Artificial micrornas targeting huntington's disease

Abstract

Provided herein are artificial miRNA molecules for treating Huntington's Disease (HD). In some embodiments, the artificial miRNA molecules target expression of HTT protein. Further provided herein are expression constructs, vectors (e.g., rAAV), cells, viral particles, and pharmaceutical compositions capable of expressing the artificial miRNA molecules. Yet further provided herein are methods and kits related to the use of the artificial miRNA molecules, for example, to treat HD.

Description

ARTIFICIAL microRNAs TARGETING HUNTINGTON’S DISEASECROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the priority benefit of U.S. Provisional Application No. 63 / 625,838, filed January 26, 2024, which is incorporated by reference in its entirety.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The content of the electronic sequence listing (159792018840seqlist.xml; Size: 95,548 bytes; and Date of Creation: January 22, 2025) is herein incorporated by reference in its entirety.FIELD OF THE DISCLOSURE

[0003] The present invention relates to methods for treating Huntington’s Disease in a patient in need thereof.BACKGROUND

[0004] Huntington ’ s Disease (HD) is a fatal monogenic disease caused by an expansion of trinucleotide repeats in Exon 1 of the gene. The accumulation of mutant HTT protein is the key driver of HD-associated neuropathology in the striatum and cortex, where neurodegeneration causes motor and cognitive impairments that are progressive and ultimately fatal. Currently no disease-modifying treatment exists for HD. Accordingly, there exists an urgent need to develop therapeutic agents to treat and / or alleviate symptoms associated with HD.BRIEF SUMMARY

[0005] The disclosure provides artificial microRNA (miRNA) molecules targeting human HTT mRNA. HTT-targeted artificial miRNA gene therapy stands to markedly improve quality of life and slow disease progression. The constructs described herein have wide commercial applicability in Huntington’s Disease (HD).

[0006] In one aspect, the disclosure provides an artificial miRNA comprising a first strand and a second strand, wherein (a) the first strand and second strand form a duplex; (b) the first strand comprises a guide region comprising a nucleotide sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 1 (5’- UAUAGCGAUGCCCAGAAGUUU-3’), SEQ ID NO: 2 (5’- UUCGAGCUGUAACCUUGGAAG-3’), SEQ ID NO: 3 (5’- UUGGUCGGUGCAGCGGCUCCU-3’), SEQ ID NO: 4 (5’- AUUCGUCAGCCACCAUCCUGA-3’), SEQ ID NO: 5 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 6 (5’- GGACUCGAAGGCCUUCAUCAG-3’), SEQ ID NO: 7 (5’- UAUUCGUCAGCCACCAUCCUG-3’), SEQ ID NO: 8 (5’- UUCGUCAGCCACCAUCCUGAC-3’), SEQ ID NO: 9 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 10 (5’- UGCGUCAUCACUGCACAGCAG-3’), SEQ ID NO: 11 (5’- UACGGUCUUUCUUGGUAGCUG-3’), SEQ ID NO: 12 (5’- UUGCGUCAUCACUGCACAGCA-3’), SEQ ID NO: 13 (5’- UUCGAAGGCCUUCAUCAGCUU-3’), SEQ ID NO: 14 (5’- AGCGAUGCCCAGAAGUUUCUG-3’), SEQ ID NO: 15 (5’- AACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 16 (5’- AACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 17 (5’- AACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 18 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 19 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 20 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 21 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 22 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 23 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 24 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 25 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 26 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 27 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 28 (5’-AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 29 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 30 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 31 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 32 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 33 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 34 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 35 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 36 (5’- AGCUCGAGCUGUAACCUUGGA-3’), or SEQ ID NO: 37 (5’- AGCUCGAGCUGUAACCUUGGA-3’); and (c) the second strand (e.g., passenger strand) comprises a non-guide region that comprises a nucleotide sequence that is partially or fully complementary to the nucleotide sequence of the guide region.

[0007] In some embodiments, provided herein is an artificial miRNA comprising a first strand and a second strand, wherein (a) the first strand and second strand form a duplex; (b) the first strand comprises a guide region comprising a nucleotide sequence of SEQ ID NO: 1 (5’- UAUAGCGAUGCCCAGAAGUUU-3’), SEQ ID NO: 2 (5’- UUCGAGCUGUAACCUUGGAAG-3’), SEQ ID NO: 3 (5’- UUGGUCGGUGCAGCGGCUCCU-3’), SEQ ID NO: 4 (5’- AUUCGUCAGCCACCAUCCUGA-3’), SEQ ID NO: 5 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 6 (5’- GGACUCGAAGGCCUUCAUCAG-3’), SEQ ID NO: 7 (5’- UAUUCGUCAGCCACCAUCCUG-3’), SEQ ID NO: 8 (5’- UUCGUCAGCCACCAUCCUGAC-3’), SEQ ID NO: 9 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 10 (5’- UGCGUCAUCACUGCACAGCAG-3’), SEQ ID NO: 11 (5’- UACGGUCUUUCUUGGUAGCUG-3’), SEQ ID NO: 12 (5’- UUGCGUCAUCACUGCACAGCA-3’), SEQ ID NO: 13 (5’- UUCGAAGGCCUUCAUCAGCUU-3’), SEQ ID NO: 14 (5’- AGCGAUGCCCAGAAGUUUCUG-3’), SEQ ID NO: 15 (5’- AACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 16 (5’- AACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 17 (5’-AACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 18 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 19 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 20 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 21 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 22 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 23 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 24 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 25 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 26 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 27 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 28 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 29 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 30 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 31 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 32 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 33 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 34 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 35 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 36 (5’- AGCUCGAGCUGUAACCUUGGA-3’), or SEQ ID NO: 37 (5’- AGCUCGAGCUGUAACCUUGGA-3’); and (c) the second strand comprises a non-guide region that comprises a nucleotide sequence that is partially or fully complementary to the nucleotide sequence of the guide region.

[0008] In one embodiment, the guide sequence comprises the sequence having at least about90% identity or at least about 95% identity to the sequence of SEQ ID NO: 1 (5’- UAUAGCGAUGCCCAGAAGUUU-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 38 (5’-AAACUUCUGCAUCGCUAUG-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 1 (5’-UAUAGCGAUGCCCAGAAGUUU-3’) and the non-guide region comprises the sequence of SEQ ID NO: 38 (5’- AAACUUCUGCAUCGCUAUG-3 ’ ).

[0009] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 2 (5’- UUCGAGCUGUAACCUUGGAAG-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:39 (5’-CUUCCAAGUACAGCUCGAG-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 2 (5’-UUCGAGCUGUAACCUUGGAAG-3’) and the non-guide region comprises the sequence of SEQ ID NO: 39 (5’-CUUCCAAGUACAGCUCGAG- 3’).

[0010] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 3 (5’- UUGGUCGGUGCAGCGGCUCCU-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:40 (5’-AGGAGCCGGCACCGACUAA-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 3 (5’-UUGGUCGGUGCAGCGGCUCCU-3’) and the non-guide region comprises the sequence of SEQ ID NO: 40 (5’-AGGAGCCGGCACCGACUAA- 3’).

[0011] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 4 (5’- AUUCGUCAGCCACCAUCCUGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:41 (5’-UCAGGAUGGGCUGACGAAU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 4 (5’-AUUCGUCAGCCACCAUCCUGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 41 (5’- UCAGGAUGGGCUGACGAAU-3’).

[0012] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 5 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:42 (5’-GCUGAUGAGCCUUCGAGUU -3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 5 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and thenon-guide region comprises the sequence of SEQ ID NO: 42 (5’- GCUGAUGAGCCUUCGAGUU -3’).

[0013] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 6 (5’- GGACUCGAAGGCCUUCAUCAG-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:43 (5’-CUGAUGAACCUUCGAGUUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 6 (5’-GGACUCGAAGGCCUUCAUCAG-3’) and the non-guide region comprises the sequence of SEQ ID NO: 43 (5’- CUGAUGAACCUUCGAGUUU-3’).

[0014] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 7 (5’- UAUUCGUCAGCCACCAUCCUG-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:44 (5’-CAGGAUGGGCUGACGAAUG-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 7 (5’-UAUUCGUCAGCCACCAUCCUG-3’) and the non-guide region comprises the sequence of SEQ ID NO: 44 (5’- CAGGAUGGGCUGACGAAUG-3’).

[0015] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 8 (5’- UUCGUCAGCCACCAUCCUGAC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:45 (5’-GUCAGGAUUGGCUGACGAA-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 8 (5’-UUCGUCAGCCACCAUCCUGAC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 45 (5’- GUCAGGAUUGGCUGACGAA-3’).

[0016] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 9 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:46 (5’-UCCAAGGUCAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 9 (5’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 46 (5’- UCCAAGGUCAGCUCGAGUU -3’).

[0017] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 10 (5’- UGCGUCAUCACUGCACAGCAG-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:47 (5’-CUGCUGUGGUGAUGACGUA-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 10 (5’-UGCGUCAUCACUGCACAGCAG-3’) and the non-guide region comprises the sequence of SEQ ID NO: 47 (5’- CUGCUGUGGUGAUGACGUA-3’).

[0018] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 11 (5’- UACGGUCUUUCUUGGUAGCUG-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:48 (5’-CAGCUACCGAAAGACCGUG-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 11 (5’-UACGGUCUUUCUUGGUAGCUG-3’) and the non-guide region comprises the sequence of SEQ ID NO: 48 (5’- CAGCUACCGAAAGACCGUG-3’).

[0019] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 12 (5’- UUGCGUCAUCACUGCACAGCA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:49 (5’-UGCUGUGCUGAUGACGUAG-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 12 (5’-UUGCGUCAUCACUGCACAGCA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 49 (5’- UGCUGUGCUGAUGACGUAG-3’).

[0020] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 13 (5’-UUCGAAGGCCUUCAUCAGCUU-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:50 (5’-AAGCUGAUAGGCCUUCGAG-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 13 (5 ’-UUCGAAGGCCUUCAUCAGCUU-3’) and the non-guide region comprises the sequence of SEQ ID NO: 50 (5’- AAGCUGAUAGGCCUUCGAG-3’).

[0021] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 14 (5’- AGCGAUGCCCAGAAGUUUCUG-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:51 (5’-CAGAAACUUGGGCAUCGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 14 (5’-AGCGAUGCCCAGAAGUUUCUG-3’) and the non-guide region comprises the sequence of SEQ ID NO: 51 (5’- CAGAAACUUGGGCAUCGUU-3’).

[0022] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 15 (5’- AACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:52 (5’-GCUGAUGAGCCUUCGAGUC-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 15 (5’-AACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 52 (5’- GCUGAUGAGCCUUCGAGUC-3’).

[0023] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 16 (5’- AACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:53 (5’-GCUGAUGAGCCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 16 (5’-AACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 53 (5’- GCUGAUGAGCCUUCGAGUU-3’).

[0024] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 17 (5’- AACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:54 (5’-GCUGAUGAGCCUUCGAUUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 17 (5’-AACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 54 (5’- GCUGAUGAGCCUUCGAUUU-3’).

[0025] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 18 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:55 (5’-GCUGAUGAAGCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 18 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 55 (5’- GCUGAUGAAGCUUCGAGUU-3’).

[0026] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 19 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:56 (5’-GCUGAUGAACCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 19 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 56 (5’- GCUGAUGAACCUUCGAGUU-3’).

[0027] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 20 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:57 (5’-GCUGAUGGGCCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 20 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and thenon-guide region comprises the sequence of SEQ ID NO: 57 (5’- GCUGAUGGGCCUUCGAGUU-3’).

[0028] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 21 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:58 (5’-GCUGAUAGGCCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 21 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 58 (5’- GCUGAUAGGCCUUCGAGUU-3’).

[0029] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 22 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:59 (5’-GCUGAAAGGCCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 22 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 59 (5’- GCUGAAAGGCCUUCGAGUU-3’).

[0030] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 23 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:60 (5’-GCUGGAAGGCCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 23 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 60 (5’- GCUGGAAGGCCUUCGAGUU-3’).

[0031] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 24 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:61 (5’-GCUUGAAGGCCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 24 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 61 (5’- GCUUGAAGGCCUUCGAGUU-3’).

[0032] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 25 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:62 (5’-GCAUGAAGGCCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 25 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 62 (5’- GCAUGAAGGCCUUCGAGUU-3’).

[0033] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 26 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:63 (5’-GGAUGAAGGCCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 26 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 63 (5’- GGAUGAAGGCCUUCGAGUU-3’).

[0034] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 27 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:64 (5’-UGAUGAAGGCCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 27 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 64 (5’- UGAUGAAGGCCUUCGAGUU-3’).

[0035] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 28 (5’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:65 (5’-UCCAAGGUCAGCUCGAUUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 28 (5 ’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 65 (5’- UCCAAGGUCAGCUCGAUUU-3’).

[0036] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 29 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:66 (5’-UCCAAGGUUAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 29 (5 ’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 66 (5’- UCCAAGGUUAGCUCGAGUU-3’).

[0037] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 30 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:67 (5’-UCCAAGGACAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 30 (5 ’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 67 (5’- UCCAAGGACAGCUCGAGUU-3’).

[0038] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 31 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:68 (5’-UCCAAGUACAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 31 (5 ’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 68 (5’- UCCAAGUACAGCUCGAGUU-3’).

[0039] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 32 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:69 (5’-UCCAAUUACAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 32 (5’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 69 (5’- UCCAAUUACAGCUCGAGUU-3’).

[0040] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 33 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:70 (5’-UCCAGUUACAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 33 (5’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 70 (5’- UCCAGUUACAGCUCGAGUU-3’).

[0041] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 34 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:71 (5’-UCCGGUUACAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 34 (5’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 71 (5’- UCCGGUUACAGCUCGAGUU-3’).

[0042] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 35 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:72 (5’-UCAGGUUACAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 35 (5’-AGCUCGAGCUGUAACCUUGGA-3’) and thenon-guide region comprises the sequence of SEQ ID NO: 72 (5’- UCAGGUUACAGCUCGAGUU-3’).

[0043] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 36 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:73 (5’-UAAGGUUACAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 36 (5’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 73 (5’- UAAGGUUACAGCUCGAGUU-3’).

[0044] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 37 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:74 (5’-CAAGGUUACAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 37 (5’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 74 (5’- CAAGGUUACAGCUCGAGUU-3’).

[0045] In some embodiments, the artificial miRNA targets HTT mRNA.

[0046] In some embodiments, binding of the guide region to the coding sequence of the HTT mRNA reduces expression of the protein HTT.

[0047] In some embodiments, provided herein is an expression construct comprising a nucleic acid encoding the artificial miRNA.

[0048] In some embodiments, the nucleic acid encoding the artificial miRNA is operably linked to a promoter.

[0049] In some embodiments, the nucleic acid encoding the artificial miRNA is cloned into a miRNA scaffold, wherein transcription of the expression construct forms a stem-loop structure.

[0050] In some embodiments, provided herein is a vector comprising the expression construct as provided herein.

[0051] In some embodiments, the vector is a rAAV vector.

[0052] In some embodiments, provided herein is a viral particle comprising the vector, wherein the viral particle is an AAV particle encapsidating the rAAV vector.

[0053] In some embodiments, the viral particle comprises a modified AAV9 or AAV2 capsid protein.

[0054] In some embodiments, provided herein is a method of treating or preventing HD in a patient in need thereof, comprising administering to the patient a composition comprising a miRNA comprising a guide strand that binds to a HTT mRNA and a passenger strand, wherein the guide strand comprises a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37.

[0055] In some embodiments, provided herein is a method of reducing HTT expression in a patient suffering from HD, comprising administering to the patient a composition comprising a miRNA comprising a guide strand that binds to a HTT mRNA and a passenger strand, wherein the guide strand comprises a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37.

[0056] In any of the embodiments herein, the guide strand and the non-guide strand can be linked by means of an RNA linker capable of forming a loop structure. In some embodiments,the RNA linker comprises from 4 to 50 nucleotides. In some embodiments, the loop structure comprises 4 to 20 nucleotides.

[0057] In some embodiments of the above aspect and embodiments, the artificial miRNA molecules target the 3 ’-untranslated region (3’-UTR) of HTT mRNA. In some embodiments, the artificial miRNA molecules show low off-target potential.

[0058] In some embodiments of the above aspect and embodiments, the disclosure provides an expression construct comprising nucleic acid encoding the artificial miRNA molecules described herein. In some embodiments, the nucleic acid encoding the artificial miRNA molecules are embedded in a miRNA scaffold. In some embodiments, the nucleic acid encoding the artificial miRNA is operably linked to a promoter. In some embodiments, the promoter is selected from a cytomegalovirus (CMV) immediate early promoter, an RSV LTR, a MoMLV LTR, a phosphoglycerate kinase- 1 (PGK) promoter, a simian virus 40 (SV40) promoter, a CK6 promoter, a transthyretin promoter (TTR), a TK promoter, a tetracycline responsive promoter (TRE), an HBV promoter, an hAAT promoter, a LSP promoter, a chimeric liver-specific promoter (LSP), an E2F promoter, a telomerase (hTERT) promoter; a cytomegalovirus enhancer / chicken beta-actin / Rabbit P-globin promoter (CAG) promoter, an elongation factor 1 - alpha promoter (EFl-alpha) promoter, a human P-glucuronidase promoter, a chicken P-actin (CBA) promoter, a retroviral Rous sarcoma virus (RSV) LTR promoter, a dihydrofolate reductase promoter, and a 13-actin promoter. In some embodiments, the expression construct further comprises an intron. In some embodiments, the intron is a CBA intron or an hEFl alpha intron. In some embodiments, the intron is a chimeric intron. In some embodiments, the expression vector is a self-complementary vector, and the intron is a delta chimeric intron. In some embodiments, the expression construct further comprises a polyadenylation signal. In some embodiments, the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or a HSV TK polyadenylation signal.

[0059] In some embodiments, the disclosure provides a vector comprising any of the expression constructs described herein. In some embodiments, the vector is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the expression construct is flanked by one or more AAV inverted terminal repeat (ITR) sequences. In some embodiments, the expression construct is flanked by two AAV ITRs. In some embodiments, the AAV ITRs areAAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV serotype ITRs. In some embodiments, the AAV ITRs are AAV2 ITRs. In some embodiments, the vector further comprises a stuffer nucleic acid. In some embodiments, the stuffer nucleic acid is located upstream or downstream of the nucleic acid encoding the artificial miRNA. In some embodiments, the vector is a self-complementary rAAV vector. In some embodiments, the vector comprises first nucleic acid sequence encoding the artificial miRNA and a second nucleic acid sequence encoding a complement of the artificial miRNA, wherein the first nucleic acid sequence can form intrastrand base pairs with the second nucleic acid sequence along most or all its length. In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are linked by a mutated AAV ITR, wherein the mutated AAV ITR comprises a deletion of the D region and comprises a mutation of the terminal resolution sequence.

[0060] In some embodiments, the disclosure provides a cell comprising any of the rAAV vectors as described herein.

[0061] In some embodiments, the disclosure provides a recombinant AAV particle comprising any of the rAAV vectors as described herein. In some embodiments, the AAV viral particle comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, AAV2-HBKO, AAVDJ8, AAVPHP.B, AAVPHP.eB, AAVBR1, AAVHSC15, AAVHSC17, a goat AAV, AAV1 / AAV2 chimeric, bovine AAV, or mouse AAV capsid rAAV2 / HBoV 1 serotype capsid. In some embodiments, the ITR and the capsid of the rAAV viral particle are derived from the same AAV serotype. In some embodiments, the ITR and the capsid of the rAAV viral particle are derived from different AAV serotypes. In some embodiments, the ITR is derived from AAV2 and the capsid of the rAAV particle is derived from AAV 1.

[0062] In some embodiments, the capsid proteins of the rAAV particles are modified AAV9 capsid. In some such embodiments, the modified AAV9 capsid proteins of the AAV viral particles comprise targeting peptides inserted into the AAV9 capsid that alter the transduction and / or endosomal release of the viral particle following administration to the patient. The rAAVparticles comprising modified AAV9 capsid proteins, as disclosed herein, comprise three structural capsid proteins, VP1, VP2 and VP3. The three capsid proteins are alternative splice variants. In some embodiments, the targeting peptide is inserted into the VP1, VP2 and VP3 capsid proteins within the rAAV particle.

