Graphene oxide-based composition for preventing or alleviating hair loss

Abstract

The present application relates to a composition for preventing or alleviating hair loss, comprising graphene oxide. The composition for preventing or alleviating hair loss, according to embodiments of the present application, allows for excellent enhancement of growth or proliferation of human dermal papilla cells, expression or activity of proteins of hair loss alleviation-related factors in human dermal papilla cells, and expression or activity of Wnt / β-catenin, and allows for an excellent level of reduction in the expression of hair loss-inducing genes and thus has the excellent effect of preventing or alleviating hair loss.

Description

Composition for preventing or improving hair loss based on graphene oxide

[0001] The present invention relates to a composition for preventing or improving hair loss, comprising graphene oxide.

[0002] Hair loss, once considered a common ailment for middle-aged men, is now becoming a widespread condition that transcends age and gender, leading to steady growth in the hair loss treatment market. According to pharmaceutical market research firm UBIST, the domestic hair loss treatment market, which was worth approximately KRW 99 billion in 2021, is expected to grow to KRW 102.4 billion in 2023. Furthermore, according to global market research firm Research & Markets, the global hair loss treatment market is expected to grow at a compound annual growth rate of 8.4% from approximately USD 3.5 billion in 2020 to approximately USD 6.2 billion by 2027. In addition to hair loss treatments, interest in hair loss prevention shampoos, health functional foods, and medical devices is also gradually increasing.

[0003] Androgenetic alopecia (Alopecia) is caused by the overexpression of the male hormone testosterone, accounting for the majority of male pattern baldness. When testosterone binds to 5α-reductase in the hair follicle, it is converted to dihydrotestosterone (DHT), a hormone known to be the primary cause of hair loss. This reduced DHT inhibits hair growth and causes hair loss. As of 2024, the hair loss treatments approved in Korea include finasteride, dutasteride, and minoxidil. Finasteride and dutasteride were initially developed to treat benign prostatic hyperplasia (BPH), but their efficacy in treating hair loss by suppressing androgen overexpression at low doses has been recognized. Minoxidil, originally intended for treating high blood pressure, was additionally approved as a hair loss treatment after its side effect, hirsutism, was identified. When applied to the scalp, it dilates blood vessels, increasing blood flow and promoting hair growth.

[0004] However, finasteride and dutasteride have a risk of causing systemic side effects such as decreased libido and erectile dysfunction due to their mechanism of suppressing male hormones, and if pregnant women or women who may become pregnant take the medication, it may have adverse effects on the male fetus.

[0005] [Prior Art Literature]

[0006] [Patent Document]

[0007] Republic of Korea Patent Publication No. 10-2506673

[0008] The present invention seeks to provide a composition for preventing or improving hair loss, comprising graphene oxide.

[0009] However, the problems that the present invention seeks to solve are not limited to the problems mentioned above, and other problems not mentioned will be clearly understood by those skilled in the art from the description below.

[0010] The first aspect of the present invention provides a composition for preventing or improving hair loss, comprising graphene oxide, wherein the average diameter of the graphene oxide is about 100 nm or more.

[0011] The second aspect of the present invention provides a method for preventing or improving hair loss, comprising administering to a subject a composition according to the first aspect.

[0012] The third aspect of the present invention provides a cosmetic composition for preventing or improving hair loss, comprising graphene oxide, wherein the average diameter of the graphene oxide is about 100 nm or more.

[0013] The fourth aspect of the present invention provides a pharmaceutical composition for preventing or improving hair loss, comprising graphene oxide, wherein the average diameter of the graphene oxide is about 100 nm or more.

[0014] The fifth aspect of the present invention provides a pharmaceutical composition for preventing or improving hair loss, comprising graphene oxide, wherein the average diameter of the graphene oxide is about 100 nm or more.

[0015] The composition for preventing or improving hair loss according to the embodiments of the present invention may have an excellent effect of preventing or improving hair loss by being excellent in promoting the growth or proliferation of human hair follicle cells, the expression or activity of hair loss improvement-related factor proteins in human hair follicle cells, and the expression or activity of Wnt / β-catenin, and by having an excellent degree of reduction in the expression of hair loss-inducing genes.

[0016] In one embodiment of the present invention, the composition for preventing or improving hair loss comprises graphene oxide having an average diameter of about 100 nm or more, and compared to graphene oxide having an average diameter of less than 100 nm, the composition is superior in promoting growth or proliferation of human hair follicle cells, expression or activity of hair loss improvement-related factor proteins in human hair follicle cells, and expression or activity of Wnt / β-catenin, and has an excellent degree of reduction in the expression of hair loss-inducing genes, so that the composition may have an excellent effect in preventing or improving hair loss.

[0017] In one embodiment of the present invention, the composition for preventing or improving hair loss is locally injected or applied to the treatment area to exhibit the effect of preventing or improving hair loss, and can prevent side effects of conventional hair loss treatments (e.g., side effects due to systemic sex hormone suppression).

[0018] Figure 1 shows, in one embodiment of the present invention, the proliferation rate of human hair follicle cells according to the size (average diameter) of graphene oxide under conditions of a cell culture time of 24 hours (24 h) and a graphene oxide concentration of 10 ppb.

[0019] Figure 2 shows the proliferation rate of human mammary gland cells according to the size of graphene oxide under conditions of a cell culture time of 72 h and a graphene oxide concentration of 10 ppb in one embodiment of the present invention.

[0020] Figure 3 shows the proliferation rate of human mammary gland cells according to the concentration of 110 nm-sized graphene oxide under cell culture conditions for 24 h in one embodiment of the present invention.

[0021] FIG. 4 is an optical microscope image of human mammary gland papilla cells according to the concentration of 110 nm-sized graphene oxide under cell culture conditions for 24 h in one embodiment of the present invention.

