Primers and method for detecting replication competent retroviruses

Abstract

Set forth are primers and a method for detecting replication competent retroviruses (RCR), and specifically provided is a primer set for rapidly detecting RCR in a sample, which has been shown by methodological verification to have excellent specificity, sensitivity, and durability. The method complies with the provisions of the "Technical Guidelines for Pharmaceutical Research and Evaluation of Human Stem Cell Products (Trial)" issued by the Center for Drug Evaluation of the National Medical Products Administration. Referring to the requirements for RCR detection of retroviral vector-based gene therapy products in the industry guide "Testing of Retroviral Vector-Based Human Gene Therapy Products for Replication Competent Retrovirus During Product Manufacture and Patient Follow-up" issued by the U.S. Food and Drug Administration (FDA), primers and a method for detecting RCR are developed, which can effectively reduce the cycle and costs of testing and release of related gene therapy products such as CAR-T, CAR-NK, and other immune cell therapy products.

Description

Replicating retrovirus detection primers and methods Technical Field

[0001] The present invention relates to the field of biological detection, and in particular to the detection of replicating retroviruses. Background Art

[0002] With advances in viral molecular and structural biology, a deeper understanding of viruses has provided a solid theoretical foundation for gene therapy and facilitated the widespread use of viral vectors in clinical research. Gamma-retroviral vectors were the first viral vector to enter clinical research, and the feasibility and safety of viral vectors in gene therapy have been evaluated. As of 2012, two-thirds of clinical trials still used viral vectors, with retroviral vectors accounting for 19.7%. Gamma-retroviral vectors are a type of RNA virus, many of which are pathogenic in their wild-type form, such as Murine leukemia virus and Feline leukemia virus. Therefore, the safety of viral vectors used in gene therapy products must be evaluated.

[0003] An important consideration is that retroviruses can integrate exogenous genes into the cellular genome, potentially causing insertional mutagenesis, altering cellular gene sequences and causing long-term effects on cellular gene expression. For example, upregulation of cellular gene expression when the integration site is located near a proto-oncogene can alter cell growth, affect host cell genotype and phenotype, and lead to activation of endogenous viruses. In gene therapy for severe immunodeficiency syndrome (SCID-X1), retroviral vector gene integration near the LMO2 proto-oncogene promoter has been reported, leading to disrupted LMO2 expression and uncontrolled cell proliferation, and these integrations are non-random. In gene therapy for X-linked chronic granulomatous disease (X-CGD), some patients have developed leukemia or myelodysplasia. These events have prompted the development of safer retroviral vector designs, such as the self-inactivating γ-retroviral vector SIN-γRV. However, replication-defective self-inactivating retroviral vectors contain the ability to infect and deliver genes, so integration events are still possible. Therefore, it is still necessary to monitor the presence of replication-competent retroviruses (RCR) during related gene therapy.

[0004] Due to the increasing use of γ-retroviral vectors in clinical trials, the European Medicines Agency (EMA) established safety requirements for retroviral vectors in Commission Directive 2003 / 63 / EC in 2003. These requirements include safety assessments, traceability of patient samples and final drug products, the absence of replication-competent viruses in non-replicating viral fluids, monitoring of patients for possible infections and related sequelae throughout and after treatment, and monitoring of frequent contact with patients, such as healthcare personnel. In 2006, the US Food and Drug Administration (FDA) issued guidance on retroviral vector-based gene therapy products. The document detailed recommendations on relevant testing methods, the content and level of RCR testing required during the production process, and a new draft guidance document was released in 2018, which still sets clear requirements for RCR testing. In 2017, the my country Food and Drug Administration (CFDA) issued the "Technical Guidelines for the Research and Evaluation of Cell Therapy Products" (Trial Implementation). For gene-modified cell therapy products, attention should be paid to the production of replication-competent viruses (RCVs) and insertional mutagenesis, particularly oncogene activation. During the production quality assessment phase, the risk of RCV formation can be assessed, and the risk of insertional mutagenesis caused by it should be evaluated. Relevant laws, regulations, and guidance documents are being gradually improved. Taking into account the requirements of these laws, regulations, and guidance documents, we primarily refer to relevant guidance documents issued by the FDA for the development and validation of RCR detection methods. Summary of the Invention

[0005] The present invention provides a primer set for detecting the presence of a replicative retrovirus in a sample, characterized in that the forward primer of the primer set has at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO: 1, and the reverse primer of the primer set has at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO: 2.

