simultaneous screening of multiple mutations based on real-time PCR rather than NGS.

[0150] <?xml version="1.0" encoding="UTF-8"?>

[0151] <!DOCTYPE ST26SequenceListing PUBLIC "- / WIPO / DTD Sequence Listing 1.3 / EN"

[0152] "ST26SequenceListing_V1_3.dtd">

[0153] <ST26SequenceListing dtdVersion="V1_3" fileName="22p379ind_서열목록.xml"

[0154] softwareName="WIPO Sequence" softwareVersion="2.3.0"

[0155] productionDate="2023-06-12">

[0156] <applicantfilereference>22p379 / ind< / applicantfilereference>

[0157] <applicantname languagecode="ko"> Seoul National University Hospital< / applicantname>

[0158] <applicantnamelatin>SEOUL NATIONAL UNIVERSITY

[0159] HOSPITAL< / applicantnamelatin>

[0160] <inventiontitle languagecode="ko">Composition for predicting or diagnosing hearing loss

[0161] < / inventiontitle>

[0162] <sequencetotalquantity> 14< / sequencetotalquantity>

[0163] <sequencedata sequenceidnumber="1">

[0164] <insdseq>

[0165] <INSDSeq_length>20< / INSDSeq_length>

[0166] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0167] <INSDSeq_division>PAT< / INSDSeq_division>

[0168] <INSDSeq_feature-table>

[0169] <insdfeature>

[0170]

[0171] <INSDFeature_key>source< / INSDFeature_key>

[0172]

[0173] <INSDFeature_location>1..20< / INSDFeature_location>

[0174] <INSDFeature_quals>

[0175] <insdqualifier>

[0176]

[0177] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0178]

[0179] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0180] < / insdqualifier>

[0181] <insdqualifier id="q2">

[0182]

[0183] <INSDQualifier_name>organism< / INSDQualifier_name>

[0184]

[0185] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0186] < / insdqualifier>

[0187] < / INSDFeature_quals>

[0188] < / insdfeature>

[0189] < / INSDSeq_feature-table>

[0190]

[0191] <INSDSeq_sequence>gtcctctgtcccagctcttg< / INSDSeq_sequence>

[0192] < / insdseq>

[0193] < / sequencedata>

[0194] <sequencedata sequenceidnumber="2">

[0195] <insdseq>

[0196] <INSDSeq_length>20< / INSDSeq_length>

[0197] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0198] <INSDSeq_division>PAT< / INSDSeq_division>

[0199] <INSDSeq_feature-table>

[0200] <insdfeature>

[0201]

[0202] <INSDFeature_key>source< / INSDFeature_key>

[0203]

[0204] <INSDFeature_location>1..20< / INSDFeature_location>

[0205] <INSDFeature_quals>

[0206] <insdqualifier>

[0207]

[0208] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0209]

[0210] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0211] < / insdqualifier>

[0212] <insdqualifier id="q4">

[0213]

[0214] <INSDQualifier_name>organism< / INSDQualifier_name>

[0215]

[0216] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0217] < / insdqualifier>

[0218] < / INSDFeature_quals>

[0219] < / insdfeature>

[0220] < / INSDSeq_feature-table>

[0221]

[0222] <INSDSeq_sequence>gctgctcctcatcttgttcc< / INSDSeq_sequence>

[0223] < / insdseq>

[0224] < / sequencedata>

[0225] <sequencedata sequenceidnumber="3">

[0226] <insdseq>

[0227] <INSDSeq_length> 20< / INSDSeq_length>

[0228] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0229] <INSDSeq_division> PAT< / INSDSeq_division>

[0230] <INSDSeq_feature-table>

[0231] <insdfeature>

[0232]

[0233] <INSDFeature_key>source< / INSDFeature_key>

[0234]

[0235] <INSDFeature_location>1..20< / INSDFeature_location>

[0236] <INSDFeature_quals>

[0237] <insdqualifier>

[0238]

[0239] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0240]

[0241] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0242] < / insdqualifier>

[0243] <insdqualifier id="q6">

[0244]

[0245] <INSDQualifier_name>organism< / INSDQualifier_name>

[0246]

[0247] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0248] < / insdqualifier>

[0249] < / INSDFeature_quals>

[0250] < / insdfeature>

[0251] < / INSDSeq_feature-table>

[0252]

