Methods for assessing dosage for epigenetic modifying agents

WO2025064469A8PCT designated stage expired Publication Date: 2026-04-09SEPIA THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-09-18
Publication Date
2026-04-09

AI Technical Summary

Technical Problem

Current methods lack effective tools to assess the efficacy of epigenetic modifying agents, which are crucial for modulating gene expression to treat diseases such as neoplasia, neurological disorders, and obesity.

Method used

A method is developed to assess the efficacy of a first dose of an epigenetic modifying agent by measuring the levels of DNA methylation and RNA of specific biomarkers in a biological sample, and determining if these levels are higher than, less than, or equal to control levels, thereby guiding the administration of subsequent doses.

Benefits of technology

This method allows for personalized dosing of epigenetic modifying agents based on real-time biological feedback, enhancing treatment efficacy and minimizing adverse effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024047157_09042026_PF_FP_ABST
    Figure US2024047157_09042026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention is based, at least in part, on the finding that dosing of an epigenetic modifying agent can be determined based on assessing the DNA methylation of a biomarker associated with a target gene for which expression is sought to modulated and / or assessing the level of extracellular vesicle RNA associated with one or more biomarkers.
Need to check novelty before this filing date? Find Prior Art

Description

METHODS FOR ASSESSING DOSAGE FOR EPIGENETIC MODIFYING AGENTSRELATED APPLICATIONS

[0001] This application claims the benefit of priority to U.S. Provisional Application No. 63 / 539,057, filed on September 18, 2023; U.S. Provisional Application No. 63 / 599,748, filed on November 16, 2023; and U.S. Provisional Application No. 63 / 574,657, filed on April 4, 2024. The entire contents of each of the foregoing applications are expressly incorporated by reference herein.SEQUENCE LISTING

[0002] The application contains a Sequence Listing which has been submitted electronically in .XML format and is hereby incorporated by reference in its entirety. Said .XML copy, created on August 15, 2024, is named “131717-01220.xml” and is 566,414 bytes in size. The sequence listing contained in this .XML file is part of the specification and is hereby incorporated by reference herein in its entirety.BACKGROUND

[0003] Mis-regulation of gene expression is the underlying cause of many diseases (e.g., in mammals, e.g., humans) e.g., neoplasia, neurological disorders, metabolic disorders and obesity. Techniques geared towards modulating gene expression (e.g., decrease or increase expression from gene of interest) provides a viable alternative approach in treating these diseases. Modulating gene expression can be accomplished by altering methylation levels at promoters and / or regulatory sequences. Tools and methods are needed to determine efficacy of treatments that alter methylation level at genomic loci.SUMMARY

[0004] Accordingly, in one aspect, the present invention provides a method of assessing the efficacy of a first dose of an epigenetic modifying agent by determining whether at least one of (i) a measured level of DNA methylation of one or more biomarkers, and (ii) a measured level of RNA of one or more biomarkers; in a biological sample obtained from a subject who has received the first dose of epigenetic modifying agent is higher than, less than or equal to a control level. In another aspect, the present invention provides a method of treating a subject with an epigenetic modifying agent comprising determining whether at least one of (i) a measured level of DNA methylation of one or more biomarkers, or (ii) a measured level of RNA of the one or more biomarkers in a biological sample obtained from a subject who has received the first dose of epigenetic modifying agent is higher than, less than or equal to a control level; and administering a second dose of the epigenetic modifying agent to the subject.

[0005] In a particular embodiment, the foregoing methods may further involve measuring (i) the level of DNA methylation of the one or more biomarkers, or (ii) the level of RNA of the one or more biomarkers in the biological sample.

[0006] In a particular embodiment, the foregoing methods further involve determining whether a measured level of extracellular vesicle RNA in a second biological sample obtained from the subject who has received the second dose of the epigenetic modifying agent is higher than, less than or equal to a control level; and administering a third dose of the epigenetic modifying agent to the subject. For example, the method may further include measuring the level of extracellular vesicle RNA in the second biological sample.

[0007] In an additional embodiment, the foregoing methods further involve determining whether a measured level of DNA methylation of the one or more biomarkers in a second biological sample obtained from the subject who has received the second dose of the epigenetic modifying agent is higher than, less than or equal to a control level; and administering a third dose of the epigenetic modifying agent to the subject. For example, the method may further include measuring the level of DNA methylation of the one or more biomarkers in the second biological sample.

[0008] Accordingly, in one aspect, the present invention provides a method of assessing the efficacy of a first dose of an epigenetic modifying agent comprising: determining whether at least one of (i) a measured level of DNA methylation of one or more biomarkers, and (ii) a measured level of RNA of one or more biomarkers in a biological sample obtained from a subject who has received the first dose of epigenetic modifying agent is higher than, less than or equal to a control level.

[0009] Accordingly, in one aspect, the present invention provides a method of treating a subject with an epigenetic modifying agent comprising: a. determining whether at least one of (i) a measured level of DNA methylation of one or more biomarkers, and (ii) a measured level of RNA of the one or more biomarkers in a biological sample obtained from a subject who has received the first dose of epigenetic modifying agent is higher than, less than or equal to a control level; and b. administering a second dose of the epigenetic modifying agent to the subject.

[0010] In one embodiment, the foregoing methods may further involve measuring (i) the level of DNA methylation of the one or more biomarkers, or (ii) the level of RNA of the one or more biomarkers in the biological sample.

[0011] In one embodiment, measuring the level of RNA of the one or more biomarkers comprises measuring the level of extracellular vesicle RNA. In one embodiment, the extracellular vesicle RNA is derived from cancer cells.

[0012] In one embodiment, the epigenetic modifying agent achieves therapeutic effect by repressing expression of a gene target. In one embodiment, the gene target is MYC, SFRP1, APOB or HNF4a.

[0013] In one embodiment, (i) wherein the level of extracellular vesicle RNA is higher than the control level and the subject is administered a second dose of the epigenetic modifying agent that is higher than the first dose of the epigenetic modifying agent; or (ii) wherein the level of extracellularvesicle RNA is less than or equal to the control level and the subject is administered a second dose of the epigenetic modifying agent that is less than or equal to the first dose of the epigenetic modifying agent.

[0014] In a particular embodiment, the epigenetic modifying agent achieves therapeutic effect by enhancing expression of a gene target. In one embodiment, the gene target is FOXP3.

[0015] In one embodiment, (i) wherein the level of extracellular vesicle RNA is less than or equal to the control level and the subject is administered a second dose of the epigenetic modifying agent that is higher than the first dose of the epigenetic modifying agent; or (ii) wherein the level of extracellular vesicle RNA is higher than the control level and the subject is administered a second dose of the epigenetic modifying agent that is less than or equal to the first dose of the epigenetic modifying agent.

[0016] In one embodiment, the control level is the level of extracellular vesicle RNA prior to administration of the first dose of the epigenetic modifying agent.

[0017] In one embodiment, the control level is a standardized level of extracellular vesicle RNA. In one embodiment, the standardized level of extracellular vesicle RNA is a predetermined level of extracellular vesicle RNA associated with a disease state.

[0018] In one embodiment, the foregoing methods may further involve a. determining whether a measured level of extracellular vesicle RNA in a second biological sample obtained from the subject who has received the second dose of the epigenetic modifying agent is higher than, less than or equal to a control level; and b. administering a third dose of the epigenetic modifying agent to the subject.

[0019] In a particular embodiment, the foregoing methods may further involve measuring the level of extracellular vesicle RNA in the second biological sample.

[0020] In one embodiment, (a) wherein the epigenetic modifying agent achieves therapeutic effect by repressing expression of a gene target; and wherein (i) the level of extracellular vesicle RNA is higher than the control level and the subject is administered a second dose of the epigenetic modifying agent that is higher than the first dose of the epigenetic modifying agent; or (ii) the level of extracellular vesicle RNA is less than or equal to the control level and the subject is administered a second dose of the epigenetic modifying agent that is less than or equal to the first dose of the epigenetic modifying agent; or (b) wherein the epigenetic modifying agent achieves therapeutic effect by enhancing expression of a gene target, and wherein (i) the level of extracellular vesicle RNA is less than or equal to the control level and the subject is administered a second dose of the epigenetic modifying agent that is higher than the first dose of the epigenetic modifying agent; or (ii) the level of extracellular vesicle RNA is higher than the control level and the subject is administered a second dose of the epigenetic modifying agent that is less than or equal to the first dose of the epigenetic modifying agent.

[0021] In one embodiment, both the level of DNA methylation and the level of extracellular vesicle RNA is measured, either of the same or different biomarkers.

[0022] In one embodiment, the extracellular vesicle is an exosome. In one embodiment, the extracellular vesicle is a microvesicle.

[0023] In one embodiment, the epigenetic modifying agent achieves therapeutic effect by repressing expression of a target gene, wherein repression of expression of the target gene is by methylating DNA.

[0024] In one embodiment, (i) the level of DNA methylation in the biological sample is less than or equal to the control level and wherein the subject is administered a second dose of the epigenetic modifying agent that is higher than the first dose of the epigenetic modifying agent; or (ii) the level of DNA methylation in the biological sample is higher than the control level and wherein the subject is administered a second dose of the epigenetic modifying agent that is less than or equal to the first dose of the epigenetic modifying agent.

[0025] In one embodiment, the epigenetic modifying agent achieves therapeutic effect by enhancing expression of the target gene, wherein the enhancement of expression of the target gene is by demethylating DNA.

[0026] In one embodiment, (i) the level of DNA methylation in the biological sample is higher than the control level and wherein the subject is administered a second dose of the epigenetic modifying agent that is higher than the first dose of the epigenetic modifying agent; or (ii) the level of DNA methylation in the biological sample is less than or equal to the control level and wherein the subject is administered a second dose of the epigenetic modifying agent that is less than or equal to the first dose of the epigenetic modifying agent.

[0027] In one embodiment, the biological sample is selected from the group consisting of blood, cerebrospinal fluid, plasma, pleural fluid, saliva, serum sputum, stool, and urine.

[0028] In one embodiment, the DNA is cell-free DNA. In one embodiment, the cell-free DNA is circulating tumor DNA (ctDNA). In one embodiment, the cell-free DNA is extracellular vesicle DNA. In one embodiment, the extracellular vesicle is an exosome. In one embodiment, the extracellular vesicle is a microvesicle. In one embodiment, the biological sample is blood. In one embodiment, the biological sample is tissue. In one embodiment, the tissue sample is a biopsy, optionally, a liquid biopsy.

[0029] In one embodiment, the DNA comprises cellular genomic DNA.

[0030] In one embodiment, measuring the level of methylation comprises quantitative polymerase chain reaction (qPCR), next-generation sequencing, nanopore sequencing, beam emulsion sequencing, sodium bisulfite conversion and sequencing, differential enzymatic cleavage, affinity capture of methylated DNA, or epiallele methylation detection. In one embodiment, measuring the level of methylation comprises nanopore sequencing. In one embodiment, measuring the level of methylation comprises sodium bisulfite conversion and sequencing.

[0031] In one embodiment, measuring the level of methylation comprises differential enzymatic cleavage.

[0032] In one embodiment, measuring the level of methylation comprises affinity capture of methylated DNA.

[0033] In one embodiment, epiallele methylation detection comprises determining variant epiallele fraction (VEF), wherein the VEF is the level of DNA methylation.

[0034] In a particular embodiment, the foregoing methods may further involve identifying genomic sequence with methylation at one or more cytosine guanine (CpG) sites in DNA extracted from the biological sample.

[0035] In one embodiment, the extracted DNA is sequenced using next generation sequencing.

[0036] In one embodiment, the next generation sequencing comprises: 1) fragmenting extracted genomic DNA; and 2) amplifying DNA fragments with oligonucleotides that hybridize to the DNA fragments.

[0037] In one embodiment, the genomic sequences are determined to be methylated when a threshold of at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% of CpG sites on the sequence are methylated. In one embodiment, the threshold is at least 50% methylated CpG sites on the sequence. In one embodiment, the DNA is cell- free DNA.

[0038] In a particular embodiment, the foregoing methods may further involve treating the DNA fragments with one or more cytosine deaminases or sodium bisulfate, thereby converting cytosine to uracil in the DNA fragments prior to amplification. In a particular embodiment, the foregoing methods may further involve capturing the DNA fragments using a panel of nucleic acid primers covering a chromosomal region of interest.

[0039] In one embodiment, the chromosomal region of interest comprises discontinuous chromosomal sequence. In one embodiment, the chromosomal region of interest comprises continuous chromosomal sequence. In one embodiment, the chromosomal region of interest comprises at least 5 kb, at least 10 kb, at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb or at least 80 kb.

[0040] In one embodiment, the epigenetic modifying agent comprises a DNA methyltransferase. In one embodiment, the epigenetic modifying agent comprises at least one DNA methyltransferase selected from the group consisting of MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, and a functional variant thereof. In one embodiment, the DNA methyltransferase is MQ1, or a functional variant thereof. In one embodiment, MQ1 comprises an amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NOs: 19 or 87.

[0041] In one embodiment, the epigenetic modifying agent comprises a DNA demethylase. In one embodiment, the epigenetic modifying agent comprises at least one DNA demethylase selected from the group consisting of DME, DML2, DML3, ROS1, TET1, TET2, TET3FL, and TET3s.

[0042] In one embodiment, the epigenetic modifying agent comprises a DNA-binding domain. In one embodiment, the DNA-binding domain binds to a target sequence in the DNA.

[0043] In one embodiment, the DNA comprises a promoter that comprises the target sequence. In one embodiment, the target sequence comprises a CTCF-binding site.

[0044] In one embodiment, the DNA-binding domain comprises a zinc finger domain. In one embodiment, the DNA-binding domain comprises an amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NOs: 5-16, 169, 170, 171, or 172. In one embodiment, the DNA-binding domain binds to the target sequence comprising at least 16, 17, 18, 19, or 20 nucleotides of SEQ ID NOs: 4, 75-86, or 199-206.

[0045] In one embodiment, the control level is the level of methylation of the DNA prior to administration of the first dose of the epigenetic modifying agent. In one embodiment, the control level is a standardized level of methylation of the DNA. In one embodiment, the standardized level of methylation of the DNA is a predetermined level of methylation known to achieve the desired therapeutic effect of the epigenetic modifying agent.

[0046] In one embodiment, the standardized level of methylation of the DNA is a predetermined level of methylation of the DNA known to enhance or repress the level of transcription of a target gene.

[0047] In one embodiment, the level of DNA methylation of the one or more biomarkers is at least 1- fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, or 20-fold higher than DNA methylation of the control. In one embodiment, the level of DNA methylation of the one or more biomarkers is at least 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, or 20-fold lower than DNA methylation of the control.

[0048] In one embodiment, the target gene is MYC. In one embodiment, the biomarker is the MYC locus.

[0049] In one embodiment, the biomarker is the MYC promoter. In one embodiment, the biomarker is located within 50 kb of the MYC gene. In one embodiment, the biomarker is located within 5 kb, 1 kb, 500 bp or 100 bp of the MYC gene. In one embodiment, the biomarker is located in the promoter of the MYC gene.

[0050] In one embodiment, the DNA comprises a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide identity to SEQ ID NO: 123.

[0051] In one embodiment, the biomarker is located within 50 kb of SEQ ID NOs: 4, 75-86, or 199- 206. In one embodiment, the biomarker is located within 5 kb, 1 kb, 500 bp or 100 bp of SEQ ID NOs: 4, 81-86, or 203-206. In one embodiment, the biomarker is located within 100 bp of SEQ ID NOs: 4, 81-86, or 203-206.

[0052] In one embodiment, the target gene is SFRP1. In one embodiment, the biomarker is the SFRP1 promoter.

[0053] In one embodiment, the target gene is HNF4a. In one embodiment, the biomarker is the HNF4a promoter.

[0054] In one embodiment, the target gene is APOB. In one embodiment, the biomarker is the APOB promoter.

[0055] In one embodiment, the target gene is FOXP3. In one embodiment, the biomarker is the FOXP3 promoter.

[0056] In one embodiment, the one or more biomarkers comprises 1) a primary biomarker, wherein the primary biomarker is the target gene or DNA sequence located within 1 kb of the target gene; and / or 2) one or more secondary biomarkers, wherein the secondary biomarker is a gene other than the target gene, and wherein the expression and / or methylation status of the secondary biomarker is modified as a result of the epigenetic modifying agent repressing or enhancing expression of the target gene.

[0057] In one embodiment, the primary biomarker is selected from the group consisting of MYC, SFRP1, HNF4a, FOXP3, and APOB. In one embodiment, the primary biomarker is MYC.

[0058] In one embodiment, the one or more secondary biomarkers are selected from the group consisting of L1TD1, Hl 9, GAPDH, MEG3, ZIM2 / PEG3, IGHD, IGHG1, CDKN2A, MT IM, MT IE, and HHIP. In one embodiment, the foregoing methods may further involve obtaining the biological sample from the subject.

[0059] In one embodiment, the foregoing methods may further involve a. determining whether a measured level of DNA methylation of the one or more biomarkers in a second biological sample obtained from the subject who has received the second dose of the epigenetic modifying agent is higher than, less than or equal to a control level; and b. administering a third dose of the epigenetic modifying agent to the subject.

[0060] In a particular embodiment, the foregoing methods may further involve measuring the level of DNA methylation in the second biological sample.

[0061] In one embodiment, (a) wherein the epigenetic modifying agent achieves therapeutic effect by methylating the DNA; and wherein (i) the level of DNA methylation in the biological sample is less than or equal to the control level and wherein the subject is administered a third dose of the epigenetic modifying agent that is higher than the second dose of the epigenetic modifying agent; or (ii) the level of DNA methylation in the biological sample is higher than the control level and wherein the subject is administered a third dose of the epigenetic modifying agent that is less than or equal to the second dose of the epigenetic modifying agent; or (b) wherein the epigenetic modifying agent achieves therapeutic effect by demethylating the DNA, and wherein (i) the level of methylation in the biological sample is higher than the control level and wherein the subject is administered a third dose of the epigenetic modifying agent that is higher than the second dose of the epigenetic modifying agent; or (ii) the level of methylation in the biological sample is less than or equal to the control leveland wherein the subject is administered a third dose of the epigenetic modifying agent that is less than or equal to the second dose of the epigenetic modifying agent.

[0062] In one embodiment, the subject has cancer. In one embodiment, the cancer is hepatocellular carcinoma (HCC). In one embodiment, the cancer is non-small cell lung cancer (NSCLC).BRIEF DESCRIPTION OF THE FIGURES

[0063] The following detailed description of the embodiments of the disclosure will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the disclosure, there are shown in the drawing embodiments, which are presently exemplified. It should be understood, however, that the disclosure is not limited to the precise arrangement and instrumentalities of the embodiments shown in the drawings.

[0064] FIG. 1 depicts tumor volume in mice after treatment with ZF17-MQ1. Mice treated with ZF17-MQ1 were dosed once every 10 days at 1 mg / kg or 0.3 mg / kg for 44 days. The control mice where dosed with control mRNA once every 5 days for 4 times, given a dosing holiday for 15 days and terminated at 30 days after initial treatment.

[0065] FIG. 2A depicts methylation levels of total extracellular vesicle DNA collected from serum comparing negative controls (PBS and SNC) to treated samples (ZF17-MQ1 at 1 mg / kg and 0.3 mg / kg).

[0066] FIG. 2B depicts raw CT values of methylation levels at the MYC locus comparing negative controls (PBS and SNC) to treated samples (ZF17-MQ1 at 1 mg / kg and 0.3 mg / kg).

[0067] FIG. 3A depicts levels of cellular MYC mRNA from extracellular vesicles released from Hep3B cells or from cells. Expression of MYC mRNA was determined after 48 hours.

[0068] FIG. 3B depicts levels of cellular MYC mRNA from extracellular vesicles released from Hep3B cells. Expression of MYC mRNA from extracellular vesicles release from treated and untreated cells was determined after 48 hours.

[0069] FIG. 4A depicts extracellular vesicle RNA after 24 hours and 48 hours of treatment with MR- 30723 encapsulated in a LNP.

[0070] FIG. 4B depicts cellular RNA after 24 hours and 48 hours of treatment with MR-30723 encapsulated in a LNP.

[0071] FIG. 5A depicts relative MYC methylation signal after treatment with ZF9-MQ1.

[0072] FIG. 5B depicts qMSP analysis of methylated DNA after treatment with MR-30723 encapsulated in a LNP.

[0073] FIG. 6 depicts tapestation results of isolated extracellular vesicle DNA from cell supernatant.

[0074] FIG. 7 depicts tapestation results of isolated extracellular vesicle DNA from pooled serum.

[0075] FIG. 8 depicts relative MYC methylation signal from extracellular vesicle DNA and cellularDNA 48hr.

[0076] FIG. 9A depicts relative MYC methylation signal from extracellular vesicle DNA 24 and 48 hrs after treatment with MR-30723 encapsulated in a LNP.

[0077] FIG. 9B depicts relative MYC methylation signal from cellular DNA 24 and 48 hrs after treatment with MR-30723 encapsulated in a LNP.

[0078] FIG. 10A depicts CT values comparing untreated, ZF17-MQ1 and SNC samples and validating mouse qMSP primers and probes.

[0079] FIG. 10B depicts relative MYC methylation signal from untreated, ZF17-MQ1 and SNC Hepal.6 sample.

[0080] FIG. 11 MYC fragments from whole genome methylation sequencing from Hep3B cells.

[0081] FIG. 12 depicts results from the plasma dilution study, as described in Example 8, to determine dilution to quantify MR-32380 mRNA luminescence within bDNA assay range.

[0082] FIG. 13A depicts standard curve for luminescence of MR-32380 RNA in diluted plasma samples from nude mice, as described in Example 8.

[0083] FIG. 13B depicts quantification of MR-32380 mRNA in plasma samples after administration of 1.2 mg / kg dose of MR-32380 in a lipid nanoparticle, as described in Example 8.

[0084] FIG. 14A depicts Capture-based method selected to enrich signal sufficiently for biomarker identification (TwistBio platform). Captured methylome was compared to whole-genome methyl-seq and showed greater than 2000x coverage efficiency increased with the captured methylome.

[0085] FIG. 14B depicts DNA methylation levels at evDNA (extracellular vesicle DNA) and cfDNA (cell free DNA) after treatment with epigenetic modifying agent compared to a control.

[0086] FIG. 15A depicts tumor volume in mice after treatment with MR-30723 / LNP over the course of day 0 through day 25 after treatment with epigenetic modifying agent compared to controls.

[0087] FIG. 15B depicts weight in mice after treatment with MR-30723 / LNP over the course of day 0 through day 25 after treatment with epigenetic modifying agent compared to controls.

[0088] FIG. 16A depicts DNA methylation of genomic DNA after treatment with MR-30723 / LNP compared to controls.

[0089] FIG. 16B depicts estimated reads of circulating tumor DNA (ctDNA) after treatment with MR-30723 / LNP compared to controls.

[0090] FIG. 16C depicts methylation detection assays in evDNA from control animals, saline and non-coding treatments. No methylation was detected in the controls.

[0091] FIG. 16D depicts methylation detections assays in plasma evDNA and Tumor gDNA from mice treated with MR-30882 / LNP.

[0092] FIG. 17A depicts mean tumor volume over the course of 25 days after treatment with MR- 30723 / LNP compared to controls.

[0093] FIG. 17B depicts mean percent weight change over the course of 25 days after treatment with MR-30723 / LNP compared to controls.

[0094] FIG. 18A depicts mean tumor volume over the course of 25 days after treatment with two doses of MR-30882 / LNP compared to controls.

[0095] FIG. 18B depicts percent variant epiallele fraction (VEF) in MYC promoter by treatment after 14 days (top panel) and after 48 hours (bottom panel).

[0096] FIG. 18C depicts percent variant epiallele fraction (VEF) for extracellular vesicle DNA after treatment with MR-30882 / LNP for 48 hours compared to controls.

[0097] FIG. 18D depicts percent variant epiallele fraction (VEF) for genomic DNA after treatment with MR-30882 / LNP for 48 hours compared to controls.

[0098] FIG. 19A depicts a subcutaneous Hep3B xenograft model was intravenously dosed with MR- 30882 / LNP (1 or 2 mg / kg), a non-coding control mRNA (2 mg / kg), or PBS after tumors reached 200 mm3 in size.

[0099] FIG. 19B depicts percent variant epiallele fraction (VEF) of samples 24 hours post-dose. Sparse DNA methylation was detected at MYC in cfDNA (top panel) in MR-30882 / LNP animals compared to tumor gDNA (bottom panel).

[0100] FIG. 19C depicts percent variant epiallele fraction (VEF) of samples 24 hours post-dose. MYC methylation was mostly absent in cfDNA (top panel) or tumor gDNA (bottom panel) from PBS control treated animals.

[0101] FIG. 19D depicts enrichment of cfDNA from plasma (whole blood). Plasma was harvested from animals in FIG. 19A and cfDNA was examined for MYC methylation using the minimal hybridization capture panel, providing the necessary enrichment over whole-genome sequencing to detect regions of interest.

[0102] FIG. 20 depicts percent variant epiallele fraction (VEF) of target enrichment panel. Methylation was detected down to 0.00001% using a synthetic control titration.

[0103] FIG. 21 depicts percent variant epiallele fraction (VEF) targeted methylation sequencing was performed on a titration series of methylated control gDNA spiked into unmethylated control gDNA (Zymo Research) and analyzed for methylated epialleles at the MYC promoter. MYC promoter methylation was detected in samples containing as low as 0.05% methylated gDNA compared to fully unmethylated control gDNA. This was at the theoretical limit of the number of copies present in the assay.

[0104] FIG. 22A shows results from examination of the MYC methylation panel performance on a biological sample designed to mimic a clinically-derived cfDNA specimen. Targeted methylation sequencing using the MYC methylation panel was able to discriminate between the MR-30882 / LNP - treated (EC) sample (bottom panel) and the PBS-treated sample (top panel).

[0105] FIG. 22B depicts enrichment of cfDNA from plasma (whole blood). Plasma was harvested from animals in FIG. 22A and cfDNA was examined for MYC methylation using the minimal hybridization capture panel, providing the necessary enrichment over whole-genome sequencing to detect regions of interest.DETAILED DESCRIPTION

[0106] The present invention is based, at least in part, on the finding that dosing of an epigenetic modifying agent can be determined based on assessing the DNA methylation of a biomarker associated with a target gene for which expression is sought to modulated and / or assessing the level of extracellular vesicle (e.g., exosome or microvesicle) RNA associated with one or more biomarkers. In various embodiments, the epigenetic modifying agent serves to methylate or demethylate a DNA locus, for example, a promoter, surrounding a gene target, thereby repressing or enhancing expression of the gene target, as desired. By assessing the level of DNA methylation and / or level of extracellular vesicle (e.g., exosome or microvesicle) RNA after an initial dose, the second dose can be modified accordingly.

[0107] Isolating and sequencing DNA or RNA for levels of methylation for one or more small genomic regions (e.g., approximately 50 kb to 100 kb in total) is challenging and requires ultrasensitive detection systems compared to assays detecting methylated DNA across tens of megabases of genomic regions. Moreover, the epigenetic modifying agent of the present invention can be tissue specific, increasing the scarcity of the specific DNA and / or RNA being captured during the isolation steps and subsequently sequenced for methylation levels. Furthermore, approximately less than 1% of nucleic acids from a standard whole-genome methylation-sequencing assay is cell-free nucleic acids or extracellular vesicle nucleic acids.

[0108] Accordingly, in one aspect the invention provides a method of assessing the efficacy of a first dose of an epigenetic modifying agent by a. measuring in a biological sample obtained from a subject who has received the first dose of the epigenetic modifying agent at least one of: the level of DNA methylation of one or more biomarkers, or the level of RNA (e.g., extracellular vesicle (e.g., exosome or microvesicle) RNA) of one or more biomarkers; and b. determining whether at least one of the measured level of methylation and / or the measured level of RNA (e.g., extracellular vesicle (e.g., exosome or microvesicle) RNA) in the sample is higher than, less than or equal to a control level. In a further aspect, a method of treating a subject with an epigenetic modifying agent by a. measuring in a biological sample obtained from a subject who has received a first dose of an epigenetic modifying agent at least one of: the level of DNA methylation of one or more biomarkers, and the level of extracellular vesicle (e.g., exosome or microvesicle) RNA of one or more biomarkers; b. determining whether at least one of the measured level of DNA methylation and / or the measured level of extracellular vesicle (e.g., exosome or microvesicle) RNA in the sample is higher than, less than or equal to a control level; and c. administering a second dose of the epigenetic modifying agent to the subject.

[0109] In another aspect, the disclosure provides a method of assessing the efficacy of a first dose of an epigenetic modifying agent by: determining whether at least one of (i) a measured level of DNA methylation of one or more biomarkers, or (ii) a measured level of RNA (e.g., extracellular vesicle(e.g., exosome or microvesicle) RNA) of one or more biomarkers in a biological sample obtained from a subject who has received the first dose of epigenetic modifying agent is higher than, less than or equal to a control level. In a further aspect, a method of treating a subject with an epigenetic modifying agent by: determining whether at least one of (i) a measured level of DNA methylation of one or more biomarkers, or (ii) a measured level of RNA (e.g., extracellular vesicle (e.g., exosome or microvesicle) RNA) of one or more biomarkers in a biological sample obtained from a subject who has received the first dose of epigenetic modifying agent is higher than, less than or equal to a control level.

[0110] The method further may involve measuring (i) the level of DNA methylation of the one or more biomarkers, or (ii) the level of RNA (e.g., extracellular vesicle (e.g., exosome or microvesicle) RNA) of the one or more biomarkers in the biological sample.

[0111] The method further may involve administering a second dose of the epigenetic modifying agent that is higher than the first dose, when the level of DNA methylation in the biological sample is less than or equal to the control level, and the epigenetic modifying agent achieves therapeutic effect by methylating the DNA.

[0112] Alternatively, the method may involve administering a second dose of the epigenetic modifying agent that is less than or equal to the first dose, when the level of DNA methylation in the biological sample is higher than the control level, and the epigenetic modifying agent achieves therapeutic effect by methylating the DNA.

[0113] Alternatively, the method may involve administering a second dose of the epigenetic modifying agent that is higher than the first dose, when the level of DNA methylation in the biological sample is higher than the control level, and the epigenetic modifying agent achieves therapeutic effect by demethylating the DNA.

[0114] Alternatively, the method may involve administering a second dose of the epigenetic modifying agent that is less than or equal to the first dose, when the level of DNA methylation in the biological sample is lower than the control level, and the epigenetic modifying agent achieves therapeutic effect by demethylating the DNA.

[0115] Alternatively, the method may involve administering a second dose of the epigenetic modifying agent that is higher than the first dose, wherein the level of extracellular vesicle (e.g., exosome or microvesicle) RNA is higher than the control level and the epigenetic modifying agent achieves therapeutic effect by repressing expression of a gene target.

[0116] Alternatively, the method may involve administering a second dose of the epigenetic modifying agent that is less than or equal to the first dose, wherein the level of extracellular vesicle (e.g., exosome or microvesicle) RNA is less than or equal to the control level and the epigenetic modifying agent achieves therapeutic effect by repressing expression of a gene target.

[0117] Alternatively, the method may involve administering a second dose of the epigenetic modifying agent that is higher than the first dose, wherein the level of extracellular vesicle (e.g.,exosome or microvesicle) RNA is less than or equal to the control level and the epigenetic modifying agent achieves therapeutic effect by enhancing expression of a gene target.

[0118] Alternatively, the method may involve administering a second dose of the epigenetic modifying agent that is less than or equal to the first dose, wherein the level of extracellular vesicle (e.g., exosome or microvesicle) RNA is higher than the control level and the epigenetic modifying agent achieves therapeutic effect by enhancing expression of a gene target.

[0119] Alternatively, the method may involve determining whether a measured level of DNA methylation of the one or more biomarkers in a second biological sample obtained from the subject who has received the second dose of the epigenetic modifying agent is higher than, less than or equal to a control level; and administering a third dose of the epigenetic modifying agent to the subject. In a further aspect, the method may involve measuring the level of DNA methylation in the second biological sample.

[0120] The method further may involve administering a third dose of the epigenetic modifying agent that is higher than the first dose or second dose, when the level of DNA methylation in the biological sample is less than or equal to the control level, and the epigenetic modifying agent achieves therapeutic effect by methylating the DNA.

[0121] Alternatively, the method may involve administering a third dose of the epigenetic modifying agent that is less than or equal to the first dose or second dose, when the level of DNA methylation in the biological sample is higher than the control level, and the epigenetic modifying agent achieves therapeutic effect by methylating the DNA.

