Peptoid compound and peptoid-lipid conjugate, and use thereof

Abstract

Disclosed herein are a peptoid compound and a peptoid conjugate such as a peptoid-lipid conjugate, and preparation methods therefor and the use thereof in a small molecule drug and nucleic acid delivery. Further disclosed herein are a lipid particle containing the peptoid-lipid conjugate, such as a liposome and a lipid nanoparticle, and a small molecule drug and / or a nucleic acid delivery composition containing the peptoid-lipid conjugate or the lipid particle. The peptoid-lipid conjugate, lipid particle, and small molecule drug and / or nucleic acid delivery composition that can be used for the small molecule drug and nucleic acid delivery of the present invention enable highly efficient compounding, protection, intracellular and targeted delivery and release of the small molecule drug and biomolecules, such as nucleic acids, in tissues and organs both in vitro and in vivo.

Description

Peptoid compounds and peptoid-lipid conjugates and uses thereof

[0001] This application claims priority to Chinese patent application No. 2024101755708, filed on February 7, 2024, entitled “Peptoid compounds and peptide-lipid conjugates and their uses,” which is hereby incorporated by reference in its entirety. Technical Field

[0002] The present disclosure belongs to the field of drug loading and delivery, and specifically relates to peptoid compounds and peptoid-lipid conjugates, as well as their preparation methods and uses in drug loading and delivery, wherein the drug is, for example, a small molecule drug or a nucleic acid. Among them, nucleic acid drugs include but are not limited to mRNA, circRNA, siRNA, microRNA, gRNA, ASO, tRNA, etc. The present disclosure also relates to lipid compositions comprising the peptoid-lipid conjugate, such as liposomes, lipid nanoparticles, and drug delivery compositions comprising the peptoid-lipid conjugate or the lipid composition. It also relates to aerosolized inhalation microparticles formed by atomizing a solution of the lipid composition of the present disclosure. Background Art

[0003] Nucleic acid delivery technology, especially LNP-mRNA vaccine technology, has played an important role in combating the SARS-Cov-2 pandemic. Nucleic acid molecules are a type of naturally negatively charged molecules that have difficulty passing through the same negatively charged cell membrane to exert biological effects. Moreover, naked nucleic acid molecules are easily degraded by the widely existing nucleases in the body. Therefore, a delivery carrier called lipid nanoparticles (LNPs) has been applied to the development of new crown vaccine mRNA to achieve the packaging and in vivo delivery of mRNA molecules. In the classic LNP formulation, the low molar content of polyethylene glycol (PEG) liposomes can play a role in stabilizing and dispersing nanoparticles and preventing LNP from aggregating during manufacturing, storage and transportation. Generally speaking, PEG is considered to be a substance with low immunogenicity, which means that it rarely triggers a response from the immune system. However, some studies in recent years have shown that humans may have an immune response to PEG and produce some side effects in some people. With the use of new crown mRNA vaccines worldwide, anti-PEG antibodies in blood samples of the population have also shown a vaccine-related increase (ACS Nano, 16(8), 11769). The presence of PEG antibodies may accelerate the clearance of PEG-containing drugs from the body, and may also cause allergic reactions to PEG in a small number of people. Therefore, finding new materials to replace PEG in drug development can avoid potential safety risks associated with PEG.

[0004] Zwitterionic materials are electrically neutral substances composed of balanced positive and negative charges. In recent years, numerous research papers have demonstrated the potential of zwitterionic polymers as alternatives to PEG in applications such as protein and lipid modification. Common zwitterionic polymers are typically prepared through free radical polymerization of double-bonded monomers. These monomers primarily include acrylates (amides), methacrylates (amides), and vinyl monomers. The resulting polymer backbones lack conventionally biodegradable groups. Zwitterionic materials possess strong water-binding capacity and poor solubility in common aprotic solvents. This makes the direct ring-opening polymerization of zwitterionic monomers in aprotic solvents to produce polyester and polyamide zwitterionic polymers extremely challenging. In the few instances in which researchers have attempted to prepare degradable zwitterionic polymers, post-modification approaches have been employed. This process typically involves first obtaining a polymer with a degradable backbone structure and then chemically linking a small molecule containing a zwitterionic structure to the polymer. The defects of this method are obvious. First, the post-modification method has the problem of difficult-to-control modification of zwitterionic groups, resulting in the final product containing a variety of polymer molecules with different degrees of zwitterionic group modification, further increasing the difficulty of separation and purification of such products, and even in many cases, they cannot be purified; secondly, in order to improve the efficiency of the post-modification reaction, it is often necessary to adopt efficient chemical reactions similar to "click chemistry". This approach requires the introduction of additional reactive groups (such as thiol and unsaturated hydrocarbons, azide groups and alkynes, etc.) on the polymer backbone and zwitterionic groups, which ultimately reduces the atomic ratio of zwitterionic groups in the final polymer. It is foreseeable that the increase in the proportion of non-zwitterionic groups will ultimately affect the physical and chemical properties of the polymer, such as the water solubility of the polymer, the molecular conformation of the polymer in water, the immunogenicity of the polymer, etc. Summary of the Invention

[0005] In order to solve the above problems, the purpose of the present invention is to provide a variety of peptoid compounds and peptoid-lipid conjugates, as well as their preparation methods and uses in drug loading and delivery. Compared with polymers, polypeptides and peptoids synthesized by solid phase chemistry can accurately control the length of the sequence and the structure of each unit, and also have a biodegradable main chain structure. It should be noted that in the usual LNP formulation, the molecular weight of PEG contained in the PEG lipid is 2000Da, which falls within the applicable synthesis range of solid phase synthesis polypeptides / peptoids (small molecule short peptides to medium weight peptides (less than 100 peptides)).

[0006] When appearing in the chemical formulae of the present disclosure, unless otherwise noted, generally, "*" independently represents a terminal group or a position where the group is connected to other parts of the molecule of the compound of the formula.

[0007] According to one aspect of the present disclosure, there is provided a peptoid compound, or a stereoisomer or a pharmaceutically acceptable salt thereof, comprising one or more structural units M of formula (I) a ,

[0008] in,

[0009] Group A is absent or substituted with R 3 -CH-;

[0010] When each appears, each R 1 、R 2 and R 3 are each independently selected from hydrogen, C 1-6 Alkyl or group B;

[0011] Group B has the structure shown in the following formula:

[0012] wherein l and m are each independently an integer selected from 1-6;

[0013] R 4 、R 5 、R 6 、R 7 and R 8 are each independently selected from hydrogen and C 1-6 alkyl;

[0014] R 9 、R 9’ 、R 10 and R 10’ are each independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 1-6 alkoxy;

[0015] The group Q is selected from -CO2 － 、-SO2 － 、-SO3 － 、-OSO2 － 、-SO4 － 、-P(O)(OR P )O － AND-OP(O)(OR P )O － The group consisting of R P Selected from hydrogen and C 1-6 alkyl;

[0016] When multiple structural units M are included a When the plurality of structural units M a are the same or different, each structural unit M aindependently having the structure represented by formula (I),

[0017] In this peptide compound, at least one structural unit M a including a group B, wherein the group B is R 1 、R 2 and R 3 Any one of

[0018] When the peptoid compound includes a plurality of groups B, the plurality of groups B are the same or different.

[0019] In some embodiments, the two terminal groups of the peptoid compound are independently selected from hydrogen, C 1-6 Hydrocarbon, C 1-6 Halogenated hydrocarbon, C 1-6 Hydroxyl, C 1-6 Alkyl, -C(O)-C 1-6 A group consisting of alkylene -COOH, OH, NH2, SH, N3, group B, and a linker containing one or more double bonds or triple bonds, wherein the linker containing one or more double bonds or triple bonds can be coupled with peptides, proteins, nucleic acids, carbohydrates, small molecule drugs, etc.

