Methods and compositions for producing sequencing libraries

Abstract

Provided are methods of producing a sequencing library from a sample comprising nucleic acids. In certain embodiments, the methods comprise amplifying nucleic acids of the sample using a forward primer comprising a 3' domain complementary to nucleic acids in the sample and a 5' domain comprising a fragment of a first sequencing adapter, and a reverse primer comprising a 3' domain complementary to the nucleic acids in the sample and a 5' domain comprising a fragment of a second sequencing adapter. The amplification produces amplicons comprising the fragment of the first sequencing adapter at a first end and the fragment of the second sequencing adapter at the second end. The methods further comprise covalently linking the remainder of the second sequencing adapter to the fragment of the second sequencing adapter, such that a sequencing library is produced in which sequenceable templates are only those derived from the amplicons.

Description

[0001] METHODS AND COMPOSITIONS FOR PRODUCING SEQUENCING LIBRARIES

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 541 ,181 , filed September 28, 2023, which application is incorporated herein by reference in its entirety.

[0004] INCORPORATION BY REFERENCE OF SEQUENCE LISTING XML

[0005] A Sequence Listing is provided herewith as a Sequence Listing XML, “UCSC- 404WO_SEQ_LIST” created on September 27, 2024, and having a size of 2,879 bytes. The contents of the Sequence Listing XML are incorporated by reference herein in their entirety.

[0006] INTRODUCTION

[0007] Nucleic acid sequencing is important for biological research, clinical diagnostics, personalized medicine, pharmaceutical development and many other fields. Improvements in next-generation sequencing (NGS) technology have greatly increased sequencing speed and data output, resulting in the massive sample throughput of current sequencing platforms.

[0008] The practical difficulties of generating and analyzing data via amplicon sequencing (e.g., for patient testing) are now well mapped out. These include: (1 ) time and expense required for handling library normalization from samples with high variation of starting template, (2) locus drop-out or poor efficiency when new genetic variants appear in PCR primer regions, and (3) sequencing library preparation options that optimize convenience, speed and / or cost.

[0009] SUMMARY

[0010] Provided are methods of producing a sequencing library from a sample comprising nucleic acids. In certain embodiments, the methods comprise amplifying nucleic acids of the sample using a forward primer comprising a 3’ domain complementary to nucleic acids in the sample and a 5’ domain comprising a fragment of a first sequencing adapter, and a reverse primer comprising a 3’ domain complementary to the nucleic acids in the sample and a 5’ domain comprising a fragment of a second sequencing adapter. The amplification produces amplicons comprising the fragment of the first sequencing adapter at a first end and the fragment of the second sequencing adapter at the second end. The methods further comprise covalently linking the remainder of the second sequencing adapter to the fragment of the second sequencing adapter, such that a sequencing library is produced in which sequenceable templates are only those derived from the amplicons.

[0011] BRIEF DESCRIPTION OF THE FIGURES

[0012] FIG. 1A-1 C: Schematic illustration of reagents and products of steps of a method for producing a sequencing library according to embodiments of the present disclosure. FIG. 2: Data demonstrating library output normalization among five amplicon reactions.

[0013] DETAILED DESCRIPTION

[0014] Before the methods and compositions of the present disclosure are described in greater detail, it is to be understood that the methods and compositions are not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the methods and compositions will be limited only by the appended claims.

[0015] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the methods and compositions. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the methods and compositions, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the methods and compositions.

[0016] Certain ranges are presented herein with numerical values being preceded by the term “about.” The term “about” is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number.

[0017] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the methods and compositions belong. Although any methods and compositions similar or equivalent to those described herein can also be used in the practice or testing of the methods and compositions, representative illustrative methods and compositions are now described.

[0018] All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the materials and / or methods in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present methods and compositions are not entitled to antedate such publication, as the date of publication provided may be different from the actual publication date which may need to be independently confirmed. It is noted that, as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.

[0019] It is appreciated that certain features of the methods and compositions, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the methods and compositions, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed, to the extent that such combinations embrace operable processes and / or compositions. In addition, all sub-combinations listed in the embodiments describing such variables are also specifically embraced by the present methods and compositions and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.

[0020] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present methods. Any recited method can be carried out in the order of events recited or in any other order that is logically possible.

[0021] METHODS OF PRODUCING SEQUENCING LIBRARIES

[0022] The present disclosure provides methods of producing sequencing libraries from a sample comprising nucleic acids. The methods include an amplification step utilizing forward and reverse primers comprising 5’ domains which are not complementary to the template nucleic acid and which comprise only a fragment of a first sequencing adapter and only a fragment second sequencing adapter, respectively. Following amplification, the first and second sequencing adapters are completed via covalent linkage of the amplicons to nucleic acids comprising the remainder of the first and second sequencing adapters. The products of the covalent linkage reaction constitute a sequencing library in which sequenceable templates are only those derived from the amplicons. The methods address deficiencies in current amplification-based approaches for sequencing library preparation in which undesired products are sequenceable, such that the methods enable more efficient sequencing of nucleic acids of interest. Moreover, in some instances, one or both of the nucleic acids comprising a remainder of the first and / or second sequencing adapter are provided at a limiting concentration in the covalent linkage reaction, enabling normalization of libraries when the sequencing assay is performed on a plurality of samples, e.g., in subjects for diagnostic, testing, and / or other purposes. The lack of normalization across samples is a problematic characteristic of current sequencing assays, e.g., for diagnostic and testing purposes, e.g., for a viral nucleic acid by way of example.

[0023] Accordingly, in some instances, methods of the present disclosure comprise producing a sequencing library from a sample comprising nucleic acids, which methods comprise amplifying nucleic acids of the sample using a primer pair comprising a forward primer and a reverse primer. The forward primer comprises a 3’ domain complementary to nucleic acids in the sample and a 5’ domain comprising a fragment of a first sequencing adapter. The reverse primer comprises a 3’ domain complementary to the nucleic acids in the sample and a 5’ domain comprising a fragment of a second sequencing adapter. The amplification produces amplicons, each amplicon comprising the fragment of the first sequencing adapter at a first end and the fragment of the second sequencing adapter at the second end. In certain embodiments, the methods further comprise combining into a ligation reaction the amplicons, nucleic acids comprising a remainder of the first sequencing adapter, and nucleic acids comprising a remainder of the second sequencing adapter. The combining is under conditions in which the remainder of the first sequencing adapter is covalently linked to the fragment of the first sequencing adapter and the remainder of the second sequencing adapter is covalently linked to the fragment of the second sequencing adapter, thereby producing a sequencing library in which sequenceable templates are only those derived from the amplicons.

[0024] As used herein, a “sequencing adapter” refers generally to an oligonucleotide sequence added to a nucleic acid which is desired to be sequenced, where the oligonucleotide sequence is required for sequencing of the nucleic acid using a particular nucleic acid sequencing system. In some embodiments, sequencing on the sequencing system of choice comprises solid-phase amplification (e.g., for cluster generation), and the first and / or second sequencing adapters are required for capture of the library molecules to the solid phase (e.g., by hybridization) and / or for amplification of the library molecules subsequent to capture. By way of example, when the nucleic acid sequencing system is an Illumina sequencing system, the first and second sequencing adapters may be the P5 and P7 adapters (or a complement thereof) for capture on the flow cell employed by Illumina sequencing system. The P5 and P7 sequencing adapter sequences are as follow: P5: 5' AATGATACGGCGACCACCGA 3' (SEQ ID NO:1 ); P7: 5'

[0025] CAAGCAGAAGACGGCATACGAGAT 3' (SEQ ID NO:2).

[0026] In some instances, the first and second sequencing adapters may be those employed by an MGI Tech Co. Ltd. (or “MGI”) sequencing system, such as a DNBSEQ T series or DNBSEQ T series G series nucleic acid sequencing system. By way of example, the first and second sequencing adapters may be required for amplification of library molecules into DNA nanoballs (DNBs). In other embodiments, the first and second sequencing adapters may be those employed by a nanopore-based sequencing system, non-limiting examples of which include the MinlON, GridlON, and PromethlON nanopore sequencing systems available from Oxford Nanopore Technologies. In still other embodiments, the first and second sequencing adapters may be those employed by a zero-mode waveguide (ZMW)-based sequencing system, such as a REVIO, ONSO, or SEQUEL lie sequencing system by Pacific Biosciences (PacBio).