[0122] Alternatively, the method may involve administering a third dose of the epigenetic modifying agent that is higher than the first dose or second dose, when the level of DNA methylation in the biological sample is higher than the control level, and the epigenetic modifying agent achieves therapeutic effect by demethylating the DNA.

[0123] Alternatively, the method may involve administering a third dose of the epigenetic modifying agent that is less than or equal to the first dose or second dose, when the level of DNA methylation in the biological sample is lower than the control level, and the epigenetic modifying agent achieves therapeutic effect by demethylating the DNA.

[0124] Alternatively, the method may involve a. determining whether a measured level of extracellular vesicle (e.g., exosome or microvesicle) RNA in a second biological sample obtained from the subject who has received the second dose of the epigenetic modifying agent is higher than, less than or equal to a control level; and b. administering a third dose of the epigenetic modifying agent to the subject. In a further aspect, the method may involve measuring the level of extracellular vesicle (e.g., exosome or microvesicle) RNA in the second biological sample.

[0125] Alternatively, the method may involve administering a third dose of the epigenetic modifying agent that is higher than the first dose or second dose, wherein the level of extracellular vesicle (e.g.,exosome or microvesicle) RNA is higher than the control level and the epigenetic modifying agent achieves therapeutic effect by repressing expression of a gene target.

[0126] Alternatively, the method may involve administering a third dose of the epigenetic modifying agent that is less than or equal to the first dose or second dose, wherein the level of extracellular vesicle (e.g., exosome or microvesicle) RNA is less than or equal to the control level and the epigenetic modifying agent achieves therapeutic effect by repressing expression of a gene target.

[0127] Alternatively, the method may involve administering a third dose of the epigenetic modifying agent that is higher than the first dose or second dose, wherein the level of extracellular vesicle (e.g., exosome or microvesicle) RNA is less than or equal to the control level and the epigenetic modifying agent achieves therapeutic effect by enhancing expression of a gene target.

[0128] Alternatively, the method may involve administering a third dose of the epigenetic modifying agent that is less than or equal to the first dose or second dose, wherein the level of extracellular vesicle (e.g., exosome or microvesicle) RNA is higher than the control level and the epigenetic modifying agent achieves therapeutic effect by enhancing expression of a gene target.Definitions

[0129] As used herein, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.

[0130] The term “anchor sequence” as used herein, refers to a nucleic acid sequence recognized by a nucleating agent that binds sufficiently to form an anchor sequence-mediated conjunction, e.g., a complex. In some embodiments, an anchor sequence comprises one or more CTCF binding motifs. In some embodiments, an anchor sequence is not located within a gene coding region. In some embodiments, an anchor sequence is located within an intergenic region. In some embodiments, an anchor sequence is not located within either of an enhancer or a promoter. In some embodiments, an anchor sequence is located at least 400 bp, at least 450 bp, at least 500 bp, at least 550 bp, at least 600 bp, at least 650 bp, at least 700 bp, at least 750 bp, at least 800 bp, at least 850 bp, at least 900 bp, at least 950 bp, or at least 1 kb away from any transcription start site. In some embodiments, an anchor sequence is located within a region that is not associated with genomic imprinting, monoallelic expression, and / or monoallelic epigenetic marks. In some embodiments, the anchor sequence has one or more functions selected from binding an endogenous nucleating polypeptide (e.g., CTCF), interacting with a second anchor sequence to form an anchor sequence mediated conjunction, or insulating against an enhancer that is outside the anchor sequence mediated conjunction. In some embodiments of the present disclosure, technologies are provided that may specifically target a particular anchor sequence or anchor sequences, without targeting other anchor sequences (e.g., sequences that may contain a nucleating agent (e.g., CTCF) binding motif in a different context); such targeted anchor sequences may be referred to as the “target anchor sequence”. In some embodiments, sequence and / or activity of a target anchor sequence is modulated while sequence and / or activity ofone or more other anchor sequences that may be present in the same system (e.g., in the same cell and / or in some embodiments on the same nucleic acid molecule - e.g., the same chromosome) as the targeted anchor sequence is not modulated. In some embodiments, the anchor sequence comprises or is a nucleating polypeptide binding motif. In some embodiments, the anchor sequence is adjacent to a nucleating polypeptide binding motif.

[0131] The term “anchor sequence-mediated conjunction” as used herein, refers to a DNA structure, in some cases, a complex, that occurs and / or is maintained via physical interaction or binding of at least two anchor sequences in the DNA by one or more polypeptides, such as nucleating polypeptides, or one or more proteins and / or a nucleic acid entity (such as RNA or DNA), that bind the anchor sequences to enable spatial proximity and functional linkage between the anchor sequences (see, e.g. Figure 1).

[0132] Two events or entities are “associated” with one another, as that term is used herein, if presence, level, form and / or function of one is correlated with that of the other. For example, in some embodiments, a particular entity (e.g., polypeptide, genetic signature, metabolite, microbe, etc.) is considered to be associated with a particular disease, disorder, or condition, if its presence, level, form and / or function correlates with incidence of and / or susceptibility to the disease, disorder, or condition (e.g., across a relevant population). In some embodiments, two or more entities are physically “associated” with one another if they interact, directly or indirectly, so that they are and / or remain in physical proximity with one another. In some embodiments, two or more entities that are physically associated with one another are covalently linked to one another; in some embodiments, two or more entities that are physically associated with one another are not covalently linked to one another but are non-covalently associated, for example by means of hydrogen bonds, van der Waals interaction, hydrophobic interactions, magnetism, and combinations thereof. In some embodiments, a DNA sequence is “associated with” a target genomic or transcription complex when the nucleic acid is at least partially within the target genomic or transcription complex, and expression of a gene in the DNA sequence is affected by formation or disruption of the target genomic or transcription complex.

[0133] As used herein, the term “domain” refers to a section or portion of an entity. In some embodiments, a “domain” is associated with a particular structural and / or functional feature of the entity so that, when the domain is physically separated from the rest of its parent entity, it substantially or entirely retains the particular structural and / or functional feature. Alternatively or additionally, in some embodiments, a domain may be or include a portion of an entity that, when separated from that (parent) entity and linked with a different (recipient) entity, substantially retains and / or imparts on the recipient entity one or more structural and / or functional features that characterized it in the parent entity. In some embodiments, a domain is or comprises a section or portion of a molecule (e.g., a small molecule, carbohydrate, lipid, nucleic acid, polypeptide, etc.). In some embodiments, a domain is or comprises a section of a polypeptide. In some such embodiments, a domain is characterized by a particular structural element (e.g., a particular amino acid sequence orsequence motif, alpha-helix character, beta-sheet character, coiled-coil character, random coil character, etc.), and / or by a particular functional feature (e.g., binding activity, enzymatic activity, folding activity, signaling activity, etc.).

[0134] As used herein, the term “effector moiety” refers to a domain that is capable of altering the expression of a target gene when localized to an appropriate site in the nucleus of a cell. In some embodiments, an effector moiety recruits components of the transcription machinery. In some embodiments, an effector moiety inhibits recruitment of components of transcription factors or expression repressing factors. In some embodiments, an effector moiety comprises an epigenetic modifying moiety (e.g., epigenetically modifies a target DNA sequence).

[0135] As used herein, “epigenetic modifying moiety” refers to a domain that alters: i) the structure, e.g., two dimensional structure, of chromatin; and / or ii) an epigenetic marker (e.g., DNA methylation or DNA demethylation), when the epigenetic modifying moiety is appropriately localized to a nucleic acid (e.g., by a targeting moiety). In some embodiments, an epigenetic modifying moiety comprises an enzyme, or a functional fragment or variant thereof, that affects (e.g., increases or decreases the level of) one or more epigenetic markers. In some embodiments, an epigenetic modifying moiety comprises a DNA methyltransferase, a DNA demethylase, or a functional fragment of any thereof. As used herein, the term “epigenetic modifying agent” refers to an agent capable of altering gene expression (e.g., decease or increase expression of target gene). In some embodiments, the epigenetic modifying agent comprises an epigenetic modifying moiety.

[0136] As used herein, the term “expression control sequence” refers to a nucleic acid sequence that increases or decreases transcription of a gene and includes (but is not limited to) a promoter and an enhancer. An “enhancing sequence” refers to a subtype of expression control sequence and increases the likelihood of gene transcription. A “silencing or repressor sequence” refers to a subtype of expression control sequence and decreases the likelihood of gene transcription.

[0137] As used herein, the term “expression repressor” refers to an agent or entity with one or more functionalities that decreases expression of a target gene in a cell and that specifically binds to a DNA sequence (e.g., a DNA sequence associated with a target gene or a transcription control element operably linked to a target gene). An expression repressor comprises at least one targeting moiety and optionally one effector moiety.

[0138] As used herein, the term “expression enhancer” refers to an agent or entity with one or more functionalities that increases expression of a target gene in a cell and that specifically binds to a DNA sequence (e.g., a DNA sequence associated with a target gene or a transcription control element operably linked to a target gene). An expression enhancer comprises at least one targeting moiety and optionally one effector moiety.

[0139] As used herein, the term “expression repression system” refers to a plurality of expression repressors which decrease expression of a target gene in a cell. In some embodiments, an expression repression system comprises a first expression repressor and a second expression repressor, whereinthe first expression repressor and second expression repressor (or nucleic acids encoding the first expression repressor and second expression repressor) are present together in a single composition, mixture, or pharmaceutical composition. In some embodiments, an expression repression system comprises a first expression repressor and a second expression repressor, wherein the first expression repressor and second expression repressor (or nucleic acids encoding the first expression repressor and second expression repressor) are present in separate compositions or pharmaceutical compositions. In some embodiments, the first expression repressor and the second expression repressor are present in the same cell at the same time. In some embodiments, the first expression repressor and the second expression repressor are not present in the same cell at the same time, e.g., they are present sequentially. For example, the first expression repressor may be present in a cell for a first time period, and then the second expression repressor may be present in the cell for a second time period, wherein the first and second time periods may be overlapping or non-overlapping.

[0140] As used herein, the term “expression enhancing system” refers to a plurality of expression enhancers which increase expression of a target gene in a cell. In some embodiments, an expression enhancing system comprises a first expression enhancer and a second expression enhancer, wherein the first expression enhancer and second expression enhancer (or nucleic acids encoding the first expression enhancer and second expression enhancer) are present together in a single composition, mixture, or pharmaceutical composition. In some embodiments, an expression enhancing system comprises a first expression enhancer and a second expression enhancer, wherein the first expression enhancer and second expression enhancer (or nucleic acids encoding the first expression enhancer and second expression enhancer) are present in separate compositions or pharmaceutical compositions. In some embodiments, the first expression enhancer and the second expression enhancer are present in the same cell at the same time. In some embodiments, the first expression enhancer and the second expression enhancer are not present in the same cell at the same time, e.g., they are present sequentially. For example, the first expression enhancer may be present in a cell for a first time period, and then the second expression enhancer may be present in the cell for a second time period, wherein the first and second time periods may be overlapping or non-overlapping.

[0141] As used herein, the term “fusion molecule” refers to a compound comprising two or more moieties, e.g., a targeting moiety and an effector moiety, that are covalently linked. A fusion molecule and its moieties may comprise any combination of polypeptide, nucleic acid, glycan, small molecule, or other components described herein (e.g., a targeting moiety may comprise a nucleic acid and an effector moiety may comprise a polypeptide). In some embodiments, a fusion molecule is a fusion protein, e.g., comprising one or more polypeptide domains covalently linked via peptide bonds. In some embodiments, a fusion molecule is a conjugate molecule that comprises a targeting moiety and effector moiety that are linked by a covalent bond other than a peptide bond or phosphodiester bond (e.g., a targeting moiety that comprises a nucleic acid and an effector moiety comprising a polypeptide linked by a covalent bond other than a peptide bond or phosphodiester bond). In someembodiments, an expression repressor is or comprises a fusion molecule. In some embodiments, an expression enhancer is or comprises a fusion molecule.

[0142] As used herein, the term “genomic complex” is a complex that brings together two genomic sequence elements that are spaced apart from one another on one or more chromosomes, via interactions between and among a plurality of protein and / or other components (potentially including, the genomic sequence elements). In some embodiments, the genomic sequence elements are anchor sequences to which one or more protein components of the complex binds. In some embodiments, a genomic complex may comprise an anchor sequence-mediated conjunction. In some embodiments, a genomic sequence element may be or comprise a CTCF binding motif, a promoter and / or an enhancer. In some embodiments, a genomic sequence element includes at least one or both of a promoter and / or regulatory site (e.g., an enhancer). In some embodiments, complex formation is nucleated at the genomic sequence element(s) and / or by binding of one or more of the protein component(s) to the genomic sequence element(s). As will be understood by those skilled in the art, in some embodiments, colocalization (e.g., conjunction) of the genomic sites via formation of the complex alters DNA topology at or near the genomic sequence element(s), including, in some embodiments, between them. In some embodiments, a genomic complex comprises an anchor sequence-mediated conjunction, which comprises one or more loops. In some embodiments, a genomic complex as described herein is nucleated by a nucleating polypeptide such as, for example, CTCF and / or Cohesin. In some embodiments, a genomic complex as described herein may include, for example, one or more of CTCF, Cohesin, noncoding RNA (e.g., eRNA), transcriptional machinery proteins (e.g., RNA polymerase, one or more transcription factors, for example selected from the group consisting of TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH, etc.), transcriptional regulators (e.g., Mediator, P300, enhancer-binding proteins, repressor-binding proteins, histone modifiers, etc.), etc. In some embodiments, a genomic complex as described herein includes one or more polypeptide components and / or one or more nucleic acid components (e.g., one or more RNA components), which may, in some embodiments, be interacting with one another and / or with one or more genomic sequence elements (e.g., anchor sequences, promoter sequences, regulatory sequences (e.g., enhancer sequences)) so as to constrain a stretch of genomic DNA into a topological configuration (e.g., a loop) that it does not adopt when the complex is not formed. Moiety. As used herein, the term “moiety” refers to a defined chemical group or entity with a particular structure and / or or activity, as described herein.

[0143] As used herein, the term “modulating agent” refers to an agent comprising one or more targeting moieties and one or more effector moieties that is capable of altering (e.g., increasing or decreasing) expression of a target gene, e.g., MYC, Secreted Frizzled Related Protein 1 (SFRP1), Hepatocyte Nuclear Factor 4-alpha (HNF4a), Forkhead box P3 (FOXP3), and Apolipoprotein B (APOB).

[0144] As used herein, the term “MYC locus” refers to the portion of the human genome that encodes a MYC polypeptide (e.g., the polypeptide disclosed in NCBI Accession Number NP002458.2, or a mutant thereof), the promoter operably linked to MYC (“MYC promoter”), and the anchor sequences that form an ASMC comprising the MYC gene. In some embodiments, the MYC locus encodes a nucleic acid having NCBI Accession Number NM — 002467. In some embodiments, the MYC gene is a protooncogene, and in some embodiments the MYC gene is an oncogene. In certain instances, a MYC gene is found on chromosome 8, at 8q24.21. In certain instances, a MYC gene begins at 128,816,862 bp from pter and ends at 128,822,856 bp from pter. In certain instances, a MYC gene is about 6 kb. In certain instances, a MYC gene encodes at least eight separate mRNA sequences — 5 alternatively spliced variants and 3 un-spliced variants.

[0145] As used herein, the terms “secreted frizzled related protein 1” and “SFRP1,” as used interchangeably herein, refer to the gene as well as the well-known encoded protein that is a Wnt signaling pathway component and, more specifically, a secreted extracellular polypeptide that binds to a Wnt protein.. The Wnt proteins control the expression of several genes, including pre-mitotic genes involved in hair growth. SFRP1 is a Wnt antagonist. In the absence of SFRP1, Wnt can bind to the frizzled receptor, this begins a phosphorylation cascade which de-phosphorylates B-catenin, and frees it from the destruction complex. Then B-catenin is able to translocate into the nucleus where it activates pro-mitotic genes for hair growth. Decreased expression of the SFRP1 gene has been associated increased expression of pre-mitotic genes and increased hair growth. Expression of the SFRP 1 gene results in sequestering of the Wnt proteins and decreased activation of pre-mitotic genes and has been associated with alopecia (e.g., androgenic alopecia, alopecia areata, traction alopecia, senescent alopecia and cicatricial alopecia). The nucleotide and amino acid sequence of SFRP1 is known and may be found in, for example, GenBank Accession Nos. NM_003012.5 (NM_003012) and NP_003003.3 (NP_003003), the entire contents of each of which are incorporated herein by reference. The nucleotide sequence of the genomic region of Chromosome 8 which includes the endogenous promoters of SFRP 1 and the SFRP 1 coding sequence is also known and may be found in GenBank Accession No. NC_000008. l l (41261962..41309473) and NC_000008.10 (41119481..41166992).

[0146] As used herein, the term “HNF4a locus” refers to the portion of the human genome that encodes a HNF4a polypeptide. The HNF4a gene is located on chromosome 20, with transcription regulated by two promoters (P 1 and P2) and alternative splicing variants, resulting in nine distinct isoforms (al- a9). The HNF4a locus is transcriptionally regulated through the use of two distinct promoters that are physically separated by more than 45 kb. Isoforms produced by the activity of the closer promoter are designated P 1 whereas isoforms produced by the second and more distant promoter are designated P2. Isoforms most common in the liver are expressed from promoter 1 (Pl), with isoforms from P2 most commonly found in fetal tissues, and in the adult kidney and small intestine. The nucleotide sequence of the genomic region of Chromosome 20 which includes theendogenous promoters of HNF4a and the HNF4a coding sequence is also known and may be found in GenBank Accession No. NC_000020.10 (42984441. ..43061485).

[0147] As used herein, the term “forkhead box P3” or “FOXP3” refers to the gene that encodes the well-known FOX protein family member that is a master transcription factor that controls the differentiation of naive T-cells into regulatory T-cells (Tregs). FOX proteins belong to the forkhead / winged-helix family of transcriptional regulators and are believed to exert control via similar DNA binding interactions during transcription. In regulatory T cell model systems, the FOXP3 transcription factor occupies the promoters for genes involved in regulatory T-cell function, and may repress transcription of key genes following stimulation of T cell receptors. Defects in this gene's ability to function can cause immunodysregulation polyendocrinopathy enteropathy X-linked syndrome (or IPEX), also known as X-linked autoimmunity-immunodeficiency syndrome, as well as numerous cancers. The nucleotide and amino acid sequence of FOXP3 is known and may be found in, for example, GenBank Accession Nos. NM_014009.4 and NM_001114377.2, the entire contents of each of which are incorporated herein by reference. The nucleotide sequence of the genomic region of the X Chromosome in human, which includes the endogenous promoters of FOXP3 and the FOXP3 coding sequence, is also known and may be found in, for example, NC_000023. 11 (49250436-49264932). There are two common transcript variants for FOXP3 mRNA, the sequences of which can be found in GenBank Accession Nos. NM_014009.4 and NM_001114377.2. The entire contents of each of the foregoing GenBank Accession numbers are incorporated herein by reference as of the date of filing this application.

[0148] As used herein, the term “apolipoprotein B” or “APOB ” refers to the gene that encodes the well-known apolipoprotein of chylomicrons, VLDL, IDL, and LDL particles. The encoded protein is the primary organizing protein component of the particles and is important for the formation of these particles. APOB on the LDL particle also acts as a ligand for LDL receptors in various cells throughout the body. High levels of APOB are related to heart disease. Hypobetalipoproteinemia is a genetic disorder that can be caused by a mutation in the APOB gene, APOB. Mutations in gene APOB 100 can also cause familial hypercholesterolemia, a hereditary (autosomal dominant) form of metabolic disorder hypercholesterolemia. Overproduction of apolipoprotein B can result in lipid- induced endoplasmic reticulum stress and insulin resistance in the liver. The nucleotide and amino acid sequence of APOB is known and may be found in, for example, GenBank Accession Nos. NM_009693, XM_001000646, XM_0010000659, XM_001000667, XMJ37955, XM_894981, XM- 906759, NP_033823.2, XP_001000646, XP_001000659, XP_001000667, XPJ37955, XP_900074, XP_911852, NM_000384.3, NP_000375.3, the entire contents of each of which are incorporated herein by reference. The nucleotide sequence of the genomic region of Chromosome 2 in human, or chromosome 12 in mouse, which includes the endogenous promoters of APOB and the APOB coding sequence is also known and may be found in: Mouse - mmlO genome build: chrl2:7968110- 8023150, Human - hgl9 genome build: chr2:21160333-21330910.

[0149] As used herein, in its broadest sense, the term “nucleic acid” refers to any compound and / or substance that is or can be incorporated into an oligonucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester linkage. As will be clear from context, in some embodiments, "nucleic acid' refers to an individual nucleic acid residue (e.g., a nucleotide and / or nucleoside); in some embodiments, "nucleic acid' refers to an oligonucleotide chain comprising individual nucleic acid residues. In some embodiments, a "nucleic acid' is or comprises RNA; in some embodiments, a "nucleic acid" is or comprises DNA. In some embodiments, a nucleic acid is, comprises, or consists of one or more natural nucleic acid residues. In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleic acid analogs. In some embodiments, a nucleic acid analog differs from a nucleic acid in that it does not utilize a phosphodiester backbone. For example, in some embodiments, a nucleic acid is, comprises, or consists of one or more "peptide nucleic acids", which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present disclosure. Alternatively or additionally, in some embodiments, a nucleic acid has one or more phosphorothioate and / or 5'-N-phosphoramidite linkages rather than phosphodiester bonds. In some embodiments, a nucleic acid is, comprises, or consists of one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxy guanosine, and deoxycytidine). In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2- thiothymidine, inosine, pyrrolo-pyrimidine, 3 -methyl adenosine, 5 -methylcytidine, C-5 propynyl- cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5 -fluorouridine, C5- iodouridine, C5-propynyl- uridine, C5 -propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7- deazaadenosine, 7- deazaguanosine, 8 -oxoadenosine, 8 -oxoguanosine, 0(6)-methylguanine, 2- thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, a nucleic acid comprises one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) as compared with those in natural nucleic acids. In some embodiments, a nucleic acid has a nucleotide sequence that encodes a functional gene product such as an RNA or protein. In some embodiments, a nucleic acid includes one or more introns. In some embodiments, nucleic acids are prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), reproduction in a recombinant cell or system, and chemical synthesis. In some embodiments, a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues long. In some embodiments, a nucleic acid is partly or wholly single stranded; in some embodiments, a nucleic acid is partly or wholly double stranded. In some embodiments a nucleic acid has a nucleotide sequence comprising at least one element that encodes, or is the complement of a sequence that encodes, apolypeptide. In some embodiments, a nucleic acid has enzymatic activity. Nucleating polypeptide: As used herein, the term “nucleating polypeptide” or “conjunction nucleating polypeptide” as used herein, refers to a protein that associates with an anchor sequence directly or indirectly and may interact with one or more conjunction nucleating polypeptides (that may interact with an anchor sequence or other nucleic acids) to form a dimer (or higher order structure) comprised of two or more such conjunction nucleating polypeptides, which may or may not be identical to one another. When conjunction nucleating polypeptides associated with different anchor sequences associate with each other so that the different anchor sequences are maintained in physical proximity with one another, the structure generated thereby is an anchor-sequence-mediated conjunction. That is, the close physical proximity of a nucleating polypeptide-anchor sequence interacting with another nucleating polypeptide- anchor sequence generates an anchor sequence-mediated conjunction (e.g., in some cases, a DNA loop), that begins and ends at the anchor sequence. As those skilled in the art, reading the present specification will immediately appreciate, terms such as “nucleating polypeptide”, “nucleating molecule”, “nucleating protein”, “conjunction nucleating protein”, may sometimes be used to refer to a conjunction nucleating polypeptide. As will similarly be immediately appreciated by those skilled in the art reading the present specification, an assembles collection of two or more conjunction nucleating polypeptides (which may, in some embodiments, include multiple copies of the same agent and / or in some embodiments one or more of each of a plurality of different agents) may be referred to as a “complex”, a “dimer” a “multimer”, etc.

[0150] As used herein, the terms “next generation sequencing” and “NGS” refer to massively parallel sequencing platforms to analyze genome, epigenome and transcriptome. Certain sequencing platforms, such as those marketed by Illumina®, Ion Torrent™, Roche™, and Life Technologies™, involve solid phase amplification of target polynucleotides of unknown sequence. In some embodiments, the genomic DNA is fragmented into smaller lengths of DNA, for example, between 200-1200 nucleotides in length. Solid phase amplification of these polynucleotides is typically performed by first ligating known adapter (such as, an oligonucleotide, primer, or probe) sequences to each end of a target polynucleotide. The double-stranded polynucleotide is then denatured to form a single-stranded template molecule that is immobilized on the solid substrate. In some embodiments, the target polynucleotide is selectively captured and isolated (e.g., purified) from the rest of the polynucleotides in the sample. The adapter sequence on the 3 ' end of the template is hybridized to an extension primer, and amplification is performed by extending the primer, thereby amplifying the target polynucleotide.

[0151] Prior to sequencing, the polynucleotides can be treated with agents (such as, but not limited to, bisulfite) capable of altering the polynucleotide sequence and / or epigenetic modifications. The term “bisulfite” as used herein encompasses all types of bisulfites, such as sodium bisulfite, that are capable of chemically converting a cytosine (C) to a uracil (U) without chemically modifying a methylated cytosine and, therefore, can be used to differentially modify a DNA sequence based on themethylation status of the DNA. As used herein, the term “cytosine deaminase” refers to an enzyme capable of converting an unmodified cytosine to uracil, without chemically modifying a methylated cytosine. In some embodiments, the cytosine deaminase is Apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC). APOBEC proteins belong to a family of deaminase proteins that can catalyze the deamination of cytosine to uracil on single-stranded DNA or / and RNA.

[0152] The term “adapter” can refer to an oligonucleotide of known sequence, the ligation of which to a target polynucleotide or a target polynucleotide strand of interest enables the generation of amplification-ready products of the target polynucleotide or the target polynucleotide strand of interest. Various adapter designs can be used. Suitable adapter molecules include single or double stranded nucleic acid (DNA or RNA) molecules or derivatives thereof, stem-loop nucleic acid molecules, double stranded molecules comprising one or more single stranded overhangs of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 bases or longer, proteins, peptides, aptamers, organic molecules, small organic molecules, or any adapter molecules known in the art that can be covalently or non-covalently attached, such as for example by ligation, to the double stranded nucleic acid fragments. The adapters can be designed to comprise a double-stranded portion which can be ligated to double-stranded nucleic acid (or double-stranded nucleic acid with overhang) products.

[0153] The term “oligonucleotide” can refer to a polynucleotide chain, typically less than 200 residues long, e.g., between 15 and 100 nucleotides long, but also intended to encompass longer polynucleotide chains. Oligonucleotides can be single- or double-stranded. The terms “primer” and “oligonucleotide primer” can refer to an oligonucleotide capable of hybridizing to a complementary nucleotide sequence. The term “oligonucleotide” can be used interchangeably with the terms “primer,” “adapter,” and “probe.”

[0154] The term “primer” can refer to an oligonucleotide, generally with a free 3' hydroxyl group, that is capable of hybridizing with a template (such as a target polynucleotide, target DNA, target RNA or a primer extension product) and is also capable of promoting polymerization of a polynucleotide complementary to the template. A primer can contain a non-hybridizing sequence that constitutes a tail of the primer. A primer can still be hybridizing to a target even though its sequences may not fully complementary to the target.

[0155] The term “hybridization” / “hybridizing” and “annealing” can be used interchangeably and can refer to the pairing of complementary nucleic acids.

[0156] In some embodiments, the DNA methylation is measured with a panel of oligonucleotides, that spans a combined length of genomic DNA which is at least 5 kb, at least 10 kb, at least 15 kb, at least 20 kb, at least 25 kb, at least 30 kb, at least 35 kb, at least 40 kb, at least 45 kb, at least 50 kb, at least 55 kb, at least 60 kb, at least 65 kb, at least 70 kb, at least 75 kb, at least 80 kb, at least 85 kb, at least 90 kb, at least 95 kb, at least 100 kb of genomic sequence. In some embodiments, the genomic region of interest comprises discontinuous genomic sequence. In some embodiments, the genomic region of interest comprises continuous genomic sequence.

[0157] In some embodiments, the DNA methylation is measured on one or more biomarkers. In some embodiments, the DNA methylation is measured on one or more secondary biomarkers. In some embodiments, the DNA methylation is measured on one or more control genomic sequences.

[0158] In one embodiment, the biomarker is the MYC gene. In one embodiment, a panel of oligonucleotides or adapters are designed to isolate regions of DNA sequence comprised in the MYC gene, MYC promoter, and / or MYC locus. For example, as shown in Table 1 and 2 below, the panel of oligonucleotides are designed to target the MYC promoter (bold), secondary biomarkers, genomic regions known to be methylated, and genomic regions known to be unmethylated.Table 1Table 2

[0159] The term “epigenetic state” or “epigenetic status” as used herein refers to any structural feature at a molecular level of a nucleic acid (e.g., DNA or RNA) other than the primary nucleotide sequence. For instance, the epigenetic state of a genomic DNA may include its secondary or tertiary structure determined or influenced by, e.g., its methylation pattern or its association with cellular proteins.

[0160] The term “methylation profile” “methylation state” or “methylation status,” as used herein to describe the state of methylation of a genomic sequence, refers to the characteristics of a DNA segment at a particular genomic locus relevant to methylation. Such characteristics include, but are not limited to, whether any of the cytosine (C) residues within this DNA sequence are methylated, location of methylated C residue(s), percentage of methylated C at any particular stretch of residues, and allelic differences in methylation due to, e.g., epigenetic inheritance, disease or environmental factors. The term “methylation” profile” or “methylation status” also refers to the relative or absolute concentration of methylated C or unmethylated C at any particular stretch of residues in a biological sample. For example, if the cytosine (C) residue(s) within a DNA sequence are methylated it may be referred to as “hypermethylated”; whereas if the cytosine (C) residue(s) within a DNA sequence are not methylated it may be referred to as “hypomethylated”. When sequences are said to be “differentially methylated”, and more specifically, when the methylation status differs between different alleles in the same or different samples, the sequences are considered “epialleles”.

[0161] As used herein, the terms “variant epiallele frequency” or “variant epiallele fraction” or “VEF” can be used interchangeably and refer to the calculated frequency of methylated epialleles which pass the threshold parameters as defined at the onset of analysis of NGS data compared to epialleles which do not pass the threshold and are counted as unmethylated at an individual cytosine level. For example, a threshold or parameter used to determine VEF is the percentage of methylation of CpG sites on each fragment sequenced. In some embodiments, the genomic sequences are determined to be methylated when a threshold of at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% of CpG sites on the sequence are methylated. In some embodiments, the threshold is at least 50% methylated CpG sites on the sequence are methylated. In some embodiments, determining the VEF comprises determining the fraction of a methylated CpG site which is comprised in a DNA fragment meeting the thresholdcompared to the fraction of the same CpG site which is comprised in a DNA fragment not meeting the threshold.

[0162] In some embodiments, the algorithm used to determine VEF is epialleleR (for example, see Nikolaienko O, Lonning PE, Knappskog S. epialleleR: an R / Bioconductor package for sensitive allele-specific methylation analysis in NGS data. Gigascience. 2022 Dec 28). Without thresholding, epialleleR produces conventional cytosine reports similar to the ones produced by other tools (e.g., Bismark), which are not as sensitive at reading the level of methylation. In this case, methylation beta value for every genomic location is computed as a ratio of a number of methylated cytosines to the total number of methylated and unmethylated cytosines:P= C / ( C+ T)

[0163] When read thresholding is performed (default mode of action), the level of methylation per every genomic position, denoted as a variant epiallele frequency (VEF), is calculated as a ratio of a number of methylated cytosines in read pairs passing the threshold ( C a ) to total number of methylated and unmethylated cytosines in all read pairs:VEF= C a / ( C + T)

[0164] The report is prepared at a level of selected genomic regions rather than individual bases, VEF equals the ratio of a number of read pairs passing threshold ( N a ) to the total number of read pairs ( N ) overlapping the region of interest:VEF = N a / N.

[0165] In general, the terms “cell-free,” “circulating,” and “extracellular” as applied to polynucleotides (e.g. “cell-free DNA” and “cell-free RNA”) are used interchangeably to refer to polynucleotides present in a sample from a subject or portion thereof that can be isolated or otherwise manipulated without applying a lysis step to the sample as originally collected (e.g., as in extraction from cells or viruses). Cell-free polynucleotides are thus unencapsulated or “free” from the cells or viruses from which they originate, even before a sample of the subject is collected. Cell-free polynucleotides may be produced as a byproduct of cell death (e.g. apoptosis or necrosis) or cell shedding, releasing polynucleotides into surrounding body fluids or into circulation. Accordingly, cell- free polynucleotides may be isolated from a non-cellular fraction of blood (e.g. serum or plasma), from other bodily fluids (e.g. urine), or from non-cellular fractions of other types of samples.