[0063] In particular embodiments, the targeting peptide of the modified AAV9 capsids are inserted after residue 588 of the AAV9 structural protein (numbering based on VP1 numbering of AAV9). In some embodiments, the targeting peptide has SEQ ID NO: 100. In some embodiments, the targeting peptide is flanked by linker sequences on the N-terminal and the C- terminal end of the targeting peptide. In some embodiments, the linker sequence on the N- terminal side has the sequence AAA. In some embodiments, the linker sequence on the C- terminal side is AS. In some embodiments, the full sequence inserted after residue 588 of the AAV9 capsid structural protein has SEQ ID NO: 101. In some embodiments, the full modified AAV9 capsid structural protein has SEQ ID NO: 102. In some embodiments, the full modified AAV9 capsid structural protein that it at least 90% (e.g., at least 92%, at least 95%, at least 98%, at least 98.5%, at least 99%, at least 99.2%, at least 99.5%, or at least 99.8%) identical to SEQ ID NO: 102, wherein the modified AAV9 structural capsid comprises the targeting peptide of SEQ ID NO: 100. The capsid having SEQ ID NO: 102 may also be referred to herein as SAN006 or AAV.SAN006.

[0064] In some embodiments, the disclosure provides a composition comprising any of the rAAV particles described herein. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0065] In some embodiments, the disclosure provides a kit comprising any of the artificial miRNA molecules described herein. In some embodiments, the disclosure provides a kit comprising any of the AAV particles described herein. In some embodiments, the disclosure provides a kit comprising any of the compositions described herein. In some embodiments, the kit further comprises instructions for use.

[0066] In some aspects, the disclosure provides methods for treating HD in a patient in need thereof, comprising administering to the patient a composition comprising an artificial miRNA comprising a guide strand that binds to a HTT mRNA and a non-guide (passenger) strand, wherein the guide strand and the non-guide have sequences as disclosed herein.

[0067] In some aspects, the disclosure provides methods for reducing HTT protein expression in a patient suffering from HD, comprising administering to the patient a composition comprising a miRNA comprising a guide strand that binds to a HTT mRNA and a non-guide (passenger) strand, wherein the guide strand and the non-guide have sequences as disclosed herein.BRIEF DESCRIPTION OF THE DRAWINGS

[0068] FIGS. 1A-B show results demonstrating artificial miRNA sequences reducing target HTT mRNA in human cells, in accordance with some embodiments.

[0069] FIG. 2 depicts results for artificial miRNA sequences demonstrating in vitro dosedependent target engagement in human cells, in accordance with some embodiments.

[0070] FIG. 3A-C show results for artificial miRNA sequences showing strand biasing and strand loading (e.g., strand processing) in human cells, in accordance with some embodiments.

[0071] FIGS. 4A-B show results of artificial miRNA sequences demonstrating in vivo target engagement in the YAC128 model, in accordance with some embodiments.

[0072] FIG. 5 shows results of artificial miRNA sequences exhibiting in vivo target engagement in the BACHD model, in accordance with some embodiments.

[0073] FIG. 6 shows artificial miRNA sequences exhibit in vivo strand biasing, in accordance with some embodiments.DETAILED DESCRIPTION

[0074] In some aspects, provided herein are compositions, therapeutic methods, and kits for lowering HTT (e.g., HTT protein) levels. In some embodiments, HTT-targeted artificial miRNAs act to lower HTT mRNA and / or reduce HTT protein with the goal of alleviating disease pathology. In some embodiments, the constructs described herein may provide therapeutic benefit in critical HD-relevant brain regions. In some embodiments, therapeutic methods may becommercially applicable to the HD patient population and may be adopted by both clinicians and patients.

[0075] In some embodiments, artificial miRNA may target HTT mRNA via AAV-artificial miRNA vectors. In some embodiments, artificial miRNA may have a lower propensity for seed- mediated off targeting, and / or have rationally designed sequence changes to optimize guide strand loading to increase potency and / or lower off-targeting via the passenger strand.

[0076] In some aspects, provided herein are constructs (e.g., therapeutic constructs) related to the fields of RNA inhibition, molecular biology, and central nervous system (CNS) gene therapy. In some embodiments, the constructs may be configured to reduce expression of the huntingtin (HTT) protein and may provide a method to treat Huntington’s Disease.

[0077] In some embodiments, provided herein are artificial miRNA sequences. In some embodiments, artificial miRNA may comprise a duplex, the duplex comprising a guide strand targeting the antisense sequence of human HTT mRNA, and / or a semi-complementary passenger strand.I. General Techniques

[0078] The techniques and procedures described or referenced herein are generally well understood and commonly employed using conventional methodology by those skilled in the art, such as, for example, the widely utilized methodologies described in Molecular Cloning: A Laboratory Manual (Sambrook et al., 4thed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2012); Current Protocols in Molecular Biology (F.M. Ausubel, et al. eds., 2003); the series Methods in Enzymology (Academic Press, Inc.); PCR 2: A Practical Approach (M.J. MacPherson, B.D. Hames and G.R. Taylor eds., 1995); Antibodies, A Laboratory Manual (Harlow and Lane, eds., 1988); Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications (R.I. Freshney, 6thed., J. Wiley and Sons, 2010); Oligonucleotide Synthesis (M.J. Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (J.E. Cellis, ed., Academic Press, 1998); Introduction to Cell and Tissue Culture (J.P. Mather and P.E. Roberts, Plenum Press, 1998); Cell and Tissue Culture: Laboratory Procedures (A. Doyle, J.B. Griffiths, and D.G. Newell, eds., J. Wiley and Sons, 1993-8); Handbook of Experimental Immunology (D.M. Weir and C.C. Blackwell, eds., 1996);Gene Transfer Vectors for Mammalian Cells (J.M. Miller and M.P. Calos, eds., 1987); PCR: The Polymerase Chain Reaction, (Mullis et al., eds., 1994); Current Protocols in Immunology (J.E. Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Ausubel et al., eds., J. Wiley and Sons, 2002); Immunobiology (C.A. Janeway et al., 2004); Antibodies (P. Finch, 1997); Antibodies: A Practical Approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal Antibodies: A Practical Approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow and D. Lane, Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and J. D. Capra, eds., Harwood Academic Publishers, 1995); and Cancer: Principles and Practice of Oncology (V.T. DeVita et al., eds., J.B. Lippincott Company, 2011).II. Definitions

[0079] A “vector,” as used herein, refers to a recombinant plasmid or virus that comprises a nucleic acid to be delivered into a host cell, either in vitro or in vivo.

[0080] The term “polynucleotide” or “nucleic acid” as used herein refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double- or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases, or other natural, chemically, or biochemically modified, non-natural, or derivatized nucleotide bases. The backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA) or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidates and thus can be an oligodeoxynucleoside phosphoramidate (P-NH2) or a mixed phosphoramidate- phosphodiester oligomer. In addition, a double-stranded polynucleotide can be obtained from the single stranded polynucleotide product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a DNA polymerase with an appropriate primer.

[0081] The terms “polypeptide” and “protein” are used interchangeably to refer to a polymer of amino acid residues and are not limited to a minimum length. Such polymers of amino acid residues may contain natural or non-natural amino acid residues, and include, but are not limited to, peptides, oligopeptides, dimers, trimers, and multimers of amino acid residues. Both full- length proteins and fragments thereof are encompassed by the definition. The terms also include post-expression modifications of the polypeptide, for example, glycosylation, sialylation, acetylation, phosphorylation, and the like. Furthermore, for purposes of the present disclosure, a “polypeptide” refers to a protein which includes modifications, such as deletions, additions, and substitutions (generally conservative in nature), to the native sequence, as long as the protein maintains the desired activity. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the proteins or errors due to PCR amplification.

[0082] A “recombinant viral vector” refers to a recombinant polynucleotide vector comprising one or more heterologous sequences (i.e., nucleic acid sequence not of viral origin). In the case of recombinant AAV vectors, the recombinant nucleic acid is flanked by at least one and in some embodiments two, inverted terminal repeat sequences (ITRs).

[0083] A “recombinant AAV vector (rAAV vector)” refers to a polynucleotide vector comprising one or more heterologous sequences (i.e., nucleic acid sequence not of AAV origin) that are flanked by at least one, and in embodiments two, AAV inverted terminal repeat sequences (ITRs). Such rAAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been infected with a suitable helper virus (or that is expressing suitable helper functions) and that is expressing AAV rep and cap gene products (i.e., AAV Rep and Cap proteins). When a rAAV vector is incorporated into a larger polynucleotide (e.g., in a chromosome or in another vector such as a plasmid used for cloning or transfection), then the rAAV vector may be referred to as a “pro-vector” which can be “rescued” by replication and encapsidation in the presence of AAV packaging functions and suitable helper functions. An rAAV vector can be in any of a number of forms, including, but not limited to, plasmids, linear artificial chromosomes, complexed with lipids, encapsulated within liposomes, and encapsidated in a viral particle, particularly an AAV particle. A rAAV vector can be packaged into an AAV virus capsid to generate a “recombinant adeno-associated viral particle (rAAV particle)”.

[0084] “Heterologous” means derived from a genotypically distinct entity from that of the rest of the entity to which it is compared or into which it is introduced or incorporated. For example, a polynucleotide introduced by genetic engineering techniques into a different cell type is a heterologous polynucleotide (and, when expressed, can encode a heterologous polypeptide). Similarly, a cellular sequence (e.g., a gene or portion thereof) that is incorporated into a viral vector is a heterologous nucleotide sequence with respect to the vector.

[0085] The term “transgene” refers to a polynucleotide that is introduced into a cell and is capable of being transcribed into RNA and optionally, translated and / or expressed under appropriate conditions. In aspects, it confers a desired property to a cell into which it was introduced, or otherwise leads to a desired therapeutic or diagnostic outcome. In another aspect, it may be transcribed into a molecule that mediates RNA interference, such as miRNA, siRNA, or shRNA.

[0086] “Chicken P-actin (CBA) promoter” refers to a polynucleotide sequence derived from a chicken P-actin gene (e.g., Gallus gallus beta actin, represented by GenBank Entrez Gene ID 396526). As used herein, “chicken P-actin promoter” may refer to a promoter containing a cytomegalovirus (CMV) early enhancer element, the promoter and first exon and intron of the chicken P-actin gene, and the splice acceptor of the rabbit beta-globin gene, such as the sequences described in Miyazaki, J. et al. (1989) Gene 79(2):269-77. As used herein, the term “CAG promoter” may be used interchangeably. As used herein, the term “CMV early enhancer / chicken beta actin (CAG) promoter” may be used interchangeably.

[0087] The terms “genome particles (gp),” “genome equivalents,” or “genome copies” as used in reference to a viral titer, refer to the number of virions containing the recombinant AAV DNA genome, regardless of infectivity or functionality. The number of genome particles in a particular vector preparation can be measured by procedures such as described in the Examples herein, or for example, in Clark et al. (1999) Hum. Gene Ther., 10: 1031-1039; Veldwijk et al. (2002) Mol. Ther., 6:272-278.

[0088] The term “vector genome (vg)” as used herein may refer to one or more polynucleotides comprising a set of the polynucleotide sequences of a vector, e.g., a viral vector. A vector genome may be encapsidated in a viral particle. Depending on the particular viralvector, a vector genome may comprise single-stranded DNA, double-stranded DNA, or singlestranded RNA, or double-stranded RNA. A vector genome may include endogenous sequences associated with a particular viral vector and / or any heterologous sequences inserted into a particular viral vector through recombinant techniques. For example, a recombinant AAV vector genome may include at least one ITR sequence flanking a promoter, a stuffer, a sequence of interest (e.g., a miRNA), and a polyadenylation sequence. A complete vector genome may include a complete set of the polynucleotide sequences of a vector. In some embodiments, the nucleic acid titer of a viral vector may be measured in terms of vg / mL. Methods suitable for measuring this titer are known in the art (e.g., quantitative PCR).

[0089] As used herein, the term “inhibit” may refer to the act of blocking, reducing, eliminating, or otherwise antagonizing the presence, or an activity of, a particular target. Inhibition may refer to partial inhibition or complete inhibition. For example, inhibiting the expression of a gene may refer to any act leading to a blockade, reduction, elimination, or any other antagonism of expression of the gene, including reduction of mRNA abundance (e.g., silencing mRNA transcription), degradation of mRNA, inhibition of mRNA translation, and so forth. In some embodiments, inhibiting the expression of HTT protein may refer a blockade, reduction, elimination, or any other antagonism of expression of HTT protein, including reduction of HTT mRNA abundance (e.g., silencing HTT mRNA transcription), degradation of HTT mRNA, inhibition of HTT mRNA translation, and so forth. As another example, inhibiting the accumulation of a protein in a cell may refer to any act leading to a blockade, reduction, elimination, or other antagonism of expression of the protein, including reduction of mRNA abundance (e.g., silencing mRNA transcription), degradation of mRNA, inhibition of mRNA translation, degradation of the protein, and so forth. In some embodiments, inhibiting the accumulation of HTT protein in a cell refers to a blockade, reduction, elimination, or other antagonism of expression of the HTT protein in a cell, including reduction of HTT mRNA abundance (e.g., silencing HTT mRNA transcription), degradation of HTT mRNA, inhibition of HTT mRNA translation, degradation of the HTT protein, and so forth.

[0090] The terms “infection unit (iu),” “infectious particle,” or “replication unit,” as used in reference to a viral titer, refer to the number of infectious and replication-competent recombinantAAV vector particles as measured by the infectious center assay, also known as replication center assay, as described, for example, in McLaughlin et al. (1988) J. Virol., 62: 1963-1973.

[0091] The term “transducing unit (tu)” as used in reference to a viral titer, refers to the number of infectious recombinant AAV vector particles that result in the production of a functional transgene product as measured in functional assays such as described in Examples herein, or for example, in Xiao et al. (1997) Exp. Neurobiol., 144: 113-124; or in Fisher et al. (1996) J. Virol., 70:520-532 (LFU assay).

[0092] An “inverted terminal repeat” or “ITR” sequence is a term well understood in the art and refers to relatively short sequences found at the termini of viral genomes which are in opposite orientation.

[0093] An “AAV inverted terminal repeat (ITR)” sequence, a term well-understood in the art, is an approximately 145 -nucleotide sequence that is present at both termini of the native single-stranded AAV genome. The outermost 125 nucleotides of the ITR can be present in either of two alternative orientations, leading to heterogeneity between different AAV genomes and between the two ends of a single AAV genome. The outermost 125 nucleotides also contain several shorter regions of self-complementarity (designated A, A', B, B', C, C and D regions), allowing intrastrand base-pairing to occur within this portion of the ITR.

[0094] A “terminal resolution sequence” or “trs” is a sequence in the D region of the AAV ITR that is cleaved by AAV rep proteins during viral DNA replication. A mutant terminal resolution sequence is refractory to cleavage by AAV rep proteins.

[0095] “AAV helper functions” refer to functions that allow AAV to be replicated and packaged by a host cell. AAV helper functions can be provided in any of a number of forms, including, but not limited to, helper virus or helper virus genes which aid in AAV replication and packaging. Other AAV helper functions are known in the art such as genotoxic agents.

[0096] A “helper virus” for AAV refers to a virus that allows AAV (which is a defective parvovirus) to be replicated and packaged by a host cell. A helper virus provides "helper functions" which allow for the replication of AAV. A number of such helper viruses have been identified, including adenoviruses, herpesviruses and, poxviruses such as vaccinia andbaculovirus. The adenoviruses encompass a number of different subgroups, although Adenovirus type 5 of subgroup C (Ad5) is most commonly used. Numerous adenoviruses of human, nonhuman mammalian and avian origin are known and are available from depositories such as the ATCC. Viruses of the herpes family, which are also available from depositories such as ATCC, include, for example, herpes simplex viruses (HSV), Epstein-Barr viruses (EBV), cytomegaloviruses (CMV) and pseudorabies viruses (PRV). Examples of adenovirus helper functions for the replication of AAV include El A functions, E1B functions, E2A functions, VA functions and E4orf6 functions. Baculoviruses available from depositories include Autographa californica nuclear polyhedrosis virus.

[0097] A preparation of rAAV is said to be “substantially free” of helper virus if the ratio of infectious AAV particles to infectious helper virus particles is at least about 102: 1 ; at least about 104:l, at least about 106:l; or at least about 108:l or more. In some embodiments, preparations are also free of equivalent amounts of helper virus proteins (z.e., proteins as would be present as a result of such a level of helper virus if the helper virus particle impurities noted above were present in disrupted form). Viral and / or cellular protein contamination can generally be observed as the presence of Coomassie staining bands on SDS gels (e.g., the appearance of bands other than those corresponding to the AAV capsid proteins VP1, VP2 and VP3).

[0098] “Percent (%) sequence identity” with respect to a reference polypeptide or nucleic acid sequence is defined as the percentage of amino acid residues or nucleotides in a candidate sequence that are identical with the amino acid residues or nucleotides in the reference polypeptide or nucleic acid sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid or nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software programs, for example, those described in Current Protocols in Molecular Biology (Ausubel et al., eds., 1987), Supp. 30, section 7.7.18, Table 7.7.1, and including BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. A preferred alignment program is ALIGN Plus (Scientific and Educational Software, Pennsylvania). Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximalalignment over the full length of the sequences being compared. For purposes herein, the % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B (which can alternatively be phrased as a given amino acid sequence A that has or comprises a certain % amino acid sequence identity to, with, or against a given amino acid sequence B) is calculated as follows: 100 times the fraction X / Y, where X is the number of amino acid residues scored as identical matches by the sequence alignment program in that program's alignment of A and B, and where Y is the total number of amino acid residues in B. It will be appreciated that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity of A to B will not equal the % amino acid sequence identity of B to A. For purposes herein, the % nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D (which can alternatively be phrased as a given nucleic acid sequence C that has or comprises a certain % nucleic acid sequence identity to, with, or against a given nucleic acid sequence D) is calculated as follows: 100 times the fraction W / Z, where W is the number of nucleotides scored as identical matches by the sequence alignment program in that program's alignment of C and D, and where Z is the total number of nucleotides in D. It will be appreciated that where the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the % nucleic acid sequence identity of C to D will not equal the % nucleic acid sequence identity of D to C.

[0099] An “isolated” molecule (e.g., nucleic acid or protein) or cell means it has been identified and separated and / or recovered from a component of its natural environment.

[0100] An “effective amount” is an amount sufficient to effect beneficial or desired results, including clinical results (e.g., amelioration of symptoms, achievement of clinical endpoints, and the like). An effective amount can be administered in one or more administrations. In terms of a disease state, an effective amount is an amount sufficient to ameliorate, stabilize, or delay development of a disease.

[0101] An “individual” or “subject” is a mammal. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and nonhuman primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In certain embodiments, the individual or subject is a human.

[0102] As used herein, “treatment” is an approach for obtaining beneficial or desired clinical results. For purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (e.g., not worsening) state of disease, preventing spread (e.g., metastasis) of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment.

[0103] As used herein, the term “prophylactic treatment” refers to treatment, wherein an individual is known or suspected to have or be at risk for having a disorder but has displayed no symptoms or minimal symptoms of the disorder. An individual undergoing prophylactic treatment may be treated prior to onset of symptoms.

[0104] “miRNA scaffold” may refer to a polynucleotide containing (i) a double-stranded sequence targeting a gene of interest for knockdown by miRNA and (ii) additional sequences that form a stem-loop structure resembling that of endogenous miRNAs. A sequence targeting a gene of interest for miRNA (e.g., a short, ~20-nt sequence) may be ligated to sequences that create a miRNA-like stem-loop and a sequence that base pairs with the sequence of interest to form a duplex when the polynucleotide is assembled into the miRNA-like secondary structure. As described herein, this duplex may hybridize imperfectly, e.g., it may contain one or more unpaired or mispaired bases. Upon cleavage of this polynucleotide by Dicer, this duplex containing the sequence targeting a gene of interest may be unwound and incorporated into the RISC complex. A miRNA scaffold may refer to the miRNA itself or to a DNA polynucleotide encoding the miRNA. An example of a miRNA scaffold is the miR-155 sequence (Lagos- Quintana, M. et al. (2002) Curr. Biol. 12:735-9). Commercially available kits for cloning a sequence into a miRNA scaffold are known in the art (e.g., the Invitrogen™ BLOCK-iT™ Poll II miR RNA interference expression vector kit from Life Technologies, Thermo Fisher Scientific; Waltham, MA).

