Novel crispr enzyme, and system and application

Abstract

Provided is a Cas enzyme, which belongs to the field of nucleic acid editing, specifically the technical field of clustered regularly interspaced short palindromic repeats (CRISPR), and has wide application prospects in the field of gene editing.

Description

A novel CRISPR enzyme and system and its applications

[0001] This application claims priority to Chinese patent application CN202311235588.4, filed on September 25, 2023. This application incorporates the entire text of the aforementioned Chinese patent application. Technical Field

[0002] The present invention relates to the field of gene editing, in particular to the technology of clustered regularly interspaced short palindromic repeats (CRISPR). Specifically, the present invention has screened a new type of Cas enzyme and developed corresponding gene editing tools and their applications based on the new Cas enzyme. Background Art

[0003] CRISPR / Cas technology is a widely used gene editing technology that uses RNA to guide specific binding to target sequences on the genome and cut DNA to produce double-strand breaks, and uses biological non-homologous end joining or homologous recombination to perform site-directed gene editing.

[0004] The CRISPR / Cas9 system is the most commonly used Type II CRISPR system, which recognizes a 3'-NGG PAM motif and performs blunt-end cleavage on target sequences. A newly discovered class of CRISPR / Cas systems, Type V, utilizes a 5'-TTN motif and performs sticky-end cleavage on target sequences. Examples include Cpf1, C2c1, CasX, and CasY. However, the various CRISPR / Cas systems currently available have varying advantages and disadvantages. For example, Cas9, C2c1, and CasX all require two guide RNAs, while Cpf1 requires only a single guide RNA and can be used for multiplexed gene editing. CasX is 980 amino acids long, while the more common Cas9, C2c1, CasY, and Cpf1 are typically around 1300 amino acids. Furthermore, the PAM sequences of Cas9, Cpf1, CasX, and CasY are more complex and diverse, while C2c1 recognizes a strict 5'-TTN motif, making its target site more predictable than other systems, thereby reducing potential off-target effects.

[0005] In summary, given that the currently available CRISPR / Cas systems are limited by some defects, the development of a new CRISPR / Cas system that is more robust and has good performance in many aspects is of great significance to the development of biotechnology.

[0006] Summary of the Invention

[0007] After extensive experiments and repeated exploration, the inventors of this application unexpectedly discovered a new type of nuclease (Cas enzyme). Based on this discovery, the inventors developed a new CRISPR / Cas system and a gene editing method and nucleic acid detection method based on this system.

[0008] Cas effector proteins

[0009] On the one hand, the present invention provides a Cas protein, which is an effector protein in the CRISPR / Cas system. In the present invention, it is referred to as Cas-sf6728, and the amino acid sequence of Cas-sf6728 protein is shown in SEQ ID No. 1.

[0010] In one embodiment, the amino acid sequence of the Cas protein has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to SEQ ID No. 1, and substantially retains the biological function of the sequence from which it is derived. Preferably, the Cas protein is derived from the same species as Cas-sf6728.

[0011] In one embodiment, the Cas protein amino acid sequence has one or more amino acid substitutions, deletions or additions compared to the SEQ ID No. 1 sequence; and substantially retains the biological function of the sequence from which it is derived; the one or more amino acid substitutions, deletions or additions include 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions, deletions or additions.

[0012] In one embodiment, the Cas protein is a derivatized protein with the same biological function as the protein having the sequence shown in SEQ ID No. 1.

[0013] In one embodiment, the amino acid sequence of the Cas protein is shown as SEQ ID No. 1.

[0014] In one embodiment, the Cas protein has a mutation (e.g., any 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid positions) at any one of the following amino acid positions corresponding to the amino acid sequence shown in SEQ ID No. 1: position 36, position 39, position 65, position 69, position 73, position 75, 119, position 122, position 132, position 154, position 155, position 156, position 157, position 171, position 186, position 191, position 195, position 208, position 264, position 278, position 281, position 296, position 304, position 342, position 344.

[0015] In one embodiment, the Cas protein has mutations at amino acid positions 65 and 75 corresponding to the amino acid sequence shown in SEQ ID No. 1 compared to SEQ ID No. 1.

[0016] In one embodiment, the amino acid sequence of the Cas protein has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to the sequence of SEQ ID No. 1; and the amino acid sequence of the Cas protein has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to the sequence of SEQ ID No. 1. No. 1 has a mutation at any one or several of the following amino acid positions (for example, any 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid positions): position 36, position 39, position 65, position 69, position 73, position 75, position 119, position 122, position 132, position 154, position 155, position 156, position 157, position 171, position 186, position 191, position 195, position 208, position 264, position 278, position 281, position 296, position 304, position 342, and position 344.

[0017] In one embodiment, the amino acid at position 36 is mutated to an amino acid other than T, for example, A, V, G, L, Q, F, W, Y, D, K, E, N, M, S, C, P, H, R, I; preferably, W.

[0018] In one embodiment, the amino acid at position 39 is mutated to a non-D amino acid, for example, A, V, G, L, Q, F, W, Y, S, K, E, N, M, T, C, P, H, R, I; preferably, L.

[0019] In one embodiment, the amino acid at position 65 or the amino acid at position 191 is mutated to a non-L amino acid, for example, A, V, G, Y, Q, F, W, S, D, K, E, N, M, T, C, P, H, R, I; preferably, R.

[0020] In one embodiment, the amino acid at position 69, the amino acid at position 154, or the amino acid at position 278 is mutated to a non-S amino acid, for example, A, V, G, Y, Q, F, W, L, D, K, E, N, M, T, C, P, H, R, I; preferably, R.

[0021] In one embodiment, the amino acid at position 73 or the amino acid at position 119 or the amino acid at position 155 or the amino acid at position 281 or the amino acid at position 344 is mutated to an amino acid other than A, for example, S, V, G, Y, Q, F, W, L, D, K, E, N, M, T, C, P, H, R, I; preferably, R.

[0022] In one embodiment, the amino acid at position 75 is mutated to an amino acid other than V, for example, A, D, G, L, Q, F, W, Y, S, K, E, N, M, T, C, P, H, R, I; preferably, R.

[0023] In one embodiment, the amino acid at position 122, the amino acid at position 195, or the amino acid at position 264 is mutated to an amino acid other than T, for example, A, V, G, Y, Q, F, W, L, D, K, E, N, M, S, C, P, H, R, I; preferably, R.

[0024] In one embodiment, the amino acid at position 132 is mutated to an amino acid other than N, for example, A, D, G, L, Q, F, W, Y, S, K, E, V, M, T, C, P, H, R, I; preferably, R.

[0025] In one embodiment, amino acid 157 or amino acid 296 is mutated to a non-D amino acid, for example, A, V, G, Y, Q, F, W, S, L, K, E, N, M, T, C, P, H, R, I; preferably, R.

[0026] In one embodiment, the amino acid at position 156, the amino acid at position 171, or the amino acid at position 342 is mutated to a non-Q amino acid, for example, A, V, G, Y, T, F, W, L, D, K, E, N, M, S, C, P, H, R, I; preferably, R.

[0027] In one embodiment, the amino acid at position 186 or the amino acid at position 208 is mutated to an amino acid other than E, for example, A, V, G, Y, Q, F, W, S, L, K, D, N, M, T, C, P, H, R, I; preferably, R.

[0028] In one embodiment, the amino acid at position 304 is mutated to a non-H amino acid, for example, A, D, G, L, Q, F, W, Y, S, K, E, V, M, T, C, P, N, R, I; preferably, R.

[0029] In one embodiment, the Cas protein has a mutation (e.g., any 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid positions) at any one of the following amino acid positions corresponding to the amino acid sequence shown in SEQ ID No. 1, compared with the amino acid sequence of the parent Cas protein: position 36, position 39, position 65, position 69, position 73, position 75, 119, position 122, position 132, position 154, position 155, position 156, position 157, position 171, position 186, position 191, position 195, position 208, position 264, position 278, position 281, position 296, position 304, position 342, position 344.

[0030] In one embodiment, the Cas protein has mutations at amino acid positions 65 and 75 corresponding to the amino acid sequence shown in SEQ ID No. 1 compared to the amino acid sequence of the parent Cas protein.

[0031] In one embodiment, the parent Cas protein is a natural wild-type Cas protein; in other embodiments, the parent Cas protein is an engineered Cas protein.

[0032] Cas proteins from a variety of organisms can be used as parent Cas proteins, and in some embodiments, the parent Cas proteins have nuclease activity. In some embodiments, the parent Cas protein is a nuclease, i.e., it cuts two chains of a target double-helical nucleic acid (e.g., double-helical DNA). In some embodiments, the parent Cas protein is a nickase, i.e., it cuts a single strand of a target double-helical nucleic acid (e.g., double-helical DNA).

[0033] In one embodiment, the parent Cas protein is a Cas protein of the Cas12f family, the Cas14 family, or the CasZ family.

[0034] In one embodiment, the amino acid sequence of the Cas protein of the Cas12f family, Cas14 family, or CasZ family is at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% or 100% identical to SEQ ID No. 1.

[0035] In one embodiment, the amino acid sequence of the parent Cas protein has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to SEQ ID No. 1.

[0036] In one embodiment, the amino acid sequence of the parent Cas protein is shown in SEQ ID No. 1.

[0037] In some embodiments, the Cas protein of the invention is capable of recognizing a protospacer adjacent motif (PAM), and the target nucleic acid comprises or consists of the PAM.

[0038] Those skilled in the art will appreciate that the structure of a protein can be altered without adversely affecting its activity and functionality. For example, one or more conservative amino acid substitutions can be introduced into a protein's amino acid sequence without adversely affecting the activity and / or three-dimensional structure of the protein molecule. Those skilled in the art will appreciate examples and implementations of conservative amino acid substitutions. Specifically, an amino acid residue can be substituted with another amino acid residue belonging to the same group as the substituted residue, i.e., a non-polar amino acid residue can be substituted for another non-polar amino acid residue, a polar uncharged amino acid residue can be substituted for another polar uncharged amino acid residue, a basic amino acid residue can be substituted for another basic amino acid residue, and an acidic amino acid residue can be substituted for another acidic amino acid residue. Such substituted amino acid residues may or may not be encoded by the genetic code. Conservative substitutions, where one amino acid is replaced with another amino acid belonging to the same group, fall within the scope of the present invention, as long as the substitution does not inactivate the biological activity of the protein. Therefore, the proteins of the present invention may contain one or more conservative substitutions in their amino acid sequences, preferably generated by substitutions according to the table below. Furthermore, the present invention also encompasses proteins containing one or more other non-conservative substitutions, as long as such non-conservative substitutions do not significantly affect the desired function and biological activity of the proteins of the present invention.

[0039] Conservative amino acid replacement can be carried out at one or more predicted non-essential amino acid residues.A "non-essential" amino acid residue is an amino acid residue that can be changed (deleted, substituted or replaced) without changing biological activity, while an "essential" amino acid residue is required for biological activity.A "conservative amino acid replacement" is a replacement in which an amino acid residue is replaced by an amino acid residue with a similar side chain.Amino acid replacement can be carried out in the non-conserved region of the above-mentioned Cas protein.In general, such replacement is not carried out on conserved amino acid residues, or on amino acid residues located within a conserved motif, where such residues are required for protein activity.However, it will be appreciated by those skilled in the art that functional variants can have fewer conservative or non-conservative changes in conserved regions.

[0040] It is well known in the art that one or more amino acid residues can be changed (replaced, deleted, truncated or inserted) from the N and / or C terminus of a protein while still retaining its functional activity. Therefore, proteins in which one or more amino acid residues are changed from the N and / or C terminus of a Cas protein while retaining its desired functional activity are also within the scope of the present invention. These changes may include changes introduced by modern molecular methods such as PCR, which includes PCR amplification of a protein coding sequence by means of including an amino acid coding sequence among the oligonucleotides used in the PCR amplification.