[0253] <INSDSeq_sequence> ggaggcatgtcctgtgagt< / INSDSeq_sequence>

[0254] < / insdseq>

[0255] < / sequencedata>

[0256] <sequencedata sequenceidnumber="4">

[0257] <insdseq>

[0258] <INSDSeq_length> 20< / INSDSeq_length>

[0259] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0260] <INSDSeq_division> PAT< / INSDSeq_division>

[0261] <INSDSeq_feature-table>

[0262] <insdfeature>

[0263]

[0264] <INSDFeature_key>source< / INSDFeature_key>

[0265]

[0266] <INSDFeature_location>1..20< / INSDFeature_location>

[0267] <INSDFeature_quals>

[0268] <insdqualifier>

[0269]

[0270] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0271]

[0272] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0273] < / insdqualifier>

[0274] <insdqualifier id="q8">

[0275]

[0276] <INSDQualifier_name>organism< / INSDQualifier_name>

[0277]

[0278] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0279] < / insdqualifier>

[0280] < / INSDFeature_quals>

[0281] < / insdfeature>

[0282] < / INSDSeq_feature-table>

[0283]

[0284] <INSDSeq_sequence> ctggccctacagttgtccat< / INSDSeq_sequence>

[0285] < / insdseq>

[0286] < / sequencedata>

[0287] <sequencedata sequenceidnumber="5">

[0288] <insdseq>

[0289] <INSDSeq_length> 20< / INSDSeq_length>

[0290] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0291] <INSDSeq_division> PAT< / INSDSeq_division>

[0292] <INSDSeq_feature-table>

[0293] <insdfeature>

[0294]

[0295] <INSDFeature_key>source< / INSDFeature_key>

[0296]

[0297] <INSDFeature_location>1..20< / INSDFeature_location>

[0298] <INSDFeature_quals>

[0299] <insdqualifier>

[0300]

[0301] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0302]

[0303] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0304] < / insdqualifier>

[0305] <insdqualifier id="q10">

[0306]

[0307] <INSDQualifier_name>organism< / INSDQualifier_name>

[0308]

[0309] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0310] < / insdqualifier>

[0311] < / INSDFeature_quals>

[0312] < / insdfeature>

[0313] < / INSDSeq_feature-table>

[0314]

[0315] <INSDSeq_sequence> gacctggctctttcagcact< / INSDSeq_sequence>

[0316] < / insdseq>

[0317] < / sequencedata>

[0318] <sequencedata sequenceidnumber="6">

[0319] <insdseq>

[0320] <INSDSeq_length>20< / INSDSeq_length>

[0321] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0322] <INSDSeq_division>PAT< / INSDSeq_division>

[0323] <INSDSeq_feature-table>

[0324] <insdfeature>

[0325]

[0326] <INSDFeature_key>source< / INSDFeature_key>

[0327]

[0328] <INSDFeature_location>1..20< / INSDFeature_location>

[0329] <INSDFeature_quals>

[0330] <insdqualifier>

[0331]

[0332] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0333]

[0334] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0335] < / insdqualifier>

[0336] <insdqualifier id="q12">

[0337]

[0338] <INSDQualifier_name>organism< / INSDQualifier_name>

[0339]

[0340] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0341] < / insdqualifier>

[0342] < / INSDFeature_quals>

[0343] < / insdfeature>

[0344] < / INSDSeq_feature-table>

[0345]

[0346] <INSDSeq_sequence>ggctctcctttccctcatgt< / INSDSeq_sequence>

[0347] < / insdseq>

[0348] < / sequencedata>

[0349] <sequencedata sequenceidnumber="7">

[0350] <insdseq>

[0351] <INSDSeq_length> 20< / INSDSeq_length>

[0352] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0353] <INSDSeq_division> PAT< / INSDSeq_division>

[0354] <INSDSeq_feature-table>

[0355] <insdfeature>

[0356]

[0357] <INSDFeature_key>source< / INSDFeature_key>

[0358]

[0359] <INSDFeature_location>1..20< / INSDFeature_location>

[0360] <INSDFeature_quals>

[0361] <insdqualifier>

[0362]

[0363] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0364]

[0365] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0366] < / insdqualifier>

[0367] <insdqualifier id="q14">

[0368]

[0369] <INSDQualifier_name>organism< / INSDQualifier_name>

[0370]

[0371] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0372] < / insdqualifier>

[0373] < / INSDFeature_quals>

[0374] < / insdfeature>

[0375] < / INSDSeq_feature-table>

[0376]

