Phosphorus compound and Anti-tumor use thereof

Abstract

The present invention relates to a phosphorus compound and the anti-tumor use thereof. Specifically, provided in the present invention is use of a compound of formula I, or an optical isomer thereof, or a racemate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, in preparing a composition or a formulation, the composition or the formulation being used for preventing and / or treating tumors. The compound of the present invention exhibits excellent precise therapeutic efficacy against tumors characterized by low expression, no expression, low activity or inactivity of mitochondrial permeability transition pores, low expression, no expression, low activity or inactivity of peptidylprolyl isomerase F, low expression or no expression of NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation levels at nucleotide sites of the NNMT gene, and / or high methylation levels at DNA CpG sites in an NNMT gene region.

Description

A phosphorus compound and its application in anti-tumor Technical Field

[0001] The present invention relates to the field of medicine, in particular to a phosphorus compound and its application in anti-tumor aspects. Background Art

[0002] Tumors are common diseases that seriously endanger human health, and the mortality rate of malignant tumors has been on the rise. Due to the heterogeneity of tumors, if the same treatment method or the same drug is simply used based on their origin or pathological characteristics, it is easy to cause improper treatment, which will waste patients' precious treatment time and opportunities. Therefore, it is very necessary to adopt precision treatment for different tumor conditions. With the development of biological technology, tumors are constantly being classified at the molecular level such as genes and proteins. More and more changes in the expression and activity of tumor-related genes, proteins have been discovered. Changes in the expression and activity of tumor-related genes, proteins have played an important role in the development of malignant tumors. The discovery and application of biomarkers will provide precise guidance for the application of related drugs, making precise treatment of tumors possible, thereby achieving targeted drug administration, significantly improving the effect of tumor treatment, reducing drug dosage and reducing toxic side effects.

[0003] Therefore, there is an urgent need in this field to develop a drug that can provide precise treatment for tumors. Summary of the Invention

[0004] The present invention provides a compound, which has an excellent precision therapeutic effect on tumors with low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidylprolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methylase, high expression of UHRF1, high methylation level of NNMT gene nucleotide sites, and / or high methylation level of DNA CpG sites in the NNMT gene region.

[0005] In a first aspect, the present invention provides a compound of formula I, or an optical isomer thereof, or a racemate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, for use in preparing a composition or formulation for preventing and / or treating tumors;

[0006] in,

[0007] R1, R2, R3 and R4 are each independently substituted or unsubstituted C1-C16 alkyl, substituted or unsubstituted C1-C16 haloalkyl, substituted or unsubstituted C2-C8 alkenyl-substituted or unsubstituted C1-C10 alkyl-, substituted or unsubstituted C3-C16 cycloalkyl, substituted or unsubstituted 3-16 membered heterocycloalkyl, substituted or unsubstituted C6-C16 aryl, substituted or unsubstituted 3-16 membered heteroaryl, substituted or unsubstituted C6-C16 aryl-substituted or unsubstituted C1-C8 alkyl-, substituted or unsubstituted 3-16 membered heteroaryl-substituted or unsubstituted C1-C8 alkyl-, substituted or unsubstituted C2-C10 ester-substituted or unsubstituted 3-12 membered heterocycloalkyl-, or substituted or unsubstituted C2-C10 ester-substituted or unsubstituted C1-C10 alkyl-.

[0008] In another preferred embodiment, the heteroaryl group is a 5-16 membered heteroaryl group, a 5-12 membered heteroaryl group or a 5-10 membered heteroaryl group.

[0009] In another preferred embodiment, R1, R2, R3 and R4 are each independently substituted or unsubstituted C1-C12 alkyl, substituted or unsubstituted C1-C12 haloalkyl, substituted or unsubstituted C2-C6 alkenyl-substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted C3-C12 cycloalkyl, substituted or unsubstituted 3-12 membered heterocycloalkyl, substituted or unsubstituted C6-C12 aryl, substituted or unsubstituted 3-12 membered heteroaryl, substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted 3-12 membered heteroaryl-substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted C2-C8 ester-substituted or unsubstituted 3-10 membered heterocycloalkyl-, or substituted or unsubstituted C2-C8 ester-substituted or unsubstituted C1-C8 alkyl-.

[0010] In another preferred embodiment, R1, R2, R3 and R4 are each independently substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C1-C10 haloalkyl, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl, substituted or unsubstituted C6-C12 aryl, substituted or unsubstituted 3-12 membered heteroaryl, substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted 3-12 membered heteroaryl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C2-C8 ester-substituted or unsubstituted 3-8 membered heterocycloalkyl-, or substituted or unsubstituted C2-C6 ester-substituted or unsubstituted C1-C6 alkyl-.

[0011] In another preferred embodiment, R1, R2, R3 and R4 are each independently substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C1-C8 haloalkyl, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted 3-8 membered heterocycloalkyl, substituted or unsubstituted C6-C10 aryl, substituted or unsubstituted 3-12 membered heteroaryl, substituted or unsubstituted C6-C10 aryl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted 3-12 membered heteroaryl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C3-C8 ester-substituted or unsubstituted 5-8 membered heterocycloalkyl-, or substituted or unsubstituted C2-C5 ester-substituted or unsubstituted C1-C6 alkyl-.

[0012] In another preferred embodiment, R1, R2, R3 and R4 are each independently substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C1-C6 haloalkyl, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C4-C6 cycloalkyl, substituted or unsubstituted 5-7 membered heterocycloalkyl, substituted or unsubstituted C6-C8 aryl, substituted or unsubstituted 5-10 membered heteroaryl, substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted 5-10 membered heteroaryl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C3-C7 ester-substituted or unsubstituted 5-7 membered heterocycloalkyl-, or substituted or unsubstituted C2-C4 ester-substituted or unsubstituted C1-C5 alkyl-.

[0013] In another preferred embodiment, R1, R2, R3 and R4 are each independently substituted or unsubstituted C1-C4 alkyl, substituted or unsubstituted C1-C4 haloalkyl, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C4-C6 cycloalkyl, substituted or unsubstituted 5-7 membered heterocycloalkyl, substituted or unsubstituted C6-C8 aryl, substituted or unsubstituted 5-10 membered heteroaryl, substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted 5-10 membered heteroaryl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C3-C7 ester-substituted or unsubstituted 5-7 membered heterocycloalkyl-, or substituted or unsubstituted C2-C4 ester-substituted or unsubstituted C1-C5 alkyl-.

[0014] In another preferred embodiment, any of the "substituted" mentioned above means that one or more (preferably 1, 2, 3, 4, 5, 6, 7 or 8) hydrogen atoms on the group are independently replaced by a substituent.

[0015] In another preferred embodiment, any of the "substituted" refers to that one or more (preferably 1, 2, 3, 4, 5, 6, 7 or 8) hydrogen atoms on the group are independently replaced by substituents selected from the group: C1-C8 alkyl, C3-C8 cycloalkyl, C2-C8 alkenyl, C1-C8 haloalkyl, C3-C8 halocycloalkyl, C3-C8 cycloalkyloxy, C3-C8 cycloalkylthio, C3-C8 halocycloalkyloxy, C3-C8 halocycloalkylthio, halogen, hydroxyl, thiol, amino, C2-C8 ester, C2-C8 amide, C1-C8 alkoxy, C1-C8 alkylthio, C1-C8 haloalkoxy, C1-C8 haloalkylthio, C6-C12 aryl, and 5-12 membered heteroaryl.

[0016] In another preferred embodiment, any of the "substituted" refers to that one or more (preferably 1, 2, 3, 4, 5, 6, 7 or 8) hydrogen atoms on the group are independently replaced by substituents selected from the group: C1-C6 alkyl, C3-C8 cycloalkyl, C2-C6 alkenyl, C1-C6 haloalkyl, C3-C8 halocycloalkyl, C3-C8 cycloalkyloxy, C3-C8 cycloalkylthio, C3-C8 halocycloalkyloxy, C3-C8 halocycloalkylthio, halogen, hydroxyl, thiol, amino, C2-C6 ester, C2-C6 amide, C1-C6 alkoxy, C1-C6 alkylthio, C1-C6 haloalkoxy, C1-C6 haloalkylthio, C6-C10 aryl, and 5-10 membered heteroaryl.

[0017] In another preferred embodiment, any of the "substituted" refers to that one or more (preferably 1, 2, 3, 4, 5, 6, 7 or 8) hydrogen atoms on the group are independently replaced by substituents selected from the group: C1-C4 alkyl, C3-C8 cycloalkyl, C2-C4 alkenyl, C1-C4 haloalkyl, C3-C8 halocycloalkyl, C3-C8 cycloalkyloxy, C3-C8 cycloalkylthio, C3-C8 halocycloalkyloxy, C3-C8 halocycloalkylthio, halogen, hydroxyl, thiol, amino, C2-C6 ester, C2-C6 amide, C1-C4 alkoxy, C1-C4 alkylthio, C1-C4 haloalkoxy, C1-C4 haloalkylthio, C6-C10 aryl, and 5-10 membered heteroaryl.

[0018] In another preferred embodiment, the heterocyclic ring of the heterocycloalkyl and heteroaryl groups has 1-4 (preferably 1, 2, 3 or 4) heteroatoms independently selected from N, O and S.

[0019] In another preferred embodiment, the heterocyclic ring of the heterocycloalkyl group has 1-4 (preferably 1, 2, 3 or 4) heteroatoms independently selected from N, O and S.

[0020] In another preferred embodiment, the heteroaryl group has 1-4 (preferably 1, 2, 3 or 4) heteroatoms independently selected from N, O and S on the heterocyclic ring.

[0021] In another preferred embodiment, the heterocycloalkyl group has 0, 1 or 2 C=C ring double bonds.

[0022] In another preferred embodiment, R1, R2 and R3 are each independently phenyl.

[0023] In another preferred embodiment, R1, R2, R3 and R4 are each independently indolyl, methyl-substituted indolyl, pyrrolopyridinyl, methyl-substituted pyrrolopyridinyl, pentyl carboxyl-tetrahydropyridinyl-, thienyl, furanyl, tetrahydropyranyl, halomethyl, halopropyl, halobutyl, methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, vinyl-methyl-, propenyl-methyl-, butenyl-methyl-, cyclopentyl, pyridyl-methyl-, propyl carboxyl-propyl-,

[0024] R5, R6, R7, R8 and R9 are each independently hydrogen, C1-C8 alkyl, C1-C8 alkoxy, C1-C8 alkylthio, or halogen.

[0025] In another preferred embodiment, R5, R6, R7, R8 and R9 are each independently hydrogen, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkylthio, or halogen.

[0026] In another preferred embodiment, R5, R6, R7, R8 and R9 are each independently hydrogen, C1-C4 alkyl, C1-C4 alkoxy, C1-C4 alkylthio, or halogen.

[0027] In another preferred embodiment, R5, R6, R7, R8 and R9 are each independently hydrogen, C1-C2 alkyl, C1-C2 alkoxy, C1-C2 alkylthio, or halogen.

[0028] In another preferred embodiment, R5, R6, R7, R8 and R9 are each independently hydrogen, methyl, methoxy, ethoxy, methylthio, ethylthio or halogen.

[0029] In another preferred embodiment, the indolyl group is

[0030] In another preferred embodiment, the methyl-substituted indolyl is a monomethyl-substituted indolyl.

[0031] In another preferred embodiment, the methyl-substituted indolyl group is

[0032] In another preferred embodiment, the methyl-substituted pyrrolopyridinyl group is a monomethyl-substituted pyrrolopyridinyl group.

[0033] In another preferred embodiment, the pyrrolopyridinyl group is pyrrolo[3,2-b]pyridinyl group.

[0034] In another preferred embodiment, the pyrrolopyridinyl group is 1H-pyrrolo[3,2-b]pyridinyl group.

[0035] In another preferred embodiment, the methyl-substituted pyrrolopyridinyl group is

[0036] In another preferred embodiment, the tetrahydropyridinyl group is 1,2,3,6-tetrahydropyridinyl group.

[0037] In another preferred embodiment, pentyl ester-tetrahydropyridinyl- is

[0038] In another preferred embodiment, the thienyl group is

[0039] In another preferred embodiment, the furyl group is

[0040] In another preferred embodiment, the tetrahydropyranyl group is

[0041] In another preferred embodiment, the propyl group is n-propyl group or isopropyl group.

[0042] In another preferred embodiment, the butyl group is

[0043] In another preferred embodiment, the pentyl group is

[0044] In another preferred embodiment, the octyl group is n-octyl group.

[0045] In another preferred embodiment, the octyl group is

[0046] In another preferred embodiment, the halomethyl group is a monohalomethyl group.

[0047] In another preferred embodiment, the halomethyl group is monoiodomethyl group.

[0048] In another preferred embodiment, the halomethyl group is

[0049] In another preferred embodiment, the halopropyl group is a monohalopropyl group.

[0050] In another preferred embodiment, the halopropyl group is a monobromopropyl group.

[0051] In another preferred embodiment, the halopropyl group is

[0052] In another preferred embodiment, the halobutyl group is a monohalobutyl group.

[0053] In another preferred embodiment, the halobutyl group is monobromobutyl group.

[0054] In another preferred embodiment, the halobutyl group is

[0055] In another preferred embodiment, vinyl-methyl- is

[0056] In another preferred embodiment, butenyl-methyl- is

[0057] In another preferred embodiment, the cyclopentyl group is

[0058] In another preferred embodiment, pyridyl-methyl- is

[0059] In another preferred embodiment, the propyl group is

[0060] In another preferred embodiment, propenyl-methyl- is

[0061] In another preferred embodiment, the halogen is fluorine, chlorine, bromine, or iodine.

[0062] In another preferred embodiment, halo is fluoro, chloro, bromo, or iodo.

[0063] In another preferred embodiment, the halogenated group is monohalogenated, dihalogenated or perhalogenated.

[0064] In another preferred embodiment, halogen means that one or more (preferably 1, 2 or 3) hydrogen atoms on the group are independently substituted by halogen.

[0065] In another preferred embodiment, the compound of formula I, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, or its deuterated compound has a structure as shown in formula I-1:

[0066] wherein R1, R2, R3 and R4 are each independently as defined above;

[0067] X - It is an anionic salt root.