[0027] A “fragment” of a sequencing adapter is an incomplete sequencing adapter such that the fragment alone is insufficient for sequencing of the amplicon using the sequencing system. According to some embodiments, the fragment of the first sequencing adapter and the fragment of the second sequencing adapter have a length independently selected from 2 to 16 nucleotides. For example, the fragment of the first sequencing adapter and the fragment of the second sequencing adapter may have a length independently selected from 3 to 10 nucleotides, 3 to 8 nucleotides, or 3 to 6 nucleotides, e.g., from 4 to 10 nucleotides, 4 to 8 nucleotides, or 4 to 6 nucleotides. In some instances, the fragment of the first sequencing adapter is 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15 or 16 nucleotides in length, and the fragment of the second sequencing adapter is 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15 or 16 nucleotides in length.

[0028] The methods comprise amplifying nucleic acids of the sample using the primer pair comprising the forward primer and the reverse primer. As used herein, “amplify”, “amplifying” or “amplification reaction” and their derivatives, refer generally to any action or process whereby at least a portion of a nucleic acid molecule is replicated or copied into at least one additional nucleic acid molecule. The additional nucleic acid molecule includes sequence that is complementary to at least some portion of the template nucleic acid molecule. The template nucleic acid molecule can be single-stranded or double-stranded and the additional nucleic acid molecule can independently be single-stranded or double-stranded. Amplification optionally includes linear or exponential replication of a nucleic acid molecule. In some embodiments, such amplification can be performed using isothermal conditions; in other embodiments, such amplification can include thermocycling. In some embodiments, the amplification is a multiplex amplification that includes the simultaneous amplification of a plurality of target sequences in a single amplification reaction. In some embodiments, “amplification” includes amplification of at least some portion of DNA and RNA based nucleic acids alone, or in combination. The amplification reaction can include any of the amplification processes known to one of ordinary skill in the art. In some embodiments, the amplification reaction includes polymerase chain reaction (PCR).

[0029] As used herein, the term "polymerase chain reaction" ("PCR") is a method for increasing the concentration of a segment of a polynucleotide of interest in a mixture of genomic DNA without cloning or purification. This process for amplifying the polynucleotide of interest consists of introducing an excess of two oligonucleotide primers to the DNA mixture containing the desired polynucleotide of interest, followed by a series of thermal cycling in the presence of a DNA polymerase. The two primers are complementary to their respective strands of the double stranded polynucleotide of interest. The mixture is denatured at a higher temperature first and the primers are then annealed to complementary sequences within the polynucleotide of interest molecule. Following annealing, the primers are extended with a polymerase to form a new pair of complementary strands. The steps of denaturation, primer annealing and polymerase extension can be repeated many times (referred to as thermocycling) to obtain a high concentration of an amplified segment of the desired polynucleotide of interest. The length of the amplified segment of the desired polynucleotide of interest (amplicon) is determined by the relative positions of the primers with respect to each other, and therefore, this length is a controllable parameter. By virtue of repeating the process, the method is referred to as PCR. Because the desired amplified segments of the polynucleotide of interest become the predominant nucleic acid sequences (in terms of concentration) in the mixture, they are said to be "PCR amplified". In a modification to the method discussed above, the target nucleic acid molecules can be PCR amplified using a plurality of different primer pairs, in some cases, one or more primer pairs per target nucleic acid molecule of interest, thereby forming a multiplex PCR reaction.

[0030] As used herein, the term “primer” and its derivatives refer generally to any polynucleotide that can hybridize to a sequence of interest, which may be targeted or non-targeted (e.g., random primers may be employed). Typically, the primer functions as a substrate onto which nucleotides can be polymerized by a polymerase; in some embodiments, however, the primer can become incorporated into the synthesized nucleic acid strand and provide a site to which another primer can hybridize to prime synthesis of a new strand that is complementary to the synthesized nucleic acid molecule. The primer may be comprised of any combination of nucleotides or analogs thereof. In some embodiments, the primer is a single-stranded oligonucleotide or polynucleotide.

[0031] In various implementations, a primer has a free 3'-OH group that can be extended by a nucleic acid polymerase. For a template-dependent polymerase, generally at least the 3'-portion of the primer oligo is complementary to a portion of a template nucleic acid, to which the oligo “binds” (or “complexes,” “anneals,” or “hybridizes”), by hydrogen bonding and other molecular forces, to the template to give a primer / template complex for initiation of synthesis by a DNA polymerase, and which is extended (i.e., “primer extended”) by the addition of covalently bonded bases linked at its 3'-end which are complementary to the template in the process of DNA synthesis. The result is a primer extension product. Template-dependent DNA polymerases (including reverse transcriptases) generally require complexing of an oligonucleotide primer to a single-stranded template to initiate DNA synthesis (“priming”), but RNA polymerases generally do not require a primer for synthesis of RNA that is complementary to a DNA template (transcription).

[0032] A “template” is a nucleic acid molecule that is being copied by a nucleic acid polymerase, such as a DNA polymerase. Whether the nucleic acid molecule comprises two strands (i.e., is “double-stranded”) or only one strand (i.e., is “single-stranded”), the strand of the nucleic acid molecule that serves to specify the sequence of nucleotides exhibited by a nucleic acid that is synthesized is the “template” or “the template strand.” The nucleic acid synthesized by the nucleic acid polymerase is complementary to the template. Both RNA and DNA are always synthesized in the 5'-to-3' direction, beginning at the 3'-end of the template strand, and the two strands of a nucleic acid duplex always are aligned so that the 5' ends of the two strands are at opposite ends of the duplex (and, by necessity, so then are the 3' ends). A primer is required for both RNA and DNA templates to initiate synthesis by a DNA polymerase, but a primer is not required to initiate synthesis by a DNA-dependent RNA polymerase, which is usually called simply an “RNA polymerase.”

[0033] The terms “nucleic acid”, “polynucleotide” and “oligonucleotide” are used interchangeably herein to refer to a polymeric form of nucleotides of any length, and may comprise ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. In some context, the term “nucleic acid” or “polynucleotide” may refer to nucleotide polymers having a relatively large number of nucleotide monomers, while the term “oligonucleotide” may refer to nucleotide polymers having a relative small number of nucleotide monomers. However, that distinction does not apply herein unless specified. Instead, the terms “nucleic acid”, “polynucleotide” and “oligonucleotide” should be understood to include, as equivalents, analogs of either DNA or RNA made from nucleotide analogs and to be applicable to single stranded (such as sense or antisense) and double stranded polynucleotides. The term as used herein also encompasses cDNA, that is complementary or copy DNA produced from an RNA template, for example by the action of reverse transcriptase. This term refers only to the primary structure of the molecule. Thus, the term includes triple-, double- and single-stranded deoxyribonucleic acid (“DNA”), as well as triple-, double- and single-stranded ribonucleic acid (“RNA”).

[0034] In addition, the terms “polynucleotide,” “nucleic acid” and “nucleic acid molecules” are used interchangeably and refer to a covalently linked sequence of nucleotides (i.e., ribonucleotides for RNA and deoxyribonucleotides for DNA) in which the 3' position of the pentose of one nucleotide is joined by a phosphodiester group to the 5' position of the pentose of the next. The nucleotides include sequences of any form of nucleic acid, including, but not limited to RNA and DNA molecules such as cell-free DNA (cfDNA) molecules. The term “polynucleotide” includes, without limitation, single- and double-stranded polynucleotides.

[0035] The forward and reverse primers comprise a 3’ domain complementary to nucleic acids in the sample. In some instances, the amplification is targeted amplification such that the 3’ domains are selected for amplification of a particular target nucleic acid of interest. In other embodiments, one or both of the 3’ domains comprise a random sequence for non-targeted amplification of the nucleic acids in the sample. Whether the amplification is targeted or nontargeted, the 3’ domains of the forward and reverse primers are complementary to their respective strands of a double stranded nucleic acid in the sample.