[0020] In some embodiments, the present disclosure provides a peptoid compound, or a stereoisomer or pharmaceutically acceptable salt thereof, having a structure represented by formula (II):

[0021] in:

[0022] R a Selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 Alkyl, C 1-6 Alkanoyl such as C 1-4 Alkanoyl, -C(O)-C 1-6 Alkylene-COOH such as -C(O)-C 1-4 a group consisting of alkylene -COOH;

[0023] R b Selected from the group consisting of OH, NH2, group B;

[0024] i is an integer selected from 2-100, preferably selected from 2-80, more preferably selected from 2-60, even more preferably selected from 2-40, most preferably selected from 2-20;

[0025] The peptidic compound comprises a plurality of structural units M of formula (I) a ,

[0026] Group A is absent or substituted with R 3-CH-;

[0027] When each appears, each R 1 、R 2 and R 3 are each independently selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 Alkyl or group B;

[0028] Group B has the structure shown in the following formula:

[0029] wherein l and m are each independently an integer selected from 1-6;

[0030] R 4 、R 5 、R 6 、R 7 and R 8 are each independently selected from hydrogen and C 1-6 Alkyl groups such as C 1-4 alkyl;

[0031] R 9 、R 9’ 、R 10 and R 10’ are each independently selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 Alkyl, C 1-6 Haloalkyl such as C 1-4 Halogenated alkyl, C 1-6 Alkoxy groups such as C 1-4 alkoxy;

[0032] The group Q is selected from -CO2 － 、-SO2 － 、-SO3 － 、-OSO2 － 、-SO4 － 、-P(O)(OR P )O － AND-OP(O)(OR P )O － The group consisting of R P Selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 alkyl;

[0033] The plurality of structural units M a are the same or different, each structural unit M a independently having the structure represented by formula (I),

[0034] In this peptide compound, at least one structural unit M a including a group B, the group B being R1 、R 2 and R 3 Any one of

[0035] When the peptoid compound includes a plurality of groups B, the plurality of groups B are the same or different.

[0036] In some embodiments, in the peptoid compound, at least two structural units M a including a group B, each occurrence of which is independently R 1 、R 2 and R 3 Any one of; or all structural units M a including a group B, each occurrence of which is independently R 1 、R 2 and R 3 Any one of .

[0037] In some embodiments, the structural unit M a Has the following structure:

[0038] wherein m is an integer selected from 1 to 6, preferably m is 2 or 3;

[0039] l is an integer selected from 1-6, and preferably l is 1, 2 or 3.

[0040] According to another aspect of the present disclosure, there is provided a peptoid compound of formula (III), or a stereoisomer or a pharmaceutically acceptable salt thereof,

[0041] The peptidic compound comprises one or more structural units M of formula (I) a and one or more structural units M b ,

[0042] in:

[0043] R a Selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 Alkyl, C 1-6 Alkanoyl such as C 1-4 Alkanoyl, -C(O)-C 1-6 Alkylene-COOH such as -C(O)-C 1-4 a group consisting of alkylene -COOH;

[0044] R b Selected from the group consisting of OH, NH2, group B;

[0045] i is an integer selected from 2-100, preferably selected from 2-80, more preferably selected from 2-60, even more preferably selected from 2-40, most preferably selected from 2-20;

[0046] Group A is absent or substituted with R 3 -CH-;

[0047] When each appears, each R 1 、R 2 and R 3 are each independently selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 an alkyl group and a group B;

[0048] Group B has the structure shown in the following formula:

[0049] wherein l and m are each independently an integer selected from 1-6;

[0050] R 4 、R 5 、R 6 、R 7 and R 8 are each independently selected from hydrogen and C 1-6 alkyl;

[0051] R 9 、R 9’ 、R 10 and R 10’ are each independently selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 Alkyl, C 1-6 Haloalkyl such as C 1-4 Halogenated alkyl, C 1-6 Alkoxy groups such as C 1-4 alkoxy;

[0052] The group Q is selected from -CO2 － 、-SO2 － 、-SO3 － 、-OSO2 － 、-SO4 － 、-P(O)(OR P )O － AND-OP(O)(OR P )O － The group consisting of R P Selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 alkyl;

[0053] When multiple structural units M are included a When the plurality of structural units Ma are the same or different, each structural unit M a Each independently has the structure shown in formula (I),

[0054] In this peptide compound, at least one structural unit M a including a group B, wherein the group B is R 1 、R 2 and R 3 Any one of

[0055] When the peptoid compound includes multiple groups B, the multiple groups B are the same or different;

[0056] When each occurs, each structural unit M b Each is independently selected from an amino acid residue, preferably an α-amino acid residue, more preferably an α-amino acid residue having a neutral side chain, for example, an amino acid residue selected from the following group: alanine (Ala), glycine (Gly), proline (Pro), cysteine ​​(Cys), valine (Val) and sarcosine (Sar);

[0057] j is an integer selected from 1-100, preferably selected from 1-80; more preferably selected from 1-60; even more preferably selected from 1-40, most preferably selected from 1-20;

[0058] In this peptide compound, the structural unit M a and structural unit M b The linkages are random, block, alternating, or a combination thereof in any order.

[0059] In some embodiments, in the peptoid compound, at least two structural units M a including a group B, each occurrence of which is independently R 1 、R 2 and R 3 Any one of; or all structural units M a including a group B, each occurrence of which is independently R 1 、R 2 and R 3 Any one of .

[0060] In some embodiments, the structural unit M a Has the following structure:

[0061] wherein m is an integer selected from 1 to 6, preferably m is 2 or 3;

[0062] l is an integer selected from 1-6, and preferably l is 1, 2 or 3.

[0063] In some embodiments, the structural unit M a and structural unit M b Connect sequentially in alternating fashion.

[0064] In some embodiments, the structural unit M a and structural unit M b The peptide compounds are connected in an alternating manner so that the peptide compound comprises repeating structural units shown in the following structure:

[0065] wherein k is an integer selected from 2 to 50;

[0066] m is an integer selected from 1-6, preferably m is 2 or 3;

[0067] l is an integer selected from 1-6, and preferably l is 1, 2 or 3.

[0068] In some embodiments, the peptoid compound of formula (III) is selected from the following:

[0069] According to another aspect of the present disclosure, there is provided a compound of formula (IV), or a stereoisomer or a pharmaceutically acceptable salt thereof,

[0070] wherein l and m are each independently an integer selected from 1-6;

[0071] PG 1 is hydrogen, or an acid protecting group, preferably

[0072] PG 2 is hydrogen or an amino protecting group, preferably Fmoc.

[0073] According to another aspect of the present disclosure, there is provided a compound of formula (IV'), or a stereoisomer or a pharmaceutically acceptable salt thereof,

[0074] wherein l and m are each independently an integer selected from 1-6;

[0075] PG 1 is hydrogen, or an acid protecting group, preferably

[0076] PG 2 is hydrogen or an amino protecting group, preferably Fmoc.

[0077] According to another aspect of the present disclosure, a method for solid-phase preparation of a peptoid compound of formula (I) or a peptoid compound of formula (III) is provided, comprising the following steps:

[0078] (1) reacting the compound of formula (IV) or (IV′) or the amino acid derivative with a resin for solid phase synthesis to attach it to the resin;

[0079] (2) Optionally remove the amino protecting group PG 2 ;

[0080] (3) continuing the reaction to connect the next compound of formula (IV) or (IV') or amino acid derivative;

[0081] (4) optionally repeating steps (2) and (3) to extend the backbone length of the peptoid compound; and

[0082] (5) optionally performing terminal group modification, resin cleavage and / or deprotection to obtain a peptoid compound;

[0083] wherein the compound of formula (IV) or (IV') or the amino acid derivative in step (1) and each repeated step (3) are the same or different,

[0084] The amino acid derivative is an amino acid having an α-amino protecting group, whose side chain has or does not have a protecting group, the α-amino protecting group is preferably Fmoc, and the amino acid is preferably an α-amino acid, more preferably an α-amino acid with a neutral side chain, for example, an amino acid selected from the following group: alanine (Ala), glycine (Gly), proline (Pro), cysteine ​​(Cys), valine (Val) and sarcosine (Sar).