[0068] In another preferred embodiment, X - It is an anionic acid radical.

[0069] In another preferred embodiment, the pharmaceutically acceptable salt of the compound of formula I includes a salt formed by the compound of formula I and an acid.

[0070] In another preferred embodiment, the salt radical of the pharmaceutically acceptable salt of the compound of formula I includes the acid losing one H + Salt roots formed.

[0071] In another preferred embodiment, the acid includes one or more of hydrochloric acid, mucic acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, phenylmethanesulfonic acid, benzenesulfonic acid, trifluoromethanesulfonic acid, aspartic acid and glutamic acid.

[0072] In another preferred embodiment, the pharmaceutically acceptable salt of the compound of formula I includes F - 、Cl - Br - , I - HCOO - 、CH3COO - 、 SO4 2- 、NO3 - or

[0073] In another preferred embodiment, X - Loss of one H to acid + Salt roots formed.

[0074] In another preferred embodiment, X - F - 、Cl - Br - , I - HCOO - 、CH3COO - 、 SO4 2- 、NO3 - or

[0075] In another preferred embodiment, the compound of formula I, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, or its deuterated compound is:

[0076] In another preferred embodiment, the tumor is a human tumor.

[0077] In another preferred embodiment, the tumor includes tumors with low expression, no expression, low activity or no activity of mitochondrial membrane permeability transition pore.

[0078] In another preferred embodiment, the tumor includes a tumor with low expression, no expression, low activity or no activity of peptidylprolyl isomerase F.

[0079] In another preferred embodiment, the protein number of peptidyl prolyl isomerase F is UniProtKB / Swiss-Prot: P30405, and the gene number is NCBI Entrez Gene: 10105.

[0080] In another preferred example, the low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore refers to the ratio of the expression level or activity level H1 of the mitochondrial membrane permeability transition pore of a certain cell (such as a tumor cell) to the expression level or activity level H0 of the mitochondrial membrane permeability transition pore in the same type of cells or normal cells (H1 / H0) <1.0, preferably ≤0.8, more preferably ≤0.7, more preferably ≤0.6, more preferably ≤0.5, more preferably ≤0.4, more preferably ≤0.3, more preferably ≤0.2, more preferably ≤0.1, more preferably ≤0.05, more preferably ≤0.01, more preferably ≤0.005, more preferably ≤0.001, more preferably ≤0.0001, more preferably ≤0.000001, more preferably ≤0.0000001.

[0081] In another preferred embodiment, the same type of cells include cells with normal expression, high expression, normal activity or high activity of the mitochondrial membrane permeability transition pore (such as the same type of tumor cells).

[0082] In another preferred embodiment, the normal cells include normal tissue cells (such as tumor cell origin cells, tumor adjacent cells or adjacent tissue cells) with normal expression or normal activity of mitochondrial membrane permeability transition pore.

[0083] In another preferred embodiment, the low expression, no expression, low activity or no activity of peptidyl prolyl isomerase F refers to the ratio of the expression level or activity level C1 of peptidyl prolyl isomerase F in a certain cell (such as a tumor cell) to the expression level or activity level C0 of peptidyl prolyl isomerase F in the same type of cells or normal cells (C1 / C0) <1.0, preferably ≤0.8, more preferably ≤0.7, more preferably ≤0.6, more preferably ≤0.5, more preferably ≤0.4, more preferably ≤0.3, more preferably ≤0.2, more preferably ≤0.1, more preferably ≤0.05, more preferably ≤0.01, more preferably ≤0.005, more preferably ≤0.001, more preferably ≤0.0001, more preferably ≤0.000001, more preferably ≤0.0000001.

[0084] In another preferred embodiment, the same type of cells include the same type of tumor cells.

[0085] In another preferred embodiment, the cells of the same type include cells with normal expression, high expression, normal activity or high activity of peptidylprolyl isomerase F (such as tumor cells of the same type).

[0086] In another preferred embodiment, the normal cells include normal tissue cells (such as tumor cell origin cells, tumor adjacent cells or adjacent tissue cells) in which peptidylprolyl isomerase F is normally expressed or normally active.

[0087] In another preferred embodiment, the tumor includes a tumor in which the NNMT gene is lowly expressed or not expressed.

[0088] In another preferred embodiment, the tumor includes a tumor with high expression of DNA methylase.

[0089] In another preferred embodiment, the DNA methylase is selected from the group consisting of DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0090] In another preferred embodiment, the tumor includes a tumor with high expression of DNMT1.

[0091] In another preferred embodiment, the tumor includes a tumor with high expression of DNMT3a.

[0092] In another preferred embodiment, the tumor includes a tumor with high expression of DNMT3b.

[0093] In another preferred embodiment, the tumor includes a tumor with high expression of UHRF1.

[0094] In another preferred embodiment, the tumor includes a tumor with a high methylation level of the NNMT gene nucleotide site.

[0095] In another preferred embodiment, the methylation of the NNMT gene nucleotide site includes methylation of the cytosine nucleotide site of the NNMT gene.

[0096] In another preferred embodiment, the tumor includes a tumor with a high methylation level of DNA CpG sites in the NNMT gene region.

[0097] In another preferred embodiment, the methylation of the DNA CpG site in the NNMT gene region includes methylation of the cytosine nucleotide site in the DNA CpG site in the NNMT gene region.

[0098] In another preferred embodiment, the NNMT gene is a human NNMT gene.

[0099] In another preferred example, the tumor with low or no NNMT gene expression means that no NNMT protein can be detected by NNMT antibody in 1 μg of protein extracted from the tumor, more preferably, no NNMT protein can be detected by NNMT antibody in 5 μg of protein extracted from the tumor, more preferably, no NNMT protein can be detected by NNMT antibody in 10 μg of protein extracted from the tumor, more preferably, no NNMT protein can be detected by NNMT antibody in 100 μg of protein extracted from the tumor, and more preferably, no NNMT protein can be detected by NNMT antibody in 1000 μg of protein extracted from the tumor.

[0100] In another preferred embodiment, the tumor with low or no NNMT gene expression refers to a tumor cell in which the expression level of the NNMT gene is lower than the expression level of the NNMT gene in the same type of cells or normal cells.

[0101] In another preferred embodiment, the low expression or non-expression of the NNMT gene refers to the ratio (E1 / E0) of the expression E1 of the NNMT gene in a certain cell (such as a tumor cell) to the expression E0 of the NNMT gene in the same type of cells or normal cells is <1.0, preferably ≤0.7, more preferably ≤0.6, more preferably ≤0.5, more preferably ≤0.4, more preferably ≤0.3, more preferably ≤0.2, more preferably ≤0.1, more preferably ≤0.05, more preferably ≤0.01, more preferably ≤0.005, more preferably ≤0.001, more preferably ≤0.0001, more preferably ≤0.00001, more preferably ≤0.000001, more preferably ≤0.0000001.

[0102] In another preferred embodiment, the same type of cells include the same type of tumor cells.

[0103] In another preferred embodiment, the same type of cells include cells with normal or high expression of the NNMT gene (such as the same type of tumor cells).

[0104] In another preferred embodiment, the cells of the same type include cells of the same type but with normal or high expression of the NNMT gene.

[0105] In another preferred embodiment, the normal cells include normal tissue cells (such as tumor cell origin cells, tumor adjacent cells or adjacent tissue cells) in which the NNMT gene is normally expressed.

[0106] In another preferred embodiment, E0 is the expression level of the NNMT gene in cells with normal or high NNMT gene expression.

[0107] In another preferred example, the tumor with high expression of DNA methylase means that DNA methylase can be detected in 20 μg of protein extracted from the tumor by DNA methylase antibody detection, more preferably, DNA methylase can be detected in 5 μg of protein extracted from the tumor by DNA methylase antibody detection, more preferably, DNA methylase can be detected in 1 μg of protein extracted from the tumor by DNA methylase antibody detection, more preferably, DNA methylase can be detected in 0.2 μg of protein extracted from the tumor by DNA methylase antibody detection, more preferably, DNA methylase can be detected in 0.05 μg of protein extracted from the tumor by DNA methylase antibody detection, and more preferably, DNA methylase can be detected in 0.01 μg of protein extracted from the tumor by DNA methylase antibody detection.

[0108] In another preferred embodiment, the tumor with high expression of DNA methylase refers to a tumor cell whose expression level of DNA methylase is greater than that of DNA methylase in the same type of cells or normal cells.

[0109] In another preferred embodiment, the tumor with high expression of DNA methylase refers to a ratio (A1 / A0) of the expression level A1 of the DNA methylase in tumor cells to the expression level A0 of the DNA methylase in the same type of cells or normal cells>1.0, preferably ≥1.2, preferably ≥1.5, more preferably ≥2, more preferably ≥3, more preferably ≥5, more preferably ≥8, more preferably ≥10, more preferably ≥15, more preferably ≥20, more preferably ≥30, more preferably ≥50, for example 2-50.

[0110] In another preferred embodiment, the same type of cells include the same type of tumor cells.

[0111] In another preferred embodiment, the cells of the same type include cells with normal or low expression of DNA methylase (such as the same type of tumor cells).

[0112] In another preferred embodiment, the normal cells include normal tissue cells (such as tumor cell-origin cells, tumor-adjacent cells or adjacent tissue cells) in which DNA methylase is normally expressed.

[0113] In another preferred embodiment, A0 is the expression level of DNA methylase in cells with normal or low expression of DNA methylase.

[0114] In another preferred embodiment, the tumor with high expression of UHRF1 refers to a ratio (F1 / F0) of the expression level F1 of UHRF1 in tumor cells to the expression level F0 of UHRF1 in the same type of cells or normal cells>1.0, preferably ≥1.2, preferably ≥1.5, more preferably ≥2, more preferably ≥3, more preferably ≥5, more preferably ≥8, more preferably ≥10, more preferably ≥15, more preferably ≥20, more preferably ≥30, more preferably ≥50, for example 2-50.

[0115] In another preferred embodiment, the same type of cells include the same type of tumor cells.

[0116] In another preferred embodiment, the same type of cells include cells with normal or low expression of UHRF1 (such as the same type of tumor cells).

[0117] In another preferred embodiment, the normal cells include normal tissue cells (such as tumor cell-origin cells, tumor-adjacent cells or paracancerous tissue cells) in which UHRF1 is normally expressed.

[0118] In another preferred embodiment, the high methylation level of the NNMT gene nucleotide site means that the methylation level of the NNMT gene nucleotide site of a certain cell (such as a tumor cell) is greater than the methylation level of the NNMT gene nucleotide site in the same type of cells or normal cells.

[0119] In another preferred example, the high methylation level of the NNMT gene nucleotide site refers to the ratio (L1 / L0) of the NNMT gene nucleotide site methylation level L1 of a certain cell (such as a tumor cell) to the NNMT gene nucleotide site methylation level L0 in the same type of cells or normal cells is >1.0, preferably ≥1.2, preferably ≥1.5, more preferably ≥2, more preferably ≥3, more preferably ≥5, more preferably ≥8, more preferably ≥10, more preferably ≥15, more preferably ≥20, more preferably ≥30, more preferably ≥50, for example 2-50.

[0120] In another preferred example, the high methylation level of the NNMT gene nucleotide site means that the methylation level of the NNMT gene nucleotide site of a certain cell (such as a tumor cell) is ≥1%, preferably ≥3%, preferably ≥5%, preferably ≥10%, preferably ≥15%, preferably ≥20%, more preferably ≥25%, more preferably ≥30%, more preferably ≥40%, and more preferably ≥50%.

[0121] In another preferred embodiment, the same type of cells include the same type of tumor cells.

[0122] In another preferred embodiment, the same type of cells include cells whose NNMT gene nucleotide site methylation level is normal or low (such as the same type of tumor cells).

[0123] In another preferred embodiment, the same type of cells include cells of the same type but with normal or low methylation levels of NNMT gene nucleotide sites.

[0124] In another preferred embodiment, the normal cells include normal tissue cells (such as tumor cell origin cells, tumor adjacent cells or adjacent tissue cells) whose NNMT gene nucleotide site methylation level is normal.

[0125] In another preferred embodiment, L0 is the methylation level of the NNMT gene nucleotide site in cells whose methylation level of the NNMT gene nucleotide site is normal or low.

[0126] In another preferred example, the high methylation level of the NNMT gene nucleotide site means that the methylation level (M%) of the NNMT gene nucleotide site of a certain cell (such as a tumor cell) is ≥3% and less than or equal to M1%, where M1 is any positive integer between 3-100.

[0127] In another preferred embodiment, M1 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95 or 100.

[0128] In another preferred embodiment, the methylation level of the NNMT gene nucleotide site refers to the ratio of the number of methylated nucleotides in the NNMT gene region to the number of all nucleotides in the NNMT gene region.

[0129] In another preferred embodiment, the NNMT gene nucleotide site methylation level includes the NNMT gene promoter region nucleotide site methylation level.

[0130] In another preferred embodiment, the nucleotide sequence of the NNMT gene promoter region is shown in SEQ ID NO: 1.

[0131] In another preferred example, the NNMT gene nucleotide site methylation level includes the nucleotide site methylation level in the region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene.

[0132] In another preferred embodiment, the 1050 bp before the transcription start site of the NNMT gene to the 499 bp after the transcription start site is positions 951-2500 of the nucleotide sequence shown in SEQ ID NO: 1.

[0133] In another preferred example, the methylation level of the NNMT gene nucleotide sites includes the methylation level of the nucleotide sites in the region from 1050 bp before the transcription start site to 193 bp before the transcription start site of the NNMT gene.

[0134] In another preferred embodiment, the region from 1050 bp before the transcription start site to 193 bp before the transcription start site of the NNMT gene is positions 951-1808 of the nucleotide sequence shown in SEQ ID NO: 1.

[0135] In another preferred example, the NNMT gene nucleotide site methylation level includes the nucleotide site methylation level in the region from 840 bp before the transcription start site to 469 bp before the transcription start site of the NNMT gene.

[0136] In another preferred embodiment, the region from 840 bp before the transcription start site to 469 bp before the transcription start site of the NNMT gene is positions 1161-1532 of the nucleotide sequence shown in SEQ ID NO: 1.

