Engineered 2-pyrone synthases, methods of use thereof for producing polyketides, polyketide precursors, polyketide derivatives, or a combination thereof, and compositions comprising the same

Abstract

Disclosed herein are compositions and methods of use thereof. For example, described herein are engineered 2-pyrone synthases, methods of use thereof for producing polyketides, polyketide precursors, polyketide derivatives, or a combination thereof, and compositions comprising the same.

Description

[0001] ENGINEERED 2-PYRONE SYNTHASES, METHODS OF USE

[0002] THEREOF FOR PRODUCING POLYKETIDES, POLYKETIDE PRECURSORS, POLYKETIDE DERIVATIVES, OR A COMBINATION

[0003] THEREOF, AND COMPOSITIONS COMPRISING THE SAME

[0004] SEQUENCE LISTING

[0005] The sequence listing submitted on December 27, 2024, as an .XML file entitled “10046- 591W01_SEQ.xml” created on December 27, 2024, and having a file size of 57,090 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5).

[0006] CROSS-REFERENCE TO RELATED APPLICATIONS

[0007] This application claims the benefit of priority to U.S. Provisional Application No. 63 / 615,933, filed December 29, 2023, which is hereby incorporated herein by reference in its entirety.

[0008] BACKGROUND

[0009] Polyketides are natural products with rich biological activities. However, many of these compounds are produced by their native plant hosts in a limited amount, which is far below the market demand. There is a strong need to produce such polyketides in great amount without the reliance of native enzymes. The compositions and methods discussed herein address these and other needs.

[0010] SUMMARY

[0011] In accordance with the purposes of the disclosed compositions and methods as embodied and broadly described herein, the disclosed subject matter relates to compositions and methods of use thereof. For example, described herein are engineered 2-pyrone synthases, methods of use thereof for producing polyketides, polyketide precursors, polyketide derivatives, or a combination thereof, and compositions comprising the same.

[0012] For example, disclosed herein are methods for producing a product, the method comprising contacting one or more reactants with an engineered 2-pyrone synthase to thereby produce the product, wherein the product is a polyketide or a salt thereof, a polyketide precursor or a salt thereof, a polyketide derivative or a salt thereof, or a combination thereof. In some examples, the method is further performed in the presence of one or more additional enzymes, such as one or more native enzy mes, for example malonyl-CoA synthetase and / or 4-coumaroyl- CoA ligase. In some examples, at least one of the one or more reactants comprises an aromatic acid, such as p-coumaric acid and / or cinnamic acid. In some examples, at least one of the one or more reactants comprises an aromatic-CoA, or a derivative thereof. In some examples, at least one of the one or more reactants comprises malonyl-CoA. In some examples, the method comprises contacting p-coumaric acid and / or cinnamic acid, or a derivative thereof, with malonyl-CoA using the engineered 2-pyrone synthase. In some examples, at least one of the one or more reactants comprises triacetic acid lactone, or a derivative or salt thereof.

[0013] In some examples, the product comprises a kavalactone or a salt thereof, a kavalactone precursor or a salt thereof, a raspberry ketone or a salt thereof, a raspberry ketone precursor or a salt thereof, or a combination thereof. In some examples, the product comprises a diketide, a triketide, a tetraketide, or a combination thereof. In some examples, the product comprises triacetic acid lactone or a derivative or salt thereof. In some examples, the product comprises p- hydroxybenzalacetone or a salt thereof, p-coumaroyltri acetic acid lactone or a salt thereof, 6- styiy l-4-hydroxy-2-pyrone or a salt thereof, bisnoryangonin or a salt thereof, or a combination thereof. In some examples, the product comprises a kavalactone or a salt thereof, a kavalactone precursor or a salt thereof, or a combination thereof.

[0014] In some examples, the product comprises bisnoryangonin (a kavalactone precursor) or a salt thereof. In some examples, the method comprises bisnoryangonin production from p- coumaric acid.

[0015] In some examples, the product comprises a styrylpyrone (a kavalactone precursor).

[0016] In some examples, the product comprises yangonin.

[0017] In some examples, the product comprises a raspberry ketone or a salt thereof, a raspberry ketone precursor or a salt thereof, or a combination thereof. In some examples, the product comprises benzalacetone (a raspberry ketone precursor) or a salt thereof.

[0018] In some examples, the product comprises 7,8-dihydroxyflavone; (2S)-3’,7-Dihydroxy-8- methyl-4’ -methoxy flavan; hesperetin dihydrochalcone; neohesperidin dihydrochalcone; or a combination thereof.

[0019] In some examples, the method produces 1 mg or more (e.g., 100 mg or more, or 200 mg or more) of the product per liter within 24 hours.

[0020] In some examples, the engineered 2-pyrone synthase comprises any one the engineered 2-pyrone synthases of SEQ ID NOS: 2-8. In some examples, the engineered 2-pyrone synthase comprises any one of the engineered 2-pyrone synthases of SEQ ID Nos: 4-5 or 7-8.

[0021] In some examples, the engineered 2-pyrone synthase is at least 80% identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation at position LI 10, 1201, L202, L219, V237, L261, L342, 1343, and / or E353.

[0022] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position LI 10, 1201, L202, L219, V237, L261, L342, 1343, and / or E353.

[0023] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position 1201, L202, L261, and / or 1343. In some examples, SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position LI 10, L219, and / or E353. In some examples, SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position V237 and / or L342.

[0024] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position 1201, L202, L261, and / or 1343 and SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position LI 10, L219, and / or E353.

[0025] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position 1201, L202, L261, and / or 1343 and SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position V237 and / or L342.

[0026] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position L261. In some examples, SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position LI 10, L219, and / or E353. In some examples, SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position V237 and / or L342.

[0027] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position L261 and SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position LI 10, L219, and / or E353.

[0028] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position L261 and SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position V237 and / or L342.

[0029] In some examples, the engineered 2-pyrone synthase is at least 80% identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, 1343 A, and / or I343L. In some examples, SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353. In some examples, the engineered 2-pyrone synthase is at least 80% identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, 1343 A, and / or I343L, and SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

[0030] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, I343A, and / or I343L. In some examples, SEQ ID NO: 1 further comprising at least one synonymous mutation at LI 10 and / or E353. In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, I343A, and / or I343L and SEQ ID NO: 1 further comprising at least one synonymous mutation at LI 10 and / or E353.

[0031] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of 1201 V, L202G, L261G, and / or I343L.

[0032] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201V, L202C, L219I, L261G, and / or I343W. In some examples, SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353. In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2- pyrone synthase comprises at least one mutation consisting of I201V, L202C, L219I, L261G, and / or I343W, and SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353

[0033] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

[0034] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201V, L202G, L261G, and / or I343A.

[0035] In some examples, the engineered 2-pyrone synthase is a component of a fusion protein.

[0036] In some examples, the engineered 2-pyrone synthase is a purified enzyme.

[0037] In some examples, the engineered 2-pyrone synthase is a partially purified enzyme.

[0038] In some examples, the engineered 2-pyrone synthase is produced by a recombinant cell line.

[0039] In some examples, the engineered 2-pyrone synthase is in a vector.

[0040] In some examples, the engineered 2-pyrone synthase is obtained from a non-human organism. In some examples, the non-human organism is selected from the group consisting of bacteria, yeast, and plant. In some examples, the non-human organism is genetically engineered.

[0041] In some examples, the engineered 2-pyrone synthase is in a cell. In some examples, the cell is a bacterial cell, such as an Escherichia coli cell. In some examples, the cell is a yeast cell, such as a Saccharomyces cerevisiae cell. In some examples, the cell is a plant cell, such as a transgenic plant cell, aNicotiana Benthamiana cell, aArabidopsis thaliana cell, or a combination thereof. In some examples, the engineered 2-pyrone synthase is heterologous to the cell. In some examples, the cell is in an organism selected from the group consisting of bacterial, yeast, and plant.

[0042] In some examples, the method is performed in vivo.

[0043] In some examples, the method is performed in vitro.

[0044] Also disclosed herein are nucleic acids, for example nucleic acids that encode an engineered 2-pyrone synthase, such as any of the engineered 2-pyrone synthases described herein. Also disclosed herein are vectors comprising any of the nucleic acids described herein.

[0045] Also disclosed herein are engineered 2-pyrone synthases.

[0046] For example, also described herein are engineered 2-pyrone synthases, wherein the engineered 2-pyrone synthase comprises any one the engineered 2-pyrone synthases of SEQ ID NOS: 2-8. In some examples, the engineered 2-pyrone synthase comprises any one of the engineered 2-pyrone synthases of SEQ ID Nos: 4-5 or 7-8.

[0047] In some examples, the engineered 2-pyrone synthase is at least 80% identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation at position LI 10, 1201, L202, L219, V237, L261, L342, 1343, and / or E353.

[0048] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position LI 10, 1201, L202, L219, V237, L261, L342, 1343, and / or E353.

[0049] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position 1201, L202, L261, and / or 1343. In some examples, , wherein SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position LI 10, L219, and / or E353. In some examples, SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position V237 and / or L342. In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position 1201, L202, L261, and / or 1343, and wherein SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position LI 10, L219, and / or E353.

[0050] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position 1201, L202, L261, and / or 1343, and wherein SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position V237 and / or L342.

[0051] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position L261. In some examples, SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position LI 10, L219, and / or E353. In some examples, SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position V237 and / or L342.

[0052] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position L261, and wherein SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position LI 10, L219, and / or E353.

[0053] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position L261, and wherein SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position V237 and / or L342.

[0054] In some examples, the engineered 2-pyrone synthase is at least 80% identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, 1343 A, and / or I343L. In some examples, SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353. In some examples, the engineered 2-pyrone synthase is at least 80% identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, I343A, and / or I343L, and SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

[0055] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, I343A. and / or I343L. In some examples, SEQ ID NO: 1 further comprising at least one synonymous mutation at LI 10 and / or E353. In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, 1343 A, and / or I343L, and SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

[0056] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of 1201 V, L202G, L261G, and / or I343L.

[0057] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201V, L202C, L219I, L261G, and / or I343W. In some examples, SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353. In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2- pyrone synthase comprises at least one mutation consisting of I201V, L202C, L219I, L261G, and / or I343W, and SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

[0058] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

[0059] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201V, L202G, L261G, and / or I343A.

[0060] Also disclosed herein are cells comprising any of the engineered 2-pyrone synthases described herein. Also disclosed herein are cells comprising any of the vectors described herein.

[0061] Also disclosed herein are the products made by any of the methods described herein. In some examples, the product is a cell isolate. In some examples, the product is a bacterial cell isolate, a yeast cell isolate, a plant cell isolate, or a combination thereof. In some examples, the product exhibits anticancer activity, antimicrobial activity, antioxidant activity, anti- inflammatory activity, or a combination thereof. In some examples, the product has a flavor. In some examples, the product has a fragrance.

[0062] Also disclosed herein are compositions comprising any of the products described herein.

[0063] Also disclosed herein are flavoring compositions comprising any of the products described herein.

[0064] Also disclosed herein are fragrance compositions comprising any of the products described herein.

[0065] Also disclosed herein are pharmaceutical compositions comprising any of the products described herein. In some examples, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier, a pharmaceutically acceptable diluent, a pharmaceutically acceptable excipient, or a combination thereof.

[0066] Also disclosed herein are composition comprising any of the products or pharmaceutical compositions disclosed herein.

[0067] Also disclosed herein are methods of use of any of the products or compositions described herein. In some examples, the method comprises using the product or composition as a flavoring, as a fragrance, or a combination thereof.

[0068] Also disclosed herein are methods of treating a disease or disorder in a subject in need thereof, the methods comprising administering to the subject a therapeutically effective amount of any of the products or compositions described herein. In some examples, the disease or disorder comprises cancer, a microbial infection, an inflammatory disease or disorder, an anxiety disorder, insomnia, other psychological and neurological disorders, or a combination thereof.

[0069] Additional advantages of the disclosed compositions and methods will be set forth in part in the description which follows, and in part will be obvious from the description. The advantages of the disclosed compositions and methods will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the disclosed compositions and methods, as claimed.

[0070] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.

[0071] BRIEF DESCRIPTION OF THE FIGURES

[0072] The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several aspects of the disclosure, and together with the description, serve to explain the principles of the disclosure.

[0073] Figure lA-Figure ID. Construct in vivo cascade reactions for the directed evolution of polyketide biosynthesis. (Figure 1A) Organic synthesis for the exact target compounds of directed evolution study. (Figure IB) Simplified organic synthesis route to synthesize homologs that mimic the target compounds. (Figure 1C) In situ generation of the target biomolecules of directed evolution study by in vivo cascades. (Figure ID) Key enzymes in the natural polyketide biosynthesis pathway and their function. Native enzymes are shown in red. 2PS mutants in this study are shown in blue with their nonnative functions. BAS, benzalacetone synthase

[0024] ; SPS, styrylpyrone synthase

[0020] ; CHS, chai cone synthase

[0018] ; CTAL, coumaroyl triacetic acid lactone synthase

[0025] ,

[0074] Figure 2A-Figure 2F. Directed evolution study of 2PS and 4CL for enhanced sty rylpyrone production. (Figure 2A) Active site residues of 2PS (PDB 1EE0). The bound intermediate acetoacetyl-CoA is shown in surface. (Figure 2B) Directed evolution result summary of bisnoryangonin (3) production for the key four mutants. The left y-axis represents product (3) titer, and the right y-axis is the biotransformation yield (the amount of product divided by its theoretical maximum). (Figure 2C) The relationship between 2PS mutants and biocatalytic performances (titer and catalytic efficiency of various substrates). (Figure 2D) Representative E. coli metabolism for malonyl-CoA production, its consumption for fatty acid biosynthesis and polyketide biosynthesis. (Figure 2E) Active site residues of At4CL (in cyan, PDB 5BST) and Nt4CL bound with the intermediate p-coumaroyl-AMP (in orange, PDB 3TSY). (Figure 2F) Directed evolution result summary for the biotransformation of cinnamic acid. Yield is calculated based on the actual product concentration quantified by HPLC divided by the theoretical maximum providing 1 mM aromatic acid.

[0075] Figure 3A-Figure 3D. Directed Evolution of 2PS for chemoselective benzalacetone and tetraketide production. (Figure 3A) Native BAS function to generate / i-hydroxybenzalacetone (2). (Figure 3B) Overlaid structure between I201V / L202C / L219I / L261G / I343W-2PS (SEQ ID NO: 6) and native BAS (PDB 3A5Q). (Figure 3C) Directed evolution result summary about the key four mutants and BAS for diketide production. (Figure 3D) One single 343 residue influenced the chemoselective of polyketide biosynthesis. Concentration calculated by the conservation of mass (1 mM theoretical maximum aromatic polyketide product minus the amount of aromatic triketide and leftover aromatic acid).2Not detected.

[0076] Figure 4A-Figure 4D. Protein ligand docking analysis and chemoenzymatic biosynthesis of kavalactones. (Figure 4A) tetraketide product (4) interaction with I201V / L202G / L261G / I343A-2PS mutant (SEQ ID NO: 4). Gly202 and Gly261 were colored in surface. (Figure 4B) triketide product (3) interaction with I201V / L202G / L261G / I343L-2PS (SEQ ID NO: 5) mutant. (Figure 4C) diketide product (2) interaction with I201V / L202G / L261G / I343W-2PS mutant (SEQ ID NO: 3). (Figure 4D) chemoenzymatic synthesis of various kavalactones. 'Yield was shown in brackets.2Titer was estimated based on the calibration curve of product (2).

[0077] Figure 5A-Figure 5C. 2PS structure, catalytic mechanism and its comparison with various PKSs. (Figure 5A) Homodimer 2PS crystal structure bound with intermediate acetoacetyl-CoA (PDB 1EE0). (Figure 5B) The catalytic mechanism of each round of chain elongation including loading, decarboxylation and condensation step. (Figure 5C) Multiple sequence alignment between 2PS (SEQ ID NO: 1 represents wild type 2PS) and other PKSs (SEQ ID NOS: 9-15). Sequences were collected from NCBI database GenBank. CUS, curcuminoid synthase (SEQ ID NO: 9); DCS, diketide CoA synthase (SEQ ID NO: 10); BAS, benzalacetone synthase (SEQ ID NO: 11); CT AL. p-coumaroyl tri acetic acid lactone synthase (SEQ ID NO: 12); SPS, styrylpyrone synthase (SEQ ID NO: 13); STS, stilbene acid synthase (SEQ ID NO: 14); CHS, chaicone synthase (SEQ ID NO: 15).

[0078] Figure 6. Time-dependent study of in vivo biotransformation from p-coumaric acid to bisnoryangonin by 3k-2PS.

[0079] Figure 7A-Figure 7C. Product separation and identification by HPLC. (Figure 7A) Analytical standards of substrate, diketide, triketide and tetraketide products. (Figure 7B) Table summary of the compound, its retention time and the HPLC detection wavelength. (Figure 7C) HPLC spectrum for I201V / L202G / L261G / I343A (SEQ ID NO: 4) generating tetraketide and I201V / L202G / L261G / I343W (SEQ ID NO: 3) generating diketide, ' / i-coumaroyltriacetic acid lactone product was assigned based on retention time, LC-MS and comparison with other tetraketide products.

[0080] Figure 8A-Figure 8E. Protein ligand interaction diagram. (Figure 8A) Tetraketide product interaction with I201V / L202G / L261G / I343A (SEQ ID NO: 4). (Figure 8B) Triketide product interaction with I201V / L202G / L261G / I343L (SEQ ID NO: 5). (Figure 8C) Diketide product interaction with I201V / L202G / L261G / I343W (SEQ ID NO: 3). (Figure 8D) Triketide product failed to be docked successfully into the active site of I201V / L202G / L261G / I343W (SEQ ID NO: 3). (Figure 8E) Tetraketide product failed to be docked successfully into the active site of I201V / L202G / L261G / I343L (SEQ ID NO: 5). The purple surface showed Phe220, Phe270 and Ile343, which blocked the entrance of tetraketide product into the chain elongation site. The correct result for tetraketide docking is shown in atoms colored in green and red.

[0081] Figure 9A-Figure 9B. Kinetic studies of I201V / L202T / L261G / I343S (SEQ ID NO: 16) (Figure 9A) Michaelis-Menten plot for malonyl-CoA (Figure 9B) Michaelis-Menten plot for p- coumaroyl-CoA.

[0082] Figure lOA-Figure 10B. Kinetic studies of I201V / L202G / L261G / I343S (SEQ ID NO: 17) (Figure 10A) Michaelis-Menten plot for malonyl-CoA. (Figure 10B) Michaelis-Menten plot for / i-coumaroyl-CoA.

[0083] Figure HA-Figure 1 IB. Kinetic studies of I201V / L202G / L261G / I343L (SEQ ID NO: 5) (Figure 11A) Michaelis-Menten plot for malonyl-CoA. (Figure 1 IB) Michaelis-Menten plot for / j-coumaroyl-CoA.

[0084] Figure 12A-Figure 12B. Kinetic studies of 3k-2PS (I201L / L202G / V237I / L261G / L342M / I343L) (SEQ ID NO: 8) (Figure 12A) Michaelis-Menten plot for malonyl-CoA. (Figure 12B) Michaelis-Menten plot for p-coumaroyl-CoA.

[0085] Figure 13A-Figure 13B. Kinetic studies of 4CL mutants (Figure 13A) Michaelis-Menten plot for cinnamic acid with K333L-4CL. (Figure 13B) Michaelis-Menten plot for cinnamic acid with WT-4CL.

[0086] Figure 14A-Figure 14B. Characteristic LC-MS spectrum for tnketide product (3) and tetraketide product (4). (Figure 14A) Extracted ion chromatography in negative mode showing tetraketide mass signal in LC-MS. (Figure 14B) Extracted ion chromatography in negative mode showing triketide mass signal in LC-MS.

[0087] Figure 15. TLC analysis of chemoenzymatic methylation. (I) biotransformation system. (II) a mixture of I and III. (Ill) Methylation reaction system. (IV) similar methylated product standard.

[0088] Figure 16. Standard Curve for yield and titer quantification of various substrates and products.

[0089] Figure 17.JH NMR spectrum of demethoxyyangonin.

[0090] Figure 18.13C NMR spectrum of demethoxyyangonin.

[0091] Figure 19. 1H NMR spectrum of Yangonin.

[0092] Figure 20.13C NMR spectrum of Yangonin.

[0093] Figure 21.JH NMR spectrum of (E)-4-methoxy-6-(4-methylstyryl)-2H-pyran-2-one.

[0094] Figure 22.13C NMR spectrum of (E)-4-methoxy-6-(4-methylstyryl)-2H-pyran-2-one.

[0095] Figure 23.JH NMR spectrum of (E)-6-(4-fluorostyryl)-4-methoxy-2H-pyran-2-one.

[0096] Figure 24.13C NMR spectrum of (E)-6-(4-fluorostyryl)-4-methoxy-2H-pyran-2-one.

[0097] Figure 25.19F NMR spectrum of (E)-6-(4-fluorostyryl)-4-methoxy-2H-pyran-2-one.

[0098] Figure 26. NMR spectrum of 7,8-dihydroyangonin.

[0099] Figure 27.13C NMR spectrum of 7,8-dihydroyangonin.

[0100] Figure 28A-Figure 28B. Apply directed evolution for diverse polyketide biosynthesis among different organisms. (Figure 28A) Protein engineenng for applications in vitro, in model / non-model microorganisms and in high-level organisms such as plants. (Figure 28B) Key enzymes in the natural polyketide biosynthesis pathway and their function. Native enzymes are shown in red. 2PS mutants in this study are shown in blue with their normative functions. BAS, benzalacetone synthase; SPS, styrylpyrone synthase; CHS, chai cone synthase; CTAL, coumaroyl triacetic acid lactone synthase.

[0101] Figure 29A-Figure 29E. Bisnoryangonin and kavalactone bioproduction by modified E. coll, plants as well as by chemoenzymatic methods. (Figure 29 A) Representative plant metabolism for aromatic-CoA and malonyl-CoA production and consumption. (Figure 29B) Modified E. coll metabolism by integrating MC'CR. from the plant lignin biosynthesis. (Figure 29C) Bisnoryangonin production in modified E. coli metabolism. (Figure 29D) Yangonin bioproduction comparison for the 4 key mutants in N. Benthamiana. The y-axis represents ion counts of yangonin from the extracted ion chromatography in LC / MS, normalized by the protein expression level analyzed by Western Blot. Data were collected from at least six samples distributed in three individual plants. The box covers 25%-75% of the value and the whisker represents the standard deviation. The line in the box represents the mean value. Statistical significance was determined by unpaired two-tailed student’s t-test; * P<0.05; ** P<Q.O 1 ; *** PO.OOl; (P = 0.000154, 0.00778 and 0.00658 separately). (Figure 29E) Chemoenzymatic synthesis of various kavalactones.1K333L-4CL was used rather than WT-4CL, due to its higher catalytic efficiency towards cinnamic acid.2Yield was shown in brackets.2Titer was estimated based on the calibration curve of product (3). Data are from two individual experiments.

[0102] Figure 30. SDS-page gel analysis of protein purity.

[0103] Figure 31A-Figure 31C. Reactivity confirmation for MCCR. (Figure 31A) The color change of LB medium after adding p-coumaric acid to E. coli expressing MCCR. The left tube contained / ?-coumanc acid; the right one did not. (Figure 3 IB) LC-MS confirmation of the aldehyde product. (Figure 31C) Michaelis-Menten plot for p-coumaroyl-CoA.

[0104] Figure 32A-Figure 32B. Protein expression level analysis by Western Blot. (Figure 32A) Western blot assays to examine 2PS protein expression levels in tobacco leaves. Total protein extracts from transfected tobacco leaves with different constructs were subjected to immunoblotting against anti -HA antibody. Ponceau red staining of RuBisCo was used as an internal loading control (lower panels). (Figure 32B) The summary of four biological replicates of the 2PS protein levels relative abundances. Error bars indicate the SD (n = 4) and the relative intensity value from each replicate is plotted as a dot. Statistical significance was determined by unpaired two-tailed Student’s t-test (ns, not significant).

[0105] Figure 33. Yangonin bioproduction comparison between I201V / L202G / L261G / I343L- 2PS (SEQ ID NO: 5) and WT-SPS in N. Benthamiana. Data were collected from at least six samples distributed in three individual plants. The box covers 25%-75% of the value and the whisker represents the standard deviation. The line in the box represents the mean value. Statistical significance was determined by unpaired two-tailed Student’s t-test; *** P<0.001 (P = 0.00015 and 0.00012 separately). I201V / L202G / L261G / I343L-2PS (SEQ ID NO: 5) showed 8.9-fold and 10.7-fold improvement than SPS1 and SPS2, respectively.

[0106] DETAILED DESCRIPTION

[0107] The compositions and methods described herein may be understood more readily by reference to the following detailed description of specific aspects of the disclosed subject matter and the Examples included therein.

[0108] Before the present compositions and methods are disclosed and described, it is to be understood that the aspects described below are not limited to specific synthetic methods or specific reagents, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting.

[0109] Also, throughout this specification, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which the disclosed matter pertains. The references disclosed are also individually and specifically incorporated by reference herein for the material contained in them that is discussed in the sentence in which the reference is relied upon.

[0110] General Definitions

[0111] In this specification and in the claims that follow, reference will be made to a number of terms, which shall be defined to have the following meanings.

[0112] Throughout the description and claims of this specification the word “comprise” and other forms of the word, such as “comprising” and “comprises,” means including but not limited to, and is not intended to exclude, for example, other additives, components, integers, or steps.

[0113] As used in the description and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a composition” includes mixtures of two or more such compositions, reference to “an agent” includes mixtures of two or more such agents, reference to “the component” includes mixtures of two or more such components, and the like.

[0114] “Optional” or “optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0115] Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. By “about” is meant within 5% of the value, e.g., within 4, 3, 2, or 1% of the value. When such a range is expressed, another aspect includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint.

[0116] “Exemplary” means “an example of’ and is not intended to convey an indication of a preferred or ideal embodiment. “Such as” is not used in a restrictive sense, but for explanatory purposes.

[0117] Values can be expressed herein as an “average” value. “Average” generally refers to the statistical mean value.

[0118] By “substantially” is meant within 5%, e.g., within 4%, 3%, 2%, or 1%.

[0119] It is understood that throughout this specification the identifiers “first” and “second” are used solely to aid in distinguishing the various components and steps of the disclosed subject matter. The identifiers “first” and “second” are not intended to imply any particular order, amount, preference, or importance to the components or steps modified by these terms.

[0120] References in the specification and concluding claims to parts by weight of a particular element or component in a composition denotes the weight relationship between the element or component and any other elements or components in the composition or article for which a part by weight is expressed. Thus, in a compound containing 2 parts by weight of component X and 5 parts by weight component Y, X and Y are present at a weight ratio of 2:5, and are present in such ratio regardless of whether additional components are contained in the compound.

[0121] A weight percent (wt. %) of a component, unless specifically stated to the contrary, is based on the total weight of the formulation or composition in which the component is included.

[0122] The term “or combinations thereof’ as used herein refers to all permutations and combinations of the listed items preceding the term. For example, “A, B, C, or combinations thereof’ is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth. The skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context.

[0123] As used herein, by a “subject” is meant an individual. Thus, the “subject” can include domesticated animals or pets (e g., cats, dogs, etc.), livestock (e.g, cattle, horses, pigs, sheep, goats, etc.), laboratory animals (e.g, mouse, rabbit, rat, guinea pig, etc.), and birds. ‘‘Subject” can also include a mammal, such as a primate or a human. Thus, the subject can be a human or veterinary patient. The term “patient” refers to a subject under the treatment of a clinician, e.g., physician.

[0124] The term “inhibit” refers to a decrease in an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This can also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to native or control levels.

[0125] By “reduce” or other forms of the word, such as “reducing” or “reduction,” is meant lowering of an event or characteristic (e.g, tumor growth). It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to. For example, “reduces tumor growth” means reducing the rate of growth of a tumor relative to a standard or a control.

[0126] By “prevent” or other forms of the word, such as “preventing” or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed. For example, the terms “prevent” or “suppress” can refer to a treatment that forestalls or slows the onset of a disease or condition or reduced the severity of the disease or condition. Thus, if a treatment can treat a disease in a subject having symptoms of the disease, it can also prevent or suppress that disease in a subject who has yet to suffer some or all of the symptoms.

[0127] As used herein, “treat” or other forms of the word, such as “treated” or “treatment,” refers to administration of a composition or performing a method in order to reduce, prevent, inhibit, or eliminate a particular characteristic or event (e.g, microbe growth or survival). The term “control” is used synonymously with the term “treat.”

[0128] The term “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder.

[0129] The term “therapeutically effective amount” refers to the amount of the composition used is of sufficient quantity to ameliorate one or more causes or symptoms of a disease or disorder. Such amelioration only requires a reduction or alteration, not necessarily elimination.

[0130] The term “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit / risk ratio.

[0131] As used herein, “molecular weight” refers to number average molecular weight as measured by NMR spectroscopy, unless indicated otherwise.

[0132] As used herein, the term “deliver}'” encompasses both local and systemic delivery. For example, delivery of mRNA encompasses situations in which an mRNA is delivered to a target tissue and the encoded protein or peptide is expressed and retained within the target tissue (also referred to as “local distribution” or “local delivery”), and situations in which an mRNA is delivered to a target tissue and the encoded protein or peptide is expressed and secreted into patient's circulation system (e.g., serum) and systematically distributed and taken up by other tissues (also referred to as “systemic distribution” or “systemic delivery).

[0133] As used herein, the term “encapsulation,” or grammatical equivalent, refers to the process of confining an individual nucleic acid molecule within a nanoparticle.

[0134] As used herein, “expression” of a mRNA refers to translation of an mRNA into a peptide (e.g., an antigen), polypeptide, or protein (e.g., an enzyme) and also can include, as indicated by context, the post-translational modification of the peptide, polypeptide or fully assembled protein (e.g., enzyme). In this application, the terms “expression” and “production,” and grammatical equivalent, are used inter-changeably.

[0135] As used herein, the term “messenger RNA (mRNA)” refers to a polynucleotide that encodes at least one peptide, polypeptide or protein. mRNA as used herein encompasses both modified and unmodified RNA. mRNA may contain one or more coding and non-coding regions. mRNA can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, mRNA can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, backbone modifications, etc. An mRNA sequence is presented in the 5' to 3' direction unless otherwise indicated. In some embodiments, an mRNA is or comprises natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl- cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8- oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, 2-thiocytidine, pseudouridine, and 5- methylcytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioates and 5'-N- phosphoramidite linkages).

[0136] As used herein, the term “nucleic acid,” in its broadest sense, refers to any compound and / or substance that is or can be incorporated into a polynucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into a polynucleotide chain via a phosphodiester linkage. In some embodiments, “nucleic acid” refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, “nucleic acid” refers to a polynucleotide chain comprising individual nucleic acid residues. In some embodiments, “nucleic acid” encompasses RNA as well as single and / or double-stranded DNA and / or cDNA. Furthermore, the terms “nucleic acid,” “DNA,” “RNA,” and / or similar terms include nucleic acid analogs, i.e., analogs having other than a phosphodiester backbone. In some examples, the term “nucleic acid” as used herein means natural and synthetic DNA, RNA, oligonucleotides, ohgonucleosides, and derivatives thereof. For ease of discussion, such nucleic acids are at times collectively referred to herein as “constructs,” “plasmids,” or “vectors.”

[0137] The term “gene” as used in this specification refers to a segment of deoxyribonucleotides (DNA) possessing the information required for synthesis of a functional biological product such as a protein or ribonucleic acid (RNA).

[0138] The term “genetic engineering” is used to indicate various methods involved in gene manipulation including isolationjoining, introducing of gene(s) as well as methods to isolate select organisms containing the manipulated gene(s).

[0139] As specified herein, the term “DNA construct” refers to a sequence of deoxyribonucleotides including deoxyribonucleotides obtained from one or more sources.

[0140] The term “gene expression” refers to efficient transcription and translation of genetic information contained in concerned genes.

[0141] The term “recombinant” cells or population of cells refers to cells or population of cells into which an exogenous nucleic acid sequence is introduced using a delivery vehicle such as a plasmid.

[0142] Chemical Definitions

[0143] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0144] The organic moieties mentioned when defining variable positions within the general formulae described herein (e.g., the term “halogen”) are collective terms for the individual substituents encompassed by the organic moiety. The prefix Cn-Cm preceding a group or moiety indicates, in each case, the possible number of carbon atoms in the group or moiety that follows.

[0145] The term “ion,” as used herein, refers to any molecule, portion of a molecule, cluster of molecules, molecular complex, moiety, or atom that contains a charge (positive, negative, or both at the same time within one molecule, cluster of molecules, molecular complex, or moiety (e.g., zwitterions)) or that can be made to contain a charge. Methods for producing a charge in a molecule, portion of a molecule, cluster of molecules, molecular complex, moiety, or atom are disclosed herein and can be accomplished by methods known in the art, e.g., protonation, deprotonation, oxidation, reduction, alkylation, acetylation, esterification, de-esterification, hydrolysis, etc.

[0146] The term “anion” is a type of ion and is included within the meaning of the term “ion.” An “anion” is any molecule, portion of a molecule (e.g., zwitterion), cluster of molecules, molecular complex, moiety, or atom that contains a net negative charge or that can be made to contain a net negative charge. The term “anion precursor” is used herein to specifically refer to a molecule that can be converted to an anion via a chemical reaction (e.g., deprotonation).

[0147] The term “cation” is a type of ion and is included within the meaning of the term “ion.” A “cab on” is any molecule, portion of a molecule (e.g., zwitterion). cluster of molecules, molecular complex, moiety, or atom, that contains a net positive charge or that can be made to contain a net positive charge. The term “cation precursor” is used herein to specifically refer to a molecule that can be converted to a cation via a chemical reaction (e.g., protonation or alkylation).

[0148] As used herein, the term “substituted” is contemplated to include all permissible substituents of organic compounds. In a broad aspect, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, and aromatic and nonaromatic substituents of organic compounds. Illustrative substituents include, for example, those described below. The permissible substituents can be one or more and the same or different for appropriate organic compounds. For purposes of this disclosure, the heteroatoms, such as nitrogen, can have hydrogen substituents and / or any permissible substituents of organic compounds described herein which satisfy the valencies of the heteroatoms. This disclosure is not intended to be limited in any manner by the permissible substituents of organic compounds. Also, the terms “substitution” or “substituted with" include the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g., a compound that does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc.

[0149] “Z1,” “Z2,” “Z3,” and “Z4” are used herein as generic symbols to represent various specific substituents. These symbols can be any substituent, not limited to those disclosed herein, and when they are defined to be certain substituents in one instance, they can, in another instance, be defined as some other substituents.

[0150] The term “aliphatic” as used herein refers to a non-aromatic hydrocarbon group and includes branched and unbranched, alkyl, alkenyl, or alkynyl groups.