[0006] In one or more embodiments, the forward primer of the primer set has an identity of at or about 90%, 90.9%, 95%, 95.2%, or 100% to SEQ ID NO: 1; and the reverse primer of the primer set has an identity of at or about 91.3%, 92%, 95.7%, 95.8%, or 100% to SEQ ID NO: 2.

[0007] In one or more embodiments, the primer set further comprises a probe that is at least 85% identical to SEQ ID NO: 3. In one or more embodiments, the probe is at or about 86.7%, 88.2%, 93.3%, 93.8%, or 100% identical to SEQ ID NO: 3.

[0008] The present invention also provides use of the primer set described in any of the above embodiments in preparing a reagent for detecting whether a replicative retrovirus is present in a sample.

[0009] In one or more embodiments, the detection is based on a polymerase chain reaction (PCR) method. In one or more embodiments, the PCR method is selected from conventional PCR (first generation PCR), quantitative real-time PCR (qPCR), quantitative real-time reverse transcription PCR (RT-qPCR), and digital PCR (Dig-PCR, dPCR). In one or more embodiments, the real-time quantitative PCR is a chimeric fluorescent dye method or a fluorescent probe method. In one or more embodiments, the fluorescent dye method uses a saturated fluorescent dye or a non-saturated fluorescent dye. In one or more embodiments, the fluorescent dye method uses a fluorescent dye such as SYBR Green I, Eva Green, LC Green, or Pico Green. In one or more embodiments, the fluorescent probe method is selected from the group consisting of a TaqMan probe method, a molecular beacon probe method, an MGB probe method, and a LightCycler probe method.

[0010] In one or more embodiments, the retrovirus is a gamma-retrovirus. In one or more embodiments, the gamma-retrovirus comprises a GaLV envelope. In one or more embodiments, the retrovirus is a gamma-retrovirus with an envelope protein from Gibbon Ape Leukemia Virus (GALV).

[0011] In one or more embodiments, the sample is genomic DNA or cDNA. In one or more embodiments, the sample is cDNA. In one or more embodiments, the genomic DNA or cDNA is from a host cell of the retrovirus, which can produce the retrovirus. In one or more embodiments, the host cell of the retrovirus is a HEK293 cell.

[0012] The present invention also provides a kit for detecting whether a replicative retrovirus exists in a sample, wherein the kit comprises the primer set described in any one of the above embodiments.

[0013] In one or more embodiments, the primer sets are stored individually or mixed in a container (eg, an EP tube).

[0014] In one or more embodiments, the primers in the primer set are in solid or liquid form.

[0015] In one or more embodiments, the kit further comprises conventional components of a PCR reaction system. In one or more embodiments, the conventional components of the PCR reaction system are selected from dNTPs, a PCR reaction buffer, and a DNA polymerase. In one or more embodiments, the kit further comprises a fluorescent probe for qPCR, and in certain embodiments, the fluorescent probe method is selected from TaqMan probes, molecular beacon probes, MGB probes, and LightCycler probes.

[0016] In one or more embodiments, the kit comprises a retroviral host cell (a cell capable of producing the virus). In one or more embodiments, the retroviral host cell is a HEK293 cell.

[0017] In one or more embodiments, the kit comprises a standard with a known copy number or concentration of the target gene or fragment.

[0018] The present invention also provides a method for detecting replicative retrovirus in a sample, wherein the method uses the primer set described in any one of the above embodiments.

[0019] In one or more embodiments, the method is based on polymerase chain reaction (PCR). In one or more embodiments, the PCR method is selected from conventional PCR (first generation PCR), quantitative real-time PCR (qPCR), real-time quantitative reverse transcription PCR (RT-qPCR), and digital PCR (Dig-PCR, dPCR). In one or more embodiments, the real-time quantitative PCR is a chimeric fluorescent dye method or a fluorescent probe method. In one or more embodiments, the fluorescent dye method uses a saturated fluorescent dye or a non-saturated fluorescent dye. In one or more embodiments, the fluorescent dye method uses SYBR Green I, Eva Green, LC Green, or Pico Green. In one or more embodiments, the fluorescent probe method is selected from TaqMan probe method, molecular beacon probe method, MGB probe method, and LightCycler probe method.

[0020] In one or more embodiments, the retrovirus is a gamma-retrovirus. In one or more embodiments, the gamma-retrovirus comprises a GaLV envelope. In one or more embodiments, the retrovirus is a gamma-retrovirus with an envelope protein from Gibbon Ape Leukemia Virus (GALV).