[0105] As used herein, a “bulge” refers to a region of nucleic acid that is non-complementary to nucleic acid opposite it in a duplex nucleic acid. For example, a bulge may refer to a nucleic acid sequence that is noncomplementary to nucleic acid opposite in a duplex nucleic acid where the bulge is flanked by regions of nucleic acid that are complementary to nucleic acid opposite ina duplex nucleic acid. In some examples, the bulge may be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or greater than 10 bases in length. In some examples, the bulge may be the result of mispairing (e.g. , the opposite strand contains a base that is noncomplementary) or the bulge may be the result of nonpairing (e.g., the opposite strand comprises nucleic acid complementary to nucleic acid flanking the bulge, but the opposite strand does not contain nucleic acid opposite the bulge).

[0106] As used herein, the term “sense” nucleic acid is a nucleic acid comprising a sequence that encodes all or a part of a transgene. In some examples, mRNA for a transgene is a sense nucleic acid.

[0107] As used herein, “antisense” nucleic acid is a sequence of nucleic acid that is complementary to a “sense” nucleic acid. For example, an antisense nucleic acid may be complementary to an mRNA encoding a transgene.

[0108] As used herein, the “guide region” of a miRNA is the strand of the miRNA that binds the target mRNA, typically on the basis of complementarity. The region of complementarity may encompass all or a portion of the guide region. Typically, the region of complementarity includes at least the seed region. In many cases, the antisense region of a miRNA is the guide region.

[0109] As used herein, the “passenger region,” or “non-guide region,” used interchangeably herein, of a miRNA is the region of the miRNA that is complementary to the guide region. In many cases, the sense region of a miRNA is the passenger region.

[0110] As used herein, the “seed region” of a miRNA is a region of about 1-8 nucleotides in length of a miRNA. In some examples, the seed region and the 3'-UTR of its target mRNA may be a key determinant in miRNA recognition.

[0111] As used herein, “off-target gene silencing” refers to the pairing of a seed region of a miRNA with sequences in 3'-UTRs of unintended mRNAs and directs translational repression and destabilization of those transcripts (e.g., reduces expression of the unintended mRNAs).

[0112] Reference to “about” a value or parameter herein includes (and describes) embodiments that are directed to that value or parameter per se. For example, description referring to “about X” includes description of “X.”

[0113] As used herein, the singular form of the articles “a,” “an,” and “the” includes plural references unless indicated otherwise.

[0114] It is understood that aspects and embodiments of the disclosure described herein include “comprising,” “consisting,” and / or “consisting essentially of’ aspects and embodiments.III. Artificial miRNA Molecules

[0115] In some aspects, the disclosure provides artificial miRNA molecules comprising sequences disclosed herein. A miRNA is known in the art as an RNA molecule that induces RNA interference in a cell comprising a short (e.g., 19-25 base pairs) sequence of doublestranded RNA linked by a loop and containing one or more additional sequences of doublestranded RNA comprising one or more bulges (e.g., mispaired or unpaired base pairs). In some embodiments, “miRNA” may refer to a pri-miRNA or a pre-miRNA. During miRNA processing, a pri-miRNA transcript is produced. The pri-miRNA is processed by Drosha- DGCR8 to produce a pre-miRNA by excising one or more sequences to leave a pre-miRNA with a 5 ’flanking region, a guide strand, a loop region, a non-guide strand, and a 3 ’flanking region; or a 5 ’flanking region, a non-guide strand, a loop region, a guide strand, and a 3 ’flanking region. The pre-miRNA is then exported to the cytoplasm and processed by Dicer to yield a miRNA with a guide strand and a non-guide (or passenger) strand. The guide strand is then used by the RISC complex to catalyze gene silencing, e.g., by recognizing a target RNA sequence complementary to the guide strand. The recognition of a target sequence by a miRNA is primarily determined by pairing between the target and the miRNA seed sequence, e.g., nucleotides 1-8 (5’ to 3’) of the guide strand (see, e.g., Boudreau, R.L. et al. (2013) Nucleic Acids Res. 41:e9).

[0116] In the pri / pre-miRNA structure, the guide strand: non-guide strand interface in a duplex is formed in part through complementary base pairing (e.g., Watson-Crick base pairing). However, in some embodiments, this complementary base pairing does not extend through the entire duplex. In some embodiments, a bulge in the interface may exist at one or more nucleotide positions. As used herein, the term "bulge" may refer to a region of nucleic acid that is non- complementary to the nucleic acid opposite it in a duplex. In some embodiments, the bulge is formed when the regions of complementary nucleic acids bind to each other, whereasthe regions of central non-complementary region do not bind. In some embodiments, the bulge is formed when the two strands of nucleic acid positioned between the two complementary regions are of different lengths. As described below, a bulge may comprise 1 or more nucleotides. In some embodiments, the miRNA comprises an internal bulge generated by deleting 2 based on the passenger strand of the miRNA -bases 9-10, counting from the start of the passenger strand.

[0117] In a particular aspect, the artificial miRNA molecules described in this disclosure are inhibitory against HTT mRNA. In some embodiments, the HTT mRNA is human HTT mRNA. In some embodiments, the artificial mRNA targets the coding sequence of the HTT mRNA. In some embodiments, the artificial miRNA targets the 3’-UTR region of mRNA encoding HTT. In some embodiments, the artificial miRNA inhibits the expression of HTT in a subject. In some embodiments, the artificial miRNA inhibits the accumulation of HTT protein in a subject. In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human.

[0118] The safety of miRNA-based therapies can be hampered by the ability of the miRNAs to bind to unintended mRNAs and reduce their expression, an effect known as off-target gene silencing. Off-targeting primarily occurs when the seed region (nucleotides 2-8 of the small miRNA) pairs with sequences in 3’-UTRs of unintended mRNAs and directs translational repression and destabilization of those transcripts. Reduced off-targeting miRNA may be designed by substituting bases within the guide and nonguide sequences; e.g., by creating CpG motifs. Potential substitutions that may result in a significantly lower off-target score can be evaluated using the SiSPOTR algorithm, a specificity-focused design algorithm which identifies candidate sequences with minimal off-targeting potentials and potent silencing capacities (Boudreau et al, Nucleic Acids Res. 2013 Jan; 41(1) e9. A reduced SiSPOTR score predicts sequences that have a lower number of potential human off targets compared parent miRNA molecules. In some embodiments of the disclosure, the miRNA is improved to reduce off-target gene silencing. In some embodiments, the miRNA comprises one or more CpG motifs. In some embodiments, the miRNA comprises one or more CpG motifs in a seed region.

[0119] In some embodiments, the first strand and the second strand are linked by means of an RNA (e.g., an RNA linker) capable of forming a loop structure. As is commonly known in the art, an RNA loop structure (e.g., a stem-loop or hairpin) is formed when an RNA moleculecomprises two sequences of RNA that base pair together separated by a sequence of RNA that does not base pair together. For example, a loop structure may form in the RNA molecule A-B- C if sequences A and C are complementary or partially complementary such that they base pair together, but the bases in sequence B do not base pair together. In some embodiments, the loop sequence is 5’-GTTTTGGCCACTGACTGAC-3’ (SEQ ID NO: 110) in DNA form or 5’- GUUUUGGCCACUGACUGAC-3’ (SEQ ID NO: 111) in RNA form.

[0120] In some embodiments, the RNA capable of forming a loop structure comprises from 4 to 50 nucleotides. In certain embodiments, the RNA capable of forming a loop structure comprises 13 nucleotides. In some embodiments, the number of nucleotides in the RNA capable of forming a loop is from 4 to 50 nucleotides or any integer there between. In some embodiments, from 0-50% of the loop can be complementary to another portion of the loop. As used herein, the term “loop structure” is a sequence that joins two complementary strands of nucleic acid. In some embodiments, 1-3 nucleotides of the loop structure are contiguous to the complementary strands of nucleic acid and may be complementary to 1 -3 nucleotides of the distal portion of the loop structure. For example, the three nucleotides at the 5’ end of the loop structure may be complementary to the three nucleotides at the 3’ end of the loop structure.

[0121] In some embodiments, nucleic acid encoding a miRNA of the present disclosure comprises a heterologous miRNA scaffold. In some embodiments, use of a heterologous miRNA scaffold is used to modulate miRNA expression; for example, to increase miRNA expression or to decrease miRNA expression. Any miRNA scaffold known in the art may be used. In some embodiments, the miRNA scaffold is derived from a miR-155 scaffold (see, e.g., Lagos-Quintana, M. et al. (2002) Curr. Biol. 12:735-9 and the Invitrogen™ BLOCK-iT™ Poll II miR RNA interference expression vector kit from Life Technologies, Thermo Fisher Scientific; Waltham, MA).

[0122] In some embodiments, the artificial miRNA is selected from Table 1.TABLE 1SEQ SEQID IDGuide sequence (5' - 3') NO Passenger sequence (5' - 3') NOUAUAGCGAUGCCCAGAAGUUU 1 AAACUUCUGCAUCGCUAUG 38UUCGAGCUGUAACCUUGGAAG 2 CUUCCAAGUACAGCUCGAG 39UUGGUCGGUGCAGCGGCUCCU 3 AGGAGCCGGCACCGACUAA 40AUUCGUCAGCCACCAUCCUGA 4 UCAGGAUGGGCUGACGAAU 41GACUCGAAGGCCUUCAUCAGC 5 GCUGAUGAGCCUUCGAGUU 42GGACUCGAAGGCCUUCAUCAG 6 CUGAUGAACCUUCGAGUUU 43UAUUCGUCAGCCACCAUCCUG 7 CAGGAUGGGCUGACGAAUG 44UUCGUCAGCCACCAUCCUGAC 8 GUCAGGAUUGGCUGACGAA 45AGCUCGAGCUGUAACCUUGGA 9 UCCAAGGUCAGCUCGAGUU 46UGCGUCAUCACUGCACAGCAG 10 CUGCUGUGGUGAUGACGUA 47UACGGUCUUUCUUGGUAGCUG 11 CAGCUACCGAAAGACCGUG 48UUGCGUCAUCACUGCACAGCA 12 UGCUGUGCUGAUGACGUAG 49UUCGAAGGCCUUCAUCAGCUU 13 AAGCUGAUAGGCCUUCGAG 50AGCGAUGCCCAGAAGUUUCUG 14 CAGAAACUUGGGCAUCGUU 51AACUCGAAGGCCUUCAUCAGC 15 GCUGAUGAGCCUUCGAGUC 52AACUCGAAGGCCUUCAUCAGC 16 GCUGAUGAGCCUUCGAGUU 53AACUCGAAGGCCUUCAUCAGC 17 GCUGAUGAGCCUUCGAUUU 54GACUCGAAGGCCUUCAUCAGC 18 GCUGAUGAAGCUUCGAGUU 55GACUCGAAGGCCUUCAUCAGC 19 GCUGAUGAACCUUCGAGUU 56GACUCGAAGGCCUUCAUCAGC 20 GCUGAUGGGCCUUCGAGUU 57GACUCGAAGGCCUUCAUCAGC 21 GCUGAUAGGCCUUCGAGUU 58GACUCGAAGGCCUUCAUCAGC 22 GCUGAAAGGCCUUCGAGUU 59GACUCGAAGGCCUUCAUCAGC 23 GCUGGAAGGCCUUCGAGUU 60GACUCGAAGGCCUUCAUCAGC 24 GCUUGAAGGCCUUCGAGUU 61GACUCGAAGGCCUUCAUCAGC 25 GCAUGAAGGCCUUCGAGUU 62GACUCGAAGGCCUUCAUCAGC 26 GGAUGAAGGCCUUCGAGUU 63GACUCGAAGGCCUUCAUCAGC 27 UGAUGAAGGCCUUCGAGUU 64AGCUCGAGCUGUAACCUUGGA 28 UCCAAGGUCAGCUCGAUUU 65AGCUCGAGCUGUAACCUUGGA 29 UCCAAGGUUAGCUCGAGUU 66AGCUCGAGCUGUAACCUUGGA 30 UCCAAGGACAGCUCGAGUU 67AGCUCGAGCUGUAACCUUGGA 31 UCCAAGUACAGCUCGAGUU 68AGCUCGAGCUGUAACCUUGGA 32 UCCAAUUACAGCUCGAGUU 69AGCUCGAGCUGUAACCUUGGA 33 UCCAGUUACAGCUCGAGUU 70AGCUCGAGCUGUAACCUUGGA 34 UCCGGUUACAGCUCGAGUU 71AGCUCGAGCUGUAACCUUGGA 35 UCAGGUUACAGCUCGAGUU 72AGCUCGAGCUGUAACCUUGGA 36 UAAGGUUACAGCUCGAGUU 73AGCUCGAGCUGUAACCUUGGA 37 CAAGGUUACAGCUCGAGUU 74

[0123] In some embodiments, the first strand comprises a nucleic acid sequence having more than about any of 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to any guide sequences. In some embodiments, the first strand comprises a nucleic acid sequence having more than about any of 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to any guide sequences but maintains the CpG motif. In some embodiments, the second strand comprises a nucleic acid sequence having more than about any of 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the corresponding passenger sequence. In some embodiments, the second strand comprises a nucleic acid sequence having more than about any of 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the corresponding passenger sequence but maintains the CpG motif.

[0124] In one aspect, the disclosure provides an artificial miRNA comprising a first strand and a second strand, wherein (a) the first strand and second strand form a duplex; (b) the first strand comprises a guide region comprising a nucleotide sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 1 (5’- UAUAGCGAUGCCCAGAAGUUU-3’), SEQ ID NO: 2 (5’- UUCGAGCUGUAACCUUGGAAG-3’), SEQ ID NO: 3 (5’- UUGGUCGGUGCAGCGGCUCCU-3’), SEQ ID NO: 4 (5’- AUUCGUCAGCCACCAUCCUGA-3’), SEQ ID NO: 5 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 6 (5’- GGACUCGAAGGCCUUCAUCAG-3’), SEQ ID NO: 7 (5’- UAUUCGUCAGCCACCAUCCUG-3’), SEQ ID NO: 8 (5’- UUCGUCAGCCACCAUCCUGAC-3’), SEQ ID NO: 9 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 10 (5’- UGCGUCAUCACUGCACAGCAG-3’), SEQ ID NO: 11 (5’- UACGGUCUUUCUUGGUAGCUG-3’), SEQ ID NO: 12 (5’- UUGCGUCAUCACUGCACAGCA-3’), SEQ ID NO: 13 (5’- UUCGAAGGCCUUCAUCAGCUU-3’), SEQ ID NO: 14 (5’- AGCGAUGCCCAGAAGUUUCUG-3’), SEQ ID NO: 15 (5’- AACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 16 (5’-AACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 17 (5’- AACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 18 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 19 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 20 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 21 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 22 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 23 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 24 (5’-GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 25 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 26 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 27 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 28 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 29 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 30 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 31 (5’-AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 32 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 33 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 34 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 35 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 36 (5’- AGCUCGAGCUGUAACCUUGGA-3’), or SEQ ID NO: 37 (5’- AGCUCGAGCUGUAACCUUGGA-3’); and (c) the second strand (e.g., passenger strand) comprises a non-guide region that comprises a nucleotide sequence that is partially complementary to the nucleotide sequence of the guide region.

[0125] In some embodiments, provided herein is an artificial miRNA comprising a first strand and a second strand, wherein (a) the first strand and second strand form a duplex; (b) the first strand comprises a guide region comprising a nucleotide sequence of SEQ ID NO: 1 (5’- UAUAGCGAUGCCCAGAAGUUU-3’), SEQ ID NO: 2 (5’- UUCGAGCUGUAACCUUGGAAG-3’), SEQ ID NO: 3 (5’- UUGGUCGGUGCAGCGGCUCCU-3’), SEQ ID NO: 4 (5’- AUUCGUCAGCCACCAUCCUGA-3’), SEQ ID NO: 5 (5’-GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 6 (5’- GGACUCGAAGGCCUUCAUCAG-3’), SEQ ID NO: 7 (5’- UAUUCGUCAGCCACCAUCCUG-3’), SEQ ID NO: 8 (5’- UUCGUCAGCCACCAUCCUGAC-3’), SEQ ID NO: 9 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 10 (5’- UGCGUCAUCACUGCACAGCAG-3’), SEQ ID NO: 11 (5’- UACGGUCUUUCUUGGUAGCUG-3’), SEQ ID NO: 12 (5’- UUGCGUCAUCACUGCACAGCA-3’), SEQ ID NO: 13 (5’- UUCGAAGGCCUUCAUCAGCUU-3’), SEQ ID NO: 14 (5’- AGCGAUGCCCAGAAGUUUCUG-3’), SEQ ID NO: 15 (5’- AACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 16 (5’- AACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 17 (5’- AACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 18 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 19 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 20 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 21 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 22 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 23 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 24 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 25 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 26 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 27 (5’- GACUCGAAGGCCUUCAUCAGC-3’), SEQ ID NO: 28 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 29 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 30 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 31 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 32 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 33 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 34 (5’- AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 35 (5’-AGCUCGAGCUGUAACCUUGGA-3’), SEQ ID NO: 36 (5’-AGCUCGAGCUGUAACCUUGGA-3’), or SEQ ID NO: 37 (5’- AGCUCGAGCUGUAACCUUGGA-3’); and (c) the second strand comprises a non-guide region that comprises a nucleotide sequence that is partially complementary to the nucleotide sequence of the guide region.

[0126] In one embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 1 (5’- UAUAGCGAUGCCCAGAAGUUU-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:38 (5’-AAACUUCUGCAUCGCUAUG-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 1 (5’-UAUAGCGAUGCCCAGAAGUUU-3’) and the non-guide region comprises the sequence of SEQ ID NO: 38 (5’-AAACUUCUGCAUCGCUAUG- 3’).

[0127] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 2 (5’- UUCGAGCUGUAACCUUGGAAG-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:39 (5’-CUUCCAAGUACAGCUCGAG-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 2 (5’-UUCGAGCUGUAACCUUGGAAG-3’) and the non-guide region comprises the sequence of SEQ ID NO: 39 (5’-CUUCCAAGUACAGCUCGAG- 3’).

[0128] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 3 (5’- UUGGUCGGUGCAGCGGCUCCU-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:40 (5’-AGGAGCCGGCACCGACUAA-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 3 (5’-UUGGUCGGUGCAGCGGCUCCU-3’) and the non-guide region comprises the sequence of SEQ ID NO: 40 (5’- AGGAGCCGGCACCGACUAA-3 ’ ).

[0129] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 4 (5’-AUUCGUCAGCCACCAUCCUGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:41 (5’-UCAGGAUGGGCUGACGAAU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 4 (5 ’-AUUCGUCAGCCACCAUCCUGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 41 (5’- UCAGGAUGGGCUGACGAAU-3’).

[0130] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 5 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:42 (5’-GCUGAUGAGCCUUCGAGUU -3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 5 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 42 (5’- GCUGAUGAGCCUUCGAGUU -3’).

[0131] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 6 (5’- GGACUCGAAGGCCUUCAUCAG-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:43 (5’-CUGAUGAACCUUCGAGUUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 6 (5’-GGACUCGAAGGCCUUCAUCAG-3’) and the non-guide region comprises the sequence of SEQ ID NO: 43 (5’- CUGAUGAACCUUCGAGUUU-3’).

[0132] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 7 (5’- UAUUCGUCAGCCACCAUCCUG-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:44 (5’-CAGGAUGGGCUGACGAAUG-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 7 (5’-UAUUCGUCAGCCACCAUCCUG-3’) and the non-guide region comprises the sequence of SEQ ID NO: 44 (5’- CAGGAUGGGCUGACGAAUG-3’).

[0133] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 8 (5’- UUCGUCAGCCACCAUCCUGAC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:45 (5’-GUCAGGAUUGGCUGACGAA-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 8 (5’-UUCGUCAGCCACCAUCCUGAC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 45 (5’- GUCAGGAUUGGCUGACGAA-3’).

[0134] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 9 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:46 (5’-UCCAAGGUCAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 9 (5’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 46 (5’- UCCAAGGUCAGCUCGAGUU -3’).

[0135] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 10 (5’- UGCGUCAUCACUGCACAGCAG-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:47 (5’-CUGCUGUGGUGAUGACGUA-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 10 (5’-UGCGUCAUCACUGCACAGCAG-3’) and the non-guide region comprises the sequence of SEQ ID NO: 47 (5’- CUGCUGUGGUGAUGACGUA-3’).

[0136] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 11 (5’- UACGGUCUUUCUUGGUAGCUG-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:48 (5’-CAGCUACCGAAAGACCGUG-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 11 (5’-UACGGUCUUUCUUGGUAGCUG-3’) and thenon-guide region comprises the sequence of SEQ ID NO: 48 (5’- CAGCUACCGAAAGACCGUG-3’).