[0085] According to another aspect of the present disclosure, there is provided a primary amine compound of formula (V), or a stereoisomer or a pharmaceutically acceptable salt thereof,

[0086] NH2-B'-PG 3 (V)

[0087] Wherein, group B' has the structure shown in the following formula:

[0088] wherein l and m are each independently an integer selected from 1-6;

[0089] R 4 and R 5 are each independently selected from hydrogen and C 1-6 Alkyl groups such as C 1-4 alkyl;

[0090] R 9 、R9’ 、R 10 and R 10’ are each independently selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 Alkyl, C 1-6 Haloalkyl such as C 1-4 Halogenated alkyl, C 1-6 Alkoxy groups such as C 1-4 alkoxy;

[0091] The group Q is selected from -CH(OR Q )O-、-C(O)O-、-P(O)(OR P )O- and -OP(O)(OR P )O-, wherein R P Selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 Alkyl, R Q Selected from C 1-6 Alkyl groups such as C 1-4 Alkyl, Q is preferably -C(O)O-;

[0092] PG 3 It is hydrogen, C 1-6 Alkyl groups such as C 1-4 Alkyl, or acid protecting group, preferably

[0093] In some embodiments, the primary amine compound of formula (V) is selected from the following:

[0094] According to another aspect of the present disclosure, a method for solid-phase preparation of a peptoid compound of formula (I) or a peptoid compound of formula (III) is provided, comprising the following steps:

[0095] (1) reacting a halogenated acid with a resin for solid phase synthesis to link the halogenated acid to the resin; and subjecting a primary amine compound of formula (V) according to claim 16 or 17 to a substitution reaction with a halogen atom on the resin to link the primary amine compound of formula (V) according to claim 16 or 17 to the resin;

[0096] (2) condensing the α-amino protected amino acid through the amino group on the carboxyl resin;

[0097] (3) optionally repeating step (1) or (2) to extend the backbone length of the peptoid compound; and

[0098] (4) optionally performing terminal group modification, resin cleavage and / or deprotection to obtain a peptoid compound;

[0099] Wherein, the halogenated acid is preferably selected from bromoacetic acid, 2-bromopropionic acid, 1-bromopropionic acid, chloroacetic acid, 2-chloroacetic acid, 1-chloroacetic acid, iodoacetic acid,

[0100] The primary amine compound of formula (V) in each repeated step (1) and the amino acid derivative in step (2) are the same or different,

[0101] The α-amino protected amino acid, the amino protecting group is preferably Fmoc, the amino acid is preferably an α-amino acid, more preferably an α-amino acid with a neutral side chain, for example, an amino acid selected from the following group: alanine (Ala), glycine (Gly), proline (Pro), cysteine ​​(Cys), valine (Val) and sarcosine (Sar).

[0102] In some embodiments, the peptoid compounds disclosed herein can be obtained as crude products in the resin cleavage step of solid-phase synthesis, and then subjected to precipitation, desolvation, and further separation and purification by high-performance liquid chromatography.

[0103] In some embodiments, the method for preparing a peptoid compound disclosed herein further includes the step of isolating and purifying the peptoid compound. The peptoid compound disclosed herein can be prepared by selecting a specific solid-phase resin and subjecting the resin to weak acid cleavage to obtain an intermediate product with a side chain protected group. The intermediate product is then purified by precipitation and desolvation, and further purified by high-performance liquid chromatography, followed by cleavage of the protecting group to obtain a peptoid compound containing a zwitterion.

[0104] In some embodiments, the solid phase resin used in the methods of the present disclosure is a CTC resin.

[0105] Unprotected zwitterionic compounds have strong polarity and tend to elute quickly in reversed-phase high-performance liquid chromatography (HPLC retention time is often less than 3 minutes). Peptide intermediates with carboxyl protecting groups have stronger interactions with the hydrophobic groups of reversed-phase HPLC column packings, which can improve the purification effect of the target intermediate by extending the retention time, thereby improving the separation purity of the target product.

[0106] In some embodiments, the peptoid compound or peptoid-lipid conjugate of the present disclosure may be composed of an N-substituted monomer and a C-substituted monomer, wherein both the N-substituted monomer and the C-substituted monomer contain a group B. When used herein, the definition is based on α-amino acids. An N-substituted monomer refers to a monomer (peptoid) having a substituent on the amino group, such as a group B, and a C-substituted monomer refers to a monomer (amino acid polypeptide) having a substituent on the α-carbon, such as a group B. When there is no substituent on the amino group, it can also be referred to as an N-non-substituted monomer, and when there is no substituent on the α-carbon, it can also be referred to as a C-non-substituted monomer.

[0107] In some embodiments, the peptoid compound or peptoid-lipid conjugate of the present disclosure may be composed of an N-substituted monomer and a C-substituted monomer, wherein only the N-substituted monomer contains a B group.

[0108] In some embodiments, the peptoid compound or peptoid-lipid conjugate of the present disclosure may be composed of an N-substituted monomer and a C-substituted monomer, wherein only the C-substituted monomer contains a B group.

[0109] In some embodiments, the peptoid compound or peptoid-lipid conjugate of the present disclosure may be composed of N-substituted monomers and C-substituted monomers, wherein all N-substituted monomers contain group B and some C-substituted monomers contain group B.

[0110] In some embodiments, the peptoid compound or peptoid-lipid conjugate of the present disclosure may be composed of an N-substituted monomer and an amino acid monomer, wherein the N-substituted monomer comprises a group B, and the amino acid is preferably an α-amino acid, more preferably an α-amino acid with a neutral side chain, for example, an amino acid selected from the following group: alanine (Ala), glycine (Gly), proline (Pro), cysteine ​​(Cys), valine (Val) and sarcosine (Sar).

[0111] Compared to high-molecular-weight compounds obtained by monomer polymerization, polypeptides or peptoid compounds prepared by solid-phase organic synthesis have greater structural controllability. Peptides and peptoids obtained by solid-phase synthesis have a controllable number of structural units. Compared to peptoids or polypeptides obtained by polymerization, they are a class of substances with precise molecular weights. Compared to polypeptides, the hydrolysis and enzymatic degradation properties of the amide bonds of the main chain of peptoid compounds are greatly reduced after the N atoms of the amide bonds of the main chain are replaced by groups. Therefore, peptoid compounds often have longer biological stability than polypeptide compounds. Compared with polyolefins, the main chain structure of peptoid compounds can still be biodegraded through the oxidation of active oxygen free radicals. Therefore, peptoid compounds are still biodegradable molecules in the general sense, which also provides a safety basis for their application in the field of drug development.

[0112] In some embodiments, the peptoid compound or peptoid-lipid conjugate of the present disclosure may be composed of N-substituted monomers and N-non-substituted monomers, and the content of N-non-substituted monomers can regulate the biodegradability of the peptoid or peptoid lipid main chain structure. The biodegradability includes but is not limited to enzymatic degradation, hydrolysis, oxidative degradation, etc. Preferably, the N-non-substituted monomer is a combination of one or more of alanine (Ala), glycine (Gly), proline (Pro) and sarcosine (Sar); more preferably, the N-non-substituted monomer is one of alanine (Ala), glycine (Gly), proline (Pro) or sarcosine (Sar). The ratio of the N-substituted monomer to the N-non-substituted monomer is between 1 / 10 and 10 / 1, preferably, the ratio is between 5 / 6 and 10 / 1.

[0113] According to yet another aspect of the present disclosure, there is provided a peptoid-lipid conjugate having formula (VI), or a stereoisomer or a pharmaceutically acceptable salt thereof,

[0114] Lipid-L-peptide (VI)

[0115] wherein the peptoid portion is the peptoid compound disclosed herein or a stereoisomer or a pharmaceutically acceptable salt thereof,

[0116] L is absent or is a linker moiety selected from a substituted or unsubstituted linear aliphatic group or a substituted or unsubstituted linear heteroaliphatic group, optionally attached to either end of the peptoid portion, wherein the linear aliphatic group is C 1-16 Straight chain aliphatic groups, such as C 1-15 、C 1-14 、C 1-13 、C 1-12 、C 1-11 、C 1- 10 、C 1-9 、C 1-8 、C 1-7 、C 1-6 、C 1-5 、C 1-4 、C 1-3 or C 1-2 The straight-chain aliphatic group is a 1-16-membered straight-chain heteroaliphatic group, such as a 1-15-membered, 1-14-membered, 1-13-membered, 1-12-membered, 1-11-membered, 1-10-membered, 1-9-membered, 1-8-membered, 1-7-membered, 1-6-membered, 1-5-membered, 1-4-membered, 1-3-membered or 1-2-membered straight-chain aliphatic group.

[0117] In some embodiments, the L is attached to the carbon-terminal carbonyl (-C(O)-) of the peptoid portion;

[0118] The L is attached to the side group reactive site of the peptoid portion; or

[0119] Said L is a linker moiety having the formula (VII) which is linked to the nitrogen terminus of the peptoid moiety via an amide bond,

[0120] Among them, L a is substituted or unsubstituted C 1-12 An aliphatic group or a substituted or unsubstituted 1-12 membered heteroaliphatic group, optionally comprising at least one -CH2CH2O- group in the backbone of the substituted or unsubstituted 1-12 membered heteroaliphatic group.

[0121] In some embodiments, L a is substituted or unsubstituted C 1-12 Straight chain alkyl, such as C 1-10 、C 1-8 、C 1-6 or C 1-4 Straight chain alkyl; or

[0122] In some embodiments, L a is a substituted or unsubstituted 1-12 membered straight chain heteroaliphatic group, such as a 1-10 membered, 1-8 membered, 1-6 membered or 1-4 membered straight chain heteroaliphatic group, optionally including at least one -CH2CH2O- in its main chain.