[0021] In one or more embodiments, the sample is genomic DNA or cDNA. In one or more embodiments, the sample is cDNA. In one or more embodiments, the genomic DNA or cDNA is from a host cell of the retrovirus, which can produce the virus. In one or more embodiments, the host cell of the retrovirus is a HEK293 cell.

[0022] In one or more embodiments, the detecting of retrovirus in a sample is detecting whether retrovirus exists in the sample. In other embodiments, the detecting of retrovirus in a sample is detecting the number or concentration of retrovirus copies in the sample.

[0023] The present invention also provides a method for detecting whether a biological product contains a replicative retrovirus, wherein the biological product uses or has been exposed to a γ-retrovirus containing a GaLV envelope during its preparation process. The method comprises the following steps: co-culturing the biological product with a γ-retrovirus host cell containing a GaLV envelope, then extracting the γ-retrovirus host cell containing the GaLV envelope, and then using the primer set described in any of the above embodiments to detect whether the GaLV gene or protein is expressed in the γ-retrovirus host cell containing the GaLV envelope.

[0024] In one or more embodiments, the detection is based on a polymerase chain reaction (PCR) method. In one or more embodiments, the PCR method is selected from conventional PCR (first generation PCR), real-time fluorescence quantitative PCR (quantitative real-time PCR, qPCR), real-time fluorescence quantitative reverse transcription PCR (real-time RT-PCR, RT-qPCR) and digital PCR (digital PCR, Dig-PCR, dPCR). In one or more embodiments, the real-time fluorescence quantitative PCR is a chimeric fluorescent dye method or a fluorescent probe method. In one or more embodiments, the fluorescent probe method is selected from the group consisting of TaqMan probe method, molecular beacon probe method, MGB probe method and LightCycler probe method.

[0025] In one or more embodiments, the detection is based on TaqMan probes.

[0026] In one or more embodiments, the biological product is or contains engineered immune cells. In one or more embodiments, the engineered immune cells use or have been exposed to a γ-retrovirus containing a GaLV envelope during their preparation. In one or more embodiments, the engineered immune cells are selected from CAR-T cells, TCR-T cells, CAR-NK cells, CAR-NKT cells, etc. In one or more embodiments, the engineered immune cells are co-cultured with retroviral host cells, and then the RNA of the retroviral host cells is extracted, reverse transcribed into cDNA, and then the retroviral host cells are detected based on the qPCR method to determine whether GaLV expression exists or the copy number or expression level of GaLV in the retroviral host cells. In one or more embodiments, the qPCR is a TaqMan probe method qPCR. In one or more embodiments, the TaqMan probe method qPCR reaction system includes:

[0027]

[0028] In one or more embodiments, the TaqMan probe qPCR reaction procedure is: step 1, 95°C for 30 seconds, 1 cycle; step 2, 95°C for 5 seconds → 60°C for 34 seconds, 40 cycles; step 3, 95°C for 15 seconds → 60°C for 1 minute → 95°C for 15 seconds.

[0029] In one or more embodiments, the engineered immune cells are subjected to retroviral host cell culture medium acclimatization before co-culturing with retroviral host cells to allow the retroviral host cells to adapt to co-culturing with the engineered immune cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1: Trend of cellular plaque lesion positive rate versus dilution.

[0031] Figure 2: GALV copy number in the genome was amplified by co-culture of batch 1 anti-human CD19 T cells with HEK293 cells.

[0032] Figure 3: GALV copy number in the genome was amplified by co-culture of batch 2 anti-human CD19 T cells with HEK293 cells.

[0033] Figure 4: GALV copy number in the genome was amplified by co-culture of batch 3 anti-human CD19 T cells with HEK293 cells. DETAILED DESCRIPTION

[0034] After extensive and in-depth research, the inventors of this application have, for the first time, developed a primer set that can rapidly detect replication-competent retroviruses in samples. Method validation has demonstrated excellent specificity, sensitivity, and durability. The method of this invention complies with the provisions of the "Technical Guidelines for Pharmaceutical Research and Evaluation of Human Stem Cell Products (Trial Implementation)" issued by the Center for Drug Evaluation of the National Medical Products Administration. Reference is made to the requirements for RCR testing for retroviral-based gene therapy products in the "Testing of Replication-Competent Retroviruses During Product Manufacturing and Patient Follow-up for Retroviral-Based Human Gene Therapy Products," issued by the U.S. Food and Drug Administration (FDA). The RCR detection primers and method described herein can effectively reduce the testing and release time and cost of related gene therapy products, such as CAR-T, CAR-NK, and other immune cell therapy products.

