A method for detecting changes in nucleotide sequence changes using an isothermal nucleic acid amplification technology, a set of primers and a composition of a reaction mixture for the detection of selected genetic variants

Abstract

The present invention relates to a method for detecting changes in nucleotide sequence alterations using an isothermal nucleic acid ampli fication technology, a set of primers and a composition of a reaction mixture for the detection of selected genetic variants.

Description

[0001] A method for detecting changes in nucleotide sequence changes using an isothermal nucleic acid amplification technology, a set of primers and a composition of a reaction mixture for the detection of selected genetic variants

[0002] The present invention relates to a method for detecting alterations in nucleotide sequence using an isothermal nucleic acid amplification technology, a set of primers and a composition of a reaction mixture for the detection of selected genetic variants. The invention is applicable e.g. in medical diagnostics.

[0003] A gene variant is a permanent change in the DNA sequence making up a gene. This type of genetic change was previously known as gene mutation, but since changes in DNA sequences are not always conducive to diseases, a revision has been made in the relevant nomenclature. Variants may involve one or more nucleotides that make up the gene sequence. Gene variants can be inherited from parents or develop during a person's life.

[0004] Hereditary variants are passed from parent to child and are present throughout a person's life in virtually every cell of their body. These variants are also referred to as germline (germinal) variants because they are present in the parent's ova or sperm cells. When an ovum and a sperm combine cell, the fertilized egg cell contains DNA from both parents. Any variants present in this DNA will be present in the cells of the child. Non-hereditary variants develop at some point in a person's life and are present only in certain cells or tissues rather than in every cell of the body. Since non-hereditary variants usually occur in somatic cells (cells other than germ cells), they are often referred to as somatic variants. These variants cannot be passed on to the next generation. Non-hereditary variants can be caused by various environmental factors, such as ultraviolet radiation or replication errors occurring before cell division (S phase of the cell cycle) or the division of the cell nucleus during mitosis. Some genetic changes are described as de novo variants; they are identified in the child while not being present in either parent. In some cases, the variant is present in the parent's ovum or sperm cell, but not in any other somatic cell. In other cases, the variant develops in the fertilized egg soon after the ovum and sperm combine. It is often impossible to exactly determine when the de novo variant has appeared. When the fertilized egg cell divides, each resulting cell within the growing embryo will contain genetic material with a sequence that matches the variant in question. De novo variants are one of the possible explanations for genetic disorders in which the affected child presents with the variant in every cell of the body while the genomes of the parents are lacking this variant and there is no family history of the disease caused by the particular variant. Variants acquired in the course of the developmental stage may lead to a situation referred to as mosaicism, i.e. genome sequence of a particular group of cells within the body differing from that in other cells. In mosaicism, the genetic change is present neither in the parent's ovum or sperm cells nor in the fertilized egg, and develops at a later stage, at any time between embryonic development and adulthood. When cells grow and divide, cells that arise from a cell with an altered gene will present with the alteration - the variant - while the others will not. When some somatic cells present with a gene variant and others do not, the phenomenon is referred to as somatic mosaicism.

[0005] Depending on the variant and the number of affected cells, somatic mosaicism may cause health problems of varying severity and clinical manifestations while in different case may not result in any phenotype changes. When some ova or sperm cells have a variant and others do not, the phenomenon is referred to as germinal mosaicism. In this situation, a healthy parent can pass on a genetic disease to their child. Most variants do not lead to the development of the disease, and those that do so are infrequent in the general population. Some variants occur within the population frequently enough to be considered common genetic variations.

[0006] Although many of the common DNA variants have no negative impact on human health, some may affect the risk of developing diseases or affect the metabolism of drugs and thus the choice of appropriate treatment. At the same time, the occurrence of variants is common in other living organisms and determines, for example, antibiotic resistance, plant growth rate, resistance to pesticides, etc. Because occurrence of some variants my pose life-threatening disease, it is important that relevant diagnostics be performed quickly and that diagnostic methods be characterized by high sensitivity and specificity. One of the diagnostic methods for detecting variants is DNA / RNA sequencing; however, due to the complex analytical process using a number of molecular methods at intermediate stages of analysis, its use is limited to specialized laboratories. Methods based on DNA / RNA sequencing are also characterized by long waiting times being required before the results are obtained. In less specialized centers, as well as in situations when the analyses pertain to smaller numbers of genetic variants, the diagnostics of genetic variants is based on the presence of an altered sequence being confirmed within the tested sample using technologies involving amplification of a specific nucleic acid fragment within the biological material - the so-called Nucleic Acid Amplification

[0007] Test (NAAT) methods. The most widely used tests in NAAT technology include those based on the Real-Time PCR methodology. A variety of tests making use of the real time methodology are available on the market; however, despite the high competition, these methods are still relatively expensive. Moreover, they require highly specialized personnel, expensive equipment and isolation of genetic material from the patient's sample. In addition, due to the need for cyclic heating and cooling of the reaction mixture, the method is relatively long, and the equipment used consumes a relatively large amount of energy to carry out the diagnostic process. Isothermal methods - including the loop-mediated isothermal amplification (LAMP) method, facilitate speeding up the diagnostic process while reducing the cost of energy required for the analysis and the costs of reagents. According to the literature, these methods have higher sensitivity and specificity than the aforementioned Real-Time PCR methodology while also being much faster. Their isothermal course does not require specialized equipment. Due to their low equipment requirements, isothermal methods are an ideal point-of-care testing (POCT) diagnostic solution, where the test can be performed in a physician's office or at the procedure room during a single patient visit. This solution allows for rapid diagnostic testing (within less than 60 minutes), facilitating the choice of targeted therapy or treatment monitoring as early as at the first visit. This is particularly important in the case of malignancies, frequently associated with rapid tumor spread which can ultimately affect prognosis and survival times. The LAMP method has been exemplarily disclosed in patent publications nos. W00028082 and W00224902. Most of the patent applications published to date and describing the use of primers in the LAMP method for variant detection relate mainly to the detection of single-nucleotide variants and / or use a number of reaction primers that is significantly higher compared to the conventional set of 6 oligonucleotides, thus increasing the chances of obtaining a non-specific result as well as production costs while also extending the times required to design and optimize the test kits. Moreover, most of the proposed solutions result in complex calculations being needed when analyzing the result based on the differences in times required to start an exponential increase of amplicons or considering a negative result (no amplification) as confirmation of a variant being present. The correct interpretation of the result is important, as most samples within the field of oncology are characterized by genetic mosaicism which makes the aforementioned variant detection process pointless. Examples of solutions proposed to date have been disclosed in

[0008] US10364458B2 (use of additional STEM oligonucleotides for SNP detection), JP6408447B2

[0009] (use of an additional set of primers along with fluorescent labeling of the primers),

[0010] US7638280B2 (no amplification when a variant is present) or WO0134838A1 (ability to detect single-nucleotide polymorphisms -SNPs -only near the intron-exon junction) or Khammanee

[0011] T et al. A LAMP-SNP Assay Detecting C580Y Mutation in Pfkelchl3 Gene from Clinically Dried

[0012] Blood Spot Samples. Korean J Parasitol. 2021 Feb;59(l):15-22 (the ability to detect only single- nucleotide polymorphism - SNPs). Thus, there is still a need to provide an easily applicable and reliable diagnostic method using appropriately refined primer sets in the diagnosis of genetic variants using the LAMP method, said method being intended for use at the point of care settings for genetic variants larger than those involving a single nucleotide. The use of the proposed method for designing LAMP reaction primers has facilitated significantly simplification of the composition of the reaction mixture and reduction in the manufacturing costs. In addition, fluorescent dyes allow for real-time detection of the reaction product, significantly reducing the reaction times (< 60 min.) and allowing for additional verification of the result using a melting curve.

[0013] The first object of the invention is a method for the detection of multinucleotide genetic variants using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3'-end so that its end over the length of 2 nucleotides is identical to the nucleic acid sequence downstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the F2 primer sequence matches the nucleic acid sequence along the length of the F2 primer after the insertion and / or deletion has occurred and is connected via its 5' -end, preferably via a TTTT bridge, to the 3'-end of the Flc primer, designed to be reverse and complementary to the nucleic acid fragment to be amplified (the 5' -3' strand) and located between the 3'-end of the F2 primer and the X'-end of the Bic primer while the remaining

[0014] LAMP reaction primers, i.e. F3, B3, BIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5' -3' strand), located upstream to the F2 primer at its 3'-end, its 5' -end marking the beginning of the nucleic acid segment to be amplified, wherein the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5' -3' strand), the 5'-end of the

[0015] B3 primer marking the end of the nucleic acid segment to be amplified and the 3' -end being preceded by the 3' -end of the B2 primer, and wherein the BIP primer consisting of a Bic fragment with a sequence identical to the nucleic acid segment to be amplified, said fragment being located between the 5'-end of the Flc primer and the 3' -end of the B2 primer, is connected, preferably at its 3' -end and via a TTTT bridge, to the 5' -end of the B2 fragment of the BIP primer, said fragment being reverse and complementary to the nucleic acid segment to be amplified while the 5'-end of said primer is located upstream of the 3' -end of the B3 primerand the 3' -end is located downstream of the 3'-end of the Bic primer, and wherein the

[0016] LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3'-end of the F2 primer and the 3' -end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3'- end of the Bic primer and the 3' -end of the B2 primer.

[0017] The second object of the invention is a method for the detection of multinucleotide genetic variants using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' -end so that its end over the length of 3 nucleotides is identical to the nucleic acid sequence downstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the F2 primer sequence matches the nucleic acid sequence along the length of the F2 primer after the insertion and / or deletion has occurred and is connected via its 5' -end, preferably via a TTTT bridge, to the 3'-end of the Flc primer, designed to be reverse and complementary to the nucleic acid fragment to be amplified (the 5'-3' strand) and located between the 3' -end of the F2 primer and the 5' -end of the Bic primer while the remaining LAMP reaction primers, i.e. F3, B3, BIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5' -3' strand), located upstream to the F2 primer at its 3' -end, its 5' -end marking the beginning of the nucleic acid segment to be amplified, wherein the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5' -3' strand), the 5' -end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3' -end being preceded by the 3' -end of the B2 primer, and wherein the BIP primer consisting of a Bic fragment with a sequence identical to the nucleic acid segment to be amplified, said fragment being located between the 5' -end of the Flc primer and the 3'- end of the B2 primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'- end of the B2 fragment of the BIP primer, said fragment being reverse and complementary to the nucleic acid segment to be amplified while the 5' -end of said primer is located upstream of the 3'-end of the B3 primer and the 3'-end is located downstream of the 3'-end of the Bic primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3' -end of the F2 primer and the 3'-end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3' -end of the Bic primer and the 3' -end of the B2 primer.