[0137] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 12 (5’- UUGCGUCAUCACUGCACAGCA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:49 (5’-UGCUGUGCUGAUGACGUAG-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 12 (5’-UUGCGUCAUCACUGCACAGCA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 49 (5’- UGCUGUGCUGAUGACGUAG-3’).

[0138] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 13 (5’- UUCGAAGGCCUUCAUCAGCUU-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:50 (5’-AAGCUGAUAGGCCUUCGAG-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 13 (5’-UUCGAAGGCCUUCAUCAGCUU-3’) and the non-guide region comprises the sequence of SEQ ID NO: 50 (5’- AAGCUGAUAGGCCUUCGAG-3’).

[0139] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 14 (5’- AGCGAUGCCCAGAAGUUUCUG-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:51 (5’-CAGAAACUUGGGCAUCGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 14 (5’-AGCGAUGCCCAGAAGUUUCUG-3’) and the non-guide region comprises the sequence of SEQ ID NO: 51 (5’- CAGAAACUUGGGCAUCGUU-3’).

[0140] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 15 (5’- AACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:52 (5’-GCUGAUGAGCCUUCGAGUC-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 15 (5’-AACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 52 (5’- GCUGAUGAGCCUUCGAGUC-3’).

[0141] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 16 (5’- AACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:53 (5’-GCUGAUGAGCCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 16 (5’-AACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 53 (5’- GCUGAUGAGCCUUCGAGUU-3’).

[0142] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 17 (5’- AACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:54 (5’-GCUGAUGAGCCUUCGAUUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 17 (5’-AACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 54 (5’- GCUGAUGAGCCUUCGAUUU-3’).

[0143] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 18 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:55 (5’-GCUGAUGAAGCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 18 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 55 (5’- GCUGAUGAAGCUUCGAGUU-3’).

[0144] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 19 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:56 (5’-GCUGAUGAACCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 19 (5 ’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 56 (5’- GCUGAUGAACCUUCGAGUU-3’).

[0145] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 20 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:57 (5’-GCUGAUGGGCCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 20 (5 ’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 57 (5’- GCUGAUGGGCCUUCGAGUU-3’).

[0146] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 21 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:58 (5’-GCUGAUAGGCCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 21 (5 ’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 58 (5’- GCUGAUAGGCCUUCGAGUU-3’).

[0147] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 22 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:59 (5’-GCUGAAAGGCCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 22 (5 ’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 59 (5’- GCUGAAAGGCCUUCGAGUU-3’).

[0148] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 23 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:60 (5’-GCUGGAAGGCCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 23 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 60 (5’- GCUGGAAGGCCUUCGAGUU-3’).

[0149] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 24 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:61 (5’-GCUUGAAGGCCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 24 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 61 (5’- GCUUGAAGGCCUUCGAGUU-3’).

[0150] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 25 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:62 (5’-GCAUGAAGGCCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 25 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 62 (5’- GCAUGAAGGCCUUCGAGUU-3’).

[0151] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 26 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:63 (5’-GGAUGAAGGCCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 26 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and thenon-guide region comprises the sequence of SEQ ID NO: 63 (5’- GGAUGAAGGCCUUCGAGUU-3’).

[0152] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 27 (5’- GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:64 (5’-UGAUGAAGGCCUUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 27 (5’-GACUCGAAGGCCUUCAUCAGC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 64 (5’- UGAUGAAGGCCUUCGAGUU-3’).

[0153] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 28 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:65 (5’-UCCAAGGUCAGCUCGAUUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 28 (5’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 65 (5’- UCCAAGGUCAGCUCGAUUU-3’).

[0154] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 29 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:66 (5’-UCCAAGGUUAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 29 (5’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 66 (5’- UCCAAGGUUAGCUCGAGUU-3’).

[0155] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 30 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:67 (5’-UCCAAGGACAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 30 (5’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 67 (5’- UCCAAGGACAGCUCGAGUU-3’).

[0156] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 31 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:68 (5’-UCCAAGUACAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 31 (5’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 68 (5’- UCCAAGUACAGCUCGAGUU-3’).

[0157] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 32 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:69 (5’-UCCAAUUACAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 32 (5’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 69 (5’- UCCAAUUACAGCUCGAGUU-3’).

[0158] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 33 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:70 (5’-UCCAGUUACAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 33 (5’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 70 (5’- UCCAGUUACAGCUCGAGUU-3’).

[0159] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 34 (5’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:71 (5’-UCCGGUUACAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 34 (5 ’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 71 (5’- UCCGGUUACAGCUCGAGUU-3’).

[0160] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 35 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:72 (5’-UCAGGUUACAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 35 (5 ’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 72 (5’- UCAGGUUACAGCUCGAGUU-3’).

[0161] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 36 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:73 (5’-UAAGGUUACAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 36 (5 ’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 73 (5’- UAAGGUUACAGCUCGAGUU-3’).

[0162] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 37 (5’- AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:74 (5’-CAAGGUUACAGCUCGAGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 37 (5 ’-AGCUCGAGCUGUAACCUUGGA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 74 (5’- CAAGGUUACAGCUCGAGUU-3’).

[0163] In some embodiments, the guide region comprises the sequence of SEQ ID NO: 1 and the non-guide region comprises the sequence of SEQ ID NO: 38.IV. miRNA Expression Constructs and Vectors

[0164] The disclosure provides expression constructs, vectors, and viral particles for expression of the miRNA molecules described herein.

[0165] In some embodiments, provided herein is an expression construct comprising a nucleic acid encoding the artificial miRNA.

[0166] In some embodiments, the nucleic acid encoding the miRNA is operably linked to a promoter.

[0167] In some embodiments, the nucleic acid encoding the artificial miRNA is cloned into a miRNA scaffold, wherein transcription of the expression construct forms a stem-loop structure.

[0168] In some embodiments, provided herein is a vector comprising the expression construct as provided herein.

[0169] In some embodiments, the vector is a rAAV vector.

[0170] In some embodiments, nucleic acid encoding an artificial miRNA of the present disclosure comprises a heterologous miRNA scaffold. In some embodiments, use of a heterologous miRNA scaffold is used to modulate miRNA expression; for example, to increase miRNA expression or to decrease miRNA expression. Any miRNA scaffold known in the art may be used. In some embodiments, the miRNA scaffold is derived from a miR-155 scaffold (see, e.g., Lagos-Quintana, M. et al. (2002) Curr. Biol. 12:735-9 and the Invitrogen™ BLOCK- iT™ Pol II miR RNA interference expression vector kit from Life Technologies, Thermo Fisher Scientific; Waltham, MA). In some embodiments, nucleic acid encoding a miRNA of the present disclosure comprises a miRNA scaffold. In some embodiments, miRNA scaffold comprises the sequence ctggaggcttgctgaaggctgtatgctgcaggacacaaggcctgttactagcactcacatggaacaaatggc (SEQ ID NO: 112), wherein the miRNA is inserted between the bolded gc residues.

[0171] In some embodiments, the miRNA in the scaffold comprises the sequence ctggaggcttgctgaaggctgtatgctgtacgatetaatategctegttttggccactgactgacgagcgatatgategtacgacaggacacaaggcctgttactagcactcacatggaacaaatggc (SEQ ID NO: 113) where the underlined regular text represents the 5 ’-flank, italics text represents the guide sequence, bolded text represents the loop, underlined italics represents the non-guide sequence and regular text represents the 3’ flank.

[0172] In some embodiments, the miRNA targets RNA encoding a polypeptide associated with HD. In some embodiments, the polypeptide is HTT.

[0173] In some embodiments, the transgene (e.g., a miRNA of the present disclosure) is operably linked to a promoter. Exemplary promoters include, but are not limited to, the cytomegalovirus (CMV) immediate early promoter, the RSV LTR, the MoMLV LTR, the phosphoglycerate kinase- 1 (PGK) promoter, a simian virus 40 (SV40) promoter and a CK6 promoter, a transthyretin promoter (TTR), a TK promoter, a tetracycline responsive promoter (TRE), an HBV promoter, an hAAT promoter, a LSP promoter, chimeric liver- specific promoters (LSPs), the E2F promoter, the telomerase (hTERT) promoter; the cytomegalovirus enhancer / chicken beta-actin / Rabbit P-globin promoter (CAG promoter; Niwa et al., Gene, 1991, 108(2): 193-9) and the elongation factor 1-alpha promoter (EFl-alpha) promoter (Kim et al., Gene, 1990, 91(2):217-23 and Guo et al., Gene Ther., 1996, 3(9):802-10). In some embodiments, the promoter comprises a human P-glucuronidase promoter, or a cytomegalovirus enhancer linked to a chicken P-actin (CBA) promoter. The promoter can be a constitutive, inducible or repressible promoter. In some embodiments, the disclosure provides a recombinant vector comprising nucleic acid encoding a heterologous transgene of the present disclosure operably linked to a CBA promoter. Exemplary promoters and descriptions may be found, e.g., in U.S. PG Pub. 20140335054. In some embodiments, the promoter is a CBA promoter, a minimum CBA promoter, a CMV promoter or a GUSB promoter. In some embodiments, the promoter is a hEF la promoter.

[0174] Examples of constitutive promoters include, without limitation, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the 13-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EFla promoter [Invitrogen].

[0175] Inducible promoters allow regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, e.g., acute phase, a particular differentiation state of the cell, or in replicating cells only. Inducible promoters and inducible systems are available from a variety of commercial sources, including, without limitation, Invitrogen, Clontech and Ariad. Many other systems have been described and can be readily selected by one of skill in the art. Examples of inducible promoters regulated by exogenously supplied promoters include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088); the ecdysone insect promoter (No et al, Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline-repressible system (Gossen et al, Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline-inducible system (Gossen et al, Science, 268: 1766-1769 (1995), see also Harvey et al, Curr. Opin. Chem. Biol., 2:512-518 (1998)), the RU486-inducible system (Wang et al, Nat. Biotech., 15:239-243 (1997) and Wang et al, Gene Ther., 4:432-441 (1997)) and the rapamycin- inducible system (Magari et al, J. Clin. Invest., 100:2865-2872 (1997)). Still other types of inducible promoters which may be useful in this context are those which are regulated by a specific physiological state, e.g., temperature, acute phase, a particular differentiation state of the cell, or in replicating cells only.

[0176] In another embodiment, the native promoter, or fragment thereof, for the transgene will be used. The native promoter may be preferred when it is desired that expression of the transgene should mimic the native expression. The native promoter may be used when expression of the transgene must be regulated temporally or developmentally, or in a tissuespecific manner, or in response to specific transcriptional stimuli. In a further embodiment, other native expression control elements, such as enhancer elements, polyadenylation sites or Kozak consensus sequences may also be used to mimic the native expression.

[0177] In some embodiments, the regulatory sequences impart tissue-specific gene expression capabilities. In some cases, the tissue-specific regulatory sequences bind tissuespecific transcription factors that induce transcription in a tissue specific manner. Such tissuespecific regulatory sequences (e.g., promoters, enhancers, etc.) are well known in the art. Exemplary tissue-specific regulatory sequences include but are not limited to the following tissuespecific promoters: neuronal such as neuron-specific enolase (NSE) promoter (Andersen et al., Cell. Mol. Neurobiol., 13:503-15 (1993)), neurofilament light-chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)), and the neuron-specific vgf gene promoter (Piccioli et al., Neuron, 15:373-84 (1995)). In some embodiments, the tissue-specific promoter is a promoter of a gene selected from: neuronal nuclei (NeuN), glial fibrillary acidic protein (GFAP), adenomatous polyposis coli (APC), and ionized calcium-binding adapter molecule 1 (Iba-1). Other appropriate tissue specific promoters will be apparent to the skilled artisan. In some embodiments, the promoter is a chicken Beta-actin promoter.

[0178] In some embodiments, the promoter expresses the heterologous nucleic acid in a cell of the CNS. As such, in some embodiments, a therapeutic polypeptide or a therapeutic nucleic acid of the disclosure may be used to treat HD. In some embodiments, the promoter expresses the heterologous nucleic acid in a brain cell. A brain cell may refer to any brain cell known in the art, including without limitation a neuron (such as a sensory neuron, motor neuron, interneuron, dopaminergic neuron, medium spiny neuron, cholinergic neuron, GABAergic neuron, pyramidal neuron, etc.'), a glial cell (such as microglia, macroglia, astrocytes, oligodendrocytes, ependymal cells, radial glia, etc.), a brain parenchyma cell, microglial cell, ependemal cell, and / or a Purkinje cell. In some embodiments, the promoter expresses the heterologous nucleic acid in a neuron and / or glial cell. In some embodiments, the neuron is a medium spiny neuron of the caudate nucleus, a medium spiny neuron of the putamen, a neuron of the cortex layer IV and / or a neuron of the cortex layer V.

[0179] Various promoters that express transcripts (e.g., a heterologous transgene) in CNS cells, brain cells, neurons, and glial cells are known in the art and described herein. Such promoters can comprise control sequences normally associated with the selected gene or heterologous control sequences. Often, useful heterologous control sequences include those derived from sequences encoding mammalian or viral genes. Examples include, without limitation, the SV40 early promoter, mouse mammary tumor virus LTR promoter, adenovirus major late promoter (Ad MLP), a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter such as the CMV immediate early promoter region (CMVIE), a rous sarcoma virus (RSV) promoter, synthetic promoters, hybrid promoters, and the like. In addition, sequences derived from nonviral genes, such as the murine metallothionein gene, may also beused. Such promoter sequences are commercially available from, e.g., Stratagene (San Diego, CA). CNS-specific promoters and inducible promoters may be used. Examples of CNS-specific promoters include without limitation those isolated from CNS-specific genes such as myelin basic protein (MBP), glial fibrillary acid protein (GFAP), and neuron specific enolase (NSE). Examples of inducible promoters include DN A responsive elements for ecdysone, tetracycline, metallothionein, and hypoxia, inter alia.

[0180] The present disclosure contemplates the use of a recombinant viral genome for introduction of one or more nucleic acid sequences encoding for an artificial miRNA as described herein or packaging into an AAV viral particle. The recombinant viral genome may include any element to establish the expression of a miRNA, for example, a promoter, a heterologous nucleic acid, an ITR, a ribosome binding element, terminator, enhancer, selection marker, intron, polyA signal, and / or origin of replication. In some embodiments, the rAAV vector comprises one or more of an enhancer, a splice donor / splice acceptor pair, a matrix attachment site, or a polyadenylation signal.

[0181] In some embodiments, the administration of an effective amount of rAAV particles comprising a vector encoding an artificial miRNA transduces cells (e.g., CNS cells, brain cells, neurons, and / or glial cells) at or near the site of administration (e.g., the striatum and / or cortex) or more distal to the site of administration. In some embodiments, more than about any of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 100% of neurons are transduced. In some embodiments, about 5% to about 100%, about 10% to about 50%, about 10% to about 30%, about 25% to about 75%, about 25% to about 50%, or about 30% to about 50% of the neurons are transduced. Methods to identify neurons transduced by recombinant viral particles expressing miRNA are known in the art; for example, immunohistochemistry, RNA detection (e.g., qPCR, Northern blotting, RNA-seq, in situ hybridization, and the like) or the use of a co-expressed marker such as enhanced green fluorescent protein can be used to detect expression.

[0182] In some aspects, the disclosure provides viral particles comprising a recombinant selfcomplementing genome (e.g., a self-complementary rAAV vector). AAV viral particles with self-complementing vector genomes and methods of use of self-complementing AAV genomes are described in US Patent Nos. 6,596,535; 7,125,717; 7,465,583; 7,785,888; 7,790,154;7,846,729; 8,093,054; and 8,361,457; and Wang Z., et al., (2003) Gene Ther 10:2105-2111, each of which are incorporated herein by reference in its entirety. A rAAV comprising a selfcomplementing genome will quickly form a double stranded DNA molecule by virtue of its partially complementing sequences (e.g., complementing coding and non-coding strands of a heterologous nucleic acid). In some embodiments, the vector comprises first nucleic acid sequence encoding the heterologous nucleic acid and a second nucleic acid sequence encoding a complement of the nucleic acid, where the first nucleic acid sequence can form intrastrand base pairs with the second nucleic acid sequence along most or all of its length.

[0183] In some embodiments, the first heterologous nucleic acid sequence encoding a miRNA and a second heterologous nucleic acid sequence encoding the complement of the miRNA are linked by a mutated ITR (e.g., the right ITR). In some embodiments, the ITR comprises the polynucleotide sequence 5’- CACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCC GGGCGACCAAAGGTCGCCCACGCCCGGGCTTTGCCCGGGCG - 3’ (SEQ ID NO: 114). The mutated ITR comprises a deletion of the D region comprising the terminal resolution sequence. As a result, on replicating an AAV viral genome, the rep proteins will not cleave the viral genome at the mutated ITR and as such, a recombinant viral genome comprising the following in 5' to 3' order will be packaged in a viral capsid: an AAV ITR, the first heterologous polynucleotide sequence including regulatory sequences, the mutated AAV ITR, the second heterologous polynucleotide in reverse orientation to the first heterologous polynucleotide and a third AAV ITR.V. Viral particles and methods of producing viral particles

[0184] The disclosure provides, inter alia, recombinant viral particles comprising a nucleic acid encoding an artificial miRNA of the present disclosure, as well as methods of use thereof to treat a disease or disorder in a mammal; e.g., HD.Viral particles

[0185] The disclosure provides viral particles comprising the miRNA molecules as disclosed herein. In some embodiments, the disclosure provides viral particles for delivering the miRNA molecules of the disclosure as disclosed herein. For example, the disclosure provides methods ofusing recombinant viral particles to deliver miRNA to treat a disease or disorder in a mammal; e.g., rAAV particles comprising miRNA to treat HD. In some embodiments, the recombinant viral particle is a recombinant AAV particle. In some embodiments, the viral particle is a recombinant AAV particle comprising a nucleic acid comprising a sequence an artificial miRNA of the present disclosure flanked by one or two ITRs. The nucleic acid is encapsidated in the AAV particle. The AAV particle also comprises capsid proteins. In some embodiments, the nucleic acid comprises the coding sequence(s) of interest (e.g., nucleic acid or miRNA of the present disclosure) operatively linked components in the direction of transcription, control sequences including transcription initiation and termination sequences, thereby forming an expression construct. The expression construct is flanked on the 5' and 3' end by at least one functional AAV ITR sequences. By “functional AAV ITR sequences” it is meant that the ITR sequences function as intended for the rescue, replication, and packaging of the AAV virion. See Davidson et al., PNAS, 2000, 97(7)3428-32; Passini et al., J. Virol., 2003, 77(12):7034-40; and Pechan et al., Gene Ther., 2009, 16: 10-16, all of which are incorporated herein in their entirety by reference. For practicing some aspects of the disclosure, the recombinant vectors comprise at least all of the sequences of AAV essential for encapsidation and the physical structures for infection by the rAAV. AAV ITRs for use in the vectors of the disclosure need not have a wildtype nucleotide sequence (e.g., as described in Kotin, Hum. Gene Ther., 1994, 5:793-801), and may be altered by the insertion, deletion, or substitution of nucleotides or the AAV ITRs may be derived from any of several AAV serotypes. More than 40 serotypes of AAV are currently known, and new serotypes and variants of existing serotypes continue to be identified. See Gao et al., PNAS, 2002, 99(18): 11854-6; Gao et al., PNAS, 2003, 100(10):6081-6; and Bossis et al., J. Virol., 2003, 77(12):6799-810. Use of any AAV serotype is considered within the scope of the present disclosure. In some embodiments, a rAAV vector is a vector derived from an AAV serotype, including without limitation, AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV capsid serotype or the like. In some embodiments, the nucleic acid in the AAV comprises an ITR of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV 11 , AAV 12, AAV2R471 A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV capsid serotype or the like. In some embodiments, the nucleic acid in the AAV further encodes amiRNA as described herein. In some embodiments the rAAV particle comprise an AAV 1 , an AAV2HBKO capsid (e.g., as described in WO2015168666), an AAV9 capsid, a PHP.B capsid, a PHP.eB capsid, or an OligOOl capsid.