[0022] FIGS. 5 and 6 show, in one embodiment of the present invention, the production amount of hair loss improvement factor proteins (FGF7 (FIG. 5) and VEGF (FIG. 6)) according to treatment with 10 nm or 110 nm sized graphene oxide (10 ppb concentration) in human hair follicle cells.

[0023] Figure 7 shows the results of evaluating the activity of superoxide dismutase (SOD) enzyme according to treatment with graphene oxide (10 ppb concentration) of 10 nm or 110 nm in size in human mammary gland cells in one embodiment of the present invention.

[0024] FIGS. 8a to 8c show, in one embodiment of the present invention, the expression level of hair loss-inducing genes (AR (FIG. 8a), 5αR1 (FIG. 8b), and DKK1 (FIG. 8c)) according to treatment with oxidized graphene having a size of 10 nm or 110 nm in human hair follicle cells.

[0025] Figure 9 shows the results of evaluating Wnt / β-catenin signaling activity according to treatment with 10 nm or 110 nm sized graphene oxide in human mammary gland papilla cells in one embodiment of the present invention.

[0026] FIGS. 10A to 10D show, in one embodiment of the present invention, the results of evaluating the expression of cytokine mRNA (HGF (FIG. 10A), IGF-1 (FIG. 10B), VEGF (FIG. 10C), and FGF7 (FIG. 10D)) following treatment with 10 nm or 110 nm sized graphene oxide (100 ppb) in human mammary gland papilla cells.

[0027] FIGS. 11 and 12 show the results of hair growth evaluation (FIG. 11) and photographs (FIG. 12) according to the treatment of PDDA-functionalized graphene oxide (PDDA-GO) having a size of 10 nm or 110 nm in one embodiment of the present invention.

[0028] Hereinafter, with reference to the attached drawings, implementation examples and embodiments of the present invention will be described in detail so that those skilled in the art can easily practice the present invention. However, the present invention may be implemented in various different forms and is not limited to the implementation examples and embodiments described herein. In addition, in the drawings, parts irrelevant to the description have been omitted to clearly explain the present invention, and similar parts have been designated with similar drawing reference numerals throughout the specification.

[0029] Throughout this specification, when a part is said to be "connected" to another part, this includes not only cases where it is "directly connected" but also cases where it is "electrically connected" with another element in between.

[0030] Throughout this specification, when it is said that an element is "on" another element, this includes not only cases where the element is in contact with the other element, but also cases where another element exists between the two elements.

[0031] Throughout this specification, whenever a part is said to "include" a component, this does not mean that it excludes other components, but rather that it may include other components, unless otherwise specifically stated.

[0032] The terms "about," "substantially," and the like used in this specification are used in a meaning that is at or close to the numerical value when manufacturing and material tolerances inherent in the meanings mentioned are presented, and are used to prevent unscrupulous infringers from unfairly exploiting the disclosure in which exact or absolute values ​​are mentioned to aid understanding of the present application.

[0033] The terms “step of” or “step of” as used throughout this specification do not mean “step for”.

[0034] Throughout this specification, the term "combination(s) thereof" included in the expressions in the Makushi format means one or more mixtures or combinations selected from the group consisting of the components described in the expressions in the Makushi format, and means including one or more selected from the group consisting of said components.

[0035] Throughout this specification, references to “A and / or B” mean “A or B, or A and B.”

[0036] Throughout this specification, the term "hair loss" means the absence of hair in an area where hair would normally be present and / or a decrease in the number of hairs compared to normal.

[0037] Throughout this specification, the “diameter” of graphene oxide means the length of the longest line passing through the center of the graphene oxide particle from one end of the graphene oxide particle to the other.

[0038] Throughout this specification, the “average diameter” of graphene oxide means the average value of the diameter distribution of graphene oxide.

[0039] Below, the implementation examples of the present invention are described in detail, but the present invention may not be limited thereto.

[0040] The first aspect of the present invention provides a composition for preventing or improving hair loss, comprising graphene oxide, wherein the average diameter of the graphene oxide is about 100 nm or more.

[0041] In one embodiment of the present disclosure, the average diameter of the graphene oxide may be about 100 nm or more. In one embodiment of the present disclosure, the average diameter of the graphene oxide may be about 2,000 nm or less, about 1,500 nm or less, about 1,000 nm or less, about 900 nm or less, about 800 nm or less, about 700 nm or less, about 600 nm or less, about 500 nm or less, about 450 nm or less, about 400 nm or less, about 350 nm or less, or about 300 nm or less. In one embodiment of the present invention, the average diameter of the graphene oxide may be from about 100 nm to about 2,000 nm, from about 100 nm to about 1,500 nm, from about 100 nm to about 1,000 nm, from about 100 nm to about 900 nm, from about 100 nm to about 800 nm, from about 100 nm to about 700 nm, from about 100 nm to about 600 nm, from about 100 nm to about 500 nm, from about 100 nm to about 450 nm, from about 100 nm to about 400 nm, from about 100 nm to about 350 nm, or from about 100 nm to about 300 nm.

[0042] In one embodiment of the present invention, the average diameter of the graphene oxide may be from about 100 nm to about 500 nm. In one embodiment of the present invention, the average diameter of the graphene oxide may be from about 100 nm to about 300 nm.

[0043] In one embodiment of the present invention, the average thickness of the graphene oxide may be from about 100 nm to about 2,000 nm, from about 100 nm to about 1,500 nm, from about 100 nm to about 1,000 nm, from about 100 nm to about 900 nm, from about 100 nm to about 800 nm, from about 100 nm to about 700 nm, from about 100 nm to about 600 nm, from about 100 nm to about 500 nm, from about 100 nm to about 450 nm, from about 100 nm to about 400 nm, from about 100 nm to about 350 nm, or from about 100 nm to about 300 nm.