[0018] The third object of the invention is a method for the detection of multinucleotide genetic variants using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' -end so that its end over the length of 4 nucleotides is identical to the nucleic acid sequence downstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the F2 primer sequence matches the nucleic acid sequence along the length of the F2 primer after the insertion and / or deletion has occurred and is connected via its 5' -end, preferably via a TTTT bridge, to the 3'-end of the Flc primer, designed to be reverse and complementary to the nucleic acid fragment to be amplified (the 5'-3' strand) and located between the 3' -end of the F2 primer and the 5'-end of the Bic primer while the remaining LAMP reaction primers, i.e. F3, B3, BIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5' -3' strand), located upstream to the F2 primer at its 3' -end, its 5' -end marking the beginning of the nucleic acid segment to be amplified, wherein the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5' -3' strand), the 5' -end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3' -end being preceded by the 3' -end of the B2 primer, and wherein the BIP primer consisting of a Bic fragment with a sequence identical to the nucleic acid segment to be amplified, said fragment being located between the 5' -end of the Flc primer and the 3'- end of the B2 primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'- end of the B2 fragment of the BIP primer, said fragment being reverse and complementary to the nucleic acid segment to be amplified while the 5' -end of said primer is located upstream of the 3'-end of the B3 primer and the 3'-end is located downstream of the 3'-end of the Bic primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3' -end of the F2 primer and the 3'-end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3' -end of the Bic primer and the 3' -end of the B2 primer.

[0019] The fourth object of the invention is a method for the detection of multinucleotide genetic variants using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' -end so that its end over the length of 5 nucleotides is identical to the nucleic acid sequence downstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the F2 primer sequence matches the nucleic acid sequence along the length of the F2 primer after the insertion and / or deletion has occurred and is connected via its 5' -end, preferably via a TTTT bridge, to the 3'-end of the Flc primer, designed to be reverse and complementary to the nucleic acid fragment to be amplified (the 5'-3' strand) and located between the 3' -end of the F2 primer and the 5' -end of the Bic primer while the remaining LAMP reaction primers, i.e. F3, B3, BIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5' -3' strand), located upstream to the F2 primer at its 3' -end, its 5' -end marking the beginning of the nucleic acid segment to be amplified, wherein the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5' -3' strand), the 5' -end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3' -end being preceded by the 3' -end of the B2 primer, and wherein the BIP primer consisting of a Bic fragment with a sequence identical to the nucleic acid segment to be amplified, said fragment being located between the 5' -end of the Flc primer and the 3'- end of the B2 primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'- end of the B2 fragment of the BIP primer, said fragment being reverse and complementary to the nucleic acid segment to be amplified while the 5' -end of said primer is located upstream of the 3'-end of the B3 primer and the 3'-end is located downstream of the 3'-end of the Bic primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3' -end of the F2 primer and the 3'-end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3' -end of the Bic primer and the 3' -end of the B2 primer.

[0020] The fifth object of the invention is a method for the detection of multinucleotide genetic variants using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' -end so that its end over the length of 6 nucleotides is identical to the nucleic acid sequence downstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the F2 primer sequence matches the nucleic acid sequence along the length of the F2 primer after the insertion and / or deletion has occurred and is connected via its 5' -end, preferably via a TTTT bridge, to the 3'-end of the Flc primer, designed to be reverse and complementary to the nucleic acid fragment to be amplified (the 5'-3' strand) and located between the 3' -end of the F2 primer and the 5' -end of the Bic primer while the remaining LAMP reaction primers, i.e. F3, B3, BIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5' -3' strand), located upstream to the F2 primer at its 3' -end, its 5' -end marking the beginning of the nucleic acid segment to be amplified, wherein the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5' -3' strand), the 5' -end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3' -end being preceded by the 3' -end of the B2 primer, and wherein the BIP primer consisting of a Bic fragment with a sequence identical to the nucleic acid segment to be amplified, said fragment being located between the 5' -end of the Flc primer and the 3'- end of the B2 primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'- end of the B2 fragment of the BIP primer, said fragment being reverse and complementary to the nucleic acid segment to be amplified while the 5' -end of said primer is located upstream of the 3'-end of the B3 primer and the 3'-end is located downstream of the 3'-end of the Bic primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3' -end of the F2 primer and the 3'-end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3' -end of the Bic primer and the 3' -end of the B2 primer.

[0021] The sixth object of the invention is a method for the detection of multinucleotide genetic variants using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' -end so that its end over the length of 7 nucleotides is identical to the nucleic acid sequence downstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the F2 primer sequence matches the nucleic acid sequence along the length of the F2 primer after the insertion and / or deletion has occurred and is connected via its 5' -end, preferably via a TTTT bridge, to the 3'-end of the Flc primer, designed to be reverse and complementary to the nucleic acid fragment to be amplified (the 5'-3' strand) and located between the 3' -end of the F2 primer and the 5' -end of the Bic primer while the remaining LAMP reaction primers, i.e. F3, B3, BIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5' -3' strand), located upstream to the F2 primer at its 3' -end, its 5' -end marking the beginning of the nucleic acid segment to be amplified, wherein the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5' -3' strand), the 5' -end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3' -end being preceded by the 3' -end of the B2 primer, and wherein the BIP primer consisting of a Bic fragment with a sequence identical to the nucleic acid segment to be amplified, said fragment being located between the 5' -end of the Flc primer and the 3'- end of the B2 primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'- end of the B2 fragment of the BIP primer, said fragment being reverse and complementary to the nucleic acid segment to be amplified while the 5' -end of said primer is located upstream of the 3'-end of the B3 primer and the 3'-end is located downstream of the 3'-end of the Bic primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3' -end of the F2 primer and the 3'-end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3' -end of the Bic primer and the 3' -end of the B2 primer.

[0022] The seventh object of the invention is a method for the detection of genetic variants using the LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has an B2 sequence modified at the 3' -end so that its end over the length 2 nucleotides is reverse and complementary to the nucleic acid sequence upstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the B2 primer sequence is reverse and complementary only to the nucleic acid sequence after the insertion and / or deletion has occurred and is connected via its 5' -end, preferably via a TTTT bridge, to the 3' -end of the Bic primer, designed to be identical to the nucleic acid fragment to be amplified (the 5' -3' strand) and located between the 5' -end of the Flc primer and the 3' -end of the B2 primer while the remaining LAMP reaction primers, i.e. F3, B3, FIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5'-3' strand), located upstream to the F2 primer at its 3'-end, its 5'-end marking the beginning of the nucleic acid segment to be amplified, and the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5'-3' strand), the 5' -end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3' -end being preceded by the 3' -end of the

[0023] B2 primer, wherein the FIP primer consisting of a Flc fragment with a sequence reverse and complementary to the nucleic acid segment to be amplified, said fragment being located between the 3'-end of the F2 primerand the 5' -end of the Bic primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'-end of the F2 fragment of the FIP primer, said fragment being identical to the nucleic acid segment to be amplified while the 5'-end of said primer is located upstream of the 3'-end of the F3 primer and the 3' -end is located upstream of the 3'-end of the Flc primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3' -end of the F2 primer and the 3' -end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3'-end of the Bic primer and the 3' -end of the B2 primer.

[0024] The eighth object of the invention is a method for the detection of genetic variants using the LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has an B2 sequence modified at the 3' -end so that its end over the length

[0025] 3 nucleotides is reverse and complementary to the nucleic acid sequence upstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the B2 primer sequence is reverse and complementary only to the nucleic acid sequence after the insertion and / or deletion has occurred and is connected via its 5' -end, preferably via a TTTT bridge, to the 3' -end of the Bic primer, designed to be identical to the nucleic acid fragment to be amplified (the 5' -3' strand) and located between the 5' -end of the Flc primer and the 3' -end of the B2 primer while the remaining LAMP reaction primers, i.e. F3, B3, FIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5'-3' strand), located upstream to the F2 primer at its 3'-end, its 5'-end marking the beginning of the nucleic acid segment to be amplified, and the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5'-3' strand), the 5' -end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3' -end being preceded by the 3' -end of the

[0026] B2 primer, wherein the FIP primer consisting of a Flc fragment with a sequence reverse and complementary to the nucleic acid segment to be amplified, said fragment being located between the 3'-end of the F2 primerand the 5' -end of the Bic primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'-end of the F2 fragment of the FIP primer, said fragment being identical to the nucleic acid segment to be amplified while the 5'-end of said primer is located upstream of the 3'-end of the F3 primer and the 3' -end is located upstream of the 3'-end of the Flc primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3' -end of the F2 primer and the 3' -end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3'-end of the Bic primer and the 3' -end of the B2 primer. The ninth object of the invention is a method for the detection of genetic variants using the LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has an B2 sequence modified at the 3' -end so that its end over the length

[0027] 4 nucleotides is reverse and complementary to the nucleic acid sequence upstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the B2 primer sequence is reverse and complementary only to the nucleic acid sequence after the insertion and / or deletion has occurred and is connected via its 5' -end, preferably via a TTTT bridge, to the 3' -end of the Bic primer, designed to be identical to the nucleic acid fragment to be amplified (the 5' -3' strand) and located between the 5' -end of the Flc primer and the 3' -end of the B2 primer while the remaining LAMP reaction primers, i.e. F3, B3, FIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5'-3' strand), located upstream to the F2 primer at its 3'-end, its 5'-end marking the beginning of the nucleic acid segment to be amplified, and the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5'-3' strand), the 5' -end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3' -end being preceded by the 3' -end of the

[0028] B2 primer, wherein the FIP primer consisting of a Flc fragment with a sequence reverse and complementary to the nucleic acid segment to be amplified, said fragment being located between the 3'-end of the F2 primerand the 5' -end of the Bic primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'-end of the F2 fragment of the FIP primer, said fragment being identical to the nucleic acid segment to be amplified while the 5'-end of said primer is located upstream of the 3'-end of the F3 primer and the 3' -end is located upstream of the 3'-end of the Flc primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3' -end of the F2 primer and the 3' -end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3'-end of the Bic primer and the 3' -end of the B2 primer.