[0035] Primer set

[0036] Disclosed herein is a primer set, wherein the forward primer of the primer set has no less than 90% identity with SEQ ID NO: 1, and the reverse primer of the primer set has no less than 90% identity with SEQ ID NO: 2.

[0037] In some embodiments, the forward primer of the primer set is at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1, and the reverse primer of the primer set is at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2. In some embodiments, the forward primer has 1-2 base substitutions compared to the nucleotide sequence shown in SEQ ID NO: 1 or has 1-2 base additions or subtractions compared to the nucleotide sequence shown in SEQ ID NO: 1, preferably has 1-2 base additions or subtractions in the 5' or 3' section of the nucleotide sequence shown in SEQ ID NO: 1. In some embodiments, the reverse primer has 1-2 base substitutions compared to the nucleotide sequence shown in SEQ ID NO: 2 or has 1-2 base additions or subtractions compared to the nucleotide sequence shown in SEQ ID NO: 2, preferably has 1-2 base additions or subtractions in the 5' or 3' section of the nucleotide sequence shown in SEQ ID NO: 2. In some embodiments, the forward primer of the primer set has or is approximately 90%, 90.9%, 95%, 95.2% or 100% identity to SEQ ID NO: 1. In some embodiments, the reverse primer of the primer set has or is approximately 91.3%, 92%, 95.7%, 95.8% or 100% identity to SEQ ID NO: 2.

[0038] In some embodiments, the primer set further comprises a probe having no less than 85% identity to SEQ ID NO: 3. In some embodiments, the probe has at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 3. In some embodiments, the probe has 1-2 base substitutions compared to the nucleotide sequence shown in SEQ ID NO: 3 or has 1-2 base additions or subtractions compared to the nucleotide sequence shown in SEQ ID NO: 3, preferably 1-2 base additions or subtractions in the 5' or 3' section of the nucleotide sequence shown in SEQ ID NO: 3. In some embodiments, the probe has or is about 86.7%, 88.2%, 93.3%, 93.8% or 100% identity to SEQ ID NO: 3.

[0039] It is known in the art that base substitution, addition or deletion, or modification of primers (or probes) is acceptable as long as it does not affect the binding of the primers (or probes) to the template strand. Therefore, the forward primers, reverse primers, and probes of the primer set of the present application also include these situations. For example, the 5' end of the primer is modified. The primers after 5' end phosphorylation can be used for linkers, cloning and gene construction, and ligase-catalyzed ligation reactions; the primers are biotin-labeled and can be used for non-radioactive immunoassays to detect proteins, intracellular chemical staining, cell separation, nucleic acid separation, hybridization detection of specific DNA / RNA sequences, ion channel conformational changes, etc.; the primers are amino-modified for use in DNA chips (DNA microarrays) and multiple labeling diagnostic systems; the primers are thiolated, usually 2-5 bases each at the 5' and 3' ends can be thiolated, preferably 3 bases each at the 5' and 3' ends can be thiolated. Thio-modified oligonucleotides are mainly used in antisense experiments to prevent degradation by nucleases. Primer modifications also include digoxigenin modification, thiol modification, spacer modification, and deoxyinosine (dI) modification.

[0040] The target gene of the primer set is the envelope gene of the gibbon ape leukemia virus GALV. In one or more embodiments, the forward primer and the reverse primer of the primer set completely match the fragment on the target gene.

[0041] Reagent test kit

[0042] Disclosed herein is a kit comprising a primer set as described in any embodiment herein. The primer set is capable of hybridizing to a GALV target nucleic acid molecule. The kit may further comprise reagents for practicing the methods disclosed herein (e.g., DNA standards, buffers, polymerases, or agents to prevent contamination). The kit may also comprise a package insert containing instructions for detecting GALV in a sample using the primer set as described in any embodiment herein. Alternatively, the kit may further comprise additional primer sets for detecting the same gene target, or primer sets for detecting other gene targets. The kit may be produced in a variety of ways known in the art.

[0043] The kits provided herein can be used to detect RCR in a sample. In specific embodiments, the kits include primer sets and probes specific for a target gene, wherein the target gene is a gamma-retroviral gene and / or a gene used to generate a gamma-retroviral vector (e.g., a replication-defective gamma-retroviral vector for gene delivery). In specific embodiments, the target gene is GaLV.