[0123] In some embodiments, the linker moiety L is selected from the group consisting of:

[0124] wherein p is an integer selected from 1-12, such as 1-10, 1-8, 1-6, or 1-4;

[0125] q, r and s are each independently 0, or an integer selected from 1-10, such as 1-8, 1-6, 1-4, or 1-2.

[0126] In some embodiments, the lipid moiety has the structure of Formula (VIII):

[0127] in Indicates that it has structure A group C, wherein c1 is selected from 0 or 1, R C Selected from H, -C 1- 6 alkyl such as methyl, ethyl, propyl, butyl, pentyl or hexyl; -OC 1-6 Alkyl such as methoxy, ethoxy, propoxy, butoxy, pentyloxy or hexyloxy; and -N(R N1 R N2 ), R N1 and RN2 Each independently selected from H and -C 1-6 an alkyl group such as methyl, ethyl, propyl, butyl, pentyl or hexyl;

[0128] R L1 、R L2 、R L3 ...R Lm Each independently absent or selected from substituted or unsubstituted saturated or unsaturated C 6-30 For example, C 6-20 aliphatic groups and substituted or unsubstituted saturated or unsaturated 6-30 membered, for example 6-20 membered, heteroaliphatic groups, which are optionally substituted with one or more substituents selected from the group consisting of deuterium, halogen, oxo (=O), -NO2 and -OH,

[0129] m is an integer selected from 1-12, such as 1-10, 1-8, 1-6, or 1-4.

[0130] In some embodiments, the lipid moiety has the structure of Formula (VIIIa), (VIIIb), (VIIIc), or (VIIId):

[0131] Among them, R L1 and R L2 are each independently selected from substituted or unsubstituted saturated or unsaturated C 6-20 aliphatic groups and substituted or unsubstituted saturated or unsaturated 6-20 membered heteroaliphatic groups, the aliphatic groups and heteroaliphatic groups optionally substituted with one or more substituents selected from the group consisting of deuterium, halogen, oxo (=O), -NO2 and -OH,

[0132] n is selected from 0, or an integer selected from 1-10, such as 1-8, 1-6, 1-4, or 1-2.

[0133] In some embodiments, the lipid moiety is selected from the group consisting of:

[0134] In some embodiments, the peptoid-lipid conjugate of formula (VI) is selected from:

[0135] wherein m is an integer selected from 1 to 6, preferably m is 2 or 3;

[0136] l is an integer selected from 1-6, preferably l is 1, 2 or 3;

[0137] i is an integer selected from 2-100, preferably selected from 2-80, more preferably selected from 2-60, even more preferably selected from 2-40, most preferably selected from 2-20;

[0138] p is an integer selected from 1-12, such as 1-10, 1-8, 1-6, or 1-4.

[0139] In some embodiments, the peptoid-lipid conjugate of formula (VI) is selected from:

[0140] wherein m is an integer selected from 1 to 6, preferably m is 2 or 3;

[0141] l is an integer selected from 1-6, preferably l is 1, 2 or 3;

[0142] i is an integer selected from 2-100, preferably selected from 2-80, more preferably selected from 2-60, even more preferably selected from 2-40, most preferably selected from 2-20;

[0143] Each structural unit M b Each is independently selected from an amino acid residue, preferably an α-amino acid residue, more preferably an α-amino acid residue having a neutral side chain, for example, an amino acid residue selected from the following group: alanine (Ala), glycine (Gly), proline (Pro), cysteine ​​(Cys), valine (Val) and sarcosine (Sar);

[0144] j is an integer selected from 1-100, preferably selected from 1-80; more preferably selected from 1-60; even more preferably selected from 1-40, most preferably selected from 1-20;

[0145] The structural unit M a and structural unit M b connected in any order in random form, block form, alternating form, or a combination thereof;

[0146] p is an integer selected from 1-12, such as 1-10, 1-8, 1-6, or 1-4.

[0147] In some embodiments, the peptoid-lipid conjugate of formula (VI) is selected from:

[0148] According to yet another aspect of the present disclosure, there is provided the peptoid-lipid conjugate of the present disclosure, or a stereoisomer or a pharmaceutically acceptable salt thereof for use in preparing a lipid composition, such as a liposome or lipid nanoparticle.

[0149] According to yet another aspect of the present disclosure, provided is a use of the peptoid-lipid conjugate of the present disclosure, or a stereoisomer or a pharmaceutically acceptable salt thereof in preparing a lipid composition, such as a liposome or lipid nanoparticle.

[0150] According to yet another aspect of the present disclosure, a lipid composition is provided, comprising the peptoid-lipid conjugate of the present disclosure, or a stereoisomer or a pharmaceutically acceptable salt thereof.

[0151] In some embodiments, the peptoid-lipid conjugate accounts for about 0.1 mol% to about 60.0 mol%, preferably about 0.5% to about 20.0%, and preferably about 1.0% to about 10.0%, based on the total molar amount of the components constituting the lipid composition.

[0152] In some embodiments, the lipid composition is a liposome or a lipid nanoparticle (LNP).

[0153] In some embodiments, the lipid composition is a liposome, which further comprises a phospholipid and cholesterol or a cholesterol derivative. In some embodiments, the phospholipid includes but is not limited to DSPC, DOPC, DOPE, DPPC, DMPC or any mixture thereof.

[0154] In some embodiments, the phospholipid accounts for about 5.0 mol% to about 60.0 mol%, or a range of any value between about 5.0 mol% and about 60.0 mol%, based on the total molar amount of the components constituting the liposome.

[0155] In some embodiments, the cholesterol or cholesterol derivative accounts for about 20.0 mol% to about 60.0 mol%, or a range of any value between about 20.0 mol% and about 60.0 mol%, based on the total molar amount of the components constituting the liposome.

[0156] In some embodiments, the liposomes further comprise a small molecule drug.

[0157] In some embodiments, the lipid composition is a lipid nanoparticle, which further comprises a phospholipid and cholesterol or a cholesterol derivative. In some embodiments, the phospholipid includes but is not limited to DSPC, DOPC, DOPE, DPPC, DMPC or any mixture thereof.

[0158] In some embodiments, based on the total molar amount of the components constituting the lipid nanoparticles, the phospholipids account for about 0 mol% to about 20.0 mol%, or a range of any value between about 0 mol% and about 20.0 mol%, preferably, the phospholipids account for about 5.0 mol% to about 20.0 mol%, or a range of any value between about 5.0 mol% and about 20.0 mol%.

[0159] In some embodiments, based on the total molar amount of the components constituting the lipid nanoparticles, the cholesterol or cholesterol derivative accounts for about 10.0 mol% to about 60.0 mol%, or a range between any values ​​between about 10.0 mol% and about 60.0 mol%, preferably, the cholesterol or cholesterol derivative accounts for about 20.0 mol% to about 60.0 mol%, or a range between any values ​​between about 20.0 mol% and about 60.0 mol%.

[0160] In some embodiments, the lipid nanoparticles further comprise a cationic lipid, and based on the total molar amount of the components constituting the lipid nanoparticles, the cationic lipid accounts for about 10.0 mol% to about 90.0 mol%, or a range of any value between about 10.0 mol% and about 90.0 mol%, preferably, the cationic lipid accounts for about 20.0 mol% to about 65.0 mol%, or a range of any value between about 20.0 mol% and about 65.0 mol%.

[0161] In some embodiments, the lipid nanoparticle further comprises a polymer lipid, optionally the polymer lipid is a PEG lipid, optionally the polymer lipid comprises about 0 mol% to about 10.0 mol%, or a range of any value between about 0 mol% and about 10.0 mol%, based on the total molar amount of the components constituting the lipid nanoparticle.

[0162] In some embodiments, the lipid nanoparticle further comprises a nucleic acid, and the N / P ratio of the cationic lipid to the nucleic acid is about 1.1:1 to 10:1.

[0163] In some embodiments, the nucleic acid is RNA.

[0164] According to another aspect of the present disclosure, provided is the use of a lipid composition comprising the peptoid-lipid conjugate of the present disclosure, or a stereoisomer or a pharmaceutically acceptable salt thereof in the delivery of small molecule drugs or nucleic acids, optionally, the lipid composition is a liposome or a lipid nanoparticle.

[0165] In some embodiments, the small molecule drug or nucleic acid delivery includes delivering the small molecule drug or nucleic acid to cells in vitro, and delivering the small molecule drug or nucleic acid to a subject in vivo, including a human subject and an animal subject.

[0166] In some embodiments, the nucleic acid molecule encodes one or more antigens, or encodes one or more therapeutic proteins, or encodes a CRISPR-Cas gene editing system.