[0029] The tenth object of the inventionis a method for the detection of genetic variants using the LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has an B2 sequence modified at the 3' -end so that its end over the length

[0030] 5 nucleotides is reverse and complementary to the nucleic acid sequence upstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the B2 primer sequence is reverse and complementary only to the nucleic acid sequence after the insertion and / or deletion has occurred and is connected via its 5' -end, preferably via a TTTT bridge, to the 3' -end of the Bic primer, designed to be identical to the nucleic acid fragment to be amplified (the 5' -3' strand) and located between the 5' -end of the Flc primer and the 3' -end of the B2 primer while the remaining LAMP reaction primers, i.e. F3, B3, FIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5'-3' strand), located upstream to the F2 primer at its 3'-end, its 5'-end marking the beginning of the nucleic acid segment to be amplified, and the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5'-3' strand), the 5' -end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3' -end being preceded by the 3' -end of the

[0031] B2 primer, wherein the FIP primer consisting of a Flc fragment with a sequence reverse and complementary to the nucleic acid segment to be amplified, said fragment being located between the 3'-end of the F2 primerand the 5' -end of the Bic primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'-end of the F2 fragment of the FIP primer, said fragment being identical to the nucleic acid segment to be amplified while the 5'-end of said primer is located upstream of the 3'-end of the F3 primer and the 3' -end is located upstream of the 3'-end of the Flc primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3' -end of the F2 primer and the 3' -end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3'-end of the Bic primer and the 3' -end of the B2 primer.

[0032] The eleventh object of the invention is a method for the detection of genetic variants using the LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has an B2 sequence modified at the 3'-end so that its end over the length 6 nucleotides is reverse and complementary to the nucleic acid sequence upstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the B2 primer sequence is reverse and complementary only to the nucleic acid sequence after the insertion and / or deletion has occurred and is connected via its 5'-end, preferably via a TTTT bridge, to the 3' -end of the Bic primer, designed to be identical to the nucleic acid fragment to be amplified (the 5' -3' strand) and located between the 5' -end of the Flc primer and the 3' -end of the B2 primer while the remaining LAMP reaction primers, i.e. F3, B3, FIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5' -3' strand), located upstream to the F2 primer at its 3'-end, its 5'-end marking the beginning of the nucleic acid segment to be amplified, and the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5' -3' strand), the 5'-end of the

[0033] B3 primer marking the end of the nucleic acid segment to be amplified and the 3' -end being preceded by the 3'-end of the B2 primer, wherein the FIP primer consisting of a Flc fragment with a sequence reverse and complementary to the nucleic acid segment to be amplified, said fragment being located between the 3' -end of the F2 primerand the 5' -end of the Bic primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'-end of the F2 fragment of the FIP primer, said fragment being identical to the nucleic acid segment to be amplified while the 5'-end of said primer is located upstream of the 3' -end of the F3 primer and the 3'- end is located upstream of the 3' -end of the Flc primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3' -end of the F2 primer and the 3'-end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3' -end of the Bic primer and the 3' -end of the B2 primer.

[0034] The twelfth object of the invention is a method for the detection of genetic variants using the LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has an B2 sequence modified at the 3' -end so that its end over the length

[0035] 7 nucleotides is reverse and complementary to the nucleic acid sequence upstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the B2 primer sequence is reverse and complementary only to the nucleic acid sequence after the insertion and / or deletion has occurred and is connected via its 5' -end, preferably via a TTTT bridge, to the 3' -end of the Bic primer, designed to be identical to the nucleic acid fragment to be amplified (the 5' -3' strand) and located between the 5' -end of the Flc primer and the 3' -end of the B2 primer while the remaining LAMP reaction primers, i.e. F3, B3, FIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5'-3' strand), located upstream to the F2 primer at its 3'-end, its 5'-end marking the beginning of the nucleic acid segment to be amplified, and the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5'-3' strand), the 5' -end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3' -end being preceded by the 3' -end of the

[0036] B2 primer, wherein the FIP primer consisting of a Flc fragment with a sequence reverse and complementary to the nucleic acid segment to be amplified, said fragment being located between the 3'-end of the F2 primerand the 5' -end of the Bic primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'-end of the F2 fragment of the FIP primer, said fragment being identical to the nucleic acid segment to be amplified while the 5'-end of said primer is located upstream of the 3'-end of the F3 primer and the 3' -end is located upstream of the 3'-end of the Flc primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3' -end of the F2 primer and the 3' -end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3'-end of the Bic primer and the 3' -end of the B2 primer.

[0037] In every aspect of the invention, including the objects of the invention presented above, that is not related to its novelty features, the primers are designed in line with current art as presented e.g. by Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino

[0038] N, Hase T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000 Jun 15;28(12):E63. doi: 10.1093 / nar / 28.12.e63. PMID: 10871386; PMCID: PMC102748 and

[0039] Nagamine K, Hase T, Notomi T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol Cell Probes. 2002 Jun;16(3):223-9. doi:

[0040] 10.1006 / mcpr.2002.0415. PMID: 12144774 in a manner that does not deviate from the literature recommendations or using bioinformatics software such as PrimerExplorer (Eiken).

[0041] The thirteenth object of the invention is a primer set for amplifying nucleotide sequence of a fragment of the human EGFR (epithelial growth factor receptor) gene, characterized in that the primer set contains a set of internal primers having the following nucleotide sequences (a) and (b), and an a set of external primers having the following nucleotide sequences (c) and (d), the primer set being specific to a fragment of the human

[0042] EGFR gene carrying the NM_005228.5(EGFR): c.2235_2249del (p.Glu746_Ala750del) mutation within exon 19: a) Flc 5' GACCCCCACACAGCAAAGCA 3' - nucleotide sequence SEQ ID NO: 3 - connected at its 3'-end, preferably via a TTTT bridge, to sequence

[0043] F25' TCCCGTCGCTATCAAAACAT 3' - nucleotide sequence SEQ ID NO: 4 b) Bic 5' GCTGCTCTGCTCTAGACCCT 3' - nucleotide sequence SEQ ID NO: 5 or - connected at its 3'-end, preferably via a TTTT bridge, to sequence B2 5'

[0044] AGAGGCCAGTGCTGTCT 3' - nucleotide sequence SEQ ID NO: 6 c) F3 5' TGGATCCCAGAAGGTGAGAA 3' - nucleotide sequence SEQ ID NO: 1 - and d) B3 5' GGGGTGGATACCAGCATG 3' nucleotide sequence SEQ ID NO: 2

[0045] Preferably, the primer set according to the invention is characterized in the said primer set contains a set of loop primer sequences containing nucleotide sequences contained within or complementary to a fragment of the human EGFR gene having SEQ ID NOs: 7 - LF 5' TCACATCGAGGATTTCCTTGTTG 3' and SEQ ID NO: 8: LB 5' GCTCTAGTGGGTATAACTCCCTC 3'.

[0046] The fourteenth object of the invention is a primer set for amplifying nucleotide sequence of a fragment of the human EGFR (epithelial growth factor receptor) gene, characterized in that the primer set contains a set of internal primers having the following nucleotide sequences (a) and (b), and an a set of external primers having the following nucleotide sequences (c) and (d), the primer set being specific to a fragment of the human

[0047] EGFR gene carrying the NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del) mutation or the NM 005228.3 :c.2239 2253dell5 mutation or the

[0048] NM 005228.3:c.2238 2252dell5 mutation within exon 19: a) Flc 5' GACCCCCACACAGCAAAGCA 3' - nucleotide sequence SEQ ID NO: 3 - connected at its 3'-end, preferably via a TTTT bridge, to sequence

[0049] F2 5' TCCCGTCGCTATCAAGGAATCTC 3' - nucleotide sequence SEQ ID NO: 9 b) Bic 5' GCTGCTCTGCTCTAGACCCT 3' - nucleotide sequence SEQ ID NO: 5 or - connected at its 3'-end, preferably via a TTTT bridge, to sequence B2 5'

[0050] AGAGGCCAGTGCTGTCT 3' - nucleotide sequence SEQ ID NO: 6 c) F3 5' TGGATCCCAGAAGGTGAGAA 3' - nucleotide sequence SEQ ID NO: 1 - and d) B3 5' GGGGTGGATACCAGCATG 3' nucleotide sequence SEQ ID NO: 2

[0051] Preferably, the primer set according to the invention is characterized in that the primer set contains a set of loop primer sequences containing nucleotide sequences contained within or complementary to a fragment of the human EGFR gene having SEQ ID NOs: 7 - LF

[0052] 5' TCACATCGAGGATTTCCTTGTTG 3' and SEQ ID NO: 8: LB 5' GCTCTAGTGGGTATAACTCCCTC 3'.

[0053] The fifteenth object of the invention is a primer set for amplifying nucleotide sequence of a fragment of the human EGFR (epithelial growth factor receptor) gene, characterized in that the primer set contains a set of internal primers having the following nucleotide sequences (a) and (b), and an a set of external primers having the following nucleotide sequences (c) and (d), the primer set being specific for a fragment of the human

[0054] EGFR gene carrying the NM_005228.5(EGFR):c.2230_2249delinsGTCAA

[0055] (p.lle744_Ala750delinsValLys) mutation within exon 19: a) Flc 5' GACCCCCACACAGCAAAGCA 3' - nucleotide sequence SEQ ID NO: 3 - connected at its 3'-end, preferably via a TTTT bridge, to sequence

[0056] F2 5' TCCCGTCGCTGTCAAAACAT 3' - nucleotide sequence SEQ ID NO: 15 b) Bic 5' GCTGCTCTGCTCTAGACCCT 3' - nucleotide sequence SEQ ID NO: 5 or - connected at its 3'-end, preferably via a TTTT bridge, to sequence B2

[0057] 5' AGAGGCCAGTGCTGTCT 3' - nucleotide sequence SEQ ID NO: 6 c) F3 5' TGGATCCCAGAAGGTGAGAA 3' - nucleotide sequence SEQ ID NO: 1 - and d) B3 5' GGGGTGGATACCAGCATG 3' nucleotide sequence SEQ ID NO: 2. Preferably, the primer set according to the invention is characterized in that the primer set contains a set of loop primer sequences containing nucleotide sequences contained within or complementary to a fragment of the human EGFR gene having SEQ ID NOs: 7 - LF

[0058] 5' TCACATCGAGGATTTCCTTGTTG 3' and SEQ ID NO: 8: LB 5' GCTCTAGTGGGTATAACTCCCTC 3'.

[0059] The sixteenth object of the invention is a method for the detection of mutations

[0060] NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del);

[0061] NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);

[0062] NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5;

[0063] NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) present within exon 19 of the human EGFR gene characterized in that selected regions of the nucleotide sequence of human genome are amplified using the primer set according to any of the invention objects 11 through 14, wherein the duplication method is RealTime-LAMP.

[0064] Preferably, the method for the detection of mutations NM_005228.5(EGFR):c.2235_2249del

[0065] (p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);

[0066] NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5;

[0067] NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) present within exon 19 of the human EGFR gene according to the invention is characterized in that the amplification is carried out at the temperature profile of 68’C, 50 min.