[0186] For example, the nucleic acid in the AAV can comprise at least one ITR of any AAV serotype contemplated herein and can further encode a miRNA comprising a first strand and a second strand, wherein a) the first strand and the second form a duplex; b) the first strand comprises a guide region, and c) the second strand comprises a non-guide region, wherein the non-guide region comprises a two nucleotide deletion at bases 9 and 10 to create bulge in the guide strand. In some embodiments, a vector may include a stuffer nucleic acid. In some embodiments, the stuffer nucleic acid may encode a green fluorescent protein. In some embodiments, the stuffer nucleic acid may be located between the promoter and the nucleic acid encoding the miRNA. In some embodiments, the stuffer nucleic acid is an A1AT stuffer nucleic acid.

[0187] Different AAV serotypes are used to optimize transduction of particular target cells or to target specific cell types within a particular target tissue (e.g., a diseased tissue). A rAAV particle can comprise viral proteins and viral nucleic acids of the same serotype or a mixed serotype. For example, in some embodiments a rAAV particle can comprise AAV 1 capsid proteins and at least one AAV2 ITR or it can comprise AAV2 capsid proteins and at least one AAV 1 ITR. Any combination of AAV serotypes for production of a rAAV particle is provided herein as if each combination had been expressly stated herein. In some embodiments, the disclosure provides rAAV particles comprising an AAV 1 capsid and a rAAV vector of the present disclosure (e.g., an expression construct comprising nucleic acid encoding a miRNA of the present disclosure), flanked by at least one AAV2 ITR. In some embodiments, the disclosure provides rAAV particles comprising an AAV2 capsid. In some embodiments the rAAV particle comprise an AAV1, an AAV2HBKO capsid (e.g., as described in WO2015168666), an AAV9 capsid, a PHP.B capsid, a PHP.eB capsid, or an OligOOl.

[0188] In some aspects, the disclosure provides viral particles comprising a recombinant self- complementing genome. AAV viral particles with self-complementing genomes and methods of use of self-complementing AAV genomes are described in US Patent Nos. 6,596,535;7,125,717; 7,465,583; 7,785,888; 7,790,154; 7,846,729; 8,093,054; and 8,361,457; and Wang Z.,et al., (2003) Gene Ther 10:2105-2111, each of which are incorporated herein by reference in its entirety. A rAAV comprising a self-complementing genome will quickly form a double stranded DNA molecule by virtue of its partially complementing sequences (e.g., complementing coding and non-coding strands of a transgene). In some embodiments, the disclosure provides an AAV viral particle comprising an AAV genome, wherein the rAAV genome comprises a first heterologous polynucleotide sequence (e.g., a miRNA of the present disclosure) and a second heterologous polynucleotide sequence (e.g., antisense strand of a miRNA of the present disclosure) wherein the first heterologous polynucleotide sequence can form intrastrand base pairs with the second polynucleotide sequence along most or all of its length. In some embodiments, the first heterologous polynucleotide sequence and a second heterologous polynucleotide sequence are linked by a sequence that facilitates intrastrand base pairing; e.g., a hairpin DNA structure. Hairpin structures are known in the art, for example in miRNA or siRNA molecules. In some embodiments, the first heterologous polynucleotide sequence and a second heterologous polynucleotide sequence are linked by a mutated ITR (e.g., the right ITR). In some embodiments, the ITR comprises the polynucleotide sequence 5’-ttggccactccctctctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcc tcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct- 3’ (SEQ ID NO: 115). The mutated ITR comprises a deletion of the D region comprising the terminal resolution sequence. As a result, on replicating an AAV viral genome, the rep proteins will not cleave the viral genome at the mutated ITR and as such, a recombinant viral genome comprising the following in 5' to 3' order will be packaged in a viral capsid: an AAV ITR, the first heterologous polynucleotide sequence including regulatory sequences, the mutated AAV ITR, the second heterologous polynucleotide in reverse orientation to the first heterologous polynucleotide and a third AAV ITR. In some embodiments, the disclosure provides AAV viral particles comprising a recombinant viral genome comprising a functional AAV2 ITR, a first polynucleotide sequence encoding a miRNA of the present disclosure, a mutated AAV2 ITR comprising a deletion of the D region and lacking a functional terminal resolution sequence, a second polynucleotide sequence comprising the complementary sequence to the sequence encoding a miRNA of the present disclosure, of the first polynucleotide sequence and a functional AAV2 ITR.

[0189] In some embodiments, provided herein is a viral particle comprising the vector, wherein the viral particle is an AAV particle encapsidating the rAAV vector.

[0190] In some embodiments, the viral particle comprises a modified AAV9 or AAV2 capsid protein.Production of viral particles

[0191] rAAV particles can be produced using methods known in the art. See, e.g., U.S. Pat. Nos. 6,566,118; 6,989,264; and 6,995,006. In practicing the disclosure, host cells for producing rAAV particles include mammalian cells, insect cells, plant cells, microorganisms, and yeast. Host cells can also be packaging cells in which the AAV rep and cap genes are stably maintained in the host cell or producer cells in which the AAV vector genome is stably maintained. Exemplary packaging and producer cells are derived from 293, A549 or HeLa cells. AAV vectors are purified and formulated using standard techniques known in the art.

[0192] Methods known in the art for production of rAAV vectors include but are not limited to transfection, stable cell line production, and infectious hybrid virus production systems which include adenovirus-AAV hybrids, herpesvirus-AAV hybrids (Conway, JE et al., (1997) J. Virology 71(11):8780-8789) and baculovirus-AAV hybrids. rAAV production cultures for the production of rAAV virus particles all require; 1) suitable host cells, including, for example, human-derived cell lines such as HeLa, A549, or 293 cells, or insect-derived cell lines such as SF-9, in the case of baculo virus production systems; 2) suitable helper virus function, provided by wild-type or mutant adenovirus (such as temperature sensitive adenovirus), herpes virus, baculovirus, or a plasmid construct providing helper functions; 3) AAV rep and cap genes and gene products; 4) a nucleic acid (such as a therapeutic nucleic acid) flanked by at least one AAV ITR sequences ; and 5) suitable media and media components to support rAAV production. In some embodiments, the AAV rep and cap gene products may be from any AAV serotype. In general, but not obligatory, the AAV rep gene product is of the same serotype as the ITRs of the rAAV vector genome as long as the rep gene products may function to replicated and package the rAAV genome. Suitable media known in the art may be used for the production of rAAV vectors. These media include, without limitation, media produced by Hyclone Laboratories and JRH including Modified Eagle Medium (MEM), Dulbecco's Modified Eagle Medium (DMEM), custom formulations such as those described in U.S. Patent No. 6,566,118, and Sf-900 II SFM media as described in U.S. Patent No. 6,723,551, each of which is incorporated herein by reference in its entirety, particularly with respect to custom media formulations for use inproduction of recombinant AAV vectors. In some embodiments, the AAV helper functions are provided by adenovirus or HSV. In some embodiments, the AAV helper functions are provided by baculovirus and the host cell is an insect cell (e.g., Spodoptera frugiperda (Sf9) cells).

[0193] In some embodiments, rAAV particles may be produced by a triple transfection method, such as the exemplary triple transfection method provided infra. Briefly, a plasmid containing a rep gene and a capsid gene, along with a helper adenoviral plasmid, may be transfected (e.g., using the calcium phosphate method) into a cell line (e.g., HEK-293 cells), and virus may be collected and optionally purified. As such, in some embodiments, the rAAV particle was produced by triple transfection of a nucleic acid encoding the rAAV vector, a nucleic acid encoding AAV rep and cap, and a nucleic acid encoding AAV helper virus functions into a host cell, wherein the transfection of the nucleic acids to the host cells generates a host cell capable of producing rAAV particles.

[0194] In some embodiments, rAAV particles may be produced by a producer cell line method, such as the exemplary producer cell line method provided infra (see also (referenced in Martin et al., (2013) Human Gene Therapy Methods 24:253-269). Briefly, a cell line (e.g., a HeLa cell line) may be stably transfected with a plasmid containing a rep gene, a capsid gene, and a promoter-heterologous nucleic acid sequence. Cell lines may be screened to select a lead clone for rAAV production, which may then be expanded to a production bioreactor and infected with an adenovirus (e.g., a wild-type adenovirus) as helper to initiate rAAV production. Virus may subsequently be harvested, adenovirus may be inactivated (e.g., by heat) and / or removed, and the rAAV particles may be purified. As such, in some embodiments, the rAAV particle was produced by a producer cell line comprising one or more of nucleic acid encoding the rAAV vector, a nucleic acid encoding AAV rep and cap, and a nucleic acid encoding AAV helper virus functions.

[0195] In some aspects, a method is provided for producing any rAAV particle as disclosed herein comprising (a) culturing a host cell under a condition that rAAV particles are produced, wherein the host cell comprises (i) one or more AAV package genes, wherein each said AAV packaging gene encodes an AAV replication and / or encapsidation protein; (ii) an rAAV provector comprising a nucleic acid encoding miRNA of the present disclosure as described herein flanked by at least one AAV ITR, and (iii) an AAV helper function; and (b) recovering therAAV particles produced by the host cell. In some embodiments, said at least one AAV ITR is selected from the group consisting of AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV capsid serotype ITRs or the like. In some embodiments, said encapsidation protein is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6 (e.g., a wild-type AAV6 capsid, or a variant AAV6 capsid such as ShHIO, as described in U.S. PG Pub. 2012 / 0164106), AAV7, AAV8, AAVrh8, AAVrh8R, AAV9 (e.g., a wild-type AAV9 capsid, or a modified AAV9 capsid as described in U.S. PG Pub. 2013 / 0323226), AAV10, AAVrhlO, AAV11, AAV12, a tyrosine capsid mutant, a heparin binding capsid mutant, an AAV2R471 A capsid, an AAVAAV2 / 2-7m8 capsid, an AAV DJ capsid (e.g., an AAV-DJ / 8 capsid, an AAV-DJ / 9 capsid, or any other of the capsids described in U.S. PG Pub. 2012 / 0066783), AAV2 N587A capsid, AAV2 E548A capsid, AAV2 N708A capsid, AAV V708K capsid, goat AAV capsid, AAV1 / AAV2 chimeric capsid, bovine AAV capsid, mouse AAV capsid, rAAV2 / HBoVl capsid, or an AAV capsid described in U.S. Pat. No. 8,283,151 or International Publication No. WG / 2003 / 042397. In some embodiments, the AAV capsid is an AAV2HBKO capsid as described in WO2015168666. In some embodiments, the AAV capsid is an AAV9 capsid. In some embodiments, the AAV capsid is a PHP.B, PHP.eB or an OligOOl capsid. In some embodiments, a mutant capsid protein maintains the ability to form an AAV capsid. In some embodiments, the encapsidation protein is an AAV5 tyrosine mutant capsid protein. In further embodiments, the rAAV particle comprises capsid proteins of an AAV serotype from Clades A-F. In some embodiments, the rAAV particles comprise an AAV1 capsid and a recombinant genome comprising AAV2 ITRs and nucleic acid encoding a miRNA of the present disclosure. In a further embodiment, the rAAV particles are purified. The term “purified” as used herein includes a preparation of rAAV particles devoid of at least some of the other components that may also be present where the rAAV particles naturally occur or are initially prepared from. Thus, for example, isolated rAAV particles may be prepared using a purification technique to enrich it from a source mixture, such as a culture lysate or production culture supernatant. Enrichment can be measured in a variety of ways, such as, for example, by the proportion of DNase-resistant particles (DRPs) or genome copies (gc) present in a solution, or by infectivity, or it can be measured in relation to a second, potentially interfering substance present in the source mixture, such as contaminants, includingproduction culture contaminants or in-process contaminants, including helper virus, media components, and the like.

[0196] Numerous methods are known in the art for production of adenoviral vector particles. For example, for a gutted adenoviral vector, the adenoviral vector genome and a helper adenovirus genome may be transfected into a packaging cell line (e.g., a 293 cell line). In some embodiments, the helper adenovirus genome may contain recombination sites flanking its packaging signal, and both genomes may be transfected into a packaging cell line that expresses a recombinase (e.g., the Cre / loxP system may be used), such that the adenoviral vector of interest is packaged more efficiently than the helper adenovirus (see, e.g., Alba, R. et al. (2005) Gene Ther. 12 Suppl 1:S 18-27). Adenoviral vectors may be harvested and purified using standard methods, such as those described herein.

[0197] Numerous methods are known in the art for production of lenti viral vector particles. For example, for a third-generation lentiviral vector, a vector containing the lentiviral genome of interest with gag and pol genes may be co-transfected into a packaging cell line (e.g., a 293 cell line) along with a vector containing a rev gene. The lentiviral genome of interest also contains a chimeric LTR that promotes transcription in the absence of Tat (see Dull, T. et al. (1998) J. Virol. 72:8463-71). Lentiviral vectors may be harvested and purified using methods (e.g., Segura MM, et al., (2013) Expert Opin Biol Ther. 13(7):987- 1011) described herein.

[0198] Numerous methods are known in the art for production of HSV particles. HSV vectors may be harvested and purified using standard methods, such as those described herein. For example, for a replication-defective HSV vector, an HSV genome of interest that lacks all of the immediate early (IE) genes may be transfected into a complementing cell line that provides genes required for virus production, such as ICP4, ICP27, and ICP0 (see, e.g., Samaniego, L.A. et al. (1998) J. Virol. 72:3307-20). HSV vectors may be harvested and purified using methods described (e.g., Goins, WF et al., (2014) Herpes Simplex Virus Methods in Molecular Biology 1144:63-79).

[0199] Also provided herein are pharmaceutical compositions comprising a recombinant viral particle comprising a transgene encoding a miRNA of the present disclosure and a pharmaceutically acceptable carrier. The pharmaceutical compositions may be suitable for anymode of administration described herein. A pharmaceutical composition of a recombinant viral particle comprising a nucleic acid encoding a miRNA of the present disclosure can be introduced to the brain. For example, a recombinant viral particle comprising a nucleic acid encoding a miRNA of the present disclosure can be administered intrastriatally. Any of the recombinant viral particles of the present disclosure may be used, including rAAV, adenoviral, lentiviral, and HSV particles.

[0200] In some embodiments, the pharmaceutical compositions comprising a recombinant viral particle comprising a transgene encoding a miRNA of the present disclosure described herein and a pharmaceutically acceptable carrier is suitable for administration to human. Such carriers are well known in the art (see, e.g., Remington's Pharmaceutical Sciences, 15th Edition, pp. 1035-1038 and 1570-1580). In some embodiments, the pharmaceutical compositions comprising a rAAV described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration). In some embodiments, the pharmaceutical compositions comprising a recombinant lentiviral particle described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration). In some embodiments, the pharmaceutical compositions comprising a recombinant adenoviral particle described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration). In some embodiments, the pharmaceutical compositions comprising a recombinant HSV particle described herein, and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration).

[0201] Such pharmaceutically acceptable carriers can be sterile liquids, such as water and oil, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, and the like. Saline solutions and aqueous dextrose, polyethylene glycol (PEG) and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. The pharmaceutical composition may further comprise additional ingredients, for example preservatives, buffers, tonicity agents, antioxidants and stabilizers, nonionic wetting or clarifying agents, viscosity-increasing agents, and the like. The pharmaceutical compositions described herein can be packaged in single unit dosages or in multidosage forms. The compositions are generally formulated as sterile and substantially isotonic solution.VI. Methods of Treatment

[0202] Certain aspects of the present disclosure relate to methods of treating HD by reducing levels of HTT protein in an individual in need thereof. In some embodiments, the invention provides methods of treating HD by administering an effective amount of an expression cassette (e.g., an expression cassette delivered in a rAAV particle) for expressing an artificial miRNA of the present disclosure.

[0203] The expression cassette for expressing the artificial miRNA may be administered through various routes. In some embodiments, the administration includes direct spinal cord injection and / or intracerebral administration. In some embodiments, the administration is at a site selected from the cerebrum, medulla, pons, cerebellum, intracranial cavity, meninges surrounding the brain, dura mater, arachnoid mater, pia mater, cerebrospinal fluid (CSF) of the subarachnoid space surrounding the brain, deep cerebellar nuclei of the cerebellum, ventricular system of the cerebrum, subarachnoid space, striatum, cortex, septum, thalamus, hypothalamus, and the parenchyma of the brain. In some embodiments, the administration comprises intracerebroventricular injection into at least one cerebral lateral ventricle. In some embodiments, the administration comprises intrathecal injection in the cervical, thoracic, and / or lumbar region. In some embodiments, the administration comprises intrastriatal injection. In some embodiments, the administration comprises intrathalamic injection.

[0204] In some embodiments, routes of administration to the central nervous system may comprise an intraparenchymal route. In some embodiments, the intraparenchymal route may comprise thalamic, striatal, or hippocampal. In some embodiments, routes of administration to the central nervous system may comprise an intra-cerebral spinal fluid (CSF) route. In some embodiments, the intra-CSF route may comprise intracerebroventricular, intra-cisternal magna, or intrathecal. In some embodiments, routes of administration to the central nervous system may comprise a peripheral route. In some embodiments, the peripheral route may comprise an intravenous route. In some embodiments, routes of administration to the central nervous system may comprise an experimental route. In some embodiments, the experimental route may comprise an intranasal route.

[0205] In some embodiments, a route of administration (ROA) may comprise an intracerebral spinal fluid (intra-CSF) ROA. In some embodiments, the intra-CSF ROA may comprise intracerebroventricular (ICV), intra-cisternal magna (ICM), or intrathecal (IT) ROA.

[0206] An effective amount of rAAV (in some embodiments in the form of particles) is administered, depending on the objectives of treatment. For example, where a low percentage of transduction can achieve the desired therapeutic effect, then the objective of treatment is generally to meet or exceed this level of transduction. In some instances, this level of transduction can be achieved by transduction of only about 1 to 5% of the target cells of the desired tissue type, in some embodiments at least about 20% of the cells of the desired tissue type, in some embodiments at least about 50%, in some embodiments at least about 80%, in some embodiments at least about 95%, in some embodiments at least about 99% of the cells of the desired tissue type. The rAAV composition may be administered by one or more administrations, either during the same procedure or spaced apart by days, weeks, months, or years. One or more of any of the routes of administration described herein may be used. In some embodiments, multiple vectors may be used to treat the human.

[0207] In some embodiments of the above aspects, the rAAV is administered via direct injection into the spinal cord, via intrathecal injection, or via intracisternal injection. In some embodiments, the rAAV is administered to more than one location of the spinal cord or cisterna magna. In some embodiments, the rAAV is administered to more than one location of the spinal cord. In some embodiments, the rAAV is administered to one or more of a lumbar subarachnoid space, thoracic subarachnoid space, and a cervical subarachnoid space of the spinal cord. In some embodiments, the rAAV is administered to the cisterna magna.

[0208] In some embodiments, the invention provides a method for treating a human with HD by administering an effective amount of a pharmaceutical composition comprising a recombinant viral vector encoding an artificial miRNA of the present disclosure. In some embodiments, the pharmaceutical composition comprises one or more pharmaceutically acceptable excipients.

[0209] In some embodiments, the methods comprise administering an effective amount of a pharmaceutical composition comprising a recombinant viral vector encoding an artificial miRNA polypeptide of the present disclosure to HD in an individual in need thereof. In someembodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about any of 5 x 1012, 6 x 1012, 7 x 1012, 8 x 1012, 9 x 1012, 10 x 1012, 11 x 1012, 15 x 1012, 20 x 1012, 25 x 1012, 30 x 1012, or 50 x 1012genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about any of 5 x 1012to 6 x 1012, 6 x 1012to 7 x 1012, 7 x 1012to 8 x 1012, 8 x 1012to 9 x 1012, 9 x 1012to 10 x 1012, 10 x 1012to 11 x 1012, 11 x 1012to 15 x 1012, 15 x 1012to 20 x 1012, 20 x 1012to 25 x 1012, 25 x 1012to 30 x 1012, 30 x 1012to 50 x 1012, or 50 x 1012to 100 x 1012genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about any of 5 x IO12to 10 x IO12, 10 x IO12to 25 x IO12, or 25 x IO12to 50 x I012genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about any of 5 x IO9, 6 x 109, 7 x 109, 8 x 109, 9 x 109, 10 x IO9, 11 x IO9, 15 x IO9, 20 x 109, 25 x 109, 30 x 109, or 50 x 109transducing units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about any of 5 x IO9to 6 x IO9, 6 x 109to 7 x 109, 7 x 109to 8 x 109, 8 x 109to 9 x 109, 9 x 109to 10 x IO9, 10 x IO9to 11 x IO9, 11 x 109to 15 x IO9, 15 x IO9to 20 x IO9, 20 x 109to 25 x 109, 25 x 109to 30 x 109, 30 x 109to 50 x 109or 50 x 109to 100 x IO9transducing units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about any of 5 x IO9to 10 x IO9, 10 x IO9to 15 x IO9, 15 x IO9to 25 x IO9, or 25 x 109to 50 x 109transducing units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least any of about 5 x IO10, 6 x IO10, 7 x IO10, 8 x IO10, 9 x IO10, 10 x IO10, 11 x IO10, 15 x IO10, 20 x IO10, 25 x IO10, 30 x IO10, 40 x IO10, or 50 x IO10infectious units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least any of about 5 x IO10to 6 x IO10, 6 x IO10to 7 x IO10, 7 x IO10to 8 x IO10, 8 x IO10to 9 x IO10, 9 x IO10to 10 x IO10, 10 x IO10to 11 x IO10, 11 x IO10to 15 x IO10, 15 x IO10to 20 x IO10, 20 x IO10to 25 x IO10, 25 x IO10to 30 x IO10, 30 x IO10to 40 x IO10, 40 x IO10to 50 x IO10, or 50 x IO10to 100 x IO10infectious units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least any of about 5 x IO10to 10 x IO10, 10 x IO10to 15 x IO10, 15 x IO10to 25 x IO10, or 25 x IO10to 50 x IO10infectious units / mL. In some embodiments, the viral particles are rAAV particles.