[0044] In one embodiment of the present invention, the graphene oxide may be functionalized with a quaternary ammonium salt.

[0045] In one embodiment of the present invention, the graphene oxide may be functionalized with a quaternary ammonium salt represented by the following chemical formula 1:

[0046] [Chemical Formula 1]

[0047] ;

[0048] In chemical formula 1,

[0049] R 1 and R 2 are, independently, unsubstituted or substituted, linear or branched C 1-10 Alkyl group, linear or branched C 2-10 Alkenyl group, linear or branched C 2-10 alkynyl group, or C 5-10 It is a cycloalkyl group,

[0050] X - is a halide ion,

[0051] n is an integer between 10,000 and 10,000,000.

[0052] In one embodiment of the present invention, n is about 10,000 to about 10,000,000, about 10,000 to about 9,000,000, about 10,000 to about 8,000,000, about 10,000 to about 7,000,000, about 10,000 to about 6,000,000, about 10,000 to about 5,000,000, about 10,000 to about 4,000,000, about 10,000 to about 3,000,000, about 10,000 to about 2,000,000, about 10,000 to about 1,000,000, about 10,000 to about 900,000, about It may be an integer of from about 10,000 to about 800,000, from about 10,000 to about 700,000, from about 10,000 to about 600,000, from about 10,000 to about 500,000, from about 10,000 to about 400,000, from about 10,000 to about 300,000, from about 10,000 to about 200,000, or from about 10,000 to about 100,000.

[0053] In one embodiment of the present invention, R 1 and R 2 If this is substituted, R 1 and R 2 is a halogen group, a hydroxyl group, an amino group, a carboxyl group, a cyano group, a nitro group, a formyl group, and C 1-10 It may be substituted with one or more selected from alkyl groups.

[0054] In one embodiment of the present invention, X - can be a fluoride ion, a chloride ion, a bromide ion, or an iodide ion.

[0055] In one embodiment of the present invention, the quaternary ammonium salt may be selected from poly(diallyldimethylammonium) (poly(diallyldimethylammonium; PDDA) salt, poly(diallyldiethylammonium) salt, poly(diallyldipropylammonium) salt, poly(diallyldibutylammonium) salt, poly(diallyldipentylammonium) salt, and poly(diallyldihexylammonium) salt.

[0056] In one embodiment of the present invention, the concentration of the graphene oxide may be from about 1 ppb to about 10,000,000 ppb, but may not be limited thereto.

[0057] In one embodiment of the present invention, the hair loss may include, but is not limited to, hormonal alopecia, alopecia areata, hereditary androgenic alopecia, telogen effluvium, traumatic alopecia, trichotillomania, compression alopecia, anagen alopecia, pityriasis versicolor, syphilitic alopecia, seborrheic alopecia, symptomatic alopecia, cicatricial alopecia, or congenital alopecia.

[0058] In one embodiment of the present invention, the composition may adsorb androgens. In one embodiment of the present invention, the androgens may include, but are not limited to, testosterone.

[0059] In one embodiment of the present invention, the hair loss may be hormonal hair loss (as a non-limiting example, androgenetic alopecia).

[0060] In one embodiment of the present invention, the composition for preventing or improving hair loss may have a hair loss prevention or improvement effect by adsorbing testosterone, thereby blocking the production of dihydrotestosterone (DHT), which is produced from testosterone through the action of 5α-reductase. Alternatively, in one embodiment of the present invention, the composition for preventing or improving hair loss may have a hair loss prevention or improvement effect by adsorbing DHT.

[0061] In one embodiment of the present invention, the composition may promote the growth or proliferation of human follicle dermal papilla cells (PromoCell).

[0062] In one embodiment of the present invention, the composition may promote the expression or activity of a hair loss improvement related factor protein in human hair follicle cells.

[0063] In one embodiment of the present invention, the composition may promote the expression or activity of one or more selected from VEGF (vascular endothelial growth factor), FGF7 (fibroblast growth factor 7), HGF (hepatocyte growth factor), IGF-1 (insulin-like growth factor-1), and β-catenin, but may not be limited thereto.

[0064] In one embodiment of the present invention, the composition may promote the expression or activity of Wnt / β-catenin / -catenin activation in human mammary gland cells.

[0065] In one embodiment of the present invention, the composition may reduce the expression of a hair loss-inducing gene in human hair follicle cells.

[0066] In one embodiment of the present invention, the composition may reduce the expression of one or more selected from AR, 5αR1, 5αR2, and DKK-1, but may not be limited thereto.

[0067] In one embodiment of the present invention, the composition may be a cosmetic composition, a quasi-drug composition, or a pharmaceutical composition, but may not be limited thereto.

[0068] In one embodiment of the present invention, the composition for preventing or improving hair loss comprises graphene oxide having an average diameter of about 100 nm or more, and compared to graphene oxide having an average diameter of less than 100 nm, the composition is superior in promoting growth or proliferation of human hair follicle cells, expression or activity of hair loss improvement-related factor proteins in human hair follicle cells, and expression or activity of Wnt / β-catenin, and has an excellent degree of reduction in the expression of hair loss-inducing genes, so that the composition may have an excellent effect in preventing or improving hair loss.

[0069] In one embodiment of the present invention, the composition for preventing or improving hair loss is locally injected or applied to the treatment area to exhibit the effect of preventing or improving hair loss, and can prevent side effects of conventional hair loss treatments (e.g., side effects due to systemic sex hormone suppression).

[0070] The second aspect of the present invention provides a method for preventing or improving hair loss, comprising administering to a subject a composition according to the first aspect.

[0071] Detailed explanations of parts that overlap with the first aspect of the present application have been omitted, but the contents described in the first aspect of the present application may be equally applied even if the explanation is omitted in the second aspect of the present application.

[0072] In one embodiment of the present invention, the administration may include, but is not limited to, applying and / or injecting to the application site of the subject.