[0137] In another preferred example, the NNMT gene nucleotide site methylation level includes the nucleotide site methylation level in the region between any two sites at positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050 and 114166066 on human chromosome 11 (including the two sites themselves).

[0138] In another preferred example, the nucleotide site methylation level of the NNMT gene includes the nucleotide methylation level of a site selected from the following group: human chromosome 11 position 114165695, human chromosome 11 position 114165730, human chromosome 11 position 114165769, human chromosome 11 position 114165804, human chromosome 11 position 114165938, human chromosome 11 position 114166050, human chromosome 11 position 114166066, or a combination thereof.

[0139] In another preferred example, the NNMT gene nucleotide site methylation level includes the nucleotide site methylation level in the region between any two sites among positions 1161, 1196, 1235, 1270, 1404, 1516 and 1532 of the nucleotide sequence of SEQ ID NO: 1 (including these two sites themselves).

[0140] In another preferred example, the methylation level of the NNMT gene nucleotide site includes the methylation level of the nucleotides selected from the following group of SEQ ID NO:1 sequence sites: position 1161, position 1196, position 1235, position 1270, position 1404, position 1516, position 1532, or a combination thereof.

[0141] In another preferred embodiment, the high methylation level of DNA CpG sites in the NNMT gene region means that the methylation level of DNA CpG sites in the NNMT gene region of a certain cell (such as a tumor cell) is greater than the methylation level of DNA CpG sites in the NNMT gene region in the same type of cells or normal cells.

[0142] In another preferred example, the high methylation level of DNA CpG sites in the NNMT gene region refers to the ratio (G1 / G0) of the methylation level G1 of the DNA CpG sites in the NNMT gene region of a certain cell (such as a tumor cell) to the methylation level G0 of the DNA CpG sites in the NNMT gene region in the same type of cells or normal cells is >1.0, preferably ≥1.2, preferably ≥1.5, more preferably ≥2, more preferably ≥3, more preferably ≥5, more preferably ≥8, more preferably ≥10, more preferably ≥15, more preferably ≥20, more preferably ≥30, more preferably ≥50, for example 2-50.

[0143] In another preferred example, the high methylation level of DNA CpG sites in the NNMT gene region means that the methylation level of DNA CpG sites in the NNMT gene region of a cell (such as a tumor cell) is ≥1%, preferably ≥3%, preferably ≥5%, preferably ≥10%, preferably ≥15%, preferably ≥20%, more preferably ≥25%, more preferably ≥30%, more preferably ≥40%, and more preferably ≥50%.

[0144] In another preferred embodiment, the same type of cells include the same type of tumor cells.

[0145] In another preferred embodiment, the same type of cells include cells whose DNA CpG site methylation level in the NNMT gene region is normal or low (such as the same type of tumor cells).

[0146] In another preferred embodiment, the same type of cells include cells of the same type but with a normal or low methylation level at the DNA CpG site in the NNMT gene region.

[0147] In another preferred embodiment, the normal cells include normal tissue cells (such as tumor cell origin cells, tumor adjacent cells or adjacent tissue cells) with normal methylation levels of DNA CpG sites in the NNMT gene region.

[0148] In another preferred embodiment, G0 is the methylation level of the DNA CpG sites in the NNMT gene region of cells whose DNA CpG sites methylation level is normal or low.

[0149] In another preferred example, the high methylation level of the DNA CpG site in the NNMT gene region means that the methylation level (M%) of the DNA CpG site in the NNMT gene region of a cell (such as a tumor cell) is ≥3% and less than or equal to M2%, where M2 is any positive integer between 3-100.

[0150] In another preferred embodiment, M2 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95 or 100.

[0151] In another preferred embodiment, the methylation level of DNA CpG sites in the NNMT gene region refers to the ratio of the number of methylated CpG nucleotides in the NNMT gene region to the number of all nucleotides in the NNMT gene region.

[0152] In another preferred embodiment, the methylation level of DNA CpG sites in the NNMT gene region refers to the ratio of the number of methylated CpG nucleotides in the NNMT gene region to the number of all CpG nucleotides in the NNMT gene region.

[0153] In another preferred embodiment, the methylation level of the CpG sites in the NNMT gene region DNA refers to the ratio of the number of methylated CpG sites in the NNMT gene region DNA to the total number of CpG sites in the NNMT gene region DNA.

[0154] In another preferred embodiment, the methylation level of the CpG sites in the NNMT gene region DNA refers to the ratio of the number of methylated CpG nucleotides in the NNMT gene region DNA to the total number of CpG nucleotides in the NNMT gene region DNA.

[0155] In another preferred embodiment, the methylation level of DNA CpG sites in the NNMT gene region includes the methylation level of DNA CpG sites in the promoter region of the NNMT gene.

[0156] In another preferred embodiment, the nucleotide sequence of the NNMT gene promoter region is shown in SEQ ID NO: 1.

[0157] In another preferred example, the methylation level of DNA CpG sites in the NNMT gene region includes the methylation level of DNA CpG sites in the region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene.

[0158] In another preferred embodiment, the 1050 bp before the transcription start site of the NNMT gene to the 499 bp after the transcription start site is positions 951-2500 of the nucleotide sequence shown in SEQ ID NO: 1.

[0159] In another preferred example, the methylation level of DNA CpG sites in the NNMT gene region includes the methylation level of DNA CpG sites in the region from 1050 bp before the transcription start site to 193 bp before the transcription start site of the NNMT gene.

[0160] In another preferred embodiment, the region from 1050 bp before the transcription start site to 193 bp before the transcription start site of the NNMT gene is positions 951-1808 of the nucleotide sequence shown in SEQ ID NO: 1.

[0161] In another preferred example, the methylation level of DNA CpG sites in the NNMT gene region includes the methylation level of DNA CpG sites in the region from 840 bp before the transcription start site to 469 bp before the transcription start site of the NNMT gene.

[0162] In another preferred embodiment, the region from 840 bp before the transcription start site to 469 bp before the transcription start site of the NNMT gene is positions 1161-1532 of the nucleotide sequence shown in SEQ ID NO: 1.

[0163] In another preferred example, the methylation level of the DNA CpG site in the NNMT gene region includes the methylation level of the DNA CpG site in the region between any two sites at positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050 and 114166066 on human chromosome 11 (including the two sites themselves).

[0164] In another preferred example, the methylation level of the DNA CpG site in the NNMT gene region includes the methylation level of a site selected from the following group: human chromosome 11 position 114165695, human chromosome 11 position 114165730, human chromosome 11 position 114165769, human chromosome 11 position 114165804, human chromosome 11 position 114165938, human chromosome 11 position 114166050, human chromosome 11 position 114166066, or a combination thereof.

[0165] In another preferred example, the methylation level of the DNA CpG site in the NNMT gene region includes the methylation level of the DNA CpG site in the region between any two sites at positions 1161, 1196, 1235, 1270, 1404, 1516 and 1532 of the nucleotide sequence site of SEQ ID NO:1 (including these two sites themselves).

[0166] In another preferred example, the methylation level of the DNA CpG site in the NNMT gene region includes the methylation level of the SEQ ID NO:1 sequence site selected from the following group: position 1161, position 1196, position 1235, position 1270, position 1404, position 1516, position 1532, or a combination thereof.

[0167] In another preferred embodiment, the tumor is selected from the group consisting of lung cancer, kidney cancer, breast cancer, intestinal cancer, lymphoma, leukemia, pancreatic cancer, brain tumor, liver cancer, prostate cancer, or a combination thereof.

[0168] In another preferred embodiment, the lung cancer is selected from the group consisting of non-small cell lung cancer, small cell lung cancer, or a combination thereof.

[0169] In another preferred embodiment, the lung cancer cells include NCI-H82 cells.

[0170] In another preferred embodiment, the intestinal cancer is selected from the group consisting of colon cancer, rectal cancer, colorectal cancer, or a combination thereof.

[0171] In another preferred embodiment, the intestinal cancer includes intestinal gland tumors.

[0172] In another preferred example, the colon cancer cells include SW48 cells.

[0173] In another preferred embodiment, the breast cancer cells include MDA-MB-453 cells.

[0174] In another preferred embodiment, the breast cancer includes triple-negative breast cancer.

[0175] In another preferred embodiment, the lymphoma is selected from the group consisting of B lymphoma, cutaneous T-cell lymphoma, or a combination thereof.

[0176] In another preferred embodiment, the brain tumor is selected from the group consisting of glioma, glioblastoma, glioma, medulloblastoma, neuroblastoma, or a combination thereof.

[0177] In another preferred embodiment, the brain tumor cells include one or more of Daoy cells, GB-1 cells and SF126 cells.

[0178] In another preferred embodiment, the renal cancer is selected from the group consisting of clear cell renal adenocarcinoma, Wilms' renal carcinoma, or a combination thereof.

[0179] In another preferred embodiment, the renal cancer cells include one or more of G-401 cells and 786-O cells.

[0180] In another preferred embodiment, the pancreatic cancer includes pancreatic ductal carcinoma.

[0181] In another preferred embodiment, the leukemia is selected from the group consisting of T lymphocytic leukemia, myeloid leukemia, or a combination thereof.

[0182] In another preferred embodiment, the level includes protein level and / or mRNA level.

[0183] In another preferred embodiment, the expression includes protein expression and / or mRNA expression.

[0184] In another preferred embodiment, the composition or preparation is a pharmaceutical composition or pharmaceutical preparation.

[0185] In another preferred embodiment, the composition or preparation further comprises a pharmaceutically acceptable carrier.

[0186] In another preferred embodiment, the composition or preparation is in the form of a solid preparation, a liquid preparation or a semisolid preparation.

[0187] In another preferred embodiment, the composition or preparation is in the form of an oral preparation, an external preparation or an injection preparation.

[0188] In a second aspect, the present invention provides a marker for determining whether a tumor patient is suitable for the use of the compound of formula I as described in the first aspect of the present invention, or its optical isomers, or its racemates, or its pharmaceutically acceptable salts, or its deuterated compounds for the prevention and / or treatment of tumors, wherein the marker includes mitochondrial membrane permeability transition pore, peptidyl prolyl isomerase F, NNMT gene, DNA methylase, UHRF1, NNMT gene nucleotide site methylation, and / or NNMT gene region DNA CpG site methylation.

[0189] In another preferred embodiment, the markers include mitochondrial membrane permeability transition pore expression level or activity, peptidyl prolyl isomerase F expression level or activity, NNMT gene expression level, DNA methylase expression level, UHRF1 expression level, NNMT gene nucleotide site methylation level, and / or NNMT gene region DNA CpG site methylation level.

[0190] In another preferred embodiment, when the tumor cells of a tumor patient have low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidyl prolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methylase, high expression of UHRF1, high methylation level of the NNMT gene nucleotide site, and / or high methylation level of the DNA CpG site in the NNMT gene region, then the tumor patient is suitable for prevention and / or treatment with the compound of formula I described in the first aspect of the present invention, or an optical isomer thereof, or a racemate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0191] In a third aspect, the present invention provides a use of a detection kit for preparing a companion diagnostic kit for determining whether a tumor patient is suitable for prevention and / or treatment with the compound of formula I described in the first aspect of the present invention, or an optical isomer, racemate, pharmaceutically acceptable salt, or deuterated compound thereof;

[0192] The detection kit comprises:

[0193] (i) Detection reagents for detecting the expression level or activity of mitochondrial membrane permeability transition pore, the expression level or activity of peptidyl prolyl isomerase F, the expression level of NNMT gene, the expression level of DNA methylase, the expression level of UHRF1, the methylation level of NNMT gene nucleotide sites, and / or the methylation level of DNA CpG sites in the NNMT gene region.

[0194] In another preferred embodiment, the detection sample of the detection kit includes tumor cells.

[0195] In another preferred embodiment, the level includes protein level and / or mRNA level.

[0196] In another preferred embodiment, the expression includes expression of mRNA and / or protein.

[0197] In another preferred embodiment, the companion diagnostic kit further comprises an instruction manual or label, wherein the instruction manual or label states:

[0198] When the tumor cells of a tumor patient have low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidyl prolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methylase, high expression of UHRF1, high methylation level of the NNMT gene nucleotide site, and / or high methylation level of the DNA CpG site in the NNMT gene region, then the tumor patient is suitable for prevention and / or treatment with the compound of formula I described in the first aspect of the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, or its deuterated compound.

[0199] A fourth aspect of the present invention provides a medicine box, comprising:

[0200] (i) a detection reagent for detecting the expression level or activity of mitochondrial membrane permeability transition pore, the expression level or activity of peptidyl prolyl isomerase F, the expression level of NNMT gene, the expression level of DNA methylase, the expression level of UHRF1, the methylation level of NNMT gene nucleotide sites, and / or the methylation level of DNA CpG sites in the NNMT gene region; and

[0201] (ii) the compound of formula I according to the first aspect of the present invention, or an optical isomer, a racemate, a pharmaceutically acceptable salt, or a deuterated compound thereof.

[0202] In a fifth aspect, the present invention provides a method for preventing and / or treating tumors, which comprises administering to a subject in need thereof a compound of formula I as described in the first aspect of the present invention, or an optical isomer thereof, or a racemate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, thereby preventing and / or treating tumors.

[0203] In another preferred embodiment, the tumor is as described in the first aspect of the present invention.

[0204] In another preferred embodiment, the subject is a human or non-human mammal (rodent, rabbit, monkey, livestock, dog, cat, etc.).

[0205] In a sixth aspect, the present invention provides a compound of formula I, or an optical isomer thereof, or a racemate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof;

[0206] In another preferred embodiment, R1, R2, R3 and R4 are each independently as described in the first aspect of the present invention.

[0207] In another preferred embodiment, the compound of formula I, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, or its deuterated compound is as described in the first aspect of the present invention.

[0208] In another preferred embodiment, R1, R2, R3 and R4 are each independently phenyl, methoxy-substituted phenyl, indolyl, methyl-substituted indolyl, pyrrolopyridinyl, methyl-substituted pyrrolopyridinyl, pentyl-tetrahydropyridinyl-, methyl, ethyl, propyl, butyl, pentyl, or hexyl.