[0036] The terms “complementary” or “complementarity” as used herein refer to a nucleotide sequence of a first nucleic acid that base-pairs by non-covalent bonds to a region of a second nucleic acid, or a nucleotide sequence of a first region of a nucleic acid that base-pairs by non- covalent bonds to a second region of the nucleic acid (e.g., a stem region). In the canonical Watson-Crick base pairing, adenine (A) forms a base pair with thymine (T), as does guanine (G) with cytosine (C) in DNA. In RNA, thymine is replaced by uracil (U). As such, A is complementary to T and G is complementary to C. In RNA, A is complementary to U and vice versa. Typically, “complementary” or “complementarity” refers to a nucleotide sequence that is at least partially complementary. These terms may also encompass duplexes that are fully complementary such that every nucleotide in one strand is complementary to every nucleotide in the other strand in corresponding positions. In certain cases, a nucleotide sequence may be partially complementary to a target, in which not all nucleotides are complementary to every nucleotide in the target nucleic acid in all the corresponding positions. For example, a region of a first nucleic acid may be perfectly (i.e. , 100%) complementary to a region of a second nucleic acid, or the region of the first nucleic acid may share some degree of complementarity which is less than perfect (e.g., 70%, 75%, 85%, 90%, 95%, 99%). The percent identity of two nucleotide sequences can be determined by aligning the sequences for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first sequence for optimal alignment). The nucleotides at corresponding positions are then compared, and the percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity^ # of identical positions / total # of positionsxl OO). When a position in one sequence is occupied by the same nucleotide as the corresponding position in the other sequence, then the molecules are identical at that position. A non-limiting example of such a mathematical algorithm is described in Karlin et al., Proc. Natl. Acad. Sci. USA 90:5873-5877 (1993). Such an algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) as described in Altschul et al., Nucleic Acids Res. 25:389-3402 (1997). When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., NBLAST) can be used. In some embodiments, parameters for sequence comparison can be set at score=100, wordlength=12, or can be varied (e.g., wordlength=5 or wordlength=20).

[0037] Any nucleic acids present in the amplification reaction or the covalent linkage reaction may be modified to include or remove, e.g., one or more phosphates group. In some instances, the nucleic acids of the sample are dephosphorylated prior to their amplification using the forward and reverse primers. According to some embodiments, the forward primer and the reverse primer used for the amplification comprise a 5’ phosphate. This is advantageous in embodiments where, e.g., the subsequent ligation reaction is an enzymatic ligation reaction, as all amplicons will carry 5’ phosphates which obviates the need for a kinase “pre-treatment” step prior to enzymatic ligation.

[0038] The methods comprise combining into a ligation reaction the amplicons produced during the amplifying step with nucleic acids comprising a remainder of the first sequencing adapter, and nucleic acids comprising a remainder of the second sequencing adapter. As used herein, the terms “ligation”, “ligating” and their derivatives refer generally to the process for covalently linking two or more nucleic acid molecules to each other. In some embodiments, the ligation can include forming a covalent bond between a 5' phosphate group of one nucleic acid and a 3' hydroxyl group of a second nucleic acid thereby forming a ligated nucleic acid molecule.

[0039] In some instances, the ligation reaction is an enzymatic ligation reaction. For example, the ligation may be achieved using a ligase. As used herein, a “ligase” and its derivatives, refers generally to any agent capable of catalyzing the ligation of two substrate molecules. In some embodiments, the ligase includes an enzyme capable of catalyzing the formation of a covalent bond between a 5' phosphate of one nucleic acid molecule to a 3' hydroxyl of another nucleic acid molecule thereby forming a ligated nucleic acid molecule. Suitable ligases include, but are not limited to, T4 DNA ligase, T4 RNA ligase, and E. coli DNA ligase. Enzymatic ligation may be carried out using a protein ligase that forms phosphodiester bonds between the 3'-OH and the 5'-phosphate of adjacent nucleotides in DNA molecules. Temperature sensitive ligases, include, but are not limited to, bacteriophage T4 ligase and E. coli ligase. Thermostable ligases include, but are not limited to, Taq ligase, Tfi ligase, Tfl ligase, Tth ligase, Tth HB8 ligase, Thermus species AK16D ligase and Pfu ligase. Conditions suitable for enzymatic ligation reactions are well known in the art and generally described in e.g., Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, New York, 1989. Typical suitable enzymatic ligation conditions include, e.g., 200-400 mM Tris-HCI (pH 7.8), 5-15 mM MgCh, 5-15 mM DTT and 0.5 to 1 .5 mM ATP. Various ligases including detailed protocols for using the same are commercially available, for example, from New England Biolabs, Thermo Fisher Scientific, and the like.

[0040] In certain embodiments, the ligation reaction is a chemical ligation reaction. Chemical ligation agents include, without limitation, activating, condensing, and reducing agents, such as carbodiimide, cyanogen bromide (BrCN), N-cyanoimidazole, imidazole, 1 - methylimidazole / carbodiimide / cystamine, dithiothreitol (DTT) and ultraviolet light. Autoligation, i.e., spontaneous ligation in the absence of a ligating agent, is also within the scope of the invention. Detailed protocols for chemical ligation methods and descriptions of appropriate reactive groups can be found in, for example, Xu et al., Nucleic Acid Res., 27:875-81 (1999); Shabarova, et al., Nucleic Acids Res. 19: 4247-4251 (1991 ); Gryaznov and Letsinger, Nucleic Acid Res. 21 :1403-08 (1993); Gryaznov et al., Nucleic Acid Res. 22:2366-69 (1994); Kanaya and Yanagawa, Biochemistry 25:7423-30 (1986); Luebke and Dervan, Nucleic Acids Res. 20:3005- 09 (1992); Sievers and von Kiedrowski, Nature 369:221 -24 (1994); Liu and Taylor, Nucleic Acids Res. 26: 3300-04 (1999); Wang and Kool, Nucleic Acids Res. 22:2326-33 (1994); Purmal et al., Nucleic Acids Res. 20:3713-19 (1992); Ashley and Kushlan, Biochemistry 30:2927-33 (1991 ); Chu and Orgel, Nucleic Acids Res. 16:3671 -91 (1988); Sokolova et al., FEBS Letters 232:153- 55 (1988); Naylor and Gilham, Biochemistry 5:2722-28 (1966); and U.S. Pat. No. 5,476,930. Ribozyme mediated ligation is described in, for example, U.S. Patent No. 5,498,531 ; U.S. Patent No. 5,780,272; WO 95 / 07351 ; and WO 98 / 40519. When the ligation reaction is a chemical ligation reaction, in some instances, the reaction is a click chemistry reaction. Click-chemistry reactions that may be employed include (i) nucleophilic substitutions; (ii) additions to C-C multiple bonds (e.g., Michael addition, epoxidation, dihydroxylation, aziridination); (iii) nonaldol like chemistry (e.g., N- hydroxysuccinimide active ester couplings); and (iv) cycloadditions (e.g., Diels-Adler reaction, Huisgen’s cycloaddition). Huisgen’s cycloaddition has been applied in various branches of chemistry. It consists of the condensation of organic azides with alkyne groups to form 1 ,2,3- triazole linkages. Azide and alkyne functionalities can be easily introduced in the scaffold of large organic constructs of biological relevance. The reaction may be catalyzed by introducing copper(l). The Cu(l) core has a dual effect in that it activates the slow-reacting alkyne group thus accelerating the azide-alkyne condensation kinetics by ~107— 108-fold, and it organizes the reacting groups by “templation” so that only a regiospecific 1 ,4-disubstituted adduct is formed. This reaction is known as the copper-catalyzed azide alkyne cycloaddition (CuAAC), and its compatibility with a wide range of biological substrates and synthetic conditions makes CuAAC the flagship among click conjugations. Since its discovery, Cu(l)-catalyzed azide alkyne cycloaddition has been widely used within the fields of biology, biochemistry, and biotechnology. Click-chemistry reactions that may be employed to attach the remainder of the first and / or second sequencing adapter to an amplicon include, but are not limited to, Huisgen Azide-Alkyne 1 ,3- Dipolar Cycloaddition, Copper-Catalyzed Azide-Alkyne Cycloaddition (CuAAC), Ruthenium- Catalyzed Azide-Alkyne Cycloaddition (RuAAC), and the like. Details regarding click-chemistry with nucleic acids are found, e.g., in Fantoni et al. (2021 ) Chem. Rev. 121 (12)7122-7154.