[0044] Purpose / Method

[0045] Provided herein is a method for detecting the presence of a replicating retrovirus in a sample. The method utilizes a primer set as described in any of the above embodiments. Based on the primer set, the presence or amount of a retrovirus in a sample can be detected using PCR. The PCR method includes, but is not limited to, conventional PCR (first generation PCR), quantitative real-time PCR (qPCR), quantitative real-time reverse transcription PCR (RT-qPCR), and digital PCR (Dig-PCR, dPCR). In some embodiments, the primer set described herein is used to detect replicating retroviruses in a sample using qPCR.

[0046] qPCR involves adding fluorescent groups to the PCR reaction system, using the accumulated fluorescent signal to monitor the entire PCR reaction in real time and quantitatively analyze the starting template. Real-time fluorescence PCR can be categorized as either using a chimeric fluorescent dye or a fluorescent probe, depending on the fluorescent chemical used.

[0047] The fluorescent dye method involves adding an excess of fluorescent dye to a standard PCR reaction system. Fluorescent dyes are essentially non-luminescent in their free state and only release a fluorescent signal after binding to double-stranded DNA. Therefore, in a PCR system, as specific PCR products are amplified, the signal intensity generated by the dye's incorporation into double-stranded DNA is positively correlated with the amount of PCR product produced. Fluorescent dyes include saturating and non-saturating fluorescent dyes. Currently, the most commonly used dye molecule, SYBR Green I, is a non-saturating fluorescent dye, while Eva Green and Solis Green are saturating fluorescent dyes. The most widely used fluorescent probe in fluorescent probe-based qPCR is the Taqman probe. Taqman technology incorporates a specific fluorescent probe into the PCR amplification system alongside a pair of primers. The probe is a linear oligonucleotide whose sequence is complementary to a specific stretch between the two primers for the target gene, thereby increasing the specificity of the reaction. It is labeled with a fluorescent reporter group at the 5' end and a fluorescent quencher group at the 3' end. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group, making it undetectable by the PCR instrument. When the PCR amplification reaction occurs, in the annealing phase, the probe binds to the complementary sequence of the target gene. In the extension phase of the reaction, the 5'-3' exonuclease activity of the Taq enzyme cleaves and degrades the probe, separating the reporter fluorescent group and the quencher group, so that the fluorescence monitoring system can receive the fluorescent signal, that is, every time a DNA chain is amplified, a fluorescent molecule is formed, achieving complete synchronization of the accumulation of the fluorescent signal and the formation of the PCR product. Available Taqman probe fluorescent reporter groups include FAM, TET, VIC, JOE, NED and HEX, etc., and available quencher groups include TAMRA, BHQ, MGB and ECLIPSE, etc. In some embodiments, the qPCR method herein is a fluorescent probe method, and in some embodiments, the qPCR method herein is a TaqMan fluorescent probe method.

[0048] In some embodiments, the sample being tested is a gene (DNA or RNA) from a host cell of a γ-retrovirus. In some specific embodiments, the sample being tested is a reverse transcription product of total RNA from HEK293 cells. By detecting the presence or amount of retroviruses in a sample, one can indirectly determine the presence or amount of retroviruses in samples related to immune cell therapy products. The samples related to immune cell therapy products can include cryopreserved immune cell preparations for clinical transfusion, newly prepared but not cryopreserved immune cells or their culture supernatants, and peripheral blood, plasma, serum, tissue fluid, urine, etc., of individuals (such as humans or other animals) who have received immune cell therapy. Specific detection methods are known in the art. For example, if it is necessary to detect whether immunotherapeutic cells contain RCR residues, the immunotherapeutic cells are co-cultured with host cells that can be used to produce the retrovirus, and then the total RNA of the host cells is extracted and reverse transcribed into cDNA. Using the cDNA as a template and the primer set in this article, an amplification reaction of the target gene is performed based on the qPCR method. The amount of the target gene in the template is obtained according to the qPCR result (absolute amount or relative amount). If the target gene GALV is present in the template, it indicates that RCR residues are present in the immunotherapeutic cells, otherwise not. If it is necessary to detect whether the immunotherapeutic cell culture supernatant contains RCR residues, the supernatant is collected and added to the culture system of the host cells of the retrovirus. Then, in the same way, the total RNA of the host cells is extracted, reverse transcribed and then a qPCR reaction is performed.