[0377] <INSDSeq_sequence> tcaaactgaccctggcttct< / INSDSeq_sequence>

[0378] < / insdseq>

[0379] < / sequencedata>

[0380] <sequencedata sequenceidnumber="8">

[0381] <insdseq>

[0382] <INSDSeq_length>20< / INSDSeq_length>

[0383] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0384] <INSDSeq_division>PAT< / INSDSeq_division>

[0385] <INSDSeq_feature-table>

[0386] <insdfeature>

[0387]

[0388] <INSDFeature_key>source< / INSDFeature_key>

[0389]

[0390] <INSDFeature_location>1..20< / INSDFeature_location>

[0391] <INSDFeature_quals>

[0392] <insdqualifier>

[0393]

[0394] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0395]

[0396] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0397] < / insdqualifier>

[0398] <insdqualifier id="q16">

[0399]

[0400] <INSDQualifier_name>organism< / INSDQualifier_name>

[0401]

[0402] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0403] < / insdqualifier>

[0404] < / INSDFeature_quals>

[0405] < / insdfeature>

[0406] < / INSDSeq_feature-table>

[0407]

[0408] <INSDSeq_sequence>gttcggaggaaccactcaca< / INSDSeq_sequence>

[0409] < / insdseq>

[0410] < / sequencedata>

[0411] <sequencedata sequenceidnumber="9">

[0412] <insdseq>

[0413] <INSDSeq_length>20< / INSDSeq_length>

[0414] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0415] <INSDSeq_division>PAT< / INSDSeq_division>

[0416] <INSDSeq_feature-table>

[0417] <insdfeature>

[0418]

[0419] <INSDFeature_key>source< / INSDFeature_key>

[0420]

[0421] <INSDFeature_location>1..20< / INSDFeature_location>

[0422] <INSDFeature_quals>

[0423] <insdqualifier>

[0424]

[0425] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0426]

[0427] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0428] < / insdqualifier>

[0429] <insdqualifier id="q18">

[0430]

[0431] <INSDQualifier_name>organism< / INSDQualifier_name>

[0432]

[0433] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0434] < / insdqualifier>

[0435] < / INSDFeature_quals>

[0436] < / insdfeature>

[0437] < / INSDSeq_feature-table>

[0438]

[0439] <INSDSeq_sequence>ccctgcttcctgtcaacact< / INSDSeq_sequence>

[0440] < / insdseq>

[0441] < / sequencedata>

[0442] <sequencedata sequenceidnumber="10">

[0443] <insdseq>

[0444] <INSDSeq_length> 20< / INSDSeq_length>

[0445] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0446] <INSDSeq_division> PAT< / INSDSeq_division>

[0447] <INSDSeq_feature-table>

[0448] <insdfeature>

[0449]

[0450] <INSDFeature_key>source< / INSDFeature_key>

[0451]

[0452] <INSDFeature_location>1..20< / INSDFeature_location>

[0453] <INSDFeature_quals>

[0454] <insdqualifier>

[0455]

[0456] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0457]

[0458] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0459] < / insdqualifier>

[0460] <insdqualifier id="q20">

[0461]

[0462] <INSDQualifier_name>organism< / INSDQualifier_name>

[0463]

[0464] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0465] < / insdqualifier>

[0466] < / INSDFeature_quals>

[0467] < / insdfeature>

[0468] < / INSDSeq_feature-table>

[0469]

[0470] <INSDSeq_sequence> tccagctgaccttctcatgg< / INSDSeq_sequence>

[0471] < / insdseq>

[0472] < / sequencedata>

[0473] <sequencedata sequenceidnumber="11">

[0474] <insdseq><h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0475] <h2 style=";text-align:left;direction:ltr"><INSDSeq_length> 20< / INSDSeq_length><h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0476] <h2 style=";text-align:left;direction:ltr"><INSDSeq_moltype> DNA< / INSDSeq_moltype><h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0477] <h2 style=";text-align:left;direction:ltr"><INSDSeq_division> PAT< / INSDSeq_division><h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0478] <h2 style=";text-align:left;direction:ltr"><INSDSeq_feature-table><h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0479] <h2 style=";text-align:left;direction:ltr"> <insdfeature>

[0480]

[0481] <INSDFeature_key>source< / INSDFeature_key>

[0482]