[0041] In certain embodiments, the ligation reaction (e.g., enzymatic or chemical ligation) comprises splint ligation. By “splint ligation” is meant a complex is formed when two nucleic acids each hybridize to a complementary “splint” oligonucleotide, forming a ligation junction, which is then ligated to form a new longer product. In the present context, in some embodiments, two splints may be employed, e.g.: (1 ) a first splint which hybridizes to a first terminal region of an amplicon comprising the fragment of the first sequencing adapter and the nucleic acid comprising the remainder of the first sequencing adapter, forming a ligation junction between the fragment and remainder of the first sequencing adapter; and (2) a second splint which hybridizes to the second terminal region of the amplicon comprising the fragment of the second sequencing adapter and the nucleic acid comprising the remainder of the second sequencing adapter, forming a ligation junction between the fragment and remainder of the second sequencing adapter. The ligation junctions may then be ligated using any convenient approach, e.g., enzymatic or chemical ligation as described elsewhere herein. In some embodiments, the terminal portion of the amplicon with which a splint overlaps consists only of the fragment of the sequence adapter at the terminal portion. According to some embodiments, such a splint is employed at each end of the amplicon, as schematically illustrated in FIG. 1 C. According to some embodiments, in the ligation reaction, the nucleic acids comprising the remainder of the first sequencing adapter or the nucleic acids comprising the remainder of the second sequencing adapter are provided at a limiting concentration. The limiting concentration may be relative to the concentration of the nucleic acids comprising the remainder of the other sequencing adapter. In certain embodiments, in the ligation reaction, the ratio of the concentration of the nucleic acids comprising the remainder of the first sequencing adapter to the concentration of the nucleic acids comprising the remainder of the second sequencing adapter is > 6:1 or < 1 :6, > 7:1 or < 1 :7, > 8:1 or < 1 :8, > 9:1 or < 1 :9, or > 10:1 or < 1 :10.

[0042] In some instances, in the ligation reaction, the concentration of the nucleic acids comprising the remainder of the first sequencing adapter or the concentration of the nucleic acids comprising the remainder of the second sequencing adapter is 0.005 to 0.2 pmol, 0.005 to 0.1 pmol, 0.005 to 0.05 pmol, or 0.005 to 0.02 pmol, e.g., from 0.005 to 0.015 pmol. In certain embodiments, the nucleic acids comprising the remainder of the other sequencing adapter are provided at an excess concentration.

[0043] According to some embodiments, once completed via the ligation reaction, the first sequencing adapter and the second sequencing adapter have a length independently selected from 14 to 30 nucleotides, e.g., from 16 to 28 nucleotides, from 18 to 26 nucleotides, or from 20 to 24 nucleotides. The amplicons may include components in addition to the first and second sequencing adapters, non-limiting examples of which include one or more barcode sequences, a unique molecular identifier (UMI), one or more index sequences (e.g., an i5 and / or i7 sequence), and / or the like.

[0044] The methods of the present disclosure are for producing a sequencing library from a sample comprising nucleic acids. In certain embodiments, the nucleic acids are deoxyribonucleic acids (DNAs). DNAs of interest include, but are not limited to, genomic DNA (including genomic DNA fragments), mitochondrial DNA (mtDNA), complementary DNA (or “cDNA”, synthesized from any RNA or DNA of interest), recombinant DNA (e.g., plasmid DNA), or the like.

[0045] In certain embodiments, the nucleic acids are ribonucleic acids (RNAs). RNAs of interest include, but are not limited to, messenger RNA (mRNA), microRNA (miRNA), small interfering RNA (siRNA), transacting small interfering RNA (ta-siRNA), natural small interfering RNA (nat- siRNA), ribosomal RNA (rRNA), transfer RNA (tRNA), small nucleolar RNA (snoRNA), small nuclear RNA (snRNA), long non-coding RNA (IncRNA), non-coding RNA (ncRNA), transfermessenger RNA (tmRNA), precursor messenger RNA (pre-mRNA), small Cajal body-specific RNA (scaRNA), piwi-interacting RNA (piRNA), endoribonuclease-prepared siRNA (esiRNA), small temporal RNA (stRNA), signal recognition RNA, telomere RNA, ribozyme, or any combination of such RNA types or subtypes.

[0046] The sample comprising nucleic acids may be prepared from any nucleic acid sample of interest, including but not limited to, a nucleic acids isolated from a single cell, a plurality of cells (e.g., cultured cells), a tissue, an organ, or an organism (e.g., bacteria, yeast, or the like). In some embodiments, the nucleic acids are isolated from a cell(s), tissue, organ, and / or the like of an animal. In some embodiments, the animal is a mammal (e.g., a mammal from the genus Homo, a rodent (e.g., a mouse or rat), a dog, a cat, a horse, a cow, or any other mammal of interest). In other embodiments, the nucleic acid sample is isolated / obtained from a source other than a mammal, such as bacteria, yeast, insects (e.g., drosophila), amphibians (e.g., frogs (e.g., Xenopus)), viruses, plants, or any other non-mammalian nucleic acid sample source.

[0047] The sample may be obtained (e.g., isolated) from an extant organism or animal. In other embodiments, however, the sample may be obtained (e.g., isolated) from an extinct (or “ancient”) organism or animal, e.g., an extinct mammal, such as an extinct mammal from the genus Homo. In certain embodiments, the nucleic acids are present in a forensic nucleic acid sample. As used herein, a “forensic nucleic acid sample” is a nucleic acid sample relating to (e.g., obtained during the course of) the investigation of a crime. Forensic samples of interest include, but are not limited to, semen, blood, and hair, e.g., a rootless hair.

[0048] According to some embodiments, the nucleic acids comprise cell-free nucleic acids, e.g., cell-free DNA, cell-free RNA, or both. Such cell-free nucleic acids may be obtained from any suitable source. In some instances, the cell-free nucleic acids are present in a sample of whole blood, blood plasma, blood serum, amniotic fluid, saliva, urine, pleural effusion, bronchial lavage, bronchial aspirates, breast milk, colostrum, tears, seminal fluid, peritoneal fluid, pleural effusion, or stool. In certain embodiments, the cell-free nucleic acids are cell-free fetal DNAs. In some instances, the cell-free nucleic acids are circulating tumor DNAs. In some embodiments, the cell- free nucleic acids comprise infectious agent DNAs. In some embodiments, the cell-free nucleic acids comprise DNAs from a transplant.

[0049] The term "cell-free nucleic acid" as used herein can refer to nucleic acid isolated from a source having substantially no cells. Cell-free nucleic acid may be referred to as “extracellular” nucleic acid, “circulating cell-free” nucleic acid (e.g., CCF fragments, ccf DNA) and / or “cell-free circulating” nucleic acid. Cell-free nucleic acid can be present in and obtained from blood (e.g., from the blood of an animal, from the blood of a human subject). Cell-free nucleic acid often includes no detectable cells and may contain cellular elements or cellular remnants. Non-limiting examples of acellular sources for cell-free nucleic acid are described above. Obtaining cell-free nucleic acid may include obtaining a sample directly (e.g., collecting a sample, e.g., a test sample) or obtaining a sample from another who has collected a sample. Without being limited by theory, cell-free nucleic acid may be a product of cell apoptosis and cell breakdown, which provides basis for cell-free nucleic acid often having a series of lengths across a spectrum (e.g., a "ladder"). In some embodiments, sample nucleic acid from a test subject is circulating cell-free nucleic acid. In some embodiments, circulating cell free nucleic acid is from blood plasma or blood serum from a test subject. In some instances, cell-free nucleic acid is degraded. Cell-free nucleic acid can include different nucleic acid species, and therefore is referred to herein as "heterogeneous" in certain embodiments. For example, a sample from a subject having cancer can include nucleic acid from cancer cells (e.g., tumor, neoplasia) and nucleic acid from non-cancer cells. In another example, a sample from a pregnant female can include maternal nucleic acid and fetal nucleic acid. In another example, a sample from a subject having an infection or infectious disease can include host nucleic acid and nucleic acid from the infectious agent (e.g., bacteria, fungus, protozoa). In another example, a sample from a subject having received a transplant can include host nucleic acid and nucleic acid from the donor organ or tissue. In some instances, cancer, fetal, infectious agent, or transplant nucleic acid sometimes is about 5% to about 50% of the overall nucleic acid (e.g., about 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, or 49% of the total nucleic acid is cancer, fetal, infectious agent, or transplant nucleic acid). In another example, heterogeneous cell-free nucleic acid may include nucleic acid from two or more subjects (e.g., a sample from a crime scene).