[0049] Gamma-retroviruses are widely used in the production of preventive or therapeutic biological products. In some embodiments, the methods herein are used to detect residual RCR in CAR-T, CAR-NK, CAR-NKT, TCR-T, CAR-M, and other products that have used or been exposed to gamma-retroviruses during the manufacturing / production process.

[0050] As used herein, the term "about" refers to the usual error range of the corresponding value that is easily known to those skilled in the art. "About" values ​​mentioned herein include embodiments for the value itself.

[0051] The present invention will be described below by way of specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. Experimental procedures in the following examples, where specific conditions are not specified, were generally performed under conventional conditions, such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, 2002, or according to the conditions recommended by the manufacturer. Example Example 1: Development and validation of RCR detection method

[0052] This example mainly refers to the relevant guidance documents issued by the FDA for the development and method validation of the RCR detection method.

[0053] 1. Use ATCC # VR-1450 positive virus solution (for GALV enveloped γ-retrovirus produced using PG13 cell line, FDA recommends ATCC # VR-1450 as the positive virus solution for RCR testing) to infect HEK293 cell line to prepare the positive cell line HEK293-GALV (HEK293 cell line is a specialized cell line that can support the replication of retrovirus containing GALV envelope protein).

[0054] 2. Design primers and probe sequences for amplifying the gene encoding the viral envelope protein GALV:

[0055] Forward primer GALV-FP: ACCTTCGGCACCAGATGAGT (SEQ ID NO: 1)

[0056] Reverse primer GALV-RP: CGCAGCTTAAGAGGATGATCAGT (SEQ ID NO: 2)

[0057] Probe GALV-probe: CTGGGAGCTGGAAAA (SEQ ID NO: 3)

[0058] The sequence of the amplified product of the above primers is shown in SEQ ID NO: 4.

[0059] 3. We cultured and acclimated HEK293 cells, a negative cell line, and HEK293-GALV cells, a positive cell line, separately to adapt them to co-culture with CAR-T cells. HEK293 and HEK293-GALV cells were co-cultured for at least five passages to enhance the replication capacity of all potential retroviruses. After co-culture, HEK293 cells were harvested, and the HEK293 cell genome was extracted and GALV copy number was determined by qPCR.

[0060] (1) Preparation of QPCR reaction system:

[0061]

[0062] (2) Add 23 μl of the reaction system to each well of the PCR tube, then add 2 μl of the template (gene) and load it onto the machine.

[0063] (3) PCR reaction procedure: Absolute quantification was performed using a 7500 real-time quantitative PCR instrument, with the following parameters: Step 1, 95°C for 30 seconds, 1 cycle; Step 2, 95°C for 5 seconds → 60°C for 34 seconds, 40 cycles; Step 3, 95°C for 15 seconds → 60°C for 1 minute → 95°C for 15 seconds.

[0064] 4. Positive virus solution ATCC # VR-1450 GALV virus solution TCID 50 Determination

[0065] GALV virus liquid TCID 50 Plaque assay was used for detection. PG-4 cells were plated in 96-well plates, with 2.0×10 3 100 μl of cells were used. After 48 hours, 100 μl of GALV virus solution of different dilutions were infected. The cells were cultured and the cytopathic effect in the 96-well plate was observed. The number of wells with cytopathic effect at each dilution was counted and the TCID was calculated according to the Reed-Muench formula. 50 . 1) Number of plaque lesions in PG-4 cells infected with GALV virus solution at different dilutions

[0066] Table 1. Number of plaque lesions in PG-4 cells infected with GALV virus solution at different dilutions

[0067]

[0068] 2) Trend of positive rate of cellular plaque lesions versus dilution (GALV 10 -7 Subsequent dilutions were all negative)

[0069] The trend graph of the positive rate of cellular plaque lesions versus dilution is shown in Figure 1.

[0070] 3) Calculation of TCID using the Reed-Muench formula 50

[0071] Table 2. TCID calculated using the Reed-Muench formula 50

[0072]

[0073] From the table above, we can see that: TCID 50 Located at 10 -6 with 10 -7 Between, assuming 10 -（6+x） , find the value of x:

[0074] X=Log 10Dilution factor × (infection rate of the previous dilution with an infection rate of 50% - 50) / (infection rate of the previous dilution with an infection rate of 50% - infection rate of the next dilution with an infection rate of 50%)

[0075] According to the formula: TCID 50 is 10 -6.35 .