[0483] <INSDFeature_location>1..20< / INSDFeature_location>

[0484] <INSDFeature_quals>

[0485] <insdqualifier>

[0486]

[0487] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0488]

[0489] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0490] < / insdqualifier>

[0491] <insdqualifier id="q22">

[0492]

[0493] <INSDQualifier_name>organism< / INSDQualifier_name>

[0494]

[0495] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0496] < / insdqualifier>

[0497] < / INSDFeature_quals>

[0498] < / insdfeature> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0499] <h2 style=";text-align:left;direction:ltr">< / INSDSeq_feature-table><h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0500] <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0501] <h2 style=";text-align:left;direction:ltr"><INSDSeq_sequence> gacgactccattgctgatga< / INSDSeq_sequence><h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0502] < / insdseq>

[0503] < / sequencedata>

[0504] <sequencedata sequenceidnumber="12">

[0505] <insdseq>

[0506] <INSDSeq_length>20< / INSDSeq_length>

[0507] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0508] <INSDSeq_division>PAT< / INSDSeq_division>

[0509] <INSDSeq_feature-table>

[0510] <insdfeature>

[0511]

[0512] <INSDFeature_key>source< / INSDFeature_key>

[0513]

[0514] <INSDFeature_location>1..20< / INSDFeature_location>

[0515] <INSDFeature_quals>

[0516] <insdqualifier>

[0517]

[0518] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0519]

[0520] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0521] < / insdqualifier>

[0522] <insdqualifier id="q24">

[0523]

[0524] <INSDQualifier_name>organism< / INSDQualifier_name>

[0525]

[0526] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0527] < / insdqualifier>

[0528] < / INSDFeature_quals>

[0529] < / insdfeature>

[0530] < / INSDSeq_feature-table>

[0531]

[0532] <INSDSeq_sequence>cacccatactgtcccaggag< / INSDSeq_sequence>

[0533] < / insdseq>

[0534] < / sequencedata>

[0535] <sequencedata sequenceidnumber="13">

[0536] <insdseq>

[0537] <INSDSeq_length>20< / INSDSeq_length>

[0538] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0539] <INSDSeq_division>PAT< / INSDSeq_division>

[0540] <INSDSeq_feature-table>

[0541] <insdfeature>

[0542]

[0543] <INSDFeature_key>source< / INSDFeature_key>

[0544]

[0545] <INSDFeature_location>1..20< / INSDFeature_location>

[0546] <INSDFeature_quals>

[0547] <insdqualifier>

[0548]

[0549] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0550]

[0551] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0552] < / insdqualifier>

[0553] <insdqualifier id="q26">

[0554]

[0555] <INSDQualifier_name>organism< / INSDQualifier_name>

[0556]

[0557] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0558] < / insdqualifier>

[0559] < / INSDFeature_quals>

[0560] < / insdfeature>

[0561] < / INSDSeq_feature-table>

[0562]

[0563] <INSDSeq_sequence>atggatgatgatgacgacga< / INSDSeq_sequence>

[0564] < / insdseq>

[0565] < / sequencedata>

[0566] <sequencedata sequenceidnumber="14">

[0567] <insdseq>

[0568] <INSDSeq_length>22< / INSDSeq_length>

[0569] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0570] <INSDSeq_division>PAT< / INSDSeq_division>

[0571] <INSDSeq_feature-table>

[0572] <insdfeature>

[0573]

[0574] <INSDFeature_key>source< / INSDFeature_key>

[0575]

[0576] <INSDFeature_location>1..22< / INSDFeature_location>

[0577] <INSDFeature_quals>

[0578] <insdqualifier>

[0579]

[0580] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0581]

[0582] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0583] < / insdqualifier>

[0584] <insdqualifier id="q28">

[0585]

[0586] <INSDQualifier_name>organism< / INSDQualifier_name>

[0587]

[0588] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0589] < / insdqualifier>

[0590] < / INSDFeature_quals>

[0591] < / insdfeature>

[0592] < / INSDSeq_feature-table>

[0593]

[0594] <INSDSeq_sequence>tcctcctgatgtacctgtgaga< / INSDSeq_sequence>

[0595] < / insdseq>

[0596] < / sequencedata>

[0597]

Claims

1. As a composition for predicting or diagnosing hearing loss, The composition includes MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, COL2A1, A composition for predicting or diagnosing hearing loss, comprising an agent for detecting a point mutation in one or more genes selected from the group consisting of COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9; or a copy number variation (CNV) in one or more genes selected from the group consisting of STRC and OTOA.