[0050] The sample comprising nucleic acids may be a tumor nucleic acid sample (that is, a nucleic acid sample isolated from a tumor). “Tumor”, as used herein, refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues. The terms “cancer” and “cancerous” refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth / proliferation. Examples of cancer include but are not limited to, carcinoma, sarcoma, myeloma, leukemia, lymphoma, or mixed type.

[0051] Cells obtained from a patient may include, but are not limited to, cells from biopsy tissue obtained from a patient. Biopsy tissues may be obtained from healthy or diseased tissues, including e.g., cancer tissues. Depending on the type of cancer and / or the type of biopsy performed the cells may be from a solid tissue biopsy or a liquid biopsy. In some instances, the cells may be prepared from a surgical biopsy. Any convenient and appropriate technique for surgical biopsy may be utilized for collection of cells to be employed in the methods described herein including but not limited to, e.g., excisional biopsy, incisional biopsy, wire localization biopsy, and the like. In some instances, a surgical biopsy may be obtained as a part of a surgical procedure which has a primary purpose other than obtaining the sample, e.g., including but not limited to tumor resection, mastectomy, lymph node surgery, axillary lymph node dissection, sentinel lymph node surgery, and the like.

[0052] Various other biopsy techniques may be employed to obtain biopsy tissue, in turn to obtain cells to be employed in the methods of the present disclosure. As a non-limiting example, a sample may be obtained by a needle biopsy. Any convenient and appropriate technique for needle biopsy may be utilized for collection of a sample including but not limited to, e.g., fine needle aspiration (FNA), core needle biopsy, stereotactic core biopsy, vacuum assisted biopsy, and the like. In some embodiments, nucleic acid is provided for conducting methods described herein after processing of the sample(s) containing the nucleic acid. For example, a nucleic acid can be extracted, isolated, purified, or partially purified from the sample(s) and / or concentrated. The term “isolated” generally refers to nucleic acid removed from its original environment (e.g., the natural environment if it is naturally occurring, or a host cell if expressed exogenously), and thus is altered by human intervention (e.g., "by the hand of man") from its original environment. The term “isolated nucleic acid” can refer to a nucleic acid removed from a subject (e.g., a human subject). An isolated nucleic acid can be provided with fewer non-nucleic acid components (e.g., protein, lipid, carbohydrate) than the amount of components present in a source sample. A composition comprising isolated nucleic acid can be about 50% to greater than 99% free of non- nucleic acid components. A composition comprising isolated nucleic acid can be about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater than 99% free of non-nucleic acid components. The term “purified” generally refers to a nucleic acid provided that contains fewer non-nucleic acid components (e.g., protein, lipid, carbohydrate) than the amount of non-nucleic acid components present prior to subjecting the nucleic acid to a purification procedure. A composition comprising purified nucleic acid may be about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater than 99% free of other non-nucleic acid components. In some embodiments, nucleic acid is concentrated (e.g., the amount of nucleic acid is increased per volume of solution).

[0053] Approaches, reagents and kits for isolating, purifying and / or concentrating DNA and RNA from sources of interest are known in the art and commercially available. For example, kits for isolating DNA from a source of interest include the DNeasy®, RNeasy®, QIAamp®, QIAprep® and QIAquick® nucleic acid isolation / purification kits by Qiagen, Inc. (Germantown, Md); the DNAzol®, ChargeSwitch®, Purelink®, GeneCatcher® nucleic acid isolation / purification kits by Life Technologies, Inc. (Carlsbad, CA); the NucleoMag®, NucleoSpin®, and NucleoBond® nucleic acid isolation / purification kits by Clontech Laboratories, Inc. (Mountain View, CA). In certain aspects, the nucleic acid is isolated from a fixed biological sample, e.g., formalin-fixed, paraffin-embedded (FFPE) tissue. Genomic DNA from FFPE tissue may be isolated using commercially available kits - such as the AllPrep® DNA / RNA FFPE kit by Qiagen, Inc. (Germantown, Md), the RecoverAII® Total Nucleic Acid Isolation kit for FFPE by Life Technologies, Inc. (Carlsbad, CA), and the NucleoSpin® FFPE kits by Clontech Laboratories, Inc. (Mountain View, CA).

[0054] When an organism, plant, animal, etc. from which the nucleic acid sample is obtained (e.g., isolated) is extinct (or “ancient”), suitable strategies for recovering such nucleic acids are known and include, e.g., those described in Green et al. (2010) Science 328(5979)710-722; Poinar et al. (2006) Science 311 (5759) :392-394; Stiller et al. (2006) Proc. Natl. Acad. Sci. 103(37):13578-13584; Miller et al. (2008) Nature 456(7220) :387-90; Rasmussen et al. (2010) Nature 463(7282)757-762; and elsewhere. In certain embodiments, the sequences of the 3’ domains of the forward and reverse primers are designed for targeted amplification of a nucleic acid analyte. In some instances, the nucleic acid of interest is a nucleic acid biomarker, e.g., a cancer biomarker. In some embodiments, the nucleic acid of interest is a nucleic acid of a pathogen. Non-limiting examples of such pathogens include a bacterium or virus. Bacterial pathogens of interest include those from the genera Mycobacterium, Corynebacterium, Nocardia, Streptococcus, Prevotella, Staphylococcus, Clostridium, Bacteroides, Actinomyces, and Burkholderia. In some embodiments, the nucleic acid of interest is a nucleic acid from a bacterial pathogen selected from Mycobacterium tuberculosis, Clostridium tetani, Klebsiella pneumoniae, Vibrio cholerae, Shigella, Pseudomonas aeruginosa, Neisseria gonorrhoeae, Treponema pallidum, Neisseria meningitidis, E.coli, Listeria monocytogenes, and Streptococcus pneumonia, and Leptospira sp. In some embodiments, the nucleic acid of interest is a nucleic acid from a viral pathogen selected from an influenza virus, a rhinovirus, varicella zoster, a coronavirus (e.g., SARS-CoV-2), hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus, hepatitis E virus, human immunodeficiency virus (HIV), human papillomavirus (HPV), respiratory syncytial virus (RSV), a norovirus, a paramyxovirus (e.g., a rubulavirus, such as orthorubulavirus), poliovirus, a lyssavirus (e.g., rabies virus), a rotavirus, a rubivirus (e.g., rubella virus), a herpes virus, a Zika virus, an mpox virus, and a Japanese encephalitis (JE) virus.

[0055] The methods of the present disclosure may further comprise sequencing the sequencing library utilizing the completed first and second sequencing adapters. The first and second sequencing adapters may be selected for sequencing the sequencing library on a variety of available high throughput nucleic acid sequencing machines and systems. Illustrative sequencing systems include those available from: Illumina, Inc. (San Diego, Calif.), non-limiting examples of which include the Illumina iSeq 100, Miniseq, MiSeq series, NextSeq series (e.g., NextSeq 500 series, NextSeq 1000, NextSeq 2000), and NovaSeq sequencing systems; MGI Tech Co. Ltd. (or “MGI”), non-limiting examples of which include the DNBSEQ T series or DNBSEQ T series G series nucleic acid sequencing systems; Oxford Nanopore Technologies (Oxford, UK), nonlimiting examples of which include the MinlON™, GridlONx5™, PromethlON™, and SmidglON™ nanopore-based sequencing systems; Pacific Biosciences (“PacBio”, Menlo Park, Calif.), nonlimiting examples of which include the REVIO, ONSO, and SEQUEL lie sequencing systems.

[0056] In certain embodiments, the sequencing comprises cluster generation utilizing the completed first and second sequencing adapters. For example, when it is desirable to sequence the library using a sequencing system employing an Illumina flowcell, the first and second completed sequencing adapters may be complementary to the “anchor” oligonucleotides on the flowcell surface (e.g., P5 and P7' anchor oligonucleotides).