[0041] It will be appreciated that proteins can be altered in various ways, including amino acid substitutions, deletions, truncations, and insertions, and methods for such manipulations are generally known in the art. For example, amino acid sequence variants of the above-described proteins can be prepared by mutations in the DNA. Other forms of mutagenesis and / or directed evolution can also be accomplished, for example, using known mutagenesis, recombination, and / or shuffling methods, in combination with relevant screening methods, to perform single or multiple amino acid substitutions, deletions, and / or insertions.

[0042] Those skilled in the art will appreciate that these minor amino acid changes in the Cas proteins of the present invention can occur (e.g., naturally occurring mutations) or be generated (e.g., using r-DNA technology) without loss of protein function or activity. If these mutations occur in the catalytic domain, active site, or other functional domains of the protein, the properties of the polypeptide may be changed, but the polypeptide may retain its activity. If the mutations present are not close to the catalytic domain, active site, or other functional domains, a smaller effect can be expected.

[0043] Those skilled in the art can identify the essential amino acids of the Cas protein of the present invention according to methods known in the art, such as site-directed mutagenesis or protein evolution or analysis of bioinformatics systems. The catalytic domain, active site or other functional domain of the protein can also be determined by physical analysis of the structure, such as by the following techniques: such as nuclear magnetic resonance, crystallography, electron diffraction or photoaffinity labeling, combined with mutations of amino acids at putative key sites.

[0044] The biological functions include, but are not limited to, the activity of binding to the guide RNA, the endonuclease activity, the activity of binding to and cutting a specific site of the target sequence under the guidance of the guide RNA, including but not limited to Cis cleavage activity and Trans cleavage activity.

[0045] The present invention also provides a fusion protein, which includes the Cas protein as described above and other modified parts.

[0046] In one embodiment, the modifying moiety is selected from another protein or polypeptide, a detectable label, or any combination thereof.

[0047] In one embodiment, the modifying portion is selected from an epitope tag, a reporter gene sequence, a nuclear localization signal (NLS) sequence, a targeting portion, a transcriptional activation domain (e.g., VP64), a transcriptional repression domain (e.g., a KRAB domain or a SID domain), a nuclease domain (e.g., Fok1), and a domain having an activity selected from the following: nucleotide deaminase, methylase activity, demethylase, transcriptional activation activity, transcriptional repression activity, transcription release factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, single-stranded DNA cleavage activity, double-stranded DNA cleavage activity and nucleic acid binding activity; and any combination thereof. The NLS sequence is well known to those skilled in the art, and examples thereof include, but are not limited to, the SV40 large T antigen, EGL-13, c-Myc and TUS protein.

[0048] In one embodiment, the NLS sequence is located at, near, or proximal to a terminus (e.g., the N-terminus, the C-terminus, or both) of the Cas protein of the invention.

[0049] The epitope tag is well known to those skilled in the art, including but not limited to His, V5, FLAG, HA, Myc, VSV-G, Trx, etc., and those skilled in the art can select other suitable epitope tags (for example, purification, detection or tracing).

[0050] The reporter gene sequence is well known to those skilled in the art, and examples thereof include but are not limited to GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP, etc.

[0051] In one embodiment, the fusion protein of the present invention comprises a domain capable of binding to a DNA molecule or an intracellular molecule, such as maltose binding protein (MBP), the DNA binding domain (DBD) of Lex A, the DBD of GAL4, and the like.

[0052] In one embodiment, the fusion protein of the invention comprises a detectable label, such as a fluorescent dye, eg, FITC or DAPI.

[0053] In one embodiment, the Cas protein of the present invention is optionally coupled, conjugated or fused to the modifying portion via a linker.

[0054] In one embodiment, the modification portion is directly linked to the N-terminus or C-terminus of the Cas protein of the present invention.

[0055] In one embodiment, the modified portion is connected to the N-terminus or C-terminus of the Cas protein of the present invention via a linker. Such linkers are well known in the art, and examples thereof include but are not limited to linkers comprising one or more (e.g., 1, 2, 3, 4 or 5) amino acids (e.g., Glu or Ser) or amino acid derivatives (e.g., Ahx, β-Ala, GABA or Ava), or PEG, etc.

[0056] The Cas protein, protein derivative or fusion protein of the present invention is not limited by the method of its production. For example, it can be produced by genetic engineering methods (recombinant technology) or by chemical synthesis methods.

[0057] Cas protein nucleic acid

[0058] In another aspect, the present invention provides an isolated polynucleotide comprising:

[0059] (a) a polynucleotide sequence encoding the Cas protein or fusion protein of the present invention;

[0060] (b) a polynucleotide whose sequence is shown in SEQ ID No. 2;

[0061] (c) a sequence having one or more base substitutions, deletions or additions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 base substitutions, deletions or additions) compared to the sequence shown in SEQ ID No. 2;

[0062] (d) a polynucleotide having a nucleotide sequence identity of ≥80% (preferably ≥90%, more preferably ≥95%, and most preferably ≥98%) to the sequence shown in SEQ ID No. 2 and encoding the polypeptide shown in SEQ ID No. 1; or

[0063] (e) A polynucleotide complementary to the polynucleotide described in any one of (a) to (d).

[0064] In one embodiment, the nucleotide sequence described in any one of (a)-(e) is codon optimized for expression in prokaryotes. In one embodiment, the nucleotide sequence described in any one of (a)-(e) is codon optimized for expression in eukaryotic cells.

[0065] In one embodiment, the polynucleotide is preferably single-stranded or double-stranded.

[0066] Guide RNA (gRNA)

[0067] On the other hand, the present invention provides a gRNA, which includes tracrRNA and crRNA; tracrRNA can pair with the pairing region of crRNA to form a duplex; crRNA also includes a region that hybridizes with the target sequence (i.e., a targeting sequence that targets the nucleic acid).

[0068] It is known in the art that Cas proteins need to target target sequences under the action of gRNA (guide RNA), which includes tracrRNA and crRNA; the 3' end of tracrRNA can form a pairing region with the 5' end of crRNA, and the 3' end of crRNA includes a region that hybridizes with the target sequence (i.e., the targeting sequence).

[0069] In one embodiment, the gRNA (from 5' to 3') includes tracrRNA and crRNA, and the crRNA includes a pairing region sequence with the tracrRNA and a targeting sequence.

[0070] In one embodiment, the gRNA (from 5' to 3') includes tracrRNA, a pairing region sequence between crRNA and tracrRNA, and a targeting sequence of crRNA.

[0071] In one embodiment, the gRNA further comprises a linker between the tracrRNA and the crRNA. Preferably, the sequence of the linker is GAAA.

[0072] In one embodiment, the gRNA (from 5' to 3') consists of tracrRNA, a linker, a pairing region sequence between crRNA and tracrRNA, and a targeting sequence of crRNA.

[0073] In one embodiment, the gRNA includes a non-targeting sequence and a targeting sequence in sequence from the 5' to the 3' end, and the non-targeting sequence includes tracrRNA, crRNA and the pairing region sequence of tracrRNA.

[0074] In one embodiment, the gRNA includes a non-targeting sequence and a targeting sequence in sequence from 5' to 3' end, and the non-targeting sequence includes tracrRNA, a connecting portion, and a pairing region sequence of crRNA and tracrRNA in sequence from 5' to 3' end.

[0075] In one embodiment, the pairing region sequence of the crRNA and tracrRNA is shown as SEQ ID No. 3.

[0076] In one embodiment, the sequence of the tracrRNA is shown as SEQ ID No. 4.

[0077] In one embodiment, the non-targeting sequence of the gRNA is as shown in SEQ ID No.5, or the non-targeting sequence of the gRNA has a base mutation compared with SEQ ID No.5.

[0078] In one embodiment, the base mutation includes base deletion, base substitution or base insertion.

[0079] In one embodiment, the base mutation is selected from any one or any combination of the following (1)-(20):

[0080] (1) Compared with SEQ ID No. 5, bases 1 to 12 are missing;

[0081] (2) Compared with SEQ ID No. 5, bases 1 to 26 are missing;

[0082] (3) Compared with SEQ ID No. 5, bases 13-26 and 158-172 are missing;

[0083] (4) Compared with SEQ ID No. 5, the A at position 29 was mutated to C, and the U at position 155 was mutated to G;

[0084] (5) Compared with SEQ ID No. 5, the U at position 31 was mutated to C, and the A at position 154 was mutated to G;

[0085] (6) Compared with SEQ ID No. 5, U is added between position 155 U and position 156 G;

[0086] (7) Compared with SEQ ID No. 5, the A at position 29 was mutated to C, the U at position 31 was mutated to C, the A at position 154 was mutated to G, and the U at position 155 was mutated to G;

[0087] (8) Compared with SEQ ID No. 5, the A at position 74 was mutated to C, and the U at position 88 was mutated to G;

[0088] (9) Compared with SEQ ID No. 5, the U at position 100 was mutated to C, and the A at position 119 was mutated to G;

[0089] (10), compared with SEQ ID No. 5, the U at position 105 was mutated to C, and the A at position 114 was mutated to G;

[0090] (11) Compared with SEQ ID No. 5, the U at position 100 was mutated to C, the U at position 105 was mutated to C, the A at position 114 was mutated to G, and the A at position 119 was mutated to G;

[0091] (12) Compared with SEQ ID No. 5, the U at position 124 was mutated to G, and the A at position 143 was mutated to C;

[0092] (13) Compared with SEQ ID No. 5, the A at position 126 was mutated to G, and the U at position 141 was mutated to C;

[0093] (14), compared with SEQ ID No. 5, U is added between G at position 127 and G at position 128;

[0094] (15) Compared with SEQ ID No. 5, the U at position 124 was mutated to G, the A at position 126 was mutated to G, the U at position 141 was mutated to C, and the A at position 143 was mutated to C;

[0095] (16), compared with SEQ ID No. 5, bases 198-201 are missing;

[0096] (17), compared with SEQ ID No. 5, bases 192-200 are missing;

[0097] (18), compared with SEQ ID No. 5, bases 205-209 are missing;

[0098] (19), compared with SEQ ID No. 5, bases 205-217 are missing;

[0099] (20) Compared with SEQ ID No. 5, bases 205-222 are missing.

[0100] In one embodiment, the above-mentioned base mutation is selected from any two combinations of the above-mentioned (1)-(20), for example, (1) and (3), (1) and (13), (3) and (13), (5) and (6), (5) and (13), (13) and (17).

[0101] In one embodiment, the above base mutation is a combination of (1) and (3), i.e., deletion of bases 1-26 and 158-172.

[0102] In one embodiment, the above base mutations are a combination of (1) and (13), i.e., bases 1 to 12 are deleted, A at position 126 is mutated to G, and U at position 141 is mutated to C.

[0103] In one embodiment, the above base mutations are a combination of (3) and (13), i.e., bases 13-26 and 158-172 are deleted, A at position 126 is mutated to G, and U at position 141 is mutated to C.

[0104] In one embodiment, the above base mutations are a combination of (5) and (6), that is, U at position 31 is mutated to C, A at position 154 is mutated to G, and U is added between U at position 155 and G at position 156.

[0105] In one embodiment, the above base mutations are a combination of (5) and (13), that is, U at position 31 mutates to C, A at position 154 mutates to G, A at position 126 mutates to G, and U at position 141 mutates to C.

[0106] In one embodiment, the above base mutations are a combination of (13) and (17), that is, A at position 126 is mutated to G, U at position 141 is mutated to C, and bases 192-200 are deleted.