2. In paragraph 1, The composition further comprises an agent for detecting a point mutation in one or more genes selected from the group consisting of MPZL2, MT-RNR1, MT-TL1, OTOG, GSDME, PTPN11, ATP1A3, ILDR1, CD164, COL1A1, COL4A4, HARS2, MT-TS1, P2RX2, PJVK, POLD1, SLC26A5, TMEM43, TMTC4, TWNK, USH1C, and USH1G.

3. In paragraph 1, The above point mutation is one or more mutations selected from Table A below, the composition: [Table A] .

4. In paragraph 1, The above point mutation is one or more mutations selected from Table B below, the composition: [Table B] .

5. In paragraph 2, The above point mutation is one or more mutations selected from Table C below, the composition: [Table C] .

6. In paragraph 1, The above hearing loss is sensorineural hearing loss, conductive hearing loss or mixed hearing loss, the composition.

7. In paragraph 1, The above hearing loss is a moderate hearing loss, composition.

8. In paragraph 1, The above hearing loss is a hearing loss caused by a genetic copy number mutation or point mutation.

9. In paragraph 1, A composition wherein the above detection agent is a primer or a probe.

10. In paragraph 9, The above primers include primers for detecting gene copy number variations, A composition comprising at least one primer set selected from the group consisting of a first primer set of SEQ ID NOs: 1 and 2, a second primer set of SEQ ID NOs: 3 and 4, a third primer set of SEQ ID NOs: 5 and 6, a fourth primer set of SEQ ID NOs: 7 and 8, a fifth primer set of SEQ ID NOs: 9 and 10, and a sixth primer set of SEQ ID NOs: 11 and 12, wherein the primers for detecting the gene copy number variation are as follows.

11. A system for predicting or diagnosing hearing loss, comprising a composition according to any one of claims 1 to 10.

12. As a method of providing information for predicting or diagnosing hearing loss, The above method of providing information includes MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, An information providing method comprising a step of detecting a point mutation in one or more genes selected from the group consisting of COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9; or a copy number variation (CNV) in one or more genes selected from the group consisting of STRC and OTOA.

13. In paragraph 12, The above information providing method further comprises a step of detecting a point mutation in one or more genes selected from the group consisting of MPZL2, MT-RNR1, MT-TL1, OTOG, GSDME, PTPN11, ATP1A3, ILDR1, CD164, COL1A1, COL4A4, HARS2, MT-TS1, P2RX2, PJVK, POLD1, SLC26A5, TMEM43, TMTC4, TWNK, USH1C, and USH1G.

14. In paragraph 12, The above point mutation is one or more mutations selected from Table A below, Information provision method: [Table A] .

15. In paragraph 12, The above point mutation is one or more mutations selected from Table B below, Information provision method: [Table B] .

16. In paragraph 13, The above point mutation is one or more mutations selected from Table C below, Information provision method: [Table C] .

17. In paragraph 12, The above hearing loss is sensorineural hearing loss, information provision method.

18. In paragraph 12, The above hearing loss is a moderate hearing loss, information provision method.

19. In paragraph 12, The above hearing loss is a hearing loss caused by a genetic copy number mutation or point mutation, and is a method for providing information.

20. In paragraph 12, An information providing method, wherein the detection step is performed using one or more primer sets selected from the group consisting of a first primer set of sequence numbers 1 and 2, a second primer set of sequence numbers 3 and 4, a third primer set of sequence numbers 5 and 6, a fourth primer set of sequence numbers 7 and 8, a fifth primer set of sequence numbers 9 and 10, and a sixth primer set of sequence numbers 11 and 12.

21. In paragraph 12, The above information provision method is an information provision method that provides information predicting or diagnosing that a subject has hearing loss when a point mutation or copy number variation of the gene is detected in a sample of the subject.

22. In paragraph 21, The above copy number mutation detection comprises the steps of measuring the copy number of one or more genes selected from the group consisting of STRC and OTOA, and the standard gene EFTUD2 in a sample of a subject; A step of calculating a value by dividing the copy number of one or more genes selected from the group consisting of the above STRC and OTOA by the copy number of the above standard gene; and An information providing method, comprising: a step of providing information predicting or diagnosing that a subject has hearing loss when the calculated value is less than 0.8 or greater than 1.2.

Images