[0068] Preferably, the method for the detection of mutations NM_005228.5(EGFR):c.2235_2249del

[0069] (p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);

[0070] NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5;

[0071] NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) present within exon 19 of the human EGFR gene according to the invention is characterized in that the method involves the detection method according to the sixteenth object of the invention and its preferred alternative.

[0072] The seventeenth object of the invention is a kit for the detection of mutations

[0073] NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del);

[0074] NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);

[0075] NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5;

[0076] NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) present within exon 19 of the human EGFR gene characterized in that said kit contains a primer set according to any of the invention objects defined above.

[0077] Preferably, the kit for the detection of mutations

[0078] NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del);

[0079] NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);

[0080] NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5;

[0081] NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) present within exon 19 of the human EGFR gene according to the invention is characterized in that the kit contains 5,0 pL Universal WarmStart* LAMP 2X Master Mix (New England Biolabs), for example obtained from (https: / / www.neb.com / en / products / el700-warmstart-lamp-kit-dna- rna#Product%20lnformation).

[0082] Preferably, the kit for the detection of mutations

[0083] NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del);

[0084] NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);

[0085] NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5;

[0086] NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) present within exon 19 of the human EGFR gene according to any of the invention objects defined above is characterized in that the primer concentrations within said kit are as follows: 0.15 pM F3, 0,15 pM B3, 1,20 pM FIP NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); 1,20 pM FIP

[0087] NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);

[0088] NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5; 1,20 pM FIP

[0089] NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys), 1,20 pM BIP,

[0090] 0,30 pM LF, 0,30 pM LB; D-(+)-Trehalose dihydrate - 6%; mannitol - 1,25%; fluorescent double-stranded DNA stain - EvaGreen (Biotium) https: / / biotium.com / product / evagreen- dve-20x-in-water / at SS IIXX or Fluorescent Dye (New England Biolabs) (https: / / www. neb, com / en / products / bl 700 lamp fluorescent dye#Product%20lnformation) at S 0,5 pL or GreenFluorescent Dye (Lucigen) (https: / / shop.biosearchtech.com / isothermal- amplification / isothermal-amplification-reagents / dna-lamp-kits-and-master-mixes / green- fluorescent-dye / p / PCRAMP-008) at SI PL or SYTO-13 (ThermoFisher Scientific) (https: / / www.thermofisher.com / order / catalog / product / S7575?ef_id=CjwKCAjw38SoBhB6Ei wA8EQVLkJfh09SOOvPUC-QmpO9zp8pjrA7AOlDZnAR_TOzQfZtv- AMS2xPKRoC3X4QAvD_BwE:G:s&s_kwcid=ALI3652l3l447292198733lllgllll0506731179ll0

[0091] 9642167491&cid=bid_pca_iva_r01_co_cpl359_pjt0000_bid00000_0se_gaw_dy_pur_con&g clid=CjwKCAjw38SoBhB6EiwA8EQVLkJfh09SOOvPUC-QmpO9zp8pjrA7AOlDZnAR_TOzQfZtv-

[0092] AMS2xPKRoC3X4QAvD_BwE) at ≤16 pM or SYTO-82 (ThermoFisher Scientific)

[0093] (https: / / www.thermofisher.com / order / catalog / product / S11363?SID=srch-srp-S11363) at

[0094] < 16 pM or other double-stranded DNA stain at concentration not inhibiting the amplification process.

[0095] The advantages of the described method for the detection of genetic variants using the LAMP technology include the high reliability of the result, the specificity, and the facilitated capability for multiplexation of kits for the detection of several variants within a single reaction and the lower production cost associated with the lower number of primers required for the reaction compared to previously disclosed solutions. An advantage of the primer set according to the invention for the detection of mutations

[0096] NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del);

[0097] NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);

[0098] NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5;

[0099] NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) within exon 19 of the EGFR gene and the method for the detection of amplification products is that it simultaneously detects a number of clinically relevant mutations and can be used as a pointof-care test (POCT) on a portable genetic analyzer as part of its intended application. In turn, the use of a fluorescent dye for the detection of amplification products increases the sensitivity and specificity of the method facilitating additional validation of the result using a melting curve.

[0100] Example embodiments of the invention are shown in the drawings, wherein Fig. 1 presents the specificity characteristics of the method, wherein specific signal was obtained for synthetic templates modified to represent the human EGFR gene with the

[0101] NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19 whereas no signals were obtained in a sample containing human genetic material extracted from a healthy person (wild-type) and a no template control - NIC; Fig. 2 presents the specificity characteristics of the method, wherein specific signal was obtained for synthetic templates modified to represent the human EGFR gene with the

[0102] NM_005228.5(EGFR):c.2240_2254del(p.Leu747_Thr751del);

[0103] NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5 mutation in exon 19 whereas no signals were obtained in a sample containing human genetic material extracted from a healthy person (wild-type) and a no template control - NIC; Fig. 3 presents the specificity characteristics of the method, wherein specific signal was obtained for synthetic templates modified to represent the human EGFR gene with the

[0104] NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) mutation in exon 19 whereas no signals were obtained in a sample containing human genetic material extracted from a healthy person (wild-type) and a no template control - NIC with the realtime detection results being shown in Table 1 indicating the minimum times required to detect the fluorescence signal.

[0105] Table 1:

[0106] While Fig. 4 illustrates the specificity of the method involving the analysis of the melting curve providing melting temperature of the reaction product for mutation

[0107] NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); Fig. 5 illustrates the specificity of the method involving the analysis of the melting curve to provide melting temperature of the reaction product for mutation NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);

[0108] NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5); Fig. 6 illustrates the specificity of the method involving the analysis of the melting curve to provide melting temperature of the reaction product for mutation

[0109] NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys); Figs. 7-10 depicts an illustrative method for the design of primers in the method described in the first object of the invention using the example of a genetic variant associated with deletion, where

[0110] Fig. 7 presents the a genome fragment with the fragment undergoing deletion being marked,

[0111] Fig. 8 presents the genome fragment after deletion, Fig. 9 depicts, in an illustrative manner, the location of the LAMP reaction primers and / or their attachment sites, where the F2 primer linking to the F2c fragment located on the 3'>5' strand of the genetic material was used to detect the genetic variant, Fig. 10 depicts, in an illustrative manner, the location of the LAMP reaction primers and / or their attachment sites, where the B2 primer linking to the B2c fragment located on the 5'>3' strand of the genetic material was used to detect the genetic variant; Figs. 11-13 show the results of the amplification reaction in the modified LAMP method depending on the presence / attachment of the FIP or BI P primer, wherein the product of the reaction occurring in the presence of all primers as shown in Fig. 11 and the absence of the reaction product when the FIP primer (Fig. 12) or the BIP primer (Fig. 13) has not attached, Table 2 showing the times required to obtain an exponential increase in the quantity of product in the RealTime-LAMP reaction

[0112] Table 2.

[0113] The results showing that both the FIP and the BIP primers play a crucial role in the course of the LAMP reaction. At the same time, the mechanism of the LAMP reaction clearly indicates that the BIP primer is the functional equivalent of the FIP primer acting on the leading strand.

[0114] Thus, the modification described in the second object of the invention allows for the detection of a nucleotide variant using the leading strand and the BI P primer; Figure 14 shows the results of an amplification reaction as carried out using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has the F2 sequence SEQ ID NO: 15 modified within the 3' -end region in a way that its end over the length of 1 nucleotide, is identical to the nucleic acid sequence after the detected insertion and / or deletion containing the genetic variant being detected and the remaining primers, i.e. F3, B3, BIP and loops LF and

[0115] LB are identical to those shown in example 1. Fig. 14. presents the product of reaction with a synthetic template modified to represent the human EGFR gene with the

[0116] NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19; the product being also present in a sample containing human genetic material extracted from a healthy person (wild-type) and no signal being detected in the no template control - NIC. This result confirms that modification of either the F2 or B2 primer within the range of a single nucleotide does not allow specific detection of the genetic variant, Table 3 showing the times required to obtain an exponential increase in the amount of product in the RealTime-LAMP reaction.

[0117] Table 3:

[0118] Fig. 15 shows the results of an amplification reaction as carried out using the multinucleotide genetic variant detection method using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has the F2 sequence SEQ ID NO: 11 modified within the 3' -end region so that its end over the length of 2 nucleotides is identical to the nucleic acid sequence after the detected insertion and / or deletion containing the genetic variant being detected and the remaining primers, i.e. F3, B3, BIP and loops LF and LB are identical to those shown in example 1. Fig. 15 presents the product of reaction with a synthetic template modified to represent the human EGFR gene with the

[0119] NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19 and no signal being detected in a sample containing human genetic material extracted from a healthy person (wild-type) and in the no template control - NIC, Table 3 showing the times required to obtain an exponential increase in the quantity of product in the RealTime-LAMP reaction.

[0120] This result confirms that modification of either the F2 or B2 primer within the range of two nucleotides facilitates specific detection of the genetic variant.Fig. 16 shows the results of an amplification reaction as carried out using the multinucleotide genetic variant detection method using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has the F2 sequence SEQ ID NO: 12 modified within the 3'-end region so that its end over the length of 3 nucleotides is identical to the nucleic acid sequence after the detected insertion and / or deletion containing the genetic variant being detected and the remaining primers, i.e. F3, B3, BIP and loops LF and LB are identical to those shown in example

[0121] 1. Fig. 16 presents the product of reaction with a synthetic template modified to represent the human EGFR gene with the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19 whereas no signals were obtained in a sample containing human genetic material extracted from a healthy person (wild-type) and a no template control - NIC, Table

[0122] 3 showing the times required to obtain an exponential increase in the quantity of product in the RealTime-LAMP reaction. This result confirms that modification of either the F2 or B2 primer within the range of three nucleotides facilitates specific detection of the genetic variant. Fig. 17 shows the results of an amplification reaction as carried out using the multinucleotide genetic variant detection method using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has the F2 sequence SEQ ID

[0123] NO: 13 modified within the 3' -end region so that its end over the length of 4 nucleotides, is identical to the nucleic acid sequence after the detected insertion and / or deletion containing the genetic variant being detected and the remaining primers, i.e. F3, B3, BIP and loops LF and

[0124] LB are identical to those shown in example 1. Fig. 17 presents the product of reaction with a synthetic template modified to represent the human EGFR gene with the

[0125] NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19 whereas no signals were obtained in a sample containing human genetic material extracted from a healthy person (wild-type) and a no template control - NTC, Table 3 showing the times required to obtain an exponential increase in the quantity of product in the RealTime-LAMP reaction This result confirms that modification of either the F2 or B2 primer within the range of four nucleotides facilitates specific detection of the genetic variant. Fig. 18 shows the results of an amplification reaction as carried out using the multinucleotide genetic variant detection method using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has the F2 sequence SEQ ID NO: 4 modified within the 3'-end region so that its end over the length of 5 nucleotides is identical to the nucleic acid sequence after the detected insertion and / or deletion containing the genetic variant being detected and the remaining primers, i.e. F3, B3, BIP and loops LF and LB are identical to those shown in example

[0126] 1. Fig. 18 presents the product of reaction with a synthetic template modified to represent the human EGFR gene with the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19 whereas no signals were obtained in a sample containing human genetic material extracted from a healthy person (wild-type) and a no template control - NIC, Table

[0127] 3 showing the times required to obtain an exponential increase in the quantity of product in the RealTime-LAMP reaction This result confirms that modification of either the F2 or B2 primer within the range of five nucleotides facilitates specific detection of the genetic variant.