[0107] In one embodiment, the sequence of the gRNA includes any one of SEQ ID No. 5-31.

[0108] In one embodiment, the non-targeting sequence of the gRNA is shown in any one of SEQ ID No. 5-31.

[0109] In one embodiment, the gRNA of the present invention (also known as guide RNA or guide RNA) is composed of crRNA and tracrRNA molecules that are partially complementary to form a complex, wherein the crRNA comprises a sequence that is sufficiently complementary to the target sequence to hybridize with the complementary sequence of the target sequence and guide the Cas enzyme to bind to the target sequence in a sequence-specific manner. The gRNA of the present invention includes tracrRNA and crRNA.

[0110] The targeting sequence of the targeting nucleic acid of the present invention or the targeting section of the targeting nucleic acid comprises a nucleotide sequence complementary to the sequence in the target nucleic acid. In other words, the targeting sequence of the targeting nucleic acid of the present invention or the targeting section of the targeting nucleic acid interacts with the target nucleic acid in a sequence-specific manner through hybridization (i.e., base pairing). Therefore, the targeting sequence of the targeting nucleic acid or the targeting section of the targeting nucleic acid can be changed, or can be modified to hybridize any desired sequence in the target nucleic acid. The nucleic acid is selected from DNA or RNA.

[0111] The percent complementarity between the targeting sequence of a targeting nucleic acid or the targeting segment of a targeting nucleic acid and the target sequence of a target nucleic acid can be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%).

[0112] The gRNA of the present invention guides its interacting Cas protein to a specific nucleotide sequence within the target nucleic acid through the action of the targeting sequence of the targeting nucleic acid.

[0113] The gRNA of the present invention is capable of forming a complex with the Cas protein.

[0114] The gRNA of the Cas-sf6728 protein of the present invention comprises a targeting sequence that hybridizes with a target nucleic acid, wherein the target nucleic acid includes a sequence located at the 3' end of the protospacer adjacent motif (PAM); the aforementioned PAM sequence is 5'-AAN-3', wherein N represents A / C / G / T.

[0115] carrier

[0116] The present invention also provides a vector comprising the Cas protein, isolated nucleic acid molecule or polynucleotide as described above; preferably, it further comprises a regulatory element operably linked thereto.

[0117] In one embodiment, the regulatory element is selected from one or more of the following groups: enhancer, transposon, promoter, terminator, leader sequence, polyadenylation sequence, marker gene.

[0118] In one embodiment, the vector includes a cloning vector, an expression vector, a shuttle vector, and an integration vector.

[0119] In some embodiments, the vector included in the system is a viral vector (e.g., a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated vector, and a herpes simplex vector), and can also be a plasmid, a virus, a cosmid, a phage, etc., which are well known to those skilled in the art.

[0120] CRISPR system

[0121] The present invention provides an engineered non-naturally occurring vector system, or a CRISPR-Cas system, which includes a Cas protein or a nucleic acid sequence encoding the Cas protein and a nucleic acid encoding one or more guide RNAs, wherein the guide RNA includes a region that binds to the Cas protein and a targeting sequence that targets the nucleic acid, or the guide RNA is the above-mentioned gRNA.

[0122] In one embodiment, the nucleic acid sequence encoding the Cas protein and the nucleic acid encoding one or more guide RNAs are artificially synthesized.

[0123] In one embodiment, the nucleic acid sequence encoding the Cas protein and the nucleic acid encoding one or more guide RNAs do not naturally occur together.

[0124] The one or more guide RNAs target one or more target sequences in the cell. The one or more target sequences hybridize to the genomic loci of the DNA molecules encoding the one or more gene products, and guide the Cas protein to the genomic loci of the DNA molecules encoding the one or more gene products. After the Cas protein reaches the target sequence position, it modifies, edits or cuts the target sequence, thereby changing or modifying the expression of the one or more gene products.

[0125] The cells of the present invention include one or more of animals, plants, or microorganisms.

[0126] In some embodiments, the Cas protein is codon-optimized for expression in a cell.

[0127] In some embodiments, the Cas protein directs cleavage of one or both strands at the location of the target sequence.

[0128] The present invention also provides an engineered non-naturally occurring vector system, which may include one or more vectors, wherein the one or more vectors include:

[0129] a) a first regulatory element, which is operably linked to the gRNA,

[0130] b) a second regulatory element, which is operably linked to the Cas protein;

[0131] Components (a) and (b) are located on the same or different carriers of the system.

[0132] The first and second regulatory elements include a promoter (e.g., a constitutive promoter or an inducible promoter), an enhancer (e.g., a 35S promoter or a 35S enhanced promoter), an internal ribosome entry site (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences).

[0133] In some embodiments, the vector in the system is a viral vector (e.g., a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated vector, and a herpes simplex vector), and can also be a plasmid, a virus, a cosmid, a phage, etc., which are well known to those skilled in the art.

[0134] In some embodiments, the systems provided herein are in a delivery system. In some embodiments, the delivery system is a nanoparticle, a liposome, an exosome, a microbubble, and a gene gun.

[0135] In one embodiment, the target sequence is a DNA or RNA sequence from a prokaryotic or eukaryotic cell. In one embodiment, the target sequence is a non-naturally occurring DNA or RNA sequence.

[0136] In one embodiment, the target sequence is present in a cell. In one embodiment, the target sequence is present in the nucleus or in the cytoplasm (e.g., an organelle). In one embodiment, the cell is a eukaryotic cell. In other embodiments, the cell is a prokaryotic cell.

[0137] In one embodiment, the Cas protein is connected to one or more NLS sequences. In one embodiment, the fusion protein comprises one or more NLS sequences. In one embodiment, the NLS sequence is connected to the N-terminus or C-terminus of the protein. In one embodiment, the NLS sequence is fused to the N-terminus or C-terminus of the protein.

[0138] On the other hand, the present invention relates to an engineered CRISPR system, comprising the above-mentioned Cas protein and one or more guide RNAs, wherein the guide RNA includes a region that binds to the Cas protein and a targeting sequence that targets nucleic acid, and the Cas protein is capable of binding to the guide RNA and targeting a target nucleic acid sequence complementary to the targeting sequence, or the guide RNA is the above-mentioned gRNA.

[0139] In one embodiment, the Cas enzyme is Cas-sf6728, the target nucleic acid is DNA (preferably, double-stranded DNA), the target nucleic acid is located at the 3' end of the protospacer adjacent motif (PAM), and the PAM is 5'-AAN-3', wherein N represents A / C / G / T.

[0140] Protein-nucleic acid complexes / compositions

[0141] In another aspect, the present invention provides a compound or composition comprising:

[0142] (i) a protein component selected from the group consisting of: the above-mentioned Cas proteins, derivatized proteins or fusion proteins, and any combination thereof; and

[0143] (ii) a nucleic acid component selected from: gRNA, or a nucleic acid encoding the gRNA, or a precursor RNA of the gRNA, or a precursor RNA nucleic acid encoding the gRNA; the gRNA includes a region that binds to the Cas protein and a targeting sequence that targets the nucleic acid.

[0144] The protein component and the nucleic acid component combine with each other to form a complex.

[0145] In one embodiment, the nucleic acid component is a guide RNA in a CRISPR-Cas system.

[0146] In one embodiment, the complex or composition is non-naturally occurring or modified. In one embodiment, at least one component of the complex or composition is non-naturally occurring or modified. In one embodiment, the first component is non-naturally occurring or modified; and / or the second component is non-naturally occurring or modified.

[0147] Activated CRISPR complex

[0148] On the other hand, the present invention also provides an activated CRISPR complex, the activated CRISPR complex comprising: (1) a protein component selected from: a Cas protein, a derivatized protein or a fusion protein of the present invention, and any combination thereof; (2) a nucleic acid component selected from: a gRNA, or a nucleic acid encoding the gRNA, or a precursor RNA of the gRNA, or a precursor RNA nucleic acid encoding the gRNA; the gRNA includes a region that binds to the Cas protein and a targeting sequence that targets the nucleic acid; and (3) a target sequence bound to the gRNA. Preferably, the binding is carried out by binding the targeting sequence of the targeting nucleic acid on the gRNA to the target nucleic acid.

[0149] As used herein, the terms "activated CRISPR complex," "activated complex," or "ternary complex" refer to the complex formed after the Cas protein, gRNA, and target nucleic acid in the CRISPR system are bound or modified.

[0150] The Cas protein and gRNA of the present invention can form a binary complex that is activated when bound to a nucleic acid substrate to form an activated CRISPR complex. The nucleic acid substrate is complementary to the targeting sequence in the gRNA (or referred to as a guide sequence that hybridizes with the target nucleic acid). In some embodiments, the targeting sequence of the gRNA fully matches the target substrate. In other embodiments, the targeting sequence of the gRNA matches a portion (continuous or discontinuous) of the target substrate.

[0151] In a preferred embodiment, the activated CRISPR complex can exhibit collateral nuclease cleavage activity, which refers to the non-specific cleavage activity or random cleavage activity of the activated CRISPR complex on single-stranded nucleic acids, also known as trans cleavage activity in the art.

[0152] Delivery and delivery compositions

[0153] The Cas proteins, gRNAs, fusion proteins, nucleic acid molecules, vectors, systems, complexes and compositions of the present invention can be delivered by any method known in the art. Such methods include, but are not limited to, electroporation, lipofection, nucleofection, microinjection, sonoporation, gene guns, calcium phosphate-mediated transfection, cationic transfection, lipofection, dendritic transfection, heat shock transfection, nucleofection, magnetofection, lipofection, puncture transfection, optical transfection, reagent-enhanced nucleic acid uptake, and delivery via liposomes, immunoliposomes, viral particles, artificial virions, etc.

[0154] Therefore, in another aspect, the present invention provides a delivery composition comprising a delivery vector and one or more selected from the following: the Cas protein, fusion protein, nucleic acid molecule, vector, system, complex and composition of the present invention.

[0155] In one embodiment, the delivery vehicle is a particle.

[0156] In one embodiment, the delivery vehicle is selected from lipid particles, sugar particles, metal particles, protein particles, liposomes, exosomes, microvesicles, gene guns or viral vectors (e.g., replication-defective retroviruses, lentiviruses, adenoviruses or adeno-associated viruses).

[0157] host cells

[0158] The present invention also relates to an in vitro, ex vivo or in vivo cell or cell line or their progeny, wherein the cell or cell line or their progeny comprises: the Cas protein, fusion protein, nucleic acid molecule, gRNA, protein-nucleic acid complex, activated CRISPR complex, vector, and delivery composition of the present invention.

[0159] In certain embodiments, the cell is a prokaryotic cell.

[0160] In certain embodiments, the cell is a eukaryotic cell. In certain embodiments, the cell is a mammalian cell. In certain embodiments, the cell is a human cell. In certain embodiments, the cell is a non-human mammalian cell, such as a cell of a non-human primate, cattle, sheep, pig, dog, monkey, rabbit, rodent (such as rat or mouse). In certain embodiments, the cell is a non-mammalian eukaryotic cell, such as a cell of poultry (such as chicken), fish or crustacean (such as clams, shrimp). In certain embodiments, the cell is a plant cell, such as a cell or cultivated plant or food crop such as cassava, corn, sorghum, soybean, wheat, oat or rice that a monocot or dicot has, such as an algae, tree or production plant, fruit or vegetable (for example, trees such as citrus trees, nut trees; Solanaceae, cotton, tobacco, tomato, grape, coffee, cocoa, etc.).

[0161] In certain embodiments, the cell is a stem cell or a stem cell line.

[0162] In certain cases, the host cells of the invention comprise genetic or genomic modifications that are not present in their wild-type form.