[0151] As used herein, the term “alkyd” refers to saturated, straight-chained or branched saturated hydrocarbon moieties. Unless otherwise specified, C1-C24 (e.g., C1-C22, C1-C20, C1-C18, C1-C16, C1-C14, C1-C12, C1-C10, C1-C8, C1-C6, or C1-C4) alkyl groups are intended. Examples of alkyl groups include methyl, ethyl, propyl, 1-methyl-ethyl, butyl, 1-methyl-propyl, 2-methyl- propyl, 1,1-dimethyl-ethyl, pentyl, I -methyl -butyl. 2-methyl-butyl, 3-methyl-butyl, 2,2- dimethyl-propyl, 1-ethyl-propyl, hexyl, 1,1-dimethyl-propyk 1,2-dimethyl-propyl, 1-methyl- pentyl, 2-methyl-pentyl, 3-methyl-pentyl, 4-methyl-pentyk 1,1-dimethyl-butyl, 1,2-dimethyl- butyl, 1,3-dimethyl-butyl, 2,2-dimethyl-butyl, 2,3-dimethyl-butyl, 3,3-dimethyl-butyl, 1-ethyl- butyl, 2-ethyl-butyl, 1,1,2-trimethyl-propyl, 1,2,2-trimethyl-propyl, 1 -ethyl- 1-methyl-propyl, 1- ethyl-2-methyl-propyl, heptyl, octyl, nonyl, decyl, dodecyl, tetradecyl, hexadecyl, eicosyl, tetracosyl, and the like. Alkyl substituents may be unsubstituted or substituted with one or more chemical moieties. The alkyl group can be substituted with one or more groups including, but not limited to, hydroxyl, halogen, acyl, alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, aldehyde, amino, cyano, carboxylic acid, ester, ether, ketone, nitro, phosphonyl, silyl, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol, as described below, provided that the substituents are sterically compatible and the rules of chemical bonding and strain energy are satisfied.

[0152] Throughout the specification “alkyl” is generally used to refer to both unsubstituted alkyl groups and substituted alkyl groups; however, substituted alkyl groups are also specifically referred to herein by identifying the specific substituent(s) on the alkyl group. For example, the term “halogenated alkyl” specifically refers to an alkyl group that is substituted with one or more halides (halogens; e.g., fluorine, chlorine, bromine, or iodine). The term “alkoxy alkyl” specifically refers to an alkyl group that is substituted with one or more alkoxy groups, as described below. The term “alkylamino” specifically refers to an alkyl group that is substituted with one or more amino groups, as described below, and the like. When “alkyl” is used in one instance and a specific term such as “alkylalcohol” is used in another, it is not meant to imply that the term “alkyl” does not also refer to specific terms such as “alkylalcohol” and the like.

[0153] This practice is also used for other groups described herein. That is, while a term such as “cycloalkyd” refers to both unsubstituted and substituted cycloalkyl moieties, the substituted moieties can, in addition, be specifically identified herein; for example, a particular substituted cycloalkyl can be referred to as, e.g., an “alkylcycloalkyl.” Similarly, a substituted alkoxy can be specifically referred to as, e.g, a “halogenated alkoxy,” a particular substituted alkenyl can be, e.g., an “alkenylalcohol,” and the like. Again, the practice of using a general term, such as “cycloalkyl,” and a specific term, such as “alkylcycloalkyl,” is not meant to imply that the general term does not also include the specific term.

[0154] As used herein, the term “alkenyl” refers to unsaturated, straight-chained, or branched hydrocarbon moieties containing a double bond. Unless otherwise specified, C2-C24 (e.g., C2-C22, C2-C20, C2-C18, C2-C16, C2-C14, C2-C12, C2-C10, C2-C8, C2-C6, or C2-C4) alkenyl groups are intended. Alkenyl groups may contain more than one unsaturated bond. Examples include ethenyl, 1-propenyl, 2-propenyl, 1 -methylethenyl, 1-butenyl, 2-butenyl, 3-butenyl, 1-methyl-l- propenyl, 2-methyl-l -propenyl, l-methyl-2-propenyl, 2-methyl-2-propenyl, 1 -pentenyl, 2- pentenyl, 3-pentenyl, 4-pentenyl, 1 -methyl- 1-butenyl, 2-methyl-l -butenyl, 3 -methyl- 1-butenyl, l-methyl-2-butenyl, 2-methyl-2-butenyl, 3-methyl-2-butenyl, l-methyl-3-butenyl, 2-methyl-3- butenyl, 3-methyl-3-butenyl, l,l-dimethyl-2-propenyl, 1,2-dimethyl- 1-propenyl, l,2-dimethyl-2- propenyl, 1 -ethyl- 1-propenyl, l-ethyl-2-propenyl, 1-hexenyl, 2-hexenyl, 3-hexenyl, 4-hexenyl, 5-hexenyl, 1 -methyl- 1 -pentenyl, 2-methyl-l -pentenyl, 3-methyl-l -pentenyl, 4-methyl-l- pentenyl, l-methyl-2-pentenyl, 2-methyl-2-pentenyl, 3-methyl-2-pentenyl, 4-methyl-2-pentenyl, l-methyl-3-pentenyl, 2-methyl-3-pentenyl, 3-methyl-3-pentenyl, 4-methyl-3 -pentenyl, 1-methyl- 4-pentenyl, 2-methyl-4-pentenyl, 3-methyl-4-pentenyl, 4-methyl-4-pentenyl, l,l-dimethyl-2- butenyl, l . l -dimelhyl-3-butenyl. 1,2-dimethyl-l-butenyl, l,2-dimethyl-2-butenyl, 1,2-dimethyl- 3-butenyl, 1,3-dimethyl-l-butenyl, l,3-dimethyl-2 -butenyl, l,3-dimethyl-3-butenyl, 2,2- dimethyl-3-butenyl, 2,3-dimethyl-l-butenyl, 2,3-dimethyl-2-butenyl, 2,3-dimethyl-3-butenyl, 3, 3-dimethyl-l -butenyl, 3,3-dimethyl-2-butenyl, 1 -ethyl- 1 -butenyl, l-ethyl-2-butenyl, l-ethyl-3- butenyl, 2-ethyl-l -butenyl, 2-ethyl-2-butenyl, 2-ethyl-3-butenyl, l,l,2-trimethyl-2 -propenyl, 1- ethyl-l-methyl-2-propenyl, l-ethyl-2-methyl-l -propenyl, and l-ethyl-2-methyl-2 -propenyl. The term “vinyl” refers to a group having the structure CHKTh: 1 -propenyl refers to a group with the structure -CH=CH-CH3; and 2-propenyl refers to a group with the structure -CH2-CH=CH2. Asymmetric structures such as (Z1Z2)C=C(Z3Z4) are intended to include both the E and Z isomers. This can be presumed in structural formulae herein wherein an asymmetric alkene is present, or it can be explicitly indicated by the bond symbol C=C. Alkenyl substituents may be unsubstituted or substituted with one or more chemical moi eties. Examples of suitable substituents include, for example, alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, acyl, aldehyde, amino, cyano, carboxylic acid, ester, ether, halide, hydroxyl, ketone, nitro, phosphonyl, silyl, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol, as described below, provided that the substituents are sterically compatible and the rules of chemical bonding and strain energy are satisfied.

[0155] As used herein, the term “alkynyl” represents straight-chained or branched hydrocarbon moieties containing a triple bond. Unless otherwise specified, C2-C24 (e.g., C2-C24, C2-C20, C2- C18, C2-C16, C2-C14, C2-C 12, C2-C10, C2-C8, C2-C6, or C2-C4) alkynyl groups are intended. Alky nyl groups may contain more than one unsaturated bond. Examples include C2-Ce-alkynyl, such as ethynyl, 1-propynyl, 2-propynyl (or propargy l), 1-butynyl, 2-butynyl, 3-butynyl, 1- methyl-2-propynyl, 1-pentynyl, 2-pentynyl, 3-pentynyl, 4-pentynyl, 3-methyl- 1-butynyl, 1- methyl-2-butynyl, l-methyl-3-butynyl, 2-methyl-3-butynyl, l,l-dimethyl-2-propynyl, l-ethyl-2- propynyl, 1 -hexynyl, 2-hexynyl, 3-hexynyl, 4-hexynyl, 5-hexynyl, 3-methyl- 1-pentynyl, 4- methyl- 1-pentynyl, l-methyl-2-pentynyl, 4-methyl-2-pentynyl, l-methyl-3-pentynyl, 2-methyl- 3-pentynyl, l-methyl-4-pentynyl, 2-methyl-4-pentynyl, 3-methyl-4-pentynyl, l,l-dimethyl-2- butynyl, l,l-dimethyl-3-butynyl, l,2-dimethyl-3-butynyl, 2,2-dimethyl-3-butynyl, 3,3-dimethyl- 1-butynyl, l-ethyl-2-butynyl, l-ethyl-3-butynyl, 2-ethyl-3-butynyl, and 1 -ethyl- 1-methy 1-2- propynyl. Alkynyl substituents may be unsubstituted or substituted with one or more chemical moieties. Examples of suitable substituents include, for example, alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, acyl, aldehyde, amino, cyano, carboxylic acid, ester, ether, halide, hydroxyl, ketone, nitro, phosphonyl, silyl, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol, as described below. As used herein, the term “aryl,” as well as derivative terms such as aryloxy, refers to groups that include a monovalent aromatic carbocyclic group of from 3 to 50 carbon atoms. Aryl groups can include a single ring or multiple condensed rings. In some examples, aryl groups include C6-C10 aryl groups. Examples of aryl groups include, but are not limited to, benzene, phenyl, biphenyl, naphthyl, tetrahydronaphthyl, phenylcyclopropyl, phenoxybenzene, and indanyl. The term “aryl” also includes “heteroaryl,” which is defined as a group that contains an aromatic group that has at least one heteroatom incorporated within the ring of the aromatic group. Examples of heteroatoms include, but are not limited to, nitrogen, oxygen, sulfur, and phosphorus. The term “non-heteroaryl,” which is also included in the term “aryl,” defines a group that contains an aromatic group that does not contain a heteroatom. The aryl substituents may be unsubstituted or substituted with one or more chemical moieties. Examples of suitable substituents include, for example, alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, acyl, aldehyde, amino, cyano, carboxylic acid, ester, ether, halide, hydroxyl, ketone, nitro, phosphonyl, silyl, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol as described herein. The term “biaryl” is a specific type of aryl group and is included in the definition of aryl. Biaryl refers to two aryl groups that are bound together via a fused ring structure, as in naphthalene, or are attached via one or more carbon-carbon bonds, as in biphenyl.

[0156] The term “cycloalkyl” as used herein is a non-aromatic carbon-based ring composed of at least three carbon atoms. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc. The term “heterocycloalkyl” is a cycloalkyl group as defined above where at least one of the carbon atoms of the ring is substituted with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus. The cycloalkyl group and heterocycloalkyl group can be substituted or unsubstituted. The cycloalkyl group and heterocycloalkyl group can be substituted with one or more groups including, but not limited to, alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, acyl, aldehyde, amino, cyano, carboxylic acid, ester, ether, halide, hydroxyl, ketone, nitro, phosphonyl, silyl, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol as described herein.

[0157] The term “cycloalkenyl” as used herein is a non-aromatic carbon-based ring composed of at least three carbon atoms and containing at least one double bound, i.e., C=C. Examples of cycloalkenyl groups include, but are not limited to, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclopentadienyl, cyclohexenyl, cyclohexadienyl, and the like. The term “heterocycloalkenyl” is a type of cycloalkenyl group as defined above and is included within the meaning of the term “cycloalkenyl,” where at least one of the carbon atoms of the ring is substituted with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus. The cycloalkenyl group and heterocycloalkenyl group can be substituted or unsubstituted. The cycloalkenyl group and heterocycloalkenyl group can be substituted with one or more groups including, but not limited to, alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl. acyl, aldehyde, amino, cyano, carboxylic acid, ester, ether, halide, hydroxyl, ketone, nitro, phosphonyl, silyl, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol as described herein.

[0158] The term “cyclic group” is used herein to refer to either aryl groups, non-aryl groups (i.e., cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl groups), or both. Cyclic groups have one or more ring systems (e.g., monocyclic, bicyclic, tricyclic, polycyclic, etc.) that can be substituted or unsubstituted. A cyclic group can contain one or more aryl groups, one or more non-aryl groups, or one or more aryl groups and one or more non-aryl groups.

[0159] The term “acyl” as used herein is represented by the formula — C(O)Z1where Z1can be a hydrogen, hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above. As used herein, the term “acyl” can be used interchangeably with “carbonyl.” Throughout this specification “C(O)” or “CO” is a shorthand notation for C=O.

[0160] The term “acetal” as used herein is represented by the formula (Z1Z2)C(=OZ3)(=OZ4), where Z1, Z2, Z3, and Z4can be, independently, a hydrogen, halogen, hydroxyl, alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0161] The term “alkanol” as used herein is represented by the formula Z'OH. where Z1can be an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0162] As used herein, the term “alkoxy” as used herein is an alkyl group bound through a single, terminal ether linkage; that is, an “alkoxy” group can be defined as to a group of the formula Z1-O-, where Z1is unsubstituted or substituted alkyl as defined above. Unless otherwise specified, alkoxy groups wherein Z1is a C1-C24 (e.g., C1-C22, C1-C20, C1-C18, C1-C16, C1-C14, C1- C12, C1-C10, Ci-Cs, Ci-Ce, or C1-C4) alkyl group are intended. Examples include methoxy, ethoxy, propoxy, 1 -methyl-ethoxy, butoxy, 1-methyl-propoxy, 2-methyl-propoxy, 1,1-dimethyl- ethoxy, pentoxy, 1-methyl-butyloxy, 2-methyl-butoxy, 3-methyl-butoxy, 2,2-di-methyl-propoxy, 1-ethyl-propoxy, hexoxy, 1,1-dimethyl-propoxy, 1,2-dimethyl-propoxy, 1-methyl-pentoxy, 2- methyl-pentoxy, 3-methyl-pentoxy, 4-methyl-penoxy, 1,1 -dimethyl -butoxy, 1,2-dimethyl- butoxy, 1,3-dimethyl-butoxy, 2,2-dimethyl-butoxy, 2,3-dimethyl-butoxy, 3,3-dimethyl-butoxy, 1-ethyl-butoxy, 2-ethylbutoxy, 1,1,2-trimethyl-propoxy, 1,2,2-trimethyl-propoxy, 1 -ethyl- 1- methyl-propoxy, and l-ethyl-2-methyl-propoxy. The term "aldehyde" as used herein is represented by the formula — C(O)H. Throughout this specification “C(O)” is a shorthand notation for C=O.

[0163] The term “amino” as used herein are represented by the formula — NZ'Z2Z3. where Z1, Z2, and Z3can each be substitution group as described herein, such as hydrogen, an alky l, alkenyl, alkynyl, aryl, heteroaiyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0164] The terms “amide” or “amido” as used herein are represented by the formula — C(O)NZ1Z2, where Z1and Z2can each be substitution group as described herein, such as hydrogen, an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0165] The term “anhydride” as used herein is represented by the formula Z1C(O)OC(O)Z2where Z1and Z2, independently, can be an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0166] The term “cyclic anhydride” as used herein is represented by the formula: where Z1can be an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0167] The term “azide” as used herein is represented by the formula -N=N=N.

[0168] The term “carboxylic acid” as used herein is represented by the formula — C(O)OH.

[0169] A “carboxylate” or “carboxyl” group as used herein is represented by the formula

[0170] — C(O)O’

[0171] The term “cyano” as used herein is represented by the formula — CN.

[0172] The term “ester” as used herein is represented by the formula — OC(O)Z1or — C(O)OZ1, where Z1can be an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0173] The term “ether” as used herein is represented by the formula Z'OZ2. where Z1and Z2can be, independently, an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0174] The term “epoxy” or “epoxide” as used herein refers to a cyclic ether with a three atom ring and can represented by the formula: where Z1, Z2, Z3, and Z4can be, independently, an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0175] The term “ketone” as used herein is represented by the formula Z1C(O)Z2, where Z1and Z2can be, independently, an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0176] The term “halide” or “halogen” or “halo” as used herein refers to fluorine, chlonne, bromine, and iodine.

[0177] The term “hydroxyl” as used herein is represented by the formula — OH.

[0178] The term “nitro” as used herein is represented by the formula — NO2.

[0179] The term “phosphonyl” is used herein to refer to the phospho-oxo group represented by the formula — P(O)(OZ1)2, where Z1can be hydrogen, an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0180] The term “silyl” as used herein is represented by the formula — SiZJZ2Z3, where Z1, Z2, and Z3can be, independently, hydrogen, alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0181] The term “sulfonyl” or “sulfone” is used herein to refer to the sulfo-oxo group represented by the formula — S(O)2Z1, where Z1can be hydrogen, an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0182] The term “sulfide” as used herein comprises the formula — S — .

[0183] The term “thiol” as used herein is represented by the formula — SH.

[0184] “R1,” “R2,” “R3,” “Rn,” etc., where n is some integer, as used herein can, independently, possess one or more of the groups listed above. For example, if R1is a straight chain alkyl group, one of the hydrogen atoms of the alkyl group can optionally be substituted with a hydroxyl group, an alkoxy group, an amino group, an alkyl group, a halide, and the like. Depending upon the groups that are selected, a first group can be incorporated within a second group or, alternatively, the first group can be pendant (i. e. , attached) to the second group. For example, with the phrase “an alkyl group comprising an amino group,” the amino group can be incorporated within the backbone of the alkyl group. Alternatively, the amino group can be attached to the backbone of the alkyl group. The nature of the group(s) that is (are) selected will determine if the first group is embedded or attached to the second group.

[0185] As used herein, Me refers to a methyl group; OMe refers to a methoxy group; and / -Pr refers to an isopropyl group. Unless stated to the contrary, a formula with chemical bonds shown only as solid lines and not as wedges or dashed lines contemplates each possible stereoisomer or mixture of stereoisomer (e.g., each enantiomer, each diastereomer, each meso compound, a racemic mixture, or scalemic mixture).

[0186] Compounds and Method of Making and Use Thereof

[0187] Disclosed herein are compounds and methods of making and use thereof.

[0188] For example, described herein are engineered 2-pyrone synthases, methods of use thereof for producing polyketides, polyketide precursors, polyketide derivatives, or a combination thereof and compositions comprising the same.

[0189] For example, disclosed herein are methods for producing a product, the method comprising contacting one or more reactants with an engineered 2-pyrone synthase to thereby produce the product, wherein the product is a polyketide or a salt thereof, a polyketide precursor or a salt thereof, a polyketide derivative or a salt thereof, or a combination thereof.

[0190] In some examples, the method is further performed in the presence of one or more additional enzymes, such as one or more native enzymes, for example malonyl-CoA synthetase and / or 4-coumaroyl-CoA ligase.

[0191] In some examples, at least one of the one or more reactants comprises an aromatic acid, such as p-coumaric acid and / or cinnamic acid.

[0192] In some examples, at least one of the one or more reactants comprises an aromatic-CoA, or a derivative thereof.

[0193] In some examples, at least one of the one or more reactants comprises malonyl-CoA.

[0194] In some examples, the method comprises contacting p-coumanc acid and / or cinnamic acid, or a derivative thereof, with malonyl-CoA using the engineered 2-pyrone synthase.

[0195] In some examples, wherein at least one of the one or more reactants comprises triacetic acid lactone, or a derivative or salt thereof.

[0196] In some examples, the product comprises a kavalactone or a salt thereof, a kavalactone precursor or a salt thereof, a raspberry ketone or a salt thereof, a raspberry ketone precursor or a salt thereof, or a combination thereof.

[0197] In some examples, the product comprises a diketide, a triketide, a tetraketide, or a combination thereof.

[0198] In some examples, the product comprises triacetic acid lactone or a derivative or salt thereof.

[0199] In some examples, the product comprises p-hydroxybenzalacetone or a salt thereof, p- coumaroyltriacetic acid lactone or a salt thereof, 6-styryl-4-hydroxy -2-pyrone or a salt thereof, bisnoryangonin or a salt thereof, or a combination thereof.

[0200] In some examples, the product comprises a kavalactone or a salt thereof, a kavalactone precursor or a salt thereof, or a combination thereof.

[0201] In some examples, the product comprises bisnoryangonin (a kavalactone precursor) or a salt thereof.

[0202] In some examples, the method comprises bisnoryangonin production from p-coumaric acid

[0203] In some examples, the product comprises a styrylpyrone (a kavalactone precursor).

[0204] In some examples, the product comprises yangonin.

[0205] In some examples, the product comprises a raspberry ketone or a salt thereof, a raspberry ketone precursor or a salt thereof, or a combination thereof.

[0206] In some examples, the product comprises benzalacetone (a raspberry ketone precursor) or a salt thereof.

[0207] In some examples, the product comprises 7,8-dihydroxyflavone; (2S)-3’,7-Dihydroxy-8- methyl-4’ -methoxy flavan; hesperetin dihydrochalcone; neohesperidin dihydrochalcone; or a combination thereof.

[0208] In some examples, the method produces 1 mg or more (e.g., 5 mg or more, 10 mg or more, 15 mg or more, 20 mg or more, 25 mg or more, 30 mg or more, 35 mg or more, 40 mg or more, 45 mg or more, 50 mg or more, 60 mg or more, 70 mg or more, 80 mg or more, 90 mg or more, 100 mg or more, 125 mg or more, 150 mg or more, 175 mg or more, 200 mg or more, 225 mg or more, 250 mg or more, 275 mg or more, 300 mg or more, 325 mg or more, 350 mg or more, 375 mg or more, 400 mg or more, 425 mg or more, 450 mg or more, 475 mg or more, 500 mg or more, 550 mg or more, 600 mg or more, 650 mg or more, 700 mg or more, 750 mg or more, 800 mg or more, 850 mg or more, 900 mg or more, 950 mg or more, 1 gram (g) or more, 1.1 g or more, 1.2 g or more, 1.3 g or more, 1.4 g or more, 1.5 g or more, 1.75 g or more, 2 g or more, 2.25 g or more, 2.5 g or more, 3 g or more, 3.5 g or more, 4 g or more, 4.5 g or more, 5 g or more, 6 g or more, 7 g or more, 8 g or more, 9 g or more, 10 g or more, 15 g or more, 20 g or more, 25 g or more, 30 g or more, 40 g or more, 45 g or more, 50 g or more, 60 g or more, 70 g or more, 80 g or more, or 90 g or more) of the product per liter within 24 hours. In some examples, the method produces 100 mg or more of the product per liter within 24 hours. In some examples, the method produces 200 mg or more of the product per liter within 24 hours.

[0209] In some examples, the method produces 100 grams (g) or less of the product per liter within 24 hours (e.g., 90 g or less, 80 g or less, 70 g or less, 60 g or less, 50 g or less, 45 g or less, 40 g or less, 35 g or less, 30 g or less, 25 g or less, 20 g or less, 15 g or less, 10 g or less, 9 g or less, 8 g or less, 7 g or less, 6 g or less, 5 g or less, 4.5 g or less, 4 g or less, 3.5 g or less, 3 g or less, 2.5 g or less, 2.25 g or less, 2 g or less, 1.75 g or less, 1.5 g or less, 1.4 g or less, 1.3 g or less, 1.2 g or less, 1.1 g or less, 1 g or less, 950 milligrams (mg) or less, 900 mg or less, 850 mg or less, 800 mg or less, 750 mg or less, 700 mg or less, 650 mg or less, 600 mg or less, 550 mg or less, 500 mg or less, 475 mg or less, 450 mg or less, 425 mg or less, 400 mg or less, 375 mg or less, 350 mg or less, 325 mg or less, 300 mg or less, 275 mg or less, 250 mg or less, 225 mg or less, 200 mg or less, 175 mg or less, 150 mg or less, 125 mg or less, 100 mg or less, 90 mg or less, 80 mg or less, 70 mg or less, 60 mg or less, 50 mg or less, 45 mg or less, 40 mg or less, 35 mg or less, 30 mg or less, 25 mg or less, 20 mg or less, 15 mg or less, 10 mg or less, or 5 mg or less).

[0210] The amount of product produced by the method per liter in 24 hours can range from any of the minimum values described above to any of the maximum values described above. For example, the method can produce from 1 milligram (mg) to 100 grams (g) of the product per liter within 24 hours (e.g., from 1 mg to 1 g, from 1 g to 100 g, from 1 mg to 10 mg, from 10 mg to 100 mg, from 100 mg to 1 g, from 1 g to 10 g, from 10 g to 100 g, from 10 mg to 100 g, from 100 mg to 100 g, from 200 mg to 100 g, from 100 mg to 1 g, or from 200 mg to 2 g). In some examples, the method produces from 100 milligrams (mg) to 100 grams (g) of the product per liter within 24 hours. In some examples, the method produces from 100 milligrams (mg) to 10 grams (g) of the product per liter within 24 hours. In some examples, the method produces from 200 milligrams (mg) to 100 grams (g) of the product per liter within 24 hours. In some examples, the method produces from 200 milligrams (mg) to 10 grams (g) of the product per liter within 24 hours.

[0211] In some examples, the engineered 2-pyrone synthase comprises any one the engineered 2-pyrone synthases of SEQ ID NOS: 2-8. In some examples, the engineered 2-pyrone synthase comprises any one of the engineered 2-pyrone synthases of SEQ ID Nos: 4-5 or 7-8.

[0212] In some examples, the engineered 2-pyrone synthase is at least 80% (e.g., 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation at position LI 10, 1201, L202, L219, V237, L261, L342, 1343, and / or E353.

[0213] In some examples, the engineered 2-pyrone synthase is at least 80% (e.g., 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) identical to SEQ ID NOS: 2-8, with the proviso that the engineered 2-pyrone synthase does not consist of SEQ ID NO: 1.

[0214] In some examples, the engineered 2-pyrone synthase is at least 80% (e.g., 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) identical to SEQ ID NOS: 4-5 or 7-8, with the proviso that the engineered 2-pyrone synthase does not consist of SEQ ID NO:1.

[0215] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position LI 10, 1201, L202, L219, V237, L261, L342, 1343, and / or E353.

[0216] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position 1201, L202, L261, and / or 1343. In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position L261. In some examples, SEQ ID NO: 1 comprises at least two mutations comprising a mutation at positions 1201, L202, L261, and / or 1343. In some examples, SEQ ID NO: 1 comprises at least three mutations comprising a mutation at positions 1201, L202, L261, and / or 1343. In some examples, SEQ ID NO: 1 comprises four mutations comprising a mutation at positions 1201, L202, L261, and 1343.

[0217] In some examples, SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position LI 10, L219, and / or E353. In some examples, SEQ ID NO: 1 comprises at least two additional mutation comprising a mutation at position LI 10, L219, and / or E353. In some examples, SEQ ID NO: 1 comprises three additional mutation comprising a mutation at positions LI 10, L219, and E353.

[0218] In some examples, SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position V237 and / or L342. In some examples, SEQ ID NO: 1 comprises two additional mutations comprising a mutation at position V237 and L342.

[0219] In some examples, the engineered 2-pyrone synthase is at least 80% (e.g., 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, I343A, and / or I343L. In some examples, SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

[0220] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, I343A, and / or I343L. In some examples, SEQ ID NO: 1 further comprising at least one synonymous mutation at LI 10 and / or E353.

[0221] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of L261G.

[0222] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of 1201 V, L202G, L261G, and / or I343L. In some examples, SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202G, L261G, and / or I343L, In some examples, SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202G, L261G, and / or I343L. In some examples, SEQ ID NO: 1 comprises four mutations consisting of I201V, L202G, L261G, and I343L.

[0223] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201V, L202C, L219I, L261G, and / or I343W. In some examples, SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202C, L219I, L261G, and / or I343W. In some examples, SEQ ID NO: 1 comprises at least three mutations consisting of 1201 V, L202C, L219I, L261G, and / or I343W. In some examples, SEQ ID NO: 1 comprises at least four mutations consisting of I201V, L202C, L219I, L261G, and / or I343W. In some examples, SEQ ID NO: 1 comprises five mutations consisting of I201V, L202C, L219I, L261G, and I343W. In some examples, SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

[0224] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L. In some examples, SEQ ID NO: 1 comprises at least two mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L. In some examples, SEQ ID NO: 1 comprises at least three mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L. In some examples, SEQ ID NO: 1 comprises at least four mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L. In some examples, SEQ ID NO: 1 comprises at least five mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L. In some examples, SEQ ID NO: 1 comprises six mutations consisting of I201L, L202G, V237I, L261G, L342M, and I343L.

[0225] In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of 1201 V, L202G, L261G, and / or 1343 A. In some examples, SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202G, L261G, and / or 1343 A. In some examples, SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202G, L261G, and / or I343A. In some examples, SEQ ID NO: 1 comprises four mutations consisting of I201V, L202G, L261G, and I343A.

[0226] In some examples, the engineered 2-pyrone synthase is a component of a fusion protein.

[0227] In some examples, the engineered 2-pyrone synthase is a purified enzyme.

[0228] In some examples, the engineered 2-pyrone synthase is a partially purified enzyme.

[0229] In some examples, the engineered 2-pyrone synthase is produced by a recombinant cell line.

[0230] In some examples, the engineered 2-pyrone synthase is in a vector. In some examples, the vector comprises a pET-16b vector.

[0231] In one aspect, the invention provides a method for altering or modifying expression of one or more gene products. The said method may comprise introducing into a eukaryotic cell containing and expressing DNA molecules encoding the one or more gene products an engineered, non-naturally occurring vector system.

[0232] In another aspect, the invention provides an engineered, non-naturally occurring vector system compnsing one or more vectors.

[0233] The term “vector” is used herein to refer to a nucleic acid molecule capable transferring or transporting another nucleic acid molecule. The transferred nucleic acid is generally linked to, e.g., inserted into, the vector nucleic acid molecule. A vector may include sequences that direct autonomous replication in a cell, or may include sequences sufficient to allow integration into host cell DNA.

[0234] The “control elements” or “regulatory sequences” present in an expression vector are those non-translated regions of the vector (e.g., origin of replication, selection cassettes, promoters, enhancers, translation initiation signals (Shine Dalgamo sequence or Kozak sequence) introns, a polyadenylation sequence, 5' and 3' untranslated regions) which interact with host cellular proteins to carry out transcription and translation. Such elements may vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including ubiquitous promoters and inducible promoters may be used. In some embodiments, the polynucleotide of interest is operably linked to a control element or regulatory sequence. “Operably linked” refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a polynucleotide sequence if the promoter affects the transcription or expression of the polynucleotide sequence.

[0235] In some embodiments, the polynucleotide of interest is operably linked to a promoter sequence. The term “promoter” as used herein refers to a recognition site of a polynucleotide (DNA or RNA) to which an RNA polymerase binds. An RNA polymerase initiates and transcribes polynucleotides operably linked to the promoter.

[0236] The heterologous expression of a gene in a host organism usually requires a vector allowing stable transformation of the host organism. A vector would provide the gene with a functional promoter adjacent to the 5’ end of the coding sequence. The transcription is thereby regulated and initiated by this promoter sequence. Most promoters used up to date have been derived from genes that code for proteins that are usually present at high concentrations in the cell.

[0237] Several aspects of the invention relate to vector systems comprising one or more vectors, or vectors as such. Vectors can be designed for expression of transcripts (e.g. nucleic acid transcripts, proteins, or enzymes) in prokaryotic or eukaryotic cells. For example, transcripts can be expressed in bacterial cells such as Escherichia coli, yeast cells, or mammalian cells. Suitable host cells are discussed further in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro.

[0238] Vectors may be introduced and propagated in a prokaryote. In some embodiments, a prokaryote is used to amplify copies of a vector to be introduced into a eukaryotic cell or as an intermediate vector in the production of a vector to be introduced into a eukaryotic cell (e.g. amplifying a plasmid as part of a viral vector packaging system). In some embodiments, a prokaryote is used to amplify copies of a vector and express one or more nucleic acids, such as to provide a source of one or more proteins for delivery to a host cell or host organism. Expression of proteins in prokaryotes is most often carried out in Escherichia coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non- fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, such as to the amino terminus of the recombinant protein. Such fusion vectors may serve one or more purposes, such as: (i) to increase expression of recombinant protein; (ii) to increase the solubility of the recombinant protein; and (iii) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase.

[0239] In some embodiments, a vector is a yeast expression vector.

[0240] In some embodiments, a vector is capable of driving expression of one or more sequences in mammalian cells using a mammalian expression vector. When used in mammalian cells, the expression vector's control functions are typically provided by one or more regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, simian vims 40, and others disclosed herein and known in the art.

[0241] In some aspects, the invention provides methods comprising delivering one or more polynucleotides, such as or one or more vectors as described herein, one or more transcripts thereof, and / or one or proteins transcribed therefrom, to a host cell. In some aspects, the invention further provides cells produced by such methods, and organisms (such as animals, plants, or fungi) comprising or produced from such cells. Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids in mammalian cells or target tissues. Non-viral vector delivery systems include DNA plasmids, RNA (e.g. a transcript of a vector described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as a liposome. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell. In some examples, the engineered 2-pyrone synthase is obtained from a non-human organism.

[0242] In some examples, the non-human organism is selected from the group consisting of bacteria, yeast, and plant. In some examples, the non-human organism is genetically engineered.

[0243] In some examples, the engineered 2-pyrone synthase is in a cell.

[0244] Exemplary host cells include Gram-positive bacteria (including but not limited to B. brevis, B. subtihs, or Streptomyces) and Gram-negative bacteria (E. coli, Pseudomonas fluorescens, Pseudomonas aeruginosa, Pseudomonas putida), as well as yeast and other eukary otic cells.

[0245] In some examples, the cell is a bactenal cell. Exemplary bacteria include species selected from Escherichia coli, Klebsiella oxytoca, Anaerobiospirillum succiniciproducens, Actinobacillus succinogenes, Mannheimia succiniciproducens, Rhizobium etli, Bacillus subtilis, Corynebacterium glutamicum, Gluconobacter oxydans, Zymomonas mobilis, Lactococcus lactis, Lactobacillus plantarum, Streptomyces coelicolor, Clostridium acetobutylicum, Pseudomonas fluor escens, and Pseudomonas putida. In some examples, the cell is an Escherichia coli cell.

[0246] In some examples, the cell is a yeast cell. Various yeasts include, but are not limited to, ascosporogenous yeasts (Endomycetales), basidiosporogenous yeasts and yeasts belonging to the Fungi imperfecti (Blastomycetes) group. The ascosporogenous yeasts are divided into two families, Spermophthoraceae and Saccharomycetaceae. The latter is comprised of four subfamilies, Schizosaccharomycoideae (e.g., genus Schizosaccharomyces), Nadsomoideae, Lipomycoideae and Saccharomycoideae (e.g., genera Pichia, Kluyveromyces and Saccharomyces). The basidiosporogenous yeasts include the genera Leucosporidium, Rhodosporidium, Sporidiobolus, Filobasidium, and Filobasidiella. Yeasts belonging to the Fungi Imperfecti (Blastomycetes) group are divided into two families, Sporobolomycetaceae (e.g., genera Sporobolomyces and Bullera) and Cryptococcaceae (e.g., genus Candida). In some cases, the yeast can be a species within the genera Pichia, Kluyveromyces, Saccharomyces, Schizosaccharomyces, Hansenula, Torulopsis, Arxula, Yarrowia, Komagataella, and Candida, including, but not limited to, P. pastoris, P. guillerimondii, S. cerevisiae, S. carlsbergensis, S. diastaticus, S. douglasii, S. kluyven, S, norbensis, S. oviformis, K. lactis, K. fragilis, C. albicans, C. maltosa, or H. polymorpha.