[0128] Fig. 19 shows the results of an amplification reaction as carried out using the multinucleotide genetic variant detection method using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has the F2 sequence SEQ ID NO: 14 modified within the 3' -end region so that its end over the length of 6 nucleotides is identical to the nucleic acid sequence after the detected insertion and / or deletion containing the genetic variant being detected and the remaining primers, i.e. F3, B3, BIP and loops LF and LB are identical to those shown in example 1. Fig. 19 presents the specificity characteristics of the method, wherein specific signal was obtained for synthetic templates modified to represent the human EGFR gene with the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19 whereas no signals were obtained in a sample containing human genetic material extracted from a healthy person (wild-type) and a no template control - NTS; fig.

[0129] Table 3 showing the times required to obtain an exponential increase in the quantity of product in the RealTime-LAMP reaction This result confirms that modification of either the F2 or B2 primer within the range of six nucleotides facilitates specific detection of the genetic variant. Fig. 20 shows the results of an amplification reaction as carried out using the multinucleotide genetic variant detection method using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has the F2 sequence SEQ ID

[0130] NO: 16 modified within the 3' -end region so that its end over the length of 7 nucleotides, is identical to the nucleic acid sequence after the detected insertion and / or deletion containing the genetic variant being detected and the remaining primers, i.e. F3, B3, BIP and loops LF and

[0131] LB are identical to those shown in example 1. Fig. 20 presents the product of reaction with a synthetic template modified to represent the human EGFR gene with the

[0132] NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19 whereas no signals were obtained in a sample containing human genetic material extracted from a healthy person (wild-type) and a no template control - NIC. Table 3 showing the times required to obtain an exponential increase in the quantity of product in the RealTime-LAMP reaction. This result confirms that modification of either the F2 or B2 primer within the range of seven nucleotides facilitates specific detection of the genetic variant. Fig. 21 shows the results of an amplification reaction as carried out using the multinucleotide genetic variant detection method using the LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has the B2 sequence SEQ ID NO: 6 modified within the 3' -end region so that its end over the length of 5 nucleotides, is identical to the nucleic acid sequence after the detected insertion and / or deletion containing the genetic variant being detected and the remaining primers, i.e. F3, B3, FIP and loops LF and LB are identical to those shown in example

[0133] 1. Fig. 21 presents the product of reaction with a synthetic template modified to represent the human EGFR gene with the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19 whereas no signals were obtained in a sample containing human EGFR gene modified so as to represent the NM_005228.5(EGFR):c.2235_2249del

[0134] (p.Glu746_Ala750del) mutation in exon 19 with an insertion of 10 nucleotides at the primer

[0135] B2 (SEQ ID NO: 6) and a no template control - NTC, Table 4 showing the times required to obtain an exponential increase in the quantity of product in the RealTime-LAMP reaction. This result confirms that modification of the B2 primer within the range of five nucleotides facilitates specific detection of the genetic variant. Table 4:

[0136] Example 1. Primer sequences

[0137] The specific oligonucleotide sequences used to amplify a nucleotide sequence specific to a fragment of the human EGFR gene carrying the NM_005228.5(EGFR):c.2235_2249del

[0138] (p.Glu746_Ala750del) mutation using the RT-LAMP technology are presented and characterized below.

[0139] 1. The sequence of oligonucleotide F3: 5' TGGATCCCAGAAGGTGAGAA 3' constitutes a sequence identical to that of a fragment of the human EGFR gene (the 5'-3' strand) carrying the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation. 2. The sequence of oligonucleotide B3: 5' GGGGTGGATACCAGCATG 3' constitutes a complementary fragment of the human EGFR gene (the 5'-3' strand) carrying the

[0140] NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation located 247 nucleotides away from the 3' -end of oligonucleotide 1.

[0141] 3. The sequence of oligonucleotide F2: 5' TCCCGTCGCTATCAAAACAT 3' constitutes a sequence identical to that of a fragment of the human EGFR gene (the 5'-3' strand) carrying the

[0142] NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation located 9 nucleotides away from the 3'-end of oligonucleotide 1.

[0143] 4. The sequence of oligonucleotide B2: 5' AGAGGCCAGTGCTGTCT 3' constitutes a complementary fragment of the human EGFR gene (the 5'-3' strand) carrying the

[0144] NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation located 228 nucleotides away from the 3' -end of oligonucleotide 1.

[0145] 5. The sequence of oligonucleotide Flc: 5' GACCCCCACACAGCAAAGCA 3' constitutes a complementary fragment of the human EGFR gene (the 5'-3' strand) carrying the

[0146] NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation located 67 nucleotides away from the 3'-end of oligonucleotide 1.

[0147] 6. The sequence of oligonucleotide Bic: 5' GCTGCTCTGCTCTAGACCCT 3' constitutes a sequence identical to that of a fragment of the human EGFR gene (the 5'-3' strand) carrying the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation located 129 nucleotides away from the 3' -end of oligonucleotide 1.

[0148] The Flc and F2 oligonucleotide sequences are advantageously linked by a TTTT bridge and used as the FIP primer. The Bic and B2 oligonucleotide sequences are advantageously linked by a TTTT bridge and used as the BIP primer.

[0149] 7. The sequence of oligonucleotide LF: 5' TCACATCGAGGATTTCCTTGTTG 3'.

[0150] 8. The sequence of oligonucleotide LB: 5' GCTCTAGTGGGTATAACTCCCTC 3'. The specific oligonucleotide sequences used to amplify a nucleotide sequence specific to a fragment of the human EGFR gene exon 19 carrying the NM_005228.5(EGFR)x.2240_2254del

[0151] (p.Leu747_Thr751del) mutation or the NM_005228.3:c.2239_2253dell5 mutation or the

[0152] NM_005228.3x.2238_2252dell5 mutation using the RT-LAMP technology are presented and characterized below.

[0153] 1. The sequence of oligonucleotide F3: 5' TGGATCCCAGAAGGTGAGAA 3' constitutes a sequence identical to that of a fragment of the human EGFR gene (the 5'-3' strand) carrying the NM_005228.5(EGFR)x.2240_2254del (p.Leu747_Thr751del) mutation or the

[0154] NM 005228.3x.2239 2253dell5 mutation or the NM 005228.3x.2238 2252dell5 mutation.

[0155] 2. The sequence of oligonucleotide B3: 5' GGGGTGGATACCAGCATG 3' constitutes a complementary fragment of the human EGFR gene (the 5'-3' strand) carrying the

[0156] NM_005228.5(EGFR)x.2240_2254del (p.Leu747_Thr751del) mutation or the

[0157] NM 005228.3x.2239 2253dell5 mutation or the NM 005228.3x.2238 2252dell5 mutation located 247 nucleotides away from the 3'-end of oligonucleotide 1.

[0158] 3. The sequence of oligonucleotide F2: 5' TCCCGTCGCTATCAAGGAATCTC 3' constitutes a sequence identical to that of a fragment of the human EGFR gene (the 5'-3' strand) carrying the NM_005228.5(EGFR)x.2240_2254del (p.Leu747_Thr751del) mutation or the

[0159] NM 005228.3x.2239 2253dell5 mutation or the NM 005228.3x.2238 2252dell5 mutation located 9 nucleotides away from the 3'-end of oligonucleotide 1.

[0160] 4. The sequence of oligonucleotide B2: 5' AGAGGCCAGTGCTGTCT 3' constitutes a complementary fragment of the human EGFR gene (the 5'-3' strand) carrying the

[0161] NM_005228.5(EGFR)x.2240_2254del (p.Leu747_Thr751del) mutation or the

[0162] NM 005228.3x.2239 2253dell5 mutation or the NM 005228.3x.2238 2252dell5 mutation located 228 nucleotides away from the 3'-end of oligonucleotide 1.

[0163] 5. The sequence of oligonucleotide Flc: 5' GACCCCCACACAGCAAAGCA 3' constitutes a complementary fragment of the human EGFR gene (the 5'-3' strand) carrying the

[0164] NM_005228.5(EGFR)x.2240_2254del (p.Leu747_Thr751del) mutation or the NM 005228.3:c.2239 2253dell5 mutation or the NM 005228.3:c.2238 2252dell5 mutation located 67 nucleotides away from the 3' -end of oligonucleotide 1.

[0165] 6. The sequence of oligonucleotide Bic: 5' GCTGCTCTGCTCTAGACCCT 3' constitutes a sequence identical to that of a fragment of the human EGFR gene (the 5'-3' strand) carrying the NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del) mutation or the

[0166] NM 005228.3:c.2239 2253dell5 mutation or the NM 005228.3:c.2238 2252dell5 mutation located 129 nucleotides away from the 3'-end of oligonucleotide 1.

[0167] The Flc and F2 oligonucleotide sequences are advantageously linked by a TTTT bridge and used as the FIP primer. The Bic and B2 oligonucleotide sequences are advantageously linked by a TTTT bridge and used as the BIP primer.

[0168] 7. The sequence of oligonucleotide LF: 5' TCACATCGAGGATTTCCTTGTTG 3'.

[0169] 8. The sequence of oligonucleotide LB: 5' GCTCTAGTGGGTATAACTCCCTC 3'.

[0170] The specific oligonucleotide sequences used to amplify a nucleotide sequence specific to a fragment of the human EGFR gene exon 19 carrying the

[0171] NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) mutation using the RT-LAMP technology are presented and characterized below.

[0172] 1. The sequence of oligonucleotide F3: 5' TGGATCCCAGAAGGTGAGAA 3' constitutes a sequence identical to that of a fragment of the human EGFR gene (the 5'-3' strand) carrying the NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) mutation.

[0173] 2. The sequence of oligonucleotide B3: 5' GGGGTGGATACCAGCATG 3' constitutes a complementary fragment of the human EGFR gene (the 5'-3' strand) carrying the

[0174] NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) mutation located 247 nucleotides away from the 3'-end of oligonucleotide 1.