[0073] The third aspect of the present invention provides a cosmetic composition for preventing or improving hair loss, comprising graphene oxide, wherein the average diameter of the graphene oxide is about 100 nm or more.

[0074] Detailed descriptions of overlapping parts with the first and second aspects of the present application have been omitted, but the contents described for the first and second aspects of the present application may be equally applied even if the description is omitted in the third aspect of the present application.

[0075] In one embodiment of the present invention, the cosmetic composition is a hair tonic, a hair conditioner, a hair essence, a hair lotion, a hair nutrition lotion, a hair shampoo, a hair rinse, a hair treatment, a hair cream, a hair nutrition cream, a hair moisture cream, a hair massage cream, a hair wax, a hair aerosol, a hair pack, a hair nutrition pack, a hair soap, a hair cleansing foam, a hair oil, a hair drying agent, a hair preservation agent, a hair dye, a hair waving agent, a hair bleaching agent, a hair gel, a hair glaze, a hair dressing agent, a hair lacquer, a hair moisturizer, a hair mousse, a hair spray, an eyebrow hair growth agent, an eyelash hair growth agent, an eyelash nutrition agent, a pet shampoo or rinse, a toner, a nutrition cream, a massage cream, an eye cream, an eye essence, an essence, a cleansing cream, a cleansing lotion, a cleansing foam, a cleansing water, a pack, a powder, a body lotion, a body cream, a body essence, or It may be in the form of a body cleanser, but may not be limited thereto.

[0076] In one embodiment of the present invention, the cosmetic composition may further include other components other than the graphene oxide depending on the intended use, etc. For example, the cosmetic composition may further include components and / or functional additives generally included in cosmetic compositions. The components generally included in cosmetic compositions may include, but are not limited to, moisturizers, emollients, surfactants, ultraviolet absorbers, preservatives, bactericides, antioxidants, pH adjusters, organic and inorganic pigments, fragrances, or cooling agents. The functional additives may include, but are not limited to, water-soluble vitamins, oil-soluble vitamins, polymeric peptides, or polymeric polysaccharides.

[0077] The fourth aspect of the present invention provides a pharmaceutical composition for preventing or improving hair loss, comprising graphene oxide, wherein the average diameter of the graphene oxide is about 100 nm or more.

[0078] Detailed descriptions of parts overlapping with aspects 1 to 3 of the present application have been omitted, but the contents described for aspects 1 to 3 of the present application may be equally applied even if the description is omitted in aspect 4 of the present application.

[0079] Typically, “over-the-counter drugs” refer to products used for the purpose of treating diseases or alleviating or preventing symptoms, while “cosmetics” refer to products used for the purpose of maintaining or promoting the health of the skin or hair for the purpose of cleansing and beautifying the human body.

[0080] The composition for preventing or improving hair loss of the present invention may be classified as a quasi-drug composition if it contains graphene oxide in a high content of a certain level or higher and is used for the purpose of treating, alleviating, or preventing hair loss, and may be classified as a cosmetic composition if it contains graphene oxide in a lower content than the quasi-drug composition and has a mild pharmaceutical effect and is used for the purpose of maintaining or promoting hair health. Accordingly, the quasi-drug composition of the present invention may have the same formulation as the cosmetic composition, and may exhibit a pharmaceutical effect by adjusting the content range of the graphene oxide.

[0081] In one embodiment of the present invention, the above-mentioned pharmaceutical composition is a hair tonic, a hair conditioner, a hair essence, a hair lotion, a hair nutrition lotion, a hair shampoo, a hair rinse, a hair treatment, a hair cream, a hair nutrition cream, a hair moisture cream, a hair massage cream, a hair wax, a hair aerosol, a hair pack, a hair nutrition pack, a hair soap, a hair cleansing foam, a hair oil, a hair drying agent, a hair preservation agent, a hair dye, a hair waving agent, a hair bleaching agent, a hair gel, a hair glaze, a hair dressing agent, a hair lacquer, a hair moisturizer, a hair mousse, a hair spray, an eyebrow hair growth agent, an eyelash hair growth agent, an eyelash nutrition agent, a pet shampoo or rinse, a toner, a nutrition cream, a massage cream, an eye cream, an eye essence, an essence, a cleansing cream, a cleansing lotion, a cleansing foam, a cleansing water, a pack, a powder, a body lotion, a body cream, a body essence, Or it may be in the form of a body cleanser, but may not be limited thereto.

[0082] In one embodiment of the present invention, the above-mentioned pharmaceutical composition may additionally include other pharmaceutical ingredients other than the above-mentioned graphene oxide, depending on the purpose of use, etc.

[0083] In one embodiment of the present invention, the content of the graphene oxide of the above pharmaceutical composition may be appropriately selected depending on the purpose of use (prevention, health or therapeutic treatment).

[0084] The fifth aspect of the present invention provides a pharmaceutical composition for preventing or improving hair loss, comprising graphene oxide, wherein the average diameter of the graphene oxide is about 100 nm or more.

[0085] Detailed descriptions of parts overlapping with aspects 1 to 4 of the present application have been omitted, but the contents described for aspects 1 to 4 of the present application may be equally applied even if the description is omitted in aspect 5 of the present application.

[0086] In one embodiment of the present invention, the pharmaceutical composition may be administered parenterally. The parenteral administration method may include, but is not limited to, intramuscular administration, transdermal administration, or subcutaneous administration.

[0087] In one embodiment of the present invention, the pharmaceutical composition may be administered by applying it to the diseased area or by injecting it, but may not be limited thereto.

[0088] In one embodiment of the present invention, the pharmaceutical composition may be formulated into a pharmaceutical formulation conventional in the art. Specifically, the pharmaceutical composition may be formulated as an injectable solution for intramuscular, transdermal, or subcutaneous administration; or as a topical skin preparation for topical application.