[0247] In some examples, the yeast comprises Saccharomyces cerevisiae, Pichia pastoris or Hansenula polymorpha. In some examples, the yeast comprises Saccharomyces cerevisiae or Pichia pastoris. In some examples, the yeast comprises Saccharomyces cerevisiae.

[0248] In some examples, a yeast host cell, such as aP. pastoris or S. cerevisiae host cell, contains a heterologous or recombinant promoter sequences, which may be derived from a / < pastoris or 5. cerevisiae strain, different from the production host. In some examples, the host cell comprises a recombinant expression construct comprising the promoter originating from the same genus, species or strain as the host cell.

[0249] In some examples, the cell is a plant cell, such as a transgenic plant cell. Examples of plants include, but are not limited to, plants from the following genera: Arabidopsis, Agrostis, Allium, Antirrhinum, Apium, Arachis, Asparagus, Atropa, Avena, Bambusa, Brassica, Bromus, Browaalia, Camellia, Cannabis, Capsicum, Cicer, Chenopodium, Chichorium, Citrus, Coffea, Coix, Cucumis, Curcubita, Cynodon, Dactylis, Datura, Daucus, Digitalis, Dioscorea, Elaeis, Eleusine, Festuca, Fragaria, Geranium, Glycine, Melianthus, Heterocallis, Hevea, Hordeum, Hyoscyamus, Ipomoea, Lactuca, Lens, Lilium, Linum, Lolium, Lotus, Lycopersicon, Majorana, Malus, Mangifera, Manihot, Medicago, Nemesia, Nicotiana, Onobrychis, Oryza, Panicum, Pelargonium, Pennisetum, Petunia, Pisum, Phaseolus, Phleum, Poa, Prunus, Ranunculus, Raphanus, Ribes, Ricinus, Rubus, Saccharum, Salpiglossis, Secale, Senecio, Setaria, Sinapis, Solarium, Sorghum, Stenotaphrum, Theobroma, Trifolium, Trigonella, Triticum, Vicia, Vigna, Vitis, Zea, and the Olyreae, the Pharoideae and others. In some examples, the cell is aNicotiana Benthamiana cell, zArabidopsis thaliana cell, or a combination thereof.

[0250] In some examples, the engineered 2-pyrone synthase is heterologous to the cell. In some examples, the cell is in an organism selected from the group consisting of bacterial, yeast, and plant. In some examples, the method is performed in vivo. In some examples, the method is performed in vitro.

[0251] Also disclosed herein are nucleic acids that encode an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises any one the engineered 2-pyrone synthases of SEQ ID NOS: 2-8. Also disclosed herein are nucleic acids that encode an engineered 2- pyrone synthase, wherein the engineered 2-pyrone sy nthase comprises any one of the engineered 2-pyrone synthases of SEQ ID Nos: 4-5 or 7-8.

[0252] Also disclosed herein are nucleic acids that encode an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase is at least 80% (e.g., 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation at position LI 10, 1201, L202, L219, V237, L261, L342, 1343, and / or E353.

[0253] Also disclosed herein are nucleic acids that encode an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase is at least 80% (e.g., 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) identical to SEQ ID NOS: 2-8, with the proviso that the engineered 2-pyrone synthase does not consist of SEQ ID NO: 1.

[0254] Also disclosed herein are nucleic acids that encode an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase is at least 80% (e.g., 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) identical to SEQ ID NOS: 4-5 or 7-8, with the proviso that the engineered 2-pyrone synthase does not consist of SEQ ID NO: 1.

[0255] Also disclosed herein are nucleic acids that encode an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position LI 10, 1201, L202, L219, V237, L261, L342, 1343, and / or E353.

[0256] Also disclosed herein are nucleic acids that encode an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position 1201, L202, L261, and / or 1343. In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position L261. In some examples, SEQ ID NO: 1 comprises at least two mutations comprising a mutation at positions 1201, L202, L261, and / or 1343. In some examples, SEQ ID NO: 1 comprises at least three mutations comprising a mutation at positions 1201, L202, L261, and / or 1343. In some examples, SEQ ID NO: 1 comprises four mutations comprising a mutation at positions 1201, L202, L261, and 1343.

[0257] In some examples, SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position LI 10, L219, and / or E353. In some examples, SEQ ID NO: 1 comprises at least two additional mutation comprising a mutation at position LI 10, L219, and / or E353. In some examples, SEQ ID NO: 1 comprises three additional mutation comprising a mutation at positions LI 10, L219, and E353.

[0258] In some examples, SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position V237 and / or L342. In some examples, SEQ ID NO: 1 comprises two additional mutations comprising a mutation at position V237 and L342.

[0259] Also disclosed herein are nucleic acids that encode an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase is at least 80% (e.g., 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising 1201 V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, I343A, and / or I343L. In some examples, SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

[0260] Also disclosed herein are nucleic acids that encode an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, I343A, and / or I343L. In some examples, SEQ ID NO: 1 further comprising at least one synonymous mutation at LI 10 and / or E353. Also disclosed herein are nucleic acids that encode an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of L261G.

[0261] Also disclosed herein are nucleic acids that encode an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of 120 IV, L202G, L261G, and / or I343L. In some examples, SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202G, L261G, and / or I343L. In some examples, SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202G, L261G, and / or I343L. In some examples, SEQ ID NO: 1 comprises four mutations consisting of I201V, L202G, L261G, and I343L.

[0262] Also disclosed herein are nucleic acids that encode an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of 120 IV, L202C, L219I, L261G, and / or 1343 W. In some examples, SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202C, L219I, L261G, and / or I343W. In some examples, SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202C, L219I, L261G, and / or I343W. In some examples, SEQ ID NO: 1 comprises at least four mutations consisting of 1201 V, L202C, L219I, L261G, and / or I343W. In some examples, SEQ ID NO: 1 comprises five mutations consisting of I201V, L202C, L219I, L261G, and I343W. In some examples, SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

[0263] Also disclosed herein are nucleic acids that encode an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of 120 IL, L202G, V237I, L261G, L342M, and / or I343L. In some examples, SEQ ID NO: 1 comprises at least two mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L. In some examples, SEQ ID NO: 1 comprises at least three mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L. In some examples, SEQ ID NO: 1 comprises at least four mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L. In some examples, SEQ ID NO: 1 comprises at least five mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L. In some examples, SEQ ID NO: 1 comprises six mutations consisting of I201L, L202G, V237I, L261G, L342M, and I343L.

[0264] Also disclosed herein are nucleic acids that encode an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of 120 IV, L202G, L261G, and / or I343A. In some examples, SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202G, L261G, and / or I343A. In some examples, SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202G, L261G, and / or 1343 A. In some examples, SEQ ID NO: 1 comprises four mutations consisting of I201V, L202G, L261G, and 1343 A.

[0265] Also disclosed herein are vectors comprising any of the nucleic acids described herein, such as nucleic acids that encode an engineered 2-pyrone synthase, such as any of the engineered 2-pyrone synthases described herein, such as any one of the 2-pyrone synthases of SEQ ID NOS:2-8. Also disclosed herein are cells comprising said vectors. In some examples, the cell comprising said vector overexpresses the engineered 2-pyrone synthase.

[0266] Also disclosed herein is an engineered 2-pyrone synthase wherein the engineered 2- pyrone synthase comprises any one the engineered 2-pyrone synthases of SEQ ID NOS: 2-8.

[0267] Also disclosed herein is an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises any one of the engineered 2-pyrone synthases of SEQ ID Nos: 4-5 or 7-8.

[0268] Also disclosed herein is an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase is at least 80% (e.g., 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) identical to SEQ ID NO: 1, and further wherein the engineered 2- pyrone synthase comprises at least one mutation at position LI 10, 1201, L202, L219, V237, L261, L342, 1343, and / or E353.

[0269] Also disclosed herein is an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase is at least 80% (e.g., 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) identical to SEQ ID NOS: 2-8, with the proviso that the engineered 2- pyrone synthase does not consist of SEQ ID NO:1.

[0270] Also disclosed herein is an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase is at least 80% (e.g., 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) identical to SEQ ID NOS: 4-5 or 7-8, with the proviso that the engineered 2-pyrone synthase does not consist of SEQ ID NO:1.

[0271] Also disclosed herein is an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position LI 10, 1201, L202, L219, V237, L261, L342, 1343, and / or E353.

[0272] Also disclosed herein is an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position 1201, L202, L261, and / or 1343. In some examples, the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position L261. In some examples, SEQ ID NO: 1 comprises at least two mutations comprising a mutation at positions 1201, L202, L261, and / or 1343. In some examples, SEQ ID NO: 1 comprises at least three mutations comprising a mutation at positions 1201, L202, L261, and / or 1343. In some examples, SEQ ID NO: 1 comprises four mutations comprising a mutation at positions 1201, L202, L261, and 1343.

[0273] In some examples, SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position LI 10, L219, and / or E353. In some examples, SEQ ID NO: 1 comprises at least two additional mutation comprising a mutation at position LI 10, L219, and / or E353. In some examples, SEQ ID NO: 1 comprises three additional mutation comprising a mutation at positions LI 10, L219, and E353.

[0274] In some examples, SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position V237 and / or L342. In some examples, SEQ ID NO: 1 comprises two additional mutations comprising a mutation at position V237 and L342.

[0275] Also disclosed herein is an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase is at least 80% (e.g., 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) identical to SEQ ID NO: 1, and further wherein the engineered 2- pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, I343A, and / or I343L. In some examples, SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

[0276] Also disclosed herein is an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, I343A, and / or I343L. In some examples, SEQ ID NO: 1 further comprising at least one synonymous mutation at LI 10 and / or E353. Also disclosed herein is an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of L261G.

[0277] Also disclosed herein is an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201V, L202G, L261G, and / or I343L. In some examples, SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202G, L261G, and / or I343L. In some examples, SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202G, L261G, and / or I343L. In some examples, SEQ ID NO: 1 comprises four mutations consisting of 120 IV, L202G, L261G, and I343L.

[0278] Also disclosed herein is an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201V, L202C, L219I, L261G, and / or I343W. In some examples, SEQ ID NO: 1 comprises at least two mutations consisting of 1201 V, L202C, L219I, L261G, and / or I343W. In some examples, SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202C, L219I, L261G, and / or I343W. In some examples, SEQ ID NO: 1 comprises at least four mutations consisting of 1201 V, L202C, L219I, L261G, and / or I343W. In some examples, SEQ ID NO: 1 comprises five mutations consisting of I201V, L202C, L219I, L261G, and I343W. In some examples, SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

[0279] Also disclosed herein is an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L. In some examples, SEQ ID NO: 1 comprises at least two mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L. In some examples, SEQ ID NO: 1 comprises at least three mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L. In some examples, SEQ ID NO: 1 comprises at least four mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L. In some examples, SEQ ID NO: 1 comprises at least five mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L. In some examples, SEQ ID NO: 1 comprises six mutations consisting of I201L, L202G, V237I, L261G, L342M, and I343L.

[0280] Also disclosed herein is an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201V, L202G, L261G, and / or 1343 A. In some examples, SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202G, L261G, and / or I343A. In some examples, SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202G, L261G, and / or I343A. In some examples, SEQ ID NO: 1 comprises four mutations consisting of 120 IV, L202G, L261G, and 1343 A.

[0281] Also disclosed herein are cells comprising any of said engineered 2-pyrone synthases described herein. In some examples, the cell overexpresses the engineered 2-pyrone synthase.

[0282] Also disclosed herein are the products made by any of the methods disclosed herein.

[0283] In some examples, the product comprises a kavalactone or a salt thereof, a kavalactone precursor or a salt thereof, a raspberry ketone or a salt thereof, a raspberry ketone precursor or a salt thereof, or a combination thereof.

[0284] In some examples, the product comprises a diketide, a triketide, a tetraketide, or a combination thereof.

[0285] In some examples, the product comprises triacetic acid lactone or a derivative or salt thereof.

[0286] In some examples, the product comprises p-hydroxybenzalacetone or a salt thereof, p- coumaroyltriacetic acid lactone or a salt thereof, 6-styryl-4-hydroxy -2-pyrone or a salt thereof, bisnoiyangonin or a salt thereof, or a combination thereof.

[0287] In some examples, the product comprises a kavalactone or a salt thereof, a kavalactone precursor or a salt thereof, or a combination thereof.

[0288] In some examples, the product comprises bisnoryangonin (a kavalactone precursor) or a salt thereof.

[0289] In some examples, the product comprises a styrylpyrone (a kavalactone precursor).

[0290] In some examples, the product comprises yangonin.

[0291] In some examples, the product comprises a raspberry ketone or a salt thereof, a raspberry ketone precursor or a salt thereof, or a combination thereof.

[0292] In some examples, the product comprises benzalacetone (a raspberry ketone precursor) or a salt thereof.

[0293] In some examples, the product comprises 7,8-dihydroxyflavone; (2S)-3’,7-Dihydroxy-8- methyl-4’ -methoxy flavan; hesperetin dihydrochalcone; neohesperidin dihydrochalcone; or a combination thereof.

[0294] In some examples, the product is a cell isolate. In some examples, the product is a bacterial cell isolate, a yeast cell isolate, a plant cell isolate, or a combination thereof.

[0295] In some examples, the product exhibits anticancer activity, antimicrobial activity, antioxidant activity, anti-inflammatory activity, or a combination thereof. In some examples, the product has a flavor and / or a fragrance.

[0296] Also disclosed herein are composition comprising any of the products (e.g., made by any of the methods) described herein. For example, the composition can comprise a flavoring composition and / or a fragrance composition.

[0297] Also disclosed herein are flavoring compositions comprising any of the products (e.g., made by any of the methods) described herein.

[0298] Also disclosed herein are fragrance compositions comprising any of the products (e.g., made by any of the methods) described herein.

[0299] Also disclosed herein are formulation vehicles comprising any of the products disclosed herein. Any of the products described herein can be incorporated into a formulation vehicle. Examples of formulation vehicles are provided herein and include, but are not limited to, foodstuffs, beverages, nutraceutical formulations, or pharmaceutical formulations. In some other specific examples, the disclosed products can be incorporated into gels, gel capsules, or tablets. Other vehicles include powders or powders. Such vehicles can be given orally or, in the case of powders for example, sprinkled onto food or beverages.

[0300] Also, disclosed herein are nutritional supplements that comprise any of the products disclosed herein. A nutritional supplement is any compound or composition that can be administered to or taken by a subject to provide, supply, or increase a nutrient(s) (e.g., vitamin, mineral, essential trace element, amino acid, peptide, nucleic acid, oligonucleotide, lipid, cholesterol, steroid, carbohydrate, and the like).

[0301] The nutritional supplement can comprise any amount of the products disclosed herein. The exact amount of product required in the nutritional supplement will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of any dietary deficiency being treated, the particular mode of administration, and the like. Thus, it is not possible to specify an exact amount for every nutritional supplement. However, an appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein.

[0302] The nutritional supplement can also comprise other nutrient(s) such as vitamins other trace elements, minerals, and the like. Further, the nutritional supplement can comprise other components such as preservatives, antimicrobials, anti-oxidants, chelating agents, thickeners, flavorings, diluents, emulsifiers, dispersing aids, or binders.

[0303] The nutritional supplements are generally taken orally and can be in any form suitable for oral administration. For example, a nutritional supplement can typically be in a tablet, gel-cap, capsule, liquid, sachets, or syrup form. The nutritional supplements can be designed for humans or animals, based on the recommended dietary intake for a given individual. Such considerations are generally based on various factors such as species, age, and sex as described above, which are known or can be determined by one of skill in the art. In one example, the disclosed supplements can be used as a component of feed for animals such as, but not limited to, livestock (e.g, pigs, chickens, cows, goats, horses, and the like) and domestic pets (e.g, cats, dogs, birds, and the like).

[0304] Also disclosed herein are foodstuffs that comprise any of the disclosed products. By “foodstuff’ is meant any article that can be consumed (e.g., eaten, drank, or ingested) by a subject. In one example, the disclosed compositions can be used as nutritional supplements that are added to a foodstuff. For example, the disclosed products can be added to food or beverages. In this sense, the disclosed compositions can be prepared in, for example, a powdered form and contained in articles such as sachets or shakers, which can be used to pour or sprinkle the disclosed compositions onto and into food and beverages.

[0305] The compositions can, for example, be conveniently incorporated in a variety of food and / or beverage products, nutraceutical products, probiotic supplements, food additives, pharmaceuticals and over-the-counter formulations. The food or food additive can be a solid form such as a powder, or a liquid form.

[0306] Specific examples of the types of beverages or foods include, but are not limited to water-based, milk-based, yogurt-based, other dairy-based, milk-substitute based such as soy milk or oat milk, or juice-based beverages, water, soft drinks, carbonated drinks, and nutritional beverages, (including a concentrated stock solution of a beverage and a dry powder for preparation of such a beverage); baked products such as crackers, breads, muffins, rolls, bagels, biscuits, cereals, bars such as muesli bars, health food bars and the like, dressings, sauces, custards, yoghurts, puddings, pre-packaged frozen meals, soups and confectioneries.

[0307] In some examples, the foodstuff is a baked good, a pasta, a meat product, a frozen dairy product, a milk product, a cheese product, an egg product, a condiment, a soup mix, a snack food, a nut product, a plant protein product, a hard candy, a soft candy, a poultry product, a processed fruit juice, a granulated sugar (e.g, white or brown), a sauce, a gravy, a syrup, a nutritional bar, a beverage, a dry beverage powder, a jam or jelly, a fish product, or pet companion food. In other examples, the foodstuff is bread, tortillas, cereal, sausage, chicken, ice cream, yogurt, milk, salad dressing, rice bran, fruit juice, a dry beverage powder, liquid beverage, rolls, cookies, crackers, fruit pies, or cakes.

[0308] The products can additionally include any suitable additives, carriers, additional therapeutic agents, bioavailability enhancers, side-effect suppressing components, diluents, buffers, flavoring agents, binders, preservatives or other ingredients that are not detrimental to the efficacy of the composition.

[0309] For example, the product comprises a nutritional product or supplement. In some examples, the product comprises a food product, such as a functional food product. In some examples, the product comprises a beverage. In some examples, the product comprises an animal food (e.g., pet food, livestock food, and / or laboratory animal food). In some examples, the food product is suitable for human consumption.

[0310] Also disclosed herein are pharmaceutical compositions comprising any of the products (e.g., made by any of the methods) described herein. In some examples, the pharmaceutical composition can further comprise a pharmaceutically acceptable carrier, a pharmaceutically acceptable diluent, a pharmaceutically acceptable excipient, or a combination thereof.

[0311] Also disclosed herein are compositions comprising any of the products or any of the pharmaceutical compositions disclosed herein.

[0312] Also disclosed herein are methods of use of any of the products or compositions disclosed herein. For example, the methods can comprise using the product or composition as a flavoring and / or as a fragrance.

[0313] Also disclosed herein are methods of treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of any of the products or compositions disclosed herein. In some examples, the disease or disorder comprises cancer, a microbial infection, an inflammatory disease or disorder, an anxiety disorder, insomnia, other psychological and neurological disorders, or a combination thereof.

[0314] Compositions

[0315] Also disclosed herein are pharmaceutical compositions comprising any of the products disclosed herein. In some examples, the pharmaceutical composition further comprising a pharmaceutically acceptable carrier, a pharmaceutically acceptable diluent, a pharmaceutically acceptable excipient, or a combination thereof.

[0316] Also disclosed herein are compositions comprising any of the products disclosed herein or any of the pharmaceutical compositions disclosed herein.

[0317] In some examples, the compositions further comprise a pharmaceutically acceptable carrier, a pharmaceutically acceptable diluent, a pharmaceutically acceptable excipient, or a combination thereof.

[0318] In some examples, the disclosed compositions optionally further comprise other therapeutic ingredients or adjuvants.

[0319] In some examples, the composition is administered to a subject. In some examples, the subject is a mammal. In some examples, the mammal is a primate. In some examples, the mammal is a human. In some examples, the human is a patient.

[0320] The instant compositions include those suitable for oral, rectal, topical, and parenteral (including subcutaneous, intramuscular, and intravenous) administration, although the most suitable route in any given case will depend on the particular host, and nature and severity of the conditions for which the active ingredient is being administered. The compositions can be conveniently presented in unit dosage form and prepared by any of the methods well known in the art of pharmacy.

[0321] In some examples, the product comprises a nutraceutical composition.

[0322] In contrast to a pharmaceutical, a “nutraceutical” need not be the subject of regulatory approval. The term “nutraceutical” is used herein to refer to a product which is generally considered beneficial to maintain or augment the health and / or general well-being of a human or non-human animal subject. Such substances include, in particular, dietary supplements such as vitamins and minerals which are intended to augment the health of a subject (e.g. a human subject).

[0323] As will be understood, some substances may be considered both a “pharmaceutical” and a “nutraceutical”. Categorization of a substance as one or the other, or indeed both, may vary in different countries depending on local regulations relating to medicinal products. It may also be dependent on the recommended daily dosage of any given substance. Higher daily doses of certain vitamins such as vitamin D, for example, may be regulated as a pharmaceutical whereas lower daily dosages may be considered nutraceutical.

[0324] By a “nutraceutical composition” is meant a composition in any form suitable to be used for a nutraceutical purpose.

[0325] A “nutraceutically effective amount” relates to an amount that will lead to the desired nutraceutical effect, i.e. an amount of the agent which is effective to achieve its intended nutraceutical purpose. While the individual needs of a subject may vary, determination of optimal ranges for effective amounts of any active agent is within the capability of those skilled in the art.

[0326] When used as nutraceuticals, for example, the compositions herein described may be used as a supplement (e.g. as a dietary supplement) for maintaining the general health and / or well-being of a subject. Any agent known for its nutraceutical effects may be provided in the compositions and suitable agents are well known in the art. Suitable nutraceuticals include, but are not limited to, any of the following: essential fatty acids (e.g. mono and poly-unsaturated fatty acids), essential amino acids (e.g. taurine, tryptophan, tyrosine, cysteine and homocysteine), vitamins (e.g. vitamins A, B1-B12, C, D, E and K), minerals (e.g. iodine, selenium, iron, zinc, calcium and magnesium), flavonoids, carotenoids (e.g. beta carotene, alpha carotene, luteine, zeoxantaine, xanthophylls and lycopene), phytosterols, sapponins, probiotics, dietary fibers (e.g. insoluble fiber and beta-glucans), and plant extracts (e.g. aloe vera, evening primrose oil, garlic, ginger, ginseng, green tea, caffeine and cannabinoids).

[0327] Methods of Use

[0328] Also disclosed herein are methods of use of any of the compounds or compositions disclosed herein.

[0329] For example, also disclosed herein are methods of treating, preventing, or ameliorating a disease or a disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of any of the compounds or compositions disclosed herein.

[0330] For example, disclosed herein are methods of treating a disease or a disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of any of the compounds or compositions disclosed herein.

[0331] In some examples, the disease or disorder comprises cancer, a microbial infection, an inflammatory disease or disorder, an anxiety disorder, insomnia, other psychological and neurological disorders, or a combination thereof.

[0332] The methods of treatment of the disease or disorder described herein can further include treatment with one or more additional agents. The one or more additional agents and the compounds and compositions or pharmaceutically acceptable salts thereof as described herein can be administered in any order, including simultaneous administration, as well as temporally spaced order of up to several days apart. The methods can also include more than a single administration of the one or more additional agents and / or the compounds and compositions or pharmaceutically acceptable salts thereof as described herein. The administration of the one or more additional agents and the compounds and compositions or pharmaceutically acceptable salts thereof as described herein can be by the same or different routes. When treating with one or more additional agents, the compounds and compositions or pharmaceutically acceptable salts thereof as described herein can be combined into a pharmaceutical composition that includes the one or more additional agents.

[0333] The methods, compounds, and compositions as described herein are useful for both prophylactic and therapeutic treatment. As used herein the term treating or treatment includes prevention; delay in onset; diminution, eradication, or delay in exacerbation of signs or symptoms after onset; and prevention of relapse. For prophylactic use, a therapeutically effective amount of the compounds and compositions or pharmaceutically acceptable salts thereof as described herein are administered to a subject prior to onset (e.g., before obvious signs of the disease or disorder), during early onset (e.g., upon initial signs and symptoms of the disease or disorder), or after an established development of the disease or disorder. Prophylactic administration can occur for several days to years prior to the manifestation of symptoms of a disease or disorder. Therapeutic treatment involves administering to a subject a therapeutically effective amount of the compounds and compositions or pharmaceutically acceptable salts thereof as described herein after the disease or disorder is diagnosed.

[0334] Compositions, Formulations, Methods of Administration, and Kits

[0335] In vivo application of the disclosed compounds, and compositions containing them, can be accomplished by any suitable method and technique presently or prospectively known to those skilled in the art. For example, the disclosed compounds can be formulated in a physiologically- or pharmaceutically-acceptable form and administered by any suitable route known in the art including, for example, oral, nasal, rectal, topical, and parenteral routes of administration. As used herein, the term parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intraperitoneal, and intrastemal administration, such as by injection. Administration of the disclosed compounds or compositions can be a single administration, or at continuous or distinct intervals as can be readily determined by a person skilled in the art.

[0336] The compounds disclosed herein, and compositions comprising them, can also be administered utilizing liposome technology, slow release capsules, implantable pumps, and biodegradable containers. These delivery methods can, advantageously, provide a uniform dosage over an extended period of time. The compounds can also be administered in their salt derivative forms or crystalline forms.

[0337] The compounds disclosed herein can be formulated according to known methods for preparing pharmaceutically acceptable compositions. Formulations are described in detail in a number of sources which are well known and readily available to those skilled in the art. For example, Remington ’s Pharmaceutical Science by E.W. Martin (1995) describes formulations that can be used in connection with the disclosed methods. In general, the compounds disclosed herein can be formulated such that an effective amount of the compound is combined with a suitable excipient in order to facilitate effective administration of the compound. The compositions used can also be in a variety of forms. These include, for example, solid, semi- solid, and liquid dosage forms, such as tablets, pills, powders, liquid solutions or suspension, suppositories, injectable and infusible solutions, and sprays. The preferred form depends on the intended mode of administration and application. The compositions can also include conventional pharmaceutically-acceptable carriers and diluents which are known to those skilled in the art.

[0338] Examples of carriers or diluents for use wi th the compounds include ethanol, dimethyl sulfoxide, glycerol, alumina, starch, saline, and equivalent carriers and diluents. To provide for the administration of such dosages for the desired application, compositions disclosed herein can comprise between about 0. 1% and 100% by weight of the total of one or more of the subject compounds based on the weight of the total composition including carrier or diluent.

[0339] The pharmaceutical earner employed can be, for example, a solid, liquid, or gas. Examples of solid carriers include lactose, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate, and stearic acid. Examples of liquid carriers are sugar syrup, peanut oil, olive oil, and water. Examples of gaseous carriers include carbon dioxide and nitrogen.

[0340] Formulations suitable for administration include, for example, aqueous sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient; and aqueous and nonaqueous sterile suspensions, which can include suspending agents and thickening agents. The formulations can be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and can be stored in a freeze dried (lyophilized) condition requiring only the condition of the sterile liquid carrier, for example, water for injections, prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powder, granules, tablets, etc. It should be understood that in addition to the excipients particularly mentioned above, the compositions disclosed herein can include other agents conventional in the art having regard to the type of formulation in question.

[0341] Compounds disclosed herein, and compositions comprising them, can be delivered to a cell either through direct contact with the cell or via a carrier means. Carrier means for delivering compounds and compositions to cells are known in the art.

[0342] For the treatment of oncological disorders, the compounds or compositions disclosed herein can be administered to a patient in need of treatment in combination with other antitumor or anticancer substances and / or with radiation and / or photodynamic therapy and / or with surgical treatment to remove a tumor. These other substances or treatments can be given at the same as or at different times from the compounds or compositions disclosed herein. For example, the compounds or compositions disclosed herein can be used in combination with mitotic inhibitors such as taxol or vinblastine, alkylating agents such as cyclophosamide or ifosfamide, antimetabolites such as 5 -fluorouracil or hydroxyurea, DNA intercalators such as adriamycin or bleomycin, topoisomerase inhibitors such as etoposide or camptothecin, antiangiogenic agents such as angiostatin, antiestrogens such as tamoxifen, and / or other anti-cancer drugs or antibodies, such as, for example, GLEEVEC (Novartis Pharmaceuticals Corporation) and HERCEPTIN (Genentech, Inc.), respectively, or an immunotherapeutic such as ipilimumab and bortezomib.

[0343] In certain examples, compounds and compositions disclosed herein can be locally administered at one or more anatomical sites, such as sites of unwanted cell growth (such as a tumor site or benign skin growth, e.g., injected or topically applied to the tumor or skin growth), optionally in combination with a pharmaceutically acceptable carrier such as an inert diluent. Compounds and compositions disclosed herein can be systemically administered, such as intravenously or orally, optionally in combination with a pharmaceutically acceptable carrier such as an inert diluent, or an assimilable edible carrier for oral delivery. They can be enclosed in hard or soft shell gelatin capsules, can be compressed into tablets, or can be incorporated directly with the food of the patient’s diet. For oral therapeutic administration, the active compound can be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, aerosol sprays, and the like.

[0344] The tablets, troches, pills, capsules, and the like can also contain the following: binders such as gum tragacanth, acacia, com starch or gelatin; diluents such as dicalcium phosphate; a disintegrating agent such as com starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, fructose, lactose or aspartame or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring can be added. When the unit dosage form is a capsule, it can contain, in addition to materials of the above type, a liquid carrier, such as a vegetable oil or a polyethylene glycol. Various other materials can be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For instance, tablets, pills, or capsules can be coated with gelatin, wax, shellac, or sugar and the like. A syrup or elixir can contain the active compound, sucrose or fructose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring such as cherry or orange flavor. Of course, any material used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts employed. In addition, the active compound can be incorporated into sustained-release preparations and devices.

[0345] Compounds and compositions disclosed herein, including pharmaceutically acceptable salts thereof, can be administered intravenously, intramuscularly, or intraperitoneally by infusion or injection. Solutions of the active agent or its salts can be prepared in water, optionally mixed with a nontoxic surfactant. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations can contain a preservative to prevent the growth of microorganisms.

[0346] The pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient, which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. The ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. Optionally, the prevention of the action of microorganisms can be brought about by various other antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it wall be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the inclusion of agents that delay absorption, for example, aluminum monostearate and gelatin.

[0347] Pharmaceutical compositions disclosed herein suitable for injectable use include sterile aqueous solutions or dispersions. Furthermore, the compositions can be in the form of sterile powders for the extemporaneous preparation of such sterile injectable solutions or dispersions. In some examples, the final injectable form can be sterile and can be effectively fluid for easy syrmgability. In some examples, the pharmaceutical compositions can be stable under the conditions of manufacture and storage; thus, they can be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol and liquid poly ethylene glycol), vegetable oils, and suitable mixtures thereof.

[0348] Sterile injectable solutions are prepared by incorporating a compound and / or agent disclosed herein in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization. In the case of sterile pow ders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile-filtered solutions.

[0349] Pharmaceutical compositions disclosed herein can be in a form suitable for topical use such as, for example, an aerosol, cream, ointment, lotion, dusting powder, mouth washes, gargles, solution, tincture, and the like. In some examples, the compositions can be in a form suitable for use in transdermal devices. In some examples, it will be desirable to administer them topically to the skin as compositions, in combination with a dermatologically acceptable carrier, which can be a solid or a liquid. Compounds and agents and compositions disclosed herein can be applied topically to a subject’s skin. These formulations can be prepared, utilizing any of the compounds disclosed herein or pharmaceutically acceptable salts thereof, via conventional processing methods.

[0350] Useful solid earners include finely divided solids such as talc, clay, microcrystalline cellulose, silica, alumina and the like. Useful liquid carriers include water, alcohols or glycols or water-alcohol / glycol blends, in which the compounds can be dissolved or dispersed at effective levels, optionally with the aid of non-toxic surfactants. Adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use. The resultant liquid compositions can be applied from absorbent pads, used to impregnate bandages and other dressings, or sprayed onto the affected area using pump-type or aerosol sprayers, for example.

[0351] Thickeners such as synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified celluloses or modified mineral materials can also be employed with liquid carriers to form spreadable pastes, gels, ointments, soaps, and the like, for application directly to the skin of the user.

[0352] Pharmaceutical compositions disclosed herein can be in a form suitable for rectal administration wherein the carrier is a solid. In some examples, the mixture forms unit dose suppositories. Suitable carriers include cocoa butter and other materials commonly used in the art. The suppositories can be conveniently formed by first admixing the composition with the softened or melted carriers) followed by chilling and shaping in molds.

[0353] In addition to the aforementioned carrier ingredients, the pharmaceutical formulations described above can include, as appropriate, one or more additional carrier ingredients such as diluents, buffers, flavoring agents, binders, surface-active agents, thickeners, lubricants, preservatives (including anti-oxidants) and the like. Furthermore, other adjuvants can be included to render the formulation isotonic with the blood of the intended recipient. Compositions containing any of the compounds disclosed herein, and / or pharmaceutically acceptable salts thereof, can also be prepared in powder or liquid concentrate form.

[0354] Useful dosages of the compounds and agents and pharmaceutical compositions disclosed herein can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art.

[0355] The dosage ranges for the administration of the compositions are those large enough to produce the desired effect in which the symptoms or disorder are affected. The dosage should not be so large as to cause adverse side effects, such as unwanted cross-reactions, anaphylactic reactions, and the like. Generally, the dosage will vary with the age, body weight, general health, condition, sex, diet, and extent of the disease in the patient and can be determined by one of skill in the art. Other factors include the time and route of administration, rate of excretion, drug combination, and the type and severity of the particular disease or disorder. The dosage can be adjusted by the individual physician in the event of any counterindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days.

[0356] Also disclosed are kits that comprise a compound or composition disclosed herein in one or more containers. The disclosed kits can optionally include pharmaceutically acceptable carriers and / or diluents. In one embodiment, a kit includes one or more other components, adjuncts, or adjuvants as described herein. In one embodiment, a kit includes instructions or packaging materials that describe how to administer a compound or composition of the kit. Containers of the kit can be of any suitable material, e.g., glass, plastic, metal, etc., and of any suitable size, shape, or configuration. In one embodiment, a compound and / or agent disclosed herein is provided in the kit as a solid, such as a tablet, pill, or powder form. In another embodiment, a compound and / or agent disclosed herein is provided in the kit as a liquid or solution. In one embodiment, the kit comprises an ampoule or syringe containing a compound and / or agent disclosed herein in liquid or solution form.