[0175] 3. The sequence of oligonucleotide F2: 5' TCCCGTCGCTGTCAAAACAT 3' constitutes a sequence identical to that of a fragment of the human EGFR gene (the 5'-3' strand) carrying the NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) mutation located 9 nucleotides away from the 3'-end of oligonucleotide 1.

[0176] 4. The sequence of oligonucleotide B2: 5' AGAGGCCAGTGCTGTCT 3' constitutes a complementary fragment of the human EGFR gene (the 5'-3' strand) carrying the

[0177] NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) mutation located 228 nucleotides away from the 3'-end of oligonucleotide 1.

[0178] 5. The sequence of oligonucleotide Flc: 5' GACCCCCACACAGCAAAGCA 3' constitutes a complementary fragment of the human EGFR gene (the 5'-3' strand) carrying the

[0179] NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) mutation located 67 nucleotides away from the 3' -end of oligonucleotide 1.

[0180] 6. The sequence of oligonucleotide Bic: 5' GCTGCTCTGCTCTAGACCCT 3' constitutes a sequence identical to that of a fragment of the human EGFR gene (the 5'-3' strand) carrying the NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) mutation located 129 nucleotides away from the 3'-end of oligonucleotide 1.

[0181] The Flc and F2 oligonucleotide sequences are advantageously linked by a TTTT bridge and used as the FIP primer. The Bic and B2 oligonucleotide sequences are advantageously linked by a TTTT bridge and used as the BIP primer.

[0182] 7. The sequence of oligonucleotide LF: 5' TCACATCGAGGATTTCCTTGTTG 3'.

[0183] 8. The sequence of oligonucleotide LB: 5' GCTCTAGTGGGTATAACTCCCTC 3'.

[0184] Example 2. Composition of the reaction mixture

[0185] The method for the amplification of a fragment of the human EGFR gene carrying one of the following mutations: NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del);

[0186] NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);

[0187] NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5;

[0188] NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) using the nucleotides described in Example 1 by means of the RT-LAMP technology with the following reaction mixture composition:

[0189] 5,0 pL Universal WarmStart* LAMP 2X Master Mix (New England Biolabs)

[0190] 0,15 pM F3

[0191] 0,15 pM B3

[0192] 1,20 pM FIP NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del)

[0193] 1,20 pM FIP NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);

[0194] NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5

[0195] 1,20 pM FIP NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys)

[0196] 1,20 pM BIP

[0197] 0,30 pM LF

[0198] 0,30 pM LB

[0199] D-(+)-Trehalose dihydrate - 6%

[0200] Mannitol - 1,25%

[0201] Fluorescent stain dye - EvaGreen (Biotium) (< IX) or Fluorescent Dye SOX (New England

[0202] Biolabs) at S 1 pL or GreenFluorescent Dye (Lucigen) at SI pL or SYTO-13 (ThermoFisher

[0203] Scientific) at <16 pM or SYTO-82 (ThermoFisher Scientific) at < 16 pM or other fluorescent stain dye at concentration not inhibiting the amplification process. DNA template > 250 copies / reaction

[0204] Total reaction volume topped up to 10 pL with DNase and RNase-free water.

[0205] Example 3. The temperature profile

[0206] The method for the amplification of a fragment of the human EGFR gene using the nucleotides described in Example 1 by means of the RT-LAMP technology with the reaction mixture composition described in Example 2 characterized by the following temperature profile:

[0207] 1) 68"C, 50 min.

[0208] 2) preferably, melting curve analysis being carried out after the amplification stage using the additional temperature profile of 65eC-95°C with increments of 0.5’C and each temperature level being maintained for the duration of 5 seconds.

[0209] Example 4. The detection method The method for the amplification and detection of a fragment of the human EGFR gene carrying one of the following mutations: NM_005228.5(EGFR):c.2235_2249del

[0210] (p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);

[0211] NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5;

[0212] NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) using the nucleotides described in Example 1 by means of the RT-LAMP technology with the reaction mixture composition described in Example 2 characterized by the temperature profile presented in Example 3 and a detection method as described hereinbelow. The fluorescent dye added to the reaction mixture in the quantity of 0,5 pL of EvaGreen 20X; 0,5 pL or SIX; <16 pM for GreenFluorescent Dye (Lucigen), SYTO-13 and SYTO-82 respectively prior to the reaction start; measurements acquired in real time and / or in an end-point fashion. Excitation wavelength in the range similar to that of the FAM dye - 490-500 nm (optimum wavelength of 494 nm) for EvaGreen, Fluorescent dye SOX (New England Biolabs), GreenFluorescent Dye

[0213] (Lucigen) and SYTO-13 dyes, or 535 nm for the SYTO-82 dye (optimum wavelength of 541 nm); emission wavelength in the range of 509-530 nm (optimum 518 nm) for EvaGreen,

[0214] GreenFluorescent Dye (Lucigen) and SYTO-13 dyes, or 556 nm for the SYTO-82 dye (optimum wavelength of 560 nm), detection method: fluorescence intensity changes being recorded every 60 seconds.

[0215] Example 5. Method sensitivity and specificity

[0216] The sensitivity and specificity of the method were determined by setting up a dilution series using the nucleotides described in Example 1 by means of the RT-LAMP technology with the reaction mixture composition described in Example 2 characterized by the temperature profile presented in Example 3 and a detection method as described in Example 4 and using synthetic templates modified to represent the human EGFR gene carrying the

[0217] NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation or the

[0218] NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del) mutation or the

[0219] NM 005228.3:c.2239 2253dell5 mutation or the NM 005228.3:c.2238 2252dell5 mutation or the NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) mutation within exon 19 in the range of 250-1000 copies within the reaction mixture, where the product amplification was measured in real time - Figure 1, Figure 2 and Figure 3 (Real- Time LAMP for a series of dilutions) with dissociation temperature readouts in the range of

[0220] 87.5-88.5 °C (Figure 4, Figure 5, Figure 6). The time required for the detection of the fluorescence as emitted from individual samples is presented in Table 1.

[0221] The presented primers facilitate the detection of the NM_005228.5(EGFR):c.2235_2249del

[0222] (p.Glu746_Ala750del) mutation or the NM_005228.5(EGFR):c.2240_2254del

[0223] (p.Leu747_Thr751del) mutation or the NM_005228.3:c.2239_2253dell5 mutation or the

[0224] NM 005228.3:c.2238 2252dell5 mutation or the

[0225] NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) mutation at the minimum quantity of 250 copies of the genome within the reaction mixture.

[0226] The superiority of the method for the detection of genetic variants and oligonucleotides and the composition of the reaction mixtures characterized in this patent description over the tests based on Real-Time LAMP technology lies in the high reliability of the result, the specificity, and the facilitated capability for multiplexation of kits for the detection of several variants within a single reaction and the lower production cost associated with the lower number of primers required for the reaction compared to previously disclosed solutions.

[0227] Sequence list

Claims

Claims1. A method for the detection of multinucleotide genetic variants using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3'-end so that its end over the length of 2 nucleotides is identical to the nucleic acid sequence downstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the F2 primer sequence matches the nucleic acid sequence along the length of the F2 primer after the insertion and / or deletion has occurred and is connected via its 5' -end, preferably via a TTTT bridge, to the 3'-end of the Flc primer, designed to be reverse and complementary to the nucleic acid fragment to be amplified (the 5' -3' strand) and located between the 3' -end of theF2 primer and the 5' -end of the Bic primer while the remaining LAMP reaction primers, i.e. F3, B3, BIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5'-3' strand), located upstream to the F2 primer at its 3'-end, its 5'-end marking the beginning of the nucleic acid segment to be amplified, wherein the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5'-3' strand), the 5' -end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3' -end being preceded by the 3'-end of the B2 primer, and wherein the BIP primer consisting of a Bic fragment with a sequence identical to the nucleic acid segment to be amplified, said fragment being located between the 5'-end of the Flc primer and the 3'-end of the B2 primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5' -end of the B2 fragment of the BIP primer, said fragment being reverse and complementary to the nucleic acid segment to be amplified while the 5' -end of said primer is located upstream of the 3' -end of the B3 primer and the 3'-end is located downstream of the3'-end of the Bic primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3'-end of the F2 primer and the 3' -end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3'-end of the Bic primer and the 3'-end of the B2 primer.

2. A method for the detection of multinucleotide genetic variants using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3'-end so that its end over the length of 3 nucleotides is identical to the nucleic acid sequence downstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the F2 primer sequence matches the nucleic acid sequence along the length of the F2 primer after the insertion and / or deletion has occurred and is connected via its 5' -end, preferably via a TTTT bridge, to the 3'-end of the Flc primer, designed to be reverse and complementary to the nucleic acid fragment to be amplified (the 5' -3' strand) and located between the 3' -end of theF2 primer and the 5' -end of the Bic primer while the remaining LAMP reaction primers, i.e.F3, B3, BIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5'-3' strand), located upstream to the F2 primer at its 3'-end, its 5'-end marking the beginning of the nucleic acid segment to be amplified, wherein the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5'-3' strand), the 5' -end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3' -end being preceded by the 3'-end of the B2 primer, and wherein the BIP primer consisting of a Bic fragment with a sequence identical to the nucleic acid segment to be amplified, said fragment being located between the 5'-end of the Flc primer and the 3'-end of the B2 primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5' -end of the B2 fragment of the BIP primer, said fragment being reverse and complementary to the nucleic acid segment to be amplified while the 5' -end of said primer is located upstream of the 3' -end of the B3 primer and the 3'-end is located downstream of the3'-end of the Bic primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3'-end of the F2 primer and the 3' -end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3'-end of the Bic primer and the 3'-end of the B2 primer.

3. A method for the detection of multinucleotide genetic variants using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3'-end so that its end over the length of 4 nucleotides is identical tothe nucleic acid sequence downstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the F2 primer sequence matches the nucleic acid sequence along the length of the F2 primer after the insertion and / or deletion has occurred and is connected via its 5' -end, preferably via a TTTT bridge, to the 3'-end of the Flc primer, designed to be reverse and complementary to the nucleic acid fragment to be amplified (the 5' -3' strand) and located between the 3' -end of theF2 primer and the 5' -end of the Bic primer while the remaining LAMP reaction primers, i.e. F3, B3, BIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5'-3' strand), located upstream to the F2 primer at its 3'-end, its 5'-end marking the beginning of the nucleic acid segment to be amplified, wherein the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5'-3' strand), the 5' -end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3' -end being preceded by the 3'-end of the B2 primer, and the BIP primer consisting of a Bic fragment with a sequence identical to the nucleic acid segment to be amplified, said fragment being located between the 5' -end of the Flc primer and the 3'-end of the B2 primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'-end of the B2 fragment of the BIP primer, said fragment being reverse and complementary to the nucleic acid segment to be amplified while the 5' -end of said primer is located upstream of the 3' -end of the B3 primer and the 3'-end is located downstream of the3'-end of the Bic primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3'-end of the F2 primer and the 3' -end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3'-end of the Bic primer and the 3'-end of the B2 primer.