[0167] According to yet another aspect of the present disclosure, a liposome-based small molecule drug delivery system is provided, wherein the liposome comprises the peptoid-lipid conjugate of the present disclosure, or a stereoisomer or a pharmaceutically acceptable salt thereof.

[0168] According to yet another aspect of the present disclosure, a lipid nanoparticle-based nucleic acid delivery system is provided, wherein the lipid nanoparticle comprises the peptoid-lipid conjugate of the present disclosure, or a stereoisomer or a pharmaceutically acceptable salt thereof.

[0169] According to yet another aspect of the present disclosure, a pharmaceutical composition is provided, comprising the peptoid-lipid conjugate of the present disclosure, or a stereoisomer or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or excipient.

[0170] In some embodiments, the peptoid compound or peptoid-lipid conjugate accounts for about 0.1 mol% to about 60.0 mol%, preferably about 0.5% to about 20.0%, and preferably about 1.0% to about 10.0%, based on the total molar amount of the components constituting the pharmaceutical composition.

[0171] In some embodiments, the pharmaceutical composition further comprises a phospholipid and cholesterol or a cholesterol derivative, optionally, based on the total molar amount of the components constituting the pharmaceutical composition, the phospholipid accounts for about 0 mol% to about 20.0 mol%, or a range of any values ​​between about 0 mol% and about 20.0 mol%, or, optionally, based on the total molar amount of the components constituting the pharmaceutical composition, the cholesterol or cholesterol derivative accounts for about 10.0 mol% to about 60.0 mol%, or a range of any values ​​between about 10.0 mol% and about 60.0 mol%.

[0172] In some embodiments, the pharmaceutical composition further comprises a cationic lipid, preferably, the cationic lipid accounts for about 10.0 mol% to about 90.0 mol%, or a range of any value between about 10.0 mol% and about 90.0 mol%, based on the total molar amount of the components constituting the pharmaceutical composition.

[0173] In some embodiments, the pharmaceutical composition further comprises a polymer lipid, optionally the polymer lipid is a PEG lipid, optionally, the polymer lipid comprises about 0 mol% to about 10.0 mol%, or a range of any value between about 0 mol% and about 10.0 mol%, based on the total molar amount of the components constituting the lipid nanoparticle.

[0174] In some embodiments, the pharmaceutical composition further comprises a nucleic acid molecule and / or a small molecule drug. Preferably, the nucleic acid molecule is RNA.

[0175] In some embodiments, the pharmaceutical composition is a lipid nanoparticle, optionally a lipid nanoparticle that can be nebulized for inhalation, and optionally, after the lipid nanoparticle is nebulized by a nebulizer, the average particle size of the lipid nanoparticle does not increase by more than 100%, preferably does not increase by more than 30%; and / or the nucleic acid encapsulation efficiency of the lipid nanoparticle decreases by no more than 20%, preferably does not decrease by more than 5%.

[0176] In some embodiments, the lipid nanoparticles are atomized via a nebulization device, optionally selected from a vibrating mesh nebulizer, an ultrasonic nebulizer, a jet nebulizer, a soft mist inhaler, and the like.

[0177] In some embodiments, in the pharmaceutical composition, the peptoid compound or peptoid-lipid conjugate comprises one or more structural units M a and optionally one or more structural units M b , which includes a structural unit M having a group B a The number of structural units M a and optional structural unit M b At least 10%, or at least 20%, 30%, 33%, 50%, 67%, 80%, 90% or 100% of the total.

[0178] According to yet another aspect of the present disclosure, a method for increasing the stability of a lipid composition during a nebulization process is provided, wherein the lipid composition is optionally a liposome or lipid nanoparticle (LNP).

[0179] In some embodiments, the lipid composition is a lipid nanoparticle comprising a cationic lipid, a phospholipid, cholesterol or a cholesterol derivative, and / or a polymeric lipid, and the method comprises: (1) adding an amphiphilic conjugate to the lipid nanoparticle; or (2) replacing the polymeric lipid component of the lipid nanoparticle with an amphiphilic conjugate.

[0180] In some embodiments, the amphiphilic conjugate is a conjugate comprising a group B disclosed herein in its structure, optionally wherein the group B is located in the hydrophilic segment of the amphiphilic conjugate, and optionally wherein the amphiphilic conjugate further comprises a hydrophobic segment. In some embodiments, the main chain of the amphiphilic conjugate is a peptide chain, a peptoid chain, or other main chain structures.

[0181] In some embodiments, the amphiphilic conjugate is a peptoid-lipid conjugate of the present disclosure, or a stereoisomer or pharmaceutically acceptable salt thereof.

[0182] The present disclosure provides a lipid composition for aerosol inhalation, which includes an amphiphilic conjugate, optionally the amphiphilic conjugate is a peptoid-lipid conjugate of the present disclosure, or a stereoisomer or a pharmaceutically acceptable salt thereof, optionally, the peptoid-lipid conjugate includes one or more structural units M a and optionally one or more structural units M b , which includes a structural unit M having a group B a The number of structural units M a and optional structural unit M b At least 10%, or at least 20%, 30%, 33%, 50%, 67%, 75%, 80%, 90% or 100% of the total, for example, structural units M comprising groups B a The number of structural units M a and optional structural unit M b 30%-100% of the total, preferably 50%-100%, more preferably 75%-100%.

[0183] In some embodiments, the molecular weight of the amphiphilic conjugate is in the range of 1000 g / mol to 40000 g / mol.

[0184] In some embodiments, the lipid composition is a liposome or a lipid nanoparticle.

[0185] The present disclosure provides a method for increasing the stability of lipid nanoparticles during atomization, wherein the lipid nanoparticles include a high proportion of PEG lipids.

[0186] Wherein, the method comprises adding an amphiphilic conjugate to the lipid nanoparticle, optionally, the amphiphilic conjugate is a conjugate comprising a group B disclosed herein in its structure, optionally, the group B is located in the hydrophilic segment of the amphiphilic conjugate, optionally, the amphiphilic conjugate is a peptoid-lipid conjugate disclosed herein, optionally, the peptoid-lipid conjugate comprises one or more structural units M a and optionally one or more structural units M b, which includes a structural unit M having a group B a The number of structural units M a and optional structural unit M b At least 10% of the total, or at least 20%, 30%, 33%, 50%, 67%, 75%, 80%, 90% or 100%, for example, comprise structural units M having groups B a The number of structural units M a and optional structural unit M b 30%-100% of the total, preferably 50%-100%, more preferably 75%-100%.

[0187] In some embodiments, the high proportion of PEG lipid means that, based on the total molar amount of the components constituting the lipid nanoparticles, PEG lipid accounts for at least about 3 mol %, at least about 4 mol %, at least about 5 mol %, at least about 6 mol %, at least about 7 mol %, at least about 8 mol %, at least about 9 mol %, or at least about 10 mol %.

[0188] In some embodiments, the molecular weight of the amphiphilic conjugate is in the range of 1000 g / mol to 40000 g / mol.

[0189] In some embodiments, lipid nanoparticles (LNPs) containing the disclosed peptoid-lipid conjugates have better size stability during nebulization than lipid nanoparticles comprising PEG lipids.

[0190] In some embodiments, after nebulization, the average size of the lipid nanoparticles containing the peptoid-lipid conjugates of the present invention increases to within 3 times the average size before nebulization; in other embodiments, the average size of the lipid nanoparticles containing the peptoid-lipid conjugates of the present invention before and after nebulization does not change by more than 20%; further, the average size of the lipid nanoparticles containing the peptoid-lipid conjugates of the present invention before and after nebulization does not change by more than 10%.

[0191] In some embodiments, the lipid nanoparticles comprising the peptoid-lipid conjugates of the present invention have an encapsulation efficiency of more than 50% for the loaded nucleic acids after nebulization; in other embodiments, the lipid nanoparticles comprising the peptoid-lipid conjugates of the present invention have an encapsulation efficiency of more than 70% for the loaded nucleic acids after nebulization; in other embodiments, the lipid nanoparticles comprising the peptoid-lipid conjugates of the present invention have an encapsulation efficiency of more than 80% for the loaded nucleic acids after nebulization; further, the lipid nanoparticles comprising the peptoid-lipid conjugates of the present invention have an encapsulation efficiency of more than 90% for the loaded nucleic acids after nebulization.

[0192] In some embodiments, after nebulization, the average size dispersity index (PDI) of the lipid nanoparticles containing the peptoid-lipid conjugates of the present disclosure increases to within 2 times of the PDI before nebulization; further, the average size PDI of the lipid nanoparticles containing the peptoid-lipid conjugates of the present disclosure increases by no more than 20% before nebulization.