[0089] In one embodiment of the present invention, the pharmaceutical composition may be in the form of an injection, cream, ointment, paste, gel, patch, jelly, serum, powder, aerosol spray, non-aerosol spray, foam, lotion, solution or suspension, but may not be limited thereto.

[0090] In one embodiment of the present invention, the pharmaceutical composition may further comprise a sterilized aqueous solution, non-aqueous solvent, suspension, emulsion, freeze-dried preparation, or external preparation for formulation into the dosage form. Specifically, if the dosage form is an injection, it may further comprise a stabilizer, a buffer, and / or water. If the dosage form is a paste, cream, or gel, it may further comprise animal fiber, plant fiber, wax, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, or zinc oxide as a carrier component. If the dosage form is a powder or spray, it may further comprise lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder as a carrier component. If the dosage form is a spray, it may further comprise a propellant such as chlorofluorohydrocarbon, propane / butane, or dimethyl ether.

[0091] In one embodiment of the present invention, the pharmaceutical composition may further comprise another therapeutic agent suitable for the treatment of hair loss.

[0092] Hereinafter, the present invention will be described in more detail using examples. However, the following examples are provided only to help understand the present invention, and the contents of the present invention are not limited to the following examples.

[0093] [Example]

[0094] Example 1: Preparation of a pharmaceutical composition comprising nano-sized graphene oxide (GO)

[0095] 1) Production of graphene oxide with various diameters

[0096] Graphene oxide was produced using the Hummer's method. Graphite was sufficiently stirred in an H2SO4 solution at room temperature, and then KMnO4 was added to the solution. After that, H2O2 was additionally added to the solution, and an oxidation reaction of the graphite was induced to form graphene oxide. After several purification processes, graphene oxide was obtained. Next, the graphene oxide was dispersed in water to obtain an aqueous graphene oxide dispersion. The graphene oxide classified into various diameter sizes is used for laser diffraction (Mie scattering method). In the Mie scattering method, when light collides with particles, scattering (diffraction) occurs, and the detector can obtain different electric signals depending on the angle and intensity of the scattered light. At this time, the size distribution of the sample (test product) can be obtained from each different electric signal based on the Mie theory. From this, the size (average diameter) of each sample was controlled.

[0097] 2) Preparation of PDDA (Poly(diallyldimethylammonium) salt-functionalized graphene oxide

[0098] 1) 30 mg of dried graphene oxide prepared in step 1 was dispersed in 30 mL of ultrapure water (1 mg / mL, 0.1 wt%) and sonicated to prepare an aqueous graphene oxide dispersion. Then, a 35 wt% poly(diallyldimethylammonium chloride) solution (Sigma Aldrich) was added to the aqueous graphene oxide dispersion and mixed at room temperature for 2 hours using a magnetic stirrer. At this time, the amount of PDDA salt solution was adjusted to 30 μL to 600 μL. Thereafter, a centrifuge was used to remove the PDDA aqueous dispersion in the form of a transparent liquid that was separated without reacting with the graphene oxide.

[0099] Experimental Example 1: In-vitro Evaluation

[0100] 1) Test method

[0101] (1) Cell culture

[0102] Human Follicle Dermal Papilla Cells (PromoCell) were cultured in Human Follicle Dermal Papilla Cell Growth Medium supplemented with Fetal Calf Serum, Bovine Pituitary Extract, Basic Fibroblast Growth Factor, and Insulin at 37°C and 5% CO2.

[0103] (2) Preparation of test products

[0104] The test product was diluted in the culture medium to 100,000 ppb, and then the 100,000 ppb test product and the culture medium were diluted 1 / 10 each in a ratio of 1:9, and the cells were treated to concentrations of 10 ppb, 100 ppb, and 1000 ppb.

[0105] (3) Evaluation of cell proliferation rate

[0106] Cultured cells were seeded at 5×10 in a 96-well plate. 3 The prepared test products were treated at different concentrations and cultured for 24, 48, and 72 hours. Afterwards, WST substrate solution (CCK-8, Dojindo) was added to the medium and cultured at 37°C for 2 hours, and the absorbance (OD) was measured at 450 nm using a microplate reader (VARIOSKAN LUX, Thermo Fisher Scientific). The measured OD value was calculated using Equation 1 below to calculate the cell proliferation rate.

[0107] [Formula 1]

[0108] Cell proliferation rate (%) = (ODexp-ODblnk) / (ODcon-ODblnk) × 100

[0109] - Blank (blnk): Medium containing WST substrate

[0110] - Control (con, (negative) control group): No treatment with test product

[0111] - Experiment (exp, experimental group): Test product treatment

[0112] (4) Evaluation of protein production

[0113] Cultured cells were 5×10 4 The cells were divided into 6-well plates and dispensed. When the confluency reached 80% or more, the test product was treated to each well according to concentration and cultured for 24 hours. Afterwards, the culture medium was taken, centrifuged at 2,000 xg for 10 minutes, and only the supernatant excluding cell debris was collected to evaluate the amount of FGF7 and VEGF proteins produced.

[0114] For quantification of VEGF protein, Human VEGF ELISA kit (abcam) was used, and for quantification of FGF-7 protein, Human FGF-7 ELISA kit (abcam) was used. The culture medium was used as a stock solution, and the test was performed according to the enclosed test method. The OD value was measured using a microplate reader (VARIOSKAN LUX, Thermo Fisher Scientific), and the measured value was substituted into the regression equation obtained from the standard curve and multiplied by the dilution factor to calculate the protein concentration.

[0115] (5) Enzyme activity evaluation

[0116] Cultured cells were 5×10 4 The cells were divided into 6-well plates and seeded. When the culture reached more than 80% confluence, H2O2 (400 μM) was treated to induce oxidative stress, and the test products were treated at various concentrations and cultured for another 24 hours. Afterwards, the culture medium was taken, centrifuged at 2,000 xg for 10 minutes, and only the supernatant excluding cell debris was collected and used for the test.