[0210] In some embodiments, the dose of viral particles administered to the individual is at least about any of 1 x IO8to about 6 x IO13genome copies / kg of body weight. In some embodiments, the dose of viral particles administered to the individual is about any of 1 x IO8to about 6 x IO13genome copies / kg of body weight. In some embodiments, the dose of viralparticles administered to the individual is about any of 1 x IO10, 2 x IO10, 3 x IO10, 4 x IO10, 5 x1010, 6 x IO10, 7 x IO10, 8 x IO10, 9 x IO10, 1 x 1011, 2 x 1011, 3 x 1011, 4 x IO11, 5 x IO11, 6 x1011, 7 x IO11, 8 x IO11, 9 x IO11, 1 x 1012, 2 x 1012, 13x 1012, 4 x 1012, 5 x 1012, 6 x 1012, 7 x1012, 8 x 1012, 9 x 1012, or 1 x 1013genome copies / kg of body weight.

[0211] In some embodiments, the total amount of viral particles administered to the individual is at least about any of 1 x 109to about 1 x 1014genome copies. In some embodiments, the total amount of viral particles administered to the individual is about any of 1 x IO9to about 1 x 1014genome copies. In some embodiments, the total amount of viral particles administered to the individual is about any of 1 x 1011, 2 x IO11, 3 x 1011, 4 x IO11, 5 x 1011, 6 x1011, 7 x 1011, 8 x 1011, 9 x 1011, 1 x IO12, 2 x IO12, 3 x IO12, 4 x IO12, 5 x IO12, 6 x IO12, 7 x1012, 8 x IO12, 9 x IO12, 1 x IO13, 2 x IO13, 13x IO13, 4 x IO13, 5 x IO13, 6 x IO13, 7 x IO13, 8 x1013, 9 x IO13, or 1 x IO14genome copies.

[0212] In some embodiments, provided herein is a method of treating or preventing HD in a patient in need thereof, comprising administering to the patient a composition comprising a miRNA comprising a guide strand that binds to a HTT mRNA and a passenger strand, wherein the guide strand comprises a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37.

[0213] In some embodiments, provided herein is a method of reducing HTT expression in a patient suffering from HD, comprising administering to the patient a composition comprising a miRNA comprising a guide strand that binds to a HTT mRNA and a passenger strand, wherein the guide strand comprises a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ IDNO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25,SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ IDNO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, orSEQ ID NO: 37.

[0214] In some aspects, provided herein are various methods comprising reducing the level of HTT protein in cells (e.g., cells of human patients afflicted with HD). In some embodiments, methods may comprise introducing constructs expressing artificial miRNA sequences configured to reduce target (e.g., endogenous) HTT mRNA in human cells. Results of such methods provided herein can be seen in FIGS. 1A-B. In some embodiments, methods may comprise using artificial miRNA sequences as provided herein to target and reduces levels of human HTT (e.g., human HTT protein). In some embodiments, artificial miRNA may be designed and ranked based on factors comprising: (1) predicted on- and off-target scores; (2) avoidance of known single-nucleotide polymorphisms; (3) homology between human and non-human primate sequences; or any combination thereof. Results for constructs expressing artificial miRNAs as described herein (e.g., SEQ ID NO: 1 - SEQ ID NO: 14) are depicted in FIG. 1A, in accordance with some embodiments. Results for constructs expressing artificial miRNAs as described herein (e.g., SEQ ID NO: 15 - SEQ ID NO: 37) are depicted in FIG. IB, in accordance with some embodiments. For the results displayed in FIGS. 1A-B, the artificial constructs were transfected into cultured human HeLa cells, in accordance with some embodiments. Human HTT mRNA was quantified by RT-dPCR relative to housekeeper genes labeled as ‘CTL’ in FIGS. 1A-B, in accordance with some embodiments. For each of FIGS. 1A-B, the results for each gene are plotted in terms of the mean ± standard error of the mean (SEM). The dotted lines are provided as a reference to 0.75 and 0.5 foldchange levels, respectively. 1-way ANOVA and Dunnett’s multiple comparisons to the control were used. The symbol is used to define various p-values for the indicated groups as follows, p*<0.05, p**<0.01, p***<0.001, and p****<0.0001.

[0215] In some aspects, provided herein are methods comprising artificial miRNA for reducing target HTT in a dose dependent manner as depicted in FIG. 2. The foldchange of the HTT mRNA relative to the control (CTL) is represented on the y-axis. Each artificial miRNA sequence is represented along the x-axis of FIG. 2. Nearly all doses of tested artificial miRNA sequences, as described herein, generated significant HTT mRNA knockdown relative to a dose- matched control.

[0216] In some embodiments, provided herein are methods comprising artificial miRNA configured for enhanced strand biasing and strand loading in human cells. In some embodiments, strand loading features of select artificial miRNA sequences may be assessed in vitro, by performing small RNA sequencing on total RNA isolated from transfected HeLa (FIGS. 3A-C). Each artificial miRNA may be expressed as a pre-miRNA hairpin loop containing guide (antisense to target) and / or passenger strands. The pre-miRNA hairpin may be processed to its mature form such that one strand may be degraded, whereby the remaining strand loading into the RISC complex may allow for target engagement and / or degradation. In some embodiments, preferential guide strand loading into the RISC complex may be associated with reduced potential for off-target activity by the passenger strand.

[0217] In some embodiments, constructs (e.g., genes, oligonucleotide sequences, expression constructs, or expression cassettes) expressing HTT-targeting artificial miRNAs may be transfected into cultured human HeLa cells. In some embodiments, small RNA libraries may be generated from each transfected well and sequenced to evaluate strand biasing as depicted in FIGS. 3A-B and to evaluate 5’ strand processing as depicted in FIG. 3C for each miRNA.

[0218] Based on in vitro performance, select candidate artificial miRNAs were assessed in vivo in rodent models (YAC128 and BACHD) of HD, in accordance with some embodiments. In some embodiments, methods may comprise administration of artificial miRNAs via intraparenchymal injection. In some embodiments, the intraparenchymal injection may comprise injection to the striatum using the novel capsid AAV.SAN006 (8E10viral particles per YAC128 mouse and IE11viral particles per BACHD rat). Results from experiments, using methods as provided herein, demonstrate that after six weeks, all tested artificial miRNAs generated significant striatal knockdown of human HTT mRNA in the YAC128 model. Additionally, significant reduction of mutant HTT protein can be observed in both rodent models for all tested HTT-targeting artificial miRNAs as depicted in FIGS. 4A-5.

[0219] In some embodiments, as described herein are various methods comprising intrastriatal injection of SAN006-HTT artificial miRNAs in YAC128 mouse model of HD. FIGS. 4A-B show results for such artificial miRNA sequences as provided herein, that demonstrate significant in vivo target engagement in the YAC128 model, in accordance with some embodiments. FIG. 4 A shows transgenic human HTT mRNA quantified by RT-dPCRrelative to housekeeper (e.g., control or CTL). FIG. 4B shows human mutant HTT protein quantified by an electrochemiluminescence assay (Meso Scale Diagnostics, LLC., or MSD) specific for the expanded polyQ region.

[0220] FIG. 5 shows artificial miRNA sequences exhibit significant in vivo target engagement in the BACHD model. Intrastriatal injection of SAN006-HTT expressing for artificial miRNAs was injected into the BACHD rat model of HD via intrastriatal administration. Human mutant HTT protein was quantified by an MSD electrochemiluminescence assay specific for the expanded polyQ region. The y-axis of FIG. 5 shows mHTT: total protein foldchange to the control (CTL)sequence. The x-axis shows each artificial miRNA and also includes CTL sequence. Data is plotted in terms of the mean ± standard error of the mean (SEM) and each data point represents a single hemisphere striatal sample of each animal.

[0221] In some embodiments, various methods comprising using artificial miRNA provided herein, may improve guide strand loading bias over passenger strand, relative to its in vitro strand bias value. Results from examples utilizing various methods as provided herein are shown in FIG. 6, where the y-axis shows the percent guide (e.g., the percentage of the guide amongst the total guide + passengers) and the x-axis shows each artificial miRNA. Three artificial miRNAs (SEQ ID NO: 1, SEQ ID NO: 11, SEQ ID NO: 12) had in vivo guide strand bias values >99%, while SEQ ID NO: 5 showed guide strand biasing of >98%. These results indicate a predicted low likelihood for off-target effects from passenger strand activity for these sequences.VII. Articles of Manufacture and Kits

[0222] Also provided are kits or articles of manufacture for use in the methods described herein. In aspects, the kits comprise the compositions described herein (e.g., a recombinant viral particle of the present disclosure, such as a rAAV particle comprising nucleic acid encoding a miRNA of the present disclosure) in suitable packaging. Suitable packaging for compositions (such as intrastriatal compositions) described herein are known in the art, and include, for example, vials (such as sealed vials), vessels, ampules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. These articles of manufacture may further be sterilized and / or sealed.

[0223] The present disclosure also provides kits comprising compositions described herein and may further comprise instruction(s) on methods of using the composition, such as uses described herein. The kits described herein may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for performing any methods described herein. For example, in some embodiments, the kit comprises a composition of recombinant viral particles comprising a transgene encoding a miRNA of the present disclosure for delivery of at least 1 x IO9genome copies into the brain of a mammal (e.g., through intrastriatal administration) to a primate as described herein, a pharmaceutically acceptable carrier suitable for injection into the brain of a primate, and one or more of: a buffer, a diluent, a filter, a needle, a syringe, and a package insert with instructions for performing injections into the brain of a primate (e.g., intrastriatal administration). In some embodiments, the kit comprising instructions for treating a neurodegenerative disorder (e.g., HD) with the recombinant viral particles described herein. In some embodiments, the kit comprising instructions for using the recombinant viral particles described herein according to any one of the methods described herein.EXAMPLES

[0224] The disclosure will be more fully understood by reference to the following examples. They should not, however, be construed as limiting the scope of the disclosure. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.General MethodsPlasmids for in vitro testing

[0225] Control or HTT-targeting artificial miRNAs were expressed from constructs as miR155-embedded hairpins under the control of either the mammalian pGK promoter (artificial miRNAs SEQ ID NO: 1 - SEQ ID NO: 14) or human CMV enhancer / chicken B-actin promoter (artificial miRNAs SEQ ID NO: 15 - SEQ ID NO: 37). HTT artificial miRNA sequences weredesigned and optimized to target the human HTT gene (SEQ ID NO: 103) excluding the polyQ region. The control sequence was designed for minimal seed-mediated off-target gene regulation.HeLa cell culture and transfection

[0226] Wildtype human HeLa cells expressing endogenous levels of HTT mRNA were cultured in DMEM (Gibco #11965-092) + 10% FBS. Unless otherwise indicated, cells were transfected with control or HTT-targeting artificial miRNA expression constructs using Opti- MEM reduced serum medium (Gibco #31985062) and Lipofectamine 3000 (Invitrogen L300015) according to manufacturer’s instructions. At 72h (SEQ ID NO: 15 - SEQ ID NO: 37) or 48h (SEQ ID NO: 1 - SEQ ID NO: 14) post-transfection, media was aspirated, and cells were lysed in QIAzol (QIAgen 79306) for RNA isolation. Dose-range experiments included dose- matched controls and normalization for total transfection contents with carrier plasmid (Promega E488A).RNA isolation

[0227] Following addition of chloroform and phase separation, total RNA including small RNAs <200nt was isolated from the aqueous phase. For samples intended for HTT mRNA screening, isolations were performed using the RNeasy 96 QIAcube HT kit (QIAgen #74171) according to manufacturer’s instructions. For samples intended for small RNA sequencing, total RNA isolations (including fragments <200nt) were performed using the miRNeasy mini kit (QIAgen 217004) according to manufacturer’s instructions. RNA concentration and purity were assessed by measuring absorbance at A260 / A280 and A260 / A230 on a NanoDrop eight spectrophotometer (ThermoS cientific) .HTT mRNA quantification by RT-digital PCR (RTdPCR)

[0228] RNA samples were diluted to equal concentration and tested by RT-dPCR for multiplexed quantification of human HTT mRNA (IDT TaqMan Hs00918174_ml) and human TBP mRNA (IDT TaqMan Hs.PT.58v.39859774) using the QIAcuity 8 system (QIAgen) and QIAcuity One-Step Viral RT-PCR Kit (QIAgen 1123145). HTT mRNA values were normalized to TBP housekeeper and analyzed relative to control levels.Small RNA library generation and sequencing

[0229] Library generation and sequencing was performed using the Truseq small RNA Library Kit (Azenta). Total RNA containing the small RNA fraction was used to determine strand processing for each artificial miRNA. Sequence reads were filtered based on size and quality, aligned to host cell genomes and custom genes for each artificial miRNA. A custom python script employed to extract data from alignment files generated lists of each artificial miRNA strand sequence and counts, allowing for calculation of guide to passenger ratios and top expressed guide sequences.ITR vectors and AAV generation

[0230] To generate recombinant AAV.SAN006 serotype vectors encoding artificial miRNAs, the artificial miRNA cassettes (e.g., artificial constructs or expression cassettes) were cloned into a plasmid containing AAV2 inverted terminal repeats (ITRs) under control of the human cytomegalovirus enhancer / chicken beta-actin (CBA) promoter. Vectors were provided by UMass Vector Core. Briefly, HEK293 cells were triple transfected with a 1: 1: 1 ratio of three plasmids (containing the ITR, AAV.SAN006 rep / cap and Ad helper). AAV purification was performed using cesium chloride ultracentrifugation, and virus was titered using qPCR and ddPCR against the polyA sequence.Animal models and care

[0231] All procedures were performed according to a protocol approved by the Institutional Animal Care and Use Committee (IACUC) at Sanofi, as per guidelines specified by the Guide for the Care and Use of Laboratory Animals, NIH. One-two month old YAC128 mice (Slow et al. 2003) or BACHD rats (Yu-Taeger, et al. 2012) were group housed except in stereotactic surgical studies, in which they were housed singly during recovery. Rodents were maintained on a 12-hour light / dark cycle with food and water available ad libitum.Stereotaxic injections with AAV-artificial miRNA vectors

[0232] Surgery was performed under aseptic conditions. Rodents were anaesthetized by isofluorane exposure and secured on a stereotactic frame (Stoelting) with constant isoflurane perfusion. The scalp was shaved, and a midline incision was made on the top of the head to expose the skull. A small burr hole was drilled in the skull above the desired location in the brain. A Hamilton syringe was mounted onto a microcontrolled stereotactic frame, and the needle was slowly lowered to the desired depth. For YAC128 intrastriatal injections, 4uLcontaining 4E10particles were injected into each of two bilateral injection sites at A / P 0.5, M / L + / -2.2, D / V -3.0. For BACHD rat, 5 uL containing 5E10particles were injected into each of two bilateral injection sites at A / P 0.7, M / L + / -2.8, D / V -5.5 scaled based on Bregma-Lambda distance. Each test article was injected at a rate of 0.5 microliters per minute. After the injection was complete, the syringe was left in the brain for one-two minutes to allow for the test article to become absorbed into the brain. The syringe was raised, and the incision closed using a horizontal mattress suturing pattern or simple interrupted pattern. Animals were warmed and observed during recovery, then housed individually and monitored for 72-hour post-surgery. Six weeks after injection animals were terminated for were euthanized by anesthetic overdose with >150 mg / kg sodium pentobarbital. Following overdose, animals were kept warm until cardiac perfusion with ice-cold PBS.Striatal tissue homogenization

[0233] Striatal samples were physically homogenized in TE buffer (Omni Bead Ruptor or Fast-prep 24) and immediately aliquoted for RNA isolation. Striatal homogenates used for protein quantification were assessed for total protein content (Pierce BCA, ThermoScientific).Striatal human mHTT protein quantification by ECL (MSD)

[0234] The expanded human huntingtin (HTT) protein in mouse brain tissue lysate was determined using a semi-quantitative electrochemiluminescence method (ECL). The MSD plate was coated with a monoclonal mouse antibody raised against amino acid 1-17 of the HTT protein. The plate was blocked and then the standards and diluted samples were loaded. The HTT protein binds to the immobilized antibody. The detection uses a biotinylated monoclonal mouse antibody (polyQ region specific). The Sulfo-tag streptavidin conjugated is added to complete the detection. A read buffer is finally added to the wells, and a voltage is applied by the MSD reader to the plate electrodes leading to light emission by the Sulfo-tag labels. Light intensity is then measured to quantify HTT protein in the samples. A calibration curve was obtained by plotting the signal against reference HTT protein concentration. Concentrations of HTT protein in samples were determined by interpolation and normalized per mg of total homogenate protein.Example 1: Artificial miRNA sequences reduce endogenous HTT mRNA in human cells

[0235] Artificial miRNA (artificial miRNA) sequences were designed to target human HTT and were ranked based on (1) predicted on- and off-target scores (siSPOTR, Boudreau et al, 2013); (2) avoidance of known single-nucleotide polymorphisms; and (3) homology between human and non-human primate sequences. Thirty-seven artificial miRNA sequences (e.g., SEQ ID NO: 1 - SEQ ID NO: 37) were selected for in vitro screening in the wildtype HeLa human cell line that endogenously expresses HTT. Constructs expressing each artificial miRNA candidate or a control sequence in the miR155 scaffold, were generated and transfected into cultured adherent HeLa cells. Of the thirty-seven artificial miRNA sequences (SEQ ID NO: 1 - SEQ ID NO: 37), the thirty-one generated significant knockdown of HTT mRNA relative to a control sequence as determined by reverse transcription-digital polymerase chain reaction (RT- dPCR) as depicted in FIGS. 1A-B. Results for constructs expressing artificial miRNAs SEQ ID NO: 1 - SEQ ID NO: 14 are depicted in FIG. 1A and results for artificial miRNAs SEQ ID NO: 15 - SEQ ID NO: 37 are depicted in FIG. IB. The artificial constructs were transfected into cultured human HeLa cells. Human HTT mRNA was quantified by RT-dPCR relative to housekeeper genes labeled as ‘CTL’ in FIGS. 1A-B. The results for each gene are plotted in terms of the mean ± standard error of the mean (SEM). The dotted lines are provided as a reference to 0.75 and 0.5 foldchange levels, respectively. 1-way ANOVA and Dunnett’s multiple comparisons to the control were used. The symbol is used to define various p-values for the indicated groups as follows: p*<0.05, p**<0.01, p***<0.001, and p****<0.0001.

[0236] Select artificial miRNA sequences with highest HTT mRNA knockdown, were selected and tested for dose-dependence in HTT mRNA knockdown. Select constructs expressing artificial miRNA sequences SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 14 were transfected into cultured human HeLa cells. A control sequence (CTL) was also used.Each sequence was dosed at 50 ng, 100 ng and 150 ng. The dosing results are depicted in FIG. 2. The foldchange of the HTT mRNA relative to the control (CTL) is shown on the y-axis. Each artificial miRNA is shown on the x-axis. Nearly all doses of tested artificial miRNA sequences generated significant HTT mRNA knockdown relative to a dose-matched control. Each data point is the average of three technical replicates; solid line means; dotted lines provided to indicate 0.75 and 0.5 level foldchange. Unless otherwise indicated, all artificial miRNAsgenerate significant HTT mRNA reduction relative to the dose-specific CTL. For analysis, 2- way ANOVA and Dunnett’s multiple comparisons were used. P-values were as follows: 0.00001 < p <0.05.Example 2: Artificial miRNA sequences show excellent guide strand biasing and 5’ end processing in vitro

[0237] Strand loading features of select artificial miRNA sequences were also assessed in vitro by performing small RNA sequencing on total RNA isolated from transfected HeLa (FIGS. 3A-C). Each artificial miRNA is expressed as a pre-miRNA hairpin loop containing both guide (antisense to target) and passenger strands. The pre-miRNA hairpin is processed to its mature form such that one strand is degraded and the remaining strand loading into the RISC complex allows target engagement and degradation. Preferential guide strand loading into the RISC complex is associated with reduced potential for off-target activity by the passenger strand.