[0193] In some embodiments, after nebulization, the mRNA expression efficiency level of the lipid nanoparticles comprising the peptoid-lipid conjugates of the present invention in cells is more than 30% of the expression efficiency at the same concentration before nebulization; in some embodiments, after nebulization, the mRNA expression efficiency level of the lipid nanoparticles comprising the peptoid-lipid conjugates of the present invention in cells is more than 50% of the expression efficiency at the same concentration before nebulization; in some embodiments, after nebulization, the mRNA expression efficiency level of the lipid nanoparticles comprising the peptoid-lipid conjugates of the present invention in cells is more than 70% of the expression efficiency at the same concentration before nebulization; in some embodiments, after nebulization, the mRNA expression efficiency level of the lipid nanoparticles comprising the peptoid-lipid conjugates of the present invention in cells is more than 85% of the expression efficiency at the same concentration before nebulization.

[0194] The present disclosure provides a nebulized inhalation microparticle, which is formed by atomizing a solution formed by dispersing the lipid composition or pharmaceutical composition of the present disclosure in a buffer solution via a nebulization device, and optionally the nebulization device is selected from a vibrating mesh nebulizer, an ultrasonic nebulizer, a jet nebulizer, a soft mist inhaler, and the like.

[0195] In some embodiments, the aerosolized inhalable microparticles disclosed herein deliver nucleic acid drugs to respiratory tract and / or lung tissue cells by inhalation.

[0196] In some embodiments, the aerosolized inhalable microparticles of the present disclosure deliver nucleic acid drugs to non-lung cells through the respiratory tract and lung tissues by inhalation.

[0197] In some embodiments, in the lipid composition forming the aerosolized inhalation microparticles of the present disclosure, the peptoid-lipid conjugate accounts for at least about 1.5 mol %, at least about 2.5 mol %, at least about 3 mol %, or at least about 5 mol %. BRIEF DESCRIPTION OF THE DRAWINGS

[0198] Figure 1 shows the relative transfection efficiency of various peptide lipid LNPs and PEG lipid LNPs in 293T cells at a) sm102 / PEG-DMG formula ratio; b) the relative transfection efficiency of various peptide lipid LNPs and PEG lipid LNPs in 293T cells at a lipid A / PEG-DMG formula ratio.

[0199] Figure 2 shows the relative delivery efficiency of luciferase mRNA in 293T cells using LNPs containing varying amounts of peptoid lipids: a) LNPs containing PL-2-1; b) LNPs containing PL-10-1. All data were normalized to the fluorescence produced by the fluc-mRNA delivered with a 2.48% peptoid lipid ratio within the group. The LNPs correspond to the formulations listed in Table 3.

[0200] FIG3 shows the anti-PreF protein IgG antibody titer in mouse sera after two doses of RSV vaccine (LNP-mRNA or PreF protein vaccine).

[0201] Figure 4 shows the changes in the physicochemical properties of LNPs prepared with peptoid lipids and PEG lipids before and after nebulization: a) LNP particle size change rate; b) LNP nanoparticle size dispersion (PDI) change rate; c) retention ratio of mRNA encapsulation efficiency after nebulization; d) ratio of the efficiency of LNP delivery of luciferase mRNA in 293T cells after nebulization to the delivery efficiency before nebulization.

[0202] Figure 5 shows the turbidity changes of the LNP solution before and after atomization. The numbers in the photo are the OD values ​​of the solution's absorbance at 660 nm.

[0203] FIG6 shows antigen-specific IgG titers in mouse sera.

[0204] FIG7 shows the IgA levels in lung lavage fluid of mice.

[0205] FIG8 shows IgG levels in lung lavage fluid of mice.

[0206] FIG9 shows the activation level of mouse lung T cells.

[0207] Figure 10 shows immunofluorescence staining of tdTomato transgenic mouse lung tracheal epithelial tissue sections, blue (DAPI, cell nuclei); golden yellow (EpCAM, epithelial cells); red (tdTomato, edited cells); green (KRT5, basal cells).

[0208] Figure 11 shows immunofluorescence staining of lung tracheal epithelial tissue sections from tdtomato transgenic mice, including blue (DAPI, cell nuclei); golden yellow (EpCAM, epithelial cells); red (tdTomato, edited cells); and green (KRT5, basal cells).

[0209] FIG12 shows the mRNA expression of N-2LNP in various major organs.

[0210] FIG. 13 shows the expression level of EPO in the serum of mice receiving PEG-LNP EPO mRNA.

[0211] FIG. 14 shows the expression level of EPO in the serum of mice receiving PL-10-1 LNP EPO mRNA.

[0212] FIG15 shows the levels of specific antibody IgG in mouse serum.

[0213] FIG16 shows the levels of specific antibody IgM in mouse serum.

[0214] FIG17 shows silencing of the SOD1 gene in mouse lung tissue. DETAILED DESCRIPTION

[0215] The above and other objects, components, and advantages will become apparent from the following more detailed description of specific embodiments, as illustrated and exemplified in the accompanying drawings, in which like reference numerals, symbols, etc. represent like parts, components, or features of the specific embodiments. It should be noted that any process not specifically described below is readily understood or comprehensible to one skilled in the art with reference to the prior art. Reagents or instruments used without manufacturer designation are deemed to be commercially available conventional products.

[0216] In terms of their scope of use, the terms "comprises," "comprising," and "having," or any variations thereof, as used in the claims and description herein, will be considered to indicate an open group that may include unspecified other elements. The terms "at least one" and "one or more" can be used interchangeably. The term "single" should be used to indicate one and only one of something. Similarly, when a specific number of things is required, other specific integer values, such as "two," will be used. The terms "preferably," "preferred," "preferred," "optionally," "may," and similar terms are used to indicate that the cited items, conditions, or steps are optional (i.e., not required) features in an embodiment. Unless otherwise stated, a range described as "between a and b" includes the values ​​of "a" and "b."

[0217] Although various improvements have been described herein with reference to specific embodiments of the invention, it should be understood that such description is by way of illustration only and should not be construed as limiting the scope of any claimed invention. Accordingly, the scope and content of any claimed invention will be limited solely by the terms of the appended claims in their current form or as amended during prosecution or as implemented in any continuation application. Furthermore, it should be understood that, unless otherwise indicated, features of any specific embodiment discussed herein may be combined with one or more features of any one or more embodiments otherwise discussed or contemplated herein.

[0218] The definitions of specific functional groups and chemical terms are described in more detail below. For the purposes of the present invention, chemical elements are identified according to the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th edition, inside cover, and specific functional groups are generally defined as described therein. In addition, the general principles of organic chemistry as well as specific functional moieties and reactivities are described in Organic Chemistry, Thomas Sorrell, University Science Books, Sausalito, 1999; Smith and March, March's Advanced Organic Chemistry, 5th edition, John Wiley & Sons, Inc., New York, 2001; Larock, Comprehensive Organic Transformations, VCH Publishers, Inc., New York, 1989; Carruthers, Some Modem Methods of Organic Synthesis, 3rd edition, Cambridge University Press, Cambridge, 1987.

[0219] All ranges cited herein are inclusive unless expressly stated otherwise.

[0220] When a range of values ​​is listed, it is intended that every value and subrange within that range be included. For example, “C 1-6 "Aims to cover C1, C2, C3, C4, C5, C6, C 1-6 、C 1-5 、C 1-4 、C 1-3 、C 1-2 、C 2-6 、C 2-5 、C 2-4 、C 2-3 、C 3-6 、C 3-5 、C 3-4 、C 4-6 、C 4-5 and C 5-6 In some embodiments, C0 represents that the number of carbon atoms is 0, that is, the group does not exist.

[0221] When any variable occurs more than one time in any constituent or in Formula (I) or in any other formula depicting and describing compounds of the present disclosure, its definition on each occurrence is independent of its definition at every other occurrence. Furthermore, combinations of substituents and / or variables are permissible only if such combinations result in stable compounds.

[0222] definition

[0223] As used herein, the term "hydrocarbyl" refers to a chemical group containing hydrogen and carbon. Hydrocarbyl groups may be substituted or unsubstituted. Hydrocarbyl groups may be unsaturated, saturated, branched, unbranched, cyclic, polycyclic or heterocyclic, and include alkyl, alkenyl and alkynyl groups. Hydrocarbyl groups may be fully saturated, monounsaturated or polyunsaturated, and may include divalent and polyvalent groups, having a specified number of carbon atoms (i.e., C 1-10 "Hydrocarbon" refers to 1 to 10 carbon atoms, including 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 carbon atoms. When a hydrocarbon group contains heteroatoms such as N, O, S, or P, it is also referred to as a "heterohydrocarbon group." Generally, when the number of main chain atoms is 6 or more, for example, 6 to 30 main chain atoms, it can be referred to as a long-chain hydrocarbon group or a long-chain heterohydrocarbon group. As used herein, the term "hydrocarbonylene" refers to a divalent substituent, i.e., a substituent formed by replacing one hydrogen atom in a monovalent hydrocarbon group with a valence.