[0163] Gene Editing Methods and Applications

[0164] The Cas protein, nucleic acid, gRNA, composition, CIRSPR / Cas system, vector system, delivery composition, activated CRISPR complex, or host cell of the present invention can be used for any one or more of the following purposes: targeting and / or editing target nucleic acid; cutting double-stranded DNA, single-stranded DNA, or single-stranded RNA; non-specific cutting and / or degradation of side branch nucleic acid; non-specific cutting of single-stranded nucleic acid; nucleic acid detection; detection of nucleic acid in target sample; specific editing of double-stranded nucleic acid; base editing of double-stranded nucleic acid; base editing of single-stranded nucleic acid. In other embodiments, it can also be used to prepare reagents or kits for any one or more of the above purposes.

[0165] The present invention also provides the use of the above-mentioned Cas protein, nucleic acid, gRNA, composition, CIRSPR / Cas system, vector system, delivery composition or activated CRISPR complex in gene editing, gene targeting or gene cleavage; or, use in the preparation of reagents or kits for gene editing, gene targeting or gene cleavage.

[0166] In one embodiment, the gene editing, gene targeting or gene cleavage is performed inside and / or outside the cell.

[0167] The present invention also provides a method for editing a target nucleic acid, targeting a target nucleic acid, or cutting a target nucleic acid, the method comprising contacting the target nucleic acid with the above-mentioned Cas protein, nucleic acid, gRNA, composition, CIRSPR / Cas system, vector system, delivery composition, or activated CRISPR complex. In one embodiment, the method is to edit the target nucleic acid, target the target nucleic acid, or cut the target nucleic acid inside or outside the cell.

[0168] The gene editing or editing of target nucleic acid includes modifying genes, knocking out genes, changing the expression of gene products, repairing mutations, and / or inserting polynucleotides, gene mutations.

[0169] The editing can be performed in prokaryotic cells and / or eukaryotic cells.

[0170] On the other hand, the present invention also provides the use of the above-mentioned Cas protein, nucleic acid, gRNA, composition, CIRSPR / Cas system, vector system, delivery composition or activated CRISPR complex in nucleic acid detection, or in the preparation of reagents or kits for nucleic acid detection.

[0171] On the other hand, the present invention also provides a method for cutting single-stranded nucleic acids, the method comprising contacting a nucleic acid population with the above-mentioned Cas protein and gRNA, wherein the nucleic acid population comprises a target nucleic acid and a plurality of non-target single-stranded nucleic acids, and the Cas protein cuts the plurality of non-target single-stranded nucleic acids.

[0172] The gRNA is capable of binding to the Cas protein.

[0173] The gRNA is capable of targeting the target nucleic acid.

[0174] The contacting can be inside the cell in vitro, ex vivo or in vivo.

[0175] Preferably, the cleavage of the single-stranded nucleic acid is non-specific cleavage.

[0176] On the other hand, the present invention also provides the use of the above-mentioned Cas protein, nucleic acid, gRNA, composition, CIRSPR / Cas system, vector system, delivery composition or activated CRISPR complex in non-specific cleavage of single-stranded nucleic acid, or in the preparation of a reagent or kit for non-specific cleavage of single-stranded nucleic acid.

[0177] On the other hand, the present invention also provides a kit for gene editing, gene targeting or gene cleavage, which comprises the above-mentioned Cas protein, nucleic acid, gRNA, composition, CIRSPR / Cas system, vector system, delivery composition, activated CRISPR complex or host cell.

[0178] On the other hand, the present invention also provides a kit for detecting a target nucleic acid in a sample, the kit comprising: (a) a Cas protein, or a nucleic acid encoding the Cas protein; (b) a guide RNA, or a nucleic acid encoding the guide RNA, or a precursor RNA comprising the guide RNA, or a nucleic acid encoding the precursor RNA; and (c) a single-stranded nucleic acid detector that is single-stranded and does not hybridize with the guide RNA.

[0179] It is known in the art that precursor RNA can be cleaved or processed into the mature guide RNA described above.

[0180] In another aspect, the invention provides the use of the above-mentioned Cas protein, nucleic acid, gRNA, composition, CIRSPR / Cas system, vector system, delivery composition, activated CRISPR complex or host cell in preparing a preparation or kit, wherein the preparation or kit is used for:

[0181] (i) gene or genome editing;

[0182] (ii) target nucleic acid detection and / or diagnosis;

[0183] (iii) editing a target sequence in a target locus to modify an organism or non-human organism;

[0184] (iv) treatment of disease;

[0185] (v) targeting target genes;

[0186] (vi) Cutting the target gene.

[0187] Preferably, the above-mentioned gene or genome editing is performed inside or outside the cell.

[0188] Preferably, the target nucleic acid detection and / or diagnosis is performed in vitro.

[0189] Preferably, the treatment of the disease is the treatment of a condition caused by a defect in the target sequence in the target locus.

[0190] In another aspect, the present invention provides a method for detecting a target nucleic acid in a sample, the method comprising contacting the sample with the Cas protein, gRNA (guide RNA) and a single-stranded nucleic acid detector, the gRNA comprising a region that binds to the Cas protein and a targeting sequence that hybridizes with the target nucleic acid; detecting a detectable signal generated by the Cas protein cleaving the single-stranded nucleic acid detector, thereby detecting the target nucleic acid; the single-stranded nucleic acid detector does not hybridize with the gRNA.

[0191] Method for specifically modifying target nucleic acid

[0192] On the other hand, the present invention also provides a method for specifically modifying a target nucleic acid, the method comprising: contacting the target nucleic acid with the above-mentioned Cas protein, nucleic acid, gRNA, composition, CIRSPR / Cas system, vector system, delivery composition or activated CRISPR complex.

[0193] The specific modification can occur in vivo or in vitro.

[0194] The specific modification can occur inside or outside the cell.

[0195] In some cases, the cell is selected from a prokaryotic cell or a eukaryotic cell, eg, an animal cell, a plant cell, or a microbial cell.

[0196] In one embodiment, the modification refers to a break in the target sequence, such as a single-strand / double-strand break in DNA, or a single-strand break in RNA.

[0197] In some cases, the method further comprises contacting the target nucleic acid with a donor polynucleotide, wherein the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide is integrated into the target nucleic acid.

[0198] In one embodiment, the modification further comprises inserting an editing template (eg, an exogenous nucleic acid) into the break.

[0199] In one embodiment, the method further comprises: contacting the target nucleic acid with an editing template, or delivering the editing template to a cell containing the target nucleic acid. In this embodiment, the method repairs the broken target gene by homologous recombination with an exogenous template polynucleotide; in some embodiments, the repair results in a mutation comprising an insertion, deletion, or substitution of one or more nucleotides in the target gene; in other embodiments, the mutation results in one or more amino acid changes in a protein expressed from a gene containing the target sequence.

[0200] Detection (non-specific cleavage)

[0201] On the other hand, the present invention provides a method for detecting a target nucleic acid in a sample, the method comprising contacting the sample with the above-mentioned Cas protein, nucleic acid, gRNA, composition, CIRSPR / Cas system, vector system, delivery composition or activated CRISPR complex and a single-stranded nucleic acid detector; detecting a detectable signal generated by the Cas protein cutting the single-stranded nucleic acid detector, thereby detecting the target nucleic acid.

[0202] In the present invention, the target nucleic acid includes ribonucleotides or deoxyribonucleotides; including single-stranded nucleic acids and double-stranded nucleic acids, such as single-stranded DNA, double-stranded DNA, single-stranded RNA, and double-stranded RNA.

[0203] In one embodiment, the target nucleic acid is derived from a sample such as a virus, bacteria, microorganism, soil, water, human body, animal, plant, etc. Preferably, the target nucleic acid is a product enriched or amplified by methods such as PCR, NASBA, RPA, SDA, LAMP, HAD, NEAR, MDA, RCA, LCR, RAM, etc.

[0204] In one embodiment, the target nucleic acid is a viral nucleic acid, a bacterial nucleic acid, a specific nucleic acid associated with a disease, such as a specific mutation site or SNP site or a nucleic acid that differs from a control; preferably, the virus is a plant virus or an animal virus, for example, a papillomavirus, a hepadnavirus, a herpes virus, adenovirus, a poxvirus, a parvovirus, a coronavirus; preferably, the virus is a coronavirus, preferably, SARS, SARS-CoV2 (COVID-19), HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, Mers-Cov.

[0205] In the present invention, the gRNA has at least 50% matching with the target sequence on the target nucleic acid, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90%.

[0206] In one embodiment, when the target sequence contains one or more characteristic sites (such as a specific mutation site or SNP), the characteristic sites are completely matched with the gRNA.

[0207] In one embodiment, the detection method may comprise one or more gRNAs with different guide sequences, which target different target sequences.

[0208] In the present invention, the single-stranded nucleic acid detector includes but is not limited to single-stranded DNA, single-stranded RNA, DNA-RNA hybrids, nucleic acid analogs, base modifiers, and single-stranded nucleic acid detectors containing a base-free spacer, etc.; "nucleic acid analogs" include but are not limited to: locked nucleic acid, bridge nucleic acid, morpholino nucleic acid, ethylene glycol nucleic acid, hexitol nucleic acid, threose nucleic acid, arabinose nucleic acid, 2'oxymethyl RNA, 2'methoxyacetyl RNA, 2'fluoro RNA, 2'amino RNA, 4'thio RNA and combinations thereof, including optional ribonucleotides or deoxyribonucleotide residues.

[0209] In the present invention, the detectable signal is achieved by the following means: vision-based detection, sensor-based detection, color detection, fluorescence signal-based detection, gold nanoparticle-based detection, fluorescence polarization, colloidal phase transition / dispersion, electrochemical detection and semiconductor-based detection.

[0210] In the present invention, preferably, a fluorescent group and a quenching group are provided at both ends of the single-stranded nucleic acid detector, respectively, so that when the single-stranded nucleic acid detector is cleaved, a detectable fluorescent signal can be exhibited. The fluorescent group is selected from one or any combination of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LC RED460; and the quenching group is selected from one or any combination of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra.

[0211] In other embodiments, different labeling molecules are respectively set at the 5' end and the 3' end of the single-stranded nucleic acid detector, and the colloidal gold test results of the single-stranded nucleic acid detector before and after being cut by the Cas protein are detected by colloidal gold detection; the single-stranded nucleic acid detector will show different color development results on the colloidal gold detection line and the quality control line before and after being cut by the Cas protein.

[0212] In some embodiments, the method of detecting a target nucleic acid may further include comparing the level of the detectable signal to a reference signal level, and determining the amount of the target nucleic acid in the sample based on the level of the detectable signal.

[0213] In some embodiments, the method of detecting a target nucleic acid can also include using RNA reporter nucleic acid and DNA reporter nucleic acid on different channels (e.g., fluorescent colors), and determining the level of detectable signal by measuring the signal levels of the RNA and DNA reporter molecules, and by measuring the amount of target nucleic acid in the RNA and DNA reporter molecules, and sampling based on the level of the combined (e.g., using a minimum or product) detectable signal.

[0214] In one embodiment, the target gene is present in a cell.

[0215] In one embodiment, the cell is a prokaryotic cell.

[0216] In one embodiment, the cell is a eukaryotic cell.

[0217] In one embodiment, the cell is an animal cell.

[0218] In one embodiment, the cell is a human cell.

[0219] In one embodiment, the cell is a plant cell, such as a cell from a cultivated plant (such as cassava, corn, sorghum, wheat, or rice), algae, tree, or vegetable.

[0220] In one embodiment, the target gene is present in a nucleic acid molecule (eg, a plasmid) in vitro.

[0221] In one embodiment, the target gene is present in a plasmid.