[0166] The term “circulating tumor DNA (ctDNA)” or “circulating cancer DNA” refers to the fraction of cell-free DNA (cf DNA) that originates from a tumor. The term “circulating tumor RNA (ctRNA)” or “circulating cancer RNA” refers to the fraction of cell-free RNA (cf RNA) that originates from a tumor.

[0167] As used herein, the term “extracellular vesicles” refers to a heterogeneous group of cell- derived membranous structures comprising exosomes and microvesicles, which originate from the endosomal system or which are shed from the plasma membrane, respectively. Extracellular vesicles (EVs) are membrane particles that can be secreted by almost every cell and re-taken up by a largenumber of cells. These vesicles can transfer information from one cell to another. Extracellular vesicles are divided into three classes: exosomes, having a diameter less approximately 100 nm or less, derived from endosomes in the intracellular portion. Larger microparticles (approximately 100- 1000 nm) detached directly from the cell membrane. A third class of extracellular vesicles are vesicles produced during apoptosis. The vesicles may be produced by various factors, such as extracellular stimuli, microbial infections, and other disease, such as cancer. Exemplary extracellular vesicles may include but are not limited to exosomes. Exemplary extracellular vesicles may include microvesicles.

[0168] The term “exosome” refers to cell-derived vesicles having a diameter of between about 20- 140 nm, such as between 40 and 120 nm, preferably a diameter of about 50-100 nm, for example, a diameter of about 60 nm, 70 nm, 80 nm, 90 nm, or 100 nm.

[0169] Extracellular vesicles (e.g., exosomes or microvesicles) may be isolated from any suitable biological sample from a mammal, including but not limited to, whole blood, serum, plasma, urine, saliva, breast milk, cerebrospinal fluid, amniotic fluid, ascitic fluid, bone marrow and cultured mammalian cells (e.g. immature dendritic cells (wild-type or immortalized), induced and non-induced pluripotent stem cells, fibroblasts, platelets, immune cells, reticulocytes, tumour cells, mesenchymal stem cells, satellite cells, hematopoietic stem cells, pancreatic stem cells, white and beige preadipocytes and the like). As one of skill in the art will appreciate, cultured cell samples will be in the cell-appropriate culture media (e.g., using exosome-free serum). Extracellular vesicles (e.g., exosomes or microvesicles) include specific surface markers not present in other vesicles, including surface markers such as tetraspanins, e.g. CD9, CD37, CD44, CD53, CD63, CD81, CD82 and CD151; targeting or adhesion markers such as integrins, 1CAM-1, EpCAM and CD31; membrane fusion markers such as annexins, TSG101, ALIX; and other exosome transmembrane proteins such as Rab5b, HLA-G, HSP70, LAMP2 (lysosome-associated membrane protein) and LIMP (lysosomal integral membrane protein). Extracellular vesicles (e.g., exosomes or microvesicles) may also be obtained from a non-mammal or from cultured non-mammalian cells. As the molecular machinery involved in extracellular vesicle (e.g., exosome) biogenesis is believed to be evolutionarily conserved, exosomes from non-mammalian sources include surface markers which are isoforms of mammalian surface markers, such as isoforms of CD9 and CD63, which distinguish exosomes from other cellular vesicles.

[0170] As used herein, the phrase “operably linked” refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A transcription control element "operably linked" to a functional element, e.g., gene, is associated in such a way that expression and / or activity of the functional element, e.g., gene, is achieved under conditions compatible with the transcription control element. In some embodiments, "operably linked" transcription control elements are contiguous (e.g., covalently linked) with coding elements, e.g., genes, of interest, in some embodiments, operably linked transcription control elements act in trans to or otherwise at a distance from the functional element, e.g., gene, of interest. In some embodiments,operably linked means two nucleic acid sequences are comprised on the same nucleic acid molecule. In a further embodiment, operably linked may further mean that the two nucleic acid sequences are proximal to one another on the same nucleic acid molecule, e.g., within 1000, 500, 100, 50, or 10 base pairs of each other or directly adjacent to each other.

[0171] As used herein, the terms “peptide,” “polypeptide,” and “protein” refer to a compound comprised of amino acid residues covalently linked by peptide bonds, or by means other than peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or by means other than peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.

[0172] As used herein, the term “pharmaceutical composition” refers to an active agent (e.g., a modulating agent, e.g., an epigenetic modifying agent), formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, active agent is present in unit dose amount appropriate for administration in a therapeutic regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream, or foam; sublingually; ocularly; trans-dermally; or nasally, pulmonary, and / or to other mucosal surfaces.

[0173] As used herein, “proximal” refers to a closeness of two sites, e.g., nucleic acid sites, such that binding of an expression repressor at the first site and / or modification of the first site by an expression repressor will produce the same or substantially the same effect as binding and / or modification of the other site. For example, a targeting moiety may bind to a first site that is proximal to an enhancer (the second site), and the effector moiety associated with said targeting moiety may epigenetically modify the first site such that the enhancer’s effect on expression of a target gene is modified, substantially the same as if the second site (the enhancer sequence) had been bound and / or modified. In some embodiments, a site proximal to a target gene (e.g., an exon, intron, or splice site within the target gene), proximal to a transcription control element operably linked to the target gene, or proximal to an anchor sequence is less than 5000, 4000, 3000, 2000, 1000, 900, 800, 700, 600, 500, 400, 300, 200,100, 50, or 25 base pairs from the target gene (e.g., an exon, intron, or splice site within the target gene), transcription control element, or anchor sequence (and optionally at least 20, 25, 50, 100, 200, or 300 base pairs from the target gene (e.g., an exon, intron, or splice site within the target gene), transcription control element, or anchor sequence).

[0174] As used herein, the term “specific”, referring to an agent having an activity, is understood by those skilled in the art to mean that the agent discriminates between potential target entities or states. For example, an in some embodiments, an agent is said to bind “specifically” to its target if it binds preferentially with that target in the presence of one or more competing alternative targets. In some embodiments, specific interaction is dependent upon the presence of a particular structural feature of the target entity (e.g., an epitope, a cleft, a binding site). It is to be understood that specificity need not be absolute. In some embodiments, specificity may be evaluated relative to that of the binding agent for one or more other potential target entities (e.g., competitors). In some embodiments, specificity is evaluated relative to that of a reference specific binding agent. In some embodiments, specificity is evaluated relative to that of a reference non-specific binding agent. In some embodiments, the agent or entity does not detectably bind to the competing alternative target under conditions of binding to its target entity. In some embodiments, binding agent binds with higher on-rate, lower off-rate, increased affinity, decreased dissociation, and / or increased stability to its target entity as compared with the competing alternative target(s).

[0175] As used herein, the term “specific binding” refers to an ability to discriminate between possible binding partners in the environment in which binding is to occur. In some embodiments, a binding agent that interacts with one particular target when other potential targets are present is said to "bind specifically" to the target with which it interacts. In some embodiments, specific binding is assessed by detecting or determining degree of association between the binding agent and its partner; in some embodiments, specific binding is assessed by detecting or determining degree of dissociation of a binding agent-partner complex. In some embodiments, specific binding is assessed by detecting or determining ability of the binding agent to compete with an alternative interaction between its partner and another entity. In some embodiments, specific binding is assessed by performing such detections or determinations across a range of concentrations.

[0176] As used herein, the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the art will understand that biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term “substantially” may therefore be used in some embodiments herein to capture potential lack of completeness inherent in many biological and chemical phenomena.

[0177] As used herein, the phrase “symptoms are reduced” may be used when one or more symptoms of a particular disease, disorder or condition is reduced in magnitude (e.g., intensity,severity, etc.) and / or frequency. In some embodiments, a delay in the onset of a particular symptom is considered one form of reducing the frequency of that symptom.

[0178] An agent or entity is considered to “target” another agent or entity, in accordance with the present disclosure, if it binds specifically to the targeted agent or entity under conditions in which they come into contact with one another. In some embodiments, a nucleic acid having a particular sequence targets a nucleic acid of substantially complementary sequence.

[0179] As used herein, the term “target gene” or “target locus” refer to a gene that is targeted for modulation, e.g., of expression. In some embodiments, a target gene is part of a targeted genomic complex (e.g. a gene that has at least part of its genomic sequence as part of a target genomic complex, e.g. inside an anchor sequence-mediated conjunction), which genomic complex is targeted by one or more modulating agents as described herein. In some embodiments, modulation comprises inhibition of expression of the target gene. In some embodiments, a target gene is modulated by contacting the target gene or a transcription control element operably linked to the target gene with an expression repression system, e.g., expression repressor(s), described herein. In some embodiments, a target gene is aberrantly expressed (e.g., overexpressed) in a cell, e.g., a cell in a subject (e.g., patient).

[0180] As used herein, the term “targeting moiety” means an agent or entity that specifically targets, e.g., binds, a genomic sequence element (e.g., an expression control sequence or anchor sequence). In some embodiments, the genomic sequence element is proximal to and / or operably linked to a target gene (e.g., MYC). As used herein, the term “target sequence” refers to a sequence within the target gene which the targeting moiety specifically targets. In some embodiments, for example, an epigenetic modifying agent (e.g., comprising a DNA binding domain and effector domain) targets a genomic locus and binds via the DNA binding domain.

[0181] As used herein, the phrase “therapeutic agent” refers to an agent that, when administered to a subject, has a therapeutic effect and / or elicits a desired biological and / or pharmacological effect. In some embodiments, a therapeutic agent is any substance that can be used to alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of, and / or reduce incidence of one or more symptoms or features of a disease, disorder, and / or condition. In some embodiments, a therapeutic agent comprises an expression repression system, e.g., an expression repressor, described herein. In some embodiments, a therapeutic agent comprises a nucleic acid encoding an expression repression system, e.g., an expression repressor, described herein. In some embodiments, a therapeutic agent comprises an expression activation system, e.g., an expression enhancer, described herein. In some embodiments, a therapeutic agent comprises a nucleic acid encoding an expression activation system, e.g., an expression enhancer, described herein. In some embodiments, a therapeutic agent comprises a pharmaceutical composition described herein.

[0182] As used herein, the term “therapeutically effective amount” means an amount of a substance e.g., a therapeutic agent, composition, and / or formulation) that elicits a desired biological responsewhen administered as part of a therapeutic regimen. In some embodiments, a therapeutically effective amount of a substance is an amount that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and / or condition, to treat, diagnose, prevent, and / or delay the onset of the disease, disorder, and / or condition. As will be appreciated by those of ordinary skill in this art, an effective amount of a substance may vary depending on such factors as desired biological endpoint(s), substance to be delivered, target cell(s) or tissue(s), etc. For example, in some embodiments, an effective amount of compound in a formulation to treat a disease, disorder, and / or condition is an amount that alleviates, ameliorates, relieves, inhibits, prevents, delays onset of, reduces severity of and / or reduces incidence of one or more symptoms or features of the disease, disorder, and / or condition. In some embodiments, a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.

[0183] The methods of the present invention also comprise measuring the methylation status of one or more biomarkers, e.g., the level of DNA methylation, and / or measuring the level of mRNA of one or more biomarkers in a biological sample obtained from a subject who has received the first dose of the epigenetic modifying agent.DNA Methylation Detection Methods

[0184] DNA methylation in mammalian genomes typically refers to the addition of a methyl group to the 5' carbon of cytosine residues (i.e. 5-methylcytosines) among CpG dinucleotides. DNA methylation may occur in cytosines in other contexts, for example CHG and CHH, where H is adenine, cytosine or thymine. Cytosine methylation may also be in the form of 5- hydroxymethylcytosine. Non-cytosine methylation, such as N6-methyladenine, has also been reported.

[0185] As used herein, the term "methylation status" (also called methylation profile) includes information related to DNA methylation for a region. Information related to DNA methylation can include, but not limited to, a methylation density of CpG sites in a region, a distribution of CpG sites over a contiguous region, a pattern or level of methylation for each individual CpG site within a region that contains more than one CpG site, and non-CpG methylation.

[0186] The term “methylation level” is intended to include the demethylation or methylation of a DNA. A DNA in question can be either methylated or non- or demethylated at least one site thereof. Since this condition is a binary one and thus the demethylation and methylation at a particular position are directly related to one another, the methylation level can be determined either by the demethylation and / or by the methylation at this at least one site. Thus, the normalized DNA methylation level as well as the relative methylation level can be determined via the methylation and / or demethylation of the DNA.

[0187] Methods of measuring methylation status, e.g., the level of methylation, may include, but are not limited to, massively parallel sequencing (e.g., next-generation sequencing) to determine methylation level, e.g., sequencing by — synthesis, real-time (e.g., single-molecule) sequencing, bead emulsion sequencing, nanopore sequencing, or other sequencing techniques known in the art. In some embodiments, a method of measuring the level of methylation can include whole-genome sequencing, e.g., measuring whole genome methylation status from bisulfite or enzymatically treated material with base-pair resolution. Methylation-sensitive restriction enzymes that typically digest unmethylated DNA provide a low cost approach to study DNA methylation. Affinity capture or immunoprecipitation of DNA bound by anti-methylated cytosine antibodies can be used to survey large segments of the genome.

[0188] In some embodiments, the methylation status can be measured by bisulfite sequencing, targeted enzymatic methylation sequencing, reduced representation bisulfite sequencing e.g., utilizing use of restriction enzymes to measure methylation status of high CpG content regions from bisulfite or enzymatically treated material with base-pair resolution, pyrosequencing, polymerase chain reaction (PCR)Zdigestion with restriction endonucleases, methylation-specific PCR, real-time PCR, Southern blot analysis, mass spectrometry, multiplex ligation-dependent probe amplification (MLP A), chromatin immunoprecipitation (ChIP), methylation microarray, high performance liquid chromatography (HPLC), high performance capillary electrophoresis (HPCE), methylation-sensitive single-nucleotide primer extension, methylation-sensitive single-stranded conformational polymorphism, methylation-sensitive restriction endonucleases, ligation mediated PCR, methylationspecific in situ hybridization, incomplete primer extension mixture, competitive primer binding site analysis, solid-phase primer extension, denaturing gradient gel electrophoresis, enzymatic regional methylation assay, combined bisulfite restriction analysis (COBRA), methylLight, and the like.

[0189] In some embodiments, a method of measuring methylation status can include targeted sequencing e.g., measuring methylation status of pre-selected genomic location from bisulfite or enzymatically treated material with base-pair resolution. In some embodiments, the pre-selection (capture) of regions of interest can be done by complementary in vitro synthesized oligonucleotide sequences (either baits, primers or probes).

[0190] In some embodiments, a method for measuring methylation status can include Illumina Methylation Assays e.g., measuring over 850,000 methylation sites quantitatively across a genome at single-nucleotide resolution.

[0191] Various methylation assay procedures can be used in conjunction with bisulfite treatment to determine methylation status of a target sequence. Such assays can include, among others, methylation-specific restriction enzyme qPCR, sequencing of bisulfite-treated nucleic acid, PCR (e.g., with sequence-specific amplification), Methylation Specific Nuclease-assisted minor-allele enrichment PCR, and methylation-sensitive high resolution melting, in some embodiments, the target sequence is amplified from a bisulfite-treated DNA sample and a DNA sequencing library is preparedfor sequencing according to, e.g., an Illumina protocol or transpose-based Nextera XT protocol. In certain embodiments, high-throughput and / or next-generation sequencing techniques are used to achieve base-pair level resolution of DNA sequence, permitting analysis of methylation status.

[0192] Another method, that can be used for methylation detection includes PCR amplification with methylation-specific oligonucleotide primers (MSP methods), e.g., as applied to bisulfite-treated sample (see, e.g., Herman 1992 Proc. Natl. Acad. Sci. USA 93: 9821-9826, which is herein incorporated by reference with respect to methods of determining methylation status). Use of methylation-status-specific oligonucleotide primers for amplification of bisulfite-treated DNA allows differentiation between methylated and unmethylated nucleic acids. Oligonucleotide primer pairs for use in MSP methods include at least one oligonucleotide primer capable of hybridizing with sequence that includes a methylation site, e.g., a CpG. An oligonucleotide primer that includes a T residue at a position complementary to a cytosine residue will selectively hybridize to templates in which the cytosine was unmethylated prior to bisulfite treatment, while an oligonucleotide primer that includes a G residue at a position complementary to a cytosine residue will selectively hybridize to templates in which the cytosine was methylated cytosine prior to bisulfite treatment. MSP results can be obtained with or without sequencing amplicons, e.g., using gel electrophoresis. MSP (methylation-specific PCR) allows for highly sensitive detection (detection level of 0.1% of the alleles, with full specificity) of locus-specific DNA methylation, using PCR amplification of bisulfite-converted DNA.

[0193] Another method that can be used to determine methylation status after bisulfite treatment of a sample is Methylation-Sensitive High Resolution Melting (MS-HRM) PCR (see, e.g., Hussmann 2018 Methods Mol Biol. 1708:551-571, which is herein incorporated by reference with respect to methods of determining methylation status). MS-HRM is an in-tube, PCR-based method to detect methylation levels at specific loci of interest based on hybridization melting. Bisulfite treatment of the DNA prior to performing MS-HRM ensures a different base composition between methylated and unmethylated DNA, which is used to separate the resulting amplicons by high resolution melting. A unique primer design facilitates a high sensitivity of the assays enabling detection of down to 0.1-1% methylated alleles in an unmethylated background. Oligonucleotide primers for MS-HRM assays are designed to be complementary to the methylated allele, and a specific annealing temperature enables these primers to anneal both to the methylated and the unmethylated alleles thereby increasing the sensitivity of the assays.

[0194] Another method that can be used to determine methylation status after bisulfite treatment of a sample is Quantitative Multiplex Methylation-Specific PCR (QM-MSP). QM-MSP uses methylation specific primers for sensitive quantification of DNA methylation (see, e.g., Fackler 2018 Methods Mol Biol. 1708:473-496, which is herein incorporated by reference with respect to methods of determining methylation status). QM-MSP is a two-step PCR approach, where in the first step, one pair of gene-specific primers (forward and reverse) amplifies the methylated and unmethylated copies of the same gene simultaneously and in multiplex, in one PCR reaction. This methylation-independentamplification step produces amplicons of up to 109 copies per pL after 36 cycles of PCR. In the second step, the amplicons of the first reaction are quantified with a standard curve using real-time PCR and two independent fluorophores to detect methylated / unmethylated DNA of each gene in the same well (e.g., 6FAM and VIC). One methylated copy is detectable in 100,000 reference gene copies.

[0195] Another method that can be used to determine methylation status after bisulfite treatment of a sample is Methylation Specific Nuclease-assisted Minor-allele Enrichment (MS-NaME) (see, e.g., Liu 2017 Nucleic Acids Res. 45(6):e39, which is herein incorporated by reference with respect to methods of determining methylation status). Ms-NaME is based on selective hybridization of probes to target sequences in the presence of DNA nuclease specific to double-stranded (ds) DNA (DSN), such that hybridization results in regions of double-stranded DNA that are subsequently digested by the DSN. Thus, oligonucleotide probes targeting unmethylated sequences generate local double stranded regions resulting to digestion of unmethylated targets; oligonucleotide probes capable of hybridizing to methylated sequences generate local double-stranded regions that result in digestion of methylated targets, leaving methylated targets intact. Moreover, oligonucleotide probes can direct DSN activity to multiple targets in bisulfite-treated DNA, simultaneously. Subsequent amplification can enrich nondigested sequences. Ms-NaME can be used, either independently or in combination with other techniques provided herein.

[0196] Another method that can be used to determine methylation status after bisulfite treatment of a sample is Methylation-sensitive Single Nucleotide Primer Extension (Ms-SNuPE™) (see, e.g., Gonzalgo 2007 Nat Protoc. 2(8): 1931 -6, which is herein incorporated by reference with respect to methods of determining methylation status). In Ms-SNuPE, strand-specific PCR is performed to generate a DNA template for quantitative methylation analysis using Ms-SNuPE. SNuPE is then performed with oligonucleotide(s) designed to hybridize immediately upstream of the CpG site(s) being interrogated. Reaction products can be electrophoresed on polyacrylamide gels for visualization and quantitation by phosphor-image analysis. Amplicons can also carry a directly or indirectly detectable labels such as a fluorescent label, radionuclide, or a detachable molecule fragment or other entity having a mass that can be distinguished by mass spectrometry. Detection may be carried out and / or visualized by means of, e.g., matrix assisted laser desorption / ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).

[0197] Certain methods that can be used to determine the level of methylation after bisulfite treatment of a sample utilize a first oligonucleotide primer, a second oligonucleotide primer, and an oligonucleotide probe in an amplification-based method. For instance, the oligonucleotide primers and probe can be used in a method of real-time polymerase chain reaction (PCR) or droplet digital PCR (ddPCR). In various instances, the first oligonucleotide primer, the second oligonucleotide primer, and / or the oligonucleotide probe selectively hybridize methylated DNA and / or unmethylated DNA, such that amplification or probe signal indicate methylation status of a sample.

[0198] Other bisulfite-based methods for detecting methylation status (e.g., the presence of level of 5 -methylcytosine) are disclosed, e.g., in Frommer (1992 Proc Natl Acad Sci USA. 1; 89(5): 1827-31, which is herein incorporated by reference with respect to methods of determining methylation status).

[0199] In certain MSRE-qPCR embodiments, the amount of total DNA is measured in an aliquot of sample in native (e.g., undigested) form using, e.g., real-time PCR or digital PCR.

[0200] Various amplification technologies can be used alone or in conjunction with other techniques described herein for detection of methylation status. Those of skill in the art, having reviewed the present specification, will understand how to combine various amplification technologies known in the art and / or described herein together with various other technologies for methylation level determination known in the art and / or provided herein. Amplification technologies include, without limitation, PCR, e.g., quantitative PCR (qPCR), real-time PCR, and / or digital PCR. Those of skill in the art will appreciate that polymerase amplification can multiplex amplification of multiple targets in a single reaction. PCR amplicons are typically 100 to 2000 base pairs in length. In various instances, an amplification technology is sufficient to determine methylations status.

[0201] Digital PCR (dPCR) based methods involve dividing and distributing a sample across wells of a plate with 96-, 384-, or more wells, or in individual emulsion droplets (ddPCR) e.g., using a microfluidic device, such that some wells include one or more copies of template and others include no copies of template. Thus, the average number of template molecules per well is less than one prior to amplification. The number of wells in which amplification of template occurs provides a measure of template concentration. If the sample has been contacted with MSRE, the number of wells in which amplification of template occurs provides a measure of the concentration of methylated template.

[0202] In various embodiments a fluorescence-based real-time PCR assay, such as MethyLight™, can be used to measure methylation levels (see, e.g., Campan 2018 Methods Mol Biol. 1708:497-513, which is herein incorporated by reference with respect to methods of determining methylation status). MethyLight is a quantitative, fluorescence-based, real-time PCR method to sensitively detect and quantify DNA methylation of candidate regions of the genome. MethyLight is uniquely suited for detecting low- frequency methylated DNA regions against a high background of unmethylated DNA, as it combines methylation-specific priming with methylation-specific fluorescent probing.Additionally, MethyLight can be combined with Digital PCR, for the highly sensitive detection of individual methylated molecules, with use in disease detection and screening.

[0203] Real-time PCR-based methods for use in determining methylation status typically include a step of generating a standard curve for unmethylated DNA based on analysis of external standards. A standard curve can be constructed from at least two points and can permit comparison of a real-time Ct value for digested DNA and / or a real-time Ct value for undigested DNA to known quantitative standards. In particular instances, sample Ct values can be determined for MSRE-digested and / or undigested samples or sample aliquots, and the genomic equivalents of DNA can be calculated from the standard curve. Ct values of MSRE-digested and undigested DNA can be evaluated to identifyamplicons digested (e.g., efficiently digested; e.g., yielding a Ct value of 45). Amplicons not amplified under either digested or undigested conditions can also be identified. Corrected Ct values for amplicons of interest can then be directly compared across conditions to establish relative differences in methylation status between conditions. Alternatively or additionally, delta-difference between the Ct values of digested and undigested DNA can be used to establish relative differences in methylation status between conditions.

[0204] In certain particular embodiments, whole genome bisulfite sequencing among other techniques, can be used to determine the methylation status of a disease biomarker that is or includes a single methylation locus. In certain particular embodiments, whole genome bisulfite sequencing, among other techniques, can be used to determine the methylation status of a biomarker that is or includes two or more methylation loci.

[0205] Those of skill in the art will further appreciate that methods, reagents, and protocols for whole genome bisulfite sequencing are well-known in the art. Unlike traditional whole genome sequencing, whole genome bisulfite sequencing is able to detect the methylation status of the cytosine nucleotide, due to deamination treatment with bisulfite reagent.

[0206] Those of skill in the art will appreciate that in embodiments in which a plurality of methylation loci are analyzed for methylation status in a method provided herein, methylation levels of each methylation locus can be measured or represented in any of a variety of forms, and the methylation levels of a plurality of methylation loci (preferably each measured and / or represented in a same, similar, or comparable manner) be together or cumulatively analyzed or represented in any of a variety of forms. In various embodiments, methylation status of each methylation locus can be measured as methylation portion. In various embodiments, methylation status of each methylation locus can be represented as the percentage value of methylated reads from total sequencing reads compared against reference sample. In various embodiments, methylation status of each methylation locus can be represented as a qualitative comparison to a reference, e.g., by identification of each methylation locus as hypermethylated or hypomethylated. mRNA Detection Methods

[0207] As used herein, the term “messenger RNA” (mRNA) refers to any polynucleotide which encodes a polypeptide of interest and which is capable of being translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ or ex vivo.

[0208] Methods for sequencing of RNA are known in the art, such as reverse transcriptase sequencing and RNA-seq.

[0209] The Sanger method is a common method for DNA sequencing. Reverse transcription coupled to the Sanger method is possible to determine RNA sequences

[0210] In one embodiment of the invention, a reverse transcription reaction is performed with an RNA transcript, a reverse transcriptase, deoxyribonucleotides, and a set of primers. In someembodiments, the set of primers include several closely spaced forward and reverse primers. The use of several primers makes it possible to work with large mRNAs. The primers are a combination of internal mRNA sequence specific primers, and primers found in the untranslated regions of mRNA. In further embodiments, the reverse transcription reaction results in several cDNA molecules that cover the length of the RNA transcript.

[0211] In another embodiment of the invention, the cDNA product or products from the reverse transcription reaction are incubated with a set of primers under conditions sufficient to allow PCR (polymerase chain reaction) to occur. The use of several primers makes it possible to work with large mRNAs. The primers are a combination of internal mRNA sequence specific primers, and primers found in the untranslated regions of mRNA. In some embodiments, the set of primers include several closely spaced forward and reverse primers.

[0212] The amplified cDNA molecules can then be analyzed using a DNA sequencing method. In one embodiment, the DNA sequencing method is the Sanger method. Other sequencing methods include CAGE tag-sequencing (Hoon 2008), deep sequencing, bidirectional sequencing, RNA sequencing, shotgun sequencing, bridge PCR, massively parallel signature sequencing (MPSS), colony sequencing, pyrosequencing, Illumina (Solexa) sequencing SOLiD sequencing, ion semiconductor sequencing, DNA nanoball sequencing, heliscope single molecule sequencing, and single molecule real time (SMRT) sequencing. By sequencing the cDNA, the sequence of the RNA transcript can be determined.

[0213] A recently developed technique called RNA Sequencing (RNA-Seq) uses massively parallel sequencing to allow for example transcriptome analyses of genomes at a far higher resolution than is available with Sanger sequencing- and microarray-based methods. In the RNA-Seq method, complementary DNAs (cDNAs) generated from the RNA of interest are directly sequenced using next-generation sequencing technologies. RNA-Seq has been used successfully to precisely quantify transcript levels, confirm or revise previously annotated 5' and 3' ends of genes, and map exon / intron boundaries (Eminaga et al., 2013. Quantification of microRNA Expression with Next-Generation Sequencing. Current Protocols in Molecular Biology. 103:4.17.1-4.17.14). Consequently, the amount of the RNA fragments can be determined also by RNA sequencing.

[0214] Messenger RNA can also be detected and quantified by branched DNA (bDNA) assay. Quantification by bDNA assay can amplify the target nucleic acid signal by 500 to 10 million molecules. First, “capture probes” are pre-coated on the bottom of plates or conjugated to beads or discs and hybridize with “target probes” or “capture extenders” that bind to specific target DNA or RNA sequences. Once the samples are added, the target DNA or RNA sequence is captured and the rest of the samples are washed away. Next, a second set of probes, including “label extender”, “preamplifier” and “amplifier” probes are added to hybridize with the target molecules to form the “sandwich”. The amplifier consists of branched DNA labeled with alkaline phosphatases. The preamplifier hybridizes with the amplifier and label extender, and the label extender hybridizes withthe target RNA or DNA. The second wash washes away the unhybridized probes. Finally, the substrate for alkaline phosphatase is added and the ensuing chemiluminescent signals are detected.Extracellular Vesicle Isolation

[0215] Extracellular vesicles (e.g., exosome or microvesicle) can be directly assayed from the biological samples, such that the level of extracellular vesicles (e.g., exosome or microvesicle) is determined or the one or more biomarkers of the extracellular vesicles (e.g., exosome or microvesicle) are determined without prior isolation, purification, or concentration of the extracellular vesicles (e.g., exosome or microvesicle).

[0216] Alternatively, in some embodiments, an exosome may be purified or concentrated prior to analysis. Analysis of an exosome can include quantitating the amount of one or more exosome populations of a biological sample. For example, a heterogeneous population of extracellular vesicles (e.g., exosome or microvesicle) can be quantitated, or a homogeneous population of extracellular vesicles (e.g., exosome or microvesicle), such as a population of extracellular vesicles (e.g., exosome or microvesicle) with a particular biomarker profile, or derived from a particular cell type (cell-of- origin specific extracellular vesicles (e.g., exosome or microvesicle)) can be isolated from a heterogeneous population of extracellular vesicles (e.g., exosome or microvesicle) and quantitated. Analysis of an extracellular vesicle (e.g., exosome or microvesicle) can also include detecting, quantitatively or qualitatively, a particular biomarker profile or a bio-signature, of an extracellular vesicle (e.g., exosome or microvesicle). An enriched population of extracellular vesicles (e.g., exosomes or microvesicles) can be obtained from a biological sample derived from any cell or cells capable of producing and releasing extracellular vesicles (e.g., exosomes or microvesicles) into the bodily fluid.

[0217] In a preferred embodiment, the biological sample of a subject is taken from the blood, plasma or urine. One skilled in the art will recognize that a biological sample can also be taken from, but not limited to the following bodily fluids: peripheral blood, ascites, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen (including prostatic fluid), Cowper's fluid or pre-ejaculatory fluid, female ejaculate, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates or other lavage fluids. A biological sample may also include the blastocyl cavity, umbilical cord blood, or maternal circulation that may be of fetal or maternal origin. The biological sample may also be a tissue sample or biopsy, from which extracellular vesicles (e.g., exosome or microvesicle)may be obtained.

[0218] Extracellular vesicles (e.g., exosome or microvesicle)may be concentrated or isolated from a biological sample using size exclusion chromatography, density gradient centrifugation, differentialcentrifugation, nanomembrane ultrafiltration, immunoabsorbent capture, affinity purification, microfiuidic separation, commercially available protein purification kits, or combinations thereof.

[0219] Size exclusion chromatography, such as gel permeation columns, centrifugation or density gradient centrifugation, and filtration methods can be used. For example, extracellular vesicles (e.g., exosomes or microvesicles) can be isolated by differential centrifugation, anion exchange and / or gel permeation chromatography, sucrose density gradients, organelle electrophoresis, magnetic activated cell sorting (MACS), or with a nanomembrane ultrafiltration concentrator. Various combinations of isolation or concentration methods can be used.

[0220] Highly abundant proteins, such as albumin and immunoglobulin, may hinder isolation of extracellular vesicles (e.g., exosomes or microvesicles) from a biological sample. For example, extracellular vesicles (e.g., exosomes or microvesicles) may be isolated from a biological sample using a system that utilizes multiple antibodies that are specific to the most abundant proteins found in blood. Such a system can remove up to several proteins at once, thus unveiling the lower abundance species such as cell-of-origin specific extracellular vesicles (e.g., exosomes or microvesicles).