[0057] Illumina sequencing technology leverages clonal array formation and reversible terminator technology for large-scale sequencing. For cluster generation, sequencing templates are immobilized on a flow cell surface designed to present the DNA in a manner that facilitates access to enzymes while ensuring high stability of surface-bound template and low non-specific binding of fluorescently labeled nucleotides. Solid-phase amplification creates up to 1 ,000 identical copies of each single template molecule in close proximity (diameter of one micron or less). Because this process does not involve photolithography, mechanical spotting, or positioning of beads into wells, densities on the order of ten million single-molecule clusters per square centimeter are achieved. The next phase involves sequencing by synthesis (SBS) utilizing four fluorescently-labeled nucleotides to sequence the tens of millions of clusters on the flow cell surface in parallel. During each sequencing cycle, a single labeled deoxynucleoside triphosphate (dNTP) is added to the nucleic acid chain. The nucleotide label serves as a terminator for polymerization, so after each dNTP incorporation, the fluorescent dye is imaged to identify the base and then enzymatically cleaved to allow incorporation of the next nucleotide. Since all four reversible terminator-bound dNTPs (A, C, T, G) are present as single, separate molecules, natural competition minimizes incorporation bias. Base calls are made directly from signal intensity measurements during each cycle.

[0058] In some embodiments, a flow cell for clustering in the Illumina platform is a glass slide with lanes. Each lane is a glass channel coated with a lawn of two types of oligos (e.g., P5 and P7' oligos). Hybridization is enabled by the first of the two types of oligos on the surface. This oligo may be complementary to the first completed sequencing adapter or the second completed sequencing adapter. A polymerase creates a compliment strand of the hybridized sequencing template. The double-stranded molecule is denatured, and the original template strand is washed away. The remaining strand, in parallel with many other remaining strands, is clonally amplified through bridge amplification.

[0059] In bridge amplification and other sequencing methods involving clustering, a strand folds over, and a second adapter region on a second end of the strand hybridizes with the second type of oligos on the flow cell surface. A polymerase generates a complementary strand, forming a double-stranded bridge molecule. This double-stranded molecule is denatured resulting in two single-stranded molecules tethered to the flow cell through two different oligos. The process is then repeated iteratively, and occurs simultaneously for millions of clusters resulting in clonal amplification of all the sequencing templates. After bridge amplification, the reverse strands are cleaved and washed off, leaving only the forward strands. The 3' ends are blocked to prevent unwanted priming.

[0060] After clustering, sequencing starts with extending a first sequencing primer to generate the first read. With each cycle, fluorescently tagged nucleotides compete for addition to the growing chain. Only one is incorporated based on the sequence of the template. After the addition of each nucleotide, the cluster is excited by a light source, and a characteristic fluorescent signal is emitted. The number of cycles determines the length of the read. The emission wavelength and the signal intensity determine the base call. For a given cluster all identical strands are read simultaneously. Hundreds of millions of clusters may be sequenced in a massively parallel manner. At the completion of the first read, the read product is washed away.

[0061] In the next step of protocols involving two index primers, an index 1 primer is introduced and hybridized to an index 1 region on the template. Index regions provide identification of fragments, which is useful for de-multiplexing samples in a multiplex sequencing process. The index 1 read is generated similar to the first read. After completion of the index 1 read, the read product is washed away and the 3' end of the strand is de-protected. The template strand then folds over and binds to a second oligo on the flow cell. An index 2 sequence is read in the same manner as index 1 . Then an index 2 read product is washed off at the completion of the step.

[0062] After reading two indices, read 2 initiates by using polymerases to extend the second flow cell oligos, forming a double-stranded bridge. This double-stranded DNA is denatured, and the 3' end is blocked. The original forward strand is cleaved off and washed away, leaving the reverse strand. Read 2 begins with the introduction of a read 2 sequencing primer. As with read 1 , the sequencing steps are repeated until the desired length is achieved. The read 2 product is washed away. This entire process generates millions of reads, representing all the fragments. Sequences from pooled sample libraries are separated based on the unique indices introduced during sample preparation. For each sample, reads of similar stretches of base calls are locally clustered. Forward and reversed reads are paired creating contiguous sequences. These contiguous sequences are aligned to the reference genome for variant identification.

[0063] The sequencing by synthesis may involve paired end reads. Paired end sequencing involves 2 reads from the two ends of a fragment. Paired end reads are used to resolve ambiguous alignments. Paired-end sequencing allows users to choose the length of the DNA to be sequenced and sequence either end of the DNA, generating high-quality, alignable sequence data. Because the distance between each paired read is known, alignment algorithms can use this information to map reads over repetitive regions more precisely. This results in better alignment of the reads, especially across difficult-to-sequence, repetitive regions of the genome. Paired-end sequencing can detect rearrangements, including insertions and deletions (indels) and inversions.

[0064] DNA nanoball sequencing (e.g., employing a sequencing system available from MGI Tech Co., Ltd. (“MGI”)) involves the amplification of genomic DNA into nanoballs, followed by sequencing by synthesis (SBS) using fluorescently labeled nucleotides. In nanoball sequencing, DNA fragments are amplified by rolling circle amplification. The original circular DNA fragment serves as a template for the amplification of each clonal copy of DNA. This results in a spherical "nanoball" of amplified DNA. The negatively charged nanoballs are then hybridized to positively charged binding spots on a patterned flow cell. The sequencing process then proceeds in a similar fashion to standard SBS sequencing. The nucleotides (A, C, G, or T) are added one at a time to the flow cell, and the incorporated nucleotides are detected by a camera. Fluorescently labeled nucleotides, or alternatively, nucleotides labeled with fluorescently labeled antibodies, can be used.

[0065] In nanopore sequencing (e.g., implemented using a sequencer available from Oxford Nanopore Technologies), the nanopore serves as a biosensor and provides the sole passage through which an ionic solution on the cis side of the membrane contacts the ionic solution on the trans side. A constant voltage bias (trans side positive) produces an ionic current through the nanopore and drives ssDNA or ssRNA in the cis chamber through the pore to the trans chamber. A processive enzyme (e.g., a helicase, polymerase, nuclease, or the like) may be bound to the polynucleotide such that its step-wise movement controls and ratchets the nucleotides through the small-diameter nanopore, nucleobase by nucleobase. Because the ionic conductivity through the nanopore is sensitive to the presence of the nucleobase’s mass and its associated electrical field, the ionic current levels through the nanopore reveal the sequence of nucleobases in the translocating strand. A patch clamp, a voltage clamp, or the like, may be employed. Details for obtaining raw sequencing reads of nucleic acid molecules using nanopores are described, e.g., in Feng et al. (2015) Genomics, Proteomics & Bioinformatics 13(1 ):4-16. Nanopore-based sequencing systems are available and include the MinlON™, GridlONx5TM, PromethlON™, and SmidglON™ nanopore-based sequencing systems available from Oxford Nanopore Technologies Limited. Detailed design considerations and protocols for performing nucleic acid sequencing are provided with such systems.

[0066] In zero mode waveguide (ZMW)-based sequence analysis (e.g., using a sequencer available from Pacific Biosciences (PacBio), the ZMW is a nanoscale-sized well that serves as an optical confinement that allows observation of individual polymerase molecules. As a result, nucleotide incorporation events provide observation of an incorporating nucleotide analog that is readily distinguishable from non-incorporated nucleotide analogs. For a description of ZMWs and their application in nucleic acid sequencing, see, e.g., U.S. Patent Application Publication No. 2003 / 0044781 and U.S. Pat. No. 6,917,726, each of which is incorporated herein by reference in its entirety for all purposes. See also Levene et al. (2003) “Zero-mode waveguides for single-molecule analysis at high concentrations” Science 299:682-686, Eid et al. (2009) “Realtime DNA sequencing from single polymerase molecules” Science 323:133-138, and U.S. Pat. Nos. 7,056,676, 7,056,661 , 7,052,847, 7,033,764, and 7,907,800, the full disclosures of which are incorporated herein by reference in their entirety for all purposes.

[0067] COMPOSITIONS

[0068] Aspects of the present disclosure further include compositions. The compositions find use in a variety of applications, including, e.g., practicing any of the methods of the present disclosure, including carrying out one or more of any of the steps described above in the Methods of Producing Sequencing Libraries section of the present disclosure. As such, the compositions may include a forward primer, a reverse primer, nucleic acids comprising a remainder of the first sequencing adapter, nucleic acids comprising a remainder of the second sequencing adapter, one or more ligation reagents, and / or other reagents, etc. described elsewhere herein, in any combination.