[0357] In some examples, the kit further comprises at least one agent, wherein the compound and the agent are co-formulated.

[0358] In some examples, the compound and the agent are co-packaged.

[0359] The kits can also comprise compounds and / or products co-packaged, co-formulated, and / or co-delivered with other components. For example, a drug manufacturer, a drug reseller, a physician, a compounding shop, or a pharmacist can provide a kit comprising a disclosed compound and / or product and another component for delivery to a patient.

[0360] It is contemplated that the disclosed kits can be used in connection with the disclosed methods of making, the disclosed methods of using, and / or the disclosed compounds and compositions.

[0361] A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.

[0362] The examples below are intended to further illustrate certain aspects of the systems and methods described herein, and are not intended to limit the scope of the claims.

[0363] EXAMPLES

[0364] The following examples are set forth below to illustrate the methods and results according to the disclosed subject matter. These examples are not intended to be inclusive of all aspects of the subject matter disclosed herein, but rather to illustrate representative methods and results. These examples are not intended to exclude equivalents and variations of the present invention which are apparent to one skilled in the art.

[0365] Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.) but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C or is at ambient temperature, and pressure is at or near atmospheric. There are numerous variations and combinations of measurement conditions, e.g., component concentrations, temperatures, pressures and other measurement ranges and conditions that can be used to optimize the described process.

[0366] Example 1 - What makes a good biocatalyst in vivo - a case study of diversified polyketide biosynthesis by in vivo cascade reactions and directed evolution

[0367] Abstract. It is highly desirable for metabolic engineering to implement engineered biosynthetic enzymes with unique reactivity in vivo to access the capability beyond natural existing pathways. However, there are insufficient guidelines to design or engineer good biocatalysts in vivo, because many of such enzymes are improved in vitro without intracellular selection pressure. It is also difficult to improve the bottleneck enzymes in the late-stage biosynthesis which usually require large amount of complex and fragile substrates for directed evolution. To address such challenges, in vivo cascade reactions for in situ coenzyme A biosynthesis have been built up to systematically engineer 2-pyrone synthase (2PS) by directed evolution. Three distinct reactivity patterns for 2PS were achieved with even higher performance than native enzymes that were widely used in metabolic engineering, which can be adopted to debottleneck the existing polyketide biosynthesis pathways such as for kavalactones and raspberry ketone. Through Michaelis-Menten kinetics, it was revealed that the best-performing 2PS mutant surprisingly evolved for the enhanced reactivity towards the central metabolite malonyl-CoA to compete with native enzymes from endogenous metabolism, rather than its normative aromatic-CoA substrates. By computational modeling, it is shown how a single residue has influenced the chain elongation that determines the reaction chemoselectivity. This study not only provides solutions to evolve key enzymes in late-stage biosynthetic pathways by substrate generation in situ, but also reveals the great importance of intracellular selection pressure for in vivo biocatalysis which is essential to the success of such protein engineering research.

[0368] Introduction. Numerous natural products with an extraordinary breath of biological activities have been generated in the natural secondary metabolism. They play many important roles in the society such as antibiotics, medicine, agrochemicals, etc. To produce such valuable bioproducts in profitable quantities, metabolic engineering has successfully designed microbial biofactories for the heterologous bioproduction utilizing natural pathways and even those with engineered enzymes that displayed unique reactivity. However, the innate low catalytic performance of enzymes in secondary metabolism compared to primary metabolism hampers the titer, rate and yield of such bioprocess. This leads to an imbalance between cell growth and bioproduction, and such natural enzymes become the bottleneck of the metabolic engineering processes. In addition, many of the enzymes with unique reactivity are engineered and selected in vitro. A lack of intracellular selection pressure from endogenous metabolism makes it difficult to implement them into cells, because they may not be compatible with other enzymes or not competitive enough for intracellular metabolites in vivo. Because of these limitations, it is important to further improve such biosynthetic enzymes with the correct intracellular selection pressure to create better metabolic engineering systems with balanced cell growth and bioproduction.

[0369] In order to improve the biocatalytic reactivity of enzy mes, protein engineering strategies are widely adopted especially directed evolution to enhance the performance of enzymes. Such directed evolution process usually requires a large amount of starting materials as well as reliable analytical methods for the extensive screening of enzymatic assays. Due to the structural complexity and fragility of natural product precursors, the throughput and effectiveness of directed evolution is hindered especially for those bottleneck enzymes in the middle or late stage of biosynthetic pathways. To supply the demanded natural product precursors for directed evolution study, the most straightforward approach is to chemically synthesize the required substrates, but the structural complexify may require laborious multistep synthesis until enough target compounds are accumulated (Figure 1 A). Rather than the exactly required ones, simplified homologs mimicking the key structural features of natural product precursors can be readily prepared to shorten the synthetic process such as the application of A-acetylcysteamine thioester resembling coenzyme A (CoA) (Figure IB). However, such alternatives often showed weaker binding affinities or lower reactivities compared to the natural substrates, which blurs the exact structural -functional relationship during protein engineering. A convenient platform to easily synthesize the exact substrates through in vivo cascade reactions for the directed evolution of target enzymes in natural product biosynthesis is needed (Figure 1C), which would accelerate the protein engineering process and benefit the related enzymology study.

[0370] Due to the anticancer, antimicrobial, antioxidant and anti-inflammatory activities of polyketides, type III polyketide synthases (PKSs) are one of the enzyme families that have drawn wide interest of research in protein engineering, enzymology and metabolic engineering. For example, triacetic acid lactone (TAL) is one of the simplest polyketides naturally produced by 2-pyrone synthase (2PS) through iterative Claisen condensation (Figure 5A-Figure 5B). It has been ranked as one of the top-ten biopnvileged molecules that can be derived from biomass and further converted to value-added products. Rational mutagenesis for the mechanistic study of PKSs has revealed how key differences in several active site residues contributed to the chemoselectivity for the PKS family sharing >50% identity in protein sequence (Figure 5C). However, most of these mutagenesis studies only proofed the interruption of chemoselectivity and substrate specificity by the removal of key residues. One great example to show how the chemoselectivity can be totally changed involves a top-down design with three mutations of chaicone synthase that produced TAL through the triketide intermediate, which yielded a functionally identical but lower performance mutant to 2PS (Figure ID). Recently, the substrate specificity of 2PS was also engineered to synthesize styrylpyrones with the catalytic efficiency even 58-fold higher than native styrylpyrone synthase (SPS). Besides such rational design, directed evolution of PKSs has also been developed. Unfortunately, because of the fragility and high cost of CoAs as the substrates, there are limitations in the directed evolution of PKSs: 1) relying on the A-acetyl cysteamine thioesters mimicking CoAs for in vitro assays 2) mostly evolving enzymes solely utilizing malonyl-CoA or acetyl-CoA that are intracellularly available in vivo. Due to the great abundance of aromatic polyketide products such as flavonoids and stilbenes in nature and their medicinal applications, it is important to establish in vivo systems for the directed evolution of PKSs utilizing aromatic-CoAs. There have been reports addressing such problem by incorporating aromatic-CoA biosynthesis pathway for directed evolution, but only the native function of enzymes was enhanced, which provided insufficient information to explain how tiny differences in the active site drastically changed the reactivity patterns among different PKSs.

[0371] To address the above issues, herein the construction of in vivo cascade reactions to engineer 2PS by directed evolution for the chemoselective biosynthesis of various aromatic polyketides by one enzy me scaffold is reported. From the directed evolution trajectory, the importance of intracellular selection pressure that ultimately determines the success of such in vivo biotransformation is revealed, which is hard to achieve via protein engineering in vitro. Such platform not only engineered 2PS to show excellent titers and yields towards various polyketides, but also can be applied to evolve other enzymes in the biosynthetic pathway by turning unstable intermediate into stable readouts. To study the structure-function relationship, computational tools were further used to reveal how a single residue has influenced the chain elongation that determines the chemoselectivity of 2PS.

[0372] Results

[0373] Directed Evolution of 2PS for enhanced styrylpyrone production. Previously, an E. coli Rosetta2(DE3) strain was constructed for the in vivo bioproduction of various pyrone products from the corresponding aromatic carboxylic acids with titer up to 17 mg / L in IL shaking flask culture. This system encoded malonyl-CoA synthetase (MatB) and 4-coumarate CoA ligase (4CL) genes in the pRSFDuet-1 vector as well as I201V / L202T / L261G / I343S-2PS mutant gene (SEQ ID NO: 16) in the pET16b vector. To further evolve the 2PS reactivity for styrylpyrone production with enhanced titer, the feasibility' for directed evolution studies of this E. coli Rosetta2(DE3) strain were first tested in 2 mL deep 96-well plates. The OD600 of each well after cell growth and protein induction period were compared by a plate reader, as well as the titer of bisnoryangonin (3, Figure ID) using p-coumaric acid as the substrate by HPLC (Table 1 - Table 2). From the coefficient of variation analysis, such platform showed small standard deviation and variation (3%-6%) for both the OD600 and the titer. As the starting point of 2PS directed evolution, this initial I201V / L202T / L261G / I343S-2PS mutant (SEQ ID NO: 16) also showed a strongly detectable signal of product (3) by HPLC with an average of 11 pg / mL titer in 1 mL culture. This suggested the possibility to access a wide range of 2PS mutants by directed evolution for enhanced polyketide biosynthesis.

[0374] Table 1. Coefficient of variation analysis of ODgoo for the deep 96-well screening platform.

[0375] Samples are diluted by 5-fold and measured by plate reader.

[0376] ODeoo: mean o = 0.433, standard deviation p = 0.014, coefficient of variation = 3.31% Table 2. Coefficient of variation analysis of titer for the deep 96-well screening platform.

[0377] Samples are diluted by 10-fold and measured by HPLC. The unit of titer is pg / mL.

[0378] HPLC: mean o = 1.103, standard deviation p = 0.067, coefficient of variation = 6.05%

[0379] With a reliable screening platform, directed evolution ofI201V / L202T / L261G / I343S- 2PS (SEQ ID NO: 16) was initiated with five rounds of iterative site-saturation mutagenesis (SSM) at the active site in the order of Leu202, Ile343, Ile201, Met259 and Thrl37 towards p- coumaric acid (Figure 2A). The results are summarized in Figure 2B showing the titer of product (3) from p-coumaric acid. In the first round of SSM at Leu202, L202G mutant resulted in 13- fold higher titer for product (3). Although the 2PS cavity was previously enlarged to accommodate aromatic CoAs by I201V / L202T / L261G / I343S-2PS (SEQ ID NO: 16) mutant from homology modeling, such L202G mutant indicated that an even larger pocket still promoted the styrylpyrone production. In the second round of SSM at Ile343, interestingly, an I343L mutation continuously increased 23% of the titer for product (3). This I343L mutation not only replaced the original I343S with a bulkier leucine mutation, but also removed the potential hydrogen bonding interaction possibilities. It is noteworthy that Ser343 widely exists in PKSs especially those which synthesizes aromatic polyketides and it is suggested to control chemoselectivity by participating in the hydrogen bonding networks (Figure 5C). Such mutation would be challenging to be designed rationally without directed evolution. Further SSM studies at V201, M259 and T137 did not result in any significant improvements, so one more round of randomization was carried out by error-prone PCR. Three extra mutations led to the final triketide mutant 1201 L / L202G / V2371 / L261 G / L342M / I343L-2PS (named as 3k-2PS) (SEQ ID NO: 8), which displayed the highest performance for triketide pyrone products generation. The titer reached 221 pg / mL and it led to the full conversion of / J-coumanc acid to bisnoryangonm. To study the rate of the whole-cell transformation by 3k-2PS, the kinetics were further monitored by measuring the time-dependent substrate consumption and product accumulation (Figure 6). It was shown that the biotransformation was fully completed after 9 hours of incubation.

[0380] With the high titer and yields for 3k-2PS mutant, it was sought to compare the catalytic performance of 3k-2PS with other evolved mutations (Table 3-Table 5 and Figure 9A- Figure 12B). Since 2PS naturally utilizes acety l-CoA and two molecules of malonyl-CoA, it was thought that the biotransformation improvement was from the enhancement of catalytic performance towards 2PS’ unnatural substrates. / ?-coumaroyl-Co A. Surprisingly, the catalytic efficiency of 2PS mutants towards the aromatic-CoA went up in the first round of L202-SSM, but gradually decreased in the other two mutants from directed evolution that showed higher titer (Figure 2C). For the 3k-2PS mutant, its catalytic efficiency towards cinnamoyl-CoA was even close to the initial mutant of directed evolution I201V / L202T / L261G / I343S-2PS (SEQ ID NO: 16). This clearly showed that the catalytic performance of p-coumaroyl-CoA could not account for the improvement via 2PS directed evolution.

[0381] Table 3. Michaelis-Menten parameters for p-coumaroyl-CoA.

[0382] Table 4. Michaelis-Menten parameters for malonyl-CoA.

[0383] Table 5. Michaelis-Menten parameters for cinnamic acid: It was then attempted to measure the catalytic performance of mutants towards malonyl- CoA, one of the other substrates. Malonyl-CoA is a central metabolite in living organisms for fatty acid biosynthesis that plays key roles in cell growth (Figure 2D). Due to the low cellular availability, it is suggested that intracellular malonyl-CoA concentration is the bottleneck for polyketide biosynthesis. Extensive metabolic engineering research has manipulated the metabolic pathways to enhance the flux towards malonyl-CoA. Based on this phenomenon, the Michaelis-Menten parameters for several mutants towards malonyl-CoA were compared. It was found that the catalytic efficiency towards malonyl-CoA continuously increased alongside the directed evolution trajectory, and 3k-2PS mutant displayed the highest one (Figure 2C). Such results not only explained the relationships between in vivo biotransformation and enzymatic function in this study, but also provided direct evidence to support that malonyl-CoA limits the polyketide biosynthesis. This result also suggested another straightforward strategy by protein engineering to enhance malonyl-CoA related bioproduction such polyketides.

[0384] Directed Evolution of 4CL for higher reactivity towards cinnamic acid With a satisfactory result for bisnoryangonin production from p-coumanc acid, it was next sought to test the performance from cinnamic acid, which would produce another major kavalactone precursor 6-styryl-4-hydroxy-2-pyrone. It is reported that WT-4CL (At4CLl fromArabidopsis thaliana is used in this study, Figure 2E) naturally prefers p-coumanc acid over cinnamic acid with over 100-fold higher catalytic efficiency. From this study, it was found that incomplete conversion of cinnamic acid and lower titer for the corresponding product (Figure 2F). Although the 3k-2PS mutant have produced 68 pg / mL pyrone product with 32-fold improvement than the initial mutant I201V / L202T / L261G / I343S-2PS (SEQ ID NO: 16), the best yield for 3k-2PS is still 32%. It was wondered if the catalytic efficiency of At4CL can be enhanced for cinnamoyl-CoA generation.

[0385] Previously, many of the reported studies to engineer the substrate specificity of 4CL has been done through rational site-directed mutagenesis. This is probably due to a lack of high throughput screening platform equipped with necessary detection methods for the final aromatic- CoAs. To address the mentioned difficulty, the polyketide biosynthesis cascade reactions were implemented in E. coli. Such in vivo cascades could transform aromatic-CoAs in situ into stable readout signals such as polyketide titers that enabled the possibility of 4CL directed evolution.

[0386] K333 and V368 sites of 4CL were first targeted by iterative SSM for a higher conversion of cinnamic acid and better titer of pyrone product (Figure 2E). These two residues were suggested to influence the substrate specificity of such enzyme family. Through directed evolution, it was found that the combination of K333L-4CL mutation with 3k-2PS showed 147 pg / mL titer and 69% yield, which was 2.1-fold better than WT-4CL (Figure 2F). Such K333L- 4CL mutant also enhanced the overall titer by 36% when I201V / L202G / L261G / I343L-2PS (SEQ ID NO: 5) was used. The Michaelis-Menten parameters of K333L-4CL were further compared with WT-4CL (Figure 13A-Figure 13B). It was shown that the single mutation enhanced the catalytic efficiency towards cinnamic acid by 7-fold. Due to the lack of 4-hydroxyl substitution and smaller size in cinnamic acid compared to p-coumaric acid, this K333L mutation provided more hydrophobic environment, which accounted for the enhanced reactivity. Overall, the potential of engineering 4CL in the polyketide biosynthesis by in vivo cascade reactions was demonstrated.

[0387] Directed Evolution of 2PS for chemoselective benzalacetone and tetraketide production. Besides triketide styrylpyrone production from the engineered 2PS with modified substrate scope to accommodate aromatic-CoAs, it was postulated that the chemoselectivity of 2PS can be switched from the lactonization of triketide to other reaction mechanisms (Figure ID). This is highly promising because a wide scope of mutant libraries can be accessed beyond rational design during the screening process of directed evolution. In the second round of Ile343 SSM using I201V / L202G / L261G / I343S-2PS (SEQ ID NO: 17) as the template, new peak generation by HPLC were successfully observed and their identities were confirmed by analytical standards and high-resolution mass spectrometry (Figure 7A-Figure 7B). It turned out that both the diketide product p-hydroxy benzalacetone (compound 2, Figure ID) as well as the tetraketide product p-coumaroyltri acetic acid lactone (compound 4, Figure ID) were generated by different mutants (Figure 7C).

[0388] Firstly, I201V / L202G / L261G / I343W-2PS (SEQ ID NO: 3) produced the 2.0 pg / mL diketide product, the native product of benzalacetone synthase (BAS). Such product is generated from the direct decarboxylation of the diketide intermediate to the corresponding methyl ketone product (Figure 3 A), which is demonstrated to rely on the unique Leu208 residue of BAS replacing the conserved gatekeeping Phe220 residue in PKSs (Figure 3B). Surprisingly, the diketide product was successfully produced in 2PS scaffold without F220L mutation with even slightly higher titer than native BAS, although the chemoselectivity is still low with 2.7 pg / mL of triketide product (Figure 3C). It would be of great interest to reconstitute this unique BAS-like reactivity with improved chemoselectivity in the 2PS scaffold which could offer more mechanistic insights behind this uncommon F208L mutation of BAS.

[0389] In order to improve the chemoselectivity as well as the titer of diketide production, one round of L202-SSM was first conducted for I201V / L202G / L261G / I343W-2PS (SEQ ID NO: 3) because this residue is known to control the selectivity and reactivity. L202S mutation stood out with doubled titer at 4.4 pg / mL, but 1.6 gg / mL of triketide product was still observed (Figure 3C). To remove the triketide side product, the native BAS active site was mimicked by screening different combinations of I201T, L202C and L219I mutations (Figure 5C). It turned out that I201V / L202C / L219I / L261G / I343W-2PS (SEQ ID NO: 6) showed the best chemoselectivity towards diketide product without obvious triketide production detected by HPLC, but the titer was decreased by 36% to 2.8 pg / mL (Figure 3C). To recover the biotransformation performance, two rounds of randomization were carried out using I201V / L202C / L219I / L261G / I343W-2PS (SEQ ID NO: 6) as the template. Two synonymous mutations (LI 10 and E353) enhanced the diketide titer to 4.3 pg / mL, which was 2-fold higher than native BAS with no detectable triketide by this 2k-2PS mutant (L110 / I201V / L202C / L219I / L261G / I343W / E353) (SEQ ID NO: 7).

[0390] Besides diketide and triketide products, another I201V / L202G / L261G / I343A-2PS mutant (SEQ ID NO: 4) with changed chemoselectivity was observed that favored tetraketide (4) production, which is the native product of CTAL ( / ?-coumaroyltri acetic acid lactone synthase) (Figure 7C and Figure 14A-Figure 14B). Although extra rounds of SSM were performed to evolve this tetraketide reactivity, a large amount of triketide side product still showed up which hampered the chemoselectivity and titer. This is probably due to the thermodynamically favorable lactonization in the triketide intermediate before another round of chain elongation happened. However, this intriguing Ile343 residue was observed that directly influenced the sterics and the reaction chemoselectivity results. With I201V / L202G / L261G triple mutations in 2PS, I343W led to diketide (2) production, I343L showed the highest reactivity towards triketide production (3) and I343A accumulated the largest amount of tetraketide (4) (Figure 3D).

[0391] Structural Explanation for the engineered chemoselectivity influenced by residue 343.

[0392] Computational studies were further conducted to reveal the residue 343 chemoselectivity mechanism among I201V / L202G / L261G / I343W | L | A-2PS mutants. Firstly, the corresponding mutant structures were prepared and simulated by molecular dynamics simulation. It is shown that the overall protein structures did not drastically change over the 20 ns simulation time with the RMSD values varying from 1.6 A to 1.9 A and about 0.1 A deviation (Table 6). The final output was then pulled out as the predicted mutant structures and different products were docked into each mutant. The tetraketide product (4) was successfully docked into the active site of I343A mutation (Figure 4A and Figure 8A) while it was kept outside of the chain elongation site for I343L due to the sterics (Figure 8D), which accounted for the increased production of tetraketide for 1343 A mutant. Similarly, the triketide product (3) entered the active site of I343L mutation (Figure 4B and Figure 8B) but it cannot be positioned correctly in I343W variant due to the bulky tryptophan (Figure 8E). Only the diketide product (2) can be docked successfully into the active site of I343W mutant (Figure 4C and Figure 8C). From the protein-ligand interaction analysis (Figure 8C), the ketone group of the diketide product showed hydrogen bonding interaction with one of the catalytic residues Asn341. Such ligand orientation and interaction in the active site clearly suggested how the engineered 2k-2PS mutant catalyzed the decarboxylation of the 0-keto acid intermediate using the same active site residues that were naturally designed for the malonyl-CoA decarboxylation, which supported the proposed native BAS mechanism.

[0393] Interestingly, key residues that were previously shown to be in charge of substrate specificity and chemoselectivity were flanked by L202G / L261G double mutation, which lost their ability to control the protein-ligand interaction through side chains. In this case, both experimental results and computational analysis revealed how one single residue 343 controlled the chemoselectivity among three distinct reactivity patterns by varying the steric effects.

[0394] Table 6. Molecular dynamics simulation result summary showing the structure variation along the 20 ns simulation time.

[0395] ( hemoen-ymatic synthesis of natural and unnatural kavalactones. Styrylpyrone products are natural precursors for the psychoactive kavalactones discovered in kava plants. The downstream reactions include further methylation and reduction reactions of styrylpyrones, naturally catalyzed by unique kava methyltransferases and reductase. Previous metabolic engineering study has revealed that the low efficiency of native SPS and methyltransferase are the major bottleneck for the heterologous expression of kavalactones. After the success of engineering 2PS with much better capability of styrylpyrone biosynthesis than native SPS, it was decided to enhance the methylation step performance. It is known that chemical nucleophilic methylation by methyl sulfate or lodomethane provides a robust solution in natural product total synthesis. Such methylation conditions for kavalactones were well documented in previous organic synthesis with 90%-95% yield. A chemoenzymatic synthetic route for kavalactones was thus built up, rather than relying on the native methyltransferase. Firstly, half liter biotransformation was carried out in shaking flasks for several substrates including 4-methyl, 4-fluoro substituted cinnamic acid that can be converted into unnatural kavalactones, with the calculated HPLC yield varying from 32%-98% (Figure 4D). Previous report utilizing native SPS could only produce ~2 mg / L bisnoryangonin (3) from p- coumaric acid in E. coli.. The system herein showed over 100-fold improvement for (3) and the highest reported titers for a series of pyrone products with an engineered 3k-2PS mutant that were not naturally designed for this purpose.

[0396] The crude products were then extracted by ethyl acetate, concentrated and the methylation reaction was directly carried out utilizing diisopropylethylamine / methyl sulfate or potassium carbonate / methyl sulfate. This led to an overall isolation yield of 16%-64% for kavalactone biosynthesis simply from the commercially available aromatic acids. Through this chemoenzymatic transformation, not only was high methylation yield for one of the bottleneck steps achieved, but the isolation procedures were also simplified. Previously, preparative HPLC was relied on to cleanly isolate styrylpyrones from the corresponding acid, due to the limited separation in flash-column chromatography and thin-layer chromatography (Figure 7C and Figure 15). After the methylation, the methyl esters synthetized from carboxylic acids are far less polar than kavalactones, which resulted in clean purifications by simple flash-column chromatography as evidenced by the NMR spectrums and other characterization methods.

[0397] Discussion. Polyketides are biosynthesized by PKSs in the secondary metabolism, which usually display low catalytic performance and become the bottleneck for metabolic engineering processes. Due to the lack of an efficient screening platform, most of the studies only showed how the chemoselectivity is hampered by mutating key residues in the active site by limited site- directed mutagenesis. In this study, in vivo cascade reactions were first built up and the exact acyl-CoA reactants were provided in situ that can be converted to different aromatic polyketides by 2PS. Through directed evolution, a full conversion of p-coumaric acid to the corresponding triketide bisnory angonin product (3) with 221 mg / L titer was achieved, which is 25-fold higher than a previous report, 100-fold higher than the reported system using native SPS. Since the native mechanism of 2PS utilizes acetyl-CoA and two molecules of malonyl-CoA, it was originally thought that the improvement of 2PS for aromatic PKSs production resulted from the continuously increasing catalytic efficiency towards its unnatural substrates, aromatic-CoAs. It turned out the catalytic improvement of 2PS towards malonyl-CoA was the determining factor. As show n in previous studies, most of the in vitro PKSs enzymatic assays usually limited the amount of starter CoAs and provided extra amount of malonyl-CoA. Sometimes such extra malonyl-CoA even increased the conversion of starter CoAs of in vitro enzymatic transformations. This not only blurred the great importance to improve the catalytic performance of malonyl-CoA, but also might lead to a failure of in vitro protein engineering for in vivo biosynthesis due to the lack of correct intracellular selection pression. In this study, the importance of engineering enzymes with proper intracellular selection pressure was addressed. Besides increasing the flux towards these low abundance intracellular metabolites by traditional metabolic engineering tools, another strategy was also suggested from protein engineering perspective by evolving these biosynthetic enzymes towards limiting metabolites. It is noteworthy that cofactor-dependent enzymes are widespread to accomplish enzymatic reactivity such as NAD(P)H, ATP and CoA, etc. Such intracellular metabolites are usually tightly regulated and widely distributed for all kinds of enzymes. This is highly intriguing for the ongoing protein engineering research to consider how to engineer a good biocatalyst in vivo', it is very important to engineer enzymes with high catalytic efficiency towards those widely used intracellular metabolites that can eventually divert the flux to the target bioproducts rather than biomass accumulation.

[0398] Besides protein engineering for styiylpyrone biosynthesis, such in vivo biocatalytic cascades can also accelerate the mechanistic understanding of PKSs. In the second round of directed evolution on 343-SSM, both diketide (2) and tetraketide (4) production were observed by different mutants (Figure 3D). This single Ile343 residue was also shown both experimentally and computationally to influence the chemoselectivity of 2PS for different polyketides production mainly through steric effect (Figure 4A-Figure 4C). It is noteworthy that these mutants have removed the potential side chain influences of L202 and L261 residues by L202G / L261G double mutations. Although previous studies have shown that Leu202, Leu261 and Ile343 all influenced the chemoselectivity based on homology modeling and rational mutagenesis, it was shown how the single Ile343 residue altered the chemoselectivity. Such phenomenon was observed previously to reveal the structural basis of natural evolution where one mutation influenced the chemoselectivity and reaction pattern of plant aromatic amino acid decarboxylase. Another artificial case was provided by reconstructing three different chemoselectivity in one enzyme scaffold by mutating this Ile343 residue.

[0399] The unusual diketide production mechanism was further studied because of the unique F220L substitution in native BAS, which is highly important for its natural function and not observed in other PKSs. Such diketide product (2) was the natural precursor for raspberry ketone, which accounts for the natural scent and flavor of ripe raspberries. Due to its low natural abundance in fruit but high demand in flavor and fragrance industry, raspberry ketone is one of the most expensive natural flavoring components. There have been reports for the heterologous production of raspberry ketone in microorganisms and all of the reports relied on native BAS. To better understand this industrially important BAS enzyme, it was previously studied by active site comparison with another diketide-producing quinolone synthase (QNS), which naturally did not accept p-coumaroyl-CoA. However, by Y202A-QNS mutation (numbered by 2PS sequence), it produced both diketide (2) and triketide (3) products from / i-coumaroyl-CoA. but the selectivity for diketide was poor and the catalytic efficiency was 4-fold lower than native BAS. In this case, it was first observed that the diketide production reactivity by I201V / L202G / L261G / I343W-2PS (SEQ ID NO: 3) also accompanied with triketide side product, but the titer was comparable with native BAS under the same biotransformation condition. By directed evolution and rational mutagenesis, 2-fold higher titer than BAS in comparison without detectable triketide was achieved. From the protein ligand docking analysis, the I343W mutation in the 2k-2PS variant blocked the active site to prevent extra chain elongation and reoriented the diketide product in a similar way as BAS, which facilitate the novel decarboxylation mechanism in this 2PS variant. Notably, such Trp343 residue was naturally observed in another PKS that only carried out one round of chain elongation with malonyl-CoA. Such chemoselectivity was hampered if Trp343 was mutated to smaller residues. This further accounted for the significance of the sterically bulky environment posted by Trp343 for diketide production in the engineered 2k-2PS mutant.

[0400] Besides polyketides, the enzymes in the biosynthetic pathways can all be possibly improved in the same platform especially for those key enzymes that would produce unstable product. 4CL is the key enzyme as the branch point of plant phenylpropanoid pathway which distribute different carbon flow from primary metabolism to various plant secondary metabolism, which was mainly studied by rational mutagenesis previously based on homology modeling. Herein the in vivo cascade reactions were utilized to enhance the reactivity of 4CL towards cinnamic acid by directed evolution (Figure 2E). By removing unnecessary hydrogen bonding interaction and providing a more compact, hydrophobic active site through K333L mutation, the cinnamate catalytic efficiency was enhanced by 7-fold, which ultimately led to over 147 pg / mL for the corresponding styrylpyrone production (Figure 2F). It is believed that such strategy can be adopted similarly in other biosynthetic pathways to further enhance the performance of enzymes by converting unstable intermediates into stable readouts.

[0401] Lastly, to further functionalize the polyketide products, the chemoenzymatic biosynthesis pathway for natural and unnatural kavalactones were constructed by methylating the corresponding styrylpyrones. It is noteworthy that kava drinking is quite popular globally with a huge market due to its psychoactive effects and have drawn a wide range of clinical research. It would be of great interest to produce both natural kavalactones and unnatural ones in large quantity in a sustainable fashion. Previously, kavalactones were only produced in very small amount in Saccharomyces cerevisiae with microgram per liter titer. A chemoenzymatic pathway was adopted to overcome the reported bottlenecks by utilizing the natural SPS and methyltransferase pathway. With the highly efficient 3k-2PS and an excellent yield of chemical methylation method, up to 160 mg / L kavalactones can be synthetized and isolated simply from the commercially available aromatic acids. This study represents the highest reported titers and yields for kavalactones produced by microorganisms.

[0402] In summary, via in vivo cascade reactions, solutions were provided to evolve key enzymes in late-stage biosynthetic pathways by substrate generation in situ and shown three distinct reactivity pattern of 2PS for diversified polyketide production. It also has revealed the great importance of intracellular selection pressure for in vivo biocatalysis which is essential to the success of such protein engineering research.

[0403] Methods

[0404] General information. Unless otherwise noted, all chemicals and reagents were obtained from commercial suppliers (Millipore Sigma, VWR, TCI America, Fischer Scientific) and were used without further purification. All the biological enzymes are purchased from New England Biolabs. NMR spectra of chemicals in CDCI3 were obtained using a Bruker AVANCE III 400 spectrometer and were referenced to residual solvent signals. Data for 1H NMR are reported as follows: chemical shift t (5 ppm), multiplicity (s = singlet, d = doublet, t = triplet, m = multiplet, bs = broad singlet), coupling constant (Hz), and integration. High-resolution mass spectra were obtained at the University of Texas, Austin Mass Spectrometry Facility using Agilent 6530 Q- TOF liquid chromatography-mass spectroscopy (LC / MS). Agilent 1200 Infinity instrument was used as reverse-phase high-performance liquid chromatography (HPLC) analysis with a Cl 8 (Agilent Polaris 180A C18-A, 4.6 x 150 mm, 5 pm) HPLC column. Self-operated LC-MS for analysis were carried out using Shimazu Q-TOF LC / MS-9030 system with a C18 (Agilent Polaris 180A C18-A, 4.6 x 150 mm, 5 pm) HPLC column. Water and acetonitrile (MeCN) containing 1% acetic acid were used as mobile phase for analytical HPLC.

[0405] HPLC methods. Water and acetonitrile (MeCN) containing 1% acetic acid were used as mobile phase in 0.4 mL / min flow rate. Column temperature oven was set at 30 °C. The separation program was 90% water for 5 min; 90% water to 10% water gradient for 10 min; 10% water for 5 min, 90% water for another 5 min. 10 pL of the reaction assay was directly injected. The yield was determined based on the product standard calibration curve (Figure 16).

[0406] Library construction for directed evolution. For saturation mutagenesis, the listed primers in Table 7 with degenerated codons (NNK) were utilized for PCR reactions. The PCR products were treated with NEB KLD enzyme mix (a mixture of Dpnl, kinase and ligase) and transformed into NEB 5-alpha competent E. coll cells. After overnight growth, all the colonies on LB agar plates were resuspended with autoclaved LB medium and collected into 5 mL LB small culture for miniprep (Qiagen spin miniprep kit) after 2 hours growth. The miniprepped DNA was the constructed library for directed evolution.

[0407] For error-prone PCR, the 2PS gene in pET16b vector was amplified with the primers by 50 pL PCR reaction. Agilent random mutagenic kit was applied for this process. A medium mutation rate was chosen based on the amount of template (~70 ng template, ~13 ng 2PS gene), primers (0.25 μM for each) and PCR cycles (30 cycles). The PCR procedure is: 95 °C for 5 min; 100 cycles of 94 °C for 30 s, 50 °C for 5 s; 4 °C forever. After PCR process, the DNA library was digested by Dpnl overnight to remove all the templates. The digested products were assembled to a linearized pET16b-vector using NEB HiFi assembly cloning kit. The assembled DNA was transformed into NEB 5-alpha competent E. coll cells. After overnight growth, all the colonies on LB agar plates were resuspended with autoclaved LB medium and collected into 5 mL LB small culture for miniprep (Qiagen spin miniprep kit) after 2 hours growth. The miniprepped DNA was the constructed library for directed evolution.

[0408] Table 7. Primers used for PCR reactions and Sanger sequencing. Degenerated codons shown in bold.

[0409] Double transformation. pET16b-2PS library and pRSFDuet-l-4CL-MatB were double- transformed into E. coll Rosetta2TM(DE3) competent cell (Novagen, purchased from Sigma- Aldrich, chloramphenicol resistance). Selection plates with 30 pg / mL kanamycin, 100 pg / mL ampicillin, 34 pg / mL chloramphenicol were prepared and used to select the double-transformed E. coli cell.