[0221] This type of system can be used for isolation of extracellular vesicles (e.g., exosomes or microvesicles) from biological samples such as blood, cerebrospinal fluid, urine and / or saliva. The isolation of extracellular vesicles (e.g., exosomes or microvesicles) from a biological sample may also be enhanced by high abundant protein removal methods as described in Chromy et al. J. Proteome Res 2004; 3: 1120-1127. In another embodiment, the isolation of extracellular vesicles (e.g., exosomes or microvesicles) from a biological sample may also be enhanced by removing serum proteins using glycopeptide capture as described in Zhang et al, Mol Cell Proteomics 2005; 4: 144- 155. In addition, extracellular vesicles (e.g., exosome or microvesicle) from a biological sample such as urine may be isolated by differential centrifugation followed by contact with antibodies directed to cytoplasmic or anti-cytoplasmic epitopes as described in Pisitkun et al., Proc Natl Acad Sci USA, 2004; 101 : 13368-13373.Target Gene

[0222] Many different diseases and syndromes, including cancer, autoimmunity, cardiovascular disease, and obesity, can be caused by mis-regulation of gene expression. Particularly, overexpression of transcription factors (e.g., MYC) has long been known to known to contribute to tumorigenesis, and recent studies indicate that overexpressed oncogenic transcription factors can alter the core autoregulatory circuitry of the cell.

[0223] In some embodiments, the term “target gene” refers to a MYC gene that is targeted for modulation, e.g., decrease, of expression. MYC, a transcription factor and master cell regulator, is frequently dysregulated in over 50% of human cancer and plays a central role in nearly every aspect of the tumorigenic process. Except for early response genes, MYC typically upregulates gene expression. MYC is the most frequently amplified oncogene, and the elevated expression of its geneproduct is associated with tumor aggression and poor clinical outcome. Elevated levels of c-MYC can promote tumorigenesis in a wide range of tissues. Without wishing to be bound by theory, it is thought that modulating e.g., decreasing the levels of MYC in a subject (e.g., overall, or in a specific target tissue or tissues) suffering from MYC mis-regulation disorder may lessen or eliminate the symptoms of the MYC mis-regulation disorder. In some embodiments, an MYC target gene is part of a targeted genomic complex (e.g. a MYC gene that has at least part of its genomic sequence as part of a target genomic complex, e.g. inside an anchor sequence-mediated conjunction), which genomic complex is targeted by one or more site-specific epigenetic modifying agents as described herein. In some embodiments, modulation comprises inhibition of expression of the MYC gene. In some embodiments, a MYC gene is modulated by contacting the MYC gene or a transcription control element operably linked to the MYC gene with one or more site-specific epigenetic modifying agents as described herein. In some embodiments, an MYC gene is aberrantly expressed (e.g., overexpressed) in a cell, e.g., a cell in a subject (e.g., a subject having a MYC -associated disease or cancer). In some embodiments, a MYC gene is aberrantly expressed (e.g., under-expressed) in a cell, e.g., a cell in a subject (e.g., a subject having a MYC -associated disease or auto-immune disease).

[0224] In some embodiments, the term “target gene” refers to an SFRP 1 gene that is targeted for modulation, e.g., decrease, of expression. In some embodiments, an SFRP1 target gene is part of a targeted genomic complex (e.g. an SFRP1 gene that has at least part of its genomic sequence as part of a target genomic complex, e.g. inside an anchor sequence-mediated conjunction), which genomic complex is targeted by one or more site-specific epigenetic modifying agents as described herein. In some embodiments, modulation comprises inhibition of expression of the SFRP1 gene. In some embodiments, an SFRP1 gene is modulated by contacting the SFRP1 gene or a transcription control element operably linked to the SFRP 1 gene with one or more site-specific epigenetic modifying agents as described herein. In some embodiments, an SFRP1 gene is aberrantly expressed (e.g., overexpressed) in a cell, e.g., a cell in a subject (e.g., a subject having an SFRP 1 -associated disease or auto-immune disease). In some embodiments, an SFRP1 gene is aberrantly expressed (e.g., underexpressed) in a cell, e.g., a cell in a subject (e.g., a subject having an SFRP 1 -associated disease or auto-immune disease).

[0225] In some embodiment, the term “target gene” means an HNF4a gene that is targeted for modulation, e.g., decrease, of expression. In some embodiments, an HNF4a target gene is part of a targeted genomic complex (e.g. an HNF4a gene that has at least part of its genomic sequence as part of a target genomic complex, e.g. inside an anchor sequence-mediated conjunction), which genomic complex is targeted by one or more site-specific epigenetic modifying agents as described herein. In some embodiments, modulation comprises inhibition of expression of the HNF4a gene. In some embodiments, an HNF4a gene is modulated by contacting the HNF4a gene or a transcription control element operably linked to the HNF4a gene with one or more site-specific epigenetic modifying agents as described herein. In some embodiments, an HNF4a gene is aberrantly expressed (e.g., over-expressed) in a cell, e.g., a cell in a subject (e.g., a subject having an HNF4a -associated disease). In some embodiments, an HNF4a gene is aberrantly expressed (e.g., under-expressed) in a cell, e.g., a cell in a subject (e.g., a subject having an HNF4a -associated disease).

[0226] In some embodiments, the term “target gene” refers to a FOXP3 gene, for example, as a part of a targeted genomic complex (e.g. a FOXP3 gene that has at least part of its genomic sequence as part of a target genomic complex, e.g. inside an anchor sequence-mediated conjunction), which genomic complex is targeted by one or more site-specific epigenetic modifying agents as described herein. In some embodiments, modulation comprises enhancement (e.g., activation) of expression of the target gene. In some embodiments, a FOXP3 gene is modulated by contacting the FOXP3 gene or a transcription control element operably linked to the FOXP3 gene with one or more site-specific epigenetic modifying agents as described herein. In some embodiments, a FOXP3 gene is aberrantly expressed (e.g., over-expressed) in a cell, e.g., a cell in a subject (e.g., a subject having a FOXP3- associated disease or an autoimmune disease). In some embodiments, a FOXP3 gene is aberrantly expressed (e.g., under-expressed) in a cell, e.g., a cell in a subject (e.g., a subject having a FOXP3- associated disease or an autoimmune disease).

[0227] in some embodiments, the term “target gene” refers to an APOB gene that is targeted for modulation, e.g., decrease, of expression. In some embodiments, an APOB target gene is part of a targeted genomic complex (e.g. an APOB gene that has at least part of its genomic sequence as part of a target genomic complex, e.g. inside an anchor sequence-mediated conjunction), which genomic complex is targeted by one or more site-specific epigenetic modifying agents as described herein. In some embodiments, modulation comprises inhibition of expression of the APOB gene. In some embodiments, an APOB gene is modulated by contacting the APOB gene or a transcription control element operably linked to the APOB gene with one or more site-specific epigenetic modifying agents as described herein. In some embodiments, an APOB gene is aberrantly expressed (e.g., overexpressed) in a cell, e.g., a cell in a subject (e.g., a subject having an APOB-associated disease). In some embodiments, an APOB gene is aberrantly expressed (e.g., under-expressed) in a cell, e.g., a cell in a subject (e.g., a subject having an APOB-associated disease).Epigenetic Modifying Agent

[0228] The disclosure provides in part, an expression repressor comprising a targeting moiety that binds to a target gene promoter, e.g., MYC, SFRP1, HNF4a, FOXP3, or APOB promoter or operably linked to the target gene, e.g., MYC, SFRP1, HNF4a, FOXP3, or APOB gene and an effector moiety capable of modulating (e.g., decreasing or increasing) expression of the target gene, e.g., MYC, SFRP1, HNF4a, FOXP3, or APOB when localized by the targeting moiety. In some embodiments, the expression repressors disclosed herein specifically bind to an expression control element (e.g., a promoter or enhancer, repressor or silencer) operably linked to the target gene, e.g., MYC, SFRP1, HNF4a, FOXP3, or APOB via the targeting moiety and the effector moiety modulates expression ofthe target gene, e.g., MYC, SFRP1, HNF4a, F0XP3, or APOB. In some embodiments, the expression repressors disclosed herein specifically bind to an anchor sequence of an anchor sequence mediated conjunction (ASMC) comprising a target gene, e.g., MYC, SFRP1, HNF4a, FOXP3, or APOB or to a sequence proximal to the anchor sequence via the targeting moiety and the effector moiety modulates expression of the target gene, e.g., MYC, SFRP1, HNF4a, FOXP3, or APOB. In some embodiments, the expression repressors disclosed herein specifically bind to a genomic locus located in a super enhancer region of a target gene, e.g., MYC, SFRP1, HNF4a, FOXP3, or APOB and the effector moiety modulates expression of the target gene, e.g., MYC, SFRP1, HNF4a, FOXP3, or APOB.

[0229] The disclosure further provides in part, an expression repression system or expression enhancing system comprising two or more expression repressors or expression enhancers, respectively, each comprising a targeting moiety and optionally an effector moiety. In some embodiments, the targeting moieties target two or more different sequences (e.g., each expression repressor or expression enhancer may target a different sequence). In some embodiments, the first expression repressor or expression enhancer binds to a transcription regulatory element (e.g., a promoter or transcription start site (TSS)) operably linked to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB and the second expression repressor or expression enhancer binds to an anchor sequence of an anchor sequence mediated conjunction (ASMC) comprising a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, the first expression repressor or expression enhancer binds to a transcription regulatory element (e.g., a promoter or transcription start site (TSS)) operably linked to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB and the second expression repressor or expression enhancer binds to an expression control element (e.g., an enhancer, a super-enhancer, a repressor, or a silencer) operably linked to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, the first expression repressor or expression enhancer binds to an anchor sequence of an anchor sequence mediated conjunction (ASMC) comprising a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB and the second expression repressor or expression enhancer binds to an expression control element (e.g., an enhancer, a superenhancer, a repressor, or a silencer) operably linked to a target gene. Generally, modulation of expression of a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB by an expression repression or expression enhancer system involves the binding of the first expression repressor or expression enhancer and second expression repressor or expression enhancer to the first and second DNA sequences, respectively. Binding of the first and second DNA sequences localizes the functionalities of the first and second effector moieties to those sites. Without wishing to be bound by theory, in some embodiments employing the functionalities of both the first and second expressor moieties stably represses or enhances expression of a target gene associated with or comprising the first and / or second DNA sequences, e.g., wherein the first and / or second DNA sequences are or comprise sequences of the target gene or one or more operably linked transcription control elements. In some embodiments, the expression repressor or expression enhancer system is encoded by a bi-cistronic nucleic acid sequence. The disclosure further provides nucleic acids encoding said expression repressors or expression enhancers and / or expression repressor systems or expression enhancing systems, compositions comprising expression repressors or expression enhancers and / or expression repressor systems or expression enhancing systems, and methods for delivering said nucleic acids. Further provided are methods for decreasing or increasing target gene expression, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB gene expression in a cell using the expression repressors or expression enhancers and / or expression repressor systems or expression enhancing systems described herein.

[0230] Expression repressors or expression enhancers as described herein, the present disclosure in part provides expression repressors or expression enhancers for modulating, e.g., decreasing or increasing the expression of a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, an expression repressor or expression enhancer may comprise a targeting moiety that binds to a target gene promoter, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB promoter and optionally an effector moiety. In some embodiments, the targeting moiety specifically binds a target DNA sequence, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB DNA sequence, thereby localizing the expression repressor’s or expression enhancer’s functionality to the DNA sequence. In some embodiments, an expression repressor or expression enhancer comprises a targeting moiety and one effector moiety. In some embodiments an expression repressor or expression enhances comprises a targeting moiety and a plurality of effector moieties (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more effector domains (and optionally, less than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 effector domains)).

[0231] An expression repressor or expression enhancer may comprise a plurality of effector moieties, where each effector moiety comprises a different functionality than the other effector moieties. For example, an expression repressor may comprise two effector moieties, where the first effector moiety comprises DNA methylase functionality and the second effector moiety comprises a transcriptional repressor functionality. For example, an expression enhancer may comprise two effector moieties, where the first effector moiety comprises DNA demethylase functionality and the second effector moiety comprises a transcriptional enhancer functionality. In some embodiments, an expression repressor comprises effector moieties whose functionalities are complementary to one another with regard to decreasing expression of a target gene, e.g., MYC, SFRP1, APOB, or HNF4a, where the functionalities together enable inhibition of expression and, optionally, do not inhibit or negligibly inhibit expression when present individually. In some embodiments, an expression repressor comprises a plurality of effector moieties, wherein each effector moiety complements each other effector moiety, each effector moiety decreases expression of a target gene, e.g., MYC, SFRP1, APOB or HNF4a.

[0232] In some embodiments, an expression enhancer may comprise two effector moieties, where the first effector moiety comprises DNA demethylase functionality and the second effector moietycomprises a transcriptional enhancer functionality. In some embodiments, an expression enhancer comprises effector moieties whose functionalities are complementary to one another with regard to increasing expression of a target gene, e.g., FOXP3, where the functionalities together enable enhancement, e.g., activation, of expression and, optionally, do not activate or negligibly activate expression when present individually. In some embodiments, an expression enhancer comprises a plurality of effector moieties, wherein each effector moiety complements each other effector moiety, each effector moiety decreases expression of a target gene, e.g., FOXP3.

[0233] In some embodiments, an expression repressor or expression enhancer comprises one or more targeting moieties e.g., a Cas domain, TAL effector domain, or Zn Finger domain. In an embodiment, when an expression repressor system or expression enhancing system comprises two or more targeting moieties of the same type, e.g., two or more Cas domains, the targeting moieties specifically bind two or more different sequences. For example, in an expression repressor system or expression enhancing system comprising two or more Cas domains, the two or more Cas domains may be chosen or altered such that they only appreciably bind the gRNA corresponding to their target sequence (e.g., and do not appreciably bind the gRNA corresponding to the target of another Cas domain).

[0234] In some embodiments, an expression repressor or expression enhancer comprises an effector moiety wherein the effector moiety comprises a protein chosen from MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, KDM1A (i.e. LSD1), KDM1B (i.e., LSD2), KDM2A, KDM2B, KDM5A, KDM5B, KDM5C, KDM5D, KDM4B, NO66, SETDB1, SETDB2, EHMT2 (i.e., G9A), EHMT1 (i.e., GLP), SUV39H1, EZH2, EZH1, SUV39H2, SETD8, SUV420H1, SUV420H2, KRAB (e g., a KRAB domain), DME, DML2, DML3, ROS1, TET1, TET2, TET3FL, TET3s, MeCP2, HP1, RBBP4, REST, FOG1, SUZ12 or a functional variant or fragment thereof. In some embodiments, an expression repressor or expression enhancer comprises a first effector moiety and a second effector moiety, wherein the first effector moiety comprises a protein chosen from MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, KDM1A (i.e., LSD1), KDM1B (i.e., LSD2), KDM2A, KDM2B, KDM5A, KDM5B, KDM5C, KDM5D, KDM4B, NO66, SETDB1, SETDB2, EHMT2 (i.e., G9A), EHMT1 (i.e., GLP), SUV39H1, EZH2, EZH1, SUV39H2, SETD8, SUV420H1, SUV420H2, KRAB (e.g., a KRAB domain), DME, DML2, DML3, ROS1, TET1, TET2, TET3FL, TET3s, MeCP2, HP1, RBBP4, REST, FOG1, SUZ12 or a functional variant or fragment thereof, and the second effector moiety comprises a different protein chosen from MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10,HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, KDM1A (i.e., LSD1), KDM1B (i.e., LSD2), KDM2A, KDM2B, KDM5A, KDM5B, KDM5C, KDM5D, KDM4B, NO66, SETDB1, SETDB2, EHMT2 (i.e., G9A), EHMT1 (i.e., GLP), SUV39H1, EZH2, EZH1, SUV39H2, SETD8, SUV420H1, SUV420H2, KRAB (e.g., a KRAB domain), DME, DML2, DML3, ROS1, TET1, TET2, TET3FL, TET3s, MeCP2, HP1, RBBP4, REST, FOG1, SUZ12 , or a functional variant or fragment thereof.

[0235] In some embodiments, the first or second effector moiety comprises a DNA methyltransferase activity (e.g., MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L , or a functional variant or fragment of any thereof), and the other effector moiety comprises a transcription repressor activity (e.g., KRAB, MeCP2, HP1, RBBP4, REST, FOG1, SUZ12, or a functional variant or fragment of any thereof), the first or second effector moiety comprises a histone methyltransferase activity and the other effector moiety comprises a histone deacetylase activity (e.g., HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, or a functional variant or fragment of any thereof). In some embodiments, the first or second effector moiety comprises a histone methyltransferase activity and the other effector moiety comprises a DNA methyltransferase activity (e.g., MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, or a functional variant or fragment of any thereof). In some embodiments, the first or second effector moiety comprises a DNA methyltransferase activity and the other effector moiety comprises a transcription repressor activity. In some embodiments the first or second effector moiety comprises a histone methyltransferase activity and the other effector moiety comprises a transcription repressor activity (e.g., KRAB, MeCP2, HP1, RBBP4, REST, FOG1, SUZ12, or a functional variant or fragment of any thereof). In some embodiments, the first or second effector moiety comprises a transcription repressor activity and the other effector moiety comprises a different transcription repressor activity. In some embodiments, the first or second effector moiety comprises a DNA methyltransferase activity and the other effector moiety comprises the same DNA methyltransferase activity. In some embodiments, the first or second effector moiety comprises a DNA methyltransferase activity and the other effector moiety comprises a histone deacetylase activity. In some embodiments, the first or second effector moiety comprises a histone demethylase activity and the other effector moiety comprises a DNA methyltransferase activity. In some embodiments, the first or second effector moiety comprises a histone methyltransferase activity and the other effector moiety comprises a DNA demethylase activity (e.g., DME, DML2, DML3, ROS1, TET1, TET2, TET3FL, TET3s, or a functional variant or fragment of any thereof). In some embodiments, the first or second effector moiety comprises a histone demethylase activity and the other effector moiety comprises a transcription repressor activity. In some embodiments, the first or second effector moiety comprises a histone demethylase activity and the other effector moiety comprises a different histone demethylaseactivity. In some embodiments, the first or second effector moiety comprises a histone demethylase activity and the other effector moiety comprises the same histone demethylase activity. In some embodiments, the first or second effector moiety comprises a histone deacetylase activity and the other effector moiety comprises a DNA methyltransferase activity. In some embodiments, the first or second effector moiety comprises a histone deacetylase activity and the other effector moiety comprises a DNA demethylase activity. In some embodiments, the first or second effector moiety comprises a histone deacetylase activity and the other effector moiety comprises a transcription repressor activity. In some embodiments, the first or second effector moiety comprises a histone deacetylase activity and the other effector moiety comprises a different histone deacetylase activity. In some embodiments, the first or second effector moiety comprises a histone deacetylase activity and the other effector moiety comprises the same histone deacetylase activity. In some embodiments, the first or second effector moiety comprises a DNA methyltransferase activity and the other effector moiety comprises a DNA demethylase activity. In some embodiments, the first or second effector moiety comprises a DNA demethylase activity and the other effector moiety comprises a transcription repressor activity. In some embodiments, the first or second effector moiety comprises a DNA methyltransferase activity and the other effector moiety comprises a different DNA methyltransferase activity. In some embodiments, the first or second effector moiety comprises a DNA methyltransferase activity and the other effector moiety comprises the same DNA methyltransferase activity. In some embodiments, the first or second effector moiety comprises a DNA demethylase activity and the other effector moiety comprises a transcription repressor activity. In some embodiments, the first or second effector moiety comprises a DNA demethylase activity and the other effector moiety comprises a different DNA demethylase activity. In some embodiments, the first or second effector moiety comprises a DNA demethylase activity and the other effector moiety comprises the same DNA demethylase activity. In some embodiments, the first or second effector moiety comprises a transcription repressor activity and the other effector moiety comprises a different transcription repressor activity. In some embodiments, the first or second effector moiety comprises a transcription repressor activity and the other effector moiety comprises the same transcription repressor activity.Targeting Moieties

[0236] The present disclosure provides, e.g., expression repressors or expression enhancers comprising a targeting moiety that specifically targets, e.g., binds, a genomic sequence element (e.g., a promoter, a TSS, or an anchor sequence) in, proximal to, and / or operably linked to a target gene. Targeting moieties may specifically bind a DNA sequence, e.g., a DNA sequence associated with a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. Any molecule or compound that specifically binds a DNA sequence may be used as a targeting moiety. In some embodiments, a targeting moiety targets, e.g., binds, a component of a genomic complex (e.g., ASMC). In someembodiments, a targeting moiety targets, e.g., binds, an expression control sequence (e.g., a promoter or enhancer) operably linked to a target gene. In some embodiments, a targeting moiety targets, e.g., binds, a target gene or a part of a target gene. The target of a targeting moiety may be referred to as its targeted component. A targeted component may be any genomic sequence element operably linked to a target gene, or the target gene itself, including but not limited to a promoter, enhancer, anchor sequence, exon, intron, UTR encoding sequence, a splice site, or a transcription start site. In some embodiments, a targeting moiety binds specifically to one or more target anchor sequences (e.g., within a cell) and not to non-targeted anchor sequences (e.g., within the same cell).

[0237] In some embodiments, a targeting moiety may be or comprise a CRISPR / Cas domain, a TAL effector domain, a Zn finger domain, peptide nucleic acid (PNA) or a nucleic acid molecule.

[0238] An expression repressor or expression enhancer or a system comprising an expressor as disclosed herein, may comprise nucleic acid, e.g., one or more nucleic acids. The term “nucleic acid" refers to any compound that is or can be incorporated into an oligonucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester linkage. As will be clear from context, in some embodiments, “nucleic acid” refers to an individual nucleic acid residue (e.g., a nucleotide and / or nucleoside); in some embodiments, “nucleic acid” refers to an oligonucleotide chain comprising individual nucleic acid residues. In some embodiments, a “nucleic acid” is or comprises RNA; in some embodiments, a “nucleic acid” is or comprises DNA. In some embodiments, a nucleic acid is or comprises more than 50% ribonucleotides and is referred to herein as a ribonucleic acid (RNA).

[0239] In some embodiments, the targeting moiety comprises or is a nucleic acid sequence, a protein, protein fusion, or a membrane translocating polypeptide. In some embodiments, the targeting moiety is selected from an exogenous conjunction nucleating molecule, a nucleic acid encoding the conjunction nucleating molecule, or a fusion of a sequence targeting polypeptide and a conjunction nucleating molecule. The conjunction nucleating molecule may be, e.g., CTCF, cohesin, USF1, YY1, TATA-box binding protein associated factor 3 (TAF3), ZNF143 binding motif. In some embodiments, a targeting moiety comprises or is a polymer or polymeric moiety, e.g., a polymer of nucleotides (such as an oligonucleotide), a peptide nucleic acid, a peptide-nucleic acid mixmer, a peptide or polypeptide, a polyamide, a carbohydrate, etc. In some embodiments, a targeting moiety comprises or is nucleic acid. In some embodiments, an effector moiety comprises or is nucleic acid. In some embodiments, a nucleic acid that may be included in a moiety may be or comprise DNA, RNA, and / or an artificial or synthetic nucleic acid or nucleic acid analog or mimic. For example, in some embodiments, a nucleic acid may be or include one or more of genomic DNA (gDNA), complementary DNA (cDNA), a peptide nucleic acid (PNA), a peptide-nucleic acid mixmer, a peptide- oligonucleotide conjugate, a locked nucleic acid (LNA), a bridged nucleic acid (BNA), a polyamide, a triplex- forming oligonucleotide, an antisense oligonucleotide, tRNA, mRNA, rRNA, miRNA, gRNA, siRNA or other RNAi molecule (e.g., that targets a non-coding RNA as describedherein and / or that targets an expression product of a particular gene associated with a targeted genomic complex as described herein), etc. A nucleic acid sequence suitable for use in a modulating agent may include modified oligonucleotides (e.g., chemical modifications, such as modifications that alter backbone linkages, sugar molecules, and / or nucleic acid bases) and / or artificial nucleic acids. In some embodiments, a nucleic acid sequence includes, but is not limited to, genomic DNA, cDNA, peptide nucleic acids (PNA) or peptide oligonucleotide conjugates, locked nucleic acids (LNA), bridged nucleic acids (BNA), polyamides, triplex forming oligonucleotides, modified DNA, antisense DNA oligonucleotides, tRNA, mRNA, rRNA, modified RNA, miRNA, gRNA, and siRNA or other RNA or DNA molecules. In some embodiments, a nucleic acid may include one or more residues that is not a naturally-occurring DNA or RNA residue, may include one or more linkages that is / are not phosphodiester bonds (e.g., that may be, for example, phosphorothioate bonds, etc.), and / or may include one or more modifications such as, for example, a 2’0 modification such as 2’-OmeP. A variety of nucleic acid structures useful in preparing synthetic nucleic acids is known in the art (see, for example, WO20 17 / 0628621 and W02014 / 012081) those skilled in the art will appreciate that these may be utilized in accordance with the present disclosure.

[0240] Some examples of nucleic acids include, but are not limited to, a nucleic acid that hybridizes to an target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB, (e.g., gRNA or antisense ssDNA as described herein elsewhere), a nucleic acid that hybridizes to an exogenous nucleic acid such as a viral DNA or RNA, nucleic acid that hybridizes to an RNA, a nucleic acid that interferes with gene transcription, a nucleic acid that interferes with RNA translation, a nucleic acid that stabilizes RNA or destabilizes RNA such as through targeting for degradation, a nucleic acid that interferes with a DNA or RNA binding factor through interference of its expression or its function, a nucleic acid that is linked to a intracellular protein or protein complex and modulates its function, etc. In some embodiments, an expression repressor comprises one or more nucleoside analogs. In some embodiments, a nucleic acid sequence may include in addition or as an alternative to one or more natural nucleosides, e.g., purines or pyrimidines, e.g., adenine, cytosine, guanine, thymine and uracil, one or more nucleoside analogs. In some embodiments, a nucleic acid sequence includes one or more nucleoside analogs. A nucleoside analog may include, but is not limited to, a nucleoside analog, such as 5 -fluorouracil; 5 -bromouracil, 5 -chlorouracil, 5 -iodouracil, hypoxanthine, xanthine, 4- acetylcytosine, 4-methylbenzimidazole, 5 -(carboxyhydroxylmethyl) uracil, 5- carboxymethylaminomethyl-2 -thiouridine, 5 -carboxymethylaminomethyluracil, dihydrouracil, dihydrouridine, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1- methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3 -methylcytosine, 5- methylcytosine, N6-adenine, 7-methyIguanine, 5 -methylaminomethyluracil, 5-methoxyaminomethyl- 2- thiouracil, beta-D-mannosylqueosine, 5 ’-methoxy carboxymethyluracil, 5 -methoxyuracil, 2- methylthio- N6-isopentenyladenine, uracil-5 -oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2- thiocytosine, 5 -methyl-2 -thiouracil, 2-thiouracil, 4-thiouracil, 5 -methyluracil, uracil-5-oxyacetic acid methylester, uracil-5 -oxyacetic acid (v), 5 -methyl -2 -thiouracil, 3-(3-amino-3-N-2- carboxypropyl) uracil, (acp3)w, 2,6-diaminopurine, 3 -nitropyrrole, inosine, thiouridine, queuosine, wyosine, diaminopurine, isoguanine, isocytosine, diaminopyrimidine, 2,4-difluorotoluene, isoquinoline, pyrrolo[2,3-P]pyridine, and any others that can base pair with a purine or a pyrimidine side chain.CRISPR / Cas Domains

[0241] In some embodiments, a targeting moiety is or comprises a CRISPR / Cas domain. A CRISPR / Cas protein can comprise a CRISPR / Cas effector and optionally one or more other domains. A CRISPR / Cas domain typically has structural and / or functional similarity to a protein involved in the clustered regulatory interspaced short palindromic repeat (CRISPR) system, e.g., a Cas protein. The CRISPR / Cas domain optionally comprises a guide RNA, e.g., single guide RNA (sgRNA). In some embodiments, the gRNA comprised by the CRISPR / Cas domain is noncovalently bound by the CRISPR / Cas domain.

[0242] In some embodiments, a Cas protein requires a protospacer adjacent motif (PAM) to be present in or adjacent to a target DNA sequence for the Cas protein to bind and / or function. In some embodiments, the PAM is or comprises, from 5’ to 3’, NGG, YG, NNGRRT, NNNRRT, NGA, TYCV, TATV, NTTN, or NNNGATT, where N stands for any nucleotide, Y stands for C or T, R stands for A or G, and V stands for A or C or G. In some embodiments, a Cas protein is a protein listed in Table 3. In some embodiments, a Cas protein comprises one or more mutations altering its PAM. In some embodiments, a Cas protein comprises E1369R, E1449H, and R1556A mutations or analogous substitutions to the amino acids corresponding to said positions. In some embodiments, a Cas protein comprises E782K, N968K, and R1015H mutations or analogous substitutions to the amino acids corresponding to said positions. In some embodiments, a Cas protein comprises DI 135V, R1335Q, and T1337R mutations or analogous substitutions to the amino acids corresponding to said positions. In some embodiments, a Cas protein comprises S542R and K607R mutations or analogous substitutions to the amino acids corresponding to said positions. In some embodiments, a Cas protein comprises S542R, K548V, and N552R mutations or analogous substitutions to the amino acids corresponding to said positions.Table 3

[0243] In some embodiments, the Cas protein is modified to deactivate the nuclease, e.g., nuclease- deficient Cas. In some embodiments, the Cas protein is a Cas9 protein. Whereas wild-type Cas9 generates double-strand breaks (DSBs) at specific DNA sequences targeted by a gRNA, a number of CRISPR endonucleases having modified functionalities are available, for example: a “nickase” version of Cas9 generates only a single-strand break; a catalytically inactive Cas9 (“dCas9”) does not cut target DNA. In some embodiments, dCas binding to a DNA sequence may interfere with transcription at that site by steric hindrance. In some embodiments, a DNA-targeting moiety is or comprises a catalytically inactive Cas, e.g., dCas. Many catalytically inactive Cas proteins are known in the art. In some embodiments, dCas9 comprises mutations in each endonuclease domain of the Cas protein, e.g., D10A and H840A mutations. In some embodiments, a catalytically inactive Cas9 protein, e.g., dCas9, comprises DI 1A, H969A, and / or N995A mutations or analogous substitutions to the amino acids corresponding to said positions. In some embodiments, a catalytically inactive Cas9 protein, e.g., dCas9, comprises D10A and / or H557A mutations or analogous substitutions to the amino acids corresponding to said positions. In some embodiments, a catalytically inactive Cas9 protein, e.g., dCas9, comprises D10A, D839A, H840A, and / or N863A mutations or analogous substitutions to the amino acids corresponding to said positions. In some embodiments, a catalytically inactive Cas9 protein, e.g., dCas9, comprises a E993A mutation or an analogous substitution to the amino acid corresponding to said position. In some embodiments, a catalytically inactive Cas9 protein, e.g., dCas9, comprises D917A, E1006A, and / or D1255A mutations or analogous substitutionsto the amino acids corresponding to said positions, n some embodiments, a catalytically inactive Cas9 protein, e.g., dCas9, comprises D16A, D587A, H588A, and / or N611A mutations or analogous substitutions to the amino acids corresponding to said positions.

[0244] In another aspect, the disclosure is directed to an expression repressor or a polypeptide comprising one or more (e.g., one) targeting moiety and one or more effector moiety, wherein the one or more targeting moiety is or comprises a CRISPR / Cas domain comprising a Cas protein, e.g., catalytically inactive Cas9 protein, e.g., dCas9, or a functional variant or fragment thereof. In some embodiments, dCas9 comprises an amino acid sequence of SEQ ID NO: 17. In some embodiments, the dCas9 is encoded by a nucleic acid sequence of SEQ ID NO: 50. In some embodiments, the dCas9 is encoded by a nucleic acid sequence of SEQ ID NO: 207. In some embodiments, the dCas9 is encoded by a nucleic acid sequence of SEQ ID NO: 208:Table 4

[0245] In some embodiments, a targeting moiety may comprise a Cas domain comprising or linked (e.g., covalently) to a gRNA. A gRNA is a short synthetic RNA composed of a “scaffold” sequence necessary for Cas-protein binding and a user-defined ~20 nucleotide targeting sequence for a genomic target. In practice, guide RNA sequences are generally designed to have a length of between 17 - 24 nucleotides (e.g., 19, 20, or 21 nucleotides) and be complementary to the targeted nucleic acid sequence. Custom gRNA generators and algorithms are available commercially for use in the design of effective guide RNAs. Gene editing has also been achieved using a chimeric “single guide RNA” (“sgRNA”), an engineered (synthetic) single RNA molecule that mimics a naturally occurring crRNA-tracrRNA complex and contains both a tracrRNA (for binding the nuclease) and at least one crRNA (to guide the nuclease to the sequence targeted for editing). Chemically modified sgRNAs have also been demonstrated to be effective for use with Cas proteins; see, for example, Hendel et al. (2015) Nature Biotechnology, 985 - 991. The exemplary guide RNA sequences are disclosed in Table 5 and Table 6.