[0222] Definition of terms

[0223] Unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, procedures in molecular genetics, nucleic acid chemistry, chemistry, molecular biology, biochemistry, cell culture, microbiology, cell biology, genomics, and recombinant DNA used herein are conventional procedures widely used in the relevant fields. To facilitate a better understanding of the present invention, definitions and explanations of relevant terms are provided below.

[0224] In the present invention, amino acid residues can be represented by single letters or three letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamine (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine ​​(Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), arginine (Arg, R).

[0225] The term "AxxB" indicates that the amino acid A at position xx is changed to amino acid B. Unless otherwise specified, this refers to the change from amino acid A at position xx from the N-terminus to amino acid B. For example, L65R indicates that the L at position 65 is mutated to an R. When multiple amino acid positions are mutated simultaneously, the expression can be expressed using formats such as L65R-V75R, L65R V75R, or L65R / V75R. For example, L65R-V75R indicates that the L at position 65 is mutated to an R and the V at position 75 is mutated to an R.

[0226] Specific amino acid positions (numbers) within the proteins of the present invention are determined by aligning the amino acid sequence of the target protein with SEQ ID No. 1 using standard sequence alignment tools, such as the Smith-Waterman algorithm or the CLUSTALW2 algorithm, wherein the sequences are considered aligned when the alignment score is the highest. The alignment score can be calculated according to the method described in Wilbur, WJ and Lipman, DJ (1983) Rapid similarity searches of nucleic acid and protein data banks. Proc. Natl. Acad. Sci. USA, 80: 726-730. The default parameters for the ClustalW2 (1.82) algorithm are preferably used: protein gap open penalty = 10.0; protein gap extension penalty = 0.2; protein matrix = Gonnet; protein / DNA end gap = -1; protein / DNAGAPDIST = 4. Preferably, the AlignX program (part of the vectorNTI group) is used to determine the position of specific amino acids in the protein of the present invention by comparing the amino acid sequence of the protein with SEQ ID No. 1 with default parameters suitable for multiple alignment (gap opening penalty: 10, gap extension penalty 0.05).

[0227] Those skilled in the art can use software commonly used in the art, such as Clustal Omega, to compare and align the amino acid sequence of any parent Cas protein with SEQ ID No. 1 for sequence identity, thereby obtaining the amino acid sites in the parent Cas protein corresponding to the amino acid sites defined based on SEQ ID No. 1 described in this application.

[0228] Cas proteins

[0229] In the present invention, Cas protein, Cas enzyme, and Cas effector protein can be used interchangeably; the present inventors have discovered and identified for the first time a Cas effector protein having an amino acid sequence selected from the group consisting of:

[0230] (i) a sequence having at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence shown in SEQ ID No. 1;

[0231] (ii) a sequence having one or more amino acid substitutions, deletions or additions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions, deletions or additions) compared to the sequence shown in SEQ ID No. 1; or

[0232] (iii) a sequence having at least 80% sequence identity with the sequence shown in SEQ ID No. 1; and, compared to the parent Cas protein, a mutation is present at any one or several of the following amino acid positions corresponding to the amino acid sequence shown in SEQ ID No. 1 (e.g., any one, two, three, four, or five amino acid positions): position 36, position 39, position 65, position 69, position 73, position 75, position 119, position 122, position 132, position 154, position 155, position 156, position 157, position 171, position 186, position 191, position 195, position 208, position 264, position 278, position 281, position 296, position 304, position 342, and position 344.

[0233] Nucleic acid cleavage or nucleic acid cleavage herein includes: DNA or RNA breakage (Cis cleavage) in the target nucleic acid produced by the Cas enzyme described herein, DNA or RNA breakage in the side branch nucleic acid substrate (single-stranded nucleic acid substrate) (i.e., non-specific or non-targeted, Trans cleavage). In some embodiments, the cleavage is a double-stranded DNA break. In some embodiments, the cleavage is a single-stranded DNA break or a single-stranded RNA break.

[0234] CRISPR system

[0235] As used herein, the terms "clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) (CRISPR-Cas) system" or "CRISPR system" are used interchangeably and have the meaning commonly understood by those skilled in the art, which generally includes transcripts or other elements associated with the expression of CRISPR-associated ("Cas") genes, or transcripts or other elements capable of directing the activity of the Cas genes.

[0236] CRISPR / Cas complex

[0237] As used herein, the term "CRISPR / Cas complex" refers to a complex formed by the binding of guide RNA or mature crRNA to the Cas protein, which can recognize and cleave polynucleotides that can hybridize with the guide RNA or mature crRNA.

[0238] Guide RNA (gRNA)

[0239] As used herein, the terms "guide RNA (gRNA)", "mature crRNA", and "guide sequence" are used interchangeably and have meanings commonly understood by those skilled in the art. Generally speaking, a guide RNA includes tracrRNA and crRNA; tracrRNA is capable of pairing with a pairing region of crRNA to form a duplex; crRNA also includes a region that hybridizes with a target sequence (i.e., a targeting sequence that targets a nucleic acid). The crRNA includes a pairing region sequence that is capable of pairing with the tracrRNA, and also includes a region that hybridizes with a target sequence (i.e., a targeting sequence that targets a nucleic acid).

[0240] In some cases, the targeting sequence is any polynucleotide sequence that has sufficient complementarity with the target sequence to hybridize with the target sequence and guide the specific binding of the CRISPR / Cas complex to the target sequence. In one embodiment, when optimally aligned, the degree of complementarity between the targeting sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. Determining the optimal alignment is within the capabilities of those of ordinary skill in the art. For example, there are publicly available and commercially available alignment algorithms and programs, such as, but not limited to, ClustalW, Smith-Waterman algorithm (Smith-Waterman) in matlab, Bowtie, Geneious, Biopython, and SeqMan.

[0241] Target sequence

[0242] "Target sequence" refers to a polynucleotide targeted by a targeting sequence in a gRNA, such as a sequence having complementarity with the targeting sequence, wherein hybridization between the target sequence and the targeting sequence promotes the formation of a CRISPR / Cas complex (including Cas protein and gRNA). Complete complementarity is not required, as long as there is sufficient complementarity to cause hybridization and promote the formation of a CRISPR / Cas complex.

[0243] The target sequence can comprise any polynucleotide, such as DNA or RNA. In some cases, the target sequence is located inside or outside the cell. In some cases, the target sequence is located in the nucleus or cytoplasm of the cell. In some cases, the target sequence may be located in an organelle of a eukaryotic cell, such as a mitochondria or chloroplast. A sequence or template that can be used to recombine into a target locus comprising the target sequence is referred to as an "editing template" or "editing polynucleotide" or "editing sequence". In one embodiment, the editing template is an exogenous nucleic acid. In one embodiment, the recombination is homologous recombination.

[0244] In the present invention, a "target sequence" or "target polynucleotide" or "target nucleic acid" can be any polynucleotide that is endogenous or exogenous to a cell (e.g., a eukaryotic cell). For example, the target polynucleotide can be a polynucleotide that is present in the nucleus of a eukaryotic cell. The target polynucleotide can be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or junk DNA). In some cases, the target sequence should be associated with a protospacer adjacent motif (PAM).

[0245] Single-stranded nucleic acid detector

[0246] The single-stranded nucleic acid detector of the present invention refers to a sequence containing 2-200 nucleotides, preferably 2-150 nucleotides, preferably 3-100 nucleotides, preferably 3-30 nucleotides, preferably 4-20 nucleotides, and more preferably 5-15 nucleotides. It is preferably a single-stranded DNA molecule, a single-stranded RNA molecule, or a single-stranded DNA-RNA hybrid.

[0247] The single-stranded nucleic acid detector includes different reporter groups or labeling molecules at both ends. When it is in the initial state (i.e., uncleaved state), it does not present a reporter signal. When the single-stranded nucleic acid detector is cleaved, it presents a detectable signal, i.e., a detectable difference is shown after cleavage and before cleavage.

[0248] In one embodiment, the reporter group or labeling molecule includes a fluorescent group and a quencher group, wherein the fluorescent group is selected from one or any combination of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED460; and the quencher group is selected from one or any combination of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

[0249] In one embodiment, the single-stranded nucleic acid detector has a first molecule (such as FAM or FITC) connected to the 5' end and a second molecule (such as biotin) connected to the 3' end. The reaction system containing the single-stranded nucleic acid detector is used in conjunction with a flow strip to detect target nucleic acid (preferably, colloidal gold detection method). The flow strip is designed to have two capture lines, with an antibody that binds to the first molecule (i.e., the first molecule antibody) at the sample contact end (colloidal gold), an antibody that binds to the first molecule antibody at the first line (control line), and an antibody that binds to the second molecule (i.e., the second molecule antibody, such as avidin) at the second line (test line). When the reaction flows along the strip, the first molecule antibody binds to the first molecule and carries the cut or uncut oligonucleotide to the capture line. The cut reporter will bind to the antibody of the first molecule antibody at the first capture line, and the uncut reporter will bind to the second molecule antibody at the second capture line. The binding of the reporter group to each line will result in a strong readout / signal (e.g., color). As more reporters are cut, more signals will accumulate at the first capture line, and less signals will appear at the second line. In certain aspects, the present invention relates to the use of a flow strip as described herein for detecting nucleic acids. In certain aspects, the present invention relates to a method for detecting nucleic acids using a flow strip as defined herein, such as a (lateral) flow test or a (lateral) flow immunochromatographic assay. In certain aspects, the molecules in the single-stranded nucleic acid detector may be interchangeable or their positions may be altered, and any such modifications are encompassed by the present invention as long as the reporting principle is the same or similar to that of the present invention.

[0250] The detection method of the present invention can be used for quantitative detection of target nucleic acids. The quantitative detection index can be quantified based on the signal strength of the reporter group, such as the luminescence intensity of the fluorescent group, or the width of the color band.

[0251] wild type

[0252] As used herein, the term "wild type" has the meaning generally understood by those skilled in the art to refer to the typical form of an organism, strain, gene, or characteristic as it exists in nature, as distinguished from mutant or variant forms, which can be isolated from a source in nature and has not been intentionally modified by man.

[0253] Derivatization

[0254] As used herein, the term "derivatization" refers to the chemical modification of an amino acid, polypeptide, or protein wherein one or more substituents have been covalently attached to the amino acid, polypeptide, or protein. The substituents may also be referred to as side chains.

[0255] A derivatized protein is a derivative of the protein. Generally, the derivatization of the protein does not adversely affect the desired activity of the protein (e.g., the activity of binding to the guide RNA, the endonuclease activity, the activity of binding to and cutting a specific site of the target sequence under the guidance of the guide RNA), that is, the derivative of the protein has the same activity as the protein.

[0256] Derivatized proteins

[0257] Also known as "protein derivatives", refers to modified forms of proteins, for example, wherein one or more amino acids of the protein may be deleted, inserted, modified and / or substituted.

[0258] Non-naturally occurring

[0259] As used herein, the terms "non-naturally occurring" or "engineered" are used interchangeably and indicate the involvement of human effort. When these terms are used to describe a nucleic acid molecule or polypeptide, they indicate that the nucleic acid molecule or polypeptide is at least substantially free from at least one other component with which it is associated in nature or as found in nature.

[0260] Orthologue (ortholog)

[0261] As used herein, the term "orthologue" has the meaning commonly understood by those skilled in the art. As a further guide, an "orthologue" of a protein as described herein refers to a protein belonging to a different species that performs the same or similar function as the protein to which it is an orthologue.