[0238] Select constructs expressing HTT-targeting artificial miRNAs were transfected into cultured human HeLa cells. Small RNA libraries were generated from each transfected well and sequenced to evaluate strand biasing (FIGS. 3A-B) and 5 ’ strand processing (FIG. 3C) for each miRNA. SEQ ID NO: 1, SEQ ID NO: 11, SEQ ID NO: 18, SEQ ID NO: 24, and SEQ ID NO: 28 all showed >95% of the total artificial miRNA population as guide strand as depicted in FIGS. 3A-B. Additionally, 5’ sequencing of guide strand populations (e.g., 5’ strand processing) was assessed for select artificial miRNAs and found to be accurate (>95%) for all sequences tested as depicted in FIG. 3C. Data points in FIGS. 3A-C represent technical replicates.Example 3: Artificial miRNA sequences lower HTT in vivo following AAV-mediated intraparenchymal delivery

[0239] Based on in vitro performance, select candidate artificial miRNAs were assessed in vivo in rodent models of HD. The YAC128 mouse (Slow et al, 2003) and BACHD rat (Yu- Taeger et al, 2012) are well characterized HD lines that each express full-length human mutant HTT and are therefore suitable for assessing in vivo target engagement. In each of these strains, the indicated artificial miRNAs were delivered via intraparenchymal injection to the striatum using the novel capsid AAV.SAN006 (8E10particles per YAC128 mouse, IE11particles per BACHD rat). After six weeks, all tested artificial miRNAs generated significant striatal knockdown of human HTT mRNA in the YAC128 model and, importantly, significant reductionof mutant HTT protein was observed in both rodent models for all tested HTT-targeting artificial miRNAs (FIGS. 4A-5).

[0240] FIGS. 4A-B show artificial miRNA sequences that demonstrate significant in vivo target engagement in the YAC128 model. Intrastriatal injection of SAN006-HTTartificial miRNAs in YAC128 mouse model of HD. Mean ± SEM, data points represent single hemisphere striatal sample of each animal. 1-way ANOVA, Dunnett’s multiple comparisons to control, p*<0.05, p**<0.01, p***<0.001, p****<0.0001. FIG. 4A shows transgenic human HTT mRNA quantified by RT-dPCR relative to housekeeper. FIG. 4B shows human mutant HTT protein quantified by MSD electrochemiluminescence specific for the expanded polyQ region.

[0241] FIG. 5 shows artificial miRNA sequences exhibit significant in vivo target engagement in the BACHD model. Intrastriatal injection of SAN006-HTT expressing for artificial miRNAs was injected into the BACHD rat model of HD via intrastriatal administration. Human mutant HTT protein was quantified by an electrochemiluminescence assay (Meso Scale Diagnostics, LLC, a.k.a. MSD) specific for the expanded polyQ region. Data is plotted in terms of the mean ± standard error of the mean (SEM) and data points represent single hemisphere striatal sample of each animal. For analysis, 1-way ANOVA and Dunnett’s multiple comparisons to control were used. P-values were as follows: p*<0.05, p**<0.01, p***<0.001, p****<0.0001.Example 4: Artificial miRNA sequences show in vivo strand biasing

[0242] Sequences tested in vivo by AAV.SAN006 intrastriatal delivery in the YAC128 mouse model of HD were also evaluated for in vivo strand loading by small RNA sequencing. Total RNA (including fragments <200nt) was isolated from striatal tissue samples for each animal and used to generate small RNA libraries. The small RNA libraries were then sequenced to evaluate strand biasing.

[0243] For each artificial miRNA, guide strand loading bias over passenger strand improved, relative to its in vitro strand bias value. Results are plotted in FIG. 6, where the y-axis represents the percent of guide (of total guide + passengers) and each artificial miRNA is shown on the x-axis. Three artificial miRNAs (SEQ ID NO: 1, SEQ ID NO: 11, SEQ ID NO: 12) had in vivo guide strand bias values >99%, while SEQ ID NO: 5 showed guide strand biasing of >98%.These results indicate a predicted low likelihood for off-target effects from passenger strand activity for these sequences.Summary of Examples

[0244] Thirty-seven artificial miRNA sequences were designed to target human HTT based on their predicted on- and off-target scores, avoidance of known single-nucleotide polymorphisms, and homology between human and non-human primate sequences. These sequences were expressed in a human cervical cancer cell line (HeLa) expressing endogenous human HTT, and HTT mRNA knockdown was assessed by RT-dPCR. In this context artificial miRNA (e.g., amiRNA) strand loading for select sequences was also evaluated by small RNA sequencing. These in vitro data enabled downselection of sequences for in vivo pharmacology experiments. Using the capsid AAV.SAN006, select artificial miRNAs were delivered via intrastriatal injection to two rodent models of HD (YAC128 mouse and BACHD rat), and after six weeks striatal tissue was evaluated for HTT mRNA and HTT protein knockdown. In vivo strand loading was also evaluated for select artificial miRNAs in the YAC128 mouse model by performing small RNA sequencing on striatal RNA samples.ADDITIONAL SEQUENCE LISTINGTargeting Peptide Amino Acid SequenceKGGGFHG (SEQ ID NO : 100 )Targeting Peptide Flanked by Linkers - Amino Acid SequenceAAAKGGGFHGAS ( SEQ ID NO : 101 )SAN0006 Capsid Amino Acid Sequence (Full Structural Protein)Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gin Pro20 25 30Lys Ala Asn Gin Gin His Gin Asp Asn Ala Arg Gly Leu Vai Leu Pro35 40 45Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro50 55 60Vai Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80Gin Gin Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala85 90 95Asp Ala Glu Phe Gin Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly100 105 110Asn Leu Gly Arg Ala Vai Phe Gin Ala Lys Lys Arg Leu Leu Glu Pro115 120 125Leu Gly Leu Vai Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg130 135 140Pro Vai Glu Gin Ser Pro Gin Glu Pro Asp Ser Ser Ala Gly He Gly 145 150 155 160Lys Ser Gly Ala Gin Pro Ala Lys Lys Arg Leu Asn Phe Gly Gin Thr165 170 175Gly Asp Thr Glu Ser Vai Pro Asp Pro Gin Pro Ile Gly Glu Pro Pro180 185 190Ala Ala Pro Ser Gly Vai Gly Ser Leu Thr Met Ala Ser Gly Gly Gly195 200 205Ala Pro Vai Ala Asp Asn Asn Glu Gly Ala Asp Gly Vai Gly Ser Ser210 215 220Ser Gly Asn Trp His Cys Asp Ser Gin Trp Leu Gly Asp Arg Vai He225 230 235 240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu245 250 255Tyr Lys Gin lie Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn260 265 270Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg275 280 285Phe His Cys His Phe Ser Pro Arg Asp Trp Gin Arg Leu He Asn Asn290 295 300Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn He305 310 315 320Gin Vai Lys Glu Vai Thr Asp Asn Asn Gly Vai Lys Thr He Ala Asn325 330 335Asn Leu Thr Ser Thr Vai Gin Vai Phe Thr Asp Ser Asp Tyr Gin Leu340 345 350Pro Tyr Vai Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro355 360 365Ala Asp Vai Phe Met Ile Pro Gin Tyr Gly Tyr Leu Thr Leu Asn Asp370 375 380Gly Ser Gin Ala Vai Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400Pro Ser Gin Met Leu Arg Thr Gly Asn Asn Phe Gin Phe Ser Tyr Glu405 410 415Phe Glu Asn Vai Pro Phe His Ser Ser Tyr Ala His Ser Gin Ser Leu420 425 430Asp Arg Leu Met Asn Pro Leu lie Asp Gin Tyr Leu Tyr Tyr Leu Ser435 440 445Lys Thr Ile Asn Gly Ser Gly Gin Asn Gin Gin Thr Leu Lys Phe Ser450 455 460Vai Ala Gly Pro Ser Asn Met Ala Vai Gin Gly Arg Asn Tyr Ile Pro465 470 475 480Gly Pro Ser Tyr Arg Gin Gin Arg Vai Ser Thr Thr Vai Thr Gin Asn485 490 495Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn500 505 510Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys515 520 525Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu He Phe Gly530 535 540Lys Gin Gly Thr Gly Arg Asp Asn Vai Asp Ala Asp Lys Vai Met He 545 550 555 560Thr Asn Glu Glu Glu He Lys Thr Thr Asn Pro Vai Ala Thr Glu Ser565 570 575Tyr Gly Gin Vai Ala Thr Asn His Gin Ser Ala Gin Ala Ala Ala Lys580 585 590Gly Gly Gly Phe His Gly Ala Ser Ala Gin Ala Gin Thr Gly Trp Vai595 600 605Gin Asn Gin Gly lie Leu Pro Gly Met Vai Trp Gin Asp Arg Asp Vai610 615 620Tyr Leu Gin Gly Pro He Trp Ala Lys He Pro His Thr Asp Gly Asn625 630 635 640Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met Lys His Pro Pro645 650 655Pro Gin He Leu He Lys Asn Thr Pro Vai Pro Ala Asp Pro Pro Thr660 665 670Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe He Thr Gin Tyr Ser Thr675 680 685Gly Gin Vai Ser Vai Glu He Glu Trp Glu Leu Gin Lys Glu Asn Ser690 695 700Lys Arg Trp Asn Pro Glu He Gin Tyr Thr Ser Asn Tyr Tyr Lys Ser705 710 715 720Asn Asn Vai Glu Phe Ala Vai Asn Thr Glu Gly Vai Tyr Ser Glu Pro725 730 735Arg Pro He Gly Thr Arg Tyr Leu Thr Arg Asn Leu ( SEQ ID NO : 102 )740 745Homo sapiens huntingtin (UTT). transcript variant 1, mRNA NCBI Reference Sequence: NM 001388492.11 gctgccggga cgggtccaag atggacggcc gctcaggttc tgcttttacc tgcggcccag61 agccccattc attgccccgg tgctgagcgg cgccgcgagt cggcccgagg cctccgggga121 ctgccgtgcc gggcgggaga ccgccatggc gaccctggaa aagctgatga aggccttcga181 gtccctcaag tccttccagc agcagcagca gcagcagcag cagcagcagc agcagcagca241 gcagcagcag cagcaacagc cgccaccgcc gccgccgccg ccgccgcctc ctcagcttcc301 tcagccgccg ccgcaggcac agccgctgct gcctcagccg cagccgcccc cgccgccgcc361 cccgccgcca cccggcccgg ctgtggctga ggagccgctg caccgaccaa agaaagaact421 ttcagctacc aagaaagacc gtgtgaatca ttgtctgaca atatgtgaaa acatagtggc481 acagtctgtc agaaattctc cagaatttca gaaacttctg ggcatcgcta tggaactttt541 tctgctgtgc agtgatgacg cagagtcaga tgtcaggatg gtggctgacg aatgcctcaa601 caaagttatc aaagctttga tggattctaa tcttccaagg ttacagctcg agctctataa661 ggaaattaaa aagaatggtg cccctcggag tttgcgtgct gccctgtgga ggtttgctga721 gctggctcac ctggttcggc ctcagaaatg caggccttac ctggtgaacc ttctgccgtg781 cctgactcga acaagcaaga gacccgaaga atcagtccag gagaccttgg ctgcagctgt841 tcccaaaatt atggcttctt ttggcaattt tgcaaatgac aatgaaatta aggttttgtt901 aaaggccttc atagcgaacc tgaagtcaag ctcccccacc attcggcgga cagcggctgg961 atcagcagtg agcatctgcc agcactcaag aaggacacaa tatttctata gttggctact1021 aaatgtgctc ttaggcttac tcgttcctgt cgaggatgaa cactccactc tgctgattct1081 tggcgtgctg ctcaccctga ggtatttggt gcccttgctg cagcagcagg tcaaggacac1141 aagcctgaaa ggcagcttcg gagtgacaag gaaagaaatg gaagtctctc cttctgcaga1201 gcagcttgtc caggtttatg aactgacgtt acatcataca cagcaccaag accacaatgt1261 tgtgaccgga gccctggagc tgttgcagca gctcttcaga acgcctccac ccgagcttct1321 gcaaaccctg accgcagtcg ggggcattgg gcagctcacc gctgctaagg aggagtctgg1381 tggccgaagc cgtagtggga gtattgtgga acttatagct ggagggggtt cctcatgcag1441 ccctgtcctt tcaagaaaac aaaaaggcaa agtgctctta ggagaagaag aagccttgga1501 ggatgactct gaatcgagat cggatgtcag cagctctgcc ttaacagcct cagtgaagga1561 tgagatcagt ggagagctgg ctgcttcttc aggggtttcc actccagggt cagcaggtca1621 tgacatcatc acagaacagc cacggtcaca gcacacactg caggcggact cagtggatct1681 ggccagctgt gacttgacaa gctctgccac tgatggggat gaggaggata tcttgagcca1741 cagctccagc caggtcagcg ccgtcccatc tgaccctgcc atggacctga atgatgggac1801 ccaggcctcg tcgcccatca gcgacagctc ccagaccacc accgaagggc ctgattcagc1861 tgttacccct tcagacagtt ctgaaattgt gttagacggt accgacaacc agtatttggg1921 cctgcagatt ggacagcccc aggatgaaga tgaggaagcc acaggtattc ttcctgatga1981 agcctcggag gccttcagga actcttccat ggcccttcaa caggcacatt tattgaaaaa2041 catgagtcac tgcaggcagc cttctgacag cagtgttgat aaatttgtgt tgagagatga2101 agctactgaa ccgggtgatc aagaaaacaa gccttgccgc atcaaaggtg acattggaca2161 gtccactgat gatgactctg cacctcttgt ccattgtgtc cgccttttat ctgcttcgtt2221 tttgctaaca gggggaaaaa atgtgctggt tccggacagg gatgtgaggg tcagcgtgaa2281 ggccctggcc ctcagctgtg tgggagcagc tgtggccctc cacccggaat ctttcttcag2341 caaactctat aaagttcctc ttgacaccac ggaataccct gaggaacagt atgtctcaga2401 catcttgaac tacatcgatc atggagaccc acaggttcga ggagccactg ccattctctg2461 tgggaccctc atctgctcca tcctcagcag gtcccgcttc cacgtgggag attggatggg2521 caccattaga accctcacag gaaatacatt ttctttggcg gattgcattc ctttgctgcg2581 gaaaacactg aaggatgagt cttctgttac ttgcaagtta gcttgtacag ctgtgaggaa2641 ctgtgtcatg agtctctgca gcagcagcta cagtgagtta ggactgcagc tgatcatcga2701 tgtgctgact ctgaggaaca gttcctattg gctggtgagg acagagcttc tggaaaccct2761 tgcagagatt gacttcaggc tggtgagctt tttggaggca aaagcagaaa acttacacag2821 aggggctcat cattatacag ggcttttaaa actgcaagaa cgagtgctca ataatgttgt2881 catccatttg cttggagatg aagaccccag ggtgcgacat gttgccgcag catcactaat2941 taggcttgtc ccaaagctgt tttataaatg tgaccaagga caagctgatc cagtagtggc3001 cgtggcaaga gatcaaagca gtgtttacct gaaacttctc atgcatgaga cgcagcctcc3061 atctcatttc tccgtcagca caataaccag aatatataga ggctataacc tactaccaag3121 cataacagac gtcactatgg aaaataacct ttcaagagtt attgcagcag tttctcatga3181 actaatcaca tcaaccacca gagcactcac atttggatgc tgtgaagctt tgtgtcttct3241 ttccactgcc ttcccagttt gcatttggag tttaggttgg cactgtggag tgcctccact3301 gagtgcctca gatgagtcta ggaagagctg taccgttggg atggccacaa tgattctgac3361 cctgctctcg tcagcttggt tcccattgga tctctcagcc catcaagatg ctttgatttt3421 ggccggaaac ttgcttgcag ccagtgctcc caaatctctg agaagttcat gggcctctga3481 agaagaagcc aacccagcag ccaccaagca agaggaggtc tggccagccc tgggggaccg3541 ggccctggtg cccatggtgg agcagctctt ctctcacctg ctgaaggtga ttaacatttg3601 tgcccacgtc ctggatgacg tggctcctgg acccgcaata aaggcagcct tgccttctct3661 aacaaacccc ccttctctaa gtcccatccg acgaaagggg aaggagaaag aaccaggaga3721 acaagcatct gtaccgttga gtcccaagaa aggcagtgag gccagtgcag cttctagaca3781 atctgatacc tcaggtcctg ttacaacaag taaatcctca tcactgggga gtttctatca3841 tcttccttca tacctcaaac tgcatgatgt cctgaaagct acacacgcta actacaaggt3901 cacgctggat cttcagaaca gcacggaaaa gtttggaggg tttctccgct cagccttgga3961 tgttctttct cagatactag agctggccac actgcaggac attgggaagt gtgttgaaga4021 gatcctagga tacctgaaat cctgctttag tcgagaacca atgatggcaa ctgtttgtgt4081 tcaacaattg ttgaagactc tctttggcac aaacttggcc tcccagtttg atggcttatc4141 ttccaacccc agcaagtcac aaggccgagc acagcgcctt ggctcctcca gtgtgaggcc4201 aggcttgtac cactactgct tcatggcccc gtacacccac ttcacccagg ccctcgctga4261 cgccagcctg aggaacatgg tgcaggcgga gcaggagaac gacacctcgg gatggtttga4321 tgtcctccag aaagtgtcta cccagttgaa gacaaacctc acgagtgtca caaagaaccg4381 tgcagataag aatgctattc ataatcacat tcgtttgttt gaacctcttg ttataaaagc4441 tttaaaacag tacacgacta caacatgtgt gcagttacag aagcaggttt tagatttgct4501 ggcgcagctg gttcagttac gggttaatta ctgtcttctg gattcagatc aggtgtttat4561 tggctttgta ttgaaacagt ttgaatacat tgaagtgggc cagttcaggg aatcagaggc4621 aatcattcca aacatctttt tcttcttggt attactatct tatgaacgct atcattcaaa4681 acagatcatt ggaattccta aaatcattca gctctgtgat ggcatcatgg ccagtggaag4741 gaaggctgtg acacatgcca taccggctct gcagcccata gtccacgacc tctttgtatt4801 aagaggaaca aataaagctg atgcaggaaa agagcttgaa acccaaaaag aggtggtggt4861 gtcaatgtta ctgagactca tccagtacca tcaggtgttg gagatgttca ttcttgtcct4921 gcagcagtgc cacaaggaga atgaagacaa gtggaagcga ctgtctcgac agatagctga4981 catcatcctc ccaatgttag ccaaacagca gatgcacatt gactctcatg aagcccttgg5041 agtgttaaat acattatttg agattttggc cccttcctcc ctccgtccgg tagacatgct5101 tttacggagt atgttcgtca ctccaaacac aatggcgtcc gtgagcactg ttcaactgtg5161 gatatcggga attctggcca ttttgagggt tctgatttcc cagtcaactg aagatattgt5221 tctttctcgt attcaggagc tctccttctc tccgtattta atctcctgta cagtaattaa5281 taggttaaga gatggggaca gtacttcaac gctagaagaa cacagtgaag ggaaacaaat5341 aaagaatttg ccagaagaaa cattttcaag gtttctatta caactggttg gtattctttt5401 agaagacatt gttacaaaac agctgaaggt ggaaatgagt gagcagcaac atactttcta5461 ttgccaggaa ctaggcacac tgctaatgtg tctgatccac atcttcaagt ctggaatgtt5521 ccggagaatc acagcagctg ccactaggct gttccgcagt gatggctgtg gcggcagttt5581 ctacaccctg gacagcttga acttgcgggc tcgttccatg atcaccaccc acccggccct5641 ggtgctgctc tggtgtcaga tactgctgct tgtcaaccac accgactacc gctggtgggc5701 agaagtgcag cagaccccga aaagacacag tctgtccagc acaaagttac ttagtcccca5761 gatgtctgga gaagaggagg attctgactt ggcagccaaa cttggaatgt gcaatagaga5821 aatagtacga agaggggctc tcattctctt ctgtgattat gtctgtcaga acctccatga5881 ctccgagcac ttaacgtggc tcattgtaaa tcacattcaa gatctgatca gcctttccca5941 cgagcctcca gtacaggact tcatcagtgc cgttcatcgg aactctgctg ccagcggcct6001 gttcatccag gcaattcagt ctcgttgtga aaacctttca actccaacca tgctgaagaa6061 aactcttcag tgcttggagg ggatccatct cagccagtcg ggagctgtgc tcacgctgta6121 tgtggacagg cttctgtgca cccctttccg tgtgctggct cgcatggtcg acatccttgc6181 ttgtcgccgg gtagaaatgc ttctggctgc aaatttacag agcagcatgg cccagttgcc6241 aatggaagaa ctcaacagaa tccaggaata ccttcagagc agcgggctcg ctcagagaca6301 ccaaaggctc tattccctgc tggacaggtt tcgtctctcc accatgcaag actcacttag6361 tccctctcct ccagtctctt cccacccgct ggacggggat gggcacgtgt cactggaaac6421 agtgagtccg gacaaagact ggtacgttca tcttgtcaaa tcccagtgtt ggaccaggtc6481 agattctgca ctgctggaag gtgcagagct ggtgaatcgg attcctgctg aagatatgaa6541 tgccttcatg atgaactcgg agttcaacct aagcctgcta gctccatgct taagcctagg6601 gatgagtgaa atttctggtg gccagaagag tgcccttttt gaagcagccc gtgaggtgac 6661 tctggcccgt gtgagcggca ccgtgcagca gctccctgct gtccatcatg tcttccagcc 6721 cgagctgcct gcagagccgg cggcctactg gagcaagttg aatgatctgt ttggggatgc 6781 tgcactgtat cagtccctgc ccactctggc ccgggccctg gcacagtacc tggtggtggt 6841 ctccaaactg cccagtcatt tgcaccttcc tcctgagaaa gagaaggaca ttgtgaaatt 6901 cgtggtggca acccttgagg ccctgtcctg gcatttgatc catgagcaga tcccgctgag 6961 tctggatctc caggcagggc tggactgctg ctgcctggcc ctgcagctgc ctggcctctg 7021 gagcgtggtc tcctccacag agtttgtgac ccacgcctgc tccctcatct actgtgtgca 7081 cttcatcctg gaggccgttg cagtgcagcc tggagagcag cttcttagtc cagaaagaag7141 gacaaatacc ccaaaagcca tcagcgagga ggaggaggaa gtagatccaa acacacagaa7201 tcctaagtat atcactgcag cctgtgagat ggtggcagaa atggtggagt ctctgcagtc7261 ggtgttggcc ttgggtcata aaaggaatag cggcgtgccg gcgtttctca cgccattgct7321 aaggaacatc atcatcagcc tggcccgcct gccccttgtc aacagctaca cacgtgtgcc7381 cccactggtg tggaagcttg gatggtcacc caaaccggga ggggattttg gcacagcatt7441 ccctgagatc cccgtggagt tcctccagga aaaggaagtc tttaaggagt tcatctaccg7501 catcaacaca ctaggctgga ccagtcgtac tcagtttgaa gaaacttggg ccaccctcct7561 tggtgtcctg gtgacgcagc ccctcgtgat ggagcaggag gagagcccac cagaagaaga7621 cacagagagg acccagatca acgtcctggc cgtgcaggcc atcacctcac tggtgctcag7681 tgcaatgact gtgcctgtgg ccggcaaccc agctgtaagc tgcttggagc agcagccccg7741 gaacaagcct ctgaaagctc tcgacaccag gtttgggagg aagctgagca ttatcagagg7801 gattgtggag caagagattc aagcaatggt ttcaaagaga gagaatattg ccacccatca7861 tttatatcag gcatgggatc ctgtcccttc tctgtctccg gctactacag gtgccctcat7921 cagccacgag aagctgctgc tacagatcaa ccccgagcgg gagctgggga gcatgagcta7981 caaactcggc caggtgtcca tacactccgt gtggctgggg aacagcatca cacccctgag8041 ggaggaggaa tgggacgagg aagaggagga ggaggccgac gcccctgcac cttcgtcacc8101 acccacgtct ccagtcaact ccaggaaaca ccgggctgga gttgacatcc actcctgttc8161 gcagtttttg cttgagttgt acagccgctg gatcctgccg tccagctcag ccaggaggac8221 cccggccatc ctgatcagtg aggtggtcag atcccttcta gtggtctcag acttgttcac8281 cgagcgcaac cagtttgagc tgatgtatgt gacgctgaca gaactgcgaa gggtgcaccc8341 ttcagaagac gagatcctcg ctcagtacct ggtgcctgcc acctgcaagg cagctgccgt8401 ccttgggatg gacaaggccg tggcggagcc tgtcagccgc ctgctggaga gcacgctcag8461 gagcagccac ctgcccagca gggttggagc cctgcacggc gtcctctatg tgctggagtg8521 cgacctgctg gacgacactg ccaagcagct catcccggtc atcagcgact atctcctctc8581 caacctgaaa gggatcgccc actgcgtgaa cattcacagc cagcagcacg tactggtcat8641 gtgtgccact gcgttttacc tcattgagaa ctatcctctg gacgtagggc cggaattttc8701 agcatcaata atacagatgt gtggggtgat gctgtctgga agtgaggagt ccaccccctc8761 catcatttac cactgtgccc tcagaggcct ggagcgcctc ctgctctctg agcagctctc8821 ccgcctggat gcagaatcgc tggtcaagct gagtgtggac agagtgaacg tgcacagccc8881 gcaccgggcc atggcggctc tgggcctgat gctcacctgc atgtacacag gaaaggagaa8941 agtcagtccg ggtagaactt cagaccctaa tcctgcagcc cccgacagcg agtcagtgat9001 tgttgctatg gagcgggtat ctgttctttt tgataggatc aggaaaggct ttccttgtga9061 agccagagtg gtggccagga tcctgcccca gtttctagac gacttcttcc caccccagga9121 catcatgaac aaagtcatcg gagagtttct gtccaaccag cagccatacc cccagttcat9181 ggccaccgtg gtgtataagg tgtttcagac tctgcacagc accgggcagt cgtccatggt9241 ccgggactgg gtcatgctgt ccctctccaa cttcacgcag agggccccgg tcgccatggc9301 cacgtggagc ctctcctgct tctttgtcag cgcgtccacc agcccgtggg tcgcggcgat9361 cctcccacat gtcatcagca ggatgggcaa gctggagcag gtggacgtga accttttctg9421 cctggtcgcc acagacttct acagacacca gatagaggag gagctcgacc gcagggcctt9481 ccagtctgtg cttgaggtgg ttgcagcccc aggaagccca tatcaccggc tgctgacttg9541 tttacgaaat gtccacaagg tcaccacctg ctgagcgcca tggtgggaga gactgtgagg9601 cggcagctgg ggccggagcc tttggaagtc tgcgcccttg tgccctgcct ccaccgagcc9661 agcttggtcc ctatgggctt ccgcacatgc cgcgggcggc caggcaacgt gcgtgtctct9721 gccatgtggc agaagtgctc tttgtggcag tggccaggca gggagtgtct gcagtcctgg9781 tggggctgag cctgaggcct tccagaaagc aggagcagct gtgctgcacc ccatgtgggt9841 gaccaggtcc tttctcctga tagtcacctg ctggttgttg ccaggttgca gctgctcttg9901 catctgggcc agaagtcctc cctcctgcag gctggctgtt ggcccctctg ctgtcctgca9961 gtagaaggtg ccgtgagcag gctttgggaa cactggcctg ggtctccctg gtggggtgtg10021 catgccacgc cccgtgtctg gatgcacaga tgccatggcc tgtgctgggc cagtggctgg10081 gggtgctaga cacccggcac cattctccct tctctctttt cttctcagga tttaaaattt10141 aattatatca gtaaagagat taattttaac gtaactcttt ctatgcccgt gtaaagtatg10201 tgaatcgcaa ggcctgtgct gcatgcgaca gcgtccgggg tggtggacag ggcccccggc10261 cacgctccct ctcctgtagc cactggcata gccctcctga gcacccgctg acatttccgt10321 tgtacatgtt cctgtttatg cattcacaag gtgactggga tgtagagagg cgttagtggg10381 caggtggcca cagcaggact gaggacaggc ccccattatc ctaggggtgc gctcacctgc10441 agcccctcct cctcgggcac agacgactgt cgttctccac ccaccagtca gggacagcag10501 cctccctgtc actcagctga gaaggccagc cctccctggc tgtgagcagc ctccactgtg10561 tccagagaca tgggcctccc actcctgttc cttgctagcc ctggggtggc gtctgcctag10621 gagctggctg gcaggtgttg ggacctgctg ctccatggat gcatgcccta agagtgtcac10681 tgagctgtgt tttgtctgag cctctctcgg tcaacagcaa agcttggtgt cttggcactg10741 ttagtgacag agcccagcat cccttctgcc cccgttccag ctgacatctt gcacggtgac10801 cccttttagt caggagagtg cagatctgtg ctcatcggag actgccccac ggccctgtca10861 gagccgccac tcctatcccc aggccaggtc cctggaccag cctcctgttt gcaggcccag10921 aggagccaag tcattaaaat ggaagtggat tctggatggc cgggctgctg ctgatgtagg10981 agctggattt gggagctctg cttgccgact ggctgtgaga cgaggcaggg gctctgcttc11041 ctcagcccta gaggcgagcc aggcaaggtt ggcgactgtc atgtggcttg gtttggtcat11101 gcccgtcgat gttttgggta ttgaatgtgg taagtggagg aaatgttgga actctgtgca11161 ggtgctgcct tgagaccccc aagcttccac ctgtccctct cctatgtggc agctggggag11221 cagctgagat gtggacttgt atgctgccca catacgtgag ggggagctga aagggagccc11281 ctcctctgag cagcctctgc caggcctgta tgaggctttt cccaccagct cccaacagag11341 gcctccccca gccaggacca cctcgtcctc gtggcggggc agcaggagcg gtagaaaggg11401 gtccgatgtt tgaggaggcc cttaagggaa gctactgaat tataacacgt aagaaaatca11461 ccattccgta ttggttgggg gctcctgttt ctcatcctag ctttttcctg gaaagcccgc11521 tagaaggttt gggaacgagg ggaaagttct cagaactgtt ggctgctccc cacccgcctc11581 ccgcctcccc cgcaggttat gtcagcagct ctgagacagc agtatcacag gccagatgtt11641 gttcctggct agatgtttac atttgtaaga aataacactg tgaatgtaaa acagagccat11701 tcccttggaa tgcatatcgc tgggctcaac atagagtttg tcttcctctt gtttacgacg11761 tgatctaaac cagtccttag caaggggctc agaacacccc gctctggcag taggtgtccc11821 ccacccccaa agacctgcct gtgtgctccg gagatgaata tgagctcatt agtaaaaatg11881 acttcaccca cgcatataca taaagtatcc atgcatgtgc atatagacac atctataatt11941 ttacacacac acctctcaag acggagatgc atggcctcta agagtgcccg tgtcggttct12001 tcctggaagt tgactttcct tagacccgcc aggtcaagtt agccgcgtga cggacatcca12061 ggcgtgggac gtggtcaggg cagggctcat tcattgccca ctaggatccc actggcgaag12121 atggtctcca tatcagctct ctgcagaagg gaggaagact ttatcatgtt cctaaaaatc12181 tgtggcaagc acccatcgta ttatccaaat tttgttgcaa atgtgattaa tttggttgtc12241 aagttttggg ggtgggctgt ggggagattg cttttgtttt cctgctggta atatcgggaa12301 agattttaat gaaaccaggg tagaattgtt tggcaatgca ctgaagcgtg tttctttccc12361 aaaatgtgcc tcccttccgc tgcgggccca gctgagtcta tgtaggtgat gtttccagct12421 gccaagtgct ctttgttact gtccaccctc atttctgcca gcgcatgtgt cctttcaagg12481 ggaaaatgtg aagctgaacc ccctccagac acccagaatg tagcatctga gaaggccctg12541 tgccctaaag gacacccctc gcccccatct tcatggaggg ggtcatttca gagccctcgg12601 agccaatgaa cagctcctcc tcttggagct gagatgagcc ccacgtggag ctcgggacgg12661 atagtagaca gcaataactc ggtgtgtggc cgcctggcag gtggaacttc ctcccgttgc12721 ggggtggagt gaggttagtt ctgtgtgtct ggtgggtgga gtcaggcttc tcttgctacc12781 tgtgagcatc cttcccagca gacatcctca tcgggctttg tccctccccc gcttcctccc12841 tctgcgggga ggacccggga ccacagctgc tggccagggt agacttggag ctgtcctcca12901 gaggggtcac gtgtaggagt gagaagaagg aagatcttga gagctgctga gggaccttgg12961 agagctcagg atggctcaga cgaggacact cgcttgccgg gcctgggcct cctgggaagg13021 agggagctgc tcagaatgcc gcatgacaac tgaaggcaac ctggaaggtt caggggccgc13081 tcttccccca tgtgcctgtc acgctctggt gcagtcaaag gaacgccttc ccctcagttg13141 tttctaagag cagagtctcc cgctgcaatc tgggtggtaa ctgccagcct tggaggatcg13201 tggccaacgt ggacctgcct acggagggtg ggctctgacc caagtggggc ctccttgtcc13261 aggtctcact gctttgcacc gtggtcagag ggactgtcag ctgagcttga gctcccctgg13321 agccagcagg gctgtgatgg gcgagtcccg gagccccacc cagacctgaa tgcttctgag13381 agcaaaggga aggactgacg agagatgtat atttaatttt ttaactgctg caaacattgt13441 acatccaaat taaaggaaaa aaatggaaac ca ( SEQ ID NO : 103 )