[0246] In some embodiments, a gRNA comprises a nucleic acid sequence that is complementary to a DNA sequence associated with a target gene. In some embodiments, the DNA sequence is, comprises, or overlaps an expression control element that is operably linked to the target gene. In some embodiments, a gRNA comprises a nucleic acid sequence that is at least 90, 95, 99, or 100% complementary to a DNA sequence associated with a target gene. In some embodiments, a gRNA for use with a DNA-targeting moiety that comprises a Cas molecule is an sgRNA.

[0247] In some embodiments, a gRNA for use with a CRISPR / Cas domain specifically binds a target sequence associated with CTCF. In some embodiments, a gRNA for use with a CRISPR / Cas domain specifically binds a target sequence associated with the promoter. In some embodiments, the gRNA binds a target sequence listed in Table 5 or Table 6. In some embodiments, an expression repressor described herein binds to a target sequence listed in Table 5 or Table 6.Table 5: Exemplary gRNA sequencesTable 6: Exemplary gRNA sequencesTAL Effector domains

[0248] In some embodiments, a DNA-targeting moiety is or comprises a TAL effector domain. A TAL effector domain, e.g., a TAL effector domain that specifically binds a DNA sequence, comprises a plurality of TAL effector repeats or fragments thereof, and optionally one or more additional portions of naturally occurring TAL effector repeats (e.g., N- and / or C-terminal of the plurality of TAL effector domains) wherein each TAL effector repeat recognizes a nucleotide. A TAL effectorprotein can comprise a TAL effector domain and optionally one or more other domains. Many TAL effector domains are known to those of skill in the art and are commercially available, e.g., from Thermo Fisher Scientific.

[0249] TALEs are natural effector proteins secreted by numerous species of bacterial pathogens including the plant pathogen Xanthomonas which modulates gene expression in host plants and facilitates bacterial colonization and survival. The specific binding of TAL effectors is based on a central repeat domain of tandemly arranged nearly identical repeats of typically 33 or 34 amino acids (the repeat variable di-residues, RVD domain).

[0250] Repeat to repeat variations occur predominantly at amino acid positions 12 and 13, which have therefore been termed “hypervariable” and which are responsible for the specificity of the interaction with the target DNA promoter sequence, as shown in Table 7 listing exemplary repeat variable di-residues (RVD) and their correspondence to nucleic acid base targets.Table 7- RVDs and Nucleic Acid Base Specificity

[0251] Accordingly, it is possible to modify the repeats of a TAL effector to target specific DNA sequences. Further studies have shown that the RVD NK can target G. Target sites of TAL effectors also tend to include a T flanking the 5' base targeted by the first repeat, but the exact mechanism of this recognition is not known. More than 113 TAL effector sequences are known to date. Non-limiting examples of TAL effectors from Xanthomonas include, Hax2, Hax3, Hax4, AvrXa7, AvrXalO and AvrBs3.

[0252] In some embodiments, the TAL effector domain comprises TAL effector repeats that correspond to a perfect match to the DNA target sequence. In some embodiments, a mismatch between a repeat and a target base-pair on the DNA target sequence is permitted as along as it allows for the function of the expression repression system, e.g., the expression repressor comprising the TAL effector domain. In general, TALE binding is inversely correlated with the number of mismatches. In some embodiments, the TAL effector domain of an expression repressor of the present disclosure comprises no more than 7 mismatches, 6 mismatches, 5 mismatches, 4 mismatches, 3 mismatches, 2 mismatches, or 1 mismatch, and optionally no mismatch, with the target DNA sequence. Without wishing to be bound by theory, in general the smaller the number of TAL effectorrepeats in the TAL effector domain, the smaller the number of mismatches will be tolerated and still allow for the function of the expression repression system, e.g., the expression repressor comprising the TAL effector domain. The binding affinity is thought to depend on the sum of matching repeat- DNA combinations. For example, TAL effector domains having 25 TAL effector repeats or more may be able to tolerate up to 7 mismatches.Zn finger domains

[0253] In some embodiments, a DNA-targeting moiety is or comprises a Zn finger domain. A Zn finger domain comprises a Zn finger, e.g., a naturally occurring Zn finger or engineered Zn finger, or fragment thereof. Many Zn fingers are known to those of skill in the art and are commercially available, e.g., from Sigma-Aldrich. Generally, a Zn finger domain comprises a plurality of Zn fingers, wherein each Zn finger recognizes three nucleotides. A Zn finger protein can comprise a Zn finger domain and optionally one or more other domains.

[0254] In some embodiments, a Zn finger molecule comprises a non-naturally occurring Zn finger protein that is engineered to bind to a target DNA sequence of choice. See, for example, Beerli, et al. (2002) Nature Biotechnol. 20: 135-141; Pabo, et al. (2001) Ann. Rev. Biochem. 70:313-340; Isalan, et al. (2001) Nature Biotechnol. 19:656-660; Segal, et al. (2001) Curr. Opin. Biotechnol. 12:632-637; Choo, et al. (2000) Curr. Opin. Struct. Biol. 10:411-416; U.S. Pat. Nos. 6,453,242; 6,534,261; 6,599,692; 6,503,717; 6,689,558; 7,030,215; 6,794,136; 7,067,317; 7,262,054; 7,070,934; 7,361,635; 7,253,273; and U.S. Patent Publication Nos. 2005 / 0064474; 2007 / 0218528; 2005 / 0267061, all incorporated herein by reference in their entireties.

[0255] An engineered Zn finger may have a novel binding specificity, compared to a naturally- occurring Zn finger. Engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, using databases comprising triplet (or quadruplet) nucleotide sequences and individual Zn finger amino acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers which bind the particular triplet or quadruplet sequence. See, for example, U.S. Pat. Nos. 6,453,242 and 6,534,261, incorporated by reference herein in their entireties.

[0256] In some embodiments, an expression repressor or expression enhancer comprises a targeting moiety comprising an engineered DNA binding domain (DBD), e.g., a Zn finger domain comprising a Zn finger (ZFN) that binds to a target sequence, e.g., a promoter or transcription start site (TSS)) sequence operably linked to a target gene (e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB), e.g., a sequence proximal to the transcription regulatory element, e.g., an anchor sequence of an anchor sequence mediated conjunction (ASMC) comprising a target gene (e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB), e.g., a sequence proximal to the anchor sequence. In some embodiments, the ZFN can be engineered to carry epigenetic effector molecules to target sites. In some embodiments, the targeting moiety comprises a Zn Finger domain that comprises 2, 3, 4, 5, 6, 7, or 8 zinc fingers. The amino acid sequences of exemplary targeting moieties disclosed herein are listed in Table 6. Thenucleotide sequences encoding exemplary targeting moieties disclosed herein are listed in Table 9. In some embodiments, an expression repressor or system described herein comprises a targeting moiety having a sequence set forth in Table 8, or a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity thereto. In some embodiments, a nucleic acid described herein comprises a sequence set forth in Table 9, or a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.Table 8: Amino acid sequences of exemplary targeting moietiesTable 9: Nucleotide sequences of exemplary targeting moieties

[0257] In some embodiments, an expression repression or expression enhancer comprises a targeting moiety comprising an engineered DNA binding domain (DBD), e.g., a Zn finger domain comprising a Zn finger (ZFN) that binds to a target sequence, e.g., a promoter or transcription start site (TSS)) sequence operably linked to a target gene (e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB), e.g., a sequence proximal to the transcription regulatory element, e.g., an anchor sequence of an anchor sequence mediated conjunction (ASMC) comprising a target gene (e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB), e.g., a sequence proximal to the anchor sequence in mouse genome. In some embodiments, the ZFN can be engineered to carry epigenetic effector molecules to target sites. In some embodiments, the targeting moiety comprises a Zn Finger domain that comprises 2, 3, 4, 5, 6, 7, or 8 zinc fingers. The amino acid sequences of exemplary targeting moieties disclosed herein are listed in Table 10. The nucleotide sequences encoding exemplary targeting moieties disclosed herein are listed in Table 11. In some embodiments, an expression repressor or system described herein comprises a targeting moiety having a sequence set forth in Table 10, or a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity thereto. In some embodiments, a nucleic acid described herein comprises a sequence set forth in Table 11, or a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.Table 10: Amino acid sequences of exemplary mouse-specific targeting moietiesTable 11: Nucleotide sequences of exemplary mouse-specific targeting moieties

[0258] In some embodiments, a DNA-targeting moiety comprises or is nucleic acid. In some embodiments, a nucleic acid that may be included in a DNA-targeting moiety, may be or comprise DNA, RNA, and / or an artificial or synthetic nucleic acid or nucleic acid analog or mimic. For example, in some embodiments, a nucleic acid may be or include one or more of genomic DNA (gDNA), complementary DNA (cDNA), a peptide nucleic acid (PNA), a peptide- oligonucleotide conjugate, a locked nucleic acid (LNA), a bridged nucleic acid (BNA), a polyamide, a triplex-forming oligonucleotide, an antisense oligonucleotide, tRNA, mRNA, rRNA, miRNA, gRNA, siRNA or other RNAi molecule (e.g., that targets a non-coding RNA as described herein and / or that targets an expression product of a particular gene associated with a targeted genomic complex as described herein), etc. In some embodiments, a nucleic acid may include one or more residues that is not a naturally-occurring DNA or RNA residue, may include one or more linkages that is / are not phosphodiester bonds (e.g., that may be, for example, phosphorothioate bonds, etc.), and / or may include one or more modifications such as, for example, a 2’0 modification such as 2’-OmeP. A variety of nucleic acid structures useful in preparing synthetic nucleic acids is known in the art (see, for example, WO2017 / 0628621 and W02014 / 012081) those skilled in the art will appreciate that these may be utilized in accordance with the present disclosure.

[0259] A nucleic acid suitable for use in an expression repressor or expression enhancer, e.g., in the DNA-targeting moiety, may include, but is not limited to, DNA, RNA, modified oligonucleotides (e.g., chemical modifications, such as modifications that alter backbone linkages, sugar molecules, and / or nucleic acid bases), and artificial nucleic acids. In some embodiments, a nucleic acid includes, but is not limited to, genomic DNA, cDNA, peptide nucleic acids (PNA) or peptide oligonucleotide conjugates, locked nucleic acids (LNA), bridged nucleic acids (BNA), polyamides, triplex forming oligonucleotides, modified DNA, antisense DNA oligonucleotides, tRNA, mRNA, rRNA, modified RNA, miRNA, gRNA, and siRNA or other RNA or DNA molecules.Effector moieties

[0260] In some embodiments, expression repressors of the present disclosure comprise one or more effector moieties. In some embodiments, an effector moiety, when used as part of an expressor repressor or an expression repression system described herein, decreases expression of a target gene in a cell.

[0261] In some embodiments, the effector moiety has functionality unrelated to the binding of the targeting moiety. For example, effector moieties may target, e.g., bind, a genomic sequence element or genomic complex component proximal to the genomic sequence element targeted by the targeting moiety or recruit a transcription factor. As a further example, an effector moiety may comprise an enzymatic activity, e.g., a genetic modification functionality.

[0262] In some embodiments, an effector moiety comprises an epigenetic modifying moiety. In some embodiments, an effector moiety comprises a DNA modifying functionality. In certain embodiments, the effector moiety comprises a DNA methyltransferase, for example, MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, or a functional variant or fragment of any thereof.

[0263] In other embodiments, the effector moiety comprises a DNA demethylase, for example, DME, DML2, DML3, ROS1, TET1, TET2, TET3FL, TET3s, or a functional variant or fragment of any thereof.

[0264] In some embodiments, an effector moiety comprises a transcription repressor. In some embodiments the transcription repressor blocks recruitment of a factor that stimulates or promotes transcription, e.g., of the target gene. In some embodiments, the transcription repressor recruits a factor that inhibits transcription, e.g., of the target gene. In some embodiments, an effector moiety, e.g., transcription repressor, is or comprises a protein chosen from KRAB, MeCP2, HP1, RBBP4, REST, FOG1, SUZ12, or a functional variant or fragment of any thereof.

[0265] In some embodiments an effector moiety promotes epigenetic modification, e.g., directly or indirectly. For example, an effector moiety can indirectly promote epigenetic modification by recruiting an endogenous protein that epigenetically modifies the chromatin. An effector moiety can directly promote epigenetic modification by catalyzing epigenetic modification, wherein the effector moiety comprises enzymatic activity and directly places an epigenetic mark on the chromatin.

[0266] In some embodiments, an effector moiety comprises a histone modifying functionality, e.g., a histone methyltransferase, histone demethylase, or histone deacetylase activity. In some embodiments, a effector moiety is or comprises a protein chosen from KDM1A (i.e., LSD1), KDM1B (i.e., LSD2), KDM2A, KDM2B, KDM5A, KDM5B, KDM5C, KDM5D, KDM4B, NO66, or a functional variant or fragment of any thereof. In some embodiments, a effector moiety is or comprises a protein chosen from HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, or a functional variant or fragment of any thereof.

[0267] In some embodiments, an effector moiety comprises a protein having a functionality described herein. In some embodiments, an effector moiety is or comprises a protein selected from: KRAB (e.g., as according to NP_056209.2 or the protein encoded by NM_015394.5); a SET domain (e.g., the SET domain of: SETDB1 (e.g., as according to NP 001353347. 1 or the protein encoded by NM_001366418. 1); EZH2 (e.g., as according to NP-004447.2 or the protein encoded by NM_004456.5); G9A (e.g., as according to NP_001350618.1 or the protein encoded by NM_001363689. 1); or SUV39H1 (e.g., as according to NP_003164. 1 or the protein encoded by NM_003173.4)); histone demethylase LSD1 (e.g., as according to NP 055828.2 or the protein encoded by NM 015013.4); FOG1 (e.g., the N- terminal residues of FOG1) (e.g., as according to NP_722520.2 or the protein encoded by NM_153813.3); or KAP1 (e.g., as according to NP_005753.1 or the protein encoded by NM_005762.3); a functional fragment or variant of any thereof, or a polypeptide with a sequence that has at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity to any of the above-referenced sequences.

[0268] In some embodiments, a effector moiety is or comprises a protein selected from: DNMT3A (e.g., human DNMT3A) (e.g., as according to NP_072046.2 or the protein encoded by NM_022552.4); DNMT3B (e.g., as according to NP 008823. 1 or the protein encoded by NM_006892.4); DNMT3L (e.g., as according to NP_787063. 1 or the protein encoded by NM_175867.3); DNMT3A / 3L complex, bacterial MQ1 (e.g., as according to CAA35058.1 orP 15840.3); a functional fragment of any thereof, or a polypeptide with a sequence that has at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity to any of the above-referenced sequences.

[0269] In another aspect, the disclosure is directed to an expression repressor or a polypeptide comprising one or more (e.g., one) targeting moiety and one or more effector moiety, wherein the one or more effector moiety is or comprises Krueppel-associated box (KRAB) e.g., as according to NP_056209.2 or the protein encoded by NM_015394.5 or a functional variant or fragment thereof. In some embodiments, KRAB is a synthetic KRAB construct. In some embodiments, KRAB comprises an amino acid sequence of SEQ ID NO: 18.

[0270] In some embodiments, the KRAB effector moiety is encoded by a nucleotide sequence of SEQ ID NO: 51. In some embodiments, a nucleotide sequence described herein comprises a sequence of SEQ ID NO: 51 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.

[0271] In some embodiments, KRAB for use in a polypeptide or an expression repressor described herein is a variant, e.g., comprising one or more mutations, relative to the KRAB sequence of SEQ ID NO: 18. In some embodiments, an KRAB variant comprises one or more amino acid substitutions, deletions, or insertions relative to SEQ ID NO: 18.Table 12

[0272] In some embodiments, the polypeptide or the expression repressor is a fusion protein comprising a effector moiety that is or comprises KRAB and a DNA-targeting moiety. In some embodiments, the targeting moiety is or comprises a zinc finger domain, TAL domain, or CRISPR / Cas domain, e.g., comprising a CRISPR / Cas protein, e.g., a dCas9 protein. In some embodiments, the polypeptide or the expression repressor comprises an additional moiety described herein. In some embodiments, the polypeptide or the expression repressor decreases expression of a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, the polypeptide or the expression repressor may be used in methods of modulating, e.g., decreasing, gene expression, methods of treating a condition, or methods of epigenetically modifying a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB or transcription control element described herein, e.g., in place of an expression repression system. In some embodiments, an expression repression system comprises two or more (e.g., two, three, or four) expression repressors, wherein the first expression repressorcomprises an effector moiety comprising the KRAB sequence of SEQ ID NO: 18, or a functional variant or fragment thereof.

[0273] In another aspect, the disclosure is directed to an expression repressor or a polypeptide comprising one or more (e.g., one) targeting moiety and one or more effector moiety, wherein the one or more effector moiety is or comprises MQ1, e.g., bacterial MQ1, or a functional variant or fragment thereof. In some embodiments, MQ 1 is Mollicutes spiroplasma MQ 1. In some embodiments, MQ 1 is Spiroplasma monobiae MQ1. In some embodiments, MQ1 is MQ1 from strain ATCC 33825 and / or corresponding to Uniprot ID P 15840. In some embodiments, MQ1 comprises an amino acid sequence of SEQ ID NO: 19 (Table 13). In some embodiments, MQ1 comprises an amino acid sequence of SEQ ID NO: 87 (Table 13). In some embodiments, an effector domain described herein comprises SEQ ID NO: 19 or 87, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.

[0274] In some embodiments, MQ1 is encoded by a nucleotide sequence of SEQ ID NO: 52 or 132 (Table 13). In some embodiments, a nucleic acid described herein comprises a sequence of SEQ ID NO: 52, 132 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.Table 13

[0275] In some embodiments, MQ1 for use in a polypeptide or an expression repressor described herein is a variant, e.g., comprising one or more mutations, relative to a wild type MQ1 (e.g., SEQ ID NO: 19). In some embodiments, an MQ1 variant comprises one or more amino acid substitutions, deletions, or insertions relative to a wild type MQ1, e.g., the MQ1 of SEQ ID NO: 19. In some embodiments, an MQ 1 variant comprises a K297P substitution. In some embodiments, an MQ 1 variant comprises a N299C substitution. In some embodiments, an MQ1 variant comprises a E301 Y substitution. In some embodiments, an MQ1 variant comprises a Q147L substitution (e.g., and has reduced DNA methyltransferase activity relative to wild type MQ1). In some embodiments, an MQ1 variant comprises K297P, N299C, and E301Y substitutions (e.g., and has reduced DNA binding affinity relative to wild type MQ1). In some embodiments, an MQ1 variant comprises Q147L, K297P, N299C, and E301Y substitutions (e.g., and has reduced DNA methyltransferase activity and DNA binding affinity relative to wild type MQ1).

[0276] In some embodiments, the polypeptide or the expression repressor is a fusion protein comprising an effector moiety that is or comprises MQ 1 and a targeting moiety is or comprises a zinc finger domain, TAL domain, or CRISPR / Cas domain, a dCas9 domain. In some embodiments, the polypeptide or the expression repressor comprises an additional moiety described herein. In some embodiments, the polypeptide or the expression repressor decreases expression of a target gene, e.g., MYC. In some embodiments, the polypeptide or the expression repressor may be used in methods of modulating, e.g., decreasing, gene expression, methods of treating a condition, or methods ofepigenetically modifying a target gene, e.g., MYC or transcription control element described herein, e.g., in place of an expression repression system. In some embodiments, an expression repression system comprises two or more (e.g., two, three, or four) expression repressors, wherein the first expression repressor comprises an effector moiety comprising MQ1, e.g., bacterial MQ1, or a functional variant or fragment thereof. In another aspect, the disclosure is directed to an expression repressor or a polypeptide comprising one or more (e.g., one) targeting moiety and one or more effector moiety, wherein the one or more effector moiety is or comprises DNMT1, e.g., human DNMT1, or a functional variant or fragment thereof. In some embodiments, DNMT1 is human DNMT1, e.g., corresponding to Gene ID 1786, e.g., corresponding to UniProt ID P26358.2. In some embodiments, DNMT1 comprises an amino acid sequence of SEQ ID NO: 20 (Table 12). In some embodiments, an effector domain described herein comprises a sequence according to SEQ ID NO: 20 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.

[0277] In some embodiments, DNMT1 is encoded by a nucleotide sequence of SEQ ID NO: 53 (Table 14). In some embodiments, a nucleic acid described herein comprises a sequence of SEQ IDNO: 53 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.Table 14

[0278] In some embodiments, DNMT1 for use in a polypeptide or an expression repressor described herein is a variant, e.g., comprising one or more mutations, relative to a DNMT sequence of SEQ ID NO: 20. In some embodiments, the effector domain comprises one or more amino acid substitutions, deletions, or insertions relative to wild type DNMT1. In some embodiments, the polypeptide is a fusion protein comprising a repressor domain that is or comprises DNMT1 and a targeting moiety. In some embodiments, the targeting moiety is or comprises a zinc finger domain, TAL domain, or CRISPR / Cas domain, e.g., a dCas9 domain. In some embodiments, an expression repression system comprises two or more (e.g., two, three, or four) expression repressors, wherein the first expression repressor comprises an effector moiety comprising DNMT1, or a functional variant or fragment thereof.

[0279] In another aspect, the disclosure is directed to an expression repressor or a polypeptide comprising one or more (e.g., one) targeting moiety and one or more effector moiety, wherein the one or more effector moiety is or comprises DNMT3a / 3L complex, or a functional variant or fragment thereof. In some embodiments, the DNMT3a / 3L complex fusion construct. In some embodiments the DNMT3a / 3L complex comprises DNMT3A (e.g., human DNMT3A) (e.g., as according to NP_072046.2 or the protein encoded by NM_022552.4). In some embodiments the DNMT3a / 3L complex comprises DNMT3L (e.g., as according to NP_787063. 1 or the protein encoded by NM_175867.3). In some embodiments, DNMT3a / 3L comprises an amino acid sequence of SEQ ID NO: 21 or SEQ ID NO: 114 (Table 13). In some embodiments, an effector domain described herein comprises SEQ ID NO: 21 or SEQ ID NO: 114, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.

[0280] In some embodiments, DNMT3a / 3L is encoded by a nucleotide sequence of SEQ ID NO: 54 (Table 15). In some embodiments, a nucleic acid described herein comprises a sequence of SEQ ID NO: 54 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.Table 15

[0281] In some embodiments, DNMT3a / 3L for use in a polypeptide or an expression repressor described herein is a variant, e.g., comprising one or more mutations, relative to the DNMT3a / 3L of SEQ ID NO: 21 or SEQ ID NO: 114. In some embodiments, an DNMT3a / 3L variant comprises one or more amino acid substitutions, deletions, or insertions relative to SEQ ID NO: 21 or SEQ ID NO: 114. In some embodiments, the polypeptide or the expression repressor is a fusion protein comprising an effector moiety that is or comprises DNMT3a / 3L and a targeting moiety. In some embodiments, the targeting moiety is or comprises a zinc finger domain, TAL domain, or CRISPR / Cas domain e.g., a dCas9 domain. In some embodiments, an expression repression system comprises two or more (e.g., two, three, or four) expression repressors, wherein the first expression repressor comprises an effector moiety comprising DNMT3a / 3L, or a functional variant or fragment thereof.

[0282] In some embodiments, an effector moiety is or comprises a polypeptide. In some embodiments, an effector moiety is or comprises a nucleic acid. In some embodiments, an effectormoiety is a chemical, e.g., a chemical that modulates a cytosine I or an adenine(A) (e.g., Na bisulfite, ammonium bisulfite). In some embodiments, an effector moiety has enzymatic activity (e.g., methyl transferase, demethylase, nuclease (e.g., Cas9), or deaminase activity). An effector moiety may be or comprise one or more of a small molecule, a peptide, a nucleic acid, a nanoparticle, an aptamer, or a pharmaco-agent with poor PK / PD.

[0283] In some embodiments, an effector moiety, may comprise a peptide ligand, a full-length protein, a protein fragment, an antibody, an antibody fragment, and / or a targeting aptamer. In some embodiments, the protein may bind a receptor such as an extracellular receptor, neuropeptide, hormone peptide, peptide drug, toxic peptide, viral or microbial peptide, synthetic peptide, or agonist or antagonist peptide.

[0284] In some embodiments, an effector moiety may comprise antigens, antibodies, antibody fragments such as, e.g. single domain antibodies, ligands, or receptors such as, e.g., glucagon-like peptide- 1 (GLP- 1), GLP-2 receptor 2, cholecystokinin B (CCKB), or somatostatin receptor, peptide therapeutics such as, e.g., those that bind to specific cell surface receptors such as G protein-coupled receptors (GPCRs) or ion channels, synthetic or analog peptides from naturally-bioactive peptides, anti-microbial peptides, poreforming peptides, tumor targeting or cytotoxic peptides, or degradation or self-destruction peptides such as an apoptosis-inducing peptide signal or photosensitizer peptide.

[0285] Peptide or protein moieties for use in effector moieties as described herein may also include small antigen-binding peptides, e.g., antigen binding antibody or antibody-like fragments, such as, e.g., single chain antibodies, nanobodies (see, e.g., Steeland et al. 2016. Nanobodies as therapeutics: big opportunities for small antibodies. Drug Discov Today: 21(7): 1076-1 13). Such small antigen binding peptides may bind, e.g., a cytosolic antigen, a nuclear antigen, an intra-organellar antigen.

[0286] In some embodiments, an effector moiety comprises a dominant negative component (e.g., dominant negative moiety), e.g., a protein that recognizes and binds a sequence (e.g., an anchor sequence, e.g., a CTCF binding motif), but with an inactive (e.g., mutated) dimerization domain, e.g., a dimerization domain that is unable to form a functional anchor sequence-mediated conjunction), or binds to a component of a genomic complex (e.g., a transcription factor subunit, etc.) preventing formation of a functional transcription factor, etc. For example, the Zinc Finger domain of CTCF can be altered so that it binds a specific anchor sequence (by adding zinc fingers that recognize flanking nucleic acids), while the homo-dimerization domain is altered to prevent the interaction between engineered CTCF and endogenous forms of CTCF. In some embodiments, a dominant negative component comprises a synthetic nucleating polypeptide with a selected binding affinity for an anchor sequence within a target anchor sequence-mediated conjunction. In some embodiments, binding affinity may be at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or higher or lower than binding affinity of an endogenous nucleating polypeptide (e.g., CTCF) that associates with a target anchor sequence. A synthetic nucleating polypeptide may have between 30-90%, 30-85%, 30-80%, 30-70%, 50-80%, 50-90% amino acidsequence identity to a corresponding endogenous nucleating polypeptide. A nucleating polypeptide may modulate (e.g., disrupt), such as through competitive binding, e.g., competing with binding of an endogenous nucleating polypeptide to its anchor sequence.

[0287] In some embodiments, an effector moiety comprises an antibody or fragment thereof. In some embodiments, target gene (e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB) expression is altered via use of effector moieties that are or comprise one or more antibodies or fragments thereof. In some embodiments, gene expression is altered via use of effector moieties that are or comprise one or more antibodies (or fragments thereof) and dCas9.

[0288] In some embodiments, an antibody or fragment thereof for use in an effector moiety may be monoclonal. An antibody may be a fusion, a chimeric antibody, a non-humanized antibody, a partially or fully humanized antibody, etc. As will be understood by one of skill in the art, format of antibody(ies) used may be the same or different depending on a given target.

[0289] In some embodiments, an effector moiety, comprises a conjunction nucleating molecule, a nucleic acid encoding a conjunction nucleating molecule, or a combination thereof. A conjunction nucleating molecule may be, e.g., CTCF, cohesin, USF1, YY1, TATA-box binding protein associated factor 3 (TAF3), ZNF143 binding motif, or another polypeptide that promotes formation of an anchor sequence-mediated conjunction. A conjunction nucleating molecule may be an endogenous polypeptide or other protein, such as a transcription factor, e.g., autoimmune regulator (AIRE), another factor, e.g., X- inactivation specific transcript (XIST), or an engineered polypeptide that is engineered to recognize a specific DNA sequence of interest, e.g., having a zinc finger, leucine zipper or bHLH domain for sequence recognition. A conjunction nucleating molecule may modulate DNA interactions within or around the anchor sequence-mediated conjunction (e.g., associated with or comprising the genomic sequence element targeted by the targeting moiety). For example, a conjunction nucleating molecule can recruit other factors to an anchor sequence that alters an anchor sequence-mediated conjunction formation or disruption. A conjunction nucleating molecule may also have a dimerization domain for homo- or heterodimerization. One or more conjunction nucleating molecules, e.g., endogenous and engineered, may interact to form an anchor sequence-mediated conjunction. In some embodiments, a conjunction nucleating molecule is engineered to further include a stabilization domain, e.g., cohesion interaction domain, to stabilize an anchor sequence- mediated conjunction. In some embodiments, a conjunction nucleating molecule is engineered to bind a target sequence, e.g., target sequence binding affinity is modulated. In some embodiments, a conjunction nucleating molecule is selected or engineered with a selected binding affinity for an anchor sequence within an anchor sequence-mediated conjunction.

[0290] Conjunction nucleating molecules and their corresponding anchor sequences may be identified through use of cells that harbor inactivating mutations in CTCF and Chromosome Conformation Capture or 3C-based methods, e.g., Hi-C or high-throughput sequencing, to examine topologically associated domains, e.g., topological interactions between distal DNA regions or loci, inthe absence of CTCF. Long-range DNA interactions may also be identified. Additional analyses may include ChlA-PET analysis using a bait, such as Cohesin, YY1 or USF1, ZNF143 binding motif, and MS to identify complexes that are associated with a bait.

[0291] In some embodiments, an effector moiety comprises a DNA-binding domain of a protein. In some embodiments, a DNA binding domain of an effector moiety enhances or alters targeting of a modulating agent but does not alone achieve complete targeting by a modulating agent (e.g., the targeting moiety is still needed to achieve targeting of the modulating agent). In some embodiments, a DNA binding domain enhances targeting of a modulating agent. In some embodiments, a DNA binding domain enhances efficacy of a modulating agent. DNA-binding proteins have distinct structural motifs, e.g., that play, a key role in binding DNA, known to those of skill in the art. In some embodiments, a DNA-binding domain comprises a helix-tum-helix (HTH) motif, a common DNA recognition motif in repressor proteins. Such a motif comprises two helices, one of which recognizes DNA (aka recognition helix) with side chains providing binding specificity. Such motifs are commonly used to regulate proteins that are involved in developmental processes. Sometimes more than one protein competes for the same sequence or recognizes the same DNA fragment. Different proteins may differ in their affinity for the same sequence, or DNA conformation, respectively through H-bonds, salt bridges and Van der Waals interactions.

[0292] In some embodiments, a DNA-binding domain comprises a helix-hairpin-helix (HhH) motif.

[0293] DNA-binding proteins with a HhH structural motif may be involved in non-sequence-specific DNA binding that occurs via the formation of hydrogen bonds between protein backbone nitrogen and DNA phosphate groups.

[0294] In some embodiments, a DNA-binding domain comprises a helix-loop-helix (HLH) motif. DNA- binding proteins with an HLH structural motif are transcriptional regulatory proteins and are principally related to a wide array of developmental processes. An HLH structural motif is longer, in terms of residues, than HTH or HhH motifs. Many of these proteins interact to form homo- and hetero-dimers. A structural motif is composed of two long helix regions, with an N-terminal helix binding to DNA, while a complex region allows the protein to dimerize.

[0295] In some embodiments, a DNA-binding domain comprises a leucine zipper motif. In some transcription factors, a dimer binding site with DNA forms a leucine zipper. This motif includes two amphipathic helices, one from each subunit, interacting with each other resulting in a left-handed coiled- coil super secondary structure. A leucine zipper is an interdigitation of regularly spaced leucine residues in one helix with leucines from an adjacent helix. Mostly, helices involved in leucine zippers exhibit a heptad sequence (abcdefg) with residues a and d being hydrophobic and other residues being hydrophilic. Leucine zipper motifs can mediate either homo- or heterodimer formation.