[0410] Deep 96-well plate screening for directed evolution. From the newly transformed library and control strain plates, 2x96 colonies were picked up into 200 pL LB medium each well in a Coming brand falcon 96-well clear flat bottom microplate (4 control strain are picked up in each plate at B2, B3, G10, G11). These two plates were shaken gently under 200 rpm for 2 hours. At the same time, 880 pL LB medium containing 30 pg / mL kanamycin, 100 pg / mL ampicillin, 34 pg / mL chloramphenicol was added into Nunc 2 mL deep 96-well plates for cell growth and reactivity test. 60 pL culture from microplates was transferred by multichannel pipette into deep well plates to inoculate each well. 40 pL 50% glycerol was added into each well of the microplates and they were stored under -80 °C for cell storage and DNA sequencing. The deep well cultures were grown under 900 rpm until OD600 reached 0.6-0.8. Then, the expression culture was induced with 0.5 mM isopropyl / >-D- 1 -thiogalactopyranoside (IPTG) (final concentration). Cells were expressed at 25 °C for another 18 hours. Once expression was finished, the cultures were centrifuged (3200 rpm, 25 minutes and 4 °C) and the spent medium was discarded. The pellet was resuspended in 1 mL M9 minimal medium containing the corresponding antibiotics, 0.5 mM IPTG, 1 mM aromatic carboxylic acid and incubated at 25 °C for an additional 48 hours. During all the process, 96-well plate was covered and taped by alumni foil to prevent water evaporation. To measure OD600 by a plate reader, 40 pL of culture was added into 160 pL of water in a microplate. To collect samples for HPLC, 60 pL of culture was collected and added into 60 p L of water in a microplate after two plates were centrifuged (3200 rpm, 25 minutes and 4 °C).

[0411] The top three mutants from the screening were picked up to inoculate another 4 replications of 1 mL culture in a deep 96-well plate to confirm its reactivity improvements. The sequence information is collected from Sanger sequencing with the corresponding primers.

[0412] The M9 minimal medium ingredients are as following: 33.7 mM Na2HPO4, 22.0 mM KH2PO4, 8.55 mM NaCl, 9.35 mMNH4Cl, 0.4% glucose, 1 mM MgSO4, 0.3 mM CaCh, 1 mg / L biotin, 1 mg / L thiamin and trace elements (134 μM EDTA, 31 μM FeCh-6H2O, 6.2 μM ZnCh, 0.76 μM CUC12-2H2O, 0.42 μM COC12-2H2O, 1.62 μM H3BO3, 0.081 μM MnCl2-4H2O).

[0413] Cell growth and protein purification for 2PS and 4CL mutants. To separate pET16b- 2PS mutant plasmid (AMP resistance) from the pRSF-Duet-1 plasmid (KAN resistance), diluted 200 pg DNA mixture from miniprepping the E. coli Rosetta2(DE3) cell was transformed into E. coli BL21(DE3) for protein expression. Several single colonies selected from the Ampicillin selection plate were steaked into another Kanamycin selection plate. The ones that can grow in Ampicillin selection plate but not Kanamycin ones are further grown in large culture. To get 4CL mutant, the corresponding gene was cloned from the miniprepped plasmid mixture and assembled into pET28a vector with the primers listed in Table 7. The cell growth, protein purification and purity characterization procedures for 2PS and 4CL variants are followed the same protocol reported in the previous publication.

[0414] Enzymatic analytical assays and Michaelis-Menten kinetic assays. For 2PS mutants, 200 pL reaction assays were conducted for all the analytical assays. Three parallel experiments for each condition were conducted. 5 mM malonyl CoA stock solution and 5 mM starter CoA stock solution were prepared in sodium phosphate buffer (NaPi, 100 mM, pH = 7) and flash- frozen under -80 °C for storage. To measure the Michaelis-Menten kinetics for aromatic CoAs, 5—75 μM starter CoA and 150 μM malonyl CoA were injected into 1.5 mL Eppendorf tube containing assay buffer (NaPi, 100 mM, pH = 7). 0.25-1 μM of protein was added into the assay solution to start the reaction. Three entries were prepared for each concentration. The reaction was shaken under 1500 rpm using a Thermo Fischer Thermomixer and quenched by adding 1% concentrated acetic acid at 30, 60, 90 seconds for each entry. The solution was vortexed carefully and centrifuged (180007g. 3 minutes and 4 °C) before chromatogram analysis. An initial rate when the conversion was less than 10% was measured from the study of kinetics.

[0415] For 4CL mutants, the assay protocol was reported previously and conducted here. The activity assay was conducted in a quartz cuvette containing 100 mM Tris (pH 7.5) with 2.5 mM MgCh, 2.5 mM ATP, 0.2 mM CoASH, 1-50 μM cinnamate and enzyme (15 nM for WT-4CL and 3 nM for K333L-4CL). The reaction starts when ATP is added and monitored by UV-Vis every 5 seconds. For cinnamoyl-CoA generation, the absorption at 311 nm was monitored with the extinction coefficient of 22000 Lxmol^xcm’1. An initial rate when the conversion was less than 10% was measured from the study of kinetics.

[0416] Product isolation, purification from large cell culture. Twenty colonies from double transformation were grown in 5 mL LB culture with 30 pg / mL kanamycin, 100 pg / mL ampicillin, 34 pg / mL chloramphenicol for 2 hours to inoculate 500 mL LB medium in 2.8-liter baffled culture flasks with the same antibiotic concentration shaking at 220 rpm, 37 °C. 0.5 mM IPTG was added when OD600 reached 0.8. The culture was kept shaking overnight at 200 rpm, 25 °C for 20 hours. Once expression was finished, the cultures were centrifuged (4000 rpm, 20 minutes and 4 °C) and the spent medium was discarded. The pellet was resuspended in 500 mL M9 minimal medium containing the three antibiotics, 0.5 mM IPTG, 1 mM aromatic carboxylic acid. The biotransformation was carried out at 25 °C for an additional 48 hours.

[0417] After 48 hrs, the pellet was separated by centrifugation (8000 rpm, 20 minutes and 4 °C). Three rounds of 300 mL ethyl acetate were used to extract the product from the supernatant. Saturated brine was added if the phase separation was poor. The organic phase was concentrated with rotatory evaporation, dried by vacuum and directly used for the methylation step.

[0418] Chemical methylation procedures. The crude organic extracts (around 100 mg) were dissolved in dry DCM (8 mL) and cooled down with ice bath. Three equivalents of diisopropylethylamine were added dropwise to the solution, followed by 5 equiv. of methyl sulfate. The reaction was kept cold for another 5 minutes and ran overnight. The reaction was quenched by adding 10 mL 1 M HC1, extracted with three times of 10 mL DCM. The organic phase was dried over anhydrous sodium sulfate and concentrated under vacuum. The resulting product was purified by flash column chromatography using hexane-EtOAc (3: 1) to afford the corresponding product.

[0419] For products from p-coumaric acid and phloretic acid that require double methylation, 8 mL dry acetone, 3 equiv. of potassium bicarbonate and 5 equiv. of methyl sulfate were utilized in the above procedures to successfully achieve double methylation in one pot.

[0420] Molecular dynamics simulation and protein-ligand docking analysis. The protein mutant structures were prepared in ChimeraX-1.2.5 by mutating the corresponding residues from the reported 2PS crystal structure (PDB: 1EE0). All the water and ligand molecules were removed. To simulate the protein scaffold, input files for NAMD were generated using CHARMM-GUI server. The ligand was parameterized by the server, a rectangular water box that fits the protein size was prepared by the server and 0.1 M sodium chloride was added. A 25 ns minimization and equilibrium process waw performed with a periodic boundary for constant pressure (isothermal-isobaric ensemble, NPT) and with a constant temperature of 310.25 K. A 20 ns production was performed with a periodic boundary for constant pressure (NPT) with a constant temperature of 310.25 K. The simulation output was analyzed by VMD and the final frame was extracted as the simulated mutation structure.

[0421] To perform protein-ligand docking, the ligand three dimensional PDB file was first converted from SMILES file by Openbable. The ligand and simulated protein scaffold both were used for docking calculations by Autodock Vina. A grid box of 20 A x 20 A x 20 A size was centered on the active site. Completeness was set to 16. No constraint was applied to the rotatable bond of the substrate. The lowest energy docking pose with the correct orientation was reported and used for further studies.

[0422] Gene and primer information

[0423] 3k-2PS (I201L / L202G / V237I / L261G / L342M / I343L) gene of pET16b-2PS (from 5’ to 3’, E. coll codon optimized) (SEQ ID NO: 44) (Start codon and stop codon are shown in bold. 6His-tag and TEV protease cleavage site are bolded and italicized. The mutation locations are underlined):

[0424] ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCGAGAACCTGTACTT CC4GGG7GGCAGCATGGGAAGTTATTCATCTGATGACGTAGAAGTGATTCGTGAGG CAGGCCGTGCTCAAGGCCTTGCCACGATCCTGGCAATTGGTACGGCGACCCCTCCCA ACTGCGTGGCCCAGGCAGACTACGCGGACTATTACTTTCGTGTTACCAAATCCGAAC ACATGGTTGACCTGAAGGAGAAGTTCAAACGCATCTGTGAGAAGACCGCGATCAAA AAGCGTTATCTGGCCTTAACCGAGGACTACTTGCAAGAAAATCCGACCATGTGCGA ATTTATGGCACCGTCCCTGAATGCTAGACAAGATCTGGTGGTAACAGGAGTTCCCAT GTTAGGGAAAGAGGCAGCTGTGAAGGCCATCGACGAATGGGGTTTGCCAAAAAGC AAAATCACGCACCTTATCTTTTGTACCACCGCGGGTGTTGATATGCCGGGCGCGGAT TATCAATTAGTCAAGCTCCTTGGCCTGTCCCCGAGCGTTAAGCGCTATATGTTGTAC CAACAGGGGTGCGCCGCGGGTGGCACCGTTCTGCGTCTGGCGAAGGATCTGGCCGA GAACAACAAAGGTTCTCGTGTTTTGATCGTTTGCAGCGAGATCACTGCGCTGGGGTT CCATGGTCCGAATGAAAACCACTTGGACAGCCTGGTTGCGCAGGCACTGTTTGGCG ATGGTGCAGCGGCGCTGATTGTGGGTAGCGGCCCTCATCTGGCGATCGAGCGTCCG ATTTTCGAGATCGTGAGTACCGACCAAACCATTCTGCCGGATACCGAAAAGGCGAT GAAAGGCCACTTGAGAGAAGGTGGTTTGACCTTCCAGCTGCACCGTGACGTGCCGC TGATGGTGGCAAAGAACATTGAAAACGCTGCTGAAAAGGCGCTGTCTCCGCTGGGT ATTACGGACTGGAATAGCGTGTTTTGGATGGTTCACCCGGGTGGCCGTGCTATCCTG GACCAGGTAGAGCGCAAACTGAATCTGAAAGAAGATAAACTGCGCGCTAGCCGTCA TGTTCTCTCCGAGTACGGCAACATGCTGTCGGCATGCGTGTTGTTCATCATTGATGA AGTTAGAAAGCGTAGCATGGCGGAAGGCAAATCTACGACCGGTGAAGGCCTGGATT GTGGTGTCCTGTTCGGCTTTGGCCCAGGTATGACCGTGGAAACCGTTGTGTTGCGCT CCGTTCGTGTGACCGCTGCTGTGGCAAACGGTAACTGA

[0425] 2k-2PS (L110 / I201V / L202C / L219I / L261G / I343W / E353) gene of pET16b-2PS (from 5’ to 3’, E. coll codon optimized) (SEQ ID NO: 7) (Start codon and stop codon are shown in bold. 6His-tag and TEV protease cleavage site are bolded and italicized. The mutation locations are underlined):

[0426] ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCGAGAACCTGTACTT CC4GGGTGGCAGCATGGGAAGTTATTCATCTGATGACGTAGAAGTGATTCGTGAGG CAGGCCGTGCTCAAGGCCTTGCCACGATCCTGGCAATTGGTACGGCGACCCCTCCCA ACTGCGTGGCCCAGGCAGACTACGCGGACTATTACTTTCGTGTTACCAAATCCGAAC ACATGGTTGACCTGAAGGAGAAGTTCAAACGCATCTGTGAGAAGACCGCGATCAAA AAGCGTTATCTGGCCTTAACCGAGGACTACTTGCAAGAAAATCCGACCATGTGCGA ATTTATGGCACCGTCCCTGAATGCTAGACAAGATCTGGTGGTAACAGGAGTTCCCAT GCTAGGGAAAGAGGCAGCTGTGAAGGCCATCGACGAATGGGGTTTGCCAAAAAGC AAAATCACGCACCTTATCTTTTGTACCACCGCGGGTGTTGATATGCCGGGCGCGGAT TATCAATTAGTCAAGCTCCTTGGCCTGTCCCCGAGCGTTAAGCGCTATATGTTGTAC CAACAGGGGTGCGCCGCGGGTGGCACCGTTCTGCGTCTGGCGAAGGATCTGGCCGA GAACAACAAAGGTTCTCGTGTTTTGATCGTTTGCAGCGAGATCACTGCGGTGTGCTT CCATGGTCCGAATGAAAACCACTTGGACAGCCTGGTTGCGCAGGCAATTTTTGGCG ATGGTGCAGCGGCGCTGATTGTGGGTAGCGGCCCTCATCTGGCGGTCGAGCGTCCG ATTTTCGAGATCGTGAGTACCGACCAAACCATTCTGCCGGATACCGAAAAGGCGAT GAAAGGCCACTTGAGAGAAGGTGGTTTGACCTTCCAGCTGCACCGTGACGTGCCGC TGATGGTGGCAAAGAACATTGAAAACGCTGCTGAAAAGGCGCTGTCTCCGCTGGGT ATTACGGACTGGAATAGCGTGTTTTGGATGGTTCACCCGGGTGGCCGTGCTATCCTG GACCAGGTAGAGCGCAAACTGAATCTGAAAGAAGATAAACTGCGCGCTAGCCGTCA TGTTCTCTCCGAGTACGGCAACCTGTGGTCGGCATGCGTGTTGTTCATCATTGATGA GGTTAGAAAGCGTAGCATGGCGGAAGGCAAATCTACGACCGGTGAAGGCCTGGATT GTGGTGTCCTGTTCGGCTTTGGCCCAGGTATGACCGTGGAAACCGTTGTGTTGCGCT CCGTTCGTGTGACCGCTGCTGTGGCAAACGGTAACTGA Key CDS region of pRSF-Duet-l-4CL-MatB (from 5’ to 3’) (SEQ ID NO: 45) (Start codon and stop codon are shown in bold. 4CL gene and MatB gene are underlined. T7 promoter is bolded and italicized):

[0427] ATGGAGGAGGATTACAAAATGGCGCCACAAGAACAAGCAGTTTCTCAGGTG ATGGAGAAACAGAGCAACAACAACAACAGTGACGTCATTTTCCGATCAAAGTTACC GGATATTTACATCCCGAACCACCTATCTCTCCACGACTACATCTTCCAAAACATCTC CGAATTCGCCACTAAGCCTTGCCTAATCAACGGACCAACCGGCCACGTGTACACTTA CTCCGACGTCCACGTCATCTCCCGCCAAATCGCCGCCAATTTTCACAAACTCGGCGT TAACCAAAACGACGTCGTCATGCTCCTCCTCCCAAACTGTCCCGAATTCGTCCTCTC TTTCCTCGCCGCCTCCTTCCGCGGCGCAACCGCCACCGCCGCAAACCCTTTCTTCACT CCGGCGGAGATAGCTAAACAAGCCAAAGCCTCCAACACCAAACTCATAATCACCGA AGCTCGTTACGTCGACAAAATCAAACCACTTCAAAACGACGACGGAGTAGTCATCG TCTGCATCGACGACAACGAATCCGTGCCAATCCCTGAAGGCTGCCTCCGCTTCACCG AGTTGACTCAGTCGACAACCGAGGCATCAGAAGTCATCGACTCGGTGGAGATTTCA CCGGACGACGTGGTGGCACTACCTTACTCCTCTGGCACGACGGGATTACCAAAAGG AGTGATGCTGACTCACAAGGGACTAGTCACGAGCGTTGCTCAGCAAGTCGACGGCG AGAACCCGAATCTTTATTTCCACAGCGATGACGTCATACTCTGTGTTTTGCCCATGTT TCATATCTACGCTTTGAACTCGATCATGTTGTGTGGTCTTAGAGTTGGTGCGGCGATT CTGATAATGCCGAAGTTTGAGATCAATCTGCTATTGGAGCTGATCCAGAGGTGTAAA GTGACGGTGGCTCCGATGGTTCCGCCGATTGTGTTGGCCATTGCGAAGTCTTCGGAG ACGGAGAAGTATGATTTGAGCTCGATAAGAGTGGTGAAATCTGGTGCTGCTCCTCTT GGTAAAGAACTTGAAGATGCCGTTAATGCCAAGTTTCCTAATGCCAAACTCGGTCA GGGATACGGAATGACGGAAGCAGGTCCAGTGCTAGCAATGTCGTTAGGTTTTGCAA AGGAACCTTTTCCGGTTAAGTCAGGAGCTTGTGGTACTGTTGTAAGAAATGCTGAGA TGAAAATAGTTGATCCAGACACCGGAGATTCTCTTTCGAGGAATCAACCCGGTGAG ATTTGTATTCGTGGTCACCAGATCATGAAAGGTTACCTCAACAATCCGGCAGCTACA GCAGAGACCATTGATAAAGACGGTTGGCTTCATACTGGAGATATTGGATTGATCGA TGACGATGACGAGCTTTTCATCGTTGATCGATTGAAAGAACTTATCAAGTATAAAGG TTTTCAGGTAGCTCCGGCTGAGCTAGAGGCTTTGCTCATCGGTCATCCTGACATTAC TGATGTTGCTGTTGTCGCAATGAAAGAAGAAGCAGCTGGTGAAGTTCCTGTTGCATT TGTGGTGAAATCGAAGGATTCGGAGTTATCAGAAGATGATGTGAAGCAATTCGTGT CGAAACAGGTTGTGTTTTACAAGAGAATCAACAAAGTGTTCTTCACTGAATCCATTC CTAAAGCTCCATCAGGGAAGATATTGAGGAAAGATCTGAGGGCAAAACTAGCAAAT GGATTGTGAGGATCCGAATTCGAGCTCGGCGCGCCTGCAGGTCGACAAGCTTGCGG CCGCATAATGCTTAAGTCGAACAGAAAGTAATCGTATTGTACACGGCCGCATAATC GAAATTA4L4CGACrC4CZ4r4G’G’GGAATTGTGAGCGGATAACAATTCCCCATCTTA GTATATTAGTTAAGTATAAGAAGGAGATATACATATGGCAGATCTCAATTGGGTGA GCAACCATCTTTTCGACGCCATGCGGGCCGCCGCGCCCGGTAACGCACCATTCATCC GGATCGATAACACGCGCACATGGACCTATGACGACGCCTTCGCTCTTTCCGGCCGCA TTGCCAGCGCGATGGACGCGCTCGGCATTCGCCCCGGCGACCGCGTTGCGGTGCAG GTCGAGAAAAGTGCCGAGGCATTGATCCTCTATCTCGCCTGTCTTCGAAGCGGCGCC GTCTACCTGCCGCTCAACACCGCCTATACGCTGGCTGAGCTCGATTATTTTATCGGC GATGCGGAGCCGCGTTTGGTGGTTGTCGCATCGTCGGCTCGAGCGGGCGTGGAGAC AATCGCCAAGCCCCGCGGTGCGATCGTCGAAACTCTCGACGCTGCTGGCAGCGGCT CGTTGCTGGATCTCGCCCGCGACGAGCCGGCCGACTTTGTCGATGCCTCGCGCTCCG CCGATGATCTGGCGGCGATCCTCTACACGTCCGGAACGACGGGACGCTCCAAGGGG GCGATGCTCACGCATGGGAACCTGCTCTCGAACGCCCTGACCTTGCGAGATTTTTGG CGCGTCACCGCCGGCGATCGACTGATCCATGCCTTGCCGATCTTCCACACGCATGGA CTGTTCGTCGCCACGAACGTCACACTGCTCGCCGGCGCCTCGATGTTCCTGCTGTCG AAGTTCGACCCGGAGGAGATCCTGTCGCTGATGCCGCAGGCAACGATGCTGATGGG CGTGCCGACCTTCTACGTGCGCCTCCTGCAGAGCCCGCGCCTCGACAAGCAAGCGGT CGCCAACATCCGCCTCTTCATTTCCGGTTCGGCTCCACTGCTTGCAGAAACACATAC CGAGTTCCAGGCACGTACCGGTCACGCCATTCTCGAGCGCTACGGCATGACGGAAA CCAATATGAACACGTCCAACCCTTATGAGGGGAAACGGATTGCCGGAACGGTCGGC TTCCCGCTGCCTGATGTGACGGTGCGCGTCACCGATCCCGCCACCGGGCTCGCGCTG CCGCCCGAACAAACCGGCATGATCGAGATCAAGGGGCCGAACGTTTTCAAGGGCTA TTGGCGCATGCCCGAAAAAACCGCGGCCGAATTCACCGCCGACGGTTTCTTCATCAG CGGCGATCTCGGCAAGATCGACCGCGACGGTTATGTCCACATCGTCGGCCGCGGCA AGGATCTGGTGATTTCGGGTGGATACAACATCTATCCGAAAGAGGTTGAGGGCGAG ATCGACCAGATCGAGGGTGTGGTTGAGAGCGCTGTGATCGGCGTGCCGCATCCCGA TTTCGGAGAAGGCGTAACGGCCGTCGTCGTGCGCAAGCCCGGCGCTGCCCTCGATG AAAAGGCCATCGTCAGCGCCCTCCAGGACCGGCTCGCGCGCTACAAACAACCCAAG CGCATCATCTTTGCAGAGGACTTGCCGCGCAACACGATGGGTAAGGTTCAGAAAAA CATCCTGCGGCAGCAATACGCCGATCTTTATACCAGGACGTAA

[0428] Product characterization

[0429] Characterization of demethoxyyangonin:

[0430] 1H NMR (400 MHz, Chloroform-J) 5 7.56 - 7.51 (m, 3H), 7.44 - 7.33 (m. 3H), 6.61 (d, J = 16.1 Hz, 1H), 5.97 (d, J= 2.1 Hz, 1H), 5.53 (d, J= 2.2 Hz, 1H), 3.86 (s, 3H) (Figure 17).13C NMR (101 MHz, CDCI3) δ 171.09, 164.02, 158.66, 135.84, 135.25, 129.46, 128.92, 127.47, 118.64, 101.35, 88.89, 55.95 (Figure 18).

[0431] HRMS: m / z calculated for C14H13O3 [M+H]+: 229.0859; found: 229.0863.

[0432] Characterization ofyangonin:

[0433] 1H NMR (400 MHz, Chloroform-J) 3 7.38 (d, J= 8.5 Hz, 2H), 6.84 (d, J= 8.7 Hz, 2H), 6.38 (d, J= 15.9 Hz, 1H), 5.83 (d, J= 2.1 Hz, 1H), 5.40 (d, J= 2.2 Hz, 1H), 3.77 (s, 3H), 3.76 (s, 3H) (Figure 19).

[0434] 13C NMR (101 MHz, CDCI3) δ 171.26, 164.20, 160.78, 159.14, 135.50, 129.00, 128.02, 116.39, 114.40, 100.47, 88.39, 55.90, 55.39 (Figure 20).

[0435] HRMS: m / z calculated for C15H15O4 [M+H]+: 259.0965; found: 259.0966.

[0436] Characterization of (E)-4-methoxy-6-(4-methylstyryl)-2H-pyran-2-one:

[0437] 1H NMR (400 MHz, Chloroform-J) δ 7.41 (d, J= 16.0 Hz, 1H), 7.33 (d, J= 7.9 Hz, 2H), 7.11 (d, J= 7.8 Hz, 2H), 6.47 (d, J= 15.9 Hz, 1H), 5.85 (d, J= 2.2 Hz, 1H), 5.41 (d, J= 2.1 Hz, 1H), 3.76 (s, 3H), 2.30 (s, 3H) (Figure 21).

[0438] 13C NMR (101 MHz, CDCI3) δ 171.17, 164.12, 158.93, 139.79, 135.85, 132.50, 129.65, 127.44, 117.65, 100.93, 88.65, 55.92, 21.42 (Figure 22).

[0439] HRMS: m / z calculated for C15H15O3 [M+H]+: 243.1016; found: 243.1019.

[0440] Characterization of (E)-6-(4-fluorostyryl)-4-methoxy-2H-pyran-2-one:

[0441] 1H NMR (400 MHz, Chloroform-d) δ 7.42 (t, J = 4.3 Hz, 3H), 7.39 (d, J = 7.0 Hz, 1H), 7.00 (t, J= 8.5 Hz, 3H), 6.43 (d, J= 15.9 Hz, 1H), 5.87 (d, J= 2.2 Hz, 1H), 5.43 (d, J= 2.2 Hz, 1H), 3.76 (s, 4H) (Figure 23).

[0442] 13C NMR (101 MHz, CDCI3) δ 171.07, 163.96, 158.48, 134.55, 131.48, 129.19 (d, J = 8.3 Hz), 118.39 (d, J= 2.5 Hz), 116.04. 115.93, 101.36, 88.90, 55.97 (Figure 24).

[0443] 19F NMR (376 MHz, Chloroform-J) δ -110.87 (m) (Figure 25).

[0444] HRMS: m / z calculated for C14H13FO3 [M+H]+: 247.0765; found: 247.0769.

[0445] Characterization of 7,8-dihydroyangonin:

[0446] !H NMR (400 MHz, Chloroform-d) δ 7.01 (d, J= 8.5 Hz, 2H), 6.76 (d, J= 8.6 Hz, 1H), 5.64 (d, J= 2.2 Hz, 1H), 5.34 (d, J= 2.2 Hz, 1H), 3.72 (s, 4H), 3.71 (s, 3H), 2.84 (dd, J= 9.0, 6.6 Hz, 2H), 2.64 (dd, J= 9.0, 6.6 Hz, 2H) (Figure 26).

[0447] 13C NMR (101 MHz, CDCI3) δ 171.19, 164.97, 164.49, 158.18, 131.92, 129.27, 114.00, 100.28, 87.69, 55.81, 55.27, 35.75, 31.98 (Figure 27).

[0448] HRMS: m / z calculated for C15H17O4 [M+H]+: 261.1121; found: 261.1124. Example 2 - Integrating Competitive Metabolic Pathways in Escherichia coli for Efficient Polyketide Biosynthesis Across Organisms

[0449] Abstract. Enzymes are frequently first engineered in vitro or in model microbial systems before being applied to non-model or multicellular organisms. However, it is challenging to ensure the high performance of engineered enzymes across different systems due to metabolic differences. Herein, the Gerbera hybrida 2-pyrone synthase (2PS) was first engineered in E. coli to display three distinct reactivity patterns by mutating a single active-site residue. Through directed evolution, engineered 2PS mutants outperformed native enzymes with over 100-fold titer improvement for diversified polyketide biosynthesis, including kavalactone and raspberry ketone precursors. To ensure the high performance of 2PS mutants in plants, a competitive plant lignin biosynthesis pathway was introduced to E. coli. Different trends of 2PS’ biocatalytic performance observed in plants have emerged in the engineered E. coli metabolism. These findings present a promising strategy to evolve enzymes in simplified platforms for their applications in non-model or multicellular organisms by integrating competitive biosynthetic pathways.

[0450] Introduction. Empowered by protein engineering, natural biocatalysts have been extensively engineered for enhanced performance and new-to-nature mechanism. Protein engineering, including directed evolution and continuous evolution, is primarily conducted in vitro or in model microorganisms such as Escherichia coli (E. colt) and Baker’s yeast, due to the well-established genetic tools (Figure 28A). To generate high-performing mutants that function effectively in non-model or multicellular systems like plants, it is advantageous to directly evolve enzymes in their working environments, allowing the appropriate selection pressures to be applied. However, this direct approach remains a significant challenge due to insufficient genetic tools and limited knowledge of the organisms’ physiology. As a result, enzymes are often engineered in vitro or in model microbial systems and then directly transferred to more complex organisms (Figure 28A). Unfortunately, the performance of these evolved mutants is not always reproducible across different organisms due to metabolic differences. Therefore, it is important to develop methods that enable the successful translation of protein engineering across diverse metabolism.

[0451] In natural secondary metabolism, many bioproducts with diverse biological activities have been produced including polyketides. For example, triacetic acid lactone (TAL, 1 in Figure 28B) is one of the simplest polyketides naturally produced by 2-pyrone synthase (2PS) through iterative Claisen condensation (Figure 5A- Figure 5B). It has been ranked as one of the top-ten bioprivileged molecules that can be derived from biomass and further converted to value-added products. Kavalactones (Figure 28B) are psychoactives that have drawn wide interest in clinical research and bioproduction. Raspberry ketone (Figure 28B) is one of the most expensive natural flavoring components due to its high demand in flavoring and fragrance industry. However, the low biocatalytic performance of the corresponding type III polyketide synthases (PKSs) presents a bottleneck for the heterologous bioproduction of these products, limiting their widespread applications.

[0452] To enhance the biocatalytic reactivities and study the mechanism of type III PKS family, extensive rational mutagenesis has been conducted. These studies revealed how specific variations in the active site played a critical role in the reactivity and chemoselectivity (Figure 5C). For example, the substrate specificity of 2PS was rationally engineered to synthesize styryl pyrones (3 in Figure 28B) with the catalytic efficiency 58-fold higher than the native styrylpyrone synthase (SPS). Besides rational mutagenesis, directed evolution of PKSs has also been explored. Unfortunately, the fragility and high cost associated with CoAs as substrates limit the throughput of directed evolution. Ideally, efficiently engineering a single PKS scaffold by directed evolution to display diverse chemoselectivity — mimicking or even outperforming other native enzymes in the PKS family — would provide deep mechanistic insights.

[0453] To address the issues above, a single 2PS scaffold was engineered by directed evolution in E. coll for chemoselective biosynthesis of diverse aromatic polyketides (Figure 28B). By introducing a competitive metabolic pathway from plants into E. coli, how metabolism influences the biocatalytic performance of these engineered 2PS mutants was examined. This study not only sheds light on the metabolic factors affecting enzyme reactivity but also provides a strategic framew ork for translating successful protein engineering from model microbial systems to more complex organisms like plants.

[0454] Results and Discussions

[0455] Directed evolution of 2PS for enhanced styrylpyrone production in E. coll Previously, an E. coll Rosetta2(DE3) strain was constructed for the bioproduction of various pyrone products from the corresponding aromatic carboxylic acids with titer up to 17 mg / L. This system encoded malonyl-CoA synthetase (MatB) and 4-coumarate CoA ligase (4CL) as well as I201V / L202T / L261G / I343S-2PS mutant (SEQ ID NO: 16). To further evolve the 2PS reactivity for styrylpyrone production by directed evolution, the bioproduction assay was tested in 2 mL deep 96-well plates. First, the ODeoo of each well after protein induction was compared by a plate reader, as well as the titer of bisnoryangomn (3, Figure 28B) by HPLC (Table 1 - Table 2). From the coefficient of variation analysis, this platform showed small variation (3%-6%) for both ODeoo and titer. The initial I201V / L202T / L261G / I343S-2PS mutant (SEQ ID NO: 16) also produced detectable amount of product (3), with an average of 11 pg / mL titer in 1 mL culture. These results suggested the possibility of screening a large set of 2PS mutants through directed evolution directly in living E. coll.

[0456] Next, the directed evolution study of I201V / L202T / L261G / I343S-2PS (SEQ ID NO: 16) was commenced, involving five rounds of iterative site-saturation mutagenesis (SSM) at the active site residues Leu202, Ile343, Ile201, Met259 and Thrl37 (Figure 2A-Figure 2B). In the first round of L202-SSM, the L202G mutant resulted in a 13-fold titer increase. Although the 2PS cavity by I201V / L202T / L261G / I343S-2PS (SEQ ID NO: 16) was previously enlarged by rational design, this beneficial L202G mutant indicated that an even larger active site still promoted the styrylpyrone production. In the second round of SSM at Ile343, interestingly, an I343L mutation increased 23% of the titer. Previously, the I343S mutation was introduced because Ser343 is highly conserved in native ty pe III PKSs that plays a role in controlling chemoselectivity through hydrogen bonding interactions (Figure 5C). This I343L mutation not only replaced the original I343S with a bulkier leucine mutation, but also removed the potential hydrogen bonding interactions. Further SSM studies at V201, M259 and T137 did not result in any significant improvements, so one more round of randomization was carried out by error- prone PCR. Three extra mutations led to the final triketide mutant I201L / L202G / V237I / L261G / L342M / I343L-2PS (named as 3k-2PS) (SEQ ID NO: 8). It reached 226 pg / mL titer and led to the 98% conversion of p-coumaric acid to bisnoryangonin (3). To study the rate of the whole-cell biotransformation by 3k-2PS, the time-dependent substrate consumption and product accumulation were monitored. It was shown that the reaction was completed after 9 hours (Figure 6).

[0457] With the high titer and yield of 3k-2PS mutant, its protein expression was compared with other evolved mutations, ft was found that the expression level was consistent and not improved by directed evolution (Table 8). Next, all the mutants were purified and the catalytic performance was compared (Table 3-Table 4 and Figure 30, Figure 9A-Supplementaiy Figure 12B). Since 2PS naturally utilizes acetyl-CoA and two molecules of malonyl-CoA, it was envisioned that the improvement was from the enhanced catalytic performance towards its unnatural substrate, p-coumaroyl-Co A. Surprisingly, the catalytic efficiency towards p- coumaroyl-CoA increased in the first round of L202-SSM (from 646 to 2957 s'1M'1), but gradually decreased in the following two mutants (Figure 2C). For the best-performing 3k-2PS mutant, its catalytic efficiency towards / ?-coumaroyl-CoA (692 s'1M'1) was even close to the initial mutant of directed evolution I201V / L202T / L261G / I343S-2PS (SEQ ID NO: 16) (646 s’1M'1). This discrepancy showed that the catalytic improvement of / ;-coumaroyl-CoA could not account for the titer enhancement.

[0458] Table 8. Protein expression yields for different mutants in 50 mL LB culture.

[0459] It was then attempted to measure the catalytic efficiency of mutants towards malonyl- CoA, one of the other substrates. Malonyl-CoA is a central metabolite essential for cell growth through fatty acid biosynthesis (Figure 2D). Due to the low cellular availability, it is suggested that intracellular malonyl-CoA concentration is the bottleneck for polyketide biosynthesis. Extensive metabolic engineering research was attempted to enhance the intracellular malonyl- CoA concentration. Through Michaelis-Menten kinetics measurement, it was found that the catalytic efficiency towards malonyl-CoA was continuously increased through directed evolution (from 4539 s'1M'1to 16570 s'1M'1) and 3k-2PS mutant displayed the highest one (Figure 2C). This trend not only correlated well with the titer improvement of 2PS mutants, but also supported the claim that malonyl-CoA abundance limited the polyketide biosynthesis.