[0262] Identity

[0263] As used herein, the term "identity" refers to the match between two polypeptides or between two nucleic acids. When a position in both sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of the two DNA molecules is occupied by adenine, or a position in each of the two polypeptides is occupied by lysine), then the molecules are identical at that position. The "percent identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared x 100. For example, if 6 out of 10 positions in two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT share 50% identity (3 out of 6 positions match). Typically, two sequences are compared when they are aligned for maximum identity. Such an alignment can be achieved, for example, by using the method of Needleman et al. (1970) J. Mol. Biol. 48:443-453, which can be conveniently performed using a computer program such as the Align program (DNAstar, Inc.). The percent identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl Biosci., 4:11-17 (1988)), which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. In addition, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J Mol Biol. 48:444-453 (1970)) algorithm, which has been incorporated into the GAP program in the GCG software package (available at www.gcg.com), using a Blossum 62 matrix or a PAM250 matrix and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.

[0264] carrier

[0265] The term "vector" refers to a nucleic acid molecule that is capable of transporting another nucleic acid molecule to which it is attached. Vectors include, but are not limited to, single-stranded, double-stranded, or partially double-stranded nucleic acid molecules; nucleic acid molecules comprising one or more free ends, or no free ends (e.g., circular); nucleic acid molecules comprising DNA, RNA, or both; and other various polynucleotides known in the art. A vector can be introduced into a host cell by transformation, transduction, or transfection so that the genetic material elements it carries are expressed in the host cell. A vector can be introduced into a host cell to produce transcripts, proteins, or peptides, including proteins, fusion proteins, isolated nucleic acid molecules, etc. as described herein (e.g., CRISPR transcripts, such as nucleic acid transcripts, proteins, or enzymes). A vector can contain a variety of elements that control expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, the vector may also contain a replication initiation site.

[0266] One type of vector is a "plasmid," which refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, eg, by standard molecular cloning techniques.

[0267] Another type of vector is a viral vector, in which a virally derived DNA or RNA sequence is present in a vector for packaging a virus (e.g., a retrovirus, a replication-defective retrovirus, adenovirus, a replication-defective adenovirus, and adeno-associated virus). The viral vector also comprises a polynucleotide carried by a virus for transfection into a host cell. Some vectors (e.g., bacterial vectors and episomal mammalian vectors with a bacterial origin of replication) can replicate autonomously in the host cell into which they are introduced.

[0268] Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of the host cell upon introduction into the host cell and are thereby replicated along with the host genome. Furthermore, some vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as "expression vectors."

[0269] host cells

[0270] As used herein, the term "host cell" refers to cells that can be used to introduce a vector, including but not limited to prokaryotic cells such as Escherichia coli or Bacillus subtilis, and eukaryotic cells such as microbial cells, fungal cells, animal cells, and plant cells.

[0271] Those skilled in the art will appreciate that the design of the expression vector may depend on factors such as the choice of the host cell to be transformed, the level of expression desired, and the like.

[0272] Regulatory elements

[0273] As used herein, the term "regulatory element" is intended to include promoters, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences), which are described in detail in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, CA (1990). In some cases, regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters can primarily direct expression in a desired tissue of interest, such as muscle, neurons, bone, skin, blood, a specific organ (e.g., liver, pancreas), or a particular cell type (e.g., lymphocytes). In some cases, regulatory elements can also direct expression in a time-dependent manner (e.g., in a cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue- or cell-type-specific. In some cases, the term "regulatory element" encompasses enhancer elements such as WPRE; the CMV enhancer; the R-U5' segment in the LTR of HTLV-I ((Mol. Cell. Biol., Vol. 8(1), pp. 466-472, 1988); the SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit β-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), pp. 1527-31, 1981).

[0274] promoter

[0275] As used herein, the term "promoter" has a meaning well known to those skilled in the art and refers to a non-coding nucleotide sequence located upstream of a gene that can initiate expression of a downstream gene. A constitutive promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in a cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell substantially only when an inducer corresponding to the promoter is present in the cell. A tissue-specific promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell substantially only when the cell is a cell of the tissue type corresponding to the promoter.

[0276] NLS

[0277] A "nuclear localization signal" or "nuclear localization sequence" (NLS) is an amino acid sequence that "tags" a protein for import into the cell nucleus via nuclear transport, i.e., proteins with an NLS are transported to the cell nucleus. Typically, an NLS comprises a positively charged Lys or Arg residue exposed on the surface of the protein. Exemplary nuclear localization sequences include, but are not limited to, NLSs from the following: SV40 large T antigen, EGL-13, c-Myc, and TUS protein. In some embodiments, the NLS comprises the PKKKRKV sequence. In some embodiments, the NLS comprises the AVKRPAATKKAGQAKKKKLD sequence. In some embodiments, the NLS comprises the PAAKRVKLD sequence. In some embodiments, the NLS comprises the MSRRRKANPTKLSENAKKLAKEVEN sequence. In some embodiments, the NLS comprises the KLKIKRPVK sequence. Other nuclear localization sequences include, but are not limited to, the acidic M9 domain of hnRNP A1, the sequence KIPIK in the yeast transcription repressor Matα2, and PY-NLS.

[0278] operably connected

[0279] As used herein, the term "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell).

[0280] Complementarity

[0281] As used herein, the term "complementarity" refers to the ability of a nucleic acid to form one or more hydrogen bonds with another nucleic acid sequence by means of traditional Watson-Crick or other non-traditional types. Percent complementarity represents the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 are 50%, 60%, 70%, 80%, 90%, and 100% complementary). "Complete complementarity" means that all consecutive residues of a nucleic acid sequence form hydrogen bonds with the same number of consecutive residues in a second nucleic acid sequence. As used herein, "substantially complementary" refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or to two nucleic acids that hybridize under stringent conditions.

[0282] Strict conditions

[0283] As used herein, "stringent conditions" for hybridization refer to conditions under which a nucleic acid having complementarity with a target sequence predominantly hybridizes to the target sequence and does not substantially hybridize to non-target sequences. Stringent conditions are generally sequence-dependent and vary depending on many factors. Generally speaking, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence.

[0284] hybridization

[0285] The terms "hybridize" or "complementary" or "substantially complementary" refer to a nucleic acid (e.g., RNA, DNA) comprising a nucleotide sequence that enables it to non-covalently bind, i.e., form base pairs and / or G / U base pairs, "anneal" or "hybridize" with another nucleic acid in a sequence-specific, antiparallel manner (i.e., a nucleic acid specifically binds to a complementary nucleic acid).

[0286] Hybridization requires that the two nucleic acids contain complementary sequences, although there may be mismatches between the bases. Suitable conditions for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementarity, which are variables well known in the art. Typically, the length of a hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).

[0287] It is understood that the sequence of a polynucleotide need not be 100% complementary to the sequence of its target nucleic acid to hybridize specifically. A polynucleotide may comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100% sequence complementarity to the target region in the target nucleic acid sequence with which it hybridizes.

[0288] The hybridization of the target sequence and the gRNA represents that at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the nucleic acid sequences of the target sequence and the gRNA can hybridize to form a complex; or represents that at least 12, 15, 16, 17, 18, 19, 20, 21, 22 or more bases of the nucleic acid sequences of the target sequence and the gRNA can complement each other and hybridize to form a complex.

[0289] Express

[0290] As used herein, the term "expression" refers to the process by which a polynucleotide is transcribed from a DNA template (e.g., into mRNA or other RNA transcripts) and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. The transcript and the encoded polypeptide may be collectively referred to as a "gene product." If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.

[0291] connector

[0292] As used herein, the term "linker" refers to a linear polypeptide formed by connecting multiple amino acid residues via peptide bonds. The linker of the present invention can be an artificially synthesized amino acid sequence, or a naturally occurring polypeptide sequence, such as a polypeptide having a hinge region function. Such linker polypeptides are well known in the art (see, for example, Holliger, P. et al. (1993) Proc. Natl. Acad. Sci. USA 90: 6444-6448; Poljak, RJ et al. (1994) Structure 2: 1121-1123).

[0293] treat

[0294] As used herein, the term "treat" refers to treating or curing a disorder, delaying the onset of symptoms of a disorder, and / or delaying the progression of a disorder.

[0295] Subjects

[0296] As used herein, the term "subject" includes, but is not limited to, various animals, plants, and microorganisms.

[0297] animal

[0298] For example, mammals, such as bovines, equines, ovines, porcines, canines, felines, lagomorphs, rodents (e.g., mice or rats), non-human primates (e.g., macaques or cynomolgus monkeys), or humans. In certain embodiments, the subject (e.g., a human) has a disorder (e.g., a disorder caused by a disease-associated gene defect).

[0299] plant

[0300] The term "plant" is to be understood as meaning any differentiated multicellular organism capable of photosynthesis, including crop plants at any stage of maturity or development, in particular monocotyledonous or dicotyledonous plants, vegetable crops including artichokes, Brussels sprouts, rocket, leeks, asparagus, lettuce (e.g., head lettuce, leaf lettuce, romaine lettuce), bok choy, yellow taro, melons (e.g., cantaloupe, watermelon, Crenshaw melon, honeydew melon, cantaloupe), oilseed crops (e.g., Brussels sprouts, cabbage, cauliflower, broccoli, kale, kale, Chinese cabbage, bok choy), cardoon, carrot, napa, okra, onion, celery, parsley, chickpeas, parsnips, endive, peppers, potatoes, cucurbits (e.g., zucchini, cucumber, courgette, squash, pumpkin), radish, cabbage, Onions, rutabagas, eggplant (also known as eggplant), salsify, lettuce, shallots, endive, garlic, spinach, green onions, squash, greens, beets (sugar beets and fodder beets), sweet potatoes, Swiss chard, horseradish, tomatoes, turnips, and spices; fruits and / or vines such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quince, almonds, chestnuts, hazelnuts, pecans, pistachios, walnuts, citrus, blueberries, boysenberries, erry), cranberries, currants, loganberries, raspberries, strawberries, blackberries, grapes, avocados, bananas, kiwis, persimmons, pomegranates, pineapples, tropical fruits, pome fruits, melons, mangoes, papayas, and lychees; field crops such as clover, alfalfa, evening primrose, meadowsweet, corn / maize (feed corn, sweet corn, popcorn), hops, jojoba, peanuts, rice, safflower, small grain cereals (barley, oats, rye, wheat, etc.), sorghum, tobacco, kapok, legumes (beans, lentils, peas beans, soybeans), oil plants (rapeseed, mustard, olive, sunflower, coconut, castor oil plant, cocoa bean, peanut), Arabidopsis, fiber plants (cotton, flax, jute), Lauraceae (cinnamon, camphor), or a plant such as coffee, sugar cane, tea, and natural rubber plant; and / or bedding plants, such as flowering plants, cacti, succulents and / or ornamental plants, as well as trees such as forests (broadleaf trees and evergreen trees, such as conifers), fruit trees, ornamental trees, and nut-bearing trees, as well as shrubs and other seedlings.

[0301] Advantageous Effects of the Invention

[0302] The present invention discovered a new type of Cas enzyme. Blast results showed that the Cas enzyme of the present application had low consistency with the reported Cas enzymes and was a new type of Cas protein. The present invention further mutated the Cas protein to obtain a Cas mutant protein with further improved activity, which has broad application prospects.

[0303] The embodiments of the present invention will be described in detail below with reference to the accompanying drawings and examples, but it will be understood by those skilled in the art that the following drawings and examples are intended only to illustrate the present invention and are not intended to limit the scope of the invention. Various objects and advantages of the present invention will become apparent to those skilled in the art based on the following detailed description of the accompanying drawings and preferred embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0304] Figure 1. PAM structure of Cas-sf6728.

[0305] Figure 2. Editing efficiency of different Cas-sf6728 single mutant proteins.

[0306] Figure 3. Structure of the non-targeting gRNA sequence of the Cas-sf6728 protein.