[0296] In some embodiments, a DNA-binding domain comprises a Zn finger domain, where a Zn++ion is coordinated by 2 Cys and 2 His residues. Such a transcription factor includes a trimer with the stoichiometry (3(3 ‘a. An apparent effect of Zn++coordination is stabilization of a small complexstructure instead of hydrophobic core residues. Each Zn-finger interacts in a conformationally identical manner with successive triple base pair segments in the major groove of the double helix. Protein-DNA interaction is determined by two factors: (i) H-bonding interaction between a-helix and DNA segment, mostly between Arg residues and Guanine bases, (ii) H-bonding interaction with DNA phosphate backbone, mostly with Arg and His. An alternative Zn-finger motif chelates Zn++with 6 Cys.

[0297] In some embodiments, a DNA-binding domain comprises a TATA box binding protein (TBP). TBP was first identified as a component of the class II initiation factor TFIID. These binding proteins participate in transcription by all three nuclear RNA polymerases acting as subunit in each of them. Structure of TBP shows two « / [> structural domains of 89-90 amino acids. The C-terminal or core region of TBP binds with high affinity to a TATA consensus sequence (TATAa / tAa / t, SEQ ID NO: 210) recognizing minor groove determinants and promoting DNA bending. TBP resemble a molecular saddle. The binding side is lined with central 8 strands of a 10-stranded anti-parallel [3- sheet. The upper surface contains four a-helices and binds to various components of transcription machinery.

[0298] In some embodiments, a DNA-binding domain is or comprises a transcription factor. Transcription factors (TFs) may be modular proteins containing a DNA-binding domain that is responsible for specific recognition of base sequences and one or more effector domains that can activate or repress transcription. TFs interact with chromatin and recruit protein complexes that serve as coactivators or corepressors.

[0299] In some embodiments, an effector moiety comprises one or more RNAs (e.g., gRNA) and dCas9. In some embodiments, one or more RNAs is / are targeted to a genomic sequence element via dCas9 and target-specific guide RNA. As will be understood by one of skill in the art, RNAs used for targeting may be the same or different depending on a given target. An effector moiety may comprise an aptamer, such as an oligonucleotide aptamer or a peptide aptamer. Aptamer moieties are oligonucleotide or peptide aptamers.

[0300] An effector moiety may comprise an oligonucleotide aptamer. Oligonucleotide aptamers are single-stranded DNA or RNA (ssDNA or ssRNA) molecules that can bind to pre-selected targets including proteins and peptides with high affinity and specificity.

[0301] Oligonucleotide aptamers are nucleic acid species that may be engineered through repeated rounds of in vitro selection or equivalently, SELEX (systematic evolution of ligands by exponential enrichment) to bind to various molecular targets such as small molecules, proteins, nucleic acids, and even cells, tissues and organisms. Aptamers provide discriminate molecular recognition and can be produced by chemical synthesis. In addition, aptamers possess desirable storage properties, and elicit little or no immunogenicity in therapeutic applications.

[0302] Both DNA and RNA aptamers show robust binding affinities for various targets. For example, DNA and RNA aptamers have been selected for t lysozyme, thrombin, humanimmunodeficiency vims trans-acting responsive element (HIV TAR), hemin, interferon y, vascular endothelial growth factor (VEGF), prostate specific antigen (PSA), dopamine, and the non-classical oncogene, heat shock factor 1 (HSF1). Diagnostic techniques for aptamer-based plasma protein profiling includes aptamer plasma proteomics. This technology will enable future multi-biomarker protein measurements that can aid diagnostic distinction of disease versus healthy states.

[0303] An effector moiety may comprise a peptide aptamer moiety. Peptide aptamers have one (or more) short variable peptide domains, including peptides having low molecular weight, 12 — 14 Da. Peptide aptamers may be designed to specifically bind to and interfere with protein-protein interactions inside cells.

[0304] Peptide aptamers are artificial proteins selected or engineered to bind specific target molecules. These proteins include of one or more peptide complexes of variable sequence. They are typically isolated from combinatorial libraries and often subsequently improved by directed mutation or rounds of variable region mutagenesis and selection. In vivo, peptide aptamers can bind cellular protein targets and exert biological effects, including interference with the normal protein interactions of their targeted molecules with other proteins. In particular, a variable peptide aptamer complex attached to a transcription factor binding domain is screened against a target protein attached to a transcription factor activating domain. In vivo binding of a peptide aptamer to its target via this selection strategy is detected as expression of a downstream yeast marker gene. Such experiments identify particular proteins bound by aptamers, and protein interactions that aptamers disrupt, to cause a given phenotype. In addition, peptide aptamers derivatized with appropriate functional moieties can cause specific post-translational modification of their target proteins or change subcellular localization of the targets. Peptide aptamers can also recognize targets in vitro. They have found use in lieu of antibodies in biosensors and used to detect active isoforms of proteins from populations containing both inactive and active protein forms. Derivatives known as tadpoles, in which peptide aptamer “heads” are covalently linked to unique sequence double-stranded DNA “tails”, allow quantification of scarce target molecules in mixtures by PCR (using, for example, the quantitative real-time polymerase chain reaction) of their DNA tails.

[0305] Peptide aptamer selection can be made using different systems, but the most used is currently a yeast two-hybrid system. Peptide aptamers can also be selected from combinatorial peptide libraries constructed by phage display and other surface display technologies such as mRNA display, ribosome display, bacterial display and yeast display. These experimental procedures are also known as biopannings. Among peptides obtained from biopannings, mimotopes can be considered as a kind of peptide aptamers. Peptides panned from combinatorial peptide libraries have been stored in a special database with named MimoDB. An exemplary effector moiety may include, but is not limited to: ubiquitin, bicyclic peptides as ubiquitin ligase inhibitors, transcription factors, DNA and protein modification enzymes such as topoisomerases, topoisomerase inhibitors such as topotecan, DNA methyltransferases such as the DNMT family (e.g., DNMT3A, DNMT3B, DNMT3a / 3L, MQ1),protein methyltransferases (e.g., viral lysine methyltransferase (vSET), protein-lysine N- methyltransferase (SMYD2), deaminases (e.g., APOBEC, UG1), histone methyltransferases such as enhancer of zeste homolog 2 (EZH2), PRMT1, histone-lysine- N-methyltransferase (Setdbl), histone methyltransferase (SET2), euchromatic histone-lysine N- methyltransferase 2 (G9a), histone-lysine N- methyltransferase (SUV39H1), and G9a), histone deacetylase (e.g., HDAC1, HDAC2, HDAC3), enzymes with a role in DNA demethylation (e.g., the TET family enzymes catalyze oxidation of 5 - methylcytosine to 5 -hydroxymethylcytosine and higher oxidative derivatives), protein demethylases such as KDM1A and lysine-specific histone demethylase 1 (LSD1), helicases such as DHX9, deacetylases (e.g., sirtuin 1, 2, 3, 4, 5, 6, or 7), kinases, phosphatases, DNA- intercalating agents such as ethidium bromide, SYBR green, and proflavine, efflux pump inhibitors such as peptidomimetics like phenylalanine arginyl [3-naphthylamide or quinoline derivatives, nuclear receptor activators and inhibitors, proteasome inhibitors, competitive inhibitors for enzymes such as those involved in lysosomal storage diseases, protein synthesis inhibitors, nucleases (e.g., Cpfl, Cas9, zinc finger nuclease), specific domains from proteins, such as a KRAB domain, and fusions of one or more thereof (e.g., dCas9-DNMT, dCas9-MQl, dCas9-KRAB).

[0306] In some embodiments, a candidate domain may be determined to be suitable for use as an effector moiety by methods known to those of skill in the art. For example, a candidate effector moiety may be tested by assaying whether, when the candidate effector moiety is present in the nucleus of a cell and appropriately localized (e.g., to a target gene or transcription control element operably linked to said target gene, e.g., via a targeting moiety), the candidate effector moiety decreases expression of the target gene in the cell, e.g., decreases the level of RNA transcript encoded by the target gene (e.g., as measured by RNASeq or Northern blot) or decreases the level of protein encoded by the target gene (e.g., as measured by ELISA).

[0307] In some embodiments, an expression repressor or expression enhancer comprises a plurality of effector moiety, wherein each effector moiety does not detectably bind, e.g., does not bind, to another effector moiety. In some embodiments, an expression repression system or expression enhancing system comprises a first expression repressor or expression enhancer comprising a first effector moiety and a second expression repressor or expression enhancer comprising a second effector moiety, wherein the first effector moiety does not detectably bind, e.g., does not bind, to the second effector moiety. In some embodiments, an expression repression system or expression enhancing system comprises a plurality of expression repressors or expression enhancers, wherein each member of the plurality of expression repressors or expression enhancers comprises an effector moiety, wherein each effector moiety does not detectably bind, e.g., does not bind, to another effector moiety. In some embodiments, an expression repression system or expression enhancing system comprises a first expression repressor or expression enhancer comprising a first effector moiety and a second expression repressor or expression enhancer comprising a second effector moiety, wherein the first effector moiety does not detectably bind, e.g., does not bind, to the second effector moiety. Insome embodiments, an expression repression system or expression enhancing system comprises a first expression repressor or expression enhancer comprising a first effector moiety and a second expression repressor or expression enhancer comprising a second effector moiety, wherein the first effector moiety does not detectably bind, e.g., does not bind, to another first effector moiety, and the second effector moiety does not detectably bind, e.g., does not bind, to another second effector moiety. In some embodiments, an effector moiety for use in the compositions and methods described herein is functional in a monomeric, e.g., non-dimeric, state.

[0308] In some embodiments, an effector moiety is or comprises an epigenetic modifying moiety, e.g., that modulates the two-dimensional structure of chromatin (i.e., that modulate structure of chromatin in a way that would alter its two-dimensional representation).

[0309] Epigenetic modifying moieties useful in methods and compositions of the present disclosure include agents that affect epigenetic markers, e.g., DNA methylation, histone methylation, histone acetylation, histone sumoylation, histone phosphorylation, and RNA-associated silencing. Exemplary epigenetic enzymes that can be targeted to a genomic sequence element as described herein include DNA methylases (e.g., DNMT3a, DNMT3b, DNMT3a / 3L, MQ1), DNA demethylation (e.g., the TET family), histone methyltransferases, histone deacetylase (e.g., HDAC1, HDAC2, HDAC3), sirtuin 1, 2, 3, 4, 5, 6, or 7, lysine-specific histone demethylase 1 (LSD1), histone-lysine-N -methyltransferase (Setdbl), euchromatic histone-lysine N-methyltransferase 2 (G9a), histone-lysine N-methyltransferase (SUV39H1), enhancer of zeste homolog 2 (EZH2), viral lysine methyltransferase (vSET), histone methyltransferase (SET2), and protein-lysine N-methyltransferase (SMYD2). Examples of such epigenetic modifying agents are described, e.g., in de Groote et al. Nuc. Acids Res. (2012): 1-18.

[0310] In some embodiments, an expression repressor, e.g., comprising an epigenetic modifying moiety, useful herein comprises or is a construct described in Koferle et al. Genome Medicine 7.59 (2015): 1-3 incorporated herein by reference. For example, in some embodiments, an expression repressor comprises or is a construct found in Table 1 of Koferle et al., e.g., histone deacetylase, histone methyltransferase, DNA demethylation, or H3K4 and / or H3K9 histone demethylase described in Table 1 (e.g., dCas9-p300, TALE-TET1, ZF-DNMT3A, or TALE-LSD1).

[0311] In some embodiments, an effector moiety comprises a component of a gene editing system e.g, a CRISPR / Cas domain, e.g., a Zn Finger domain, e.g., a TAL effector domain. In some embodiments, an epigenetic modifying moiety may comprise a polypeptide (e.g., peptide or protein moiety) linked to a gRNA and a targeted nuclease, e.g., a Cas9, e.g., a wild type Cas9, a nickase Cas9 (e.g., Cas9 D10A), a catalytically inactive Cas9 (dCas9), eSpCas9, Cpfl, C2C1, or C2C3, or a nucleic acid encoding such a nuclease.

[0312] As used herein, the term “biomarker” means any gene, protein, or a fragment derived from that gene, the expression or level of which changes between certain conditions. Where the expression of the gene correlates with a certain condition, the gene is a biomarker for that condition. Forexample, a biomarker comprises a polynucleotide, such as a DNA of a gene locus, e.g, MYC, SFRP1, HNF4a , FOXP3, or APOB, or RNA transcribed from the biomarker gene.

[0313] In some embodiments, the biomarker is the target gene, e.g., gene that is targeted for modulation, e.g., of expression. In some embodiments, the biomarker, which is a target gene, is DNA of a gene locus (e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB) or RNA transcribed from the biomarker gene. In some embodiments, the target gene as the biomarker is a primary biomarker.

[0314] In some embodiments, the biomarker is a secondary biomarker, whereby expression or DNA modification of the secondary biomarker is indirectly affected by administration of the epigenetic modifying moiety. In some embodiments, the methylation status of the secondary biomarker is modified, e.g., increased or decreased, by the epigenetic modifying moiety targeting the target gene. In some embodiments, the expression of the secondary biomarker is altered, e.g., repressed or enhanced, by the epigenetic modifying moiety targeting the target gene.

[0315] In some embodiments, the secondary biomarker gene is associated with cancer. In some embodiments, the cancer is hepatocellular carcinoma (HCC). In some embodiments, the cancer is non-small cell lung cancer (NSCLC).

[0316] In some embodiments, the methylation state of one or more of the secondary biomarker genes listed in Table 16 can be analyzed. In some embodiments, the one or more secondary biomarker genes listed in Table 16 can be analyzed for gene expression, e.g., mRNA quantification.Table 16: Secondary Biomarker Genes associated with Cancer (e.g., Hepatocellular Carcinoma (HCC))

[0317] As used herein, a “biologically active portion of an effector domain” is a portion that maintains function (e.g., completely, partially, minimally) of an effector domain (e.g., a “minimal” or “core” domain). In some embodiments, fusion of a dCas9 with all or a portion of one or more effectordomains of an epigenetic modifying agent (such as a DNA methylase or enzyme with a role in DNA demethylation, e.g., DNMT3a, DNMT3b, DNMT3L, a DNMT inhibitor, combinations thereof, TET family enzymes, protein acetyl transferase or deacetylase, dCas9-DNMT3a / 3L, dCas9- DNMT3a / 3L / KRAB, dCas9 / VP64) creates a chimeric protein that is linked to the polypeptide and useful in the methods described herein. An effector moiety comprising such a chimeric protein is referred to as either a genetic modifying moiety (because of its use of a gene editing system component, Cas9) or an epigenetic modifying moiety (because of its use of an effector domain of an epigenetic modifying agent).

[0318] In some embodiments, provided technologies are described as comprising a gRNA that specifically targets a target gene. In some embodiments, the target gene is an oncogene, a tumor suppressor, or a MYC mis-regulation disorder related gene. In some embodiments, the target gene is MYC. In some embodiments, the target gene is SFRP1. In some embodiments, the target gene is HNF4a. In some embodiments, the target gene is FOXP3. In some embodiments, the target gene is APOB.

[0319] In some embodiments, technologies provided herein include methods of delivering one or more genetic modifying moieties (e.g., CRISPR system components) described herein to a subject, e.g., to a nucleus of a cell or tissue of a subject, by linking such a moiety to a targeting moiety as part of a fusion molecule. In some embodiments, technologies provided herein include methods of delivering one or more genetic modifying moieties (e.g., CRISPR system components) described herein to a subject, e.g., to a nucleus of a cell or tissue of a subject, by encapsulating the one or more genetic modifying moieties (e.g., CRISPR system components) in a lipid nanoparticle.Additional Moieties

[0320] An expression repressor may further comprise one or more additional moieties (e.g., in addition to one or more targeting moieties and one or more effector moieties). In some embodiments, an additional moiety is selected from a tagging or monitoring moiety, a cleavable moiety (e.g., a cleavable moiety positioned between a DNA-targeting moiety and an effector moiety or at the N- or C-terminal end of a polypeptide), a small molecule, a membrane translocating polypeptide, or a pharmaco-agent moiety.Exemplary Expression Repressors

[0321] The following exemplary expression repressors are presented for illustration purposes only and are not intended to be limiting.

[0322] In some embodiments, an expression repressor comprises a targeting moiety comprising dCas9, e.g., an S. aureus dCas9, and an effector moiety comprising MQ1, e.g., bacterial MQ1. In some embodiments, the expression repressor is encoded by the nucleic acid sequence of SEQ ID NOs: 68 (e.g., a nucleic acid (e.g., cDNA) encoding the expression repressor). In some embodiments, the expression repressor is encoded by the nucleic acid sequence of SEQ ID NOs: 119. In some embodiments, the expression repressor is encoded by the nucleic acid sequence of SEQ ID NOs: 209.In some embodiments, a nucleic acid described herein comprises a nucleic acid sequence of SEQ ID NO: 68, 1 19,209 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.

[0323] In some embodiments, an expression repressor comprises the amino acid sequence of SEQ ID NOs: 35 or 151. In some embodiments, an expression repressor described herein comprises an amino acid sequence of SEQ ID NO: 35, 151, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.Table 17

[0324] In some embodiments, an expression repressor comprises a targeting moiety comprising dCas9, e.g., an S. pyogenes dCas9, and an effector moiety comprising KRAB, e.g., a KRAB domain. In some embodiments, the expression repressor is encoded by the nucleic acid sequence of SEQ IDNOs: 67 (e.g., a nucleic acid (e.g., cDNA) encoding the expression repressor). In some embodiments, the expression repressor is encoded by the nucleic acid sequence of SEQ ID NOs: 210. In some embodiments, a nucleic acid described herein comprises a nucleic acid sequence of SEQ ID NO: 67, 210, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.

[0325] In some embodiments, an expression repressor comprises the amino acid sequence of SEQ ID NOs: 34 or 150. In some embodiments, a nucleic acid described herein comprises an amino acid sequence of SEQ ID NO: 34, 150, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.Table 18

[0326] In some embodiments, an expression repressor comprises a DNA-targeting moiety comprising dCas9, e.g., an S. aureus dCas9, and an effector moiety comprising DNMT1, e.g., human DNMT 1. In some embodiments, the expression repressor is encoded by the nucleic acid sequence of SEQ ID NO: 69 (e.g., a nucleic acid (e.g., cDNA) encoding the expression repressor). In some embodiments, the expression repressor is encoded by the nucleic acid sequence of SEQ ID NO: 211. In some embodiments, a nucleic acid described herein comprises a nucleic acid sequence of SEQ ID NO: 69, 211, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.

[0327] In some embodiments, an expression repressor comprises the amino acid sequence of SEQ ID NOs: 36, or 152. In some embodiments, an expression repressor described herein comprises an amino acid sequence of SEQ ID NO: 36, 152, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.Table 19

[0328] In some embodiments, an expression repressor comprises a DNA-targeting moiety comprising dCas9, e.g., an S. aureus dCas9, and an effector moiety comprising DNMT13a / 3L. In some embodiments, the expression repressor is encoded by the nucleic acid sequence of SEQ ID NO: 70 (e.g., a nucleic acid (e.g., cDNA) encoding the expression repressor). In some embodiments, the expression repressor is encoded by the nucleic acid sequence of SEQ ID NO: 212. In some embodiments, a nucleic acid described herein comprises a nucleic acid sequence of SEQ ID NO: 70, 212, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.

[0329] In some embodiments, an expression repressor comprises the amino acid sequence of SEQ ID NO: 37 or 153. In some embodiments, an expression repressor described herein comprises an amino acid sequence of SEQ ID NO: 37, 153, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.Table 20

[0330] In some embodiments, an expression repressor comprises a targeting moiety comprising a Zn Finger domain, and an effector moiety comprising KRAB, e.g., a KRAB domain. In some embodiments, the expression repressors are encoded by a nucleic acid sequence of any of SEQ ID NOs: 55, 56, 57, 58, 59, 60, 189, 193, 194, 195, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, and 224 (e.g., a nucleic acid (e.g., cDNA) encoding the expression repressor). The nucleic acid sequences of these exemplary expression repressors are disclosed in Table 18. In some embodiments, a nucleic acid described herein comprises a nucleic acid sequence of any of SEQ ID NOs: 55-60, 189, 193, 194, 195, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto. In some embodiments, the nucleic acid sequence comprises a poly-A sequence, and in other embodiments, the nucleic acid lacks the poly-A sequence.Table 21: Nucleotide sequences of exemplary ZF-KRAB effectors

[0331] In some embodiments, an expression repressor comprises a targeting moiety comprising a Zn Finger domain (e.g., having an amino acid sequence according to any of SEQ ID NO: 5-10 or 169- 172), and an effector moiety comprising KRAB (e.g., an amino acid sequence SEQ ID NO: 18), e.g., a KRAB domain. In some embodiments, an expression repressor described herein comprises an amino sequence of any of SEQ ID NOs: 22, 23, 24, 25, 26, 27, 134, 139-144, 177-180, or 183-186. The protein sequence of these exemplary expression repressors are disclosed in Table 22. In some embodiments, an expression repressor described herein comprises an amino acid sequence of any of SEQ ID NOs: 22-27, 134, 139-144, 177-180, 183-186 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.Table 22: Amino Acid sequences of exemplary Zinc Finger-KRAB effectors

[0332] In some embodiments, an expression repressor comprises a targeting moiety comprising a Zn Finger domain (e.g., one encoded by a nucleotide sequence of any of SEQ ID NO: 44-49 or 115), and an effector moiety comprising MQ1, e.g., a bacterial MQ1 (e.g., one encoded by a nucleotide sequence of SEQ ID NO: 52). In some embodiments, the expression repressors are encoded by the nucleic sequence of SEQ ID NOs: 61, 62, 63, 64, 65, 66, 116, 117, 118, 130, 225, 226, 227, 228, 229, 230, or 231. The nucleic acid sequence of these exemplary expression repressors are disclosed in Table 20. In some embodiments, a nucleic acid described herein comprises a nucleic acid sequence of any of SEQ ID NO: 61-66, 116-118, 130, 225, 226, 227, 228, 229, 230, 231 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto. In some embodiments, the nucleic acid sequence comprises a poly-A sequence, and in other embodiments, the nucleic acid lacks the poly-A sequence. For example, in some embodiments, a nucleic acid described herein comprises a sequence according to any of SEQ ID NO: 61-66, 116-118, 130, 225, 226, 227, 228, 229, 230, or 231 (or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto), but lacking the 3 ’ poly-A sequence, or comprising a 3 ’ poly-A sequence of a shorter length.Table 23: Nucleotide sequences of exemplary ZF-MQ1 effectors

[0333] In some embodiments, an expression repressor comprises a targeting moiety comprising a Zn Finger domain (e.g., comprising an amino acid sequence of any of SEQ ID NO: 11-14), and an effector moiety comprising MQ1, e.g., a bacterial MQ1 (e.g., SEQ ID NO: 19). In some embodiments, the expression repressor comprises an amino sequence of any of SEQ ID NOs: 28, 29, 30, 31, 32, ,33, 129, 133 and 145-149. The protein sequence of these exemplary expression repressors are disclosed in Table 24. In some embodiments, an expression repressor described herein comprises an amino acid sequence of any of SEQ ID NOs: 28-33, 129, 133, 145-149, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.Table 24 Amino acid sequences of exemplary ZF-MQ1 effectors

[0334] In some embodiments an expression repressor comprises a targeting moiety comprising a Zn Finger domain (e.g., having an amino acid sequence of any of SEQ ID NO: 11-14), and an effector moiety comprising MQ1, e.g., a bacterial MQ1 (e.g., SEQ ID NO: 87). In some embodiments, an expression repressor comprises a targeting moiety comprising a Zn Finger domain (e.g., one encodedby a nucleotide sequence of any of SEQ ID NO: 166-168, 232, 233, 234, 235, 236), and an effector moiety comprising MQ1, e.g., a bacterial MQ1 (e.g., one encoded by a nucleotide sequence of SEQ ID NO: 52). In some embodiments, the expression repressors are encoded by the nucleic sequence of SEQ ID NOs: 157, 158, or 159. The nucleic acid sequence of these exemplary expression repressors are disclosed in Table 25. In some embodiments, a nucleic acid described herein comprises a nucleic acid sequence of any of SEQ ID NO: 166-168, 232, 233, 234, 235, 236, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto. In some embodiments, the nucleic acid sequence comprises a poly-A sequence, and in other embodiments, the nucleic acid lacks the poly-A sequence. For example, in some embodiments, a nucleic acid described herein comprises a sequence according to any of SEQ ID NO: 166-168, 232, 233, 234, 235, 236 (or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto), but lacking the 3’ poly-A sequence, or comprising a 3 ’ poly-A sequence of a shorter length.Table 25: Nucleotide sequences of exemplary mouse-specific ZF-MQ1 effectors

[0335] In some embodiments, an expression repressor comprises a targeting moiety comprising a Zn Finger domain (e.g., comprising an amino acid sequence of any of SEQ ID NO: 154-156), and an effector moiety comprising MQ1, e.g., a bacterial MQ1 (e.g., SEQ ID NO: 19). In some embodiments, the expression repressor comprises an amino sequence of any of SEQ ID NOs: 160- 165. The protein sequences of these exemplary expression repressors are disclosed in Table 25. In some embodiments, an expression repressor described herein comprises an amino acid sequence of any of SEQ ID NOs: 160-165 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.Table 25: Amino acid sequences of exemplary ZF-MQ1 effectors

[0336] In some embodiments, the present disclosure provides an expression repressor system comprising a first targeting moiety comprising a first ZF, a first effector moiety comprising a DNA methyltransferase, e.g., MQ1 or a functional fragment thereof, a second targeting moiety comprising a second ZF, and a second effector moiety comprising KRAB, e.g., a KRAB domain. In some embodiments, the expression repressor system is encoded by a first nucleic acid encoding the first targeting moiety and first effector moiety, wherein expression is driven by a first promoter or IRES, and a second nucleic acid encoding the second targeting moiety and second effector moiety, wherein expression is driven by a second promoter or IRES. In some embodiments, mono-cistronic sequences are used. In some embodiments, the nucleic acid encoding the expression repressor system is a multi- cistronic sequence. In some embodiments, the multi-cistronic sequence is a bi-cistronic sequence. In some embodiments, the multi-cistronic sequence comprises a sequence encoding the first expression repressor and a sequence encoding the second expression repressor. In some embodiments, the multi- cistronic sequence encodes a self-cleavable peptide sequence, e.g., a 2A peptide sequence, e.g., a T2A peptide sequence, a P2A sequence. In some embodiments, the multi-cistronic sequence encodes a T2A peptide sequence and a P2A peptide sequence. In some embodiments, the multi-cistronic sequence encodes a tandem 2A sequence, e.g., a tPT2A sequence. In some embodiments, the multi- cistronic construct encodes, from 5’ to 3’, (i) a first nuclear localization signal, e.g., a SV40 NLS, (ii) a first targeting moiety, e.g., a DNA binding domain, e.g., a zinc finger binding domain, e.g., ZF-9, (iii) a first effector moiety, e.g., a DNA methyltransferase, e.g., MQ1, (iv) a second nuclear localization signal, e.g., a nucleoplasmin NLS, (v) a linker, e.g., a tPT2A linker, (vi) a third nuclear localization signal, e.g., a SV40NLS, (vii) a second targeting moiety, e.g., a DNA binding domain, e.g., a zinc finger binding domain, e.g., ZF-3, (viii) a second effector moiety, e.g., a transcription repressor moiety, e.g., KRAB, and (ix) a fourth nuclear localization signal, e.g., a nucleoplasmin NLS. In some embodiments, the bi-cistronic construct further comprises a polyA tail. In some embodiments, upon transcription of the bi-cistronic gene construct, a single mRNA transcript encoding the first expression repressor, and the second expression repressor are produced, which upon translation gets cleaved, e.g., after the glycine residue within the 2A peptide, to yield the first expression repressor and the second expression repressor as two separate proteins. In some embodiments, the first and the second expression repressor are separated by “ribosome-skipping”. In some embodiments the first expression repressor and / or the second expression repressor retains a fragment of the 2A peptide after ribosome skipping. In some embodiments, the expression level of the first and second expression repressor are equal. In some embodiments, the expression level of the firstand the second expression repressor are different. In some embodiments, the protein level of the first expression repressor is within 1%, 2%, 5%, or 10% of (greater than or less than) the protein level of the second expression repressor.

[0337] In some embodiments, a system encoded by a bi-cistronic nucleic acid decreases expression of a target gene (e.g., MYC) at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, in a cell, than an otherwise similar system wherein the first and second expression repressor are encoded by mono-cistronic nucleic acids.

[0338] In some embodiments, the bi-cistronic sequence encodes an amino acid of SEQ ID NO: 91, 92, 121, 122, 181, 182, 187, 188, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto. In some embodiments, an expression repressor system comprises a targeting moiety comprising a Zn Finger domain (e.g., comprising an amino acid sequence of any of SEQ ID NO: 7 or 13), and an effector moiety comprising MQ1, e.g., a bacterial MQ1 (e.g., SEQ ID NO: 19) or KRAB, e.g., a KRAB domain (e.g., SEQ ID NO: 18). In some embodiments, the expression repressor comprises an amino sequence of any of SEQ ID NOs: 91, 92, 121, 122, 181, 182, 187, or 188. The protein sequence of these exemplary expression repressor systems are disclosed in Table 24. In some embodiments, an expression repressor system described herein comprises an amino acid sequence of any of SEQ ID NOs: 91, 92, 121, 122, 181, 182, 187, or 188, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.

[0339] In some embodiments, the bi-cistronic sequence comprises nucleic acid sequence of SEQ ID NO: 93 or 112 (e.g., a nucleic acid (e.g., cDNA) encoding the expression repressor) or SEQ ID NO: 94 or 113 (e.g., a nucleic acid (e.g., cDNA) encoding the expression repressor). In some embodiments, the bi- cistronic sequence comprises nucleic acid sequence of SEQ ID NO: 196 (e.g., a nucleic acid (e.g., cDNA) encoding the expression repressor) or SEQ ID NO: 197 (e.g., a nucleic acid (e.g., cDNA) encoding the expression repressor). In some embodiments, the bi-cistronic sequence comprises nucleic acid sequence of SEQ ID NO: 237. In some embodiments, the bi-cistronic sequence comprises nucleic acid sequence of SEQ ID NO: 238. In some embodiments, the bi- cistronic sequence comprises nucleic acid sequence of SEQ ID NO: 239. In some embodiments, the bi-cistronic sequence comprises nucleic acid sequence of SEQ ID NO: 240. In some embodiments, the bi-cistronic sequence comprises nucleic acid sequence of SEQ ID NO: 241. In some embodiments, the bi-cistronic sequence comprises nucleic acid sequence of SEQ ID NO: 242. In some embodiments, the bi-cistronic sequence comprises nucleic acid sequence of SEQ ID NO: 243. In some embodiments, the bi-cistronic sequence comprises nucleic acid sequence of SEQ ID NO: 244. In some embodiments, the bi-cistronic sequence comprises nucleic acid sequence of SEQ ID NO: 245. In some embodiments, the bi-cistronic sequence comprises nucleic acid sequence of SEQ ID NO: 246. In some embodiments, a nucleic acid described herein comprises a nucleic acid sequenceof SEQ ID NO: 93, 94, 112, 113, 196, 197, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto. The nucleic acid sequence encoding these exemplary expression repressor systems are disclosed in Table 27. In some embodiments, the nucleic acid sequence comprises a poly-A sequence, and in other embodiments, the nucleic acid lacks the poly-A sequence.Table 27 Amino acid sequences of, and Nucleic acid sequences encoding, exemplary expression repressor systems

[0340] In some embodiments, an expression repressor or expression enhancer comprises a nuclear localization sequence (NLS). In some embodiments, the expression repressor or expression enhancer comprises an NLS, e.g., an SV40 NLS at the N-terminus. In some embodiments, the expression repressor or expression enhancer comprises an NLS, e.g., a nucleoplasmin NLS at the C- terminus. In some embodiments, the expression repressor or expression enhancer comprises a first NLS at the N- terminus and a second NLS at the C-terminus. In some embodiments the first and the second NLS have the same sequence. In some embodiments, the first and the second NLS have different sequences. In some embodiments, the expression repressor or expression enhancer comprises an SV40 NLS, e.g., the expression repressor or expression enhancer comprises a sequence according to PKKKRK (SEQ ID NO: 135). In some embodiments, the N-terminal sequence comprises an NLS and a spacer, e.g., having a sequence according to: MAPKKKRKVGIHGVPAAGSSGS (SEQ ID NO: 88). In some embodiments, the expression repressor or expression enhancer comprises a C-terminal sequence comprising one or more of, e.g., any two or all three of: a spacer, a nucleoplasmin nuclear localization sequence and an HA-tag: e g., SGGKRPAATKKAGQAKKKGSYPYDVPDYA (SEQ ID NO: 89). In some embodiments, the expression repressor or expression enhancer comprises an epitope tag, e.g., an HA tag: YPYDVPDYA (SEQ ID NO: 90). For example, the expression repressor or expression enhancer may comprise two copies of the epitope tag.