[0117] Superoxide dismutase (SOD) activity was measured using an SOD kit (BIOMAX), and the culture medium was a stock solution. The test was performed according to the enclosed test method, and the OD value was measured using a microplate reader (VARIOSKAN LUX, Thermo Fisher Scientific). The measured OD value was used to calculate SOD activity according to the enclosed result analysis method.

[0118] (6) Cell penetration ability evaluation

[0119] Cultured cells were 1×10 6 The cells were divided into 100 mm dishes and seeded. When the culture reached more than 80% confluence, the test products were treated at different concentrations and cultured for another 24 hours. Afterwards, the cells, excluding the culture medium, were collected with a scraper and fixed in a transmission electron microscopy (TEM) fixer for more than 8 hours. The cells were washed, fixed once more using OsO4, and then moisture was removed. After infiltrating the cells with resin and embedding them, they were thinly sectioned with an ultramicrotome to allow electron beam penetration, and then stained with toluidine to designate the TEM observation area. After staining, grids were made and used for TEM (JEM-1011, Jeol) photography after uranyl / lead double staining.

[0120] (7) Statistical analysis

[0121] Statistical analysis was performed using the IBM SPSS statistics 25.0 program, and the significance between the experimental and control groups was confirmed at a hypothesized mean difference of 5% (p<0.05). After the normality test, significance was confirmed using an independent-samples t-test (parametric method) depending on whether normality was satisfied.

[0122] 2) Results

[0123] (1) Evaluation of cell proliferation rate according to graphene oxide size under 24 h / 10 ppb conditions

[0124] Under conditions of a cell culture time of 24 h and a graphene oxide concentration of 10 ppb, the cell proliferation rate was evaluated according to the graphene oxide size (10 nm, 110 nm, 300 nm, 500 nm, 2000 nm, and 7500 nm) (Table 1 and Fig. 1). Referring to Table 1 and Fig. 1, when the graphene oxide size was 110 nm, 300 nm, and 500 nm, the cell proliferation rate value was approximately 128% or more, which was significantly higher than that of 10 nm or 2000 nm or more. In addition, when the graphene oxide size was 110 nm, the cell proliferation rate value showed the highest value of 141.533%.

[0125] Graphene oxide size (nm) Cell proliferation rate (%) 1094.86 3110 141.53 300 132.50 4500 128.97 72000 80.90 17500 88.916

[0126] (2) Evaluation of cell proliferation rate according to graphene oxide size under 72 h / 10 ppb conditions

[0127] Under conditions of a cell culture time of 72 h and a graphene oxide concentration of 10 ppb, the cell proliferation rate according to the graphene oxide size (10 nm, 110 nm, and 300 nm) was evaluated (Table 2 and Fig. 2). Referring to Table 2 and Fig. 2, the cell proliferation rate increased as the cell culture time increased regardless of the graphene oxide size. In addition, similar to the 24 h / 10 ppb condition of (1), it can be confirmed that the cell proliferation rates of 110 nm and 300 nm were significantly higher than those of 10 nm.

[0128] Graphene oxide size (nm) Cell proliferation rate (%) 10 1 1 7.56 4 1 1 0 1 4 9.27 0 300 139.433

[0129] (3) Evaluation of cell proliferation rate according to the concentration of 110 nm graphene oxide at 24 h Under cell culture conditions for 24 h, the cell proliferation rate according to the concentration of 110 nm sized graphene oxide (1 ppb, 10 ppb, 100 ppb, 1,000 ppb, and 10,000 ppb) was evaluated (Table 3 and Fig. 3). Referring to Table 3 and Fig. 3, 110 nm sized graphene oxide showed a high cell proliferation rate of about 129% or more at concentrations of 1 ppb to 1,000 ppb, and showed the highest value of 141.533% at 10 ppb. Fig. 4 shows the (negative) control group; And the cell morphology at concentrations of 1,000 ppb, 10,000 ppb, and 100,000 ppb of 110 nm graphene oxide under cell culture conditions for 24 hours was measured by optical microscopy, and it was confirmed that a deformation of the cell morphology (arrow) occurred at concentrations higher than 10,000 ppb.

[0130] Concentration (ppb) Cell proliferation rate (%) 1129.898 10141.533 100137.975 1,000 133.340

[0131] (4) Evaluation of protein production related to hair loss improvement To compare GO 10 nm and GO 110 nm at a concentration of 10 ppb in human hair follicle cells, the production of protein factors related to hair loss improvement (fibroblast growth factor (FGF7) and vascular endothelial growth factor (VEGF)) was evaluated (Figs. 5 and 6, Table 4). It was confirmed that the production of FGF7 and VEGF proteins was significantly increased in GO 110 nm compared to the control group and GO 10 nm.

[0132] Graphene oxide size (nm)FGF7 protein production (pg / mL)VEGF protein production (pg / mL)Control group5.056±1.68214.364±0.1981037.722±7.096**13.864±0.20011084.311±1.526***36.241±0.365***

[0133] **: p<0.01 by independent samples t-test vs. (negative) control group

[0134] ***: p<0.001 by independent samples t-test vs. (negative) control group

[0135] (5) Enzyme activity evaluation

[0136] Superoxide dismutase (SOD) enzyme activity was evaluated for comparison of 10 ppb GO 10 nm and GO 110 nm in human mammary gland papilla cells (Fig. 7 and Table 5).

[0137] SOD activity (%) Control (untreated with H2O2) 304.903±4.765 H2O2-2 51.993±10.685 GO 10 nm 2 34.866±0.919 GO 110 nm 2 90.245±5.108

[0138] As a result of the SOD activity evaluation, a significant increase was confirmed in GO 110 nm compared to the H2O2 only treatment group, and it was confirmed that the SOD activity of GO 110 nm was superior to that of GO 10 nm.