[0069] In some instances, provided are compositions comprising a forward primer comprising a 3’ domain complementary to nucleic acids of interest and a 5’ domain comprising a fragment of a first sequencing adapter, and a reverse primer comprising a 3’ domain complementary to the nucleic acids of interest and a 5’ domain comprising a fragment of a second sequencing adapter. According to some embodiments, the fragment of the first sequencing adapter and the fragment of the second sequencing adapter have a length independently selected from 2 to 16 nucleotides. For example, the fragment of the first sequencing adapter and the fragment of the second sequencing adapter may have a length independently selected from 3 to 10 nucleotides, 3 to 8 nucleotides, or 3 to 6 nucleotides, e.g., from 4 to 10 nucleotides, 4 to 8 nucleotides, or 4 to 6 nucleotides. In some instances, the fragment of the first sequencing adapter is 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15 or 16 nucleotides in length, and the fragment of the second sequencing adapter is 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15 or 16 nucleotides in length.

[0070] According to some embodiments, in a composition of the present disclosure, the molar ratio of the concentration of the nucleic acids comprising the remainder of the first sequencing adapter to the concentration of the nucleic acids comprising the remainder of the second sequencing adapter is > 6:1 or < 1 :6, > 7:1 or < 1 :7, > 8:1 or < 1 :8, > 9:1 or < 1 :9, or > 10:1 or < 1 :10.

[0071] In certain embodiments, a composition of the present disclosure includes the one or more components in a liquid medium. The liquid medium may be an aqueous liquid medium, such as water, a buffered solution, and the like. One or more additives such as a salt (e.g., NaCI, MgCh, KCI, MgSC ), a buffering agent (a Tris buffer, N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) (HEPES), 2-(N-Morpholino)ethanesulfonic acid (MES), 2-(N-Morpholino)ethanesulfonic acid sodium salt (MES), 3-(N-Morpholino)propanesulfonic acid (MOPS), N- tris[Hydroxymethyl]methyl-3-aminopropanesulfonic acid (TAPS), etc.), a solubilizing agent, a detergent (e.g., a non-ionic detergent such as Tween-20, etc.), a nuclease inhibitor, glycerol, a chelating agent, and the like may be present in such compositions. In some instances, the forward and reverse primers are lyophilized.

[0072] KITS

[0073] Aspects of the present disclosure further include kits. The kits find use in a variety of applications, including, e.g., practicing any of the methods of the present disclosure, including carrying out one or more of any of the steps described above in the section entitled Methods of Producing Sequencing Libraries section of the present disclosure. As such, the kits may include a forward primer, a reverse primer, nucleic acids comprising a remainder of the first sequencing adapter, nucleic acids comprising a remainder of the second sequencing adapter, one or more ligation reagents, and / or other reagents, etc. described elsewhere herein, in any desired combination.

[0074] In some embodiments, a kit of the present disclosure comprises one or more of any of the following: a forward primer comprising a 3’ domain complementary to nucleic acids of interest and a 5’ domain comprising a fragment of a first sequencing adapter; a reverse primer comprising a 3’ domain complementary to the nucleic acids of interest and a 5’ domain comprising a fragment of a second sequencing adapter; nucleic acids comprising a remainder of the first sequencing adapter; and nucleic acids comprising a remainder of the second sequencing adapter.

[0075] A kit of the present disclosure may further comprise a reagent for ligating the remainder of the first and second sequencing adapters to the fragment of the first a second sequencing adapter, respectively. Such reagents include, e.g., enzymatic ligation reagents (e.g., a ligase and / or ligation buffer), and chemical ligation reagents (e.g., one or more of any of the chemical ligation reagents described elsewhere herein) non-limiting examples of which include click chemistry reagents.

[0076] Components of the subject kits may be present in separate containers, or multiple components may be present in a single container. For example, the forward and reverse primers may be provided in separate containers or the same container. Similarly, a kit of the present disclosure may comprise in separate containers or the same container nucleic acids comprising a remainder of the first sequencing adapter and nucleic acids comprising a remainder of the second sequencing adapter. Suitable containers include, e.g., a tube (e.g., vial), one or more wells of a plate (e.g., a 96-well plate, a 384-well plate, etc.), or the like.

[0077] In certain embodiments, a kit of the present disclosure further comprises instructions for amplifying the nucleic acids of interest using the forward and reverse primers, and covalently linking the remainder of the first and second sequencing adapters to the fragments of the first and second sequencing adapters, respectively. Such instructions may further comprise instructions for ligating the remainder of the first and second sequencing adapters to the fragment of the first a second sequencing adapter, respectively. Instructions of a kit of the present disclosure may be recorded on a suitable recording medium. For example, the instructions may be printed on a substrate, such as paper or plastic, etc. As such, the instructions may be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or sub-packaging), etc. In other embodiments, the instructions are present as an electronic storage data file present on a suitable computer- readable storage medium, e.g., portable flash drive, DVD, CD-ROM, diskette, etc. In yet other embodiments, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g. via the internet, are provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and / or from which the instructions can be downloaded. As with the instructions, the means for obtaining the instructions is recorded on a suitable substrate. The following examples are offered by way of illustration and not by way of limitation.

[0078] EXPERIMENTAL

[0079] Example 1 - Amplicon Library Preparation

[0080] High-throughput sequencing of a pool of PCR generated products is used in many areas of biomedical research. For example, the most commonly used sequencing-based test for COVID-19 is a PCR amplicon-based protocol. High-throughput sequencing of multiple PCR products presents several challenges. Among these are generation of artifacts of PCR or sequencing library generation and normalization of PCR product across samples.

[0081] Described herein is an approach for amplicon library preparation that simplifies, accelerates, and normalizes PCR-amplicon sequencing. According to this approach, for amplicon library preparation, primers for a target of interest are 5’ tagged with a fragment of a sequencing adapter. In the present non-limiting example, primers for a target of interest are 5’ tagged with 4 bp of the Illumina adapter, which are used for the generation of amplicons. The 4 bp tagged to the primers are fragments of (i.e., are “removed” from) the P5 and P7 Illumina adapters, which are then used for the ligation of adapters to the amplicons during library preparation.

[0082] FIG. 1 schematically illustrates this approach in the non-limiting context of amplifying a target sequence of SARS-CoV-2 cDNA. As will be appreciated with the benefit of the present disclosure, the approach may be implemented for any target for which PCR primers can be generated. As shown in FIG. 1 A, PCR primers are designed, each with a 4 base pair 5-prime tail that is not complimentary to the target DNA. In the present example, the four base pair tail is chosen to be the last four bases of the 3-prime end of the P5 Illumina adapter (forward primer) and the reverse complement of the first four bases of the 5-prime end of the P7 Illumina adapter (reverse primer). As shown in FIG. 1 B, after PCR, each amplicon will contain these 4 base pairs at their ends. As shown in FIG. 1 C, a library is produced by completing the adapters via splint ligation or other ligation, where the four base pair sequences will then be common to all amplicon products and provide known, fixed targets for splint ligation. This new design was tested and found to have comparable ligation efficiency to 7 bp defined splints over an input range of 0.1 ng - 10 ng using an oligonucleotide amplicon mimic. Results are shown in the following table:

[0083] Splint i 4bp Splint 7bp Splint

[0084] Input 10ng 1ng 0.1 ng 10ng 1ng 0.1ng

[0085] CT 14.64 18.79 22.81 14.99 18.89 22.59

[0086] Full adapter sequences are generated when an adapter is ligated to an amplicon, while adapter-dimers are truncated. During library index PCR the adapter-dimers are not amplified as the indexing primer hybridization leads to a 5’ 4 bp flap, which prevents amplification. This design was observed to reduce the PCR efficiency of adapter-dimers by 12 CT cycles, an approximately 4000X difference. Optionally, the P5 and P7 adapter concentrations in the ligation reaction may be asymmetric to normalize the final concentration of libraries over a wide range of library inputs. By way of example, in the ligation reaction, the remainder of the P5 adapter may be included in excess while the remainder of the P7 adapter is limited in the reaction. In this example, the concentration of the remainder of the P7 adapter drives the output of double-ligated library product. A proof of concept experiment was performed where only the P7 adapter must be ligated to an oligonucleotide to form a P5 / P7 ligated product. When the P7 adapter is at an input of 0.4 pmol, there is a 17.9X difference in final library molecules between 10 ng and 1 ng target oligo inputs. However, when the P7 adapter is limited to 0.01 pmol, the difference was reduced to 1 .5X.