[0209] In another preferred embodiment, the methoxy-substituted phenyl group is a monomethoxy-substituted phenyl group.

[0210] In another preferred embodiment, the methoxy-substituted phenyl group is

[0211] In another preferred embodiment, the indolyl group is

[0212] In another preferred embodiment, the methyl-substituted indolyl is a monomethyl-substituted indolyl.

[0213] In another preferred embodiment, the methyl-substituted indolyl group is

[0214] In another preferred embodiment, the methyl-substituted pyrrolopyridinyl group is a monomethyl-substituted pyrrolopyridinyl group.

[0215] In another preferred embodiment, the pyrrolopyridinyl group is pyrrolo[3,2-b]pyridinyl group.

[0216] In another preferred embodiment, the pyrrolopyridinyl group is 1H-pyrrolo[3,2-b]pyridinyl group.

[0217] In another preferred embodiment, the methyl-substituted pyrrolopyridinyl group is

[0218] In another preferred embodiment, the tetrahydropyridinyl group is 1,2,3,6-tetrahydropyridinyl group.

[0219] In another preferred embodiment, pentyl ester-tetrahydropyridinyl- is

[0220] In another preferred embodiment, the compound of formula I, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, or its deuterated compound is:

[0221] The seventh aspect of the present invention provides a composition comprising (a) a compound of formula I as described in the sixth aspect of the present invention, or an optical isomer thereof, or a racemate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0222] In another preferred embodiment, the content of (a) the compound of formula I as described in the ninth aspect of the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, or its deuterated compound is 0.001-99.9 wt%, based on the weight of the composition.

[0223] In another preferred embodiment, the composition is a pharmaceutical composition.

[0224] In another preferred embodiment, the composition further comprises a pharmaceutically acceptable carrier.

[0225] In another preferred embodiment, the dosage form of the composition is a solid preparation, a liquid preparation or a semisolid preparation.

[0226] In another preferred embodiment, the composition is in the form of an oral preparation, an external preparation or an injection preparation.

[0227] Within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0228] Figure 1 shows the expression level of PPIF protein determined by western blot, wherein Con shRNA represents the expression level of PPIF protein in Daoy cells transfected with an empty viral vector that does not carry shRNA that specifically induces the degradation of PPIF mRNA, and PPIF shRNA represents the expression level of PPIF protein in Daoy cells transfected with a viral vector that carries shRNA that specifically induces the degradation of PPIF mRNA.

[0229] Figure 2 shows the relative cell viability of Daoy cells with inactive mPTP and Daoy cells with active mPTP, where Con shRNA is the relative viability of Daoy cells transfected with an empty viral vector that does not carry shRNA that specifically induces degradation of PPIF mRNA (i.e., Daoy cells with active mPTP), and PPIF shRNA is the relative viability of Daoy cells transfected with a viral vector that carries shRNA that specifically induces degradation of PPIF mRNA (Daoy cells with inactive mPTP).

[0230] Figure 3 shows the expression levels of NNMT proteins in Con-NCI-H82 cells and ov-NNMT NCI-H82 cells detected by western blot. Con-NCI-H82 is the expression level of NNMT proteins in NCI-H82 cells transfected with an empty viral vector that does not carry the NNMT gene, serving as a control; ov-NNMT NCI-H82 is the expression level of NNMT proteins in NCI-H82 cells transfected with a viral vector that carries the NNMT gene.

[0231] Figure 4 shows the relative cell viability of Con-NCI-H82 cells and ov-NNMT NCI-H82 cells, where Con-NCI-H82 is the cell viability of NCI-H82 cells transfected with an empty viral vector that does not carry the NNMT gene, serving as a control; ov-NNMT NCI-H82 is the cell viability of NCI-H82 cells transfected with a viral vector that carries the NNMT gene.

[0232] FIG5 shows the NNMT gene expression in tumor cells that are sensitive and insensitive to the compounds of the examples of the present invention.

[0233] FIG6 shows the methylation levels of DNA CpG sites in the promoter region of the NNMT gene in tumor cells that are sensitive and insensitive to the compounds of the present invention.

[0234] FIG7 shows the methylation levels of DNA CpG sites in the region between 1050 bp before the transcription start site and 499 bp after the transcription start site in tumor cells that are sensitive and insensitive to the compounds of the present invention.

[0235] FIG8 shows the methylation levels of DNA CpG sites in the region between 1050 bp before the transcription start site and 193 bp before the transcription start site of the NNMT gene in tumor cells that are sensitive and insensitive to the compounds of the present invention.

[0236] Figure 9 shows the methylation status of DNA CpG sites in the specific NNMT gene region of tumor cells that are sensitive and insensitive to the compounds of the embodiments of the present invention, namely, sites 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 on human chromosome 11. Black dots indicate that the relevant sites are methylated, and white dots indicate that the relevant sites are not methylated. SST refers to the transcription start site, and Chr11 refers to human chromosome 11 defined according to the human genome version GCF_000001405.25 (GRCh37.p13).

[0237] FIG10 shows the correlation between the expression of NNMT and the expression of DNMT1, UHRF1, DNMT3a, and DNMT3b in tumor cells. DETAILED DESCRIPTION

[0238] After long and in-depth research, the inventors unexpectedly discovered for the first time that the compounds described in the present invention have excellent precision therapeutic effects on tumor cells with low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidylprolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation levels of NNMT gene nucleotide sites, and / or high methylation levels of DNA CpG sites in the NNMT gene region. On this basis, the inventors completed the present invention.

[0239] the term

[0240] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0241] As used herein, the terms "include," "comprise," and "contain" are used interchangeably to encompass not only open definitions but also semi-closed and closed definitions. In other words, the terms encompass "consisting of," "consisting essentially of."

[0242] As used herein, the terms "cancer," "cancer," "tumor," and "neoplasm" are used interchangeably.

[0243] As used herein, the term "a cell" refers to a cell (such as a single cancer cell) or a group of cells comprising a plurality of similar cells (such as a tumor tissue).

[0244] As used herein, "a tumor patient is suitable for the compound of the present invention" includes a tumor patient whose tumor is sensitive to the compound of the present invention.

[0245] As used herein, the terms "high methylation level of DNA CpG sites", "high methylation level of DNA CpG sites" and "high methylation of DNA CpG sites" are used interchangeably.

[0246] As used herein, the terms "CpG site methylation," "CpG nucleotide methylation," and "CpG methylation" are used interchangeably.

[0247] As used herein, the term "IC50" is synonymous with "IC 50 ” are used interchangeably to refer to the 50% inhibitory concentration, which is the concentration of the inhibitor that achieves 50% inhibition.

[0248] As used herein, the term "P / S" refers to the addition of Penicillin and Streptomycin to the relevant culture medium.

[0249] As used herein, "low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidyl prolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methylase, high expression of UHRF1, high methylation level of the NNMT gene nucleotide site, and / or high methylation level of DNA CpG site in the NNMT gene region" refers to one or more of low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of the peptidyl prolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methylase, high expression of UHRF1, high methylation level of the NNMT gene nucleotide site, and high methylation level of DNA CpG site in the NNMT gene region.

[0250] As used herein, the term "mitochondrial permeability transition pore" is abbreviated as mPTP (mitochondria permeability transition pore).

[0251] As used herein, the term "peptidyl-prolyl isomerase F" is abbreviated as PPIF (Peptidyl-prolyl cis-trans isomerase F).

[0252] As used herein, the term "NNMT" is the English name of Nicotinamide N-Methyltransferase.

[0253] As used herein, the term "bp" refers to base pair.

[0254] As used herein, the term "SST" refers to a transcription start site.

[0255] As used herein, the term "Chr11" refers to human chromosome 11 as defined by the GCF_000001405.25 (GRCh37.p13) human genome version.

[0256] As used herein, "human chromosome 11" refers to human chromosome 11 as defined by the human genome version GCF_000001405.25 (GRCh37.p13).

[0257] As used herein, the terms "before the transcription start site", "after the transcription start site", "before the transcription start site", and "after the transcription start site" do not include the transcription start site itself.

[0258] As used herein, the term "human chromosome 11, position 114165695" refers to the nucleotide at position 114165695 of human chromosome 11, and so on.

[0259] As used herein, gene expression includes gene protein expression and / or gene mRNA expression, etc.

[0260] As used herein, DNA methylation is referred to in English as DNA methylation.

[0261] As used herein, the term "DNMT3a" refers to DNA methyltransferase 3a and is used interchangeably with "DNMT3A".

[0262] As used herein, the term "DNMT3b" refers to DNA methyltransferase 3b and is used interchangeably with "DNMT3B".

[0263] As used herein, the term "DNMT1" refers to DNA methyltransferase 1.

[0264] As used herein, the term "UHRF1" refers to ubiquitin-like PHD and RING finger domain-containing protein 1.

[0265] As used herein, the term "CpG" refers to a dinucleotide, which is an abbreviation for cytosine (C)-phosphate (P)-guanine (G).

[0266] As used herein, the terms "SF-126 cells" and "SF126 cells" are used interchangeably.

[0267] As used herein, the term "MS-ESI" refers to electrospray ionization mass spectrometry.

[0268] As used herein, the term “ 1 "H NMR" refers to proton nuclear magnetic resonance.

[0269] It will be appreciated that one of ordinary skill in the art can select substituents and substitution patterns on the compounds of the present invention to produce chemically stable compounds, which can be synthesized by techniques known in the art and as described below. If substituted with more than one substituent group, it will be appreciated that these multiple groups may be on the same carbon or on different carbons, as long as a stable structure results.

[0270] As used herein, the term "substituted" or "substituted" means that a hydrogen atom on a group is replaced by a non-hydrogen atom group, but the valence requirements need to be met and the substitution generates a chemically stable compound, that is, a compound that does not spontaneously undergo transformations such as cyclization, elimination, etc.

[0271] As used herein, the term "deuterated" refers to a compound or group in which one or more hydrogen atoms are replaced by deuterium. Deuterated groups may be monosubstituted, disubstituted, polysubstituted, or fully substituted.

[0272] As used herein, Indicates the attachment site of a group.

[0273] As used herein, the term "alkyl" refers to a straight-chain (i.e., unbranched) or branched saturated hydrocarbon group containing only carbon atoms and hydrogen atoms, or a combination of straight-chain and branched groups. When the number of carbon atoms in front of the alkyl group is specified (e.g., C1-C6 alkyl), it refers to the number of carbon atoms contained in the alkyl group (e.g., 1-6). For example, C1-C4 alkyl refers to an alkyl group containing 1-4 carbon atoms. Representative examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, or similar groups.

[0274] As used herein, the term "alkenyl" refers to a hydrocarbon group formed by removing a hydrogen atom connected to a double bond from a straight-chain or branched olefin molecule having one or more double bonds. When the number of carbon atoms in front of the alkenyl group is limited (such as C2-C6 alkenyl), it refers to the number of carbon atoms contained in the alkenyl group (such as 2-6). For example, C2-C4 alkenyl refers to an alkenyl group containing 2-4 carbon atoms. Representative examples include but are not limited to vinyl (CH2=CH-), butenyl (such as C(CH3)2=CH-), or similar groups.

[0275] As used herein, the term "halogen" refers to F, Cl, Br, or I.

[0276] As used herein, the term "halo" refers to a group in which one or more (preferably 1, 2 or 3) hydrogen atoms are replaced by halogen.

[0277] As used herein, the term "haloalkyl" refers to an alkyl group in which one or more (preferably 1, 2, 3, or 4) hydrogen atoms are replaced by halogen, wherein the alkyl and halogen are as defined above. When the number of carbon atoms in the haloalkyl group is specified (e.g., C1-C8 haloalkyl), the number of carbon atoms in the haloalkyl group (e.g., 1-8) is specified. For example, C1-C6 haloalkyl refers to a haloalkyl group containing 1-6 carbon atoms. Representative examples of haloalkyl groups include, but are not limited to, -CF3, -CHF2, monofluoroisopropyl, difluorobutyl, or the like.

[0278] As used herein, the term "cycloalkyl" refers to a hydrocarbon group having a saturated or partially saturated single ring, bicyclic, or polycyclic (fused, bridged, or spirocyclic) ring. When a cycloalkyl group is preceded by a carbon number specification (e.g., C3-C12), this refers to the number of ring carbon atoms in the cycloalkyl group (e.g., 3-12). For example, the term "C3-C8 cycloalkyl" refers to a saturated or partially saturated monocyclic or bicyclic alkyl group having 3-8 ring carbon atoms, including cyclopropyl, cyclobutyl, cyclopentyl, cycloheptyl, or similar groups. "Spirocycloalkyl" refers to a bicyclic or polycyclic group in which the rings share a single carbon atom (called a spiro atom). These rings may contain one or more double bonds, but none of the rings have a completely conjugated π electron system. "Fused cycloalkyl" refers to an all-carbon bicyclic or polycyclic group in which each ring shares a pair of adjacent carbon atoms with the other rings in the system. One or more of the rings may contain one or more double bonds, but none of the rings have a completely conjugated π electron system. "Bridged cycloalkyl" refers to an all-carbon polycyclic group in which any two rings share two carbon atoms that are not directly connected. These rings may contain one or more double bonds, but no ring has a completely conjugated π electron system. The following are representative examples of cycloalkyl groups, including but not limited to:

[0279] As used herein, the term "halocycloalkyl" refers to a cycloalkyl group in which one or more (preferably 1, 2, 3 or 4) hydrogen atoms are replaced by halogen, wherein the cycloalkyl group and the halogen group are as defined above. When the number of carbon atoms in the halocycloalkyl group is specified (e.g., C3-C8 halocycloalkyl), the number of carbon atoms in the halocycloalkyl group (e.g., 3-8 ring carbon atoms) is specified. For example, C3-C8 halocycloalkyl refers to a halocycloalkyl group containing 3-8 ring carbon atoms. Representative examples of halocycloalkyl groups include, but are not limited to, monofluorocyclopropyl, monochlorocyclobutyl, monofluorocyclopentyl, difluorocycloheptyl, or the like.

[0280] As used herein, the term "alkoxy" refers to an RO- group, where R is an alkyl group, and alkyl is as defined above. Alkoxy is preceded by a carbon atom number, e.g., C1-C8 alkoxy refers to an alkoxy group in which the alkyl group has 1-8 carbon atoms. Representative examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, n-propoxy, isopropoxy, tert-butoxy, and the like.

[0281] As used herein, the term "alkylthio" refers to an RS- group, where R is an alkyl group, and alkyl is as defined above. When the alkylthio group is preceded by a carbon atom number, for example, C1-C8 alkylthio means that the alkyl group in the alkylthio group has 1-8 carbon atoms. Representative examples of alkylthio groups include, but are not limited to, methylthio, ethylthio, n-propylthio, isopropylthio, tert-butylthio, or the like.

[0282] As used herein, the term "haloalkoxy" refers to a haloalkyl-O- group, where the haloalkyl group is as defined above, with the number of carbon atoms preceding the haloalkoxy group being specified. For example, a C1-C6 haloalkoxy group refers to a C1-C6 haloalkyl-O- group, i.e., a haloalkoxy group containing 1-6 carbon atoms. Representative examples of haloalkoxy groups include, but are not limited to, monofluoromethoxy, monofluoroethoxy, bisfluorobutoxy, and the like.

[0283] As used herein, the term "haloalkylthio" refers to a haloalkyl-S- group, where the haloalkyl group is as defined above, and the number of carbon atoms preceding the haloalkylthio group is specified. For example, a C1-C6 haloalkylthio group refers to a C1-C6 haloalkyl-S- group, i.e., a haloalkylthio group containing 1-6 carbon atoms. Representative examples of haloalkylthio groups include, but are not limited to, monofluoromethylthio, monofluoroethylthio, bisfluorobutylthio, and the like.

[0284] As used herein, the term "cycloalkoxy" refers to an RO- group, where R is a cycloalkyl group, and the cycloalkyl group is as defined above. When the cycloalkoxy group is preceded by a carbon atom number, for example, C3-C8 cycloalkoxy refers to a cycloalkoxy group in which the cycloalkyl group has 3-8 ring carbon atoms. Representative examples of cycloalkoxy groups include, but are not limited to, cyclopropyloxy, cyclobutyloxy, and the like.

[0285] As used herein, the term "cycloalkylthio" refers to an RS- group, where R is a cycloalkyl group, and the cycloalkyl group is as defined above. When the cycloalkylthio group is preceded by a carbon atom number, for example, C3-C8 cycloalkylthio refers to a cycloalkylthio group in which the cycloalkyl group has 3-8 ring carbon atoms. Representative examples of cycloalkylthio groups include, but are not limited to, cyclopropylthio, cyclobutylthio, and the like.

[0286] As used herein, the term "halocycloalkoxy" refers to a cycloalkoxy group in which one or more (preferably 1, 2, 3 or 4) hydrogen atoms are replaced by halogen, wherein the cycloalkoxy group and halogen are as defined above. When the number of carbon atoms in the halocycloalkoxy group is specified (e.g., C3-C8 halocycloalkoxy), the number of carbon atoms in the ring of the halocycloalkoxy group (e.g., 3-8) is specified. For example, C3-C8 halocycloalkoxy refers to a halocycloalkoxy group containing 3-8 ring carbon atoms. Representative examples of halocycloalkoxy groups include, but are not limited to, monofluorocyclopropyl-O-, monochlorocyclobutyl-O-, monofluorocyclopentyl-O-, difluorocycloheptyl-O-, or the like.

[0287] As used herein, the term "halocycloalkylthio" refers to a cycloalkylthio group in which one or more (preferably 1, 2, 3, or 4) hydrogen atoms are replaced by halogen, wherein the cycloalkylthio group and halogen are as defined above. When the number of carbon atoms in the halocycloalkylthio group is specified (e.g., C3-C8 halocycloalkylthio), it refers to the number of ring carbon atoms in the halocycloalkylthio group (e.g., 3-8). For example, C3-C8 halocycloalkylthio refers to a halocycloalkylthio group containing 3-8 ring carbon atoms. Representative examples of halocycloalkylthio include, but are not limited to, monofluorocyclopropyl-S-, monochlorocyclobutyl-S-, monofluorocyclopentyl-S-, difluorocycloheptyl-S-, or the like.

[0288] As used herein, the term "heterocycloalkyl" refers to a fully saturated or partially unsaturated cyclic (including but not limited to 3-7 membered monocyclic, 7-11 membered bicyclic, or 8-16 membered tricyclic) group, wherein at least one heteroatom is present in a ring having at least one carbon atom, and the attachment site of the group is located on the ring containing the heteroatom. When there is a number of atoms before the heterocycloalkyl group, it refers to the number of ring atoms of the heterocycloalkyl group, for example, a 3-16 membered heterocycloalkyl group refers to a heterocycloalkyl group having 3-16 ring atoms. Each heterocyclic ring containing a heteroatom may carry one or more (such as 1, 2, 3 or 4) heteroatoms, each of which is independently selected from a nitrogen atom, an oxygen atom or a sulfur atom, wherein the nitrogen atom or the sulfur atom may be oxidized, and the nitrogen atom may also be quaternized. Typical monocyclic heterocycloalkyl groups include, but are not limited to, azetidinyl, oxetanyl, tetrahydrofuranyl, piperidinyl, and piperazinyl. Polycyclic heterocycloalkyl groups include spiro, condensed and bridged heterocyclic groups; wherein the spiro, condensed and bridged heterocycloalkyl groups are optionally connected to other groups through single bonds, or further connected to other cycloalkane rings or heterocycloalkane rings through any two or more atoms on the ring.

[0289] As used herein, the term "aryl" refers to an all-carbon monocyclic or fused polycyclic (i.e., rings that share adjacent pairs of carbon atoms) group with a conjugated π electron system, and is an aromatic cyclic hydrocarbon compound group. When the number of carbon atoms in front of the aryl group is limited, it means that the aryl group has a number of ring carbon atoms, such as C6-C12 aryl, which means that the aryl group has 6-12 ring carbon atoms, such as phenyl and naphthyl.

[0290] As used herein, the term "heteroaryl" refers to an aromatic heterocyclic group having one to multiple (preferably 1, 2, 3 or 4) ring heteroatoms, wherein at least one heteroatom is present in a ring having at least one carbon atom, which can be a monocyclic (monocyclic) or a polycyclic (bicyclic, tricyclic or polycyclic) group fused together or covalently linked, and each heterocyclic ring containing a heteroatom can have one or more (e.g., 1, 2, 3, 4) heteroatoms independently selected from the group consisting of oxygen, sulfur and nitrogen. When the number of atoms in the heteroaryl group is specified, it refers to the number of ring atoms in the heteroaryl group, for example, a 5-12 membered heteroaryl group refers to a heteroaryl group having 5-12 ring atoms. Representative examples of heteroaryl groups include, but are not limited to, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, furanyl, pyridinyl, pyrimidinyl, and the like.

[0291] As used herein, the term "ester group" refers to a group having a RC(O)-O- group or a -C(O)-OR group, wherein R is an alkyl group and the alkyl group is as defined above. For example, a "C2-C4 ester group" refers to a group having a C1-C3 alkyl-C(O)-O- structure or a group having a -C(O)-O-C1-C3 alkyl structure. Representative examples of ester groups include, but are not limited to, CH3C(O)O-, C2H5C(O)O-, (CH3)2CHC(O)O-, -C(O)OCH3, -C(O)OC2H5, or the like.

[0292] As used herein, the term "amide" refers to a RC(O)-NH- group or a -C(O)-NH-R group, wherein R is an alkyl group and the alkyl group is as defined above. For example, a "C2-C4 amide" refers to a group with a C1-C3 alkyl-C(O)-NH- structure or a group with a -C(O)-NH-C1-C3 alkyl structure. Representative examples of amide groups include, but are not limited to, CH3C(O)-NH-, C2H5C(O)-NH-, (CH3)2CHC(O)-NH-, -C(O)-NH-CH3, -C(O)-NH-C2H5, or the like.

[0293] As used herein, "-C(O)-" Can be used interchangeably.

[0294] As used herein, the term "amino" by itself or as part of another substituent is -NH2.

[0295] As used herein, the term "hydroxy" by itself or as part of another substituent is -OH.

[0296] As used herein, the term "mercapto" by itself or as part of another substituent is -SH.

[0297] In the present invention, all substituents are interpreted as being unsubstituted unless explicitly described herein as "substituted". The term "substituted" refers to the fact that one or more hydrogen atoms on a group are independently replaced by a substituent. The substituents may be the substituents described above or the substituents appearing in the examples. Unless otherwise specified, an optionally substituted group may be substituted at any substitutable site on the group, and the substituents may be the same or different at each position.

[0298] In the present invention, the term "prevention" refers to a method of preventing the onset of a disease and / or its attendant symptoms or protecting a subject from acquiring a disease. As used herein, "prevention" also includes delaying the onset of a disease and / or its attendant symptoms and reducing the risk of a subject acquiring a disease.

[0299] In the present invention, the term "treatment" includes delaying and stopping the progression of the disease, or eliminating the disease, and does not require 100% inhibition, elimination and reversal. In some embodiments, compared to the levels observed in the absence of the compound of the present invention, the compound of the present invention reduces, inhibits and / or reverses the relevant disease (such as tumor) and its complications by, for example, at least about 30%, at least about 50%, or at least about 80%, at least about 90%, or 100%.

[0300] Compound

[0301] As used herein, "compounds of the present invention," "compounds described in the present invention," "compounds of formula I of the present invention," or "compounds of formula I" are used interchangeably to refer to compounds having the structure of formula I, or optical isomers thereof, or racemates thereof, or pharmaceutically acceptable salts thereof, or deuterated compounds thereof.

[0302] The structure of the compound of formula I of the present invention is as follows:

[0303] Specifically, the compound of formula I, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, or its deuterated compound according to the present invention is as described above in the first aspect of the present invention.

[0304] Representatively, the compound of formula I described in the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, or its deuterated compound such as the specific compound of the embodiments of the present invention (including its salt form or free form without the salt radical).

[0305] NNMT gene

[0306] In the present invention, the English name of NNMT is Nicotinamide N-Methyltransferase. Different databases have different identification numbers for the NNMT gene: HGNC: 7861; Entrez Gene: 4837; Ensembl: ENSG00000166741; OMIM: 600008; UniProtKB: P40261.

[0307] According to the human genome version GCF_000001405.25 (GRCh37.p13), the NNMT gene region is located on human chromosome 11 from bp 114,128,528 to bp 114,184,258, with a total length of 55,731 bp of DNA sequence, including the NNMT gene promoter region, NNMT gene exon region and NNMT gene intron region, and the NNMT gene transcription start site is at bp 114,166,535.

[0308] The NNMT gene promoter region is the nucleotide sequence from bp 114,164,535 to bp 114,167,034 on human chromosome 11, i.e., the sequence from 2000 bp before the NNMT gene transcription start site (bold portion) to the transcription start site itself and the 499 bp after it (underlined portion). The total length of the 2500 bp region is the NNMT gene promoter region. The nucleotide sequence of the NNMT gene promoter region is shown in SEQ ID NO: 1 below:

[0309] DNA methylation

[0310] DNA methylation is a form of chemical modification of DNA that can alter genetic expression without changing the DNA sequence.

[0311] Typically, DNA methylation is methylation of DNA CpG sites. In the present invention, CpG is the abbreviation for cytosine (C)-phosphate (P)-guanine (G).

[0312] In a preferred embodiment of the present invention, the DNA methylase is selected from the group consisting of DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0313] tumor

[0314] In the present invention, the terms "tumor", "cancer", "cancer" and "neoplasm" are used interchangeably.

[0315] Specifically, the tumor described in the present invention is as described above in the first aspect of the present invention.

[0316] anti-tumor drugs

[0317] In the present invention, the anti-tumor drug may be the compound of formula I described in the present invention, or an optical isomer thereof, or a racemate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0318] use

[0319] The compounds of the present invention have significantly excellent precision therapeutic effects on tumors with low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidyl prolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methylase, high expression of UHRF1, high methylation level of NNMT gene nucleotide sites, and / or high methylation level of DNA CpG sites in the NNMT gene region.

[0320] Composition

[0321] The composition or preparation of the present invention is preferably a pharmaceutical composition or preparation, and the composition or preparation of the present invention may include a pharmaceutically acceptable carrier.

[0322] As used herein, "pharmaceutically acceptable carrier" refers to one or more compatible solid, semisolid, liquid, or gel fillers suitable for human or animal use and possessing sufficient purity and sufficiently low toxicity. "Compatibility" refers to the ability of the components and active ingredients in a composition or formulation to be incorporated with each other without significantly reducing efficacy.

[0323] The main excellent technical effects of the present invention include:

[0324] The present invention unexpectedly discovered for the first time a compound that has excellent precision therapeutic effects on tumors with low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidyl prolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methylase, high expression of UHRF1, high level of methylation of NNMT gene nucleotide sites, and / or high level of methylation of DNA CpG sites in the NNMT gene region. That is, tumors with low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidyl prolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methylase, high expression of UHRF1, high level of methylation of NNMT gene nucleotide sites, and / or high level of methylation of DNA CpG sites in the NNMT gene region have high sensitivity to the compound of the present invention. Therefore, the compounds of the present invention have more excellent preventive and therapeutic effects on tumors with low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidylprolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methylase, high expression of UHRF1, high methylation level of NNMT gene nucleotide sites, and / or high methylation level of DNA CpG sites in the NNMT gene region, and have the advantages of low drug dosage and small side effects. While improving the precise preventive and therapeutic effects of the compounds of the present invention on tumors, it can reduce side effects and improve patient compliance.

[0325] It should be understood that the following specific examples are based on the present technical solution and provide detailed implementation methods and specific operating processes, but the scope of protection of the present invention is not limited to these examples.

[0326] Example

[0327] The English name of mitochondrial membrane permeability transition pore is mitochondria permeability transition pore, abbreviated as mPTP.

[0328] The English name of peptidyl prolyl isomerase F is Peptidyl-prolyl cis-trans isomerase F, abbreviated as PPIF.

[0329] The English name of NNMT gene is Nicotinamide N-Methyltransferase.

[0330] DNMT3a refers to DNA methyltransferase 3a, English name DNA methyltransferase 3a, NCBI entrez gene: 1788; Uniprotkb / Swiss-port: Q9Y6K1.

[0331] DNMT3b refers to DNA methyltransferase 3b, English name DNA methyltransferase 3b, NCBI entrez gene: 1789; Uniprotkb / Swiss-port: Q9UBC3.

[0332] DNMT1 refers to DNA methyltransferase 1, whose English name is DNA methyltransferase 1, NCBI entrez gene: 1786; Uniprotkb / Swiss-port: P26358.

[0333] UHRF1 refers to ubiquitin-like protein containing PHD and RING finger domain 1, with the English name, NCBI entrez gene: 29128; Uniprotkb / Swiss-port: Q96T88.

[0334] The 1050 bp before the transcription start site of the NNMT gene to the 499 bp after the transcription start site are positions 951 to 2500 of the nucleotide sequence shown in SEQ ID NO: 1.

[0335] The 1050 bp before the transcription start site of the NNMT gene to the 193 bp before the transcription start site are positions 951-1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0336] The 840 bp before the transcription start site of the NNMT gene to the 469 bp before the transcription start site are positions 1161-1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0337] Example 1 Compound AB36462

[0338] The synthetic route is as follows:

[0339] Compound 1 (100 mg, 0.27 mmol, 1 eq) was dissolved in dimethyl sulfoxide (2 mL) in a sealed tube, and compound 2 (56 mg, 0.27 mmol, 1 eq) and tris(dibenzylideneacetone)dipalladium (17 mg, 0.027 mmol, 0.1 eq) were added. The reaction was carried out at 120°C under nitrogen for 16 h. After cooling, the reaction solution was diluted with water and extracted with dichloromethane. The organic phase was dried over anhydrous sodium sulfate, filtered, and spun down to dryness. The crude product was then purified by reverse phase chromatography (acetonitrile / water + 0.01% formic acid) to afford compound AB36462.

[0340] MS-ESI: theoretical value [M] + :506.20; measured value [M] + :506.20.

[0341] 1 H NMR(400MHz, DMSO-d6)δ8.42(s,1H),8.23-8.20(m,1H),8.02(d,J=4.0Hz,1H),7.86-7.83(m,2H),7.69-7.82(m, 5H),7.49-7.38(m,2H),7.32-7.29(m,4H),6.84(d,J=4.0Hz,1H),6.67(d,J=4.0Hz,1H),3.92(d,J=12.0Hz,12H).

[0342] Example 2 Compound AB36590

[0343] The synthetic route is as follows:

[0344] Compound 1 (50 mg, 0.16 mmol, 1.0 eq) was dissolved in tetrahydrofuran (5 mL), and iodomethane (26 mg, 0.18 mmol, 1.1 eq) was added. The mixture was reacted at 65°C for 16 h. The reaction solution was concentrated, and the crude product was purified by flash chromatography (dichloromethane / methanol = 20 / 1) to afford compound AB36590 (55.1 mg, yield: 74.9%) as a white solid.

[0345] MS-ESI: theoretical value [M] + :316.12; measured value:316.05.

[0346] 1H NMR (400MHz, DMSO-d6) δ12.05 (s, 1H), 7.95 (d, J = 8.0Hz, 1H), 7.89-7.86 (m, 2H), 7.80-7.73 (m, 8H ),7.61-7.59(m,1H),7.42-7.37(m,1H),7.21-7.16(m,1H),6.00(s,1H),3.15(d,J=14.0Hz,3H).

[0347] Example 3 Compound AB36591

[0348] The synthetic route is as follows:

[0349] Compound 1 (50 mg, 0.16 mmol, 1.0 eq) was dissolved in tetrahydrofuran (5 mL), and iodoethane (28 mg, 0.18 mmol, 1.1 eq) was added. The mixture was reacted at 65°C for 16 h. The reaction solution was concentrated, and the crude product was purified by flash chromatography (dichloromethane / methanol = 20 / 1) to afford AB36591 (41.3 mg, yield: 54.5%) as a white solid.

[0350] MS-ESI: theoretical value [M] + :330.20; measured value:330.14.

[0351] 1 H NMR (400MHz, DMSO-d6) δ12.04 (s, 1H), 7.96 (d, J = 8.0Hz, 1H), 7.89-7.79 (m, 6H), 7.76-7.73 (m,4H),7.58(s,1H),7.46-7.37(m,2H),5.91(s,1H),3.67-3.58(m,2H),1.25-1.16(m,3H).

[0352] Example 4 Compound AB36564

[0353] The synthetic route is as follows:

[0354] Note: Boc is tert-butyloxycarbonyl.

[0355] Compound 1 (300 mg, 1.14 mmol, 1.0 eq) and compound 2 (454 mg, 1.37 mmol, 1.2 eq) were dissolved in tetrahydrofuran (5 mL), and tetrakis(triphenylphosphine)palladium (127 mg, 0.11 mmol, 0.1 eq) was added. The mixture was reacted at 65°C for 16 h. The reaction solution was diluted with water and extracted with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and filtered. The filtrate was spin-dried and the crude product was prepared using normal phase (dichloromethane / methanol = 15 / 1) to obtain compound AB36564.

[0356] MS-ESI: theoretical value [M] + :444.21; measured value:444.05.

[0357] 1 H NMR(400MHz,DMSO-d6)δ7.08-7.00(m,8H),6.96-6.91(m,5H),6.20(s,1H),4.31-4.27 (m,1H),3.93(s,1H),2.57(s,4H),1.59-1.56(m,1H),1.01-0.98(m,1H),0.54(s,9H).

[0358] Example 5 Compound AB35414

[0359] It was purchased from a commercial source and has the following structure:

[0360] Example 6 Compound AB36540

[0361] It was purchased from a commercial source and has the following structure:

[0362] Example 7 Compound AB36541

[0363] It was purchased from a commercial source and has the following structure:

[0364] Example 8 Compound AB36543

[0365] It was purchased from a commercial source and has the following structure:

[0366] Example 9 Compound AB36544

[0367] It was purchased from a commercial source and has the following structure:

[0368] Example 10 Compound AB36558

[0369] It was purchased from a commercial source and has the following structure:

[0370] Example 11 Compound AB3020-28-8

[0371] It was purchased from a commercial source and has the following structure:

[0372] Example 12 Compound AB2065-66-9

[0373] It was purchased from a commercial source and has the following structure:

[0374] Example 13 Compound AB1530-32-1

[0375] It was purchased from a commercial source and has the following structure:

[0376] Example 14 Compound AB6228-47-3

[0377] It was purchased from a commercial source and has the following structure:

[0378] Example 15 Compound AB1560-54-9

[0379] It was purchased from a commercial source and has the following structure:

[0380] Example 16 Compound AB3607-17-8

[0381] It was purchased from a commercial source and has the following structure:

[0382] Example 17 Compound AB24470-78-8

[0383] It was purchased from a commercial source and has the following structure:

[0384] Example 18 Compound AB13371-17-0

[0385] It was purchased from a commercial source and has the following structure:

[0386] Example 19 Compound AB7333-63-3

[0387] It was purchased from a commercial source and has the following structure:

[0388] Example 20 Compound AB22884-29-3

[0389] It was purchased from a commercial source and has the following structure:

[0390] Example 21 Compound AB21406-61-1

[0391] It was purchased from a commercial source and has the following structure:

[0392] Example 22 Compound AB28322-40-9

[0393] It was purchased from a commercial source and has the following structure:

[0394] Example 23 Compound AB1530-34-3

[0395] It was purchased from a commercial source and has the following structure:

[0396] Example 24 Compound AB42036-78-2

[0397] It was purchased from a commercial source and has the following structure:

[0398] Example 25 Compound AB7333-52-0

[0399] It was purchased from a commercial source and has the following structure:

[0400] Example 26 Compound AB2751-90-8

[0401] It was purchased from a commercial source and has the following structure:

[0402] Example 27 Compound AB99662-46-1

[0403] It was purchased from a commercial source and has the following structure:

[0404] Example 28 Compound AB1449-46-3

[0405] It was purchased from a commercial source and has the following structure:

[0406] Example 29 Compound AB18583-55-6

[0407] It was purchased from a commercial source and has the following structure:

[0408] Example 30 Compound AB2492-23-1

[0409] It was purchased from a commercial source and has the following structure:

[0410] Example 31 Compound AB3462-95-1

[0411] It was purchased from a commercial source and has the following structure:

[0412] Example 32 Compound AB63368-37-6

[0413] It was purchased from a commercial source and has the following structure:

[0414] Example 33 Compound AB18880-05-2

[0415] It was purchased from a commercial source and has the following structure:

[0416] Example 34 Compound AB70219-09-9

[0417] It was purchased from a commercial source and has the following structure:

[0418] Example 35 Compound AB50479-11-3

[0419] It was purchased from a commercial source and has the following structure:

[0420] Example 36 Compound AB13138-25-5

[0421] It was purchased from a commercial source and has the following structure:

[0422] Example 37 Compound AB82105-88-2

[0423] It was purchased from a commercial source and has the following structure:

[0424] Example 38

[0425] Investigate the activity of mitochondrial membrane permeability transition pore in relevant cells

[0426] Experimental Background: The mitochondrial permeability transition pore (mPTP) is a non-specific channel on the inner mitochondrial membrane that allows small molecules with a molecular weight less than 1.5 kD to pass freely. Its activity is affected by intramitochondrial peroxides (such as H2O2), pH, and calcium ions. The mitochondrial permeability transition pore is active in some cells, while in others. For cells with active mitochondrial permeability transition pores, the addition of peroxides (such as H2O2) increases their mitochondrial permeability transition pore activity, resulting in a decrease in mitochondrial membrane potential. In contrast, for cells with inactive mitochondrial permeability transition pores, the addition of peroxides (such as H2O2) has no significant effect on mitochondrial permeability transition pore activity, and the mitochondrial membrane potential remains unchanged. Based on this principle, the activity of the mPTP in a specific cell can be determined by measuring the change in the potential difference of the mitochondrial membrane under peroxide stimulation.

[0427] Experimental Methods and Results: Daoy cells (human medulloblastoma cells, ATCC No. HTB-186) were cultured in DMEM medium (supplemented with P / S) supplemented with 10% fetal bovine serum. 1.5 μM cyclosporin A (CsA) was added to the cell culture medium; CsA effectively inhibits mitochondrial permeability transition pore activity. Cells without CsA served as blank controls. Tetramethylrhodamine (TMRM) was used to measure the mitochondrial membrane potential difference in Daoy cells after various treatments. A high TMRM fluorescence intensity indicates a high membrane potential difference. The results are shown in Table 1.

[0428] Table 1 Relative TMRM signal intensity (%) of Daoy cells after different treatments

[0429] Note: “+” indicates existence, “-” indicates absence.

[0430] As can be seen from Table 1, for normal Daoy cells without CsA added to the culture medium, their membrane potential decreased significantly under the action of H2O2, indicating that the mPTP in Daoy cells is active. However, for Daoy cells with CsA added to the culture medium to inhibit the activity of the mitochondrial membrane permeability transition pore (mPTP), the membrane potential did not change much after the addition of H2O2, indicating that the active mPTP was inhibited by CsA and became inactive. In this case, H2O2 would not cause a decrease in its membrane potential.

[0431] Therefore, it can be seen from Table 1 that the mitochondrial membrane permeability transition pore is active in Daoy cells.

[0432] Example 39

[0433] The inhibitory effect of the compounds of the present invention on the viability of Daoy cells with active mPTP and Daoy cells with inactive mPTP constructed by transfecting shRNA that specifically induces degradation of PPIF mRNA was investigated

[0434] Peptidyl-prolyl isomerase F is Peptidyl-prolyl cis-trans isomerase F, abbreviated as PPIF. The protein number is UniProtKB / Swiss-Prot: P30405, and the gene number is NCBI Entrez Gene: 10105.

[0435] 1. Construction of Daoy Cells with Inactive Mitochondrial Permeability Transition Pore (mPTP)

[0436] 1.1 Experimental Background: The activity of the mitochondrial permeability transition pore (mPTP) is regulated by the protein PPIF. When PPIF protein is inhibited, mPTP activity is significantly reduced. PPIF protein activity is controlled by the intracellular expression level of PPIF protein. By transfecting Daoy cells with shRNA that specifically induces the degradation of PPIF mRNA, the expression level of PPIF protein in Daoy cells was specifically reduced, thereby constructing Daoy cells with inactive mitochondrial permeability transition pore (mPTP) (hereinafter referred to as mPTP-inactive Daoy cells).

[0437] 1.2 Experimental methods and results: Through cloning technology, a viral vector carrying shRNA that specifically induces the degradation of PPIF mRNA was obtained. The shRNA sequence carried by the viral vector (the nucleotide sequence of shRNA is: GTTCTTCATCTGCACCATAAA (SEQ ID NO: 2)) specifically induces the degradation of PPIF mRNA. Daoy cells were transfected with a viral vector carrying shRNA that specifically induces the degradation of PPIF mRNA, while Daoy cells transfected with an empty viral vector that did not carry shRNA that specifically induces the degradation of PPIF mRNA were used as a control. The expression level of PPIF protein in Daoy cells was detected by western blot technology, and the results are shown in Figure 1. As can be seen from the results in Figure 1, PPIF is basically not expressed in Daoy cells transfected with shRNA that specifically induces the degradation of mPTP regulatory protein PPIF mRNA (i.e., PPIF shRNA in Figure 1), while PPIF is normally expressed in Daoy cells that are not transfected with shRNA that specifically induces the degradation of PPIF mRNA (i.e., Con shRNA in Figure 1, as a control).

[0438] According to the method in Example 38 above, Daoy cells transfected with an empty viral vector but not carrying an shRNA that specifically induces PPIF mRNA degradation and Daoy cells transfected with a viral vector that specifically induces PPIF mRNA degradation were cultured in DMEM medium (supplemented with P / S) supplemented with 10% fetal bovine serum. 1.5 μM cyclosporin A (CsA, which effectively inhibits mitochondrial permeability transition pore activity) was added to the cell culture medium. Cells not supplemented with cyclosporin A (CsA) were selected as blank controls. Tetramethylrhodamine (TMRM) was used to detect the mitochondrial membrane potential difference in Daoy cells transfected with an empty viral vector but not carrying an shRNA that specifically induces PPIF mRNA degradation and Daoy cells transfected with a viral vector that specifically induces PPIF mRNA degradation after different treatments. A high TMRM fluorescence intensity indicates a high membrane potential difference. The results are shown in Tables 2 and 3:

[0439] Table 2 Relative TMRM signal intensity (%) of Daoy cells transfected with empty viral vectors without shRNA that specifically induces degradation of PPIF mRNA after different treatments

[0440] Table 3 Relative TMRM signal intensity (%) of Daoy cells transfected with viral vectors carrying shRNA that specifically induces degradation of PPIF mRNA after different treatments

[0441] As can be seen from Tables 2 and 3, the mitochondrial permeability transition pore (mPTP) in Daoy cells transfected with an empty viral vector but not carrying shRNA that specifically induces degradation of PPIF mRNA is active. However, the membrane potential of Daoy cells transfected with a viral vector carrying shRNA that specifically induces degradation of PPIF mRNA is not affected by Cyclosporin A (C S A) and H2O2 effects indicate that the mitochondrial permeability transition pore (mPTP) is inactive in Daoy cells transfected with a viral vector carrying a shRNA that specifically induces degradation of PPIF mRNA. Therefore, Daoy cells with inactive mitochondrial permeability transition pore (mPTP) were successfully constructed by transfecting Daoy cells with a shRNA that specifically induces degradation of PPIF mRNA, a regulatory protein of the mPTP.

[0442] The Promega CellTiter-Glo kit (which reflects cell viability by detecting intracellular ATP content) was used to detect the viability of the above-mentioned Daoy cells with inactive mPTP constructed by transfecting shRNA that specifically induces the degradation of PPIF mRNA and the Daoy cells with active mPTP that were not transfected with shRNA that specifically induces the degradation of PPIF mRNA. The results are shown in Figure 2. As can be seen from Figure 2, the cell viability of the Daoy cells with inactive mPTP constructed by transfecting shRNA that specifically induces the degradation of PPIF mRNA and the Daoy cells with active mPTP that were not transfected with shRNA that specifically induces the degradation of PPIF mRNA are almost the same, and the difference in cell viability is not statistically significant.

[0443] 2. Investigating the correlation between the inhibitory effect of the compounds of the present invention on tumor cells and the activity of mPTP

[0444] 2.1 Experimental Background: The Promega CellTiter-Glo kit was used. This kit directly detects the intracellular ATP content to reflect cell viability. The IC values ​​of the compounds of the present invention on the viability of Daoy cells that were not transfected with shRNA that specifically induces the degradation of PPIF mRNA and were mPTP-active Daoy cells that were transfected with shRNA that specifically induces the degradation of PPIF mRNA and were mPTP-inactive were determined. 50 value.

[0445] 2.2 Experimental Methods and Results: The mPTP-active Daoy cells not transfected with shRNA that specifically induces degradation of PPIF mRNA and the mPTP-inactive Daoy cells transfected with shRNA that specifically induces degradation of PPIF mRNA were cultured in DMEM medium containing 10% fetal bovine serum (P / S supplemented). The half-inhibitory dose IC values ​​of the compounds of the present invention on these two cell lines were determined. 50 , the experimental results are shown in Table 4:

[0446] Table 4 Inhibitory effects of different compounds of the present invention on Daoy cells with active mPTP and Daoy cells with inactive mPTP (IC 50 , μM)

[0447] Note: IC 50The 50% inhibitory concentration (50%) is the concentration of the inhibitory compound required to achieve 50% inhibition. Daoy cells with active mPTPs were transfected with an empty viral vector but without a shRNA specifically designed to induce PPIF mRNA degradation. Daoy cells with inactive mPTPs were transfected with a viral vector specifically designed to induce PPIF mRNA degradation.

[0448] As can be seen from Table 4, the compounds of the embodiments of the present invention have a more significant inhibitory effect on Daoy cells with inactive mitochondrial membrane permeability transition pore (mPTP), while the inhibitory effect on Daoy cells with active mPTP is poor, indicating that reducing the mPTP activity of Daoy cells can significantly improve the inhibitory effect of the compounds of the embodiments of the present invention. Therefore, the compounds of the embodiments of the present invention have a more significant inhibitory effect on Daoy cells with inactive mPTP, and Daoy cells with inactive mPTP are more sensitive to the compounds of the embodiments of the present invention. Therefore, the compounds of the embodiments of the present invention have excellent precision therapeutic effects on Daoy cells with inactive mPTP. As mentioned above, when PPIF protein is inhibited, mPTP activity is significantly reduced. Inhibiting the expression level of PPIF protein can reduce the mPTP activity of Daoy cells. Therefore, the compounds of the embodiments of the present invention have a more significant inhibitory effect on Daoy cells with low expression of PPIF protein, while the inhibitory effect on Daoy cells with normal expression of PPIF protein is poor, indicating that reducing the expression level of PPIF protein can significantly improve the inhibitory effect of the compounds of the embodiments of the present invention. Therefore, the compounds of the embodiments of the present invention have a more significant inhibitory effect on Daoy cells with low expression of PPIF protein, that is, Daoy cells with low expression of PPIF protein are more sensitive to the compounds of the embodiments of the present invention, and the compounds of the embodiments of the present invention have excellent precision treatment effects on Daoy cells with low expression of PPIF protein.

[0449] Example 40

[0450] This example investigates the sensitivity of the expression level of NNMT (Nicotinamide N-Methyltransferase) in NCI-H82 cells (human small cell lung cancer cells) to the compounds of the present invention.

[0451] Experimental Methods and Results: The NNMT gene was introduced into NCI-H82 cells via a viral vector, resulting in overexpression of the NNMT protein in NCI-H82 cells. This resulted in NCI-H82 cells with high NNMT protein expression (ov-NNMT NCI-H82 cells). NCI-H82 cells transfected with an empty viral vector without the NNMT gene (Con-NCI-H82 cells) served as a control. Western Blot analysis was performed to detect NNMT protein expression in Con-NCI-H82 cells and ov-NNMT NCI-H82 cells. The results are shown in Figure 3. As can be seen from Figure 3, NNMT protein expression is higher in ov-NNMT NCI-H82 cells than in Con-NCI-H82 cells.

[0452] The cell viability of Con-NCI-H82 cells and ov-NNMT NCI-H82 cells was detected using the Promega CellTiter-Glo kit (which reflects cell viability by detecting intracellular ATP content). The results are shown in Figure 4. As can be seen from Figure 4, the cell viability of Con-NCI-H82 cells and ov-NNMT NCI-H82 cells is almost the same, and the difference in cell viability is not statistically significant.

[0453] The Promega CellTiter-Glo kit was used to determine the inhibitory effects of different compounds of the present invention on Con-NCI-H82 cells and ov-NNMT NCI-H82 cells by directly detecting the intracellular ATP content (IC 50 ), the results are shown in Table 5:

[0454] Table 5 Inhibitory effects of different compounds of the present invention on Con-NCI-H82 cells and ov-NNMT NCI-H82 cells (IC 50 , μM)

[0455] Note: Con-NCI-H82 cells are NCI-H82 cells transfected with an empty viral vector that does not carry the NNMT gene and serve as a control; ov-NNMT NCI-H82 cells are NCI-H82 cells transfected with a viral vector that carries the NNMT gene. NNMT protein is highly expressed in ov-NNMT NCI-H82 cells.

[0456] As can be seen from Table 5, this example further confirms that the compounds of the present invention have a more significant inhibitory effect on tumor cells with low or no expression of the NNMT gene by overexpressing the NNMT protein in NCI-H82 cells. Tumor cells with low or no expression of the NNMT gene are highly sensitive to the compounds of the present invention, and the NNMT expression level of tumor cells is significantly negatively correlated with the sensitivity of the compounds of the present invention.

[0457] Example 41

[0458] Cell activity detection reagents were used to detect the inhibitory effects of the compounds of the examples of the present invention on different tumor cell lines.

[0459] Experimental background: Cell viability was detected using the Promega CellTiter-Glo kit, which directly detects intracellular ATP content to reflect cell viability. This experiment tested the IC values ​​of the compounds in the examples of the present invention for inhibiting cell viability in different tumor cell lines. 50 value.

[0460] Experimental methods and results: Each tumor cell was cultured in a relevant culture medium. After cell passage, different compounds of the present invention were added in gradient dilutions. After culturing for 3 days, the half inhibitory concentration (IC) was determined. 50 The names, sources, and culture conditions of each tumor cell line are as follows:

[0461] NCI-H82 cells transfected with the empty viral vector not carrying the NNMT gene in Example 40 were cultured in RPMI1640 medium + P / S containing 10% fetal bovine serum;

[0462] Cell line G-401 (ATCC, No. CRL-1441) was cultured in McCoy's 5a medium + P / S containing 10% fetal bovine serum;

[0463] The cell line MDA-MB-453 (ATCC, No. HTB-131) was cultured in Leibovitz's L-15 medium + P / S containing 10% fetal bovine serum;

[0464] The cell line SW48 (ATCC, No. CCL-231) was cultured in Leibovitz's L-15 medium + P / S containing 10% fetal bovine serum;

[0465] The cell line CFPAC-1 (ATCC, No. CRL-1918) was cultured in IMDM medium + P / S containing 10% fetal bovine serum;

[0466] Cell line 786-O (ATCC, No. CRL-1932) was cultured in RPMI1640 medium + P / S containing 10% fetal bovine serum;

[0467] Cell line GB-1 (JCRB, No. IFO50489) was cultured in DMEM medium + P / S containing 10% fetal bovine serum;

[0468] The cell line SF-126 (JCRB, No. IFO50286) was cultured in EMEM medium containing 10% fetal bovine serum + P / S

[0469] The experimental results are shown in Table 6:

[0470] Table 6 Inhibitory effects of different compounds of the present invention on different cell lines (IC 50 ,μM)

[0471] Note: NCI-H82 is the NCI-H82 cell transfected with the empty viral vector without NNMT gene in Example 40.

[0472] As can be seen from Table 6, NCI-H82 (human small cell lung cancer cells), G-401 (human renal carcinoma Wilms cells), MDA-MB-453 (breast cancer cells), and SW48 (human colon adenocarcinoma cells) are sensitive to the compounds of the present invention (IC 50 However, 786-O (renal clear cell adenocarcinoma cell line), CFPAC-1 (human pancreatic cancer cell line), GB-1 (human glioblastoma cell line) and SF-126 (human glioblastoma multiforme cell line) were insensitive to the compounds of the present invention (IC 50 value is high).

[0473] Example 42

[0474] RT-qPCR gene expression analysis was used to detect the mRNA transcription levels of the NNMT gene in different tumor cells of four tumor cell lines sensitive to the compounds of the present invention and four tumor cell lines insensitive to the compounds of the present invention. The expression of the NNMT gene in these tumor cell lines was measured respectively. The results are shown in FIG5 .

[0475] As can be seen from Figure 5, the RT-qPCR gene expression analysis experiment was used to detect the mRNA transcription level of the NNMT gene in four tumor cell lines (NCI-H82, G-401, MDA-MB-453, SW48) sensitive to the compounds of the present invention and four tumor cell lines (786-O, CFPAC-1, GB-1 and SF-126) insensitive to the compounds of the present invention. It was found that the NNMT gene was lowly expressed in sensitive cell lines (NCI-H82, G-401, MDA-MB-453 and SW48) and highly expressed in insensitive cell lines (786-O, CFPAC-1, GB-1 and SF-126).

[0476] Therefore, it can be concluded from Figure 5 that compared with tumor cell lines with high expression of the NNMT gene, the compounds of the embodiments of the present invention have a more significantly enhanced inhibitory effect on tumor cell lines with low or no expression of the NNMT gene, that is, the expression of the NNMT gene in tumor cells is negatively correlated with their sensitivity to the compounds of the embodiments of the present invention. Therefore, tumors with low or no expression of the NNMT gene are highly sensitive to the compounds of the embodiments of the present invention, and the compounds of the embodiments of the present invention have excellent precision treatment effects on tumors with low or no expression of the NNMT gene.

[0477] Example 43

[0478] The NNMT gene promoter region, the region between 1050 bp before the transcription start site and 499 bp after the transcription start site, and the region between 1050 bp before the transcription start site and 193 bp before the transcription start site of the NNMT gene of four tumor cell lines (NCI-H82, G-401, MDA-MB-453 and SW48) sensitive to the compounds of the present invention and four tumor cell lines (786-O, CFPAC-1, GB-1 and SF-126) insensitive to the compounds of the present invention were subjected to bisulfite sequencing to detect the methylation level of DNA CpG sites in the relevant regions. First, the genomic DNA was treated with bisulfite to deaminize the unmethylated cytosine into uracil, while the methylated cytosine did not undergo deamination. Therefore, based on this, the bisulfite-treated and untreated sequencing samples can be compared to find the methylated sites. The results are shown in Figures 6, 7 and 8.

[0479] As shown in Figure 6 (NNMT gene promoter region), Figure 7 (the region between 1050 bp before the NNMT gene transcription start site and 499 bp after the transcription start site) and Figure 8 (the region between 1050 bp before the NNMT gene transcription start site and 193 bp before the transcription start site), the compounds of the embodiments of the present invention have a significantly stronger inhibitory effect on tumor cell lines with high methylation levels of DNA CpG sites in the NNMT gene promoter region, the region between 1050 bp before the NNMT gene transcription start site and 499 bp after the transcription start site, and the region between 1050 bp before the NNMT gene transcription start site and 193 bp before the transcription start site. The inhibitory effect on tumor cell lines with low CpG site methylation levels is significantly weaker, indicating that the DNA CpG site methylation levels in the NNMT gene promoter region, the region between 1050 bp before the NNMT gene transcription start site and 499 bp after the transcription start site, and the region between 1050 bp before the NNMT gene transcription start site and 193 bp before the transcription start site of the tumor cells are positively correlated with their sensitivity to the compounds of the embodiments of the present invention. Therefore, tumor cells with high DNA CpG site methylation levels in the NNMT gene promoter region, the region between 1050 bp before the NNMT gene transcription start site and 499 bp after the transcription start site, and the region between 1050 bp before the NNMT gene transcription start site and 193 bp before the transcription start site are highly sensitive to the compounds of the embodiments of the present invention. The compounds of the embodiments of the present invention have excellent precision treatment effects on tumors with high DNA CpG site methylation levels in the NNMT gene promoter region, the region between 1050 bp before the NNMT gene transcription start site and 499 bp after the transcription start site, and the region between 1050 bp before the NNMT gene transcription start site and 193 bp before the transcription start site.

[0480] Example 44

[0481] The methylation status of specific DNA CpG sites in the region from 840 bp before the transcription start site of the NNMT gene (i.e., position 114165695 on human chromosome 11) to 469 bp before the gene transcription start site (i.e., position 114166066 on human chromosome 11) in three tumor cell lines (NCI-H82, G-401, and SW48) that were sensitive to the compounds of the present invention and three tumor cell lines (786-O, CFPAC-1, and SF-126) that were insensitive was studied.

[0482] First, the cell genomic DNA is treated with bisulfite to deaminate the unmethylated cytosine into uracil, while the methylated cytosine is not deaminated. Based on this, the bisulfite-treated and untreated sequencing samples can be compared to find the methylated sites. The region is then amplified by PCR using the corresponding primers and sequenced and analyzed to detect the methylation level of the CpG sites in the DNA region.

[0483] Analysis found that the seven CpG sites in this region (human chromosome 11 positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066) in the NCI-H82, G-401, and SW48 cell lines that are sensitive to the compounds of the present invention were almost all methylated, while the seven CpG sites in this region in the 786-O, CFPAC-1, and SF-126 cell lines that are insensitive to the compounds of the present invention were not methylated. The methylation status of the relevant sites is shown in Figure 9.

[0484] Among them, the sites 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 of human chromosome 11 correspond to the sites of the nucleotide sequence of SEQ ID NO: 1 as shown below:

[0485] Example 45

[0486] The methylation level of cellular DNA is maintained by the DNA methyltransferases DNMT3a (DNA methyltransferase 3a), DNMT3b (DNA methyltransferase 3b), and DNMT1 (DNA methyltransferase 1). DNMT3a and DNMT3b can methylate DNA de novo, while DNMT1 can replicate and maintain methylated DNA with the help of the protein UHRF1 (ubiquitin-like protein containing PHD and RING finger domain 1). The present invention detects the correlation between NNMT expression in tumors and the expression of DNMT1, UHRF1, DNMT3a, and DNMT3b.

[0487] Experimental methods and results: The expression data of NNMT genes, DNMT1, UHRF1, DNMT3a and DNMT3b in various cell lines were obtained from a public database (Cancer Cell Line Encyclopedia, CCLE, a total of 1019 cell lines). Then, bioinformatics methods were used to analyze the correlation between NNMT expression and DNMT1, UHRF1, DNMT3a, and DNMT3b expression in these cells. The correlation between the expression level of NNMT genes in each cell line and the expression levels of DNMT1, UHRF1, DNMT3a, and DNMT3b was analyzed. The experimental results are shown in Figure 10.

[0488] As can be seen from Figure 10, the expression of NNMT in each cell is negatively correlated with the expression of DNA methylases (DNMT3a, DNMT3b, and DNMT1) and UHRF1. Therefore, tumor cells with high expression of DNA methylases (DNMT3a, DNMT3b, and DNMT1) and UHRF1 are highly sensitive to the compounds of the present invention. The compounds of the present invention have excellent precision treatment effects on tumors with high expression of DNA methylases (DNMT3a, DNMT3b, and DNMT1) and UHRF1.

[0489] The above is an implementation scheme of the present invention designed for a case. It should be pointed out that for ordinary technicians in this technical field, several improvements can be made without departing from the principles of the present invention, and these improvements should also be regarded as the scope of protection of the present invention.

Claims

1. A use of a compound of formula I, or an optical isomer thereof, or a racemate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, for preparing a composition or a preparation for preventing and / or treating a tumor; in, The tumor includes a tumor with low or no expression of NNMT gene; and / or The tumor includes a tumor with a high methylation level of the NNMT gene nucleotide site; and / or The tumor includes a tumor with high methylation level of DNA CpG site in the NNMT gene region; and / or The tumor includes a tumor with high expression of DNA methylase (such as DNMT1, DNMT3a and / or DNMT3b); and / or The tumor includes a tumor with high expression of UHRF1; and / or The tumors include tumors with low expression, no expression, low activity or no activity of mitochondrial membrane permeability transition pore; and / or The tumor includes a tumor with low expression, no expression, low activity or no activity of peptidylprolyl isomerase F; in, R1, R2, R3 and R4 are each independently substituted or unsubstituted C1-C16 alkyl, substituted or unsubstituted C1-C16 haloalkyl, substituted or unsubstituted C2-C8 alkenyl-substituted or unsubstituted C1-C10 alkyl-, substituted or unsubstituted C3-C16 cycloalkyl, substituted or unsubstituted 3-16-membered heterocycloalkyl, substituted or unsubstituted C6-C16 aryl, substituted or unsubstituted 3-16-membered heteroaryl, substituted or unsubstituted C6-C16 aryl-substituted or unsubstituted C1-C8 alkyl-, substituted or unsubstituted 3-16-membered heteroaryl-substituted or unsubstituted C1-C8 alkyl-, substituted or unsubstituted C2-C10 ester-substituted or unsubstituted 3-12-membered heterocycloalkyl-, or substituted or unsubstituted C2-C10 ester-substituted or unsubstituted C1-C10 alkyl-; Any of the "substituted" mentioned above means that one or more (preferably 1, 2, 3, 4, 5, 6, 7 or 8) hydrogen atoms on the group are independently substituted by a substituent selected from the group consisting of C1-C8 alkyl, C3-C8 cycloalkyl, C2-C8 alkenyl, C1-C8 haloalkyl, C3-C8 halocycloalkyl, C3-C8 cycloalkyloxy, C3-C8 cycloalkylthio, C3-C8 halocycloalkyloxy, C3-C8 halocycloalkylthio, halogen, hydroxyl, thiol, amino, C2-C8 ester, C2-C8 amide, C1-C8 alkoxy, C1-C8 alkylthio, C1-C8 haloalkoxy, C1-C8 haloalkylthio, C6-C12 aryl, and 5-12 membered heteroaryl; The heterocyclic ring of the heterocycloalkyl and heteroaryl groups has 1 to 4 (preferably 1, 2, 3 or 4) heteroatoms independently selected from N, O and S.

2. The use according to claim 1, characterized in that The compound of formula I, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, or its deuterated compound is:

3. The use according to claim 1, characterized in that The tumor is selected from the following group: lung cancer, kidney cancer, breast cancer, intestinal cancer, lymphoma, leukemia, pancreatic cancer, brain tumor, liver cancer, prostate cancer, or a combination thereof.

4. The use according to claim 1, characterized in that The low expression or non-expression of the NNMT gene refers to a ratio (E1 / E0) of the expression E1 of the NNMT gene in tumor cells to the expression E0 of the NNMT gene in the same type of cells or normal cells <1.0, preferably ≤0.7, more preferably ≤0.6, more preferably ≤0.5, more preferably ≤0.4, more preferably ≤0.3, more preferably ≤0.2, more preferably ≤0.1, more preferably ≤0.05, more preferably ≤0.01, more preferably ≤0.005, more preferably ≤0.001, more preferably ≤0.0001, more preferably ≤0.00001, more preferably ≤0.000001, more preferably ≤0.0000001; The high methylation level of the NNMT gene nucleotide site refers to a ratio (L1 / L0) of the methylation level L1 of the NNMT gene nucleotide site in tumor cells to the methylation level L0 of the NNMT gene nucleotide site in the same type of cells or normal cells>1.0, preferably ≥1.2, preferably ≥1.5, more preferably ≥2, more preferably ≥3, more preferably ≥5, more preferably ≥8, more preferably ≥10, more preferably ≥15, more preferably ≥20, more preferably ≥30, more preferably ≥50, for example 2-50; The high methylation level of DNA CpG sites in the NNMT gene region refers to a ratio (G1 / G0) of the methylation level G1 of the DNA CpG sites in the NNMT gene region of tumor cells to the methylation level G0 of the DNA CpG sites in the same type of cells or normal cells>1.0, preferably ≥1.2, preferably ≥1.5, more preferably ≥2, more preferably ≥3, more preferably ≥5, more preferably ≥8, more preferably ≥10, more preferably ≥15, more preferably ≥20, more preferably ≥30, more preferably ≥50, for example 2-50; The tumor with high expression of DNA methylase refers to a ratio (A1 / A0) of the expression level A1 of DNA methylase in tumor cells to the expression level A0 of DNA methylase in the same type of cells or normal cells>1.0, preferably ≥1.2, preferably ≥1.5, more preferably ≥2, more preferably ≥3, more preferably ≥5, more preferably ≥8, more preferably ≥10, more preferably ≥15, more preferably ≥20, more preferably ≥30, more preferably ≥50, for example 2-50; The tumor with high expression of UHRF1 refers to a ratio (F1 / F0) of the expression level F1 of UHRF1 in tumor cells to the expression level F0 of UHRF1 in the same type of cells or normal cells>1.0, preferably ≥1.2, preferably ≥1.5, more preferably ≥2, more preferably ≥3, more preferably ≥5, more preferably ≥8, more preferably ≥10, more preferably ≥15, more preferably ≥20, more preferably ≥30, more preferably ≥50, for example 2-50; The low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore refers to a ratio (H1 / H0) of the expression level or activity level H1 of the mitochondrial membrane permeability transition pore of tumor cells to the expression level or activity level H0 of the mitochondrial membrane permeability transition pore of the same type of cells or normal cells <1.0, preferably ≤0.8, more preferably ≤0.7, more preferably ≤0.6, more preferably ≤0.5, more preferably ≤0.4, more preferably ≤0.3, more preferably ≤0.2, more preferably ≤0.1, more preferably ≤0.05, more preferably ≤0.01, more preferably ≤0.005, more preferably ≤0.001, more preferably ≤0.0001, more preferably ≤0.00001, more preferably ≤0.000001, more preferably ≤0.0000001; and / or The low expression, no expression, low activity or no activity of peptidyl prolyl isomerase F refers to that the ratio of the expression level or activity level C1 of peptidyl prolyl isomerase F in tumor cells to the expression level or activity level C0 of peptidyl prolyl isomerase F in the same type of cells or normal cells (C1 / C0) is <1.0, preferably ≤0.8, more preferably ≤0.7, more preferably ≤0.6, more preferably ≤0.5, more preferably ≤0.4, more preferably ≤0.3, more preferably ≤0.2, more preferably ≤0.1, more preferably ≤0.05, more preferably ≤0.01, more preferably ≤0.005, more preferably ≤0.001, more preferably ≤0.0001, more preferably ≤0.00001, more preferably ≤0.000001, more preferably ≤0.0000001.

5. The use according to claim 4, characterized in that The same type of cells include the same type of tumor cells with normal or high expression of NNMT gene; The same type of cells include the same type of tumor cells whose NNMT gene nucleotide site methylation level is normal or low; The same type of cells include the same type of tumor cells whose methylation level of DNA CpG site in the NNMT gene region is normal or low; The same type of cells include the same type of tumor cells with normal or low expression of DNA methylase; The same type of cells include the same type of tumor cells with normal or low expression of UHRF1; The same type of cells include the same type of tumor cells with normal expression, high expression, normal activity or high activity of mitochondrial membrane permeability transition pore; and / or The same type of cells include the same type of tumor cells with normal expression, high expression, normal activity or high activity of peptidyl prolyl isomerase F.

6. A marker for determining whether a tumor patient is suitable for the use of the compound of formula I as claimed in claim 1, or its optical isomers, or its racemates, or its pharmaceutically acceptable salts, or its deuterated compounds for the prevention and / or treatment of tumors, the marker comprising mitochondrial membrane permeability transition pore, peptidyl prolyl isomerase F, NNMT gene, DNA methylase, UHRF1, NNMT gene nucleotide site methylation, and / or NNMT gene region DNA CpG site methylation.

7. A use of a detection kit, characterized in that: Used for preparing a companion diagnostic kit, the companion diagnostic kit is used to determine whether a tumor patient is suitable for prevention and / or treatment with the compound of formula I as claimed in claim 1, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, or its deuterated compound; The detection kit comprises: (i) a detection reagent for detecting the expression level or activity of mitochondrial membrane permeability transition pore, the expression level or activity of peptidyl prolyl isomerase F, the expression level of NNMT gene, the expression level of DNA methylase, the expression level of UHRF1, the methylation level of NNMT gene nucleotide sites, and / or the methylation level of DNA CpG sites in the NNMT gene region; The companion diagnostic kit further includes an instruction manual or a label, wherein the instruction manual or the label states: When the mitochondrial membrane permeability transition pore is lowly expressed, not expressed, lowly active or inactive, peptidyl prolyl isomerase F is lowly expressed, not expressed, lowly active or inactive, the NNMT gene is lowly expressed or not expressed, DNA methylase is highly expressed, UHRF1 is highly expressed, the methylation level of the NNMT gene nucleotide site is high, and / or the methylation level of the DNA CpG site in the NNMT gene region is high in the tumor cells of the tumor patient, then the tumor patient is suitable for prevention and / or treatment with the compound of formula I as claimed in claim 1, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, or its deuterated compound.

8. A compound of formula I, or an optical isomer thereof, or a racemate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof; in, R1, R2, R3 and R4 are each independently phenyl, methoxy-substituted phenyl, indolyl, methyl-substituted indolyl, pyrrolopyridinyl, methyl-substituted pyrrolopyridinyl, pentyl-tetrahydropyridinyl-, methyl, ethyl, propyl, butyl, pentyl, hexyl.

9. The compound of formula I according to claim 1, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, or its deuterated compound, characterized in that: The compound of formula I, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, or its deuterated compound is:

Images