[0341] While an epitope tag is useful in many research contexts, it is sometimes desirable to omit an epitope tag in a therapeutic context. Accordingly, in some embodiments, the expression repressor or expression enhancer lacks an epitope tag. In some embodiments, an expression repressor or expression enhancer described herein comprises a sequence provided herein (or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto), but lacking the HA tag of SEQ ID NO: 90. In some embodiments, a nucleic acid described herein comprises a sequence provided herein (or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto), but lacking a region encoding the HA tag of SEQ ID NO: 90. In some embodiments, the expression repressor or expression enhancer comprises a nucleoplasmin NLS, e.g., the expression repressor or expression enhancer comprises a sequence of KRPAATKKAGQAKKK (SEQ ID NO: 136). In some embodiments, the expression repressor or expression enhancer does not comprise an NLS. In some embodiments, the expression repressor or expression enhancer does not comprise an epitope tag. In some embodiments the expression repressor or expression enhancer does not comprise an HA tag. In some embodiments, the expression repressor or expression enhancer does not comprise an HA tag sequence according to SEQ ID NO: 90. In some embodiments, the present disclosure provides an expression repressor system or expression enhancing system comprises a self-cleaving peptide. Selfcleaving peptides, first discovered in picomaviruses, are peptides of between 19 to 22 amino acids in length and are usually found between two proteins in some members of the picomavirus family. Using self-cleaving proteins, picomaviruses are capable of producing equimolar levels of multiple genes from the same mRNA. Such self-cleaving proteins are known to be found in other species of viruses and a person skilled in the art, based on the information provided herein, will be readily able to determine a suitable substitution for the self-cleaving protein disclosed herein, if required. In some embodiments, an expression repressor system or expression enhancing system comprises a selfcleaving peptide, e.g., a 2A self-cleaving peptide. In some embodiments, the 2A peptide comprises a single cleavage site, e.g., a 2A peptide, e.g., a P2A, a T2A, a E2A, or a F2A peptide. In some embodiments the self-cleaving peptide, e.g., a 2A peptide, comprises two cleavage sites, , e.g., pPT2A, or P2A-T2A-E2A. In some embodiments, an expression repressor system or expression enhancing system comprises a self-cleaving peptide comprising a plurality of cleavage sites, e.g., a T2A self-cleaving peptide and a P2A self-cleaving peptide. In some embodiments, the 2A peptide gets cleaved after translation. In some embodiments, the self-cleaving peptide produces two or more fragments after cleaving. In some embodiments, the 2A peptide fragments comprise the sequences of SEQ ID NO: 126-128. In some embodiments, the 2A self-cleaving peptide comprises a sequence of SEQ ID NO: 120, 124, 125 or derivative thereof. In some embodiments, SEQ ID NO: 95 comprises a sequence of a self-cleaving peptide.Table 28

[0342] It is of course understood that although a 2A sequence, e.g., tPT2A sequence (e.g., according to SEQ ID NO: 124), may be referred to in the scientific literature and herein as a self-cleaving peptide, this is according to a non-limiting theory. According to another non-limiting theory, in some embodiments, a 2 A sequence acts via ribosome-skipping. For instance, an mRNA encoding a 2 A sequence may induce ribosome skipping, wherein the ribosome fails to form a peptide bond while translating the 2A region, resulting in a release of the first part of the translation product. The ribosome then produces the second part of the translation product. Overall, it is well established that a 2A sequence placed between a first sequence and a second sequence will lead to the production of a first protein comprising the first sequence and a separate, second protein comprising the second sequence. This disclosure is not bound by any particular theory as to the molecular mechanism by which this is achieved.Functional Characteristics

[0343] An expression repressor or expression enhancer or a system of the present disclosure can be used to decrease or increase expression of a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB, in a cell. In general, an expression repressor or expression enhancer or a system as described herein binds (e.g., via a targeting moiety) a genomic sequence element proximal to and / or operably linked to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, binding of the expression repressor or expression enhancer or a system to the genomic sequence element modulates (e.g., decreases or increases) expression of the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. For example, binding of an expression repressor or expression enhancer or a system comprising an effector moiety that inhibits recruitment of components of the transcription machinery to the genomic sequence element may modulate (e.g., decrease) expression of the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. As a further example, binding of an expression repressor or expression enhancer or a system comprising an effector moiety with an enzymatic activity (e.g., an epigenetic modifying moiety) may modulate (e.g., decrease or increase) expressionof the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB) through the localized enzymatic activity of the effector moiety. As a further example, both binding of an expression repressor or expression enhancer or a system to a genomic sequence element and the localized enzymatic activity of an expression repressor or expression enhancer or a system may contribute to the resulting modulation (e.g., decrease or increase) in expression of the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB.

[0344] In some embodiments, decreasing or increasing expression comprises decreasing or increasing, respectively, the level of RNA, e.g., mRNA, encoded by the target gene e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, decreasing or increasing expression comprises decreasing or increasing, respectively, the level of a protein encoded by the target gene e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, decreasing or increasing expression comprises both decreasing or increasing, respectively, the level of mRNA and protein encoded by the target gene e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, the expression of a target gene in a cell contacted by or comprising the expression repressor or expression enhancer or the expression repression system expression enhancing system disclosed herein is at least 1.05x (i.e., 1.05 times), l. lx, 1.15x, 1.2x, 1.25x, 1.3x, 1.35x, 1.4x, 1.45x, 1.5x, 1.55x, 1.6x, 1.65x, 1.7x, 1.75x, 1.8x, 1.85x, 1.9x, 1.95x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, lOx, 20x, 30x, 40x, 50x, 60x, 70x, 80x, 90x, or lOOx lower or higher, respectively, than the level of expression of the target gene in a cell not contacted by or comprising the expression repressor or expression enhancer or the expression repression system or expression enhancing system disclosed herein. Expression of a target gene e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB may be assayed by methods known to those of skill in the art, including RT-PCR, ELISA, Western blot. Expression level of a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB in a subject, e.g., a patient, e.g., a patient having a MYC mis-regulation disorder, e.g., a patient having a hepatic disease, a patient having a neoplasia and / or viral or alcohol related hepatic disease, e.g., a patient having a hepatocarcinoma, e.g., a patient having a hepatocarcinoma subtype SI or hepatocarcinoma subtype S2, may be assessed by evaluating blood (e.g., whole blood) levels of the target gene, e.g., MYC, e.g., by the method of either Oglesbee et al. Clin Chem. 2013 Oct;59(10): 1461-9. Doi: 10.1373 / clinchem.2013.207472 or Deutsch et al. J Neurol Neurosurg Psychiatry. 2014 Sep;85(9):994- 1002. Doi: 10.1136 / jnnp-2013-306788, the contents of which are hereby incorporated by reference in their entirety.

[0345] An expression repressor or expression enhancer or a system of the present disclosure can be used to decrease or increase expression, respectively, of a target gene e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB in a cell for a time period. In some embodiments, the expression of a target gene e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB in a cell contacted by or comprising the expression repressor or expression enhancer or a system is appreciably decreased or increased, respectively, for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours, or at least 1, 2, 3, 4, 5, 6, 7, 10, 14, or 15 days, or at least 1, 2, 3, 4, or 5 weeks, or at least 1, 2, 3, 4, 5, 6, 7,8, 9, 10, 11, or 12 months, or at least 1, 2, 3, 4, or 5 years (e.g., indefinitely). Optionally, the expression of a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB in a cell contacted by or comprising the expression repressor or the system is appreciably decreased for no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 years. In some embodiments, the expression of a target gene e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB in a cell contacted by or comprising the expression repressor or the system is appreciably decreased for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 cell divisions. An expression repressor or expression enhancer or a system of the present disclosure can be used to methylate CpG nucleotides in a target promoter, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB promoter. In some embodiments, the transcriptional changes in MYC, SFRP1, HNF4a , FOXP3, or APOB expression correlates to percentage of CpG methylation. In some embodiments, the methylation persists for at least 1 days, at least 2 days, at least 5 days, at least 7 days, at least 10 days, at least 15 days, or at least 20 days post-treatment with an expression repressor or a system disclosed herein.

[0346] An expression repressor or expression enhancer or a system of the present disclosure can be used to decrease the viability of a cell comprising the target locus, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB locus. In some embodiments, expression repressor or expression enhancer or a system of the present disclosure can be used to decrease the viability of a plurality of cells comprising the target locus, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB locus. In some embodiments, the number of viable cells contacted by or comprising the expression repressor or expression enhancer or a system is appreciably decreased by 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% compared to number of viable cells in a control population of cells that is not contacted by or does not comprise the expression repressor or the system. In some embodiments, an expression repressor or expression enhancer or a system of the present disclosure can be used to decrease the viability of a plurality of cells comprising cancer cells and non-cancer cells. In some embodiments, an expression repressor or expression enhancer or a system of the present disclosure can be used to decrease the viability of the plurality of cancer cells more than it decreases the viability of the plurality of non-cancer cells. In some embodiments, an expression repressor or expression enhancer or a system of the present disclosure can be used to decrease the viability of the plurality of cancer cells 1.05x (i.e., 1.05 times), l. lx, 1.15x, 1.2x, 1.25x, 1.3x, 1.35x, 1.4x, 1.45x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, lOx, 20x, 5 Ox, or lOOx more than it decreases the viability of the plurality of non-cancer cells.

[0347] In some embodiments, an expression repressor or expression enhancer or a system of the present disclosure can be used to decrease the viability of a plurality of cells comprising infected cells and uninfected cells. In some embodiments, an expression repressor or expression enhancer or a system of the present disclosure can be used to decrease the viability of the plurality of infected cells more than it decreases the viability of the plurality of uninfected cells. In some embodiments, an expression repressor or expression enhancer or a system of the present disclosure can he used to decrease the viability of the plurality of infected cells I.05x (i.e., 1.05 times), l. lx, 1.15x, 1.2x, 1.25x,1.3x, 1.35x, 1.4x, 1.45x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, lOx, 20x, 5Ox, or lOOx more than it decreases the viability of the plurality of uninfected cells.

[0348] An expression repressor or expression enhancer or a system may comprise a plurality of expression repressors or expression enhancers, where each expression repressor or expression enhancer comprises an effector moiety with a different functionality than the effector moiety of another expression repressor. For example, an expression repression system or expression enhancing system may comprise two expression repressors, where the first expression repressor or expression enhancer comprises a first effector moiety comprising an epigenetic modifying moiety e.g., DNA methyltransferase, e.g., MQ1 and the second or expression enhancer comprises a second effector moiety comprising a transcription repressor, e.g., KRAB. In some embodiments, the second expression repressor or expression enhancer does not comprise a second effector moiety. In some embodiments, an expression repressor or expression enhancer or a system comprises expression repressors comprising a combination of effector moieties whose functionalities are complementary to one another with regard to inhibiting expression of a target gene, e.g., MYC, where the functionalities together enable inhibition of expression and, optionally, do not inhibit or negligibly inhibit expression when present individually. In some embodiments, an expression repressor or expression enhancer or a system comprises a plurality of expression repressors or expression enhancers, wherein each expression repressor or expression enhancer comprises an effector moiety that complements the effector moieties of each other expression repressor or expression enhancer, e.g., each effector moiety decreases or increases, respectively, expression of a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, an expression repression system expression repressor or expression enhancer or a system comprises expression repressors or expression enhancers comprising a combination of effector moieties whose functionalities synergize with one another with regards to inhibiting expression of a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. Without wishing to be bound by theory, epigenetic modifications to a genomic locus may be cumulative, in that multiple repressive epigenetic markers (e.g., multiple different types of epigenetic markers and / or more extensive marking of a given type) individually together reduce expression or increase expression more effectively than individual modifications alone (e.g., producing a greater decrease in expression and / or a longer-lasting decrease in expression). In some embodiments, an expression repressor or expression enhancer or a system comprises a plurality of expression repressors or expression enhancers, wherein each expression repressor or expression enhancer comprises an effector moiety that synergizes with the effector moieties of each other expression repressor or expression enhancer, e.g., each effector moiety decreases or increases expression of a target gene, e.g., MYC.

[0349] In some embodiments, an expression repressor or a system modulates (e.g., decreases) expression of a target gene, e.g., MYC by altering one or more epigenetic markers associated with the target gene, e.g., MYC or an expression control sequence operably linked thereto. In someembodiments, altering comprises decreasing the level of an epigenetic marker associated with the target gene, e.g., MYC or an expression control sequence operably linked thereto. Epigenetic markers include, but are not limited to, DNA methylation, histone methylation, and histone deacetylation.

[0350] In some embodiments, altering the level of an epigenetic marker decreases or increases the level of the epigenetic marker associated with the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB or an expression control sequence operably linked thereto by at least 1.05x (i.e., 1.05 times), l. lx, 1.15x, 1.2x, 1.25x, 1.3x, 1.35x, 1.4x, 1.45x, 1.5x, 1.55x, 1.6x, 1.65x, 1.7x, 1.75x, 1.8x, 1.85x, 1.9x, 1.95x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, lOx, 20x, 30x, 40x, 50x, 60x, 70x, 80x, 90x, or lOOx lower or higher than the level of the epigenetic marker associated with the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB or an expression control sequence operably linked thereto in a cell not contacted by or comprising the expression repressor or expression enhancer or the system. The level of an epigenetic marker may be assayed by methods known to those of skill in the art, including whole genome bisulfite sequencing, reduced representation bisulfite sequencing, bisulfite amplicon sequencing, methylation arrays, pyrosequencing, ChlP-seq, or ChlP-qPCR. In some embodiments, the changes (e.g., increase or decrease) in epigenetic marker e.g., DNA methylation may be assayed using bisulfite genomic sequencing at precise genomic coordinates according to hgl9 reference genome, e.g., in between chr8: 129188693- 129189048 according to hgl9 reference genome. In some embodiments, the changes (e.g., increase or decrease) in epigenetic marker e.g., DNA methylation may be assayed using bisulfite genomic sequencing at a genomic location according to SEQ ID NO: 123.CAGAGAAGGAGGAAGTTAATTCACATTCTTAATTTTTTCTAAGGGCAAAAAAAAAAAAA AAATGCACCAGCTCATTTTCCATCTCTGCTTGGGTCATCAGTGTGCATTGTGAGCCTGTAC AAAGGCCTTAGACGGGGAATGCTGCCGAGAGCATCACCTTTTATGTCTTCTTTTATATGA AATGTGCCACTTCCCCACTAACCCTGGCTCTGGGCTCTGCCTCTGCTCTCCTGATGGTGTG TTTATGGTGGATTCAGCATTCTGGGCCACACAAGGAAGCTGCAGGGGGTGTCCAAGTTCA CATGTCCCCGCATTCCAGGCGAATGTTTCTGACATTGAGCAATGATATGGCTCT (SEQ ID NO: 123)

[0351] An expression repressor or the system of the present disclosure can be used to alter the level of an epigenetic marker associated with the target gene, e.g., MYC or an expression control sequence operably linked thereto in a cell for a time period. In some embodiments, the level of the epigenetic marker associated with the target gene or an expression control sequence operably linked thereto in a cell contacted by or comprising the expression repressor or the system is appreciably decreased for at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours, or at least 1, 2, 3, 4, 5, 6, 7, 10, or 14 days, or at least 1, 2, 3, 4, or 5 weeks, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months, or at least 1, 2, 3, 4, or 5 years (e.g., indefinitely). Optionally, the level of an epigenetic marker associated with the target gene, e.g., MYC or an expression control sequenceoperably linked thereto in a cell contacted by or comprising the expression repressor or the system is appreciably decreased for no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 years.Combinations of Repressors

[0352] In some embodiments, an expression repression system or expression enhancing system comprises a first expression repressor or expression enhancer comprising a first effector moiety and a second expression repressor or expression enhancer comprising a second effector moiety wherein the first effector moiety and second effector moiety are different from one another. In some embodiments, the first effector moiety is or comprises a first epigenetic modifying moiety (e.g., that increases or decreases a first epigenetic marker) or functional fragment thereof and the second effector moiety is or comprises a second epigenetic modifying moiety (e.g., that increases or decreases a second epigenetic marker) or functional fragment thereof. In some embodiments, the first effector moiety is or comprises a DNA methyltransferase or functional fragment thereof and the second effector moiety is or comprises a KRAB or functional fragment thereof. In some embodiments, the first effector moiety is or comprises a histone deacetylase or functional fragment thereof and the second effector moiety is or comprises a KRAB or functional fragment thereof. In some embodiments, the first effector moiety is or comprises a histone methyltransferase or functional fragment thereof and the second effector moiety n is or comprises a KRAB or functional fragment thereof. In some embodiments, the first effector moiety is or comprises a histone demethylase or functional fragment thereof and the second effector moiety is or comprises a KRAB or functional fragment thereof. In some embodiments, the first effector moiety is or comprises MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, KDM1A (i.e., LSD1), KDM1B (i.e., LSD2), KDM2A, KDM2B, KDM5A, KDM5B, KDM5C, KDM5D, KDM4B, NO66, SETDB1, SETDB2, EHMT2 (i.e., G9A), EHMT1 (i.e., GLP), SUV39H1, EZH2, EZH1, SUV39H2, SETD8, SUV420H1, SUV420H2 or a functional fragment of any thereof, and the second effector moiety is or comprises KRAB (e g., a KRAB domain), MeCP2, HP1, RBBP4, REST, FOG1, SUZ12, or a functional fragment of any thereof.

[0353] In some embodiments, the first effector moiety is or comprises KRAB (e.g., a KRAB domain), MeCP2, HP1, RBBP4, REST, FOG1, SUZ12, or a functional fragment of any thereof, and the second effector moiety is or comprises MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, KDM1A (i.e., LSD1), KDM1B (i.e., LSD2), KDM2A, KDM2B, KDM5A, KDM5B, KDM5C, KDM5D, KDM4B, NO66, SETDB1,SETDB2, EHMT2 (i.e., G9A), EHMT1 (i.e., GLP), SUV39H1, EZH2, EZH1, SUV39H2, SETD8, SUV420H1, SUV420H2 or a functional fragment of any thereof.

[0354] In some embodiments, the first effector moiety is or comprises bacterial MQ1 or a functional variant or fragment thereof, and the second effector moiety is or comprises KRAB or a functional variant or fragment thereof.

[0355] In some embodiments, the first effector moiety is or comprises DNMT3A or a functional variant or fragment thereof, and the second effector moiety is or comprises KRAB or a functional variant or fragment thereof.

[0356] In some embodiments, the first effector moiety is or comprises DNMT3B or a functional variant or fragment thereof, and the second effector moiety is or comprises KRAB or a functional variant or fragment thereof. In some embodiments, the first effector moiety is or comprises DNMT3L or a functional variant or fragment thereof, and the second effector moiety is or comprises KRAB or a functional variant or fragment thereof.

[0357] In some embodiments, the first effector moiety is or comprises DNMT3a / 3L complex or a functional variant or fragment thereof, and the second effector moiety is or comprises KRAB or a functional variant or fragment thereof.Target Sites

[0358] Expression repressors, expression enhancers, expression repressor systems, or expression enhancing systems disclosed herein are useful for modulating, e.g., decreasing, expression of a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB in cell, e.g., in a subject or patient. A target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB may be any gene known to those of skill in the art. In some embodiments, a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB is associated with a disease or condition in a subject, e.g., a mammal, e.g., a human, bovine, horse, sheep, chicken, rat, mouse, cat, or dog. A target gene may include coding sequences, e.g., exons, and / or non-coding sequences, e.g., introns, 3’UTR, or 5’UTR. In some embodiments, a target gene is operably linked to a transcription control element.

[0359] A targeting moiety suitable for use in an expression repressor or expression enhancer or an expression repressor of system or expression enhancing system described herein may bind, e.g., specifically bind, to any site within a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB, transcription control element operably linked to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB to an anchor sequence (e.g., an anchor sequence proximal to a target gene or associated with an anchor sequence-mediated conjunction operably linked to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB (e.g., an anchor sequence-mediated conjunction is operably linked to a target gene if disruption of the conjunction alters expression of the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB)), or to a regulatory element located in a super enhancer region (e.g., a regulatory element located in a super enhancer region of MYC).

[0360] In some embodiments, an expression repressor or expression enhancer described herein binds at a site or at a location that is proximal to the site. For example, a targeting moiety may bind to a first site that is proximal to a repressor or enhancer (the second site), and the effector moiety associated with said targeting moiety may epigenetically modify the first site such that the enhancer’s effect on expression of a target gene is modified, substantially the same as if the second site (the enhancer sequence) had been bound and / or modified. In some embodiments, a site proximal to a target gene (e.g., an exon, intron, or splice site within the target gene), proximal to a transcription control element operably linked to the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB, or proximal to an anchor sequence is less than 5000, 4000, 3000, 2000, 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100, 50, or 25 base pairs from the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB (e.g., an exon, intron, or splice site within the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB), transcription control element, or anchor sequence (and optionally at least 20, 25, 50, 100, 200, or 300 base pairs from the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB (e.g., an exon, intron, or splice site within the target gene), transcription control element, or anchor sequence).

[0361] In some embodiments, a targeting moiety binds to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, a DNA-targeting moiety binds to a site within an exon of a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, a targeting moiety binds to a site within an intron of a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, a targeting moiety binds to a site at the boundary of an exon and an intron, e.g., a splice site, of a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, a targeting moiety binds to a site within the 5’UTR of a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, a targeting moiety binds to a site within the 3’UTR of a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. Target genes include, but are not limited to the gene encoding MYC, SFRP1, HNF4a , FOXP3, or APOB.

[0362] In some embodiments, a targeting moiety binds to a transcription control element operably linked to a target gene (e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB), e.g., a promoter or enhancer. In some embodiments, a targeting moiety binds to a portion of or a site within a promoter operably linked to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, a targeting moiety binds to the transcription start site of a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, a targeting moiety binds to a portion of or a site within an enhancer operably linked to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, a genomic complex (e.g., ASMC) co-localizes two or more genomic sequence elements, wherein the two or more genomic sequence elements include a promoter. A promoter is, typically, a sequence element that initiates transcription of an associated gene. Promoters are typically near the 5’ end of a gene, not far from its transcription start site. As those of ordinary skill are aware, transcription of protein-coding genes in eukaryotic cells is typically initiated by binding of general transcription factors (e.g., TFIID, TFIIE, TFIIH, FUSE, CT-element etc.) and Mediator to corepromoter sequences as a preinitiation complex that directs RNA polymerase II to the transcription start site, and in many instances remains bound to the core promoter sequences even after RNA polymerase escapes and elongation of the primary transcript is initiated. In some embodiments, a promoter includes a sequence element such as TATA, Inr, DPE, or BRE, but those skilled in the art are well aware that such sequences are not necessarily required to define a promoter. Those skilled in the art are familiar with a variety of positive (e.g., enhancers) or negative (e.g., repressors or silencers) transcription control elements that are associated with genes. In some embodiments, a transcription control element is a transcription factor binding site. Typically, when a cognate regulatory protein is bound to such a transcription control element, transcription from the associated gene(s) is altered (e.g., increased or decreased). In some embodiments, a targeting moiety binds to a genomic sequence located within a genomic coordinate GRCh37: chr8: 129162465-129212140.

[0363] In some embodiments, a targeting moiety binds to a target sequence comprised by or partially comprised by a genomic sequence element. In some embodiments, the genomic sequence element is or comprises an expression control sequence. In some embodiments, the genomic sequence element is or comprises the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB or a part of the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, a targeting moiety binds to a target sequence that is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 bases long (and optionally no more than 40, 39, 38, 37, 36, 35,34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, or 20 bases long). In some embodiments, a targeting moiety binds to a target sequence that is 10-30, 15-30, 15-25, 18-24, 19-23, 20-23, 21-23, or 22- 23 bases long. In some embodiments, the target sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 bases long. In some embodiments, the genomic sequence element is or comprises an anchor sequence.

[0364] Each ASMC comprises one or more anchor sequences, e.g., a plurality. In some embodiments, anchor sequences can be manipulated or altered to modulate (e.g., disrupt) a naturally occurring genomic complex (e.g., ASMC) or to form a new genomic complex (e.g., ASMC) (e.g., to form a non-naturally occurring genomic complex (e.g., ASMC) with an exogenous or altered anchor sequence). In some embodiments, an anchor sequence-mediated conjunction can be disrupted to alter, e.g., inhibit, e.g., decrease expression of a target gene. Such disruptions may modulate gene expression by, e.g., changing topological structure of DNA, e.g., by modulating the ability of a target gene to interact with a transcription control element (e.g., enhancing and silencing / repressive sequences).

[0365] In some embodiments, a targeting moiety binds to an anchor sequence, e.g., an anchor sequence proximal to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB or associated with an anchor sequence-mediated conjunction (ASMC) operably linked to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB (e.g., an anchor sequence-mediated conjunction is operably linked to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB if disruption of theconjunction alters expression of the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB). In general, an anchor sequence is a genomic sequence element to which a genomic complex component, e.g., nucleating polypeptide binds specifically. In some embodiments, binding of a genomic complex component to an anchor sequence nucleates complex formation, e.g., ASMC formation. In some embodiments, a targeting moiety binds to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB locus. A locus is generally defined to encompass transcribed region, promoter, and anchor sites of an ASMC comprising a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, a targeting moiety binds to a sequence comprising any one of SEQ ID NOS: 75-86 or 199-206. In some embodiments, the first targeting moiety binds to a sequence comprising any one of SEQ ID NOS: 75-86 and the second targeting moiety binds to a sequence comprising any one of SEQ ID NOS: 75-86, wherein the first and the second targeting moiety binds to the same sequence. In some embodiments, the first targeting moiety binds to a sequence comprising any one of SEQ ID NOS: 75-86 and the second targeting moiety binds to a sequence comprising any one of SEQ ID NOS: 75-86 wherein the first and the second targeting moiety binds to different sequences. In some embodiments, the first targeting moiety binds to a sequence comprising any of SEQ ID NOs: 83, 203, or 206 and the second targeting moiety binds to a sequence comprising SEQ ID NO: 77. In some embodiments, the first targeting moiety binds to a sequence comprising SEQ ID NO: 77 and the second targeting moiety binds to a sequence comprising any of SEQ ID NOs: 83, 203, or 206. In some embodiments, the first targeting moiety binds to a sequence comprising any of SEQ ID NOs: 83, 203, or 206 and the second targeting moiety binds to a sequence comprising any of SEQ ID NOs: 199, 204, or 205. In some embodiments, the first targeting moiety binds to a sequence comprising any of SEQ ID NOs: 199, 204, or 205 and the second targeting moiety binds to a sequence comprising any of SEQ ID NOs: 83, 203, or 206. In some embodiments, the first targeting moiety binds to a sequence comprising any of SEQ ID NOs: 83, 203, or 206 and the second targeting moiety binds to a sequence comprising SEQ ID NO: 201 . In some embodiments, a nucleic acid encoding the first and second expression repressors or expression enhancers comprises a first region that encodes the first expression repressor or expression enhancer, wherein the first region is upstream of a second region that encodes the second expression repressor or expression enhancer. In some embodiments, a nucleic acid encoding the first and second expression repressors or expression enhancers comprises a first region that encodes the first expression repressor or expression enhancer, wherein the first region is downstream of a second region that encodes the second expression repressor or expression enhancers. In some embodiments, the first targeting moiety binds to a sequence comprising any one of SEQ ID NOs: 75-86 or 199-206, and the second targeting moiety (e.g., a CRISPR / Cas domain comprising a gRNA) binds to a sequence comprising any one of SEQ ID NOS: 1-4. In some embodiments, a targeting moiety binds to a sequence comprising any one of SEQ ID NOS: 96-110. In some embodiments, the first targeting moiety binds to a sequence comprising any one of SEQ ID NOS: 96- 110 and the second targeting moiety binds to a sequence comprising any one of SEQ ID NOS: 96-110, wherein the first and the second targeting moiety binds to the same sequence. In some embodiments, the first targeting moiety binds to a sequence comprising any one of SEQ ID NOS: 96- 110 and the second targeting moiety binds to a sequence comprising any one of SEQ ID NOS: 96-110 wherein the first and the second targeting moiety binds to different sequences. In some embodiments, the first targeting moiety binds to a sequence comprising any one of SEQ ID NOs: 96-110, and the second targeting moiety (e.g., a CRISPR / Cas domain comprising a gRNA) binds to a sequence comprising any one of SEQ ID NOS: 1-4. In some embodiments, the first targeting moiety binds to a sequence comprising any one of the SEQ ID Nos. disclosed in tables 3, 4, or 26, and the second targeting moiety (e.g., a CRISPR / Cas domain comprising a gRNA) binds to a sequence comprising any one of the SEQ ID Nos. disclosed in tables 3, 4, or 26. Exemplary target sequences are disclosed in Table 29.Table 29: Exemplary target sequences

[0366] In some embodiments, an expression repressor or expression enhancer binds a genomic locus having a sequence set forth herein, e.g., any one of SEQ ID NOS: 1-4, 75-86, 96-110, or 199-206. It is understood that, in many cases, the genomic locus being bound comprises double stranded DNA, and this locus can be described by giving the sequence of its sense strand or its antisense strand. Thus, a gRNA having a given spacer sequence may cause expression repressor or expression enhancer to bind to a particular genomic locus, wherein one strand of the genomic locus has a sequence similar or identical to the spacer sequence, and the other strand of the genomic locus has the complementary sequence. Typically, gRNA binding to the genomic locus will involve some unwinding of the genomic locus and pairing of the gRNA spacer with the strand to which it the spacer complementary.

[0367] In some embodiments, a targeting moiety binds to an anchor sequence, e.g., an anchor sequence proximal to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB or associated with an anchor sequence-mediated conjunction (ASMC) operably linked to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB (e.g., an anchor sequence-mediated conjunction is operably linked to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB if disruption of the conjunction alters expression of the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB) in mouse genome. In general, an anchor sequence is a genomic sequence element to which a genomic complex component, e.g., nucleating polypeptide binds specifically. In some embodiments, binding of a genomic complex component to an anchor sequence nucleates complex formation, e.g., ASMC formation. In some embodiments, a targeting moiety binds to a target gene, e.g., MYC, SFRP1,HNF4a , F0XP3, or APOB locus. A locus is generally defined to encompass transcribed region, promoter, and anchor sites of an ASMC comprising a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, a targeting moiety binds to a sequence comprising any one of SEQ ID NOS: 190-192. In some embodiments, the targeting moiety binds to a sequence comprising any one of the SEQ ID Nos. disclosed in Table 30. Exemplary target sequences in mouse genome are disclosed in Table 30.Table 30: Exemplary target sequences in mouse genome

[0368] In some embodiments, an expression repressor or expression enhancer binds a genomic locus having a sequence set forth herein, e.g., any one of SEQ ID NOS: 190-192. It is understood that, in many cases, the genomic locus being bound comprises double stranded DNA, and this locus can be described by giving the sequence of its sense strand or its antisense strand.

[0369] In one embodiment, the anchor sequence-mediated conjunction comprises a loop, such as an intra-chromosomal loop. In certain embodiments, the anchor sequence-mediated conjunction has a plurality of loops. One or more loops may include a first anchor sequence, a nucleic acid sequence, a transcriptional control sequence, and a second anchor sequence. In another embodiment, at least one loop includes, in order, a first anchor sequence, a transcriptional control sequence, and a second anchor sequence, or a first anchor sequence, a nucleic acid sequence, and a second anchor sequence. In yet another embodiment, either one or both of the nucleic acid sequences and the transcriptional control sequence is located within or outside the loop. In still another embodiment, one or more of the loops comprises a transcriptional control sequence.

[0370] In some embodiments, the anchor sequence-mediated conjunction includes a TATA box, a CAAT box, a GC box, or a CAP site. In some embodiments, the anchor sequence-mediated conjunction comprises a plurality of loops, and where the anchor sequence-mediated conjunction comprises at least one of an anchor sequence, a nucleic acid sequence, and a transcriptional control sequence in one or more of the loops.

[0371] In some embodiments, chromatin structure is modified by substituting, adding, or deleting one or more nucleotides within an anchor sequence. In some embodiments, chromatin structure is modified by substituting, adding, or deleting one or more nucleotides within an anchor sequence of an anchor sequence-mediated conjunction. In some embodiments, transcription is inhibited by inclusionof an activating loop or exclusion of a repressive loop. In one such embodiment, the anchor sequence- mediated conjunction excludes a transcriptional control sequence that decreases transcription of the nucleic acid sequence. In some embodiments, transcription is repressed by inclusion of a repressive loop or exclusion of an activating loop. In one such embodiment, the anchor sequence-mediated conjunction includes a transcriptional control sequence that decreases transcription of the nucleic acid sequence.