4. A method for the detection of multinucleotide genetic variants using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3'-end so that its end over the length of 5 nucleotides is identical to the nucleic acid sequence downstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the F2 primersequence matches the nucleic acid sequence along the length of the F2 primer after the insertion and / or deletion has occurred and is connected via its via its 5' -end, preferably via aTTTT bridge, to the 3' -end of the Flc primer, designed to be inverse and complementary to the nucleic acid fragment to be amplified (the 5'-3' strand) and located between the 3'-end of the F2 primerand the 5'-end of the Bic primer wherein the remaining LAMP reaction primers, i.e. F3, B3, BIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5' -3' strand), located upstream to the F2 primer at its 3'-end, its 5'- end marking the beginning of the nucleic acid segment to be amplified, and the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5'-3' strand), the 5' -end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3' -end being preceded by the 3'-end of the B2 primer, and the BIP primer consisting of a Bic fragment with a sequence identical to the nucleic acid segment to be amplified, said fragment being located between the 5' -end of the Flc primer and the 3'-end of the B2 primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'-end of the B2 fragment of the BIP primer, said fragment being reverse and complementary to the nucleic acid segment to be amplified while the 5' -end of said primer is located upstream of the 3' -end of the B3 primerand the 3'-end is located downstream of the3'-end of the Bic primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3'-end of the F2 primer and the 3' -end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3'-end of the Bic primer and the 3'-end of the B2 primer.5.

5. A method for the detection of multinucleotide genetic variants using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3'-end so that its end over the length of 6 nucleotides is identical to the nucleic acid sequence downstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the F2 primer sequence matches the nucleic acid sequence along the length of the F2 primer after theinsertion and / or deletion has occurred and is connected via its 5' -end, preferably via a TTTT bridge, to the 3'-end of the Flc primer, designed to be reverse and complementary to the nucleic acid fragment to be amplified (the 5' -3' strand) and located between the 3' -end of theF2 primer and the 5' -end of the Bic primer while the remaining LAMP reaction primers, i.e. F3, B3, BIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5'-3' strand), located upstream to the F2 primer at its 3'-end, its 5'-end marking the beginning of the nucleic acid segment to be amplified, and the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5'-3' strand), the 5'-end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3' -end being preceded by the 3'-end of the B2 primer, wherein the BIP primer consisting of a Bic fragment with a sequence identical to the nucleic acid segment to be amplified, said fragment being located between the 5'-end of the Flc primer and the 3'-end of the B2 primer, is connected, preferably at its 3' -end and via a TTTT bridge, to the 5' -end of the B2 fragment of the BIP primer, said fragment being reverse and complementary to the nucleic acid segment to be amplified while the 5' -end of said primer is located upstream of the 3' -end of the B3 primer and the 3'-end is located downstream of the3'-end of the Bic primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3'-end of the F2 primer and the 3' -end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3'-end of the Bic primer and the 3'-end of the B2 primer.

6. A method for the detection of multinucleotide genetic variants using the LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3'-end so that its end over the length of 7 nucleotides is identical to the nucleic acid sequence downstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the F2 primer sequence matches the nucleic acid sequence along the length of the F2 primer after the insertion and / or deletion has occurred and is connected via its 5' -end, preferably via a TTTT bridge, to the 3' -end of the Flc primer, designed to be inverse and complementary to thenucleic acid fragment to be amplified (the 5' -3' strand) and located between the 3' -end of theF2 primer and the 5' -end of the Bic primer while the remaining LAMP reaction primers, i.e. F3, B3, BIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5'-3' strand), located upstream to the F2 primer at its 3'-end, its 5'-end marking the beginning of the nucleic acid segment to be amplified, and the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5'-3' strand), the 5'-end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3' -end being preceded by the 3'-end of the B2 primer, and the BIP primer consisting of a Bic fragment with a sequence identical to the nucleic acid segment to be amplified, said fragment being located between the 5' -end of the Flc primer and the 3'-end of the B2 primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'-end of the B2 fragment of the BIP primer, said fragment being reverse and complementary to the nucleic acid segment to be amplified while the 5' -end of said primer is located upstream of the 3' -end of the B3 primer and the 3'-end is located downstream of the3'-end of the Bic primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3'-end of the F2 primer and the 3' -end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3'-end of the Bic primer and the 3'-end of the B2 primer.

7. A method for the detection of genetic variants using the LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has an B2 sequence modified at the 3' -end so that its end over the length of 2 nucleotides is reverse and complementary to the nucleic acid sequence upstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the B2 primer sequence is reverse and complementary only to the nucleic acid sequence after the insertion and / or deletion has occurred and is connected via its 5'-end, preferably via a TTTT bridge, to the 3' -end of the Bic primer, designed to be identical to the nucleic acid fragment to be amplified (the 5'-3' strand) and located between the 5' -end of the Flc primer and the 3'-end of the B2 primer while the remaining LAMP reaction primers, i.e. F3, B3, FlP and optionally theLF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5' -3' strand), located upstream to the F2 primerat its 3'-end, its 5' -end marking the beginning of the nucleic acid segment to be amplified, and the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5' -3' strand), the 5'-end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3'-end being preceded by the 3' -end of the B2 primer, wherein the FIP primer consisting of a Flc fragment with a sequence reverse and complementary to the nucleic acid segment to be amplified, said fragment being located between the 3'-end of the F2 primer and the 5' -end of the Bic primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'-end of the F2 fragment of the FIP primer, said fragment being identical to the nucleic acid segment to be amplified while the 5' -end of said primer is located upstream of the 3'-end of the F3 primer and the 3' -end is located upstream of the 3'-end of the Flc primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3'-end of the F2 primer and the 3' -end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3'- end of the Bic primer and the 3' -end of the B2 primer.

8. A method for the detection of genetic variants using the LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has an B2 sequence modified at the 3' -end so that its end over the length of 3 nucleotides is reverse and complementary to the nucleic acid sequence upstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the B2 primer sequence is reverse and complementary only to the nucleic acid sequence after the insertion and / or deletion has occurred and is connected via its 5'-end, preferably via a TTTT bridge, to the 3' -end of the Bic primer, designed to be identical to the nucleic acid fragment to be amplified (the 5'-3' strand) and located between the 5' -end of the Flc primer and the 3'-end of the B2 primer while the remaining LAMP reaction primers, i.e. F3, B3, FIP and optionally theLF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5' -3' strand), located upstream to the F2 primerat its 3'-end, its 5' -end marking the beginning of the nucleicacid segment to be amplified, and the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5' -3' strand), the 5'-end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3'-end being preceded by the 3' -end of the B2 primer, wherein the FIP primer consisting of a Flc fragment with a sequence reverse and complementary to the nucleic acid segment to be amplified, said fragment being located between the 3'-end of the F2 primer and the 5' -end of the Bic primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'-end of the F2 fragment of the FIP primer, said fragment being identical to the nucleic acid segment to be amplified while the 5' -end of said primer is located upstream of the 3'-end of the F3 primer and the 3' -end is located upstream of the 3'-end of the Flc primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3'-end of the F2 primer and the 3' -end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3'- end of the Bic primer and the 3' -end of the B2 primer.

9. A method for the detection of genetic variants using the LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has an B2 sequence modified at the 3' -end so that its end over the length of 4 nucleotides is reverse and complementary to the nucleic acid sequence upstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the B2 primer sequence is reverse and complementary only to the nucleic acid sequence after the insertion and / or deletion has occurred and is connected via its 5'-end, preferably via a TTTT bridge, to the 3' -end of the Bic primer, designed to be identical to the nucleic acid fragment to be amplified (the 5'-3' strand) and located between the 5' -end of the Flc primer and the 3'-end of the B2 primer while the remaining LAMP reaction primers, i.e. F3, B3, FlP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5' -3' strand), located upstream to the F2 primerat its 3'-end, its 5' -end marking the beginning of the nucleic acid segment to be amplified, where the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5'-3' strand), the 5'- end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3'-end being preceded by the 3' -end of the B2 primer, wherein the FIP primer consisting of a Flc fragment with a sequence reverse and complementary to the nucleic acid segment to be amplified, said fragment being located between the 3'-end of the F2 primer and the 5' -end of the Bic primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'-end of the F2 fragment of the FIP primer, said fragment being identical to the nucleic acid segment to be amplified while the 5' -end of said primer is located upstream of the 3'-end of the F3 primer and the 3' -end is located upstream of the 3'-end of the Flc primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3'-end of the F2 primer and the 3' -end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3'- end of the Bic primer and the 3' -end of the B2 primer.

10. A method for the detection of genetic variants using the LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has an B2 sequence modified at the 3' -end so that its end over the length of 5 nucleotides is reverse and complementary to the nucleic acid sequence upstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the B2 primer sequence is reverse and complementary only to the nucleic acid sequence after the insertion and / or deletion has occurred and is connected via its 5'-end, preferably via a TTTT bridge, to the 3' -end of the Bic primer, designed to be identical to the nucleic acid fragment to be amplified (the 5'-3' strand) and located between the 5' -end of the Flc primer and the 3'-end of the B2 primer wherein the remaining LAMP reaction primers, i.e. F3, B3, FIP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5' -3' strand), located upstream to the F2 primer at its 3' -end, its 5' -end marking the beginning of the nucleic acid segment to be amplified, and the B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5' -3' strand), the 5' -end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3'-end being preceded by the 3' -end of the B2 primer, wherein the FIP primer consisting of a Flc fragment with a sequence reverse and complementary to the nucleic acid segment to be amplified, said fragment being located between the 3' -end of theF2 primer and the 5'-end of the Bic primer, is connected, preferably at its 3' -end and via aTTTT bridge, to the 5'-end of the F2 fragment of the FIP primer, said fragment being identical to the nucleic acid segment to be amplified while the 5'-end of said primer is located upstream of the 3'-end of the F3 primer and the 3' -end is located upstream of the 3'-end of the Flc primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3' -end of the F2 primer and the 3' -end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3' -end of the Bic primer and the 3' -end of the B2 primer.