[0139] Experimental Example 2: In-vitro Evaluation-2

[0140] 1) Test method

[0141] (1) Human mammary gland cell culture

[0142] Dermal papilla were isolated from the bulb of cut hairs, transferred to culture dishes coated with collagen type Ⅰ, and cultured in DMEM supplemented with penicillin (100 U / mL), streptomycin (100 ug / mL), and 20% heat-inactivated serum. The explants were left in place for a week, and the medium was changed every three days when the dermal papilla attached to the culture dish and the cells began to extend. Once the cells grew, they were harvested using 0.25% trypsin / 10 mM EDTA and maintained in DMEM supplemented with 10% heat-inactivated serum at 37°C and 5% CO2. In this experiment, RNA was isolated from passage 2 cells after 24 hours of treatment with 10 nm graphene oxide or 110 nm graphene oxide depending on the conditions.

[0143] (2) RNA isolation and real-time PCR

[0144] Cells treated with graphene oxide were isolated according to the protocol using the Qiagen RNeasey Mini kit (Qiagen). cDNA was synthesized from 5 μg of RNA using a cDNA synthesis kit (Promega) containing ImProm-II™ reverse transcriptase and oligo-dT primers. cDNA (1 μL) was amplified with each forward and reverse primer. Real-time PCR was performed using a Step One Plus real-time PCR instrument (Applied Biosystems, Foster City, CA), and all reactions were performed with 50 ng of cDNA and 10 μM primers using Power SYBRR Green premix (Applied Biosystems). Amplification was performed under the following cycling conditions: 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, and then 60°C for 60 s. Differences between samples and controls were calculated using Step One Plus real-time PCR analysis software (Applied Biosystems). The primer base sequences used are as shown in Table 6 below.

[0145] GeneOligonucleotide primersGAPDHCGA CCA CTT TGT CAA GCT CAAGG GGA GAT TCA GTG TGG TGGHFTCCACGGAAGAGGAGATGAGAGGCCATATACCAGCTGGGAAAIGF-1CCTCTCAAGAGCCACAAATGCTCCAGCAGCCAAGATTCAGAVEGFAGGCCAGCACATAGGAGAGACGCGAGTCTGTGTTTTTGCAFGF-7CAAGAGCACAAATGCCCAAAACCTCAAGCCTTCATGACATTC

[0146] 2) Results

[0147] (1) Evaluation of inhibition of hair loss-inducing gene expression by graphene oxide

[0148] Dermal papilla (DP) cells were isolated and cultured from the frontal and occipital hair follicles of male pattern baldness patients with high AR and 5αR1 gene expression, and experiments were conducted using the established cell lines. DP cells were treated with GO 10 nm or GO 110 nm, and after 24 hours, the expression levels of hair loss-inducing genes (AR, 5αR1, and DKK-1) were evaluated using real-time PCR. Referring to Figures 8a to 8c, the expression levels of hair loss-inducing genes were all decreased in the GO-treated group compared to the control group. In addition, it can be confirmed that the degree of decrease in hair loss-inducing gene expression was greater in GO 110 nm compared to GO 10 nm. In particular, it can be confirmed that the expression of DKK-1 mRNA, known as a male pattern baldness-inducing factor, was inhibited.

[0149] (2) Evaluation of Wnt / β-catenin activation

[0150] DP cells were transfected with TOPFlash vector (TCF / LEF promoter) and treated with graphene oxide, and the promoter activity was measured using luciferase. The Wnt / β-catenin pathway is one of the important signaling pathways related to hair growth. The Wnt / β-catenin signal promotes the maintenance and activation of activated stem cells to maintain hair health, promotes cell division to accelerate hair growth or participates in new hair formation, and further promotes new hair regeneration. In addition, the pathway is activated when the Wnt protein binds to the Fizzled receptor and LRP 5 / 6 receptor on the cell surface, and the activated Wnt signal stabilizes β-catenin, which enters the nucleus and binds to the TCF / LEF promoter to promote the expression of target genes.

[0151] Referring to Figure 9, signal activity increased in all groups treated with graphene oxide compared to the control group, and it can be seen from this that graphene oxide is involved in Wnt / β-catenin signal activity.

[0152] (3) Confirmation of mRNA expression of cytokines involved in hair growth

[0153] Various factors have been reported as hair growth promoting factors, and in particular, HGF (Hepatocyte growth factor), IGF-1 (Insulin-like growth factor-1), VEGF (vascular endothelial growth factor), and FGF7 (fibroblast growth factor 7) are known as representative hair growth factors.

[0154] After treating hair papilla cells with 100 ppb of 10 nm GO or 110 nm GO, RNA was isolated 24 hours later, reverse transcribed using reverse transcriptase, and real-time PCR was performed using each primer to obtain the results. Referring to Figs. 10a to 10d, it can be observed that the expression of HGF, IGF-1 VEGF, and FGF-7 genes increased in the groups treated with 10 nm GO and 110 nm GO compared to the control group. In addition, it was confirmed that the expression of all of the above genes increased in the 110 nm GO treatment group compared to 10 nm GO. This suggests that 110 nm GO can promote hair growth by inducing the expression of growth factors in hair papilla cells more than 10 nm GO.