[0460] Bringing the plant lignin biosynthetic pathway into E. coll. Styrylpyrone products are natural precursors for kavalactones discovered in plant kava (Figure 28B). Unlike E. coli, since plants are known to generate a series of aromatic-CoAs including p-coumaroyl-Co A from the shikimate metabolic pathway (Figure 29A), they can produce kavalactones without feeding extra aromatic substrates. In order to establish a highly efficient biosynthetic pathway for kavalactones in the model plant Nicotiana Benthamiana (N. Benthamiana), the effects of plant metabolism on the engineered 2PS mutants achieved from E. coli were studied.

[0461] By evaluating the plant metabolism, the lignin biosynthesis pathway is identified as a major route that consumes aromatic-CoAs and potentially competes with polyketide production (Figure 29A). Particularly, (hydroxy )cinnamoyl-CoA reductase (CCR) is one of the core lignin biosynthesis enzymes, which reduces aromatic-CoAs by NADPH. However, there is no such pathway in E. coli. To study the influence of plant lignin biosynthesis on polyketide production, the CCR was introduced into E. coli metabolism (Figure 29B).

[0462] Although CCRs have been characterized in many plant systems, the CCR gene from N. Benthamiana has only been tentatively reported (NP_001312907 in NCBI database) without confirmation. Thus, the putative 7V&CCR enzyme was first expressed and purified. From the enzymatic assays, it indeed catalyzes the reduction of p-coumaroyl-CoA to the aldehyde with the measured catalytic efficiency 1.4 xlO5M1s'1towards p-coumaroyl-CoA (Supplementary Figure 31A- Supplementary Figure 31C), which is over 200-fold higher than that of 3k-2PS (692 s'1M’ \ Figure 2C).

[0463] After identifying the functional MC’CR gene, it was cloned into the E. coll styrylpyrone biosynthesis strain and the bioproduction of bisnoryangonin (3) was monitored (Figure 29C). The titer was significantly decreased for all mutants, dropping to below 10 pg / mL. Surprisingly, it was I201V / L202G / L261G / I343L-2PS (SEQ ID NO: 5) (8 pg / mL) rather than 3k-2PS (4 pg / mL) that showed the highest titer. These differences suggest that the plant lignin biosynthesis pathways have influenced the biocatalytic performance of evolved 2PS mutants by competing with p-coumaroyl-CoA.

[0464] Applying 2PS mutants in plants for the direct kavalactone bioproduction. To further investigate how plant metabolism influenced 2PS mutants, the yangonin production (Figure 29D) in N. Benthamiana by the transient expression of necessary biosynthetic genes (2PS mutants and native kavalactone methyltransferases KOMT1, KOMT2) was compared. Indeed, all the 2PS protein were expressed in comparable levels in A Benthamiana, as verified by Western Blot (Figure 32A-Figure 32B). However, they produced yangonin in different amounts (Figure 29D). Among them, I201V / L202G / L261G / I343L-2PS (SEQ ID NO: 5) is the best performing mutant in N. Benthamiana (Figure 29D), with 2.7- and 8.9-fold improvement than 3k-2PS and the native styrylpyrone synthase (Figure 33), respectively. Such difference highlighted the difficulty of translating the success of protein engineering from E. coli to plants. However, the trend in plants resembled the results in E. coli after MCCR was introduced, which suggested a promising method to evolve enzymes in simplified platforms by integrating competing biosynthetic pathways from non-model or multicellular organisms.

[0465] To account for the observation above, the metabolic difference between E. coli and N. Benthamiana was compared. For both, malonyl-CoA is essential. In E. coli, 98% of the metabolic flux from p-coumaric acid was directed to bisnoryangonin (3), which suggested that the aromatic-CoA competition between endogenous E. coli metabolism and 3k-2PS was trivial. However, aromatic-CoAs are basic building blocks for lignin biosynthesis in plants (Figure 29 A), which play fundamental roles such as enhancing cell wall rigidity, promoting mineral transportation and acting as barriers against pathogens. The best performing mutant in plant I201V / L202G / L261G / I343L-2PS (SEQ ID NO: 5) has comparatively high catalytic efficiency for malonyl-CoA and 3.7-fold higher catalytic efficiency of p-coumaroyl-CoA than 3k-2PS (Figure 2C). Overall, it also indicates that both malonyl-CoA and aromatic-CoAs are potential limiting factors in plant systems for polyketide biosynthesis.

[0466] Chemoenzymatic synthesis of natural and unnatural kavalactones. The biosynthesis of kavalactones requires methylation of styrylpyrones, naturally catalyzed by methyltransferases K0MT1 and K0MT2. Previous studies have revealed that the low efficiencies of native SPS and methyltransferases were the major bottlenecks for the heterologous expression of kavalactones. After the success of engineering 2PS for styrylpyrone biosynthesis, it was decided to establish a chemoenzymatic synthetic route for kavalactones, because chemical methylation of styrylpyrone showed excellent yields (90%-95%).

[0467] Firstly, half-liter biotransformation was conducted in shaking flasks for several substrates, including 4-methyl and 4-fluoro substituted cinnamic acid. They were converted into unnatural kavalactones with the calculated HPLC yields ranging from 32% to 98% (Figure 29C). Previous reports utilizing native SPS could only produce ~2 mg / L bisnoryangonin (3) from p- coumaric acid in E. coll. In contrast, this system showed over 100-fold titer improvement and achieved the highest reported titers for various pyrone products.

[0468] The crude products were then extracted by ethyl acetate, concentrated, and then the methylation was directly carried out using the reported protocols. This led to an overall isolated yield of 16%-64% for kavalactone biosynthesis from the commercially available aromatic (Figure 29C). Previously, preparative HPLC was relied on to isolate styrylpyrones from the corresponding acids, due to their similar polarity (Figure 7A- Figure 7C, Figure 14A- Figure 14B, Figure 15). After the methylation step, the methyl esters derived from carboxylic acids are far less polar than kavalactones, which resulted in clean purifications by flash-column chromatography.

[0469] Directed evolution of 2PS for chemoselective benzalacetone and tetraketide production. Besides modifying the substrate scope of 2PS for triketide (3) production, it was postulated that the chemoselectivity of 2PS can be switched from the lactonization of triketide to other reaction mechanisms (Figure 28B). Indeed, during the second round of SSM targeting Ile343 with I201V / L202G / L261G / I343S-2PS (SEQ ID NO: 17) as the template, new products were able to be detected using HPLC. It was confirmed that both the diketide p- hydroxybenzalacetone (2, Figure 28B), and the tetraketide, / i-coumaroyltn acetic acid lactone (4, Figure 28B) were generated by different mutants (Figure 7A- Figure 7C, Figure 14A-Figure 14B).

[0470] Firstly, I201V / L202G / L261G / I343W-2PS (SEQ ID NO: 3) produced the 2.0 pg / mL diketide (2), via the direct decarboxylation of the diketide intermediate to the corresponding methyl ketone product (Figure 3A). Notably, such Trp343 residue was naturally observed in another PKS that only carried out one round of chain elongation with malonyl-CoA. This unique diketide (2) is natively produced by benzalacetone synthase (BAS), which replaced the highly- conserved gatekeeping Phe208 residue in PKSs with leucine in the BAS active site (Figure 3B). Surprisingly, the diketide (2) was successfully produced by a 2PS mutant without F220L mutation (Figure 3C). However, the chemoselectivity is still low with 2.7 pg / mL of triketide (3).

[0471] To improve the chemoselectivity as well as the titer of diketide (2) production, one round of L202-SSM was first conducted for I201V / L202G / L261G / I343W-2PS (SEQ ID NO: 3) because this residue is known to control the selectivity and reactivity'. L202S mutation stood out with doubled titer at 4.4 pg / mL, but 1.6 pg / mL of triketide was still observed (Figure 3C). To remove the triketide side product, the native BAS active site was mimicked by screening different combinations of I201T, L202C and L219I mutations. It turned out that I201V / L202C / L219I / L261G / I343W-2PS (SEQ ID NO: 6) showed the best chemoselectivity towards diketide (2) without detectable triketide (3) by HPLC. However, the titer was decreased by 36% to 2.8 pg / mL (Figure 3C). To recover the biotransformation performance, two rounds of randomization were conducted using I201V / L202C / L219I / L261G / I343W-2PS (SEQ ID NO: 6) as the template. Two synonymous mutations (LI 10 and E353) enhanced the diketide titer to 4.3 pg / mL, which was 2-fold higher than WT-BAS without detectable triketide side product (Figure 3C). The best mutant was named as 2k-2PS (LI 10 / I201V / L202C / L219I / L261G / I343W / E353) (SEQ ID NO: 7).

[0472] Besides diketide (2) and triketide (3), another I201V7L202G / L261G / I343A-2PS (SEQ ID NO: 4) mutant was observed with changed chemoselectivity that favored tetraketide (4) production, which is the native product of CTAL ( / ?-coumaroyl tri acetic acid lactone synthase) (Figure 32A-Figure 32B). Although extra rounds of SSM were performed to evolve this tetraketide reactivity, a large amount of triketide side product still formed. This is probably due to the thermodynamically favorable lactonization in the triketide intermediate before the next round of chain elongation. However, it was observed that the intriguing Ile343 residue directly influenced the sterics and chemoselectivity results. With I201V / L202G / L261G triple mutations in 2PS, I343W led to diketide (2) production; I343L showed the highest reactivity towards triketide (3); I343A accumulated the largest amount of tetraketide (4) (Figure 3D).

[0473] Computational studies were further conducted to reveal how residue 343 changed the chemoselectivity among I201V / L202G / L261G / I343W|L|A-2PS mutants. Firstly, the protein structures of the three mutants didn’t drastically change over the 20 ns simulation, with the Ca RMSD varying from 1.6 A to 1.9 A (Table 6). The final outputs were then used as the predicted mutant structures and different products were docked into each mutant. Tetraketide (4) was successfully docked into the active site of 1343 A mutant (Figure 4A, Figure 8A) while it was kept outside of I343L mutant due to sterics (Figure 8E), which accounted for the increased production of tetraketide for I343A mutant. Similarly, triketide (3) entered the active site of I343L mutant (Figure 4B, Figure 8B) but it cannot be positioned correctly in I343W mutant due to the bulky tryptophan (Figure 8D). Only the diketide (2) can be docked successfully into the active site of I343W mutant (Figure 4C, Figure 8C). From the protein-ligand interaction analysis, the ketone group of diketide (2) showed hydrogen bonding interaction with one of the catalytic residues Asn341 that natively participated in the decarboxylation of malonyl-CoA (Figure 8C). Such decarboxylative mechanism can be utilized to catalyze the decarboxylation of the P-keto acid intermediate in 2k-2PS (Figure 3A), which supported the proposed BAS mechanism.

[0474] Conclusion. In summary, a single 2PS scaffold was engineered by directed evolution to display three distinct reactivity patterns controlled by Ile343. This approach enabled the effective bioconversion (>98%) of p-coumaric acid to bisnoryangonin (3) in E. coli by 3k-2PS with >1 OO- fold higher titer than WT-SPS, and >2-fold higher titer than WT-BAS for raspberry ketone precursor biosynthesis by 2k-2PS. From Michaelis-Menten kinetics, it turned out the catalytic improvement of 2PS towards malonyl-CoA contributed to the titer growth, rather than its unnatural reactant p-coumaroyl-CoA. To explore how to translate the success of 2PS protein engineering from E. coli to N. Benthamiana, a key plant lignin biosynthesis pathway was introduced in E. coli to establish a competitive metabolic pathway for p-coumaroyl-CoA. The best-performing 2PS mutant was changed from 3k-2PS to the one with high catalytic efficiency towards both malonyl-CoA and p-coumaroyl-CoA. This altered trend was also observed in N. Benthamiana. It suggested a promising method to evolve enzymes via simplified platforms by integrating competitive biosynthetic pathways from non-model or multicellular organisms to allow the successful translation across diverse biological systems. Furthermore, a chemoenzymatic biosynthesis pathway for natural and unnatural kavalactones was established from p-coumaric acid with up to 64% yield in two steps.

[0475] Methods

[0476] General information. Unless otherwise noted, all chemicals and reagents were obtained from commercial suppliers (Millipore Sigma, VWR, TCI America, Fisher Scientific) and were used without further purification. All the biological enzymes are purchased from New England Biolabs. NMR spectra of chemicals in CDCI3 were obtained using a Bruker AVANCE III 400 spectrometer and were referenced to residual solvent signals. Data forJH NMR are reported as follows: chemical shift t (5 ppm), multiplicity (s = singlet, d = doublet, t = triplet, m = multiplet, bs = broad singlet), coupling constant (Hz), and integration. High-resolution mass spectra were obtained at the University of Texas, Austin Mass Spectrometry Facility using Agilent 6530 Q- TOF liquid chromatography-mass spectroscopy (LC / MS). Agilent 1200 Infinity instrument was used as reverse-phase high-performance liquid chromatography (HPLC) analysis with a Cl 8 (Agilent Polaris 180A C18-A, 4.6 x 150 mm, 5 pm) HPLC column.

[0477] HPLC method and LC / MS method. For analytical HPLC, water and acetonitrile (MeCN) containing 1% acetic acid were used as mobile phase in 0.4 mL / min flow rate. Column temperature oven was set at 30 °C. The separation program was 90% water for 5 min; 90% water to 10% water gradient for 10 min; 10% water for 5 min, 90% water for another 5 min. 10 pL of the reaction assay was directly injected. The yield was determined based on the standard calibration curves (Figure 16).

[0478] For LC / MS analysis of kavalactones, it was conducted in Agilent Technology 6546 accurate-mass Q-TOF. Ionization was negative mode electrospray. Agilent ZORBAX RRHD Eclipse Plus C18 column was used. Water containing 0.1% formic acid and methanol were used as mobile phase in 0.4 mL / min flow rate. The separation program was 95% water for 2 min; 95% water to 80% water gradient for 3 min; 80% water to 5% water gradient for 7 min; 5% water for 4 min.; 95% water for 0. 1 min.

[0479] Library construction for directed evolution. For saturation mutagenesis, the listed primers in Table 7 with degenerated codons (NNK) were utilized for PCR reactions. The PCR products were treated with NEB KLD enzyme mix (a mixture of Dpnl, kinase and ligase) and transformed into NEB 5-alpha competent E. coll cells. After overnight growth, all the colonies on LB agar plates were resuspended with autoclaved LB medium and collected into 5 mL LB small culture for miniprep (Qiagen spin miniprep kit) after 2 hours growth. The minipreped DNA was the constructed library for directed evolution.

[0480] For error-prone PCR, the 2PS gene in pET16b vector was amplified with the primers by 50 pL PCR reaction. Agilent random mutagenic kit was applied for this process. A medium mutation rate was chosen based on the amount of template (~70 ng template, ~13 ng 2PS gene), primers (0.25 μM for each) and PCR cycles (30 cycles). The PCR procedure is: 95 °C for 5 min; 100 cycles of 94 °C for 30 s, 50 °C for 5 s; 4 °C forever. After PCR process, the DNA library was digested by Dpnl overnight to remove all the templates. The digested products were assembled to a linearized pET16b-vector using NEB HiFi assembly cloning kit. The assembled DNA was transformed into NEB 5-alpha competent E. coli cells. After overnight growth, all the colonies on LB agar plates were resuspended with autoclaved LB medium and collected into 5 mL LB small culture for miniprep (Qiagen spin miniprep kit) after 2 hours growth. The minipreped DNA was the constructed library for directed evolution.

[0481] Deep 96-well plate screening for directed evolution. From the newly transformed library and control strain plates, 2x96 colonies were picked up into 200 pL LB medium each well in a Coming brand falcon 96-well clear flat bottom microplate (4 control strain are picked up in each plate at B2, B3, GIO, Gil). These two plates were shaken gently under 200 rpm for 2 hours. At the same time, 880 pL LB medium containing 30 pg / mL kanamycin, 100 pg / mL ampicillin, 34 pg / mL chloramphenicol was added into Nunc 2 mL deep 96-well plates for cell growth and reactivity test. 60 pL culture from microplates was transferred by multichannel pipette into deep well plates to inoculate each well. 40 pL 50% glycerol was added into each well of the microplates and they were stored under -80 °C for cell storage and DNA sequencing. The deep well cultures were grown under 900 rpm until OD600 reached 0.6-0.8. Then, the expression culture was induced with 0.5 mM isopropyl / >-D- l -thiogalactopyranoside (IPTG) (final concentration). Cells were expressed at 25 °C for another 18 hours. Once expression was finished, the cultures were centrifuged (3200 rpm, 25 minutes and 4 °C) and the spent medium was discarded. The pellet was resuspended in 1 mL M9 minimal medium containing the corresponding antibiotics, 0.5 mM IPTG, 1 mM aromatic carboxylic acid and incubated at 25 °C for an additional 48 hours. During all the process, 96-well plate was covered and taped by alumni foil to prevent water evaporation. To measure OD600 by a plate reader, 40 pL of culture was added into 160 pL of water in a microplate. To collect samples for HPLC, 60 pL of culture was collected and added into 60 pL of water in a microplate after two plates were centrifuged (3200 rpm, 25 minutes and 4 °C).

[0482] The top three mutants from the screening were picked up to inoculate another 4 replications of 1 mL culture in a deep 96-well plate to confirm its reactivity improvements. The sequence information is collected from Sanger sequencing with the corresponding primers.

[0483] The M9 minimal medium ingredients are as following: 33.7 mM Na2HPO4, 22.0 mM KH2PO4, 8.55 mM NaCl, 9.35 mMNELCl, 0.4% glucose, 1 mM MgSCL, 0.3 mM CaCh, 1 mg / L biotin, 1 mg / L thiamin and trace elements (134 μM EDTA, 31 μM FeCh-6H2O, 6.2 μM ZnCh, 0.76 μM CUC12-2H2O, 0.42 μM COC12-2H2O, 1.62 μM H3BO3, 0.081 μM MnCl2-4H2O).

[0484] Cell growth and protein purification for 2PS mutants and A / A CR. To separate pET16b-2PS mutant plasmid (AMP resistance) from the pRSF-Duet-1 plasmid (KAN resistance), diluted 200 pg DNA mixture from miniprepping the E. coli Rosetta2(DE3) cell was transformed into E. coli BL21(DE3) for protein expression. Several single colonies selected from ampicillin selection plate were steaked into another Kanamycin selection plate. The ones that can grow in ampicillin selection plate but not Kanamycin ones are further grown in large culture. The cell growth, protein purification and purity characterization procedures for 2PS variants are followed the same protocol reported elsewhere. For protein expression yield comparison of 2PS mutants, three 200 mL shaking flasks containing 50 mL LB medium were prepared for each mutant. The protein was purified using the reported protocol but with 1 mL Ni-HisTrap column.

[0485] For MCCR, 1.5 L LB medium of A’, coll BL21(DE3) were grown at 37°C with 100 pg / mL ampicillin. Then, the expression culture was induced with 0.5 mM isopropyl / AD- 1 - thiogalactopyranoside (IPTG) when ODeoo reached 0.6. Protein expression was conducted at 20 °C and 180 rpm overnight. Once expression was finished, the cultures were centrifuged (8000 x g, 20 minutes and 4 °C). The pellet was then resuspended in 50 mL lysis buffer (300 mM NaCl, 20 mM imidazole, pH 8) by adding 1 mg / mL lysozyme, 1 mM PMSF (final concentration) and 1 pL benzonase for 30 min. The solution was sonicated for 5 minutes. The supernatant was separated and filtered after centrifugation (18000 x g, 20 minutes and 4 °C) and loaded into 5 mL Cytiva nickel HisTrap high performance column (2 mL / min loading rate). The column was washed with 2 CVs of the lysis buffer, and recombinant enzymes were eluted with elution buffer (50 mM Tris, 300 mM NaCl, 250 mM imidazole, pH 8). The corresponding fraction was concentrated using centrifugal spin filters (10 kDa molecular weight cut-off, Amicon Ultra, Merck Millipore). Subsequently, the concentrated protein solution was loaded into HiLoad™ 16 / 60 Superdex 75 size exclusion column. Concentrated protein was further purified in the Akta purifier FPLC system in 0.5 mL / min SEC buffer (100 mM NaPi, pH = 7.5) for 1 CV. Protein fractions were analyzed by SDS-PAGE gel.

[0486] Enzymatic analytical assays and Michaelis-Menten kinetic assays. For 2PS mutants, 200 pL reaction assays were conducted for all the analytical assays. Three parallel experiments for each condition were conducted. 5 mM malonyl CoA stock solution and 5 mM starter CoA stock solution were prepared in sodium phosphate buffer (NaPi, 100 mM, pH = 7) and flash- frozen under -80 °C for storage. To measure the Michaelis-Menten kinetics for aromatic CoAs, 5—75 μM starter CoA and 150 μM malonyl CoA were injected into 1.5 mL Eppendorf tube containing assay buffer (NaPi, 100 mM, pH = 7). 0.25-1 μM of protein was added into the assay solution to start the reaction. Three entries were prepared for each concentration. The reaction was shaken under 1500 rpm using a Thermo Fisher Thermomixer and quenched by adding 1% concentrated acetic acid at 30, 60, 90 seconds for each entry. The solution was vortexed carefully and centrifuged (18000 x g. 3 minutes and 4 °C) before chromatogram analysis. An initial rate when the conversion was less than 10% was measured from the study of kinetics.

[0487] For MCCR, the reaction mixture contained 100 mM phosphate buffer (pH 6.5), different concentrations of p-coumaroyl-CoA (10-100 μM), 200 μM NADPH and 100 nM protein in a total volume of 200 pL at 37 °C. It was monitored by UV-Vis spectrophotometer at 366 nm. Reduction was determined by the decrease in A366 and quantified with the reported extinction coefficient.

[0488] Product isolation and purification from large cell culture. A single colony from double transformation was grown in 5 mL LB culture overnight with 30 pg / mL kanamycin, 100 pg / mL ampicillin, 34 pg / mL chloramphenicol to inoculate 500 mL LB medium with the same antibiotic concentration shaking at 220 rpm, 37 °C. 0.5 mM IPTG was added when ODeoo reached 0.8. The culture was kept shaking overnight at 200 rpm, 25 °C for 20 hours. Once expression was finished, the cultures were centrifuged (4000 rpm, 20 minutes and 4 °C) and the spent medium was discarded. The pellet was resuspended in 500 mL M9 minimal medium containing the three antibiotics, 0.5 mM IPTG, 1 mM aromatic carboxylic acid. The biotransformation was carried out at 25 °C for an additional 48 hours.

[0489] After 48 hours, the pellet was separated by centrifugation (8000 rpm, 20 minutes and 4 °C). Three rounds of 300 mL ethyl acetate were used to extract the product from the supernatant. Saturated brine was added if the phase separation was poor. The organic phase was concentrated with rotatory evaporation, dried by vacuum, and directly used for the methylation step.

[0490] Chemical methylation procedures. The crude organic extracts (around 100 mg) were dissolved in dry DCM (8 mL) and cooled down with ice bath. Three equivalents of diisopropylethylamine were added dropwise to the solution, followed by 5 equiv. of methyl sulfate. The reaction was kept cold for another 5 minutes and ran overnight. The reaction was quenched by adding 10 mL 1 M HC1, extracted with three times of 10 mL DCM. The organic phase was dried over anhydrous sodium sulfate and concentrated under vacuum. The resulting product was purified by flash column chromatography using hexane-EtOAc (3: 1) to afford the corresponding product.

[0491] For products from p-coumaric acid and phloretic acid that require double methylation, 8 mL dry acetone, 3 equiv. of potassium bicarbonate and 5 equiv. of methyl sulfate were utilized in the above procedures to successfully achieve double methylation in one pot.

[0492] Plant infiltration for kavalactone transient expression in N. Benthamiana. pEAQ- HT-2PS mutants are prepared by NEB HiFi assembly with the purchased gblocks from Integrated DNA Technologies. The constructed plasmids were individually transformed into LBA4404 agrobacterium chemical competent cells (purchased from GoldBio). Bacteria were grown at 28 °C in LB medium overnight, washed with 0.5 x PBS buffer and resuspended in 0.5 x PBS buffer to ODsoo of 0.8. Individual cultures were mixed to reach the final ODeoo of 0.8 for co-expression of multiple genes. 1 mL of the final culture was utilized to infiltrate the underside of 5-6 weeks old N. Benthamiana leaves. The infiltrated leaves were harvested 5 days for metabolite extraction.

[0493] Western blotting for the protein expression level comparison of 2PS mutants. The protocol was modified from a previous publication. For 2PS protein detection of transient expression in tobacco leaves, leaf tissues of transfected tobacco were snap-frozen and ground in a prechilled mortar to fine powders with liquid nitrogen. Non-transfected tobacco leaves served as negative control. Approximately 200 mg ground plant materials were weighed and mixed with 2x Laemmli sample buffer with 10% 2-mercaptoethanol and total protein extracts were then denatured by heating at 85°C for 8 min. Denatured proteins were resolved by 10% SDS-PAGE and transferred to a nitrocellulose membrane (0.2 pm; Bio-Rad) using the wet-tank transfer method and blocked with 5% nonfat milk solution in Tris-buffered saline Tween (TBST) for one hour at room temperature before the overnight inoculation in primary antibody at 4°C with gentle rotation. The anti-HA (HA-Tag (C29F4) Rabbit mAb #3724, Cell Signaling Technology) were diluted to 1 : 10 000 in 5% nonfat milk solution in TBST as primary antibody; goat anti- rabbit (IgG (H + L)-horseradish peroxidase (HRP) conjugate #1706515; Bio-Rad) were used as secondary antibody at 1 : 10 000 dilution. HRP activity was detected using enhanced chemiluminescence (ECL; GE Healthcare) according to the manufacturer's instructions with ChemiDoc Imaging System (Bio-Rad). Ponceau red staining of RuBisCO on the immunoblot was used as the loading control. Quantifications of western blot band intensities were performed with ImageJ, and normalized to the band intensity of RuBisCo in the same sample lane.

[0494] Molecular dynamics simulation and protein-ligand docking analysis. The protein mutant structures were prepared in ChimeraX-1.2.5 by mutating the corresponding residues from the reported 2PS crystal structure (PDB: 1EE0). All the water and ligand molecules were removed. To simulate the protein scaffold, input files for NAMD were generated using CHARMM-GUI server. The ligand was parameterized by the server, a rectangular water box that fits the protein size was prepared by the server and 0.1 M sodium chloride was added. A 25 ns minimization and equilibrium process was performed with a periodic boundary for constant pressure (isothermal-isobaric ensemble, NPT) and with a constant temperature of 310.25 K. A 20 ns production was performed with a periodic boundary for constant pressure (NPT) with a constant temperature of 310.25 K. The simulation output was analyzed by VMD and the final frame was extracted as the simulated mutation structure.

[0495] To perform protein-ligand docking, the ligand three dimensional PDB file was first converted from SMILES file by Openbable. The ligand and simulated protein scaffold both were used for docking calculations by Autodock Vina. A grid box of 20 A x 20 A x 20 A size was centered on the active site. Completeness was set to 16. No constraint was applied to the rotatable bond of the substrate. The lowest energy docking pose with the correct orientation were reported and used for further studies.

[0496] Gene and primer information

[0497] 3k-2PS (I201L / L202G / V237I / L261G / L342M / I343L) gene of pET16b-2PS (from 5’ to 3’, E. coll codon optimized) (SEQ ID NO: 44) (Start codon and stop codon are shown in bold. 6His-tag and TEV protease cleavage site are bolded and italicized. The mutation locations are underlined):

[0498] ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCGAGAACCTGTACTT CC4GGGTGGCAGCATGGGAAGTTATTCATCTGATGACGTAGAAGTGATTCGTGAGG CAGGCCGTGCTCAAGGCCTTGCCACGATCCTGGCAATTGGTACGGCGACCCCTCCCA ACTGCGTGGCCCAGGCAGACTACGCGGACTATTACTTTCGTGTTACCAAATCCGAAC ACATGGTTGACCTGAAGGAGAAGTTCAAACGCATCTGTGAGAAGACCGCGATCAAA AAGCGTTATCTGGCCTTAACCGAGGACTACTTGCAAGAAAATCCGACCATGTGCGA ATTTATGGCACCGTCCCTGAATGCTAGACAAGATCTGGTGGTAACAGGAGTTCCCAT GTTAGGGAAAGAGGCAGCTGTGAAGGCCATCGACGAATGGGGTTTGCCAAAAAGC AAAATCACGCACCTTATCTTTTGTACCACCGCGGGTGTTGATATGCCGGGCGCGGAT TATCAATTAGTCAAGCTCCTTGGCCTGTCCCCGAGCGTTAAGCGCTATATGTTGTAC CAACAGGGGTGCGCCGCGGGTGGCACCGTTCTGCGTCTGGCGAAGGATCTGGCCGA GAACAACAAAGGTTCTCGTGTTTTGATCGTTTGCAGCGAGATCACTGCGCTGGGGTT CCATGGTCCGAATGAAAACCACTTGGACAGCCTGGTTGCGCAGGCACTGTTTGGCG ATGGTGCAGCGGCGCTGATTGTGGGTAGCGGCCCTCATCTGGCGATCGAGCGTCCG ATTTTCGAGATCGTGAGTACCGACCAAACCATTCTGCCGGATACCGAAAAGGCGAT GAAAGGCCACTTGAGAGAAGGTGGTTTGACCTTCCAGCTGCACCGTGACGTGCCGC TGATGGTGGCAAAGAACATTGAAAACGCTGCTGAAAAGGCGCTGTCTCCGCTGGGT ATTACGGACTGGAATAGCGTGTTTTGGATGGTTCACCCGGGTGGCCGTGCTATCCTG GACCAGGTAGAGCGCAAACTGAATCTGAAAGAAGATAAACTGCGCGCTAGCCGTCA TGTTCTCTCCGAGTACGGCAACATGCTGTCGGCATGCGTGTTGTTCATCATTGATGA AGTTAGAAAGCGTAGCATGGCGGAAGGCAAATCTACGACCGGTGAAGGCCTGGATT GTGGTGTCCTGTTCGGCTTTGGCCCAGGTATGACCGTGGAAACCGTTGTGTTGCGCT CCGTTCGTGTGACCGCTGCTGTGGCAAACGGTAACTGA

[0499] 2k-2PS (L110 / I201V / L202C / L219I / L261G / I343W / E353) gene of pET16b-2PS (from 5’ to 3’, E. coli codon optimized) (SEQ ID NO: 7) (Start codon and stop codon are shown in bold. 6His-tag and TEV protease cleavage site are bolded and italicized. The mutation locations are underlined):

[0500] ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCGAGAACCTGTACTT CCdGGGTGGCAGCATGGGAAGTTATTCATCTGATGACGTAGAAGTGATTCGTGAGG CAGGCCGTGCTCAAGGCCTTGCCACGATCCTGGCAATTGGTACGGCGACCCCTCCCA ACTGCGTGGCCCAGGCAGACTACGCGGACTATTACTTTCGTGTTACCAAATCCGAAC ACATGGTTGACCTGAAGGAGAAGTTCAAACGCATCTGTGAGAAGACCGCGATCAAA AAGCGTTATCTGGCCTTAACCGAGGACTACTTGCAAGAAAATCCGACCATGTGCGA ATTTATGGCACCGTCCCTGAATGCTAGACAAGATCTGGTGGTAACAGGAGTTCCCAT GCTAGGGAAAGAGGCAGCTGTGAAGGCCATCGACGAATGGGGTTTGCCAAAAAGC AAAATCACGCACCTTATCTTTTGTACCACCGCGGGTGTTGATATGCCGGGCGCGGAT TATCAATTAGTCAAGCTCCTTGGCCTGTCCCCGAGCGTTAAGCGCTATATGTTGTAC CAACAGGGGTGCGCCGCGGGTGGCACCGTTCTGCGTCTGGCGAAGGATCTGGCCGA GAACAACAAAGGTTCTCGTGTTTTGATCGTTTGCAGCGAGATCACTGCGGTGTGCTT CCATGGTCCGAATGAAAACCACTTGGACAGCCTGGTTGCGCAGGCAATTTTTGGCG ATGGTGCAGCGGCGCTGATTGTGGGTAGCGGCCCTCATCTGGCGGTCGAGCGTCCG ATTTTCGAGATCGTGAGTACCGACCAAACCATTCTGCCGGATACCGAAAAGGCGAT GAAAGGCCACTTGAGAGAAGGTGGTTTGACCTTCCAGCTGCACCGTGACGTGCCGC TGATGGTGGCAAAGAACATTGAAAACGCTGCTGAAAAGGCGCTGTCTCCGCTGGGT ATTACGGACTGGAATAGCGTGTTTTGGATGGTTCACCCGGGTGGCCGTGCTATCCTG GACCAGGTAGAGCGCAAACTGAATCTGAAAGAAGATAAACTGCGCGCTAGCCGTCA TGTTCTCTCCGAGTACGGCAACCTGTGGTCGGCATGCGTGTTGTTCATCATTGATGA GGTTAGAAAGCGTAGCATGGCGGAAGGCAAATCTACGACCGGTGAAGGCCTGGATT GTGGTGTCCTGTTCGGCTTTGGCCCAGGTATGACCGTGGAAACCGTTGTGTTGCGCT CCGTTCGTGTGACCGCTGCTGTGGCAAACGGTAACTGA

[0501] Key CDS region of pRSF-Duet-l-4CL-MatB (from 5’ to 3’) (SEQ ID NO: 45) (Start codon and stop codon are shown in bold. 4CL gene and MatB gene are underlined. T7 promoter is bolded and italicized.):

[0502] ATGGAGGAGGATTACAAAATGGCGCCACAAGAACAAGCAGTTTCTCAGGTG ATGGAGAAACAGAGCAACAACAACAACAGTGACGTCATTTTCCGATCAAAGTTACC GGATATTTACATCCCGAACCACCTATCTCTCCACGACTACATCTTCCAAAACATCTC CGAATTCGCCACTAAGCCTTGCCTAATCAACGGACCAACCGGCCACGTGTACACTTA CTCCGACGTCCACGTCATCTCCCGCCAAATCGCCGCCAATTTTCACAAACTCGGCGT TAACCAAAACGACGTCGTCATGCTCCTCCTCCCAAACTGTCCCGAATTCGTCCTCTC TTTCCTCGCCGCCTCCTTCCGCGGCGCAACCGCCACCGCCGCAAACCCTTTCTTCACT