[0307] Figure 4. Editing efficiency of different editing systems. DETAILED DESCRIPTION

[0308] The following examples are only used to describe the present invention, but are not intended to limit the present invention. Unless otherwise specified, the experiment and method described in the embodiment are carried out substantially according to conventional methods well known in the art and described in various references. For example, the conventional techniques such as immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA used in the present invention can be found in Sambrook, Fritsch and Maniatis, " molecular cloning: laboratory manual " (MOLECULAR CLONING:A LABORATORY MANUAL), 2nd edition (1989); " current protocols in molecular biology " (FM Ausubel et al. edit, (1987)); " methods in enzymes " (METHODS IN ENZYMOLOGY) series (Academic Publishing Company): " PCR 2: practical methods " (PCR 2:A PRACTICAL APPROACH) (MJ MacPherson, BD Hames and GR Taylor, eds. (1995)), ANTIBODIES, A LABORATORY MANUAL (Harlow and Lane, eds. (1988)), and ANIMAL CELL CULTURE (RI Freshney, ed. (1987)).

[0309] In addition, if specific conditions are not specified in the examples, the experiments were performed under conventional conditions or the conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be obtained commercially. It is understood that the examples describe the present invention by way of example and are not intended to limit the scope of the present invention. All publications and other references mentioned herein are incorporated herein by reference in their entirety.

[0310] Example 1. Acquisition of Cas-sf6728 protein

[0311] The inventors analyzed the metagenomics of uncultured plants and, through redundancy removal and protein cluster analysis, identified a new CRISPR-Cas enzyme. Blast analysis revealed that the Cas protein shared low sequence identity with previously reported Cas proteins, and the enzyme is designated Cas-sf6728 in this invention. The amino acid sequence of Cas-sf6728 is shown in SEQ ID No. 1, the nucleotide sequence is shown in SEQ ID No. 2, the crRNA and tracrRNA pairing region sequence is shown in SEQ ID No. 3, and the tracrRNA sequence is shown in SEQ ID No. 4.

[0312] Amino acid sequence of Cas-sf6728 (SEQ ID No. 1):

[0313] Nucleotide sequence of Cas-sf6728 (SEQ ID No. 2):

[0314] Sequence of the pairing region between crRNA and tracrRNA of Cas-sf6728 (SEQ ID No. 3):

[0315] Cas-sf6728 tracrRNA sequence (SEQ ID No. 4):

[0316] Example 2. PAM identification of Cas-sf6728 protein

[0317] The expression plasmid of Cas-sf6728 protein in Example 1 was constructed: its nucleic acid sequence was subjected to E. coli codon optimization and gene synthesis, and then connected to the E. coli expression vector PeT28 (a) + vector, and the J23119 promoter was added to initiate the transcription of tracrRNA and crRNA of Cas protein to form the vector: PeT28 (a) + -Cas-J23119-gRNA, the gRNA sequence was:

[0318] TCAACCAAATATGTCCAACGAAAGGAGCAATGCCGGGCCTACATCGAGCGACAAACC

[0319] ACAACAACCGAATCCGACGATATCGAGAAGTCGGAAACTGATTCGGCTGGGCCCACA

[0320] GCCGAAGGGGTGAGGGCTAAGCGCCACTCACCACCCCGCATGCGCAATATATTGCGA

[0321] CTTGGCTCGTCCCACAGCACAACATGGCAGAAAAACGAGCCCACGCGTGCCGGGATGGGTCGTCCCCTACGTGCTGCTGAAGTTGC, the underlined sequence is the target sequence.

[0322] Construction of PAM library: synthetic sequences

[0323] CGTGTTTCGTAAAGTCTGGAAACGCGGAAGCCCCCAGCGCTTCAGCGTTCNNNNNNT CCCCTACGTGCTGCTGAAGTTGCCCGCAA, where N represents a random deoxynucleotide and the target sequence is underlined. The fragment was blunted with Klenow enzyme and ligated into the pacyc184 vector. E. coli was transformed and the plasmid was extracted to form a PAM library.

[0324] PAM library subtraction experiment: The expression vector PeT28(a)+-Cas-J23119-gRNA and the PAM library plasmid were co-transformed into competent BL21 (DE3) cells and plated on LB plates containing kanamycin and chloramphenicol. After overnight culture at 37°C, the cells were harvested and the concentration adjusted to an OD600 of 0.6-0.8. IPTG 0.2 mM was added and induced at 37°C for 4 h. Plasmid extraction was performed using the FastPure EndoFree Plasmid Maxi Kit (Vazyme) to obtain the subtracted PAM library. Primers: PAM-F: GGTCTTCGGTTTCCGTGTT; PAM-R: TGGCGTTGACTCTCAGTCAT. PCR reactions were performed using 30 ng / μL of the plasmid (PAM library) as template to generate control samples. Experimental samples were also generated using 30 ng / μL of the plasmid (subtracted PAM library) as template. The samples of the control group and the experimental group were sent for second-generation sequencing for data analysis.

[0325] The PAM preference of Cas-sf6728 protein was obtained, as shown in Figure 1. The PAM preference of Cas-sf6728 protein is 5'-AAN-3', where N represents A / C / G / T.

[0326] Example 3. Editing efficiency of Cas-sf6728 protein in animal cells

[0327] The gene-editing activity of the Cas-sf6728 protein was verified in animal cells. The vector pcDNA3.3 was modified to carry the ECFP fluorescent protein gene. The SV40 NLS-Cas-NLS fusion protein was inserted via the BsmB1 restriction site, and the U6 promoter and gRNA sequence were inserted via the Mfe1 restriction site. The gRNA sequence is TCAACCAAATATGTCCAACGAAAGGAGCAATGCCGGGCCTACATCGAGCGACAAACCACAACAACCGAATCCGACGATATCGAGAAGTCGGAAACTGATTCGGCTGGGCCCACAGCCGAAGGGTGAGGGCTAAGCGCCACTCACCAACCCCGCATGCGCAATATATTGCGACTTGGCTCGTCCCACAGCACAACATGGCAGAAAAACGAGCCCACGCGTGCCGGGATGGGTCGTCCCCTACGTGCTGCTGAAGTTGC. The target sequence is underlined. Expression of the SV40 NLS-Cas-NLS-ECFP fusion protein is driven by the CMV promoter. The Cas-NLS protein and the ECFP protein were linked using the linker peptide T2A. The pUC19 vector was modified to drive expression of the tdTomato-T2A-GF (5-spacer1 24bp) FP gene under the EF-1α promoter. After the Cas protein recognized the target site 5-spacer1 24bp and edited it, the proportion of GFP-positive cells in the CFP- and tdTomato-positive cells was analyzed to determine the Cas protein editing efficiency.

[0328] Plating: 293T cells were plated when the confluency reached 70-80%, and the number of cells seeded in a 12-well plate was 8*10^4 cells / well.

[0329] Transfection: 12-24 hours after plating, add 2ug plasmid to 100μL opti-MEM and mix well; add 4μL diluted plasmid Incubate with EL Transfection Reagent (TRAN) at room temperature for 15-20 minutes. Add the incubated mixture to the culture medium containing the cells for transfection. Replace the culture medium with normal culture medium 24 hours after transfection. Flow cytometry analysis was performed 48 hours after transfection. The results showed that the editing efficiency of the Cas9 protein sf6728 was 5.89%.

[0330] Example 4. Acquisition of Cas-sf6728 mutant protein

[0331] On the basis of Cas-sf6728 (amino acid sequence as shown in SEQ ID No.1), the amino acids that bind to the potential Cas enzyme and the target sequence are site-directed mutated by bioinformatics methods, and variants of the Cas protein are generated by PCR-based site-directed mutagenesis, which can adopt the site-directed mutagenesis method commonly used in this field. The specific method is to divide the DNA sequence of Cas-sf6728 into two parts with the mutation site as the center, design two pairs of primers to amplify the two parts of the DNA sequence respectively, and introduce the sequence that needs to be mutated into the primers. The combination of mutants is constructed by splitting the DNA into multiple segments and using PCR and Gibson clone. Fragment amplification kit: TransStart FastPfu DNA Polymerase (containing 2.5mM dNTPs), please refer to the instructions for the specific experimental process. Glue recovery kit: Gel DNA Extraction Mini Kit. Detailed experimental procedures are provided in the instructions. Vector construction kit: pEASY-Basic Seamless Cloning and Assembly Kit (CU201-03). Detailed experimental procedures are provided in the instructions.

[0332] In this embodiment, mutations are performed on the following sites based on SEQ ID No. 1: T36W, D39L, L65R, S69R, A73R, V75R, A119R, T122R, N132R, S154R, A155R, Q156R, D157R, Q171R, E186R, L191R, T195R, E208R, T264R, S278R, A281R, D296R, H304R, Q342R, A344R and other mutated amino acid sites. Based on the above amino acid mutation sites, Cas-sf6728 single mutant proteins T36W, D39L, L65R, S69R, A73R, V75R, A119R, T122R, N132R, S154R, A155R, Q156R, D157R, Q171R, E186R, L191R, T195R, E208R, T264R, S278R, A281R, D296R, H304R, Q342R, A344R and Cas-sf6728 combined mutant protein L65R-V75R were obtained. The above Cas-sf6728 single mutant proteins were respectively SEQ ID No.1 From the N-terminus, the 36th amino acid mutated to W, the 39th amino acid mutated to L, the 65th amino acid mutated to R, the 69th amino acid mutated to R, the 73rd amino acid mutated to R, the 75th amino acid mutated to R, the 119th amino acid mutated to R, the 122nd amino acid mutated to R, the 132nd amino acid mutated to R, the 154th amino acid mutated to R, the 155th amino acid mutated to R, the 156th amino acid mutated to R, the 157th amino acid mutated to R, and the 171st amino acid mutated to The present invention relates to a mutant protein in which the amino acid at position 186 is mutated to R, the amino acid at position 191 is mutated to R, the amino acid at position 195 is mutated to R, the amino acid at position 208 is mutated to R, the amino acid at position 264 is mutated to R, the amino acid at position 278 is mutated to R, the amino acid at position 281 is mutated to R, the amino acid at position 296 is mutated to R, the amino acid at position 304 is mutated to R, the amino acid at position 342 is mutated to R, and the amino acid at position 344 is mutated to R; the Cas-sf6728 combined mutant protein L65R-V75R is a mutant protein in which the amino acid at position 65 from the N-terminus of SEQ ID No.1 is mutated to R and the amino acid at position 75 is mutated to R.

[0333] Example 5. Verification of the editing activity of Cas-sf6728 mutant protein

[0334] The gene editing activity of the Cas-sf6728 single mutant protein obtained in Example 4 was verified in cells, and the wild-type Cas-sf6728 protein (SEQ ID No. 1) was used as a control. The target site cagcctagctcaggagaagt on the TTR gene was selected and the cells were transformed to test the editing efficiency.

[0335] The vector pcDNA3.3 was modified to carry EGFP fluorescent protein. The SV40NLS-Cas fusion protein was inserted through the restriction sites XbaI and PstI; the U6 promoter and gRNA sequence were inserted through the restriction site Mfe1. The CMV promoter drives the expression of the fusion protein SV40 NLS-Cas-XX-NLS-GFP. The protein Cas-XX-NLS and the protein GFP are connected with the connecting peptide T2A. Plating: The cells are plated when the confluency reaches 70-80%, and the number of cells seeded in a 12-well plate is 8*10^4 cells / well. Transfection: Transfection is performed 24 hours after plating, and 6.25μl Hieff Trans was added to 100μl opti-MEM. TM Liposome nucleic acid transfection reagent, mix well; add 2.5ug plasmid to 100μl opti-MEM and mix well. TM Mix the diluted plasmid with the liposome transfection reagent and incubate at room temperature for 20 minutes. Add the incubated mixture to the culture medium containing cells for transfection. 48 hours after transfection, digest the cells with trypsin-EDTA (0.05%) and sort the cells with GFP signal using flow cytometry (FACS).