[0224] As used herein, the term "hydrocarbyl" refers to the group -O-hydrocarbyl, wherein hydrocarbyl has a meaning as defined herein.

[0225] As used herein, the term "hydrocarbyl" refers to the group -C(O)-hydrocarbyl, wherein hydrocarbyl has the meaning defined herein.

[0226] As used herein, the term "alkyl" refers to a straight or branched chain saturated hydrocarbon group. i-j "Alkyl" refers to an alkyl group having i to j carbon atoms. Unless otherwise specified, an alkyl group may contain 1 to 10 carbon atoms. In certain embodiments, the alkyl group contains 1 to 6 carbon atoms, such as 1 to 5 carbon atoms, 1 to 4 carbon atoms, 1 to 3 carbon atoms, or 1 to 2 carbon atoms. Non-limiting examples of alkyl groups include methyl, ethyl, n-propyl and isopropyl, n-butyl, sec-butyl, isobutyl and tert-butyl, neopentyl, and the like. As used herein, the term "alkylene" refers to a divalent substituent, i.e., a substituent formed by replacing one hydrogen atom in a monovalent alkyl group with a valence.

[0227] As used herein, term " alkenyl " refers to a straight or branched hydrocarbon radical with at least one carbon-carbon double bond, and includes groups with " cis " and " trans " orientations, or alternatively, " E " and " Z " directions. Unless otherwise indicated, alkenyl can contain 2 to 10 carbon atoms. In certain embodiments, alkenyl can contain 2 to 6 carbon atoms, such as 2 to 5 carbon atoms, 2 to 4 carbon atoms, 2 to 3 carbon atoms. In certain embodiments, alkenyl groups contain 2 carbon atoms. Non-limiting examples of alkenyl include ethylene (vinyl), propenyl, butenyl, pentenyl, 1-methyl-2-butene-1-yl, 5-hexenyl etc.

[0228] As used herein, the term "alkynyl" refers to a straight or branched hydrocarbon group having at least one carbon-carbon triple bond. Unless otherwise indicated, an alkynyl group may contain 2 to 10 carbon atoms. In certain embodiments, an alkynyl group contains 2 to 8 carbon atoms, 2 to 6 carbon atoms, 2 to 4 carbon atoms, or 2 to 3 carbon atoms. In certain embodiments, an alkynyl group contains 2 carbon atoms. Non-limiting examples of alkynyl groups include ethynyl, 1-propynyl, 2-propynyl, etc.

[0229] As used herein, the term "alkoxy" refers to the group -O-alkyl, wherein alkyl has the meaning defined herein.

[0230] As used herein, the term "alkanoyl" refers to the group -C(O)-alkyl, wherein alkyl has the meaning defined herein.

[0231] As used herein, the term "cycloalkyl" refers to non-aromatic, saturated monocyclic and polycyclic ring systems in which all ring atoms are carbon. Unless otherwise specified, a cycloalkyl group may contain 3 to 10 ring carbon atoms (i.e., C 3-10 Cycloalkyl). In certain embodiments, the cycloalkyl group can contain 3 to 9, 3 to 8, 3 to 7, 3 to 6, 4 to 10, 4 to 9, 4 to 8, 4 to 7, 4 to 6, 4 to 5, 5 to 10, 5 to 9, 5 to 8, 5 to 7, 5 to 6 ring-forming carbon atoms, etc. In particular, the cycloalkyl can be monocyclic or bicyclic. Alternatively, the bicyclic cycloalkyl group can include fused, spirocyclic and bridged cycloalkyl structures.

[0232] On the other hand, also include the cycloalkyl ring that wherein 1,2 or 3 heteroatoms replace into ring carbon atom.This type of group is referred to as " heterocyclic radical " or " heterocycle ", and it refers to as defined above but with at least one heteroatom selected from N, O and S as the cycloalkyl group of ring-forming atoms.Unless otherwise indicated, heterocyclic radical group can contain 3 to 10 ring-forming atoms (i.e. 3 to 10 yuan of heterocyclic radicals).In certain embodiments, heterocyclic radical group can contain 3 to 9,3 to 8,3 to 7,3 to 6,4 to 10,4 to 9,4 to 8,4 to 7,4 to 6,4 to 5,5 to 10,5 to 9,5 to 8,5 to 7,5 to 6 ring-forming atoms etc.Especially, heterocyclic radical group can be monocycle or bicyclic.Alternatively, bicyclic heterocyclic radical group can comprise condensation, spirocycle and bridged heterocyclic radical structure. Non-limiting examples of heterocyclyl groups include oxiranyl, pyrrolidinyl, piperidinyl, tetrahydropyranyl, piperazinyl, pyrrolidinyl, and morpholinyl. Heterocyclyl groups can also be described by using the number of carbon atoms. For example, C 3-6Heterocyclyl refers to a heterocyclyl group containing three to six ring-forming carbon atoms, and may also contain at least one heteroatom, such as 1, 2 or 3 heteroatoms as ring-forming atoms. In certain embodiments, the heterocyclyl group or heterocycle contains 1 or 2 heteroatoms as ring-forming atoms. In certain embodiments, the heterocyclyl group can be monocyclic or bicyclic, such as fused bicyclic and spiro bicyclic. In the context of the present disclosure, the terms "heterocyclyl" and "heterocycle" can be used interchangeably.

[0233] As used herein, the term "aliphatic group" refers to a substituted or unsubstituted linear and / or branched, saturated or unsaturated hydrocarbon group, including linear, branched or cyclic alkyl, alkenyl and alkynyl groups. In some embodiments, the term "aliphatic group" can be used interchangeably with "hydrocarbon group". In some embodiments, the aliphatic group contains one or more, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 unsaturated carbon-carbon double bonds (-C=C-), carbon-carbon triple bonds (-C≡C-) groups, and / or any combination thereof.

[0234] As used herein, the term "heteroaliphatic group" refers to a substituted or unsubstituted straight and / or branched, saturated or unsaturated hydrocarbon group containing heteroatoms selected from N, O and S, including straight-chain, branched or cyclic alkyl, alkenyl and alkynyl groups. In some embodiments, the term "heteroaliphatic group" can be used interchangeably with "heterohydrocarbon group". When used herein, for example, a 1-12-membered heteroaliphatic group means that the number of atoms constituting the main chain of the heteroaliphatic group is 1-12, and when the heteroaliphatic group is branched, the number of atoms of all branches is included. In some embodiments, the heteroatoms contained in the heteroaliphatic group can constitute the main chain of the heteroaliphatic group together with carbon atoms, such as, but not limited to, group structures such as -CNC-, -COC-, -COOC, -CSC-, -CSSC, or any combination thereof. In some embodiments, the heteroatoms contained in the heteroaliphatic group can be substituents attached to carbon atoms, such as but not limited to -C≡N, -C=N-, -CN=, -C=O, -C-OH, -C=S, -C-SH and other substitution structures. In some of the embodiments, the heteroatoms contained in the heteroaliphatic group can be any combination of the group structures listed above. In some embodiments, the heteroaliphatic group contains one or more, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 unsaturated carbon-carbon double bonds (-C=C-), carbon-carbon triple bonds (-C≡C-), -NH-, -NH2-, OH, -OR m 、-O-、-C(O)-、-C(OR n )-、-C(O)O-、-SH、-SR o、-S-、-C(S)-、-C(SR p )-, -C(S)O-, -P(O)-, and / or any combination thereof, wherein R m 、R n 、R o and R p are each independently substituted or unsubstituted C 1-14 Aliphatic hydrocarbon groups, such as C 1-12 、C 1-10 、C 1-8 、C 1-6 、C 1-4 Aliphatic hydrocarbon group, substituted or unsubstituted C 1-14 Specific non-limiting examples of aliphatic hydrocarbon groups include, but are not limited to, methyl, ethyl, n- and isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, neopentyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, ethylene (vinyl), propenyl, butenyl, pentenyl, 1-methyl-2-buten-1-yl, 5-hexenyl, ethynyl, 1-propynyl, 2-propynyl, and the like.