[0503] CCGGCGGAGATAGCTAAACAAGCCAAAGCCTCCAACACCAAACTCATAATCACCGA

[0504] AGCTCGTTACGTCGACAAAATCAAACCACTTCAAAACGACGACGGAGTAGTCATCG

[0505] TCTGCATCGACGACAACGAATCCGTGCCAATCCCTGAAGGCTGCCTCCGCTTCACCG

[0506] AGTTGACTCAGTCGACAACCGAGGCATCAGAAGTCATCGACTCGGTGGAGATTTCA

[0507] CCGGACGACGTGGTGGCACTACCTTACTCCTCTGGCACGACGGGATTACCAAAAGG

[0508] AGTGATGCTGACTCACAAGGGACTAGTCACGAGCGTTGCTCAGCAAGTCGACGGCG

[0509] AGAACCCGAATCTTTATTTCCACAGCGATGACGTCATACTCTGTGTTTTGCCCATGTT

[0510] TCATATCTACGCTTTGAACTCGATCATGTTGTGTGGTCTTAGAGTTGGTGCGGCGATT

[0511] CTGATAATGCCGAAGTTTGAGATCAATCTGCTATTGGAGCTGATCCAGAGGTGTAAA

[0512] GTGACGGTGGCTCCGATGGTTCCGCCGATTGTGTTGGCCATTGCGAAGTCTTCGGAG

[0513] ACGGAGAAGTATGATTTGAGCTCGATAAGAGTGGTGAAATCTGGTGCTGCTCCTCTT

[0514] GGTAAAGAACTTGAAGATGCCGTTAATGCCAAGTTTCCTAATGCCAAACTCGGTCA

[0515] GGGATACGGAATGACGGAAGCAGGTCCAGTGCTAGCAATGTCGTTAGGTTTTGCAA

[0516] AGGAACCTTTTCCGGTTAAGTCAGGAGCTTGTGGTACTGTTGTAAGAAATGCTGAGA

[0517] TGAAAATAGTTGATCCAGACACCGGAGATTCTCTTTCGAGGAATCAACCCGGTGAG

[0518] ATTTGTATTCGTGGTCACCAGATCATGAAAGGTTACCTCAACAATCCGGCAGCTACA

[0519] GCAGAGACCATTGATAAAGACGGTTGGCTTCATACTGGAGATATTGGATTGATCGA

[0520] TGACGATGACGAGCTTTTCATCGTTGATCGATTGAAAGAACTTATCAAGTATAAAGG

[0521] TTTTCAGGTAGCTCCGGCTGAGCTAGAGGCTTTGCTCATCGGTCATCCTGACATTAC

[0522] TGATGTTGCTGTTGTCGCAATGAAAGAAGAAGCAGCTGGTGAAGTTCCTGTTGCATT

[0523] TGTGGTGAAATCGAAGGATTCGGAGTTATCAGAAGATGATGTGAAGCAATTCGTGT

[0524] CGAAACAGGTTGTGTTTTACAAGAGAATCAACAAAGTGTTCTTCACTGAATCCATTC

[0525] CTAAAGCTCCATCAGGGAAGATATTGAGGAAAGATCTGAGGGCAAAACTAGCAAAT

[0526] GGATTGTGAGGATCCGAATTCGAGCTCGGCGCGCCTGCAGGTCGACAAGCTTGCGG

[0527] CCGCATAATGCTTAAGTCGAACAGAAAGTAATCGTATTGTACACGGCCGCATAATC

[0528] GAAAT7MA7MCGAC7OC7X7MGY;GGAATTGTGAGCGGATAACAATTCCCCATCTTA

[0529] GTATATTAGTTAAGTATAAGAAGGAGATATACATATGGCAGATCTCAATTGGGTGA

[0530] GCAACCATCTTTTCGACGCCATGCGGGCCGCCGCGCCCGGTAACGCACCATTCATCC

[0531] GGATCGATAACACGCGCACATGGACCTATGACGACGCCTTCGCTCTTTCCGGCCGCA

[0532] TTGCCAGCGCGATGGACGCGCTCGGCATTCGCCCCGGCGACCGCGTTGCGGTGCAG

[0533] GTCGAGAAAAGTGCCGAGGCATTGATCCTCTATCTCGCCTGTCTTCGAAGCGGCGCC

[0534] GTCTACCTGCCGCTCAACACCGCCTATACGCTGGCTGAGCTCGATTATTTTATCGGC

[0535] GATGCGGAGCCGCGTTTGGTGGTTGTCGCATCGTCGGCTCGAGCGGGCGTGGAGAC AATCGCCAAGCCCCGCGGTGCGATCGTCGAAACTCTCGACGCTGCTGGCAGCGGCT CGTTGCTGGATCTCGCCCGCGACGAGCCGGCCGACTTTGTCGATGCCTCGCGCTCCG CCGATGATCTGGCGGCGATCCTCTACACGTCCGGAACGACGGGACGCTCCAAGGGG GCGATGCTCACGCATGGGAACCTGCTCTCGAACGCCCTGACCTTGCGAGATTTTTGG CGCGTCACCGCCGGCGATCGACTGATCCATGCCTTGCCGATCTTCCACACGCATGGA CTGTTCGTCGCCACGAACGTCACACTGCTCGCCGGCGCCTCGATGTTCCTGCTGTCG AAGTTCGACCCGGAGGAGATCCTGTCGCTGATGCCGCAGGCAACGATGCTGATGGG CGTGCCGACCTTCTACGTGCGCCTCCTGCAGAGCCCGCGCCTCGACAAGCAAGCGGT CGCCAACATCCGCCTCTTCATTTCCGGTTCGGCTCCACTGCTTGCAGAAACACATAC CGAGTTCCAGGCACGTACCGGTCACGCCATTCTCGAGCGCTACGGCATGACGGAAA CCAATATGAACACGTCCAACCCTTATGAGGGGAAACGGATTGCCGGAACGGTCGGC TTCCCGCTGCCTGATGTGACGGTGCGCGTCACCGATCCCGCCACCGGGCTCGCGCTG CCGCCCGAACAAACCGGCATGATCGAGATCAAGGGGCCGAACGTTTTCAAGGGCTA TTGGCGCATGCCCGAAAAAACCGCGGCCGAATTCACCGCCGACGGTTTCTTCATCAG CGGCGATCTCGGCAAGATCGACCGCGACGGTTATGTCCACATCGTCGGCCGCGGCA AGGATCTGGTGATTTCGGGTGGATACAACATCTATCCGAAAGAGGTTGAGGGCGAG ATCGACCAGATCGAGGGTGTGGTTGAGAGCGCTGTGATCGGCGTGCCGCATCCCGA TTTCGGAGAAGGCGTAACGGCCGTCGTCGTGCGCAAGCCCGGCGCTGCCCTCGATG AAAAGGCCATCGTCAGCGCCCTCCAGGACCGGCTCGCGCGCTACAAACAACCCAAG CGCATCATCTTTGCAGAGGACTTGCCGCGCAACACGATGGGTAAGGTTCAGAAAAA CATCCTGCGGCAGCAATACGCCGATCTTTATACCAGGACGTAA

[0536] I201V / L202G / L261G / I343L gene of pEAQ-HT-m2PS (from 5’ to 3’, N. Benthamiana codon optimized) (SEQ ID NO: 46) (Start codon and stop codon are shown in bold. The mutation locations are underlined):

[0537] ATGGGTAGCTACAGCAGCGACGACGTGGAGGTAATTCGTGAAGCGGGGCGT

[0538] GCACAAGGGTTAGCCACTATTCTTGCGATTGGAACGGCCACACCTCCGAATTGCGTA GCACAGGCCGATTATGCCGATTACTATTTCCGTGTGACGAAATCCGAGCACATGGTA GATTTGAAAGAGAAATTCAAAAGAATATGTGAGAAAACCGCCATTAAGAAACGTTA CCTCGCGTTGACTGAAGATTATCTACAAGAGAACCCCACTATGTGTGAATTCATGGC TCCGTCACTCAATGCCCGTCAAGACCTGGTCGTCACCGGCGTACCTATGCTGGGCAA AGAGGCTGCCGTAAAAGCAATAGATGAGTGGGGATTGCCGAAAAGTAAGATCACTC ATTTAATCTTCTGTACAACTGCCGGAGTTGATATGCCTGGTGCAGACTATCAACTTG TGAAACTTCTGGGACTATCCCCCTCAGTTAAGAGGTACATGCTGTATCAACAAGGCT GCGCTGCGGGCGGTACGGTGTTAAGACTAGCGAAAGACCTCGCTGAAAATAATAAA GGTAGCCGAGTCCTGATCGTTTGCTCAGAGATTACGGCTGTGGGATTCCACGGGCCT AACGAAAACCATTTAGACAGTTTGGTGGCTCAGGCTCTGTTTGGGGACGGCGCGGC AGCGTTGATTGTTGGAAGCGGCCCCCACCTCGCAGTAGAACGACCTATCTTCGAGAT CGTGTCCACCGATCAGACCATCTTACCAGACACCGAGAAGGCCATGAAAGGGCACC TGCGTGAAGGGGGACTAACGTTTCAATTACATCGAGATGTACCTTTGATGGTAGCAA AAAACATCGAAAATGCCGCGGAAAAAGCGCTTAGTCCTTTGGGCATAACTGATTGG AACTCCGTCTTTTGGATGGTGCATCCGGGCGGTAGAGCAATATTGGACCAAGTTGAA AGAAAATTGAACCTGAAGGAGGACAAATTAAGGGCTTCTCGACACGTTTTAAGTGA ATATGGTAACTTGCTTTCAGCATGCGTACTGTTCATCATAGACGAGGTGCGAAAGCG AAGTATGGCCGAAGGTAAATCTACGACAGGAGAGGGGTTAGATTGCGGAGTATTGT TCGGCTTCGGGCCTGGAATGACTGTTGAGACAGTTGTCCTGCGATCCGTACGAGTCA CAGCAGCAGTTGCAAATGGCAATTGA

[0539] 7V&CCR gblock ordered from IDT (SEQ ID NO: 47) (Start codon and stop codon are shown in bold. 6His-tag and TEV protease cleavage site are bolded and italicized. The T7 terminator was underlined. The regions before the start codon and after the stop codon were designed to overlap with the backbone for HiFi assembly):

[0540] CataaccaagcctatgcctacagtaatacgactcactataggggaattgtgagcggataacaattcccctCTAGAATAA TTTTGTTTAACTTTAAGAAGGAGATATACCATGC4TC4TC4TC4TC4TCACCCTAGTG TGTCTGGGCAGATCGTTTGCGTTACAGGGGCCGGAGGTTTTATTGCTAGCTGGCTTG TCAAAATTTTGCTTGAAAAGGGATATACAGTTCGTGGCACAGTTCGTAACCCCGACG ATCCCAAAAACTCGCATTTACGCGAACTTGAAGGCGCGAAAGAACGTCTGACACTG TGCCGCGCGGACCTGTTAGACTTTCAGTCCCTGCGTGAAGCGATTTCAGGGTGCGAT GGGGTTTTTCACACGGCTTCCCCCGTGACGGATGACCCGGAGCAGATGGTCGAACC GGCTGTCATCGGGACGAAAAACGTAATTACAGCTGCAGCGGAAGCAAACGTCCGTC GCGTCGTATTTACTTCATCCATCGGCGCTGTTTATATGGACCCGAATCGCGACCCGG ACAAAGTTGTTGACGAGACATGCTGGTCGGATCCTGATTTTTGCAAAAATACGAAG AATTGGTATTGCTATGGTAAGATGGTCGCGGAGCAGGCTGCGTGGGACGAAGCGCG CGAGAAGGGGGTAGATTTGGTCGCCATCAATCCCGTCCTGGTCCTTGGGCCATTATT GCAACAGAACGTCAACGCCAGCGTGTTGCATATTCATAAGTATTTGACTGGCAGCG CCAAGACATACGCTAATAGTGTCCAGGCATACATTCATGTTCGTGACGTGGCGTTAG CTCACATCCTGTTGTATGAAACGCCGAGCGCATCAGGGCGTTACCTGTGTGCTGAAA GCGTACTTCATCGTGGAGATGTTGTGGAAATCCTTGCTAAATTTTTTCCAGAGTACC CGATCCCCACGAAGTGTTCCGATGTCACGAAGCCGCGCGTGAAACCGTACAAATTTT CTAATCAGAAGCTTAAAGATCTGGGACTGGAGTTCACCCCTGTCAAGCAGTGCTTAT

[0541] ATGAGACAGTTAAGTCCTTGCAAGAGAAGGGACATTTGCCGATTCCGACGCAAAAA

[0542] GATGAAATCATTCGCATTCAATCTTGATAATAACAtatgATGACTGGTGGACAGCAAA T GGGT C Gggatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataacccctt ggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggatCatccagggtgacggtgccgag

[0543] Product characterization

[0544] Characterization of demethoxyyangonin:

[0545] 1H NMR (400 MHz, Chloroform-J) 5 7.56 - 7.51 (m, 3H), 7.44 - 7.33 (m, 3H), 6.61 (d,

[0546] J= 16.1 Hz, 1H), 5.97 (d, J= 2.1 Hz, 1H), 5.53 (d, J = 2.2 Hz, 1H), 3.86 (s, 3H) (Figure 17).

[0547] 13C NMR (101 MHz, CDCI3) δ 171.09, 164.02, 158.66, 135.84, 135.25, 129.46, 128.92, 127.47, 118.64, 101.35, 88.89, 55.95 (Figure 18).

[0548] HRMS: m / z calculated for C14H13O3 [M+H]+: 229.0859; found: 229.0863.

[0549] Characterization of yangonin:

[0550] 1H NMR (400 MHz, Chloroform-J) 5 7.38 (d, J= 8.5 Hz, 2H), 6.84 (d, J= 8.7 Hz, 2H),

[0551] 6.38 (d, J= 15.9 Hz, 1H), 5.83 (d, J= 2.1 Hz, 1H), 5.40 (d, J= 2.2 Hz, 1H), 3.77 (s, 3H), 3.76 (s, 3H) (Figure 19).

[0552] 13C NMR (101 MHz, CDCI3) δ 171.26, 164.20, 160.78, 159.14, 135.50, 129.00, 128.02,

[0553] 116.39, 114.40, 100.47, 88.39, 55.90, 55.39 (Figure 20).

[0554] HRMS: m / z calculated for C15H15O4 [M+H]+: 259.0965; found: 259.0966.

[0555] Characterization of (E)-4-methoxy-6-(4-methylstyryl)-2H-pyran-2-one:

[0556] 1H NMR (400 MHz, Chloroform- J) δ 7.41 (d, J= 16.0 Hz, 1H), 7.33 (d, J= 7.9 Hz, 2H),

[0557] 7.11 (d, .7= 7.8 Hz, 2H), 6.47 (d, J= 15.9 Hz, 1H), 5.85 (d, J= 2.2 Hz, 1H), 5.41 (d, J= 2.1 Hz, 1H), 3.76 (s, 3H), 2.30 (s, 3H) (Figure 21).

[0558] 13C NMR (101 MHz, CDCI3) δ 171.17, 164.12, 158.93, 139.79, 135.85, 132.50, 129.65, 127.44, 117.65, 100.93, 88.65, 55.92, 21.42 (Figure 22).

[0559] HRMS: m / z calculated for C15H15O3 [M+H]+: 243.1016; found: 243.1019.

[0560] Characterization of (E)-6-(4-fluorostyryl)-4-methoxy-2H-pyran-2-one:

[0561] 1H NMR (400 MHz, Chloroform-J) δ 7.42 (t, J = 4.3 Hz, 3H), 7.39 (d, J = 7.0 Hz, 1H),

[0562] 7.00 (t, J= 8.5 Hz, 3H), 6.43 (d, J= 15.9 Hz, 1H), 5.87 (d, J= 2.2 Hz, 1H), 5.43 (d, J= 2.2 Hz, 1H), 3.76 (s, 4H) (Figure 23).

[0563] 13C NMR (101 MHz, CDCI3) δ 171.07, 163.96, 158.48, 134.55, 131.48, 129.19 (d, J =

[0564] 8.3 Hz), 118.39 (d, 7 = 2.5 Hz), 116.04, 115.93, 101.36, 88.90, 55.97 (Figure 24).

[0565] 19F NMR (376 MHz, Chloroform-J) δ -110.87 (m) (Figure 25).

[0566] HRMS: m / z calculated for C14H13FO3 [M+H]+: 247.0765; found: 247.0769. Characterization of 7,8-dihydroyangonin:

[0567] 1H NMR (400 MHz, Chloroform-c / ) δ 7.01 (d, J= 8.5 Hz, 2H), 6.76 (d, J= 8.6 Hz, 1H), 5.64 (d, J= 2.2 Hz, 1H), 5.34 (d, J= 2.2 Hz, 1H), 3.72 (s, 4H), 3.71 (s, 3H), 2.84 (dd, J= 9.0, 6.6 Hz, 2H), 2.64 (dd, J= 9.0, 6.6 Hz, 2H) (Figure 26).

[0568] 13C NMR (101 MHz, CDCI3) δ 171.19, 164.97, 164.49, 158.18, 131.92, 129.27, 114.00, 100.28, 87.69, 55.81, 55.27, 35.75, 31.98 (Figure 27).

[0569] HRMS: m / z calculated for C15H17O4 [M+H]+: 261.1121; found: 261.1124.

[0570] Example 3 - Enhanced kavalactone and raspberry ketone biosynthesis via 2-pyrone synthase protein engineering

[0571] Kava root extract is a globally popular drink which contain a variety of kavalactones. The global kava market size was valued at USD 1.02 billions in 2021 and it is projected to grow to USD 3.41 billion by 2029 ( https: / / www.fortunebusinessinsights.com / kava-root-extract-market- 103694). Raspberry ketone is one of the most expensive natural flavoring components due to its low natural abundance (https: / / doi.org / 10.1186 / sl2934-020-01351-y).

[0572] Polyketides are natural products with rich biological activities such as anticancer, antimicrobial, antioxidant and anti-inflammatory. Due to the rich biological activities, polyketide compounds such as kavalactones and raspberry ketone have huge markets and potential. For example, the global market size of kavalactone has been over 1 billion since 2020. Raspberry ketone is one of the most expensive natural flavoring components. However, many of these compounds are produced by their native plant hosts in a limited amount, which is far below the market demand.

[0573] To efficiently synthesize such valuable kavalactone and raspberry ketone products, herein the design of Escherichia coli as a microbial biofactory for the heterologous expression of these two series of compounds with over 100-fold improvement for kavalactone production and 2-fold improvement for benzalacetone (raspberry ketone precursor) than the existing systems in a comparable platform is reported. The compositions and methods described herein can significantly address the insufficient supply of such target molecules in the market.

[0574] Such E. coli strain expresses two native enzymes (malonyl-CoA synthetase and 4- coumaroyl-CoA ligase) and one engineered 2-pyrone synthase (2PS). Through in vivo cascade reaction and directed evolution, the 2PS enzyme was systematically engineered to display enhanced catalytic efficiency towards intracellular malonyl-CoA that ultimately led to great improvements in the titers / yields of the corresponding polyketide products.

[0575] There are mainly two strategies to synthesize kavalactones and raspberry ketone by living organisms presently. The first one relies on the native hosts such as plants to produce the natural products. However, the slow growth speed, the cultivation challenges and the low natural abundance limit the supply. The other strategy utilizes microorganisms such as Escherichia coli and yeast to heterologously express these compounds by using the native polyketide synthases (PKSs) from plants. However, the best reported titer is still low due to the innate low reactivity of natural PKSs. Herein, without the reliance of native PKSs, a 2-pyrone synthase was engineered by protein engineering strategies for enhanced kavalactones and raspberry ketone biosynthesis. This resulted in over 100-fold improvement for kavalactone production than the existing systems and 2-fold improvement for benzalacetone, the precursor of raspberry ketone.

[0576] The compositions and methods described herein can significantly address the problems of low performance in the existing systems related to the valuable kavalactone and raspberry ketone biosynthesis.

[0577] The compositions and methods described herein don’t rely on the native polyketide synthases that display low catalytic performance for kavalactone and benzalacetone biosynthesis. Instead, another 2-pyrone synthase scaffold was engineered with enhanced catalytic efficiency that showed over 100-fold improvement for kavalactone production and 2-fold improvement for benzalacetone than the existing systems in a comparable platform.

[0578] The compositions and methods described herein convert aromatic acids (p-coumaric acid and cinnamic acid) into the mentioned polyketide products.

[0579] Yeast models and transgenic plants can also be generated for the production of kavalactones and raspberry ketone with enhanced titer.

[0580] Example 4

[0581] Polyketides are natural products with rich biological activities such as anticancer, antimicrobial, antioxidant and anti-inflammatory. Due to the rich biological activities, polyketide compounds such as kavalactones and raspberry ketone have huge markets and potential. However, many of these compounds are produced by their native plant hosts in a limited amount, which is far below the market demand. Another strategy was developed to utilize microorganisms such as Escherichia coli and yeast to heterologously express these compounds by using the native enzymes from plants. However, the best reported titers and yields are still far from ideal due to the innate low reactivity of such natural enzymes. There is a strong need to produce such polyketides in great amount without the reliance of native enzymes.

[0582] To efficiently synthesize such valuable kavalactone and raspberry ketone products, herein the design of Escherichia coli as a microbial biofactory for the heterologous expression of kavalactones is reported, with the highest reported yield and titer and benzalacetone (raspberry ketone precursor) with 2-fold higher performance than the native enzyme. The engineered E. coli converts cheap aromatic acids to the value-added polyketides with up to >200 mg product per liter within 1 day.

[0583] The compositions and methods described herein showed over 100-fold improvement for kavalactone production and 2-fold improvement for benzalacetone than the existing systems in a comparable platform. It is a highly efficient and cost-effective system to synthesize these value- added compounds from cheap starting materials.

[0584] The global market size of kavalactone has been over 1 billion since 2020 (https: / / www.fortunebusinessinsights.com / kava-root-extract-market-103694). Raspberry ketone is one of the most expensive natural flavoring components due to its low natural abundance (https: / / doi.org / 10.1186 / sl2934-020-01351-y).

[0585] Example 5

[0586] A single E. coli colony from double transformation that has the required 2PS and 4CL genes was grown in 5 mL LB culture overnight with 30 pg / mL kanamycin, 100 pg / mL ampicillin, 34 pg / mL chloramphenicol to inoculate 500 mL LB medium with the same antibiotic concentration shaking at 220 rpm, 37 °C. 0.5 mM IPTG was added when OD600 reached 0.8. The culture was kept shaking overnight at 200 rpm, 25 °C for 20 hours. Once expression was finished, the cultures were centrifuged (4000 rpm, 20 minutes and 4 °C) and the spent medium was discarded. The pellet was resuspended in 500 mL M9 minimal medium containing the three antibiotics, 0.5 mM IPTG, 1 mM aromatic carboxylic acid. The biotransformation was carried out at 25 °C for an additional 24 hours.

[0587] The LB medium recipe is 10 g / L try ptone, 5 g / L NaCl, 5 g / L yeast extract. The M9 minimal medium ingredients are as following: 33.7 mM Na2HPO4, 22.0 mM KH2PO4, 8.55 mM NaCl, 9.35 mM NLLCl, 0.4% glucose, 1 mM MgSCh, 0.3 mM CaCh, 1 mg / L biotin, 1 mg / L thiamin.

[0588] After 24 hours, the pellet was separated by centrifugation (8000 rpm, 20 minutes and 4 °C). Three rounds of 300 mL ethyl acetate were used to extract the product from the supernatant. Organic phase was concentrated with rotatory evaporation, dried by vacuum, and directly used for the methylation step.

[0589] EXEMPLARY ASPECTS

[0590] In view of the described compositions and methods, herein below are described certain more particularly described aspects of the inventions. The particularly recited aspects should not, however, be interpreted to have any limiting effect on any different claims containing different or more general teachings described herein or that the “particular” aspects are somehow limited in some way other than the inherent meanings of the language and formulas literally used therein.

[0591] Example 1: A method for producing a product, the method comprising contacting one or more reactants with an engineered 2-pyrone synthase to thereby produce the product, wherein the product is a polyketide or a salt thereof, a polyketide precursor or a salt thereof, a polyketide derivative or a salt thereof, or a combination thereof.

[0592] Example 2: The method of any examples herein, particularly example 1, wherein the method is further performed in the presence of one or more additional enzymes, such as one or more native enzymes, for example malonyl-CoA synthetase and / or 4-coumaroyl-CoA ligase.

[0593] Example 3: The method of any examples herein, particularly example 1 or example 2, wherein at least one of the one or more reactants comprises an aromatic acid, such as p-coumanc acid and / or cinnamic acid.

[0594] Example 4: The method of any examples herein, particularly examples 1-3, wherein at least one of the one or more reactants comprises an aromatic-CoA, or a derivative thereof.

[0595] Example 5: The method of any examples herein, particularly examples 1-4, wherein at least one of the one or more reactants comprises malonyl-CoA.

[0596] Example 6: The method of any examples herein, particularly examples 1-5, wherein the method comprises contacting p-coumaric acid and / or cinnamic acid, or a derivative thereof, with malonyl-CoA using the engineered 2-pyrone synthase.

[0597] Example 7: The method of any examples herein, particularly examples 1-6, wherein at least one of the one or more reactants comprises triacetic acid lactone, or a derivative or salt thereof.

[0598] Example 8: The method of any examples herein, particularly examples 1-7, wherein the product comprises a kavalactone or a salt thereof, a kavalactone precursor or a salt thereof, a raspberry ketone or a salt thereof, a raspberry ketone precursor or a salt thereof, or a combination thereof.

[0599] Example 9: The method of any examples herein, particularly examples 1-8, wherein the product comprises a diketide, atriketide, a tetraketide, or a combination thereof.

[0600] Example 10: The method of any examples herein, particularly examples 1-9, wherein the product comprises triacetic acid lactone or a derivative or salt thereof.

[0601] Example 11 : The method of any examples herein, particularly examples 1-10, wherein the product comprises p-hydroxybenzalacetone or a salt thereof, p-coumaroyltriacetic acid lactone or a salt thereof, 6-styryl-4-hydroxy -2-pyrone or a salt thereof, bisnoryangonin or a salt thereof, or a combination thereof.

[0602] Example 12: The method of any examples herein, particularly examples 1-11, wherein the product comprises a kavalactone or a salt thereof, a kavalactone precursor or a salt thereof, or a combination thereof.

[0603] Example 13: The method of any examples herein, particularly examples 1-12, wherein the product comprises bisnoryangonin (a kavalactone precursor) or a salt thereof.

[0604] Example 14: The method of any examples herein, particularly examples 1-13, wherein the method comprises bisnoryangonin production from p-coumaric acid.

[0605] Example 15: The method of any examples herein, particularly examples 1-14, wherein the product comprises a styrylpyrone (a kavalactone precursor).

[0606] Example 16: The method of any examples herein, particularly examples 1-15, wherein the product comprises yangonin.

[0607] Example 17: The method of any examples herein, particularly examples 1-16, wherein the product comprises a raspberry ketone or a salt thereof, a raspberry ketone precursor or a salt thereof, or a combination thereof.

[0608] Example 18: The method of any examples herein, particularly examples 1-17, wherein the product comprises benzalacetone (a raspberry ketone precursor) or a salt thereof.

[0609] Example 19: The method of any examples herein, particularly examples 1-18, wherein the product comprises 7,8-dihydroxyflavone; (2S)-3’,7-Dihydroxy-8-methyl-4’-methoxyflavan; hesperetin dihydrochalcone; neohespendin dihydrochalcone; or a combination thereof.

[0610] Example 20: The method of any examples herein, particularly examples 1-19, wherein the method produces 1 mg or more (e.g., 100 mg or more, or 200 mg or more) of the product per liter within 24 hours.

[0611] Example 21 : The method of any examples herein, particularly examples 1-20, wherein the engineered 2-pyrone synthase comprises any one the engineered 2-pyrone synthases of SEQ ID NOS: 2-8.

[0612] Example 22: The method of any examples herein, particularly examples 1-21, wherein the engineered 2-pyrone synthase comprises any one of the engineered 2-pyrone synthases of SEQ ID Nos: 4-5 or 7-8.

[0613] Example 23: The method of any examples herein, particularly examples 1-22, wherein the engineered 2-pyrone synthase is at least 80% identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation at position LI 10, 1201, L202, L219, V237, L261, L342, 1343, and / or E353.

[0614] Example 24: The method of any examples herein, particularly examples 1-23, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position LI 10, 1201, L202, L219, V237, L261, L342, 1343, and / or E353.

[0615] Example 25: The method of any examples herein, particularly examples 1-24, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position 1201, L202, L261, and / or 1343.

[0616] Example 26: The method of any examples herein, particularly example 25, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2- pyrone synthase comprises at least one mutation comprising a mutation at position L261.

[0617] Example 27: The method of any examples herein, particularly example 25, wherein SEQ ID NO: 1 comprises at least two mutations comprising a mutation at positions 1201, L202, L261, and / or 1343.

[0618] Example 28: The method of any examples herein, particularly example 25, wherein SEQ ID NO: 1 comprises at least three mutations comprising a mutation at positions 1201, L202, L261, and / or 1343.

[0619] Example 29: The method of any examples herein, particularly example 25, wherein SEQ ID NO: 1 comprises four mutations comprising a mutation at positions 1201, L202, L261, and 1343.

[0620] Example 30: The method of any examples herein, particularly examples 25-29, wherein SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position LI 10, L219, and / or E353.

[0621] Example 31 : The method of any examples herein, particularly examples 25-29, wherein SEQ ID NO: 1 comprises at least two additional mutation comprising a mutation at position LI 10, L219, and / or E353.

[0622] Example 32: The method of any examples herein, particularly examples 25-29, wherein SEQ ID NO: 1 comprises three additional mutation comprising a mutation at positions LI 10, L219, and E353.

[0623] Example 33: The method of any examples herein, particularly examples 25-29, wherein SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position V237 and / or L342.

[0624] Example 34: The method of any examples herein, particularly examples 25-29, wherein SEQ ID NO: 1 comprises two additional mutations comprising a mutation at position V237 and L342.

[0625] Example 35: The method of any examples herein, particularly examples 1-34, wherein the engineered 2-pyrone synthase is at least 80% identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, I343A, and / or I343L.

[0626] Example 36: The method of any examples herein, particularly example 35, wherein SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

[0627] Example 37: The method of any examples herein, particularly examples 1-34, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, I343A, and / or I343L.

[0628] Example 38: The method of any examples herein, particularly example 37, wherein SEQ ID NO: 1 further comprising at least one synonymous mutation at LI 10 and / or E353.

[0629] Example 39: The method of any examples herein, particularly examples 1-38, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of L261G.

[0630] Example 40: The method of any examples herein, particularly examples 1-39, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201V, L202G, L261G, and / or I343L.

[0631] Example 41 : The method of any examples herein, particularly example 40, wherein SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202G, L261G, and / or I343L.

[0632] Example 42: The method of any examples herein, particularly example 40, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202G, L261G, and / or I343L.

[0633] Example 43: The method of any examples herein, particularly example 40, wherein SEQ ID NO: 1 comprises four mutations consisting of 1201 V, L202G, L261G, and I343L.

[0634] Example 44: The method of any examples herein, particularly examples 1-43, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of 120 IV, L202C, L219I, L261G, and / or 1343 W.

[0635] Example 45: The method of any examples herein, particularly example 44, wherein SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202C, L219I, L261G, and / or I343W.

[0636] Example 46: The method of any examples herein, particularly example 44, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202C, L219I, L261G, and / or I343W.

[0637] Example 47 : The method of any examples herein, particularly example 44, wherein SEQ ID NO: 1 comprises at least four mutations consisting of 1201 V, L202C, L219I, L261G, and / or

[0638] I343W.

[0639] Example 48: The method of any examples herein, particularly example 44, wherein SEQ ID NO: 1 comprises five mutations consisting of I201V, L202C, L219I, L261G, and I343W.

[0640] Example 49: The method of any examples herein, particularly examples 44-48, wherein SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

[0641] Example 50: The method of any examples herein, particularly examples 1-49, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

[0642] Example 51 : The method of any examples herein, particularly example 50, wherein SEQ ID NO: 1 comprises at least two mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

[0643] Example 52: The method of any examples herein, particularly example 50, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

[0644] Example 53: The method of any examples herein, particularly example 50, wherein SEQ ID NO: 1 comprises at least four mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

[0645] Example 54: The method of any examples herein, particularly example 50, wherein SEQ ID NO: 1 comprises at least five mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

[0646] Example 55: The method of any examples herein, particularly example 50, wherein SEQ ID NO: 1 comprises six mutations consisting of I201L, L202G, V237I, L261G, L342M, and I343L.

[0647] Example 56: The method of any examples herein, particularly examples 1-55, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201V, L202G, L261G, and / or I343A.

[0648] Example 57: The method of any examples herein, particularly example 56, wherein SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202G, L261G, and / or 1343 A.

[0649] Example 58: The method of any examples herein, particularly example 56, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202G, L261G, and / or 1343 A.

[0650] Example 59: The method of any examples herein, particularly example 56, wherein SEQ ID NO: 1 comprises four mutations consisting of I201V, L202G, L261G, and I343A.

[0651] Example 60: The method of any examples herein, particularly examples 1-59, wherein the engineered 2-pyrone synthase is a component of a fusion protein.

[0652] Example 61 : The method of any examples herein, particularly examples 1-60, wherein the engineered 2-pyrone synthase is a purified enzy me.

[0653] Example 62: The method of any examples herein, particularly examples 1-61, wherein the engineered 2-pyrone synthase is a partially purified enzyme.

[0654] Example 63: The method of any examples herein, particularly examples 1-62, wherein the engineered 2-pyrone synthase is produced by a recombinant cell line.

[0655] Example 64: The method of any examples herein, particularly examples 1-63, wherein the engineered 2-pyrone synthase is in a vector.

[0656] Example 65: The method of any examples herein, particularly examples 1-64, wherein the engineered 2-pyrone synthase is obtained from a non-human organism.

[0657] Example 66: The method of any examples herein, particularly example 65, wherein the non-human organism is selected from the group consisting of bacteria, yeast, and plant.

[0658] Example 67: The method of any examples herein, particularly example 65 or example 66, wherein the non-human organism is genetically engineered.

[0659] Example 68: The method of any examples herein, particularly examples 1-67, wherein the engineered 2-pyrone synthase is in a cell.

[0660] Example 69: The method of any examples herein, particularly example 68, wherein the cell is a bacterial cell, such as an Escherichia coli cell.

[0661] Example 70: The method of any examples herein, particularly example 68 or example 69, wherein the cell is a yeast cell, such as a Saccharomyces cerevisiae cell.

[0662] Example 71 : The method of any examples herein, particularly examples 68-70, wherein the cell is a plant cell, such as a transgenic plant cell, aNicotiana Benthamiana cell, a Arabidopsis thaliana cell, or a combination thereof.

[0663] Example 72: The method of any examples herein, particularly examples 68-71, wherein the engineered 2-pyrone synthase is heterologous to the cell.

[0664] Example 73: The method of any examples herein, particularly examples 68-72, wherein the cell is in an organism selected from the group consisting of bacterial, yeast, and plant.

[0665] Example 74: The method of any examples herein, particularly examples 68-73, wherein the method is performed in vivo.