[0155] Experimental Example 3: Ex-vivo Evaluation

[0156] 1) Test method

[0157] (1) Ex vivo human hair follicle organ culture

[0158] Hair follicles were obtained from occipital biopsies of patients undergoing hair transplantation at the Kyungpook National University Hospital Hair Transplant Center with the consent of the patient. The hair follicles were dissected into follicular units and then cut in a straight line below the sebaceous gland. Hair follicles prepared under the above conditions were cultured in William's E medium containing 2 mM L-glutamine, 10 ng / ml Hydrocortisone, 10 ng / ml Insulin, and Penicillin / Streptomycin, with either 10 nm graphene oxide or 110 nm graphene oxide, depending on the conditions. Hair follicles were cultured in 24-well culture medium (500 μL medium containing the substances), with six follicles per condition added, for six days under 5% CO2 and 37°C. The medium containing the substances was replaced every three days to avoid damaging the follicles. After six days of culture, photographs were taken and the growth length was measured. For each substance, the growth length and the follicles were observed in three replicates. On the 6th day of the final culture, the hair follicle tissue was transferred onto a slide, photographed under a microscope (OLYMPUS, SZX9), and the length of the growth was measured using iSolution Lite.

[0159] Reagents used - William's E (no phenol red, Gibco, A1217601), 2mM L-glutamin (Gibco, 25030081), 10ng / ml Hydrocortisone (Sigma, H0888), 10μg / ml Insulin (Sigma, I2643), Penicillin / Streptomycin (Gibco, 10378016).

[0160] 2) Results

[0161] (1) Hair growth evaluation

[0162] Hair growth was evaluated by treating with 10 nm and 110 nm PDDA-functionalized graphene oxide (PDDA-GO). Referring to FIGS. 11 and 12, hair growth was observed in the groups treated with 10 nm or 110 nm PDDA-GO at concentrations of 0.1 ppm and 1 ppm, respectively, compared to the control group. In addition, it can be confirmed that the degree of hair growth of 110 nm PDDA-GO is greater than that of 10 nm PDDA-GO.

[0163] The above description of the present invention is for illustrative purposes only, and those skilled in the art will readily appreciate that the present invention can be readily modified into other specific forms without altering the technical spirit or essential characteristics of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive. For example, each component described as a single entity may be implemented in a distributed manner, and similarly, components described as distributed may be implemented in a combined manner.

[0164] The scope of the present invention is indicated by the claims described below rather than the detailed description above, and all changes or modifications derived from the meaning and scope of the claims and their equivalent concepts should be interpreted as being included in the scope of the present invention.

Claims

1. A composition for preventing or improving hair loss, comprising graphene oxide, A composition for preventing or improving hair loss, wherein the average diameter of the above-mentioned graphene oxide is 100 nm or more.

2. In paragraph 1, A composition for preventing or improving hair loss, wherein the average diameter of the above graphene oxide is 100 nm to 500 nm.

3. In paragraph 1, A composition for preventing or improving hair loss, wherein the average diameter of the above-mentioned graphene oxide is 100 nm to 300 nm.

4. In paragraph 1, A composition for preventing or improving hair loss, wherein the average thickness of the above graphene oxide is 100 nm to 2,000 nm.

5. In paragraph 1, A composition for preventing or improving hair loss, wherein the above graphene oxide is functionalized with a quaternary ammonium salt.

6. In paragraph 1, A composition for preventing or improving hair loss, wherein the above-mentioned graphene oxide is functionalized with a quaternary ammonium salt represented by the following chemical formula 1: [Chemical Formula 1] ; In chemical formula 1, R 1 and R 2 are, independently, unsubstituted or substituted, linear or branched C 1-10 Alkyl group, linear or branched C 2-10 Alkenyl group, linear or branched C 2-10 Alkynyl group, or C 5-10 It is a cycloalkyl group, X - is a halide ion, n is an integer between 10,000 and 10,000,000.

7. In paragraph 5, A composition for preventing or improving hair loss, wherein the quaternary ammonium salt is selected from poly(diallyldimethylammonium) (poly(diallyldimethylammonium; PDDA) salt, poly(diallyldiethylammonium) salt, poly(diallyldipropylammonium) salt, poly(diallyldibutylammonium) salt, poly(diallyldipentylammonium) salt, and poly(diallyldihexylammonium) salt.

8. In paragraph 1, A composition for preventing or improving hair loss, wherein the concentration of the above graphene oxide is 1 ppb to 10,000,000 ppb.

9. In paragraph 1, The above composition is a composition for preventing or improving hair loss, which promotes the growth or proliferation of human hair follicle cells.

10. In paragraph 1, The composition is a composition for preventing or improving hair loss, which promotes the expression or activity of one or more selected from VEGF (vascular endothelial growth factor), FGF7 (fibroblast growth factor), HGF (hepatocyte growth factor), IGF-1 (insulin-like growth factor-1), and β-catenin.

11. In paragraph 1, A composition for preventing or improving hair loss, wherein the composition reduces the expression of one or more selected from AR, 5αR1, 5αR2, and DKK-1.

12. In paragraph 1, A composition for preventing or improving hair loss, wherein the above hair loss is androgenetic alopecia.

13. In paragraph 1, A composition for preventing or improving hair loss, wherein the composition is a cosmetic composition, a quasi-drug composition, or a pharmaceutical composition.

14. A method for preventing or improving hair loss, comprising administering to a subject a composition according to paragraph 1.

15. In paragraph 14, A method for preventing or improving hair loss, wherein the above administration comprises applying and / or injecting to the application site of the subject.

16. A cosmetic composition for preventing or improving hair loss, comprising graphene oxide, A cosmetic composition for preventing or improving hair loss, wherein the average diameter of the above-mentioned graphene oxide is 100 nm or more.

17. A pharmaceutical composition for preventing or improving hair loss, comprising graphene oxide, A pharmaceutical composition for preventing or improving hair loss, wherein the average diameter of the above-mentioned graphene oxide is 100 nm or more.

18. A pharmaceutical composition for preventing or improving hair loss, comprising graphene oxide, A pharmaceutical composition for preventing or improving hair loss, wherein the average diameter of the above graphene oxide is 100 nm or more.

Images