11. A method for the detection of genetic variants using the LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has an B2 sequence modified at the 3' -end so that its end over the length of 6 nucleotides is reverse and complementary to the nucleic acid sequence upstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the B2 primer sequence is reverse and complementary only to the nucleic acid sequence after the insertion and / or deletion has occurred and is connected via its 5'-end, preferably via a TTTT bridge, to the 3' -end of the Bic primer, designed to be identical to the nucleic acid fragment to be amplified (the 5'-3' strand) and located between the 5' -end of the Flc primer and the 3'-end of the B2 primer while the remaining LAMP reaction primers, i.e. F3, B3, FIP and optionally theLF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5' -3' strand), located upstream to the F2 primerat its 3'-end, its 5' -end marking the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5' -3' strand), the 5'-end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3'-end being preceded by the 3' -end of the B2 primer, wherein the FIP primer consisting of a Flc fragment with a sequence reverse and complementary to the nucleic acid segment to be amplified, said fragment being located between the 3'-end of the F2 primer and the 5' -end of the Bic primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'-end of the F2 fragment of the FIP primer, said fragment being identical to the nucleic acid segment to be amplified while the 5' -end of said primer is located upstream of the 3'-end of the F3primer and the 3' -end is located upstream of the 3'-end of the Flc primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3'-end of the F2 primer and the 3' -end of the Flc primer and the LB loop primer having a sequence identical to the segment to be amplified is located between the 3'- end of the Bic primer and the 3' -end of the B2 primer.

12. A method for the detection of genetic variants using the LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has an B2 sequence modified at the 3' -end so that its end over the length of 7 nucleotides is reverse and complementary to the nucleic acid sequence upstream of the nucleic acid fragment subject to the detected insertion and / or deletion containing the genetic variant to be detected, wherein the B2 primer sequence is reverse and complementary only to the nucleic acid sequence after the insertion and / or deletion has occurred and is connected via its 5'-end, preferably via a TTTT bridge, to the 3' -end of the Bic primer, designed to be identical to the nucleic acid fragment to be amplified (the 5'-3' strand) and located between the 5' -end of the Flc primer and the 3'-end of the B2 primer while the remaining LAMP reaction primers, i.e. F3, B3, FlP and optionally the LF and / or LB loops are designed in such a way that the F3 primer is an oligonucleotide having a sequence identical to the fragment of the nucleic acid segment to be amplified (5' -3' strand), located upstream to the F2 primerat its 3'-end, its 5' -end marking the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide with a sequence reverse and complementary to the nucleic acid segment to be amplified (5' -3' strand), the 5'-end of the B3 primer marking the end of the nucleic acid segment to be amplified and the 3'-end being preceded by the 3' -end of the B2 primer, wherein the FIP primer consisting of a Flc fragment with a sequence reverse and complementary to the nucleic acid segment to be amplified, said fragment being located between the 3'-end of the F2 primer and the 5' -end of the Bic primer, is connected, preferably at its 3'-end and via a TTTT bridge, to the 5'-end of the F2 fragment of the FIP primer, said fragment being identical to the nucleic acid segment to be amplified while the 5' -end of said primer is located upstream of the 3'-end of the F3 primer and the 3' -end is located upstream of the 3'-end of the Flc primer, and wherein the LF loop primer is reverse and complementary to the nucleic acid segment to be amplified and located between the 3'-end of the F2 primer and the 3' -end of the Flc primer and the LB loopprimer having a sequence identical to the segment to be amplified is located between the 3'- end of the Bic primer and the 3' -end of the B2 primer.

13. A primer set for amplifying nucleotide sequence of a fragment of the human EGFR(epithelial growth factor receptor) gene, characterized in that the primer set contains a set of internal primers having the following nucleotide sequences (a) and (b), and an a set of external primers having the following nucleotide sequences (c) and (d), the primer set being specific to a fragment of the human EGFR gene carrying the NM_005228.5(EGFR): c.2235_2249del(p.Glu746_Ala750del) mutation within exon 19: a) Flc 5' GACCCCCACACAGCAAAGCA 3' - nucleotide sequence SEQ ID NO: 3 - connected at its 3' -end, preferably via a TTTT bridge, to sequenceF25' TCCCGTCGCTATCAAAACAT 3' - nucleotide sequence SEQ ID NO: 4 b ) Bic 5' GCTGCTCTGCTCTAGACCCT 3' - nucleotide sequence SEQ ID NO: 5 or - connected at its 3' -end, preferably via a TTTT bridge, to sequenceB25' AGAGGCCAGTGCTGTCT 3' - nucleotide sequence SEQ ID NO: 6 c ) F35' TGGATCCCAGAAGGTGAGAA 3' - nucleotide sequence SEQ ID NO: 1 - and d) B35' GGGGTGGATACCAGCATG 3' nucleotide sequence SEQ ID NO:

214. A set of primers according to claim 13, characterized in that the primer set contains a set of loop primer sequences containing nucleotide sequences contained within or complementary to a fragment of the human EGFR gene having SEQ ID NOs: 7 -LF 5' TCACATCGAGGATTTCCTTGTTG 3' and SEQ ID NO: 8:LB 5' GCTCTAGTGGGTATAACTCCCTC 3'.

15. A primer set for amplifying nucleotide sequence of a fragment of the human EGFR(epithelial growth factor receptor) gene, characterized in that the primer set contains a set of internal primers having the following nucleotide sequences (a) and (b), and an a set of external primers having the following nucleotide sequences (c) and (d), the primer set being specific to a fragment of the human EGFR gene carrying the NM_005228.5(EGFR):c.2240_2254del(p.Leu747_Thr751del) mutation or the NM_005228.3:c.2239_2253dell5 mutation or theNM 005228.3:c.2238 2252dell5 mutation within exon 19: a) Flc 5' GACCCCCACACAGCAAAGCA 3' - nucleotide sequence SEQ ID NO: 3 - connected at its 3' -end, preferably via a TTTT bridge, to sequenceF2 5' TCCCGTCGCTATCAAGGAATCTC 3' - nucleotide sequence SEQ ID NO: 9 b ) Bic 5' GCTGCTCTGCTCTAGACCCT 3' - nucleotide sequence SEQ ID NO: 5 or - connected at its 3' -end, preferably via a TTTT bridge, to sequenceB2 5' AGAGGCCAGTGCTGTCT 3' - nucleotide sequence SEQ ID NO: 6 c ) F35' TGGATCCCAGAAGGTGAGAA 3' - nucleotide sequence SEQ ID NO: 1 - and d) B3 5' GGGGTGGATACCAGCATG 3' nucleotide sequence SEQ ID NO:

216. A set of primers according to claim 15, characterized in the said primer set contains a set of loop primer sequences containing nucleotide sequences contained within or complementary to a fragment of the human EGFR gene having SEQ ID NOs: 7 -LF 5' TCACATCGAGGATTTCCTTGTTG 3' and SEQ ID NO: 8:LB 5' GCTCTAGTGGGTATAACTCCCTC 3'.

17. A primer set for amplifying nucleotide sequence of a fragment of the human EGFR(epithelial growth factor receptor) gene, characterized in that the primer set contains a set of internal primers having the following nucleotide sequences (a) and (b), and an a set of external primers having the following nucleotide sequences (c) and (d), the primer set being specific for a fragment of the human EGFR gene carrying theNM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) mutation within exon 19: a) Flc 5' GACCCCCACACAGCAAAGCA 3' - nucleotide sequence SEQ ID NO: 3 - connected at its 3' -end, preferably via a TTTT bridge, to sequenceF2 5' TCCCGTCGCTGTCAAAACAT 3' - nucleotide sequence SEQ ID NO: 15 b ) Bic 5' GCTGCTCTGCTCTAGACCCT 3' - nucleotide sequence SEQ ID NO: 5 or - connected at its 3' -end, preferably via a TTTT bridge, to sequenceB2 5' AGAGGCCAGTGCTGTCT 3' - nucleotide sequence SEQ ID NO: 6c ) F35' TGGATCCCAGAAGGTGAGAA 3' - nucleotide sequence SEQ ID NO: 1 - and d) B35' GGGGTGGATACCAGCATG 3' nucleotide sequence SEQ ID NO: 2.

18. A set of primers according to claim 17, characterized in that the primer set contains a set of loop primer sequences containing nucleotide sequences contained within or complementary to a fragment of the human EGFR gene having SEQ ID NOs: 7 -LF 5' TCACATCGAGGATTTCCTTGTTG 3' and SEQ ID NO: 8:LB 5' GCTCTAGTGGGTATAACTCCCTC 3'.

19. A method for the detection of mutations NM_005228.5(EGFR):c.2235_2249del(p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5;NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) present within exon 19 of the human EGFR gene characterized in that selected regions of the nucleotide sequence of human genome are amplified using the primer set according to any of the claims13 through 18, wherein the duplication method is RealTime-LAMP.

20. A method for the detection of mutations NM_005228.5(EGFR):c.2235_2249del(p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5;NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) present within exon 19 of the human EGFR gene according to claim 19 characterized in that amplification is carried out at the temperature profile of 68’C, 50 min.

21. A method for the detection of mutations NM_005228.5(EGFR):c.2235_2249del(p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5;NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) present within exon 19 of the human EGFR gene characterized in that the method involves the detection method according to claims 19 and / or 20.

22. A kit for the detection of mutations NM_005228.5(EGFR):c.2235_2249del(p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5;NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) present within exon 19 of the human EGFR gene characterized in that said kit contains a primer set according to any of the claims 13 through 18.

23. A kit for the detection of mutations NM_005228.5(EGFR):c.2235_2249del(p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5;NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) present within exon 19 of the human EGFR gene according to any of the claims 17 or 18 characterized in that the kit contains 5,0 pL Universal WarmStart* LAMP 2X Master Mix (New England Biolabs).

24. A kit for the detection of mutations NM_005228.5(EGFR):c.2235_2249del(p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5;NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys) present within exon 19 of the human EGFR gene according to any of the claims 19 through 23 characterized in that said kit contains amplification primers according to claims 13-18, wherein the primer concentrations are as follows: i pM FF33,, 00,,1155 pM B3, 1,20 pM FIPNM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); 1,20 pM FIPNM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del);NM_005228.3:c.2239_2253dell5; NM_005228.3:c.2238_2252dell5; 1,20 pM FIPNM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.lle744_Ala750delinsValLys), 1,20 pM BIP, 0,30 pM LF, 0,30 pM LB; D-(+)-Trehalose dihydrate - 6%; mannitol - 1,25%; fluorescent double-stranded DNA stain - EvaGreen (Biotium)at < IX or Fluorescent Dye (New EnglandBiolabs) at <0,5 iiL or GreenFluorescent Dye (Lucigen) at Si pL or SYTO-13 (ThermoFisher Scientific) at <16 pM or SYTO-82 (ThermoFisher Scientific) at < 16 pM or other doublestranded DNA stain at concentration not inhibiting the amplification process.

Images