Claims

CLAIMSWhat is claimed is:

1. An artificial miRNA comprising a first strand and a second strand, wherein(a) the first strand and second strand form a duplex;(b) the first strand comprises a guide region comprising a nucleotide sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37; and(c) the second strand comprises a non-guide region that comprises a nucleotide sequence that is partially complementary to the nucleotide sequence of the guide region.

2. An artificial miRNA comprising a first strand and a second strand, wherein(a) the first strand and second strand form a duplex;(b) the first strand comprises a guide region comprising a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37; and(c) the second strand comprises a non-guide region that comprises a nucleotide sequence that is partially complementary to the nucleotide sequence of the guide region.

3. The artificial miRNA of claim 1 or 2, wherein the guide region comprises(a) the sequence of SEQ ID NO: 1 and the non-guide region comprises the sequence of SEQ ID NO: 38;(b) the sequence of SEQ ID NO: 2 and the non-guide region comprises the sequence of SEQ ID NO: 39;(c) the sequence of SEQ ID NO: 3 and the non-guide region comprises the sequence of SEQ ID NO: 40;(d) the sequence of SEQ ID NO: 4 and the non-guide region comprises the sequence of SEQ ID NO: 41;(e) the sequence of SEQ ID NO: 5 and the non-guide region comprises the sequence of SEQ ID NO: 42;(f) the sequence of SEQ ID NO: 6 and the non-guide region comprises the sequence of SEQ ID NO: 43;(g) the sequence of SEQ ID NO: 7 and the non-guide region comprises the sequence of SEQ ID NO: 44;(h) the sequence of SEQ ID NO: 8 and the non-guide region comprises the sequence of SEQ ID NO: 45;(i) the sequence of SEQ ID NO: 9 and the non-guide region comprises the sequence of SEQ ID NO: 46;(j) the sequence of SEQ ID NO: 10 and the non-guide region comprises the sequence of SEQ ID NO: 47;(k) the sequence of SEQ ID NO: 11 and the non-guide region comprises the sequence of SEQ ID NO: 48;(l) the sequence of SEQ ID NO: 12 and the non-guide region comprises the sequence of SEQ ID NO: 49;(m) the sequence of SEQ ID NO: 13 and the non-guide region comprises the sequence of SEQ ID NO: 50;(n) the sequence of SEQ ID NO: 14 and the non-guide region comprises the sequence of SEQ ID NO: 51;(o) the sequence of SEQ ID NO: 15 and the non-guide region comprises the sequence of SEQ ID NO: 52;(p) the sequence of SEQ ID NO: 16 and the non-guide region comprises the sequence of SEQ ID NO: 53;(q) the sequence of SEQ ID NO: 17 and the non-guide region comprises the sequence of SEQ ID NO: 54;(r) the sequence of SEQ ID NO: 18 and the non-guide region comprises the sequence of SEQ ID NO: 55;(s) the sequence of SEQ ID NO: 19 and the non-guide region comprises the sequence of SEQ ID NO: 56;(t) the sequence of SEQ ID NO: 20 and the non-guide region comprises the sequence of SEQ ID NO: 57;(u) the sequence of SEQ ID NO: 21 and the non-guide region comprises the sequence of SEQ ID NO: 58;(v) the sequence of SEQ ID NO: 22 and the non-guide region comprises the sequence of SEQ ID NO: 59;(w) the sequence of SEQ ID NO: 23 and the non-guide region comprises the sequence of SEQ ID NO: 60;(x) the sequence of SEQ ID NO: 24 and the non-guide region comprises the sequence of SEQ ID NO: 61;(y) the sequence of SEQ ID NO: 25 and the non-guide region comprises the sequence of SEQ ID NO: 62;(z) the sequence of SEQ ID NO: 26 and the non-guide region comprises the sequence of SEQ ID NO: 63;(aa) the sequence of SEQ ID NO: 27 and the non-guide region comprises the sequence of SEQ ID NO: 64;(bb) the sequence of SEQ ID NO: 28 and the non-guide region comprises the sequence of SEQ ID NO: 65;(cc) the sequence of SEQ ID NO: 29 and the non-guide region comprises the sequence of SEQ ID NO: 66;(dd) the sequence of SEQ ID NO: 30 and the non-guide region comprises the sequence of SEQ ID NO: 67;(ee) the sequence of SEQ ID NO: 31 and the non-guide region comprises the sequence of SEQ ID NO: 68;(ff) the sequence of SEQ ID NO: 32 and the non-guide region comprises the sequence of SEQ ID NO: 69;(gg) the sequence of SEQ ID NO: 33 and the non-guide region comprises the sequence of SEQ ID NO: 70;(hh) the sequence of SEQ ID NO: 34 and the non-guide region comprises the sequence of SEQ ID NO: 71;(ii) the sequence of SEQ ID NO: 35 and the non-guide region comprises the sequence of SEQ ID NO: 72;(jj) the sequence of SEQ ID NO: 36 and the non-guide region comprises the sequence of SEQ ID NO: 73; or(kk) the sequence of SEQ ID NO: 37 and the non-guide region comprises the sequence of SEQ ID NO: 74.

4. The artificial miRNA of any one of claims 1-3, wherein the artificial miRNA targets HTT mRNA.

5. The artificial miRNA of claim 4, wherein binding of the guide region to the coding sequence of the HTT mRNA reduces expression of the protein HTT.

6. An expression construct comprising a nucleic acid encoding the artificial miRNA of any one of claims 1-5.

7. The expression construct of claim 6, wherein the nucleic acid encoding the miRNA is operably linked to a promoter.

8. The expression construct of claim 6 or claim 7, wherein the nucleic acid encoding the artificial miRNA is cloned into a miRNA scaffold, wherein transcription of the expression construct forms a stem-loop structure.

9. A vector comprising the expression construct of any one of claims 6-8.

10. The vector of claim 9, wherein the vector is a rAAV vector.

11. A viral particle comprising the vector of claim 10, wherein the viral particle is an AAV particle encapsidating the rAAV vector.

12. The viral particle of claim 11 , wherein the viral particle comprises a modified AAV9 or AAV2 capsid protein.

13. A method of treating or preventing HD in a patient in need thereof, comprising administering to the patient a composition comprising a miRNA comprising a guide strand that binds to a HTT mRNA and a passenger strand, wherein the guide strand comprises a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37.

14. A method of reducing HTT expression in a patient suffering from HD, comprising administering to the patient a composition comprising a miRNA comprising a guide strand that binds to a HTT mRNA and a passenger strand, wherein the guide strand comprises a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37.

Images