[0235] As used herein, the term "aryl" or "aromatic ring" refers to a monocyclic, bicyclic, or polycyclic carbocyclic ring system having at least one aromatic ring. Unless otherwise indicated, an aryl group can be 6 to 10 members. In certain embodiments, an aryl group can contain 6 ring carbon atoms. All atoms within a carbocyclic aryl group are carbon atoms. Non-limiting examples of aryl groups include phenyl, naphthyl, 1,2-dihydronaphthyl, 1,2,3,4-tetrahydronaphthyl, fluorenyl, indanyl, indenyl, and the like. In the context of the present disclosure, the terms "aryl" and "aromatic ring" can be used interchangeably.

[0236] As used herein, the term "heteroaryl" or "heteroaromatic ring" refers to a monocyclic ring system, or a fused or bridged bicyclic ring system, wherein the ring system contains one, two, three, or four heteroatoms independently selected from the group consisting of nitrogen, oxygen, and sulfur; and at least one ring is an aromatic ring. Unless otherwise specified, a heteroaryl group can be 5 to 10 members. In certain embodiments, a heteroaryl group can be 5-membered or 6-membered. In certain embodiments, a heteroaryl group can contain one, two, or three heteroatoms. In certain embodiments, a heteroaryl group can contain one or two heteroatoms. The limiting examples of heteroaryl groups include benzimidazolyl, benzofuranyl, benzothiazolyl, benzothienyl, benzoxazolyl, furyl, imidazolyl, indolyl, isoindazolyl, isoquinolyl, isothiazolyl, isothiazolyl, isoxazolyl, oxadiazolyl, oxazolyl, purinyl, pyrrolyl, pyridyl, pyrazinyl, pyrimidinyl, quinolyl, quinolyl, thiadiazolyl, thiazolyl, thienyl, triazolyl, tetrazolyl, indolinyl, tetrahydroquinolyl, tetrahydroisoquinolyl etc.Heteroaryl groups include at least one heteroatomic ring and at least one aromatic ring with at least one as above.For example, there is at least one heteroatomic ring can be fused to one, two or three carbocyclic rings, for example aryl ring, cyclohexane ring, cyclohexene ring, cyclopentane ring, cyclopentene ring or another monocyclic heterocycle. Non-limiting examples of fused heteroaryl groups include 1,2,3,5,8,8a-hexahydroindolizine, 2,3-dihydrobenzofuran, 2,3-dihydroindole, 2,3-dihydrobenzothiophene, etc. In the context of the present disclosure, the terms "heteroaryl" and "heteroaromatic ring" are used interchangeably.

[0237] As used herein, the term "oxo" refers to a divalent oxygen atom and the structure of oxo may be shown as =0.

[0238] As used herein, the term "halo" or "halogen" refers to fluoride, chloride, bromide and iodide. In certain embodiments, non-limiting examples of halo include fluoride, chloride and bromide, more particularly fluoride and chloride.

[0239] As used herein, the term "heteroatom" refers to nitrogen (N), oxygen (O), and sulfur (S), and can include any oxidized forms of nitrogen and sulfur, and any quaternized forms of basic nitrogen, unless otherwise specified.

[0240] As used herein, the term "substituted" when referring to a chemical group means that the chemical group has one or more hydrogen atoms that are removed and replaced by a substituent. As used herein, the term "substituent" has its ordinary meaning as known in the art and refers to a chemical moiety that is covalently attached to a parent group or, if appropriate, fused to a parent group. It is understood that substitution of a given atom is limited by valence. It is understood that a substituent may be further substituted.

[0241] When it is stated in Formula (I) or any embodiment thereof that a moiety is "optionally" substituted, this means that Formula (I) or its embodiments encompasses compounds that are substituted with the indicated substituents on that moiety and compounds that do not contain the indicated substituents on that moiety (i.e., wherein the moiety is unsubstituted).

[0242] As used herein, the term "α-amino acid" refers to a compound of the following formula:

[0243] Among them, the group R z1 、R z2 and R z3 It can be any substituent, such as R z1 、R z2 and R z3 Each independently can be any of those substituents in natural α-amino acids, such as hydrogen, hydrocarbon, halogenated hydrocarbon, heteroalkyl, aromatic hydrocarbon, and the like.

[0244] In some embodiments, examples of α-amino acids include natural and non-natural α-amino acids. Natural α-amino acids include α-amino acids with non-polar R groups: alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, and valine; α-amino acids with polar but uncharged R groups: asparagine, cysteine, glutamine, glycine, serine, threonine, and tyrosine; α-amino acids with positively charged R groups: arginine, histidine, and lysine; and α-amino acids with negatively charged R groups: aspartic acid and glutamic acid.

[0245] Examples of non-natural α-amino acids include derivatives of natural α-amino acids such as β-(naphth-2-yl)alanine, β-(furan-2-yl)alanine, β-(thiophen-2-yl)alanine, hydroxyproline, norleucine, sarcosine, etc., alanine and β-(4-pyridyl)alanine.

[0246] As used herein, the term "amino acid residue" refers to an incomplete amino acid, i.e., the structural fragment remaining after at least a portion of an amino acid molecule is missing, such as the corresponding structural portion remaining after a hydrogen atom is removed from an amine group and / or a hydroxyl group is removed from the carboxyl terminus of an amino acid. For example, when multiple amino acids are linked to form a peptide chain, the amino-terminal hydrogen and carboxyl-terminal hydroxyl groups are removed to form peptide bonds, and the remaining structural portion, as shown below, can also be referred to as an amino acid residue:

[0247] As used herein, the term "α-amino acid with a neutral side chain" means that the side chain substituent at the α position of the α-amino acid is neutral, for example, a non-polar group or a polar but uncharged group. Exemplary α-amino acids with neutral side chains include alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, valine, asparagine, cysteine, glutamine, glycine, serine, threonine, and tyrosine.

[0248] The compounds provided herein are described with reference to general formulae and specific compounds. In addition, the compounds of the present disclosure may exist in a variety of different forms or derivatives, all of which are within the scope of the present disclosure. These include, for example, pharmaceutically acceptable salts, tautomers, stereoisomers, racemic mixtures, positional isomers, prodrugs, solvated forms, different crystalline forms or polymorphs, and active metabolites.

[0249] As used herein, unless otherwise indicated, the term "pharmaceutically acceptable salt" includes salts that maintain the biological effectiveness of the free acid / alkaline form of a particular compound and are not undesirable biologically or otherwise. Pharmaceutically acceptable salts can include salts formed with inorganic bases or acids and organic bases or acids. In the case where the compounds of the present disclosure contain one or more acidic or basic groups, the present invention also includes their corresponding pharmaceutically acceptable salts. Therefore, compounds of the present disclosure containing acidic groups (such as carboxyl groups) can exist in salt form and can be used according to the present invention, for example, alkali metal salts, alkaline earth metal salts, aluminum salts or ammonium salts. More non-limiting examples of such salts include lithium salts, sodium salts, potassium salts, calcium salts, magnesium salts, barium salts or salts with ammonia or organic amines (such as ethylamine, ethanolamine, diethanolamine, triethanolamine, piperidine, N-methylglutamine or amino acids). For example, by reacting a compound with an acidic group with a suitable base (such as lithium hydroxide, sodium hydroxide, sodium propoxide, potassium hydroxide, potassium ethoxide, magnesium hydroxide, calcium hydroxide or barium hydroxide), these salts are easily obtained. Other alkali salts of compound of the present disclosure include but are not limited to copper (I), copper (II), iron (II), iron (III), manganese (II) and zinc salts. Compound of the present disclosure contains one or more basic groups, such as protonated groups, can exist in the form of salts, and can be used according to the present invention in the form of addition salts with inorganic or organic acids. The example of suitable acid includes hydrogen chloride, hydrogen bromide, hydrogen iodide, phosphoric acid, sulfuric acid, nitric acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, sulfoacetic acid, trifluoroacetic acid, oxalic acid, acetic acid, tartaric acid, lactic acid, salicylic acid, benzoic acid, carbonic acid, formic acid, propionic acid, pivalic acid, diethylacetic acid, malonic acid, succinic acid, pimelic acid, fumaric acid, malonic acid, maleic acid, malic acid, pamoic acid, mandelic acid, sulfamic acid, phenylpropionic acid, gluconic acid, ascorbic acid, isonicotinic acid, citric acid, adipic acid, taurocholic acid, glutaric acid, stearic acid, glutamic acid or aspartic acid, and other acids well known by persons skilled in the art. The salt formed is especially hydrochloride, chloride, hydrobromide, bromide, iodide, sulfate, phosphate, methanesulfonate (mesylate), toluenesulfonate, carbonate, bicarbonate, formates, acetate, sulfoacetate, trifluoromethanesulfonate, oxalate, malonate, maleate, succinate, tartrate, malate, pamoate, mandelate, fumarate, lactate, citrate, glutarