Spherical preparation of retinal pigment epithelial cells
By developing spherical preparations of retinal pigment epithelial cells, the existing RPE cell preparations are solved, and the problems of leakage and complex surgery are easily solved after injection, achieving convenient injection and uniform expansion of the preparations, meeting the stability and controllability needs of clinical treatment.
Patent Information
- Application Number
- PCT/CN2023/140706
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-19
- Filing Date
- 2023-12-21
- Publication Date
- 2025-06-26
AI Technical Summary
The existing RPE cell preparation forms are difficult to meet clinical treatment needs, including cell leakage, difficulty in surgery, and difficulty in shape control.
A spherical preparation of retinal pigment epithelial cells was developed. RPE cells were aggregated into spherical shapes through inoculation medium and centrifugal precipitation technology, ensuring that the preparation is not easy to leak after injection and facilitates uniform expansion.
It has achieved effective leakage avoidance, convenient injection and uniform cell expansion of RPE cell preparations, meeting the stability and controllability needs of clinical treatment.
Smart Images

Figure CN2023140706_26062025_PF_FP_ABST
Abstract
Description
A spherical preparation of retinal pigment epithelial cells Technical Field
[0001] The invention belongs to the field of cell technology, and particularly relates to a retinal pigment epithelial cell spherical preparation. Background Art
[0002] The retina receives nearly one-third of the input to the human brain's sensory system, playing a key role in light perception and transduction. The macula, an oval, pale yellow area located in the central retina, is responsible for the vast majority of visual information perception. Macular degeneration (MD) is characterized by the degeneration of retinal cells (such as the retinal pigment epithelium and / or photoreceptors), leading to severe visual impairment (doi: 10.1016 / j.ophtha.2020.11.024 and doi: 10.1016 / j.ophtha.2022.02.001). MD is mainly divided into Stargardt macular degeneration (SMD) and age-related macular degeneration (AMD), which are more common in children and the elderly, respectively (doi: 10.1111 / aos.14996 and doi: 10.1186 / s12974-021-02088-0).
[0003] In the eye, the neural retina and retinal pigment epithelium (RPE) cells are important components of the retina. The neural retina comprises multiple layers of different cell types, including the RPE cell layer. The RPE cell layer is composed of a single, tightly packed layer of RPE cells. In the neural retina, they contribute to the formation of the blood-retinal barrier, phagocytize and transport visual cycle products, and play a crucial role in maintaining photoreceptor cell metabolism and retinal function.
[0004] Clinically, AMD is divided into two types: atrophic (dry) and neovascular (wet). Both types of AMD share common pathological features, including degeneration and death of RPE cells and damage to secondary photoreceptor cells (doi: 10.3389 / fphar.2021.727870). Therefore, RPE cells play an important role in the pathogenesis and replacement therapy of retinal diseases. Existing studies have shown that transplanting fetal RPE (fRPE) cells from aborted fetuses or RPE cells differentiated from stem cells into the subretinal space of the eye can effectively alleviate the progression of retinal degeneration.
[0005] Due to the complex ethical review procedures and limited sample size, fRPE treatment for macular degeneration has significant limitations. Therefore, RPE derived from pluripotent stem cells through directed induction has become the first choice for alternative treatment of macular degeneration. It has the characteristics of strong plasticity, convenient in vitro expansion and preparation, safe and controllable quality and quantity, and no need for ethical review procedures. Among the existing RPE replacement therapies, there are various forms of RPE cell preparations, mainly divided into RPE cell suspension (RPE Suspension), RPE cell patch (RPE Sheet / RPE Patch), and RPE cell strip (RPE Strip). Although the cell suspension does not require further preparation and is easy to administer to the subretinal space, it is easy to leak into the vitreous cavity after injection and often forms a multi-layer stack in the fundus (doi: 10.1016 / S0140-6736(14)61376-3). Subsequently, in order to solve the above problems, different scholars have obtained RPE cell patches (biomaterial substrates or autologous sheets, etc.) through various means. The RPE cell patches that have been tightly arranged in a polar monolayer can be transplanted into the subretinal space. However, this method is difficult to operate, and the patches are not easy to fix in the fundus and are easy to float in the fundus, which seriously affects the treatment effect (doi: 10.1038 / nbt.4114 and doi: 10.1056 / NEJMoa1608368). The emergence of RPE cell strips avoids cell leakage after transplantation and is convenient for surgery. However, the shape of the cell strips is difficult to control after injection into the fundus and they are easy to curl and stack (doi: 10.1038 / s41598-021-00703-x). Technical issues
[0006] Therefore, there is currently a lack of an effective form of RPE cell preparation to ensure that RPE cell preparations can meet clinical treatment needs. Technical Solutions
[0007] In order to solve the above technical problems, the present application provides a spherical preparation of retinal pigment epithelial cells, which can avoid leakage during injection into the subretinal space and has the advantages of convenient injection and uniform cell expansion.
[0008] The present invention develops a retinal pigment epithelial cell spheroid preparation, which is obtained by the following method:
[0009] Step 1: Obtain RPE cells;
[0010] Step 2: The RPE cells are inoculated into a cell culture plate using an inoculation medium, and then cultured after centrifugation to allow a number of RPE cells to aggregate to form RPE cell spheres of uniform size.
[0011] As an improved technical solution of the present application, the RPE cells are fRPE, or RPE cells obtained by differentiation of pluripotent stem cells.
[0012] As an improved technical solution of the present application, the pluripotent stem cells are induced pluripotent stem cells or embryonic stem cells; the pluripotent stem cells are human pluripotent stem cells, mouse pluripotent stem cells, or monkey pluripotent stem cells.
[0013] As an improved technical solution of the present application, step one further includes: after obtaining the RPE cells, culturing the RPE cells in RPE culture medium for 0-10 days.
[0014] As an improved technical solution of the present application, the inoculation culture medium contains 1-100 μM Y27632.
[0015] As an improved technical solution of the present application, the inoculation culture medium includes additives; the additives include 0.25-5% of any one of FBS, KSR, HSA, BSA, recombinant BSA, or recombinant HSA.
[0016] As an improved technical solution of this application, the additive further includes:
[0017] Either N2 (1×) or B27 (1×);
[0018] 1-100 mM of any one of Nicotinamide, Niacin, Niacin hydrochloride, or L-Tryptophan;
[0019] 10-200 nM EDN3; 1-100 ng / mL FGF2 or EGF;
[0020] 1-100 μM of any one of SB431542, A 83-01, Lefty-A, or LY2157299, and 1-100 μM of T3.
[0021] As an improved technical solution of the present application, the additive includes an amount of 1-100 μM CHIR-99021.
[0022] As an improved technical solution of the present application, the inoculation culture medium includes a basal culture medium; the basal culture medium is any one of MEM, DMEM, Ham's F12, DMEM / F12, RPMI-1640, MEM α, IMDM, E6, and E8.
[0023] As an improved technical solution of the present application, in step 2, the RPE cells are cultured by suspension inoculation.
[0024] As an improved technical solution of the present application, in step 2, when the RPE cells are cultured based on the inoculation medium, the initial inoculation amount of RPE cells per well is 300-5000 cells, and the diameter of the RPE cell spheres that can be formed is 50-400 μm.
[0025] As an improved technical solution of the present application, the RPE cell preparation has the following properties: multiple RPE cell spheres are plated in a single well of the same cell culture plate for 1-8 days, no adhesion occurs between each RPE cell sphere, and each RPE cell sphere can achieve adherence and expansion. Beneficial effects
[0026] 1. This application proposes the concept of RPE cell spheres and develops for the first time a preparation process for obtaining RPE cell spheres. The RPE cell spheres can form spheres in vitro and have the potential to automatically extend into a single layer of RPE cells in vivo / in vitro.
[0027] 2. The RPE cell sphere of the present application has the characteristics of avoiding leakage of subretinal injection and convenient injection; At the same time, it can also ensure that RPE cells can expand evenly. Wherein, the reason for avoiding leakage is: when selecting RPE cell suspension, because the diameter of RPE cells themselves is between 15-17 μm, and the inner diameter of the surgical injection needle is between 100-200 μm, RPE cells are prone to leakage from the injection point after the injection is completed, and the diameter of the RPE cell sphere of the present application is not less than 100 μm, compared to a single RPE cell, it is not easy to leak after injection. Convenient injection: compared to RPE cell patches / strips, its surgical injection method is more convenient.
[0028] 3. The RPE cell spheres of this application have controllable size and cell number, and the preparation process is highly reproducible, which can meet clinical stability requirements.
[0029] 4. The RPE cell spheres of the present application are suitable for a seeding range of 300-5000 cells during the preparation process, and the diameter of the formed RPE cell spheres is 50-400 μm, which corresponds to the ability to obtain RPE cell spheres with a diameter within the clinical application range to meet the needs of different application scenarios.
[0030] 5. The RPE cell spheres of the present application have the ability to adhere to and expand, that is, whether a single or multiple RPE cell spheres are inoculated, they can adhere to and expand in vitro.
[0031] 6. The RPE cell spheres obtained in this application can maintain the biological characteristics of RPE cells before sphere formation, such as high expression of specific markers, purity of RPE cells, and the ability of RPE cells to secrete VEGF. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] FIG1 is a cell morphology diagram on day D1 in Example 2.
[0033] FIG2 is a cell morphology diagram on day D2 in Example 2.
[0034] FIG3 is a cell morphology diagram on day D3 in Example 2.
[0035] FIG4 is a cell morphology diagram of 300 cells and 600 cells inoculated in Example 3 on day D3.
[0036] FIG5 is a D0 (first day) state diagram of Example 4 for verifying the expansion performance of RPE cell spheres.
[0037] FIG6 is a state diagram of D3 (day 3) for verifying the expansion performance of RPE cell spheres in Example 4. FIG.
[0038] FIG. 7 is a state diagram of D7 (seventh day) for verifying the expansion performance of RPE cell spheres in Example 4. FIG.
[0039] FIG8 is a state diagram of the expansion performance of multiple RPE cell spheres verified in Example 4.
[0040] FIG9 shows the effect of RPE cells from different sources on RPE cell spheroidization in the same process of Example 5. At this time, the inoculation range of fRPE is 1000 cells-5000 cells.
[0041] FIG10 is a diagram showing the first day (D1) of inoculation culture for verifying the effect of the selection of RPE cell culture medium and inoculation culture medium on RPE cell sphere formation in Example 6. FIG10 is a diagram showing the effect of the selection of RPE cell culture medium and inoculation culture medium on RPE cell sphere formation in Example 6.
[0042] FIG11 is a diagram showing the second day (D2) of inoculation culture for verifying the effect of the selection of RPE cell culture medium and inoculation culture medium on RPE cell sphere formation in Example 6. FIG.
[0043] FIG12 is a diagram showing the third day (D3) of inoculation culture for verifying the effect of the selection of RPE cell culture medium and inoculation culture medium on RPE cell sphere formation in Example 6. FIG.
[0044] FIG13 is a graph showing the effect of different concentrations of additives in the inoculation culture medium on RPE cell spheroidization on day 0 (D0) in Example 7.
[0045] FIG14 is a diagram showing the effect of different concentrations of additives in the inoculation culture medium on RPE cell spheroidization on day 1 (D1) in Example 7.
[0046] FIG15 is a graph showing the effects of different concentrations of additives in the inoculation culture medium on RPE cell spheroidization on day 3 (D3) in Example 7.
[0047] FIG. 16 is a graph showing the effects of different inoculation culture media on RPE cell spheroidization as verified in Example 7.
[0048] FIG17 is an immunofluorescence assay of the adherent growth of RPE cell spheres in Example 8: (a) RPE65; (b) MITF; (c) ZO-1; (d) Tyrosinase; and (e) BEST1.
[0049] Figure 18 shows the RPE65 expression levels of the RPE cells in the four experimental groups and the control group iPSC cells detected by flow cytometry in Example 8: (a) iPSC (0%), (b) iPSC-RPE-1 (98.52%), (c) iPSC-RPE-2 (99.69%), (d) iPSC-RPE-3 (99.45%), and (e) iPSC-RPE-4 (99.75%).
[0050] Figure 19 shows the MITF expression levels of RPE cells in the experimental four groups and the control group iPSC cells detected by flow cytometry in Example 8: (a) iPSC (0%), (b) iPSC-RPE-1 (99.86%), (c) iPSC-RPE-2 (98.45%), (d) iPSC-RPE-3 (97.35%), and (e) iPSC-RPE-4 (98.56%).
[0051] Figure 20 shows the PAX6 expression levels of RPE cells in the experimental four groups and the control group iPSC cells detected by flow cytometry in Example 8: (a) iPSC (0%), (b) iPSC-RPE-1 (98.35%), (c) iPSC-RPE-2 (98.73%), (d) iPSC-RPE-3 (99.12%), and (e) iPSC-RPE-4 (99.22%).
[0052] FIG21 shows the expression levels of RPE65, MITF, BEST1, and PAX6 in the four groups detected by qPCR in Example 8.
[0053] FIG. 22 shows the expression level of VEGF secretion in experimental group 4 detected by ELISA assay in Example 8. Best Mode for Carrying Out the Invention
[0054] The retinal pigment epithelial cells (RPE) are derived from directed differentiation of pluripotent stem cells.
[0055] Method 1: The obtained RPE cells are cultured in RPE cell culture medium to obtain an RPE cell suspension:
[0056] (1) Obtaining RPE cells, wherein the RPE cells are RPE cells or fRPE cells obtained by differentiation of pluripotent stem cells.
[0057] (2) Use RPE cell culture medium to culture for 1-10 days to obtain RPE cells in good condition, which is mainly to ensure that the RPE cells used for inoculation are in good condition.
[0058] (3) Digest the RPE cells using pancreatic enzyme or commercial digestion solution, neutralize the digestion with culture medium, and centrifuge to discard the supernatant to obtain the RPE cell pellet.
[0059] (4) Each well is inoculated with 300-5000 RPE cells as the initial inoculum: After resuspending the RPE cell pellet with inoculation medium, the RPE cell suspension is inoculated into the cell culture plate, centrifuged and placed in the incubator for culture. This is D0.
[0060] (5) Inoculation and culture method: RPE cells are cultured in a cell culture plate for 3 days, which is D3.
[0061] Method 2: Directly obtain RPE cell suspension:
[0062] (1) Obtaining an RPE cell suspension, wherein the RPE cell suspension is an RPE cell suspension obtained by differentiation of pluripotent stem cells or an fRPE cell suspension.
[0063] (2) Each well is inoculated with 300-5000 RPE cells as the initial inoculum: inoculate the RPE cell suspension into the cell culture plate, centrifuge it, and then place it in the incubator for culture. This is D0.
[0064] (3) Inoculation and culture method: RPE cells are cultured in a cell culture plate for 3 days, which is D3.
[0065] The inoculation culture medium includes: basic culture medium and additives.
[0066] The basal culture medium includes but is not limited to any one of MEM, DMEM, Ham's F12, DMEM / F12, RPMI-1640, MEM α, IMDM, E6 or E8.
[0067] An optional embodiment of the additive is that the additive comprises the following components:
[0068] Component I: any one of 0.25-5% FBS, 0.25-5% KSR, 0.25-5% HSA, 0.25-5% BSA, 0.25-5% recombinant BSA, or 0.25-5% recombinant HSA;
[0069] Component II: either N2 (1×) or B27 (1×);
[0070] Component III: 1-100 mM of any one of Nicotinamide, Niacin, Niacin hydrochloride, or L-Tryptophan;
[0071] Component IV: 10-200 nM EDN3;
[0072] Component V: 1-100 ng / mL of either FGF2 or EGF;
[0073] Component VI: 1-100 μM of any one of SB431542, A 83-01, Lefty-A, or LY2157299;
[0074] Component VII: and 1-100 μM T3.
[0075] Another optional embodiment of the additive is that the additive includes the following components:
[0076] Component I: any one of 0.25-5% FBS, 0.25-5% HSA, 0.25-5% BSA, 0.25-5% recombinant BSA, or 0.25-5% recombinant HSA;
[0077] Component II: 1-100 μM CHIR-99021.
[0078] As an improvement to the above two embodiments, the additive further comprises Y27632, and the amount of Y27632 is 1-100 μM, so as to make the RPE cell spheres more compact. Modes for Carrying Out the Invention
[0079] To further illustrate the technical means and effects of the present invention, the present invention is further described below with reference to the embodiments and drawings. It should be understood that the specific embodiments described herein are only used to explain the present invention, rather than to limit the present invention.
[0080] If no specific techniques or conditions are specified in the examples, the experiments were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.
[0081] In order to more clearly understand the present invention, the following terms are defined:
[0082] Retinal pigment epithelial cell spheroid preparation: a preparation with RPE cell spheroids as the active ingredient.
[0083] RPE cells, also known as Retinal Pigment Epithelium cells, are retinal pigment epithelial cells. They can be classified as fRPE or RPE cells derived from pluripotent stem cells.
[0084] Wherein, fRPE, fetal RPE, source is: the source is the eyeball of aborted fetus and is separated and cultured, and the specific method is prior art, and the method based on includes but is not limited to Chinese patent CN103602631A "Isolation and Culture Method of Human Fetal Retinal Pigment Epithelial Cells". Due to the complicated ethical review procedures and the limitation of the amount of materials, fetal RPE has great limitations in treating macular degeneration. For this reason, the present application also studies the method for obtaining RPE cell preparations by RPE cells obtained by differentiation of pluripotent stem cells, which is formed by directed induction of RPE with pluripotent stem cells. It has strong plasticity, convenient in vitro amplification preparation, safe and controllable quality and quantity, and does not require the characteristics of ethical review procedures, becoming the first choice for alternative treatment of macular degeneration.
[0085] RPE cells differentiated from pluripotent stem cells refer to RPE cells differentiated from pluripotent stem cells using a specific method. The species of origin of these cells include but are not limited to mouse (doi: 10.1371 / journal.pone.0158282), human (doi: 10.1056 / NEJMoa1608368. or doi: 10.1242 / jcs.050393, or doi: 10.1007 / 978-1-4939-8669-9_6), and non-human primates (doi: 10.1016 / j.stemcr.2016.08.010).
[0086] RPE cell spheres: cell spheres or cell pellets mentioned in the text. The definition of spheres is that cells in a single well are evenly aggregated and clump together in a spherical shape, with no scattered cells or small cell clusters around them.
[0087] Expansion: It is the process in which RPE cells disperse into the surrounding monolayer after the RPE cell spheres adhere to the wall.
[0088] N2 (1×) means: a medium containing 1% N2 by volume obtained by diluting commercially available N2 (100×) 100 times; the medium used for dilution is the basal medium in the inoculation medium.
[0089] B27 (1×) means: a B27 medium containing 1% volume concentration obtained by diluting commercially available B27 (50×) 100 times; the medium used for dilution is the basal medium in the inoculation medium.
[0090] Centrifugation can be performed at normal cell centrifugation process parameters, such as 300 g - 500 g, 5 min - 10 min. For the purpose of specific description in the examples of this application, the parameters selected are 300 g, 5 min.
[0091] KSR, Knockout serum replacement: is a chemically defined FBS-free medium used to replace FBS in cell culture.
[0092] The “%” in the culture medium formula refers to the volume percentage. For example, 5% BSA means the volume concentration of BSA is 5%, not the weight concentration.
[0093] Example 1. Preparation method of RPE cell spheres.
[0094] The retinal pigment epithelial cells (RPE) are derived from directed differentiation of pluripotent stem cells.
[0095] Method 1: The obtained RPE cells are cultured in RPE cell culture medium to obtain an RPE cell suspension:
[0096] (1) Obtaining RPE cells, wherein the RPE cells are RPE cells or fRPE cells obtained by differentiation of pluripotent stem cells.
[0097] (2) Use RPE cell culture medium to culture for 1-10 days to obtain RPE cells in good condition, which is mainly to ensure that the RPE cells used for inoculation are in good condition.
[0098] (3) Digest the RPE cells using pancreatic enzyme or commercial digestion solution, neutralize the digestion with culture medium, and centrifuge to discard the supernatant to obtain the RPE cell pellet.
[0099] (4) Each well is inoculated with 300-5000 RPE cells as the initial inoculum: After resuspending the RPE cell pellet with inoculation medium, the RPE cell suspension is inoculated into the cell culture plate, centrifuged and placed in the incubator for culture. This is D0.
[0100] (5) Inoculation and culture method: RPE cells are cultured in a cell culture plate for 3 days, which is D3.
[0101] Method 2: Directly obtain RPE cell suspension:
[0102] (1) Obtaining an RPE cell suspension, wherein the RPE cell suspension is an RPE cell suspension obtained by differentiation of pluripotent stem cells or an fRPE cell suspension.
[0103] (2) Each well is inoculated with 300-5000 RPE cells as the initial inoculum: inoculate the RPE cell suspension into the cell culture plate, centrifuge it, and then place it in the incubator for culture. This is D0.
[0104] (3) Inoculation and culture method: RPE cells are cultured in a cell culture plate for 3 days, which is D3.
[0105] The inoculation culture medium includes: basic culture medium and additives.
[0106] The basal culture medium includes but is not limited to any one of MEM, DMEM, Ham's F12, DMEM / F12, RPMI-1640, MEM α, IMDM, E6 or E8.
[0107] An optional embodiment of the additive is that the additive comprises the following components:
[0108] Component I: any one of 0.25-5% FBS, 0.25-5% KSR, 0.25-5% HSA, 0.25-5% BSA, 0.25-5% recombinant BSA, or 0.25-5% recombinant HSA;
[0109] Component II: either N2 (1×) or B27 (1×);
[0110] Component III: 1-100 mM of any one of Nicotinamide, Niacin, Niacin hydrochloride, or L-Tryptophan;
[0111] Component IV: 10-200 nM EDN3;
[0112] Component V: 1-100 ng / mL of either FGF2 or EGF;
[0113] Component VI: 1-100 μM of any one of SB431542, A 83-01, Lefty-A, or LY2157299;
[0114] Component VII: and 1-100 μM T3.
[0115] Another optional embodiment of the additive is that the additive includes the following components:
[0116] Component I: any one of 0.25-5% FBS, 0.25-5% HSA, 0.25-5% BSA, 0.25-5% recombinant BSA, or 0.25-5% recombinant HSA;
[0117] Component II: 1-100 μM CHIR-99021.
[0118] As an improvement to the above two embodiments, the additive further comprises Y27632, and the amount of Y27632 is 1-100 μM, so as to make the RPE cell spheres more compact.
[0119] Example 2. Verification of process parameters in the preparation method of RPE cell spheres.
[0120] In this example, the inoculation medium selected one of the above combinations: 5% recombinant BSA, B27 (1×), 25 mM Niacin, 60 nM EDN3, 50 ng / mL EGF, 5 μM A83-01 and 30 μL / mL T3, and the basal medium was MEM α.
[0121] Condition 1: Whether to add Y27632; Combined with Figures 1-3, it can be compared that when other conditions are the same, only adding 10 μM Y27632 to the inoculation medium does not affect whether the RPE cells can form spheres, but only affects the compactness of the RPE cell spheres.
[0122] Condition 2: at D0, select whether to centrifuge the RPE cells after inoculation to precipitate the RPE cells; the selection of centrifugal parameters can be: rotation speed 300g, 5min. In conjunction with Figures 1-3, it can be compared that: when other conditions are the same, centrifugation is relative to non-centrifugation, and it is easier to form a ball. It is supplemented that: the applicant has also verified that normal cell centrifugation process parameters, such as 300 g -500g, 5 min-10 min, can produce the effect consistent with the present embodiment.
[0123] Condition 3: Initial cell seeding size: This example compares the effects of 1000 cells, 2000 cells, and 5000 cells seeding sizes on RPE cell spheres. Combined with Figures 1 to 3, the conclusion is that different seeding sizes do not affect sphere formation, but affect the diameter of RPE cell spheres.
[0124] Table 1 Results of effect verification of Example 2 (RPE cells differentiated from pluripotent stem cells)
[0125] Whether centrifuged Y27632 inoculum size (cells) Whether spheres were formed RPE sphere density +-1000 Loose spheres +-2000 Loose spheres +-5000 Loose spheres ++1000 Tight spheres ++2000 Tight spheres ++5000 Tight spheres --1000 Not spheres Dispersed --2000 Not spheres Dispersed --5000 Not spheres Dispersed -+1000 Not spheres Dispersed -+2000 Not spheres Dispersed -+5000 Not spheres\
[0126] In Table 1, + represents addition / centrifugation, and - represents no addition / no centrifugation; tightness and looseness are relative conclusions drawn by comparing only a single parameter under the same conditions.
[0127] The comprehensive conclusion is: the relevant figures are shown in Figures 1 to 3 (RPE cells differentiated from pluripotent stem cells). At D0, centrifugation has a greater effect on the spherical morphology of RPE cells. After centrifugation, RPE cells can be aggregated. Without centrifugation, RPE cells are in a dispersed state.
[0128] However, under the same conditions on days 1-3, centrifugation resulted in more cell aggregation into spheroids. Furthermore, under centrifugation, the cell spheroids formed with Y27632 were more rounded and more regularly shaped than those without Y27632. This suggests that combining centrifugation with Y27632 is the optimal strategy, and that spheroids can be formed even with a cell inoculation size of 1,000-5,000 cells.
[0129] When the same number of cells were inoculated, the smaller the diameter of the pellet under centrifugation and Y27632 conditions, the more compact the pellet.
[0130] Example 3. Verification of the spheroidization ability of RPE cells at low cell inoculation doses in the preparation method of RPE cell spheroids.
[0131] In this example, RPE cells were cultured in RPE cell seeding medium (with Y27632), centrifuged, and cultured for 3 days. The relevant dosages were the same as in Example 2. The only difference from Example 2 was that the RPE cell seeding amount was 300 cells and 600 cells.
[0132] The inoculation medium of the present invention is one of the above combinations: 5% recombinant BSA, B27 (1×), 25 mM Niacin, 60 nM EDN3, 50 ng / mL EGF, 5 μM A83-01 and 30 μL / mL T3, and the basal medium is MEM α.
[0133] Procedure: Add Y27632 to the obtained RPE cells and centrifuge at 300 g for 5 minutes. Use a cell culture plate and culture the RPE cells in non-treatable, non-adherent, suspension culture conditions.
[0134] 10 μM Y27632 is added to this protocol to tighten the cells.
[0135] Conclusion As shown in Figure 4, RPE cells can still form spheres at inoculation levels of 300 cells and 600 cells.
[0136] Example 4. Verification of the expansion performance of RPE cell spheres.
[0137] 1. Verification of seeding of single RPE cell spheres.
[0138] In Example 2, the inoculation culture medium was selected: 5% recombinant BSA, B27 (1×), 25 mM Niacin, 60 nM EDN3, 50 ng / mL EGF, 5 μM A83-01 and 30 μL / mL T3, and the basal culture medium was MEM α. The RPE cell spheres obtained after 3 days of culture were used to verify the expansion performance of the RPE cell spheres.
[0139] RPE cell spheres obtained with an initial inoculation amount of 1000-5000 cells were plated and cultured for adherence, and the cell adherence was observed about one week after inoculation.
[0140] 5-7 , the day of RPE cell sphere formation was designated as D0.
[0141] Combined with Figure 5, it can be seen that the RPE cell spheres obtained by centrifugation conditions combined with the use of Y27632 have a tendency to expand outward at D0, but the overall shape is still spherical; and gradually expand as the number of days increases; Combined with Figures 5-7, the RPE cell spheres have good expansion performance when the initial inoculation amount of the RPE cell spheres is 1000-2000 cells in the inoculation stage.
[0142] In summary, this example has verified the effect of the above parameters on the cell state of RPE cells after spheroidization and cell spheroid adhesion. It can be seen that the RPE cell spheroids formed under the above parameter conditions can spread out evenly.
[0143] 2. Verification of simultaneous inoculation of several RPE spherical preparations.
[0144] In order to simulate the in vivo RPE cell sphere attachment state in vitro, the present application adopted several small spheres for verification in the same well.
[0145] In Example 2, the inoculation culture medium was selected: 5% recombinant BSA, B27 (1×), 25 mM Niacin, 60 nM EDN3, 50 ng / mL EGF, 5 μM A83-01 and 30 μL / mL T3, and the basal culture medium was MEM α. The RPE cell spheres obtained after 3 days of culture were used to verify the expansion performance of the RPE cell spheres.
[0146] The RPE cell spheres obtained with an initial inoculation amount of 1500 cells were plated and cultured for adherence, and the cell adherence was observed about one week after inoculation.
[0147] The day of plating was recorded as D0, and the cell morphology was observed about one week after plating. This example also verified the post-plating cell morphology after two or three cell spheroids were placed simultaneously, as shown in Figure 8.
[0148] As shown in Figure 8, on day D0, the cells had not yet begun to spread and were in the state of having just been inoculated into the well plate. On day D1, the cells began to adhere to the wall and spread, and when multiple cell spheroids were inoculated simultaneously, there was no adhesion between the spheroids. On day D5, the cells continued to adhere to the wall and spread, and when multiple cell spheroids were inoculated simultaneously, there was no adhesion between the spheroids. On day D6, the cells were almost completely adhered to the wall and spread, and when multiple cell spheroids were inoculated simultaneously, there was no adhesion between the spheroids. On day D8, the cells were completely adhered to the wall and spread, and when multiple cell spheroids were inoculated simultaneously, there was no adhesion between the spheroids.
[0149] As can be seen from the comparison, no matter whether one RPE cell sphere, two RPE cell spheres or three RPE cell spheres are inoculated simultaneously, no adhesion occurs between the cell spheres, and the RPE cells are evenly expanded all around. As can be seen from Figure 8. Especially on the 6th and 8th day, the entire screen is filled with cells of uniform expansion, and on the 8th day, the cells adhere to the wall completely and expand.
[0150] In this embodiment, only one of the initial inoculum sizes was selected for expansion performance verification. In actual operation, the applicant also verified RPE cells with multiple initial inoculum sizes such as 300, 600, 1000, 1500, 2000, 3000, and 5000. When multiple RPE cell spheres were used for plating, the same technical effects were achieved as in this embodiment when multiple RPE cell spheres were used for plating.
[0151] Example 5: Effects of RPE cells from different sources on RPE cell spheroidization using the same process.
[0152] The process parameters in this example are: 5% recombinant BSA, B27 (1×), 25 mM Niacin, 60 nM EDN3, 50 ng / mL EGF, 5 μM A83-01 and 30 μL / mL T3, and the basal culture medium is MEM α.