[0666] Example 75: The method of any examples herein, particularly examples 68-74, wherein the method is performed in vitro. Example 76: A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises any one the engineered 2-pyrone synthases of SEQ ID NOS: 2-8.

[0667] Example 77: A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises any one of the engineered 2-pyrone synthases of SEQ ID Nos: 4-5 or 7-8.

[0668] Example 78: A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase is at least 80% identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation at position LI 10, 1201, L202, L219, V237, L261, L342, 1343, and / or E353.

[0669] Example 79: A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2- pyrone synthase comprises at least one mutation comprising a mutation at position LI 10, 1201, L202, L219, V237, L261, L342, 1343, and / or E353.

[0670] Example 80: A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2- pyrone synthase comprises at least one mutation comprising a mutation at position 1201, L202, L261, and / or 1343.

[0671] Example 81 : The nucleic acid of any examples herein, particularly example 80, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position L261.

[0672] Example 82: The nucleic acid of any examples herein, particularly example 80, wherein SEQ ID NO: 1 comprises at least two mutations comprising a mutation at positions 1201, L202, L261, and / or 1343.

[0673] Example 83: The nucleic acid of any examples herein, particularly example 80, wherein SEQ ID NO: 1 comprises at least three mutations comprising a mutation at positions 1201, L202, L261, and / or 1343.

[0674] Example 84: The nucleic acid of any examples herein, particularly example 80, wherein SEQ ID NO: 1 comprises four mutations comprising a mutation at positions 1201, L202, L261, and 1343.

[0675] Example 85: The nucleic acid of any examples herein, particularly examples 80-84, wherein SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position LI 10, L219, and / or E353.

[0676] Example 86: The nucleic acid of any examples herein, particularly examples 80-84, wherein SEQ ID NO: 1 comprises at least two additional mutation comprising a mutation at position LI 10, L219, and / or E353.

[0677] Example 87: The nucleic acid of any examples herein, particularly examples 80-84, wherein SEQ ID NO: 1 comprises three additional mutation comprising a mutation at positions LI 10, L219, and E353.

[0678] Example 88: The nucleic acid of any examples herein, particularly examples 80-84, wherein SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position V237 and / or L342.

[0679] Example 89: The nucleic acid of any examples herein, particularly examples 80-84, wherein SEQ ID NO: 1 comprises two additional mutations comprising a mutation at position V237 and L342.

[0680] Example 90: A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase is at least 80% identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, I343A, and / or I343L.

[0681] Example 91 : The nucleic of any examples herein, particularly example 90, wherein SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

[0682] Example 92: A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2- pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, I343A, and / or I343L.

[0683] Example 93: The nucleic acid of any examples herein, particularly example 92, wherein SEQ ID NO: 1 further comprising at least one synonymous mutation at LI 10 and / or E353.

[0684] Example 94: A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2- pyrone synthase comprises at least one mutation consisting of L261G.

[0685] Example 95: A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2- pyrone synthase comprises at least one mutation consisting of I201V, L202G, L261G, and / or I343L.

[0686] Example 96: The nucleic acid of any examples herein, particularly example 95, wherein SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202G, L261G, and / or I343L.

[0687] Example 97: The nucleic acid of any examples herein, particularly example 95, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202G, L261G, and / or I343L.

[0688] Example 98: The nucleic acid of any examples herein, particularly example 95, wherein SEQ ID NO: 1 comprises four mutations consisting of I201V, L202G, L261G, and I343L.

[0689] Example 99: A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2- pyrone synthase comprises at least one mutation consisting of I20IV, L202C, L219I, L261G, and / or 1343 W.

[0690] Example 100: The nucleic acid of any examples herein, particularly example 99, wherein SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202C, L219I, L261G, and / or 1343 W.

[0691] Example 101: The nucleic acid of any examples herein, particularly example 99, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202C, L219I, L261G, and / or I343W.

[0692] Example 102: The nucleic acid of any examples herein, particularly example 99, wherein SEQ ID NO: 1 comprises at least four mutations consisting of I201V, L202C, L219I, L261G, and / or 1343 W.

[0693] Example 103: The nucleic acid of any examples herein, particularly example 99, wherein SEQ ID NO: 1 comprises five mutations consisting of I201V, L202C, L219I, L261G, and I343W.

[0694] Example 104: The nucleic acid of any examples herein, particularly examples 99-103, wherein SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

[0695] Example 105: A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2- pyrone synthase comprises at least one mutation consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

[0696] Example 106: The nucleic acid of any examples herein, particularly example 105, wherein SEQ ID NO: 1 comprises at least two mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

[0697] Example 107: The nucleic acid of any examples herein, particularly example 105, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

[0698] Example 108: The nucleic acid of any examples herein, particularly example 105, wherein SEQ ID NO: 1 comprises at least four mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

[0699] Example 109: The nucleic acid of any examples herein, particularly example 105, wherein SEQ ID NO: 1 comprises at least five mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

[0700] Example 110: The nucleic acid of any examples herein, particularly example 105, wherein SEQ ID NO: 1 comprises six mutations consisting of I201L, L202G, V237I, L261G, L342M, and I343L.

[0701] Example 111 : A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2- pyrone synthase comprises at least one mutation consisting of I201V, L202G, L261G, and / or I343A.

[0702] Example 112: The nucleic acid of any examples herein, particularly example 111, wherein SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202G, L261G, and / or 1343 A.

[0703] Example 113: The nucleic acid of any examples herein, particularly example 111, wherein SEQ ID NO: 1 comprises at least three mutations consisting of 1201 V, L202G, L261G, and / or 1343 A.

[0704] Example 114: The nucleic acid of any examples herein, particularly example 111, wherein SEQ ID NO: 1 comprises four mutations consisting of 1201 V, L202G, L261G, and I343A

[0705] Example 115: A vector comprising a nucleic acid of any examples herein, particularly examples 76-114.

[0706] Example 116: An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises any one the engineered 2-pyrone synthases of SEQ ID NOS: 2-8.

[0707] Example 117: An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises any one of the engineered 2-pyrone synthases of SEQ ID Nos: 4-5 or 7-8.

[0708] Example 118: An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase is at least 80% identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation at position LI 10, 1201, L202, L219, V237, L261, L342, 1343, and / or E353.

[0709] Example 119: An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position LI 10, 1201, L202, L219, N231, L261, L342, 1343, and / or E353.

[0710] Example 120: An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position 1201, L202, L261, and / or 1343.

[0711] Example 121: The engineered 2-pyrone synthase of any examples herein, particularly example 120, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position L261.

[0712] Example 122: The engineered 2-pyrone synthase of any examples herein, particularly example 120, wherein SEQ ID NO: 1 comprises at least two mutations comprising a mutation at positions 1201, L202, L261, and / or 1343.

[0713] Example 123: The engineered 2-pyrone synthase of any examples herein, particularly example 120, wherein SEQ ID NO: 1 comprises at least three mutations comprising a mutation at positions 1201, L202, L261, and / or 1343.

[0714] Example 124: The engineered 2-pyrone synthase of any examples herein, particularly example 120, wherein SEQ ID NO: 1 comprises four mutations comprising a mutation at positions 1201, L202, L261, and 1343.

[0715] Example 125: The engineered 2-pyrone synthase of any examples herein, particularly examples 120-124, wherein SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position LI 10, L219, and / or E353.

[0716] Example 126: The engineered 2-pyrone synthase of any examples herein, particularly examples 120-124, wherein SEQ ID NO: 1 comprises at least two additional mutation comprising a mutation at position LI 10, L219, and / or E353.

[0717] Example 127: The engineered 2-pyrone synthase of any examples herein, particularly examples 120-124, wherein SEQ ID NO: 1 comprises three additional mutation comprising a mutation at positions LI 10, L219, and E353.

[0718] Example 128: The engineered 2-pyrone synthase of any examples herein, particularly examples 120-124, wherein SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position V237 and / or L342.

[0719] Example 129: The engineered 2-pyrone synthase of any examples herein, particularly examples 120-124, wherein SEQ ID NO: 1 comprises two additional mutations comprising a mutation at position V237 and L342.

[0720] Example 130: An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase is at least 80% identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, I343A, and / or I343L.

[0721] Example 131: The engineered 2-pyrone synthase of any examples herein, particularly example 130, wherein SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

[0722] Example 132: An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, I343A, and / or I343L.

[0723] Example 133: The engineered 2-pyrone synthase of any examples herein, particularly example 132, wherein SEQ ID NO: 1 further comprising at least one synonymous mutation at LI 10 and / or E353.

[0724] Example 134: An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of L261G.

[0725] Example 135: An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of 1201 V, L202G, L261G, and / or I343L.

[0726] Example 136: The engineered 2-pyrone synthase of any examples herein, particularly example 135, wherein SEQ ID NO: 1 comprises at least two mutations consisting of 1201 V, L202G, L261G, and / or I343L.

[0727] Example 137: The engineered 2-pyrone synthase of any examples herein, particularly example 135, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202G, L261G, and / or I343L.

[0728] Example 138: The engineered 2-pyrone synthase of any examples herein, particularly example 135, wherein SEQ ID NO: 1 comprises four mutations consisting of I201V, L202G, L261G, and I343L.

[0729] Example 139: An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of 1201 V, L202C, L219I, L261G, and / or I343W.

[0730] Example 140: The engineered 2-pyrone synthase of any examples herein, particularly example 139, wherein SEQ ID NO: 1 comprises at least two mutations consisting of 1201 V, L202C, L219I, L261G, and / or I343W. Example 141: The engineered 2-pyrone synthase of any examples herein, particularly example 139, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202C, L219I, L261G, and / or I343W.

[0731] Example 142: The engineered 2-pyrone synthase of any examples herein, particularly example 139, wherein SEQ ID NO: 1 comprises at least four mutations consisting of I201V, L202C, L219I, L261G, and / or I343W.

[0732] Example 143: The engineered 2-pyrone synthase of any examples herein, particularly example 139, wherein SEQ ID NO: 1 comprises five mutations consisting of I201V, L202C, L219I, L261G, and I343W.

[0733] Example 144: The engineered 2-pyrone synthase of any examples herein, particularly examples 139-143, wherein SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

[0734] Example 145: An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

[0735] Example 146: The engineered 2-pyrone synthase of any examples herein, particularly example 145, wherein SEQ ID NO: 1 comprises at least two mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

[0736] Example 147: The engineered 2-pyrone synthase of any examples herein, particularly example 145, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

[0737] Example 148: The engineered 2-pyrone synthase of any examples herein, particularly example 145, wherein SEQ ID NO: 1 comprises at least four mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

[0738] Example 149: The engineered 2-pyrone synthase of any examples herein, particularly example 145, wherein SEQ ID NO: 1 comprises at least five mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

[0739] Example 150: The engineered 2-pyrone synthase of any examples herein, particularly example 145, wherein SEQ ID NO: 1 comprises six mutations consisting of I201L, L202G, V237I, L261G, L342M, and I343L.

[0740] Example 151: An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of 1201 V, L202G, L261G, and / or I343A. Example 152: The engineered 2-pyrone synthase of any examples herein, particularly example 151, wherein SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202G, L261G, and / or I343A.

[0741] Example 153: The engineered 2-pyrone synthase of any examples herein, particularly example 151, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202G, L261G, and / or I343A.

[0742] Example 154: The engineered 2-pyrone synthase of any examples herein, particularly example 151, wherein SEQ ID NO: 1 comprises four mutations consisting of I201V, L202G, L261G, and I343A.

[0743] Example 155: A cell comprising the engineered 2-pyrone synthase of any examples herein, particularly examples 116-154.

[0744] Example 156: A cell comprising the vector of any examples herein, particularly example 115.

[0745] Example 157: The product made by the method of any examples herein, particularly examples 1-75.

[0746] Example 158: The product of any examples herein, particularly example 157, wherein the product is a cell isolate.

[0747] Example 159: The product of any examples herein, particularly example 157 or example 158, wherein the product is a bacterial cell isolate, a yeast cell isolate, a plant cell isolate, or a combination thereof.

[0748] Example 160: The product of any examples herein, particularly examples 157-159, wherein the product exhibits anticancer activity, antimicrobial activity, antioxidant activity, anti- inflammatory activity, or a combination thereof.

[0749] Example 161: The product of any examples herein, particularly examples 157-160, wherein the product has a flavor.

[0750] Example 162: The product of any examples herein, particularly examples 157-161, wherein the product has a fragrance.

[0751] Example 163: A composition comprising the product of any examples herein, particularly examples 157-162.

[0752] Example 164: A flavoring composition comprising the product of any examples herein, particularly examples 157-162.

[0753] Example 165: A fragrance composition comprising the product of any examples herein, particularly examples 157-162.

[0754] Example 166: A pharmaceutical composition comprising the product of any examples herein, particularly examples 157-162.

[0755] Example 167: The pharmaceutical composition of any examples herein, particularly example 166, further comprising a pharmaceutically acceptable carrier, a pharmaceutically acceptable diluent, a pharmaceutically acceptable excipient, or a combination thereof.

[0756] Example 168: A composition comprising the product of any examples herein, particularly examples 157-162 or the pharmaceutical composition of any examples herein, particularly examples 166-167.

[0757] Example 169: A method of use of the product or composition of any examples herein, particularly examples 157-168.

[0758] Example 170: The method of any examples herein, particularly example 169, wherein the method comprises using the product or composition as a flavoring, as a fragrance, or a combination thereof.

[0759] Example 171: A method of treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the product or composition of any examples herein, particularly examples 157-168.

[0760] Example 172: The method of any examples herein, particularly example 171, wherein the disease or disorder comprises cancer, a microbial infection, an inflammatory disease or disorder, an anxiety disorder, insomnia, other psychological and neurological disorders, or a combination thereof.

[0761] Other advantages which are obvious and which are inherent to the invention will be evident to one skilled in the art. It will be understood that certain features and sub-combinations are of utility and may be employed without reference to other features and sub-combinations. This is contemplated by and is within the scope of the claims. Since many possibl...

Claims

CLA1MSWhat is claimed is:

1. A method for producing a product, the method comprising contacting one or more reactants with an engineered 2-pyrone synthase to thereby produce the product, wherein the product is a polyketide or a salt thereof, a polyketide precursor or a salt thereof, a polyketide derivative or a salt thereof, or a combination thereof.

2. The method of claim 1, wherein the method is further performed in the presence of one or more additional enzymes, such as one or more native enzymes, for example malonyl-CoA synthetase and / or 4-coumaroyl-CoA ligase.

3. The method of claim 1 or claim 2, wherein at least one of the one or more reactants comprises an aromatic acid, such as p-coumaric acid and / or cinnamic acid.

4. The method of any one of claims 1-3, wherein at least one of the one or more reactants comprises an aromatic-CoA. or a derivative thereof.

5. The method of any one of claims 1-4, wherein at least one of the one or more reactants comprises malonyl-CoA.

6. The method of any one of claims 1-5, wherein the method comprises contacting p- coumaric acid and / or cinnamic acid, or a derivative thereof, with malonyl-CoA using the engineered 2-pyrone synthase.

7. The method of any one of claims 1-6, wherein at least one of the one or more reactants comprises triacetic acid lactone, or a derivative or salt thereof.

8. The method of any one of claims 1-7, wherein the product comprises a kavalactone or a salt thereof, a kavalactone precursor or a salt thereof, a raspberry ketone or a salt thereof, a raspberry ketone precursor or a salt thereof, or a combination thereof.

9. The method of any one of claims 1-8, wherein the product comprises a diketide, a triketide, a tetraketide, or a combination thereof.

10. The method of any one of claims 1-9, wherein the product comprises triacetic acid lactone or a derivative or salt thereof.

11. The method of any one of claims 1-10, wherein the product comprises p-hydroxy benzalacetone or a salt thereof, / ?-coumaroyltn acetic acid lactone or a salt thereof. 6- styryl-4-hydroxy-2-pyrone or a salt thereof, bisnoryangonin or a salt thereof, or a combination thereof.

12. The method of any one of claims 1-11. wherein the product comprises a kavalactone or a salt thereof, a kavalactone precursor or a salt thereof, or a combination thereof.

13. The method of any one of claims 1-12. wherein the product comprises bisnoryangonin (a kavalactone precursor) or a salt thereof.

14. The method of any one of claims 1-13, wherein the method comprises bisnoryangonin production from p-coumaric acid.

15. The method of any one of claims 1-14, wherein the product comprises a styrylpyrone (a kavalactone precursor).

16. The method of any one of claims 1-15. wherein the product comprises yangonin.

17. The method of any one of claims 1-16, wherein the product comprises a raspberry ketone or a salt thereof, a raspberry ketone precursor or a salt thereof, or a combination thereof.

18. The method of any one of claims 1-17, wherein the product comprises benzalacetone (a raspberry ketone precursor) or a salt thereof.

19. The method of any one of claims 1-18. wherein the product comprises 7,8- dihydroxyflavone; (2S)-3’,7-Dihydroxy-8-methyl-4’-methoxyflavan; hesperetin dihydrochalcone; neohesperidin dihydrochalcone; or a combination thereof.

20. The method of any one of claims 1-19. wherein the method produces 1 mg or more (e.g.. 100 mg or more, or 200 mg or more) of the product per liter within 24 hours.

21. The method of any one of claims 1-20. wherein the engineered 2-pyrone synthase comprises any one the engineered 2-pyrone synthases of SEQ ID NOS: 2-8.

22. The method of any one of claims 1-21, wherein the engineered 2-pyrone synthase comprises any one of the engineered 2-pyrone synthases of SEQ ID Nos: 4-5 or 7-8.

23. The method of any one of claims 1-22, wherein the engineered 2-pyrone synthase is at least 80% identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthasecomprises at least one mutation at position LI 10, 1201, L202. L219, V237. L261, L342, 1343, and / or E353.

24. The method of any one of claims 1-23. wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position LI 10, 1201, L202, L219, V237, L261 , L342, 1343, and / or E353.

25. The method of any one of claims 1-24. wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1 , and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position 1201, L202, L261, and / or 1343.

26. The method of claim 25, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position L261.

27. The method of claim 25, wherein SEQ ID NO: 1 comprises at least two mutations comprising a mutation at positions 1201, L202, L261, and / or 1343.

28. The method of claim 25, wherein SEQ ID NO: 1 comprises at least three mutations comprising a mutation at positions 1201. L202, L261, and / or 1343.

29. The method of claim 25, wherein SEQ ID NO: 1 comprises four mutations comprising a mutation at positions 1201, L202, L261, and 1343.

30. The method of any one of claims 25-29, wherein SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position LI 10, L219, and / or E353.

31. The method of any one of claims 25-29, wherein SEQ ID NO: 1 comprises at least two additional mutation comprising a mutation at position LI 10, L219, and / or E353.

32. The method of any one of claims 25-29, wherein SEQ ID NO: 1 comprises three additional mutation comprising a mutation at positions LI 10, L219, and E353.

33. The method of any one of claims 25-29, wherein SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position V237 and / or L342.

34. The method of any one of claims 25-29, wherein SEQ ID NO: 1 comprises two additional mutations comprising a mutation at position V237 and L342.

35. The method of any one of claims 1-34. wherein the engineered 2-pyrone synthase is at least 80% identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G. I342M, I343W, I343A, and / or I343L.

36. The method of claim 35, wherein SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

37. The method of any one of claims 1-34. wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1 , and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I20IV, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, 1343 A, and / or I343L.

38. The method of claim 37, wherein SEQ ID NO: 1 further comprising at least one synonymous mutation at LI 10 and / or E353.

39. The method of any one of claims 1-38. wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of L261G.

40. The method of any one of claims 1-39. wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of 1201 V, L202G, L261G, and / or I343L.

41. The method of claim 40, wherein SEQ ID NO: 1 comprises at least two mutations consisting of 120 IV, L202G, L261G, and / or I343L.

42. The method of claim 40, wherein SEQ ID NO: 1 comprises at least three mutations consisting ofI201V, L202G. L261G, and / or I343L.

43. The method of claim 40, wherein SEQ ID NO: 1 comprises four mutations consisting of I201V, L202G, L261G, and I343L.

44. The method of any one of claims 1-43, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of 120 IV, L202C, L219I, L261G, and / or 1343 W.

45. The method of claim 44, wherein SEQ ID NO: 1 comprises at least two mutationsconsisting of I201V, L202C. L219I. L261G. and / or I343W.

46. The method of claim 44, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202C, L219I, L261G. and / or I343W.

47. The method of claim 44, wherein SEQ ID NO: 1 comprises at least four mutations consisting of I20IV, L202C, L219I, L261G, and / or I343W.

48. The method of claim 44. wherein SEQ ID NO: 1 comprises five mutations consisting of I201V, L202C, L219I, L261G, and I343W.

49. The method of any one of claims 44-48, wherein SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

50. The method of any one of claims 1-49, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201L, L202G, V237I, L261G. L342M, and / or I343L.

51. The method of claim 50, wherein SEQ ID NO: 1 comprises at least two mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

52. The method of claim 50, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

53. The method of claim 50, wherein SEQ ID NO: 1 comprises at least four mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

54. The method of claim 50, wherein SEQ ID NO: 1 comprises at least five mutations consisting of I201L, L202G. V237I, L261G, L342M, and / or I343L.

55. The method of claim 50, wherein SEQ ID NO: 1 comprises six mutations consisting of I201L, L202G, V237I, L261G, L342M, and I343L.

56. The method of any one of claims 1-55, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of 1201 V, L202G, L261G, and / or I343A.

57. The method of claim 56, wherein SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202G, L261G, and / or I343A.

58. The method of claim 56, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202G, L261G, and / or I343A.

59. The method of claim 56, wherein SEQ ID NO: 1 comprises four mutations consisting of I201V, L202G. L261G, and I343A.

60. The method of any one of claims 1-59, wherein the engineered 2-pyrone synthase is a component of a fusion protein.

61. The method of any one of claims 1-60, wherein the engineered 2-pyrone synthase is a purified enzy me.

62. The method of any one of claims 1-61. wherein the engineered 2-pyrone synthase is a partially purified enzyme.

63. The method of any one of claims 1-62. wherein the engineered 2-pyrone synthase is produced by a recombinant cell line.

64. The method of any one of claims 1-63, w herein the engineered 2-pyrone synthase is in a vector.

65. The method of any one of claims 1-64, wherein the engineered 2-pyrone synthase is obtained from a non-human organism.

66. The method of claim 65, wherein the non-human organism is selected from the group consisting of bacteria, yeast, and plant.

67. The method of claim 65 or claim 66, w herein the non-human organism is genetically engineered.

68. The method of any one of claims 1-67, w herein the engineered 2-pyrone synthase is in a cell.

69. The method of claim 68, w herein the cell is a bacterial cell, such as an Escherichia coli cell.

70. The method of claim 68 or claim 69. wherein the cell is a yeast cell, such as a Saccharomyces cerevisiae cell.

71. The method of any one of claims 68-70, wherein the cell is a plant cell, such as atransgenic plant cell. aNicotiana Benthamiana cell. aArabidopsis thaliana cell, or a combination thereof.

72. The method of any one of claims 68-71, wherein the engineered 2-pyrone synthase is heterologous to the cell.

73. The method of any one of claims 68-72, wherein the cell is in an organism selected from the group consisting of bacterial, yeast, and plant.

74. The method of any one of claims 68-73, wherein the method is performed in vivo.

75. The method of any one of claims 68-74, wherein the method is performed in vitro.

76. A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises any one the engineered 2-pyrone synthases of SEQ ID NOS: 2-8.

77. A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises any one of the engineered 2-pyrone synthases of SEQ ID Nos: 4-5 or 7-8.

78. A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase is at least 80% identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation at position LI 10, 1201, L202, L219, V237, L261, L342, 1343, and / or E353.

79. A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position LI 10, 1201, L202, L219, V237, L261. L342, 1343, and / or E353.

80. A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position 1201, L202, L261, and / or 1343.

81. The nucleic acid of claim 80, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position L261.

82. The nucleic acid of claim 80. wherein SEQ ID NO: 1 comprises at least two mutations comprising a mutation at positions 1201, L202, L261, and / or 1343.

83. The nucleic acid of claim 80. wherein SEQ ID NO: 1 comprises at least three mutations comprising a mutation at positions 1201. L202, L261, and / or 1343.

84. The nucleic acid of claim 80, wherein SEQ ID NO: 1 comprises four mutations comprising a mutation at positions 1201, L202, L261, and 1343.

85. The nucleic acid of any one of claims 80-84, wherein SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position LI 10, L219, and / or E353.

86. The nucleic acid of any one of claims 80-84. wherein SEQ ID NO: 1 comprises at least two additional mutation comprising a mutation at position LI 10, L219, and / or E353.

87. The nucleic acid of any one of claims 80-84. wherein SEQ ID NO: 1 comprises three additional mutation comprising a mutation at positions LI 10, L219, and E353.

88. The nucleic acid of any one of claims 80-84, wherein SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position V237 and / or L342.

89. The nucleic acid of any one of claims 80-84, wherein SEQ ID NO: 1 comprises two additional mutations comprising a mutation at position V237 and L342.

90. A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase is at least 80% identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G. I342M, I343W, 1343 A, and / or I343L.

91. The nucleic of claim 90, wherein SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

92. A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C, L219I, V237I, L261G, I342M, I343W, 1343 A, and / or I343L.

93. The nucleic acid of claim 92, wherein SEQ ID NO: 1 further comprising at least one synonymous mutation at LI 10 and / or E353.

94. A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of L261G.

95. A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201V, L202G, L261G, and / or I343L.

96. The nucleic acid of claim 95. wherein SEQ ID NO: 1 comprises at least two mutations consisting ofI201V, L202G, L261 G, and / or I343L.

97. The nucleic acid of claim 95, wherein SEQ ID NO: 1 comprises at least three mutations consisting ofI201V, L202G. L261G, and / or I343L.

98. The nucleic acid of claim 95, wherein SEQ ID NO: 1 comprises four mutations consisting of I201V, L202G, L261G, and I343L.

99. A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201V. L202C, L219I. L261G, and / or I343W.

100. The nucleic acid of claim 99, wherein SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202C, L219I, L261G, and / or I343W.

101. The nucleic acid of claim 99, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202C, L219I, L261G, and / or I343W.

102. The nucleic acid of claim 99. wherein SEQ ID NO: 1 comprises at least four mutations consisting of I201V, L202C, L219I, L261G, and / or I343W.

103. The nucleic acid of claim 99, wherein SEQ ID NO: 1 comprises five mutations consisting of I201V, L202C, L219I, L261G, and I343W.

104. The nucleic acid of any one of claims 99-103, wherein SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

105. A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyronesynthase comprises at least one mutation consisting of 1201L. L202G, V2371, L261G, L342M. and / or I343L.

106. The nucleic acid of claim 105, wherein SEQ ID NO: 1 comprises at least two mutations consisting of I201L, L202G. V237I. L261G, L342M, and / or I343L.

107. The nucleic acid of claim 105, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

108. The nucleic acid of claim 105, wherein SEQ ID NO: 1 comprises at least four mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

109. The nucleic acid of claim 105, wherein SEQ ID NO: 1 comprises at least five mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

110. The nucleic acid of claim 105, wherein SEQ ID NO: 1 comprises six mutations consisting of 120 IL, L202G. V237I. L261G, L342M, and I343L.

111. A nucleic acid that encodes an engineered 2-pyrone synthase, wherein the engineered 2- pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of 120 IV. L202G, L261G, and / or 1343 A.

112. The nucleic acid of claim 111, wherein SEQ ID NO: 1 comprises at least two mutations consisting ofI201V, L202G, L261G, and / or I343A.

113. The nucleic acid of claim 111, wherein SEQ ID NO: 1 comprises at least three mutations consisting ofI201V, L202G, L261G, and / or I343A.

114. The nucleic acid of claim 111, wherein SEQ ID NO: 1 comprises four mutations consisting of 120 IV, L202G, L261G, and 1343 A.

115. A vector comprising a nucleic acid of any one of claims 76-114.

116. An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises any one the engineered 2-pyrone synthases of SEQ ID NOS: 2-8.

117. An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises any one of the engineered 2-pyrone synthases of SEQ ID Nos: 4-5 or 7-8.

118. An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase is at least80% identical to SEQ ID NO:

1. and further wherein the engineered 2-pyrone synthase comprises at least one mutation at position LI 10, 1201, L202, L219, V237, L261, L342, 1343, and / or E353.

119. An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1 , and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position LI 10, 1201, L202, L219, V237, L261, L342, 1343, and / or E353.

120. An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position 1201, L202, L261, and / or 1343.

121. The engineered 2-pyrone synthase of claim 120, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising a mutation at position L261.

122. The engineered 2-pyrone synthase of claim 120, wherein SEQ ID NO: 1 comprises at least two mutations comprising a mutation at positions 1201, L202, L261, and / or 1343.

123. The engineered 2-pyrone synthase of claim 120. wherein SEQ ID NO: 1 comprises at least three mutations comprising a mutation at positions 1201, L202, L261, and / or 1343.

124. The engineered 2-pyrone synthase of claim 120, wherein SEQ ID NO: 1 comprises four mutations comprising a mutation at positions 1201, L202, L261, and 1343.

125. The engineered 2-pyrone synthase of any one of claims 120-124, wherein SEQ ID NO: 1 further comprises at least one additional mutation comprising a mutation at position LI 10, L219, and / or E353.

126. The engineered 2-pyrone synthase of any one of claims 120-124, wherein SEQ ID NO: 1 comprises at least two additional mutation comprising a mutation at position LI 10, L219, and / or E353.

127. The engineered 2-pyrone synthase of any one of claims 120-124, wherein SEQ ID NO: 1 comprises three additional mutation comprising a mutation at positions LI 10, L219, and E353.

128. The engineered 2-pyrone synthase of any one of claims 120-124, wherein SEQ ID NO: 1further comprises at least one additional mutation compnsing a mutation at position V237 and / or L342.

129. The engineered 2-pyrone synthase of any one of claims 120-124, wherein SEQ ID NO: 1 comprises two additional mutations comprising a mutation at position V237 and L342.

130. An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase is at least 80% identical to SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G, L202C. L219I, V237I, L261 G, I342M, I343W, 1343 A, and / or I343L.

131. The engineered 2-pyrone synthase of claim 130, wherein SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

132. An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO:

1. and further wherein the engineered 2-pyrone synthase comprises at least one mutation comprising I201V, I201L, L202S, L202G. L202C, L219L V237I. L261G, I342M, I343W, I343A, and / or I343L.

133. The engineered 2-pyrone synthase of claim 132, wherein SEQ ID NO: 1 further comprising at least one synonymous mutation at LI 10 and / or E353.

134. An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO:

1. and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of L261G.

135. An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO:

1. and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201V, L202G, L261G, and / or I343L.

136. The engineered 2-pyrone synthase of claim 135, wherein SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202G, L261G, and / or I343L.

137. The engineered 2-pyrone synthase of claim 135, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202G, L261G, and / or I343L.

138. The engineered 2-pyrone synthase of claim 135. wherein SEQ ID NO: 1 comprises four mutations consisting of I201V, L202G, L261G, and I343L.

139. An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of 120 IV, L202C, L219I, L261G, and / or 1343 W.

140. The engineered 2-pyrone synthase of claim 139. wherein SEQ ID NO: 1 comprises at least two mutations consisting of I201V, L202C, L219I, L261G, and / or I343W.

141. The engineered 2-pyrone synthase of claim 139, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202C. L219I, L261G. and / or I343W.

142. The engineered 2-pyrone synthase of claim 139, wherein SEQ ID NO: 1 comprises at least four mutations consisting of I201V, L202C, L219I, L261G, and / or I343W.

143. The engineered 2-pyrone synthase of claim 139, wherein SEQ ID NO: 1 comprises five mutations consisting of I201V, L202C, L219I, L261G, and I343W.

144. The engineered 2-pyrone synthase of any one of claims 139-143, wherein SEQ ID NO: 1 further comprises at least one synonymous mutation at LI 10 and / or E353.

145. An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO:

1. and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

146. The engineered 2-pyrone synthase of claim 145, wherein SEQ ID NO: 1 comprises at least two mutations consisting of I201L. L202G, V237I, L261G, L342M. and / or I343L.

147. The engineered 2-pyrone synthase of claim 145, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

148. The engineered 2-pyrone synthase of claim 145, wherein SEQ ID NO: 1 comprises at least four mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

149. The engineered 2-pyrone synthase of claim 145. wherein SEQ ID NO: 1 comprises at least five mutations consisting of I201L, L202G, V237I, L261G, L342M, and / or I343L.

150. The engineered 2-pyrone synthase of claim 145, wherein SEQ ID NO: 1 comprises six mutations consisting of I201L. L202G, V237I, L261G, L342M. and I343L.

151. An engineered 2-pyrone synthase, wherein the engineered 2-pyrone synthase comprises SEQ ID NO: 1, and further wherein the engineered 2-pyrone synthase comprises at least one mutation consisting of I201V, L202G, L261G, and / or I343A.

152. The engineered 2-pyrone synthase of claim 151. wherein SEQ ID NO: 1 comprises at least two mutations consisting of 1201 V, L202G, L261G, and / or I343A.

153. The engineered 2-pyrone synthase of claim 151, wherein SEQ ID NO: 1 comprises at least three mutations consisting of I201V, L202G. L261G, and / or I343A.

154. The engineered 2-pyrone synthase of claim 151, wherein SEQ ID NO: 1 comprises four mutations consisting of I201V, L202G, L261G, and I343A.

155. A cell comprising the engineered 2-pyrone synthase of any one of claims 116-154.

156. A cell comprising the vector of claim 115.

157. The product made by the method of any one of claims 1-75.

158. The product of claim 157, wherein the product is a cell isolate.

159. The product of claim 157 or claim 158, wherein the product is a bacterial cell isolate, a yeast cell isolate, a plant cell isolate, or a combination thereof.

160. The product of any one of claims 157-159. wherein the product exhibits anticancer activity, antimicrobial activity, antioxidant activity, anti-inflammatory activity, or a combination thereof.

161. The product of any one of claims 157-160. wherein the product has a flavor.

162. The product of any one of claims 157-161, wherein the product has a fragrance.

163. A composition comprising the product of any one of claims 157-162.

164. A flavoring composition comprising the product of any one of claims 157-162.

165. A fragrance composition comprising the product of any one of claims 157-162.

166. A pharmaceutical composition comprising the product of any one of claims 157-162.

167. The pharmaceutical composition of claim 166. further comprising a pharmaceutically acceptable carrier, a pharmaceutically acceptable diluent, a pharmaceutically acceptable excipient, or a combination thereof.

168. A composition comprising the product of any one of claims 157-162 or the pharmaceutical composition of claims 166-167.

169. A method of use of the product or composition of any one of claims 157-168.

170. The method of claim 169, wherein the method comprises using the product or composition as a flavoring, as a fragrance, or a combination thereof.

171. A method of treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the product or composition of any one of claims 157-168.

172. The method of claim 171, wherein the disease or disorder comprises cancer, a microbial infection, an inflammatory disease or disorder, an anxiety disorder, insomnia, other psychological and neurological disorders, or a combination thereof.

Images