[0076] Based on the cytopathic effect and Reed-Muench formula, the TCID of GALV virus solution can be calculated. 50 is 10 -6.35 , that is, the GALV virus solution was diluted 10 6.35 TCID 50 According to the experiment, 96 wells were infected with 100 μl / well, i.e. 1 ml of GALV virus solution was used for 10 6.35 Dilute to a volume of 100 μl containing 1 TCID 50 Virus particles, that is, 1 ml of GALV virus solution was diluted 1 / 2200000 times, and 100 μl of the volume contained 1 TCID 50 The concentration of viral particles in the GALV virus stock solution before dilution is 2.2×10 7 TCID 50 / ml. According to TCID 50 Conversion relationship between TCID and PFU (plaque-forming units): 1 TCID 50 =0.7 PFU. The concentration of viral particles in the GALV virus stock solution before dilution is 1.5×10 7 PFU / ml.

[0077] Based on the calculated viral particle concentration of the positive virus solution, the amount of virus to infect CAR-T cells in the next step can be calculated. 5. qPCR method specificity verification

[0078] After RNA extraction from negative samples (HEK293 cells co-cultured with CAR-T) and positive samples (GALV-HEK293 cells co-cultured with CAR-T), qPCR reactions were performed to determine the GALV gene copy number in the samples and compare the qPCR results. Each sample had two extractions.

[0079] The data is as follows:

[0080]

[0081] 6. qPCR method sensitivity verification

[0082] (1) 100 positive cells were added to 1E6, 2E6, and 3E6 CAR-T cells, respectively, to prepare three samples. Each sample had two extractions. RNA was extracted simultaneously and qPCR reactions were performed to determine the gene copy number of GALV in the samples and compare the qPCR results.

[0083] The data is as follows:

[0084]

[0085] (2) 10, 100, and 1000 positive cells were added to 2E6 CAR-T cells, respectively, to prepare three samples. Each sample had two extractions. RNA was extracted simultaneously and qPCR reactions were performed to determine the gene copy number of GALV in the samples and compare the qPCR results.

[0086] The data is as follows:

[0087]

[0088] 7. qPCR Method Robustness Verification

[0089] 1000 positive cells were added to 2E6 CAR-T cells, and RNA was extracted and measured for concentration. Two extractions were performed for each sample. The concentrations were adjusted to 50 ng / μl and 100 ng / μl for testing. The qPCR results and back-calculation results were compared for different loading amounts.

[0090] The original data is as follows:

[0091]

[0092] Summary: The qPCR method was tested for specificity, sensitivity, and durability, with a sensitivity of 10 positive cells per 2E6 CAR-T cells, which met the acceptable standard. Example 2: RCR detection of three batches of anti-human CD19 T cell samples using the established RCR detection method 1. Methods

[0093] The experimental groups were set up as follows:

[0094] Positive control: HEK293+HEK293-GALV (HEK293-GALV cells co-cultured with HEK293)

[0095] Negative control 1: HEK293+X10 (HEK293 cell single culture group) (Note: X10 is X-VIVO 15 Culture medium + 10% FBS.

[0096] Experimental group: HEK293+CAR T (CAR T cells co-cultured with HEK293)

[0097] Detection limit group: HEK293 + 1 HEK293-GALV (HEK293-GALV cell (1) co-cultured with HEK293)

[0098] Detection method: Three batches of anti-human CD19 CAR T cells (batch number: 170904 / 171002 / 171101, the CAR T cells were prepared by using γ-retrovirus with GALV envelope to mediate CAR gene transduction, for example, such as the CD19 CAR T cells described in patent document CN201610377871.4) were taken, with a total volume of 1%, and the cell number was 5×10 7 , 6×10 7 and 2×10 7 , divided into groups, 5×10 6 HEK293-GALV cells (positive control cells), cell number 1×10 6 The two cell types were respectively compared with HEK293 cells (cell number 5×10 6 ) were co-cultured for more than 21 days and passaged 5 times. After the last passage, the cells were confluent and the supernatant and HEK293 cells were collected. The HEK293 cell monoculture group was used as a negative control and cultured in parallel with the experimental group for 5 generations. The supernatant and cells were collected. A detection limit group was also set up in the experiment: HEK293-GALV cells (HEK293 cells that can secrete GALV virus) were taken and divided into 3 groups, with 1 cell in each group, and then compared with HEK293 cells (cell number 5×10 6 ) were co-cultured with the experimental group for 5 generations, and the co-culture supernatant and cells were collected. 2. qPCR test results

[0099] After the co-culture, HEK293 cells were collected, the cell genome was extracted, and the GALV copy number in the genome was detected using the qPCR method described in Example 1. The results of each group of qPCR experiments are shown in Figures 2, 3, and 4.