[0336] Extract DNA, PCR amplify the area near the editing region, and send for hiTOM sequencing: The cells were collected after trypsin digestion, and genomic DNA was extracted using a cell / tissue genomic DNA extraction kit (Biotech). The area near the target site was amplified from the genomic DNA. The target sequence was amplified using sequencing primers: TTR-NGS-F1 CTATTCGcaggtttgcagtcagattgg, TTR-NGS-R1 ATCACGgtaggaatgggatgtcacag. The PCR product was sequenced by hiTOM. The sequencing data was analyzed, and the editing efficiency of the wild-type Cas-sf6728 protein (SEQ ID No. 1) was used as the benchmark (100%) to obtain the editing efficiency of different Cas-sf6728 single mutant proteins at the target site, as shown in Figure 2. The Cas-sf6728 single mutant proteins with significantly improved editing efficiency were selected, and their editing efficiencies were statistically shown in the following table.

[0337] The above results show that the 36th, 39th, 65th, 69th, 73rd, 75th, 119th, 122nd, 132nd, 154th, 155th, 156th, 157th, 171st, 186th, 191st, 195th, 208th, 264th, 278th, 281st, 296th, 304th, 342nd or 344th amino acid of SEQ ID No. 1 from the N-terminus is the key site for the activity of Cas-sf6728 protein. By mutation of the above amino acid sites, the editing efficiency of Cas-sf6728 protein can be greatly improved.

[0338] In addition, the above method was used to verify the editing efficiency of the Cas-sf6728 combination mutant protein L65R-V75R. The results showed that compared with the wild-type Cas-sf6728 protein, the editing efficiency of the Cas-sf6728 combination mutant protein L65R-V75R was increased by about 7 times.

[0339] Example 6. gRNA modification of Cas-sf6728 protein

[0340] The gRNA of the Cas-sf6728 protein includes tracrRNA and crRNA, and tracrRNA can be paired with the pairing region of crRNA to form a duplex; crRNA also includes a region that hybridizes with the target sequence (i.e., a targeting sequence for targeting nucleic acid). This embodiment transforms the non-targeting sequence portion of the gRNA. The non-targeting sequence of the wild-type gRNA of the Cas-sf6728 protein is shown in SEQ ID No. 5.

[0341] The secondary structure of the wild-type gRNA non-targeting sequence of the Cas-sf6728 protein was predicted using RNAfold2, as shown in Figure 3. By analyzing its secondary structural characteristics, nucleotides at different positions were selected for truncation or mutation. The modified gRNA non-targeting sequence is shown in the table below.

[0342] A fluorescent reporter system was used to test the editing efficiency of the editing system consisting of wild-type Cas9 protein and modified gRNA. A fluorescent reporter system suitable for verifying the editing efficiency of the Cas9-sf6728 editing system was constructed with reference to the literature (Yang, Yi, et al. "Highly efficient and rapid detection of the cleavage activity of Cas9 / gRNA via a fluorescent reporter." Applied biochemistry and biotechnology 180.4(2016):655-667.). The fluorescent reporter vector contained RFP and the non-luminescent GFFP fluorescent protein, while the Cas vector contained the CFP fluorescent protein. The AAGTTTAACAGTGGCCTTATTAA target site on the GFFP sequence was selected for testing. The PAM sequence is underlined. 293T cells were transfected 48 hours later, and the ratio of GFP fluorescence to CFP and RFP fluorescence was used to determine the editing efficiency. The editing efficiency of the editing system consisting of wild-type Cas9 protein and modified gRNA is shown in the table below.

[0343] The experimental results showed that the modified gRNAs A1-A20 can significantly improve the editing efficiency, especially A13 (A at position 126 mutated to G, and U at position 141 mutated to C) has the best effect.

[0344] Subsequently, the modified gRNA sequences A1-A20 were combined into a new gRNA sequence, and the editing activity of the editing system composed of the combined gRNA sequence and the wild-type Cas-sf6728 protein was tested in vivo using the method described in Example 5. The results are shown in the table below. The results show that the gRNA sequence A3+A13 combination is the most effective, with an activity increase of more than 5 times that of the wild-type gRNA.

[0345] In addition, the editing efficiency of the editing system consisting of wild-type Cas-sf6728 protein + wild-type gRNA sequence (WT in Figure 4), Cas-sf6728 combined mutant protein L65R-V75R + wild-type gRNA sequence (L65RV75R in Figure 4), and Cas-sf6728 combined mutant protein L65R-V75R + modified gRNA sequence (A3 + A13) (L65R V75R + tracrRNA in Figure 4) was detected using the method described in Example 5. As shown in Figure 4, compared with the editing system of wild-type Cas-sf6728 protein + wild-type gRNA sequence, the editing activity of the editing system of Cas-sf6728 combined mutant protein L65R-V75R + wild-type gRNA sequence in vivo was increased by about 7 times, while the activity of the editing system consisting of Cas-sf6728 combined mutant protein L65R-V75R + modified gRNA sequence (A3 + A13) was increased by about 8 times, and the editing efficiency in vivo was 33%. This shows that the editing activity of the Cas-sf6728 editing system can be significantly improved through Cas-sf6728 protein mutation and gRNA modification.

[0346] Although the specific embodiments of the present invention have been described in detail, those skilled in the art will understand that various modifications and changes can be made to the details based on all the teachings published, and these changes are all within the scope of protection of the present invention. The entire invention is given by the appended claims and any equivalents thereof.

Claims

1. A Cas protein, characterized in that The Cas protein is any one of the following I-IV Cas proteins: I. The amino acid sequence of the Cas protein has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to SEQ ID No. 1, and substantially retains the biological function of the sequence from which it is derived; II. The amino acid sequence of the Cas protein has one or more amino acids (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids) replaced, deleted or added compared to SEQ ID No. 1, and substantially retains the biological function of the sequence from which it is derived; III. The Cas protein comprises the amino acid sequence shown in SEQ ID No.1; IV. Compared with SEQ ID No. 1, the Cas protein amino acid sequence has mutations at any one or several of the following amino acid positions of the amino acid sequence shown in SEQ ID No. 1: position 36, position 39, position 65, position 69, position 73, position 75, position 119, position 122, position 132, position 154, position 155, position 156, position 157, position 171, position 186, position 191, position 195, position 208, position 264, position 278, position 281, position 296, position 304, position 342, and position 344.

2. A fusion protein comprising the Cas protein according to claim 1 and other modified parts.

3. An isolated polynucleotide, characterized in that The polynucleotide is a polynucleotide sequence encoding the Cas protein according to claim 1, or a polynucleotide sequence encoding the fusion protein according to claim 2.

4. A carrier, characterized in that The vector comprises the polynucleotide according to claim 3 and a regulatory element operably linked thereto.

5. A gRNA, the gRNA comprising a targeting sequence and a non-targeting sequence, the non-targeting sequence comprising a tracrRNA, a pairing region sequence of crRNA and tracrRNA; Preferably, the non-targeting sequence of the gRNA is as shown in SEQ ID No. 5, or the non-targeting sequence of the gRNA has a base mutation compared with SEQ ID No. 5, and the base mutation is selected from any one or any combination of several (for example, any 1, 2, 3, 4 or 5) of the following (1)-(20): (1) Compared with SEQ ID No. 5, bases 1 to 12 are missing; (2) Compared with SEQ ID No. 5, bases 1 to 26 are missing; (3) Compared with SEQ ID No. 5, bases 13-26 and 158-172 are missing; (4) Compared with SEQ ID No. 5, the A at position 29 is mutated to C, and the U at position 155 is mutated to G; (5) Compared with SEQ ID No. 5, the U at position 31 is mutated to C, and the A at position 154 is mutated to G; (6) Compared with SEQ ID No. 5, U is added between position 155 U and position 156 G; (7) Compared with SEQ ID No. 5, the A at position 29 is mutated to C, the U at position 31 is mutated to C, the A at position 154 is mutated to G, and the U at position 155 is mutated to G; (8) Compared with SEQ ID No. 5, the A at position 74 is mutated to C, and the U at position 88 is mutated to G; (9) Compared with SEQ ID No. 5, the U at position 100 is mutated to C, and the A at position 119 is mutated to G; (10), compared with SEQ ID No. 5, the U at position 105 is mutated to C, and the A at position 114 is mutated to G; (11), compared with SEQ ID No. 5, the U at position 100 is mutated to C, the U at position 105 is mutated to C, the A at position 114 is mutated to G, and the A at position 119 is mutated to G; (12), compared with SEQ ID No. 5, the 124th position U is mutated to G, and the 143rd position A is mutated to C; (13), compared with SEQ ID No. 5, the 126th position A is mutated to G, and the 141st position U is mutated to C; (14), compared with SEQ ID No. 5, U is added between G at position 127 and G at position 128; (15), compared with SEQ ID No. 5, the 124th U mutated to G, the 126th A mutated to G, the 141st U mutated to C, and the 143rd A mutated to C; (16), compared with SEQ ID No. 5, bases 198-201 are missing; (17), compared with SEQ ID No. 5, bases 192-200 are missing; (18), compared with SEQ ID No. 5, bases 205-209 are missing; (19), compared with SEQ ID No. 5, bases 205-217 are missing; (20) Compared with SEQ ID No. 5, bases 205 to 222 are missing.

6. A CRISPR-Cas system, characterized in that The system comprises the Cas protein of claim 1 and at least one gRNA capable of binding to the Cas protein, wherein the gRNA comprises a region binding to the Cas protein and a targeting sequence for targeting nucleic acid, or the gRNA is the gRNA of claim 5.

7. A composition, characterized in that The composition comprises: (i) a protein component selected from: the Cas protein according to claim 1 or the fusion protein according to claim 2; (ii) a nucleic acid component selected from: a gRNA, or a nucleic acid encoding the gRNA, or a precursor RNA of the gRNA, or a precursor RNA nucleic acid encoding the gRNA, wherein the gRNA comprises a region binding to the Cas protein of claim 1 and a targeting sequence for targeting nucleic acid, or the gRNA is the gRNA of claim 5; The protein component and the nucleic acid component are combined with each other to form a complex.

8. An engineered host cell, characterized in that The host cell comprises the Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the gRNA of claim 5, or the CRISPR-Cas system of claim 6, or the composition of claim 7.

9. Use of the Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the gRNA of claim 5, or the CRISPR-Cas system of claim 6, or the composition of claim 7, or the host cell of claim 8 in gene editing, gene targeting, gene cleavage, cleavage of double-stranded DNA, single-stranded DNA or single-stranded RNA, non-specific cleavage and / or degradation of collateral nucleic acid, non-specific cleavage of single-stranded nucleic acid, nucleic acid detection, specific editing of double-stranded nucleic acid, base editing of double-stranded nucleic acid, base editing of single-stranded nucleic acid; Alternatively, the use in preparing a preparation or a kit, wherein the preparation or the kit is used for: gene editing, gene targeting, gene cleavage, cleavage of double-stranded DNA, single-stranded DNA or single-stranded RNA, non-specific cleavage and / or degradation of side branch nucleic acids, non-specific cleavage of single-stranded nucleic acids, nucleic acid detection, specific editing of double-stranded nucleic acids, base editing of double-stranded nucleic acids, base editing of single-stranded nucleic acids.

10. A method for editing, targeting or cutting a target nucleic acid, the method comprising contacting the target nucleic acid with the Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the gRNA of claim 5, or the CRISPR-Cas system of claim 6, or the composition of claim 7, or the host cell of claim 8.

Images