[0153] The inoculum size for stage 2 was 1000 cells, 1500 cells, 2000 cells, 3000 cells, 4000 cells, and 5000 cells.
[0154] The source of RPE cells is fRPE cells.
[0155] As shown in FIG9 , by culturing fRPE cells using the process of the present application, compact RPE cell spheres can be obtained at different inoculation doses.
[0156] Example 6: Verification of the Effect of the Selection of RPE Cell Culture Medium and Seeding Medium on RPE Cell Spheroid Formation: In this example, only the RPE cell culture medium and seeding medium were changed between the various protocols to verify the effect on cell spheroid formation. Other process parameters remained the same.
[0157] RPE cell culture medium selection: high glucose DMEM + 20% Knockout serum replacement (KSR) + 1% non-essential amino acid solution + 1mM L-glutamine + 0.1mM β-mercaptoethanol (Source: Wu W, et al. Features specific to retinal pigment epithelium cells derived from three-dimensional human embryonic stem cell cultures - a new donor for cell therapy. Oncotarget. 2016 Apr 19;7(16):22819-33. doi: 10.18632 / oncotarget.8185. PMID: 27009841; PMCID: PMC5008403.).
[0158] The inoculation culture medium includes: 5% recombinant BSA, B27 (1×), 25 mM Niacin, 60 nM EDN3, 50 ng / mL EGF, 5 μM A 83-01 and 30 μL / mL T3. The basal culture medium is MEM α.
[0159] In the following protocol, the cell inoculation volume for stage 2 is 1000 cells in 100 μL. All RPE cells are derived from RPE cells differentiated from pluripotent stem cells. RPE cells are first cultured in each of the two media, then digested to obtain an RPE cell suspension. Spheroids are then inoculated using each of the two media.
[0160] Protocol 1: In stage 1, cells were cultured in RPE cell culture medium for 2 days; in stage 2, spheroids were subsequently cultured in RPE cell culture medium; three parallel experiments were performed.
[0161] Protocol 2: In phase 1, cells were cultured in RPE cell culture medium for 2 days; in phase 2, spheroids were subsequently inoculated in the inoculation medium; three parallel experiments were performed.
[0162] Protocol 3: In stage 1, cells were first cultured in inoculation medium (the inoculation medium used for RPE cell culture at this time) for 2 days; in stage 2, spheres were then inoculated and cultured in RPE cell culture medium; three parallel experiments were performed;
[0163] Protocol 4: In stage 1, cells were first cultured in inoculation medium (the inoculation medium used for RPE cell culture at this time) for 2 days; in stage 2, spheres were subsequently inoculated in inoculation medium; and three parallel experiments were performed.
[0164] After inoculation, the morphology of RPE cells in scheme 1-4 groups were photographed on the 1st, 2nd and 3rd days respectively. The experiment found that cell spheroids were not formed in scheme 1 and scheme 3 groups, while cell spheroids were formed in scheme 2 and scheme 4 groups.
[0165] The results showed that the preparation of RPE cell spheroid preparations was only related to the inoculation medium used in stage 2, and was unrelated to the medium used during the RPE cell culture in stage 1. Moreover, the inoculation medium formula of the present invention was used to form uniformly sized cell spheres. See Figures 10 (day 1 of culture after inoculation) to 12 (day 3 of culture after inoculation) for details.
[0166] Example 7: Verify the effect of the selection of additives in the inoculation culture medium on the spheroidization of RPE cells.
[0167] In Scheme 1, the cell inoculum size was 1000 cells. The inoculation medium used in Example 2 consisted of: 10 μM Y27632, recombinant BSA, B27 (1×), 25 mM Niacin, 60 nM EDN3, 50 ng / mL EGF, 5 μM A83-01, and 30 μL / mL T3. The basal medium was MEMα. The recombinant BSA dosages were 0.01%, 0.25%, 0.5%, 1%, 2.5%, and 5%, respectively. As shown in Figures 13 to 15 , the results show that medium containing 0.25%-5% BSA can form RPE cell spheres.
[0168] In Scheme 2, the cell inoculum size was 1000 cells, and the inoculation medium used included 10 μM Y27632, 5% recombinant BSA, and 10 μM CHIR-99021. The results are shown in Figure 16. Using the same other conditions, the same amount of recombinant BSA, and different additives, RPE cell spheres were also formed.
[0169] Example 8, Immunofluorescence detection of RPE cell sphere adherent growth.
[0170] After the cells reached confluency, the supernatant was aspirated, and the cells were washed once with DPBS. The cells were incubated with 4% paraformaldehyde for 15 minutes at room temperature, followed by three 2-minute washes with DPBS. The cells were then permeabilized with 0.2% Triton-X100 (w / v) for 10 minutes and blocked with 1% bovine serum albumin (BSA) in DPBS for 1 hour at room temperature. The BSA was aspirated and the cells were incubated without washing with the following primary antibodies: mouse monoclonal MITF antibody (1:100 dilution in diluent), rabbit monoclonal BEST1 antibody (1:250 dilution in diluent), rabbit monoclonal Tyrosinase antibody (1:100 dilution in diluent), rabbit monoclonal RPE65 antibody (1:100 dilution in diluent), and rabbit monoclonal ZO-1 antibody (1:100 dilution in diluent). The cells were incubated overnight at 4°C. The sections were then washed three times with PBS for 5 minutes each, followed by the addition of secondary antibodies: 546-labeled goat anti-rabbit IgG (diluted 1:1000 in diluent), 546-labeled goat anti-mouse IgG (diluted 1:1000 in diluent), FITC-labeled goat anti-rabbit IgG (diluted 1:1000 in diluent), and FITC-labeled goat anti-mouse IgG (diluted 1:1000 in diluent) and incubated at room temperature for 2 hours. The sections were then washed three times with DPBS for 5 minutes each, followed by the addition of DAPI staining solution and incubation at room temperature for 15 minutes in the dark. Finally, the sections were washed three times with DPBS for 5 minutes each, and the sections were observed and photographed directly under an inverted fluorescence microscope.
[0171] The adherent cells were plated and cultured with cell pellets formed by inoculating 1500 cells. Immunofluorescence analysis was performed on the 8th day. RPE cells specifically expressed RPE65, MITF, ZO-1, Tyrosinase and BEST1.