[0087] Using the primer and adapter scheme described above, 5 single-stranded libraries were prepared from amplicon reactions ranging in concentration 0.23 ng / pl_ to 10.75 ng / pL (up to 47X difference). Following library preparation, qPCR was performed to compare the amount of double-ligated products among the libraries. The 4 highest input libraries (up to 6X difference) were found to have similar library outputs, with up to 0.08X difference (FIG. 2). The lowest input library (47X difference from maximum) resulted in only a 2.4X output difference from the maximum input.

[0088] Accordingly, the preceding merely illustrates the principles of the present disclosure. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein.

Claims

WHAT IS CLAIMED IS:1 . A method of producing a sequencing library from a sample comprising nucleic acids, the method comprising: amplifying nucleic acids of the sample using a primer pair comprising a forward primer and a reverse primer, wherein: the forward primer comprises a 3’ domain complementary to nucleic acids in the sample and a 5’ domain comprising a fragment of a first sequencing adapter, and the reverse primer comprises a 3’ domain complementary to the nucleic acids in the sample and a 5’ domain comprising a fragment of a second sequencing adapter, thereby producing amplicons, each amplicon comprising the fragment of the first sequencing adapter at a first end and the fragment of the second sequencing adapter at the second end; and combining into a ligation reaction: the amplicons, nucleic acids comprising a remainder of the first sequencing adapter, and nucleic acids comprising a remainder of the second sequencing adapter, under conditions in which the remainder of the first sequencing adapter is ligated to the fragment of the first sequencing adapter and the remainder of the second sequencing adapter is ligated to the fragment of the second sequencing adapter, thereby completing the first and second sequencing adapters and producing a sequencing library in which sequenceable templates are only those derived from the amplicons.

2. The method according to claim 1 , wherein the fragment of the first sequencing adapter and the fragment of the second sequencing adapter have a length independently selected from2 to 16 nucleotides.

3. The method according to claim 2, wherein the fragment of the first sequencing adapter and the fragment of the second sequencing adapter have a length independently selected from3 to 10 nucleotides, 3 to 8 nucleotides, or 3 to 6 nucleotides.

4. The method according to any one of claims 1 to 3, wherein the nucleic acids of the sample are dephosphorylated prior to the amplifying.

5. The method according to any one of claims 1 to 4, wherein the forward primer and the reverse primer comprise a 5’ phosphate.

6. The method according to any one of claims 1 to 5, wherein the ligation reaction is an enzymatic ligation reaction.

7. The method according to any one of claims 1 to 5, wherein the ligation reaction is a chemical ligation reaction.

8. The method according to claim 7, wherein the chemical ligation reaction is a click chemistry reaction.

9. The method according to any one of claims 1 to 8, wherein the enzymatic ligation reaction comprises splint ligation.

10. The method according to any one of claims 1 to 9, wherein in the ligation reaction, the nucleic acids comprising the remainder of the first sequencing adapter or the nucleic acids comprising the remainder of the second sequencing adapter are provided at a limiting concentration.11 . The method according to claim 10, wherein in the ligation reaction, the ratio of the concentration of the nucleic acids comprising the remainder of the first sequencing adapter to the concentration of the nucleic acids comprising the remainder of the second sequencing adapter is > 6:1 or < 1 :6.

12. The method according to claim 11 , wherein the ratio is > 8:1 or < 1 :8.

13. The method according to any one of claims 10 to 12, wherein in the ligation reaction, the concentration of the nucleic acids comprising the remainder of the first sequencing adapter or the concentration of the nucleic acids comprising the remainder of the second sequencing adapter is 0.005 to 0.2 pmol.

14. The method according to claim 13, wherein in the ligation reaction, the concentration of the nucleic acids comprising the remainder of the first sequencing adapter or the concentration of the nucleic acids comprising the remainder of the second sequencing adapter is 0.005 to 0.02 pmol.

15. The method according to any one of claims 1 to 10, wherein the first sequencing adapter and the second sequencing adapter have a length independently selected from 14 to 30 nucleotides.

16. The method according to claim 15, wherein the first sequencing adapter and the second sequencing adapter have a length independently selected from 16 to 28 nucleotides, 18 to 26 nucleotides, or 20 to 24 nucleotides.

17. The method according to any one of claims 1 to 16, wherein the sequences of the 3’ domains of the forward and reverse primers are designed for targeted amplification of a nucleic acid of interest.

18. The method according to claim 17, wherein the nucleic acid of interest is a nucleic acid biomarker.

19. The method according to claim 18, wherein the biomarker is a cancer biomarker.

20. The method according to claim 17 or 18, wherein the nucleic acid of interest is a nucleic acid of a pathogen.21 . The method according to claim 20, wherein the pathogen is a bacterium or a virus.

22. The method according to any one of claims 1 to 16, wherein the 3’ domains of the forward and reverse primers are random for non-targeted amplification of nucleic acids of the sample.

23. The method according to any one of claims 1 to 22, wherein the nucleic acids of the sample are genomic DNA.

24. The method according to any one of claims 1 to 22, wherein the nucleic acids of the sample are complementary DNA (cDNA).

25. The method according to any one of claims 1 to 22, wherein the sample is a biological sample.

26. The method according to any one of claims 1 to 22, wherein the sample is a forensic sample.

27. The method according to any one of claims 1 to 26, further comprising sequencing the sequencing library utilizing the completed first and second sequencing adapters.

28. The method according to claim 27, wherein the sequencing comprises cluster generation utilizing the completed first and second sequencing adapters.

29. The method according to claim 28, wherein the sequencing comprises sequencing by synthesis subsequent to cluster generation.

30. The method according to claim 27, wherein the sequencing comprises DNA nano ball (DNB) generation utilizing the completed first and second sequencing adapters.31 . The method according to claim 30, wherein the sequencing comprises sequencing by synthesis subsequent to cluster generation.

32. The method according to claim 27, wherein the sequencing comprises nanopore sequencing.

33. A composition comprising: a forward primer comprising a 3’ domain complementary to nucleic acids of interest and a 5' domain comprising a fragment of a first sequencing adapter; and a reverse primer comprising a 3’ domain complementary to the nucleic acids of interest and a 5’ domain comprising a fragment of a second sequencing adapter.

34. The composition of claim 33, wherein the forward and reverse primers are present in a liquid medium.

35. The composition of claim 33, wherein the forward and reverse primers are lyophilized.

36. The composition of any one of claims 33 to 35, wherein the fragment of the first sequencing adapter and the fragment of the second sequencing adapter have a length independently selected from 2 to 16 nucleotides.

37. The composition of claim 36, wherein the fragment of the first sequencing adapter and the fragment of the second sequencing adapter have a length independently selected from 3 to 10 nucleotides, 3 to 8 nucleotides, or 3 to 6 nucleotides.

38. A kit, comprising: a forward primer comprising a 3’ domain complementary to nucleic acids of interest and a 5’ domain comprising a fragment of a first sequencing adapter; a reverse primer comprising a 3’ domain complementary to the nucleic acids of interest and a 5’ domain comprising a fragment of a second sequencing adapter; nucleic acids comprising a remainder of the first sequencing adapter; and nucleic acids comprising a remainder of the second sequencing adapter.

39. The kit of claim 38, further comprising a reagent for ligating the remainder of the first and second sequencing adapters to the fragment of the first a second sequencing adapter, respectively.

40. The kit of claim 39, wherein the reagent is a ligase.41 . The kit of claim 39, wherein the reagent is a chemical ligation reagent.

42. The kit of claim 41 , wherein the chemical ligation reagent is a click chemistry reagent.

43. The kit of any one of claim 38, wherein the kit further comprises instructions for amplifying the nucleic acids of interest using the forward and reverse primers, and ligating the remainder of the first and second sequencing adapters to the fragments of the first and second sequencing adapters, respectively.

Images