[0100] The qPCR results showed that after the three batches of anti-human CD19 T cells were co-cultured and amplified with HEK293 cells, the GALV copy number in their genomes was consistent with the GALV copy number in the supernatant of the blank negative control X10 group, and no GALV was detected. However, after the positive control cells HEK293-GALV were co-cultured and amplified with HEK293 cells, the GALV copy number in the supernatant reached the order of magnitude of 10 4, and the GALV copy number in the supernatant of the co-culture detection limit group (only one HEK293-GALV cell) reached the order of magnitude of 10 after amplification by HEK293 cells. 4 That is, anti-human CD19 T cells were co-cultured and expanded in HEK293 and their GALV copies were negative by qPCR detection.

[0101] Summary: All three batches of anti-human CD19 T cells tested negative for replication-competent retrovirus. We have developed a qPCR-based rapid assay for RCR in CAR-T cells, which can be used for rapid testing and release of CAR-T products.

[0102] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

[0103] Sequence of this article:

[0104] Forward primer GALV-FP: ACCTTCGGCACCAGATGAGT (SEQ ID NO: 1)

[0105] Reverse primer GALV-RP: CGCAGCTTAAGAGGATGATCAGT (SEQ ID NO: 2)

[0106] Probe GALV-probe: CTGGGAGCTGGAAAA (SEQ ID NO: 3)

[0107] Amplification product: accttcggcaccagatgagtcctgggagctggaaaagactgatcatcctcttaagctgc (SEQ ID NO: 4)

Claims

1. A primer set for detecting whether a replicative retrovirus is present in a sample, characterized in that: The forward primer of the primer set has no less than 90% identity with SEQ ID NO: 1, and the reverse primer of the primer set has no less than 90% identity with SEQ ID NO:

2.

2. The primer set according to claim 1, characterized in that The forward primer of the primer set has or is about 90%, 90.9%, 95%, 95.2% or 100% identity with SEQ ID NO:1, and the reverse primer of the primer set has or is about 91.3%, 92%, 95.7%, 95.8% or 100% identity with SEQ ID NO:2; or the primer set also includes a probe, which has no less than 85% identity with SEQ ID NO:3, preferably, the probe has or is about 86.7%, 88.2%, 93.3%, 93.8% or 100% identity with SEQ ID NO:

3.

3. Use of the primer set of claim 1 in preparing a reagent for detecting whether a retrovirus is present in a sample, wherein the retrovirus contains a GaLV envelope or a gamma-retrovirus with a Gibbon Ape Leukemia Virus (GALV) envelope protein as an envelope.

4. A kit for detecting whether a replicative retrovirus exists in a sample, characterized in that: The kit comprises the primer set according to claim 1 or 2.

5. The kit according to claim 4, characterized in that The kit also contains conventional components of a qPCR reaction system, such as dNTPs, a PCR reaction buffer or a DNA polymerase.

6. A method for detecting whether a replicative retrovirus exists in a sample, characterized in that: The method uses the primer set according to claim 1 or 2.

7. The method according to claim 6, characterized in that The method is a method based on polymerase chain reaction (PCR); preferably, the PCR method is selected from ordinary PCR (first generation PCR), real-time fluorescence quantitative PCR (Quantitative Real-time PCR, qPCR), real-time fluorescence quantitative reverse transcription PCR (Real-time RT-PCR, RT-qPCR) and digital PCR (Digital PCR, Dig-PCR, dPCR); more preferably, the PCR method is real-time fluorescence quantitative PCR.

8. The method according to claim 7, characterized in that The real-time fluorescence quantitative PCR is a chimeric fluorescent dye method or a fluorescent probe method; preferably, the fluorescent probe method is selected from the group consisting of a TaqMan probe method, a molecular beacon probe method, an MGB probe method and a LightCycler probe method.

9. The method according to claim 6, characterized in that The retrovirus is a γ-retrovirus. Preferably, the γ-retrovirus contains a GaLV envelope or a γ-retrovirus with a Gibbon Ape Leukemia Virus (GALV) envelope protein as an envelope.

10. The method according to claim 6, characterized in that The sample is an immune cell therapy product, which has used or been in contact with a γ-retrovirus containing a GaLV envelope during the preparation or production process; preferably, the immune cell therapy product is a CAR-T, TCR-T, CAR-NK, CAR-NKT or CAR-M product.

Images