[0172] Figure 17 shows immunofluorescence analysis of RPE cell spheroids adherent to the wall, which are detected for (a) RPE65, (b) MITF, (c) ZO-1, (d) Tyrosinase, and (e) BEST1. The cells above showed positive fluorescence expression of RPE65, MITF, ZO-1, Tyrosinase, and BEST1, indicating that the adherent cells are the RPE cells required for this application.
[0173] Example 9, RPE cell sphere detection: RPE cells with seeding sizes of 2000 cells, 1500 cells, 1000 cells, and 600 cells were inoculated and cultured for 3 days. The expression of RPE cell-specific markers and the secretion of functional protein VEGF were detected by flow cytometry, qPCR, and ELISA. iPSCs were set as a negative control group, i.e., a total of 5 groups, namely, the experimental group and the 4 groups:
[0174] iPSC-RPE-1: 2000 cells seeded to form RPE spheres;
[0175] iPSC-RPE-2: 1500 cells seeded to form RPE spheres;
[0176] iPSC-RPE-3: 1000 cells seeded to form RPE spheres;
[0177] iPSC-RPE-4: 600 cells seeded to form RPE spheres;
[0178] iPSC: control group.
[0179] In the following experiments, the number of experimental cells used in each group was consistent to ensure the stability of the experiments.
[0180] Flow Cytometry:
[0181] After collecting RPE cell spheres, they were digested and the single-cell suspension was washed once with DPBS. The suspension was then incubated with 4% paraformaldehyde (v / v) at room temperature for 10 minutes, washed once with DPBS, centrifuged, and the supernatant discarded. The suspension was then permeabilized with 0.2% Triton-X100 (w / v) for 10 minutes, washed once with DPBS, centrifuged, and the supernatant discarded. The suspension was blocked with 1% bovine serum albumin (BSA) in DPBS at room temperature for 30 minutes. After centrifugation and aspiration of the BSA, the suspension was incubated with FITC-conjugated PAX6 antibody for 0.5 hours at room temperature, washed once with PBS, and the supernatant discarded. The suspension was then loaded into a flow cytometer for analysis. For MITF and RPE65, the primary antibodies (mouse monoclonal MITF antibody at a 1:100 dilution in diluent) and rabbit monoclonal RPE65 antibody at a 1:100 dilution in diluent) were added without washing and incubated overnight at 4°C. The cells were then washed once with PBS and incubated with secondary antibodies: FITC-conjugated goat anti-mouse IgG (1:1000 dilution in diluent) and PE-conjugated goat anti-rabbit IgG (1:1000 dilution in diluent) for 1 hour at room temperature. The cells were then washed once with PBS, the supernatant discarded, and DPBS added for analysis on a flow cytometer.
[0182] The expression levels of RPE65, MITF, and PAX6 in the RPE of the experimental 4 groups and the iPSC cells of the control group were detected by flow cytometry. It was found that the expression of RPE-65 in the RPE of the experimental 4 groups was around 99%, as shown in Figure 18, (a) iPSC (0%), (b) iPSC-RPE-1 (98.52%), (c) iPSC-RPE-2 (99.69%), (d) iPSC-RPE-3 (99.45%), and (e) iPSC-RPE-4 (99.75%). The expression of MITF in the RPE of the experimental 4 groups was also not much different, and the expression was high, with the highest expression of 99.86%, as shown in Figure 19, (a) iPSC (0%), (b) iPSC-RPE-1 (99.86%). , (c) iPSC-RPE-2 (98.45%), (d) iPSC-RPE-3 (97.35%), and (e) iPSC-RPE-4 (98.56%). PAX6 expression in RPE of the four experimental groups was similar and high, reaching a maximum of 99.22%, as shown in Figure 20 , (a) iPSC (0%), (b) iPSC-RPE-1 (98.35%), (c) iPSC-RPE-2 (98.73%), (d) iPSC-RPE-3 (99.12%), and (e) iPSC-RPE-4 (99.22%). None of the iPSC controls expressed PAX6.
[0183] Real-time quantitative polymerase chain reaction (qPCR) detection:
[0184] Total RNA was extracted from each cell group using an RNA extraction kit (Novozymes, China). OD values were measured to ensure that the OD 260 / OD 280 ratio for each group was between 1.8 and 2.1 to ensure purity. RNA was then reverse-transcribed into cDNA using a reverse transcription kit (Novozymes, China). The reaction system and protocol were described in the product manual. The resulting cDNA was used for qPCR. Primer sequences are shown in Table 2. The reaction system was described in the SYBR Green Mix kit (Bio, USA) manual. After centrifugation, the reaction was placed in a microplate reader. Denaturation was performed at 95°C for 5 minutes, and the reaction was repeated for 40 cycles (94°C for 30 seconds; 59°C for 30 seconds; and 72°C for 30 seconds). Two μL of the reaction product was pipetted and added to 3 μL of SYBR Green Mix, mixed thoroughly, and then placed in a microplate reader.
[0185] Table 2 Primer sequences
[0186] Primer sequence (5' to 3')GAPDH-FSEQ ID No.1: GGACGAGATCCCTCCAAAATGAPDH-RSEQ ID No.2: GGCTGTTGTCATACTTCTCATGGRPE65-FSEQ ID No.3: TTGGATCTGAGCCATTTTACCACRPE65-RSEQ ID No.4: GTCAGTAACCTCTACTCCTCGAAMITF-FSEQ ID No.5: TGCCCAGGCATGAACACACMITF-RSEQ ID No.6: TGGGAAAAATACACGCTGTGAGPAX6-FSEQ ID No.7: CCAGGGCAATCGGTGGTAGTPAX6-RSEQ ID No.8: ACGGGCACTCCCGCTTATACBEST1-FSEQ ID No.9: AACTGAGCCTACCACACAACABEST1-RSEQ ID No.10: CGGATTCGACCTCCAAGCC
[0187] Note: F: Forward primer; R: Reversed primer; the product sequence length of the primer for the GAPDH gene is 197bp; the product sequence length of the primer for the RPE65 gene is 236bp; the product sequence length of the primer for the MITF gene is 276bp; the product sequence length of the primer for the PAX6 gene is 84bp; the product sequence length of the primer for the BEST1 gene is 88bp.
[0188] RPE65, MITF, PAX6 and BEST1 were used to detect the expression levels of RPE, and GAPDH was used as an internal reference gene to correct and normalize the expression of target genes.
[0189] The results showed that compared to the iPSC control group, all four iPSC-RPE experimental groups expressed RPE65, MITF, BEST1, and PAX6, and the expression levels among the four groups were similar, indicating the specificity and stability of the formed RPE spheres. See Figure 21 for details.
[0190] ELISA test:
[0191] The supernatants of the four iPSC-RPE experimental groups and the iPSC control group, which had been cultured for 2 days, were assayed using a human VEGF ELISA kit (Thermo Fisher Scientific, USA). The following experimental steps were as follows: Antigen diluted in coating solution (1:250 dilution) was added to the microplate for overnight coating. The plates were removed the next day, washed, and blocked with ELISA working solution for 1 hour at room temperature. After washing, standards and corresponding samples were added to each well and incubated at room temperature for 2 hours. After washing, primary antibody was added (1:250 dilution) at room temperature for 1 hour. After washing, enzyme-linked secondary antibody was added (1:250 dilution) at room temperature for 30 minutes. After washing, substrate solution (TMB) was added for color development and incubated at room temperature for 10 minutes. Finally, stop solution (2 mol / L H₂SO₄) was added to each well to terminate the reaction, and detection was performed using a microplate reader.
[0192] The experimental results showed that compared to the iPSC control group, the culture supernatants of all four iPSC-RPE experimental groups expressed significant amounts of VEGF (>1500 pg / mL), and the VEGF secretion levels of the RPE cells in the four groups were similar, demonstrating the specificity and stability of the formed RPE spheres. (See Figure 22 for details.) Industrial Applicability
[0193] The present application proposes the RPE cell sphere concept and develops a preparation process for obtaining RPE cell spheres for the first time. The RPE cell spheres can be spherical in vitro and have the potential to automatically expand into a single layer of RPE cell layers in vivo / in vitro. The RPE cell spheres obtained by the present application have the characteristics of avoiding subretinal injection leakage and convenient injection; At the same time, it can also ensure that RPE cells can be evenly expanded. At the same time, the RPE cell spheres of the present application are controllable in size and cell number, and the preparation process is highly repeatable and can meet clinical stability requirements. Ultimately, the RPE cell spheres obtained by the process of the present application can be used for AMD treatment and meet clinical use requirements.
Claims
1. A spherical preparation of retinal pigment epithelial cells, characterized in that, The spherical preparation of retinal pigment epithelial cells is obtained by the following method: Step 1: Obtain RPE cells; Step 2: The RPE cells are inoculated into a cell culture plate through an inoculation medium, centrifuged and precipitated, and then cultured to form RPE cell spheres with uniform size by the aggregation of several RPE cells.
2. The spherical preparation of retinal pigment epithelial cells according to claim 1, wherein The RPE cells are fRPE or RPE cells differentiated from pluripotent stem cells.
3. The spherical preparation of retinal pigment epithelial cells according to claim 2, wherein, The pluripotent stem cells are induced pluripotent stem cells or embryonic stem cells; the pluripotent stem cells are human-derived pluripotent stem cells, mouse-derived pluripotent stem cells, or monkey-derived pluripotent stem cells.
4. A spherical preparation of retinal pigment epithelial cells according to claim 1, characterized in that, Step 1 further includes: after obtaining the RPE cells, culturing the RPE cells in an RPE medium for 0-10 days.
5. A spherical preparation of retinal pigment epithelial cells according to claim 1, wherein, The inoculation medium contains 1-100 μM of Y27632.
6. The spherical preparation of retinal pigment epithelial cells according to claim 1, wherein The inoculation medium includes additives; the additives contain any one of 0.25-5% of FBS, KSR, HSA, BSA, recombinant BSA, or recombinant HSA.
7. A spherical preparation of retinal pigment epithelial cells according to claim 6, characterized in that, The additives further include: Any one of N2 (1×) or B27 (1×); Any one of 1-100 mM of Nicotinamide, Niacin, Niacin hydrochloride, or L-Tryptophan; 10-200 nM of EDN3; any one of 1-100 ng / mL of FGF2 or EGF; Any one of 1-100 μM of SB431542, A 83-01, Lefty-A, or LY2157299, and 1-100 μM of T3.
8. A spherical preparation of retinal pigment epithelial cells according to claim 6, characterized in that, The additives include a dosage of 1-100 μM of CHIR-99021.
9. A spherical preparation of retinal pigment epithelial cells according to claim 1, wherein, The inoculation medium includes a basal medium; the basal medium is any one of MEM, DMEM, Ham’s F12, DMEM / F12, RPMI-1640, MEM α, IMDM, E6, E8.
10. A spherical preparation of retinal pigment epithelial cells according to claim 1, characterized in that, In Step 2, the RPE cells are cultured by suspension inoculation.
11. A spherical preparation of retinal pigment epithelial cells according to claim 1, characterized in that, In Step 2, when the RPE cells are cultured based on the inoculation medium, the initial inoculation amount of the RPE cells per well is 300-5000 cells, and the diameter of the formed RPE cell spheres is 50-400 μm.
12. A spherical preparation of retinal pigment epithelial cells according to claim 1, characterized in that, The RPE cell preparation has the following performance: that is, several RPE cell spheres are plated in a single well of the same cell culture plate for 1-8 days, and there is no adhesion between each RPE cell sphere, and each RPE cell sphere can achieve adherent expansion.
Citation Information
Patent Citations
Recombinant microorganism having increased d(-) 2,3-butanediol productivity, and method for producing d(-) 2,3-butanediol by using same
CN105829527A
Three-dimensional cell structure and method for producing the same
JP2020202785A
Substantially pure human retinal progenitor, forebrain progenitor, and retinal pigment epithelium cell cultures and methods of making the same
US20110081719A1
Cell Aggregate Including Retinal Tissue and Production Method Therefor
US20200206387A1
Hollow three-dimensional unit made from retinal tissue and use thereof in the treatment of retinopathies
US20220273727A1
Cited By
Method for preparing retinal pigment epithelial cells through induced differentiation
CN122235069A