[0372] The anchor sequences may be non-contiguous with one another. In embodiments with noncontiguous anchor sequences, the first anchor sequence may be separated from the second anchor sequence by about 500bp to about 500Mb, about 750bp to about 200Mb, about Ikb to about 100Mb, about 25kb to about 50Mb, about 50kb to about 1Mb, about lOOkb to about 750kb, about 150kb to about 500kb, or about 175kb to about 500kb. In some embodiments, the first anchor sequence is separated from the second anchor sequence by about 500bp, 600bp, 700bp, 800bp, 900bp, Ikb, 5kb, lOkb, 15kb, 20kb, 25kb, 30kb, 35kb, 40kb, 45kb, 50kb, 55kb, 60kb, 65kb, 70kb, 75kb, 80kb, 85kb, 90kb, 95kb, lOOkb, 125kb, 150kb, 175kb, 200kb, 225kb, 250kb, 275kb, 300kb, 350kb, 400kb, 500kb, 600kb, 700kb, 800kb, 900kb, 1Mb, 2Mb, 3Mb, 4Mb, 5Mb, 6Mb, 7Mb, 8Mb, 9Mb, 10Mb, 15Mb, 20Mb, 25Mb, 50Mb, 75Mb, 100Mb, 200Mb, 300Mb, 400Mb, 500Mb, or any size therebetween.

[0373] In some more embodiments, the targeting moiety introduces at least one of the following: at least one exogenous anchor sequence; an alteration in at least one conjunction nucleating molecule binding site, such as by altering binding affinity for the conjunction nucleating molecule; a change in an orientation of at least one common nucleotide sequence, such as a CTCF binding motif, YY1 binding motif, ZNF143 binding motif, or other binding motif mentioned herein; and a substitution, addition or deletion in at least one anchor sequence, such as a CTCF binding motif, YY1 binding motif, ZNF143 binding motif, or other binding motif mentioned herein.

[0374] In some embodiments, an anchor sequence comprises a nucleating polypeptide binding motif, e.g., a CTCF-binding motif: N(T / C / G)N(G / A / T)CC(A / T / G)(C / G)(C / T / A)AG(G / A)(G / T)GG(C / A / T)(G / A)(C / G)(C / T / A)(G / A / C), where N is any nucleotide.

[0375] A CTCF-binding motif may also be in an opposite orientation, e.g., (G / A / C)(C / T / A)(C / G)(G / A)(C / A / T)GG(G / T)(G / A)GA(C / T / A)(C / G)(A / T / G)CC(G / A / T)N(T / C / G)N. Where N is any nucleotide In some embodiments, an anchor sequence comprises N(T / C / G)N(G / A / T)CC(A / T / G)(C / G)(C / T / A)AG(G / A)(G / T)GG(C / A / T)(G / A)(C / G)(C / T / A)(G / A / C) or (G / A / C)(C / T / A)(C / G)(G / A)(C / A / T)GG(G / T)(G / A)GA(C / T / A)(C / G)(A / T / G)CC(G / A / T)N(T / C / G)N or a sequence at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to either N(T / C / G)N(G / A / T)CC(A / T / G)(C / G)(C / T / A)AG(G / A)(G / T)GG(C / A / T)(G / A)(C / G)(C / T / A)(G / A / C)or(G / A / C)(C / T / A)(C / G)(G / A)(C / A / T)GG(G / T)(G / A)GA(C / T / A)(C / G)(A / T / G)CC(G / A / T)N(T / C / G)N.

[0376] In some embodiments, an anchor sequence comprises a nucleating polypeptide binding motif, e.g., a YY1 -binding motif: CCGCCATNTT, where N is any nucleotide.

[0377] A YYl-binding motif may also be in an opposite orientation, e.g., AANATGGCGG, where N is any nucleotide.

[0378] In some embodiments, an anchor sequence-mediated conjunction comprises at least a first anchor sequence and a second anchor sequence. For example, in some embodiments, a first anchor sequence and a second anchor sequence may each comprise a nucleating polypeptide binding motif, e.g., each comprises a CTCF binding motif.

[0379] In some embodiments, a first anchor sequence and second anchor sequence comprise different sequences, e.g., a first anchor sequence comprises a CTCF binding motif, and a second anchor sequence comprises an anchor sequence other than a CTCF binding motif. In some embodiments, each anchor sequence comprises a nucleating polypeptide binding motif and one or more flanking nucleotides on one or both sides of a nucleating polypeptide binding motif.

[0380] Two CTCF-binding motifs (e.g., contiguous or non-contiguous CTCF binding motifs) that can form an ASMC may be present in a genome in any orientation, e.g., in the same orientation (tandem) either 5 ’-3’ (left tandem, e.g., the two CTCF-binding motifs that comprise N(T / C / G)N(G / A / T)CC(A / T / G)(C / G)(C / T / A)AG(G / A)(G / T)GG(C / A / T)(G / A)(C / G)(C / T / A)(G / A / C)) or 3 ’-5’ (right tandem, e.g., the two CTCF-binding motifs comprise (G / A / C)(C / T / A)(C / G)(G / A)(C / A / T)GG(G / T)(G / A)GA(C / T / A)(C / G)(A / T / G)CC(G / A / T)N(T / C / G)N), or convergent orientation, where one CTCF-binding motif comprises N(T / C / G)N(G / A / T)CC(A / T / G)(C / G)(C / T / A)AG(G / A)(G / T)GG(C / A / T)(G / A)(C / G)(C / T / A)(G / A / C) and another other comprises (G / A / C)(C / T / A)(C / G)(G / A)(C / A / T)GG(G / T)(G / A)GA(C / T / A)(C / G)(A / T / G)CC(G / A / T)N(T / C / G)N.

[0381] In some embodiments, an anchor sequence comprises a CTCF binding motif associated with a target gene (e.g., MYC), wherein the target gene is associated with a disease, disorder and / or condition, e.g., MYC mis-regulating disorder, e.g., hepatic disorder, (e.g., hepatocarcinoma) or lung cancer.

[0382] In some embodiments, methods of the present disclosure comprise modulating, e.g., disrupting, a genomic complex (e.g., ASMC), e.g., by modifying chromatin structure, by substituting, adding, or deleting one or more nucleotides within an anchor sequence, e.g., a nucleating polypeptide binding motif. One or more nucleotides may be specifically targeted, e.g., a targeted alteration, for substitution, addition or deletion within an anchor sequence, e.g., a nucleating polypeptide binding motif.

[0383] In some embodiments, a genomic complex (e.g., ASMC) may be altered by changing an orientation of at least one nucleating polypeptide binding motif. In some embodiments, an anchorsequence comprises a nucleating polypeptide binding motif, e.g., CTCF binding motif, and a targeting moiety introduces an alteration in at least one nucleating polypeptide binding motif, e.g., altering binding affinity for a nucleating polypeptide.

[0384] In some embodiments, before administration of an expression repressor, expression enhancer or system described herein, the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB has a defined state of expression, e.g., in a diseased state. For example, the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB may have a high level of expression in a disease cell. By disrupting the anchor sequence-mediated conjunction, expression of the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB may be decreased.

[0385] A targeting moiety suitable for use in an expression repressor, expression enhancer or system described herein may bind, e.g., specifically bind, to a site comprising at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides or base pairs (and optionally no more 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nucleotides or base pairs). In some embodiments, a DNA- targeting moiety binds to a site comprising 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides or base pairs.

[0386] Expression repressor, expression enhancer or system of the present disclosure may comprise two or more expression repressors or expression enhancers. In some embodiments, the expression repressors or expression enhancers of an expression repressor system or expression enhancing system each comprise a different targeting moiety.

[0387] In some embodiments, an expression repression system or expression enhancer or system comprises a first expression repressor or expression enhancer comprising a targeting moiety that binds a target gene, e.g., an exon, intron, or exon intron boundary (e.g., splice site), and second expression repressor or expression enhancer comprising a targeting moiety that binds the target gene, e.g., an exon, intron, or exon intron boundary (e.g., splice site). In some embodiments, an expression repression system comprises a first expression repressor or expression enhancer comprising a targeting moiety that binds a target gene, e.g., an exon, intron, or exon intron boundary (e.g., splice site), and second expression repressor or expression enhancer comprising a targeting moiety that binds to a transcription control element (e.g., promoter or enhancer) operably linked to the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, an expression repression system comprises a first expression repressor or expression enhancer comprising a targeting moiety that binds to a transcription control element (e.g., promoter or enhancer) operably linked to a target gene, and a second expression repressor or expression enhancer comprising a targeting moiety that binds to a transcription control element (e.g., promoter or enhancer) operably linked to the target gene. In some embodiments, an expression repression system comprises a firstexpression repressor or expression enhancer comprising a targeting moiety that binds to an anchor sequence proximal to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB or associated with an anchor sequence-mediated conjunction operably linked to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB, and a second expression repressor or expression enhancer comprising a targeting moiety that binds to a transcription control element (e.g., promoter or enhancer) operably linked to the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. In some embodiments, an expression repression system comprises a first expression repressor or expression enhancer comprising a targeting moiety that binds to an anchor sequence proximal to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB or associated with an anchor sequence-mediated conjunction operably linked to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB, and a second expression repressor or expression enhancer comprising a targeting moiety that binds to the target gene (e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB), e.g., an exon, intron, or exon intron boundary (e.g., splice site). In some embodiments, an expression repression system comprises a first expression repressor or expression enhancer comprising a targeting moiety that binds to an anchor sequence proximal to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB or associated with an anchor sequence-mediated conjunction operably linked to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB, and a second expression repressor or expression enhancer comprising a targeting moiety that binds to an anchor sequence proximal to the target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB or associated with an anchor sequence-mediated conjunction operably linked to the target gene, e g., MYC, SFRP1, HNF4a , FOXP3, or APOB.

[0388] In some embodiments, an expression repression system or expression enhancing system comprises a first expression repressor or expression enhancer comprising a targeting moiety that binds to a first site, e.g., in a promoter operably linked to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB, and a second expression repressor or expression enhancer comprising a targeting moiety that binds to a second site, e.g., in the promoter operably linked to a target gene, e.g., MYC, SFRP1, HNF4a , FOXP3, or APOB. The first site and second site may be different and nonoverlapping sites, e.g., the first site and second site do not share any sequence in common. The first site and second site may be different but overlapping sites, e.g., the first site and second site comprise different sequences but share some sequence in common.

[0389] In some embodiments, the target gene is MYC. In some embodiments, MYC is located on human chromosome 8. In some embodiments, the expression repressor, expression enhancer or system as described herein binds to the transcription start site (TSS) of MYC.Pharmaceutical Compositions, Formulation, Delivery, and Administration

[0390] The present disclosure is further directed, in part, to pharmaceutical compositions comprising an expression repressor or an expression repression system, e.g., expression repressor(s), described herein, to pharmaceutical compositions comprising nucleic acids encoding the expression repressor orthe expression repression system, e.g., expression repressor(s), described herein, and / or to and / or compositions that deliver an expression repressor or an expression repression system, e.g., expression repressor(s), described herein to a cell, tissue, organ, and / or subject.

[0391] As used herein, the term “pharmaceutical composition” refers to an active agent (e.g., an expression repressor or nucleic acids of the expression receptor, e.g., an expression repression system, e.g., expression repressor(s) of an expression repressor system, or nucleic acid encoding the same), formulated together with one or more pharmaceutically acceptable carriers (e.g., pharmaceutically acceptable carriers known to those of skill in the art). In some embodiments, active agent is present in unit dose amount appropriate for administration in a therapeutic regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, a pharmaceutical composition comprising an expression repressor of the present disclosure comprises an expression repressor or nucleic acid(s) encoding the same. In some embodiments, a pharmaceutical composition comprising an expression repression system of the present disclosure comprises or each of the expression repressors of the expression repression system or nucleic acid(s) encoding the same (e.g., if an expression repression system comprises a first expression repressor and a second expression repressor, the pharmaceutical composition comprises the first and second expression repressor). In some embodiments, a pharmaceutical composition comprises less than all of the expression repressors of an expression repression system comprising a plurality of expression repressors. For example, an expression repression system may comprise a first expression repressor and a second expression repressor, and a first pharmaceutical composition may comprise the first expression repressor or nucleic acid encoding the same and a second pharmaceutical composition may comprise the second expression repressor or nucleic acid encoding the same. In some embodiments, a pharmaceutical composition may comprise coformulation of one or more expression repressors, or nucleic acid(s) encoding the same.

[0392] As used herein, the term “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0393] Examples of suitable pharmaceutical compositions can be found in International Applications PCT / US2020 / 052275, PCT / US2020 / 052119, PCT / US2021 / 021825, PCT / US2022 / 036389, PCT / US2017 / 050553, and PCT / US2021 / 010059, all incorporated herein by reference in their entireties.Dosage

[0394] The dosage of the administered agent or composition can vary based on, e.g., the condition being treated, the severity of the disease, the subject’s individual parameters, including age,physiological condition, size and weight, duration of treatment, the type of treatment to be performed (if any), the particular route of administration and similar factors. Thus, the dose administered of the agents described herein can depend on such various parameters. The dosage of an administered composition may also vary depending upon other factors as the subject’s sex, general medical condition, and severity of the disorder to be treated. It may be desirable to provide the subject with a dosage of a modulatory agent or combination of modulatory agents disclosed herein that is in the range of from about 1 mg / kg to 6 mg / kg as a single intravenous infusion, although a lower or higher dosage also may be administered as circumstances dictate. The dosage may be repeated as needed, for example, once every day (e.g., for 1-30 days), once every 3 days (e.g., for 1-30 days) once every 5 days (e.g., for 1-30 days), once per week (e.g., for 1-6 weeks or for 2-5 weeks). In some embodiments, dosages may include, but are not limited to, 1.0 mg / kg- 6mg / kg, 1.0 mg / kg- 5 mg / kg, 1.0 mg / kg-4 mg / kg, 1.0-3.0mg / kg, 1.5 mg / kg-3.0mg / kg, 1.0 mg / kg - 1.5 mg / kg, 1.5 mg / kg - 3 mg / kg, 3 mg / kg - 4 mg / kg, 4 mg / kg - 5 mg / kg, or 5 mg / kg - 6 mg / kg. The dosage may be administered multiple times, e.g., once, or twice a week, or once every 1 or 2 weeks. In some embodiments, the subject is provided with a dosage of a modulatory agent or combination of modulatory agents disclosed herein that is in the range of from about 1 mg / kg to 6 mg / kg as multiple intravenous infusions although a lower or higher dosage also may be administered as circumstances dictate.

[0395] Pharmaceutical compositions according to the present disclosure may be delivered in a therapeutically effective amount. A precise therapeutically effective amount is an amount of a composition that will yield the most effective results in terms of efficacy of treatment in a given subject. This amount will vary depending upon a variety of factors, including but not limited to characteristics of a therapeutic compound (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), physiological condition of a subject (including age, sex, disease type and stage, general physical condition, responsiveness to a given dosage, and type of medication), nature of a pharmaceutically acceptable carrier or carriers in a formulation, and / or route of administration.

[0396] In some aspects, the present disclosure provides methods of delivering a therapeutic comprising administering a composition as described herein to a subject, wherein a modulating agent is a therapeutic and / or wherein delivery of a therapeutic causes changes in gene expression relative to gene expression in absence of a therapeutic.

[0397] Methods as provided in various embodiments herein may be utilized in any some aspects delineated herein. In some embodiments, one or more compositions is / are targeted to specific cells, or one or more specific tissues.

[0398] For example, in some embodiments one or more compositions is / are targeted to hepatic, epithelial, connective, muscular, reproductive, and / or nervous tissue or cells. In some embodiments a composition is targeted to a cell or tissue of a particular organ system, e.g., cardiovascular system (heart, vasculature); digestive system (esophagus, stomach, liver, gallbladder, pancreas, intestines, colon, rectum and anus); endocrine system (hypothalamus, pituitary gland, pineal body or pinealgland, thyroid, parathyroids, adrenal glands); excretory system (kidneys, ureters, bladder); lymphatic system (lymph, lymph nodes, lymph vessels, tonsils, adenoids, thymus, spleen); integumentary system (skin, hair, nails); muscular system (e.g., skeletal muscle); nervous system (brain, spinal cord, nerves); reproductive system (ovaries, uterus, mammary glands, testes, vas deferens, seminal vesicles, prostate); respiratory system (pharynx, larynx, trachea, bronchi, lungs, diaphragm); skeletal system (bone, cartilage); and / or combinations thereof.

[0399] In some embodiments, a composition of the present disclosure crosses a blood-brain-barrier, a placental membrane, or a blood-testis barrier. In some embodiments, a pharmaceutical composition as provided herein is administered systemically.

[0400] In some embodiments, administration is non-parenteral and a therapeutic is a parenteral therapeutic.

[0401] Methods and compositions provided herein may comprise a pharmaceutical composition administered by a regimen sufficient to alleviate a symptom of a disease, disorder, and / or condition. In some aspects, the present disclosure provides methods of delivering a therapeutic by administering compositions as described herein.

[0402] Pharmaceutical uses of the present disclosure may include compositions (e.g., modulating agents, e.g., epigenetic modifying agents) as described herein. Examples of suitable pharmaceutical compositions can be found in International Applications PCT / US2020 / 052275, PCT / US2020 / 052119, PCT / US2021 / ...

Claims

CLAIMS1. A method of assessing the efficacy of a first dose of an epigenetic modifying agent comprising: determining whether at least one of (i) a measured level of DNA methylation of one or more biomarkers, and (ii) a measured level of RNA of one or more biomarkers in a biological sample obtained from a subject who has received the first dose of epigenetic modifying agent is higher than, less than or equal to a control level.

2. A method of treating a subject with an epigenetic modifying agent comprising: a. determining whether at least one of (i) a measured level of DNA methylation of one or more biomarkers, and (ii) a measured level of RNA of the one or more biomarkers in a biological sample obtained from a subject who has received the first dose of epigenetic modifying agent is higher than, less than or equal to a control level; and b. administering a second dose of the epigenetic modifying agent to the subject.

3. The method of claim 1 or claim 2, further comprising measuring (i) the level of DNA methylation of the one or more biomarkers, or (ii) the level of RNA of the one or more biomarkers in the biological sample.

4. The method of claim 3, wherein measuring the level of RNA of the one or more biomarkers comprises measuring the level of extracellular vesicle RNA.

5. The method of claim 4, wherein the extracellular vesicle RNA is derived from cancer cells.

6. The method of any one of claims 1-5, wherein the epigenetic modifying agent achieves therapeutic effect by repressing expression of a gene target.

7. The method of claim 6, wherein the gene target is MYC, SFRP1, APOB or HNF4a.

8. The method of claim 6 or 7,(i) wherein the level of extracellular vesicle RNA is higher than the control level and the subject is administered a second dose of the epigenetic modifying agent that is higher than the first dose of the epigenetic modifying agent; or(ii) wherein the level of extracellular vesicle RNA is less than or equal to the control level and the subject is administered a second dose of the epigenetic modifying agent that is less than or equal to the first dose of the epigenetic modifying agent.

9. The method of any one of claims 1-5, wherein the epigenetic modifying agent achieves therapeutic effect by enhancing expression of a gene target.

10. The method of claim 10, wherein the gene target is FOXP3.

11. The method of claim 9 or 10,(i) wherein the level of extracellular vesicle RNA is less than or equal to the control level and the subject is administered a second dose of the epigenetic modifying agent that is higher than the first dose of the epigenetic modifying agent; or(ii) wherein the level of extracellular vesicle RNA is higher than the control level and the subject is administered a second dose of the epigenetic modifying agent that is less than or equal to the first dose of the epigenetic modifying agent.

12. The method of any one of claims 4-11, wherein the control level is the level of extracellular vesicle RNA prior to administration of the first dose of the epigenetic modifying agent.

13. The method of any one of the preceding claims, wherein the control level is a standardized level of extracellular vesicle RNA.

14. The method of claim 13, wherein the standardized level of extracellular vesicle RNA is a predetermined level of extracellular vesicle RNA associated with a disease state.

15. The method of any one of claims 4-14, further comprising a. determining whether a measured level of extracellular vesicle RNA in a second biological sample obtained from the subject who has received the second dose of the epigenetic modifying agent is higher than, less than or equal to a control level; and b. administering a third dose of the epigenetic modifying agent to the subject.

16. The method of claim 15, further comprising measuring the level of extracellular vesicle RNA in the second biological sample.

17. The method of claim 15 or claim 16,(a) wherein the epigenetic modifying agent achieves therapeutic effect by repressing expression of a gene target; and wherein(i) the level of extracellular vesicle RNA is higher than the control level and the subject is administered a second dose of the epigenetic modifying agent that is higher than the first dose of the epigenetic modifying agent; or(ii) the level of extracellular vesicle RNA is less than or equal to the control level and the subject is administered a second dose of the epigenetic modifying agent that is less than or equal to the first dose of the epigenetic modifying agent; or(b) wherein the epigenetic modifying agent achieves therapeutic effect by enhancing expression of a gene target, and wherein(i) the level of extracellular vesicle RNA is less than or equal to the control level and the subject is administered a second dose of the epigenetic modifying agent that is higher than the first dose of the epigenetic modifying agent; or(ii) the level of extracellular vesicle RNA is higher than the control level and the subject is administered a second dose of the epigenetic modifying agent that is less than or equal to the first dose of the epigenetic modifying agent.

18. The method of any one of the preceding claims, wherein both the level of DNA methylation and the level of extracellular vesicle RNA is measured, either of the same or different biomarkers.

19. The method of any one of claims 4-18, wherein the extracellular vesicle is an exosome.

20. The method of any one of claims 4-18, wherein the extracellular vesicle is a microvesicle.

21. The method of claim 6, wherein repression of expression of the gene target is by methylatingDNA.

22. The method of claim 21, wherein(i) the level of DNA methylation in the biological sample is less than or equal to the control level and wherein the subject is administered a second dose of the epigenetic modifying agent that is higher than the first dose of the epigenetic modifying agent; or(ii) the level of DNA methylation in the biological sample is higher than the control level and wherein the subject is administered a second dose of the epigenetic modifying agent that is less than or equal to the first dose of the epigenetic modifying agent.

23. The method of claim 9, wherein the enhancement of expression of the gene target is by demethylating DNA.

24. The method of claim 23, wherein(i) the level of DNA methylation in the biological sample is higher than the control level and wherein the subject is administered a second dose of the epigenetic modifying agent that is higher than the first dose of the epigenetic modifying agent; or(ii) the level of DNA methylation in the biological sample is less than or equal to the control level and wherein the subject is administered a second dose of the epigenetic modifying agent that is less than or equal to the first dose of the epigenetic modifying agent.

25. The method of any one of the preceding claims, wherein the biological sample is selected from the group consisting of blood, cerebrospinal fluid, plasma, pleural fluid, saliva, serum sputum, stool, and urine.

26. The method of any one of the preceding claims, wherein the DNA is cell-free DNA.

27. The method of claim 26, wherein the cell-free DNA is circulating tumor DNA (ctDNA).

28. The method of claim 26, wherein the cell-free DNA is extracellular vesicle DNA.

29. The method of claim 28, wherein the extracellular vesicle is an exosome.

30. The method of claim 28, wherein the extracellular vesicle is a microvesicle.

31. The method of any one of claims 25-30, wherein the biological sample is blood.

32. The method of any one of claims 1-24, wherein the biological sample is tissue.

33. The method of claim 32, wherein the tissue sample is a biopsy, optionally, a liquid biopsy.

34. The method of claim 32 or 33, wherein the DNA comprises cellular genomic DNA.

35. The method of any one of the preceding claims, wherein measuring the level of methylation comprises quantitative polymerase chain reaction (qPCR), next-generation sequencing, nanopore sequencing, beam emulsion sequencing, sodium bisulfite conversion and sequencing, differential enzymatic cleavage, affinity capture of methylated DNA, or epiallele methylation detection.

36. The method of claim 35, wherein measuring the level of methylation comprises nanopore sequencing.

37. The method of claim 35, wherein measuring the level of methylation comprises sodium bisulfite conversion and sequencing.

38. The method of claim 35, wherein measuring the level of methylation comprises differential enzymatic cleavage.

39. The method of claim 35, wherein measuring the level of methylation comprises affinity capture of methylated DNA.

40. The method of claim 35, wherein epiallele methylation detection comprises determining variant epiallele fraction (VEF), wherein the VEF is the level of DNA methylation.

41. The method of claim 40, further comprising identifying genomic sequence with methylation at one or more cytosine guanine (CpG) sites in DNA extracted from the biological sample.

42. The method of claim 41, wherein the extracted DNA is sequenced using next generation sequencing.

43. The method of claim 42, wherein the next generation sequencing comprises:1) fragmenting extracted genomic DNA; and2) amplifying DNA fragments with oligonucleotides that hybridize to the DNA fragments.

44. The method of claim 41, wherein the genomic sequences are determined to be methylated when a threshold of at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% of CpG sites on the sequence are methylated.

45. The method of claim 44, wherein the threshold is at least 50% methylated CpG sites on the sequence.

46. The method of any one of claims 40-45, wherein the DNA is cell-free DNA.

47. The method of any one of claims 43-46, further comprising treating the DNA fragments with one or more cytosine deaminases or sodium bisulfate, thereby converting cytosine to uracil in the DNA fragments prior to amplification.

48. The method of any one of claims 43-47, further comprising capturing the DNA fragments using a panel of nucleic acid primers covering a chromosomal region of interest.

49. The method of claim 48, wherein the chromosomal region of interest comprises discontinuous chromosomal sequence.

50. The method of claim 48, wherein the chromosomal region of interest comprises continuous chromosomal sequence.

51. The method of any one of claims 48-50, wherein the chromosomal region of interest comprises at least 5 kb, at least 10 kb, at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb or at least 80 kb.

52. The method of any one of claims 1-8, 12-22, and 25-51, wherein the epigenetic modifying agent comprises a DNA methyltransferase.

53. The method of claim 52, wherein the epigenetic modifying agent comprises at least one DNA methyltransferase selected from the group consisting of MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, and a functional variant thereof.

54. The method of claim 53, wherein the DNA methyltransferase is MQ1, or a functional variant thereof.

55. The method of claim 54, wherein MQ1 comprises an amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NOs: 19 or 87.

56. The method of any one of claims 1-5, 9-20, and 23-51, wherein the epigenetic modifying agent comprises a DNA demethylase.

57. The method of claim 56, wherein the epigenetic modifying agent comprises at least one DNA demethylase selected from the group consisting of DME, DML2, DML3, ROS1, TET1, TET2, TET3FL, and TET3s.

58. The method of any one of the preceding claims, wherein the epigenetic modifying agent comprises a DNA-binding domain.

59. The method of claim 58, wherein the DNA-binding domain binds to a target sequence in the DNA.

60. The method of claim 59, wherein the DNA comprises a promoter that comprises the target sequence.

61. The method of claim 60, wherein the target sequence comprises a CTCF -binding site.

62. The method of any one of claims 58-61, wherein the DNA-binding domain comprises a zinc finger domain.

63. The method of any one of claims 58-62, wherein the DNA-binding domain comprises an amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NOs: 5-16, 169, 170, 171, or 172.

64. The method of any one of claims 58-63, wherein the DNA-binding domain binds to the target sequence comprising at least 16, 17, 18, 19, or 20 nucleotides of SEQ ID NOs: 4, 75-86, or 199-206.

65. The method of any one of the preceding claims, wherein the control level is the level of methylation of the DNA prior to administration of the first dose of the epigenetic modifying agent.

66. The method of any one of the preceding claims, wherein the control level is a standardized level of methylation of the DNA.

67. The method of claim 66, wherein the standardized level of methylation of the DNA is a predetermined level of methylation known to achieve the desired therapeutic effect of the epigenetic modifying agent.

68. The method of claim 66 or 67, wherein the standardized level of methylation of the DNA is a predetermined level of methylation of the DNA known to enhance or repress the level of transcription of a target gene.

69. The method of any one of the preceding claims, wherein the level of DNA methylation of the one or more biomarkers is at least 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, or 20-fold higher than DNA methylation of the control.

70. The method of any one of the preceding claims, wherein the level of DNA methylation of the one or more biomarkers is at least 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, or 20-fold lower than DNA methylation of the control.

71. The method of any one of claims 1-8, 12-22, 25-55, and 58-70, wherein the target gene is MYC.

72. The method of claim 71, wherein the biomarker is the MYC locus.

73. The method of claim 71 or 72, wherein the biomarker is the MYC promoter.

74. The method of any one of claims 71-73, wherein the biomarker is located within 50 kb of the MYC gene.

75. The method of any one of claims 71-74, wherein the biomarker is located within 5 kb, 1 kb, 500 bp or 100 bp of the MYC gene.

76. The method of any one of claims 71-75, wherein the biomarker is located in the promoter of the MYC gene.

77. The method of any one of claims 71-76, wherein the DNA comprises a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide identity to SEQ ID NO: 123.

78. The method of any one of claims 71-77, wherein the biomarker is located within 50 kb of SEQ ID NOs: 4, 75-86, or 199-206.

79. The method of any one of claims 71-78, wherein the biomarker is located within 5 kb, 1 kb, 500 bp or 100 bp of SEQ ID NOs: 4, 75-86, or 203-206.

80. The method of any one of preceding claims 71-79, wherein the biomarker is located within 100 bp of SEQ ID NOs: 4, 75-86, or 203-206.

81. The method of any one of claims 1-8, 12-22, 25-55, and 58-70, wherein the target gene is SFRP1.

82. The method of claim 81, wherein the biomarker is the SFRP1 promoter.

83. The method of any one of claims 1-8, 12-22, 25-55, and 58-70, wherein the target gene isHNF4a.

84. The method of claim 83, wherein the biomarker is the HNF4a promoter.

85. The method of any one of claims 1-8, 12-22, 25-55, and 58-70, wherein the target gene is APOB.

86. The method of claim 85, wherein the biomarker is the APOB promoter.

87. The method of any one of claims 1-5, 9-20, 23-39, 56, and 57, wherein the target gene is FOXP3.

88. The method of claim 87, wherein the biomarker is the FOXP3 promoter.

89. The method of any one of claims 1-88, wherein the one or more biomarkers comprises1) a primary biomarker, wherein the primary biomarker is the target gene or DNA sequence located within 1 kb of the target gene; and / or2) one or more secondary biomarkers, wherein the secondary biomarker is a gene other than the target gene, and wherein the expression and / or methylation status of the secondary biomarker is modified as a result of the epigenetic modifying agent repressing or enhancing expression of the target gene.

90. The method of claim 89, wherein the primary biomarker is selected from the group consisting of MYC, SFRP1, HNF4a, FOXP3, and APOB.

91. The method of claim 90, wherein the primary biomarker is MYC.

92. The method of claim 91, wherein the one or more secondary biomarkers are selected from the group consisting of L1TD1, H19, GAPDH, MEG3, ZIM2 / PEG3, IGHD, IGHG1, CDKN2A, MT1M, MT IE, and HHIP.

93. The method of any one of the preceding claims, further comprising obtaining the biological sample from the subject.

94. The method of any one of claims 1-93, further comprising a. determining whether a measured level of DNA methylation of the one or more biomarkers in a second biological sample obtained from the subject who has received the second dose of the epigenetic modifying agent is higher than, less than or equal to a control level; and b. administering a third dose of the epigenetic modifying agent to the subject.

95. The method of claim 94, further comprising measuring the level of DNA methylation in the second biological sample.

96. The method of claim 92 or 95,(a) wherein the epigenetic modifying agent achieves therapeutic effect by methylating the DNA; and wherein(i) the level of DNA methylation in the biological sample is less than or equal to the control level and wherein the subject is administered a third dose of the epigenetic modifying agent that is higher than the second dose of the epigenetic modifying agent; or(ii) the level of DNA methylation in the biological sample is higher than the control level and wherein the subject is administered a third dose of the epigenetic modifying agent that is less than or equal to the second dose of the epigenetic modifying agent; or(b) wherein the epigenetic modifying agent achieves therapeutic effect by demethylating the DNA, and wherein(i) the level of methylation in the biological sample is higher than the control level and wherein the subject is administered a third dose of the epigenetic modifying agent that is higher than the second dose of the epigenetic modifying agent; or(ii) the level of methylation in the biological sample is less than or equal to the control level and wherein the subject is administered a third dose of the epigenetic modifying agent that is less than or equal to the second dose of the epigenetic modifying agent.

97. The method of any one of the preceding claims, wherein the subject has cancer.

98. The method of claim 97, wherein the cancer is hepatocellular carcinoma (HCC).

99. The method of claim 97, wherein the cancer is non-small cell lung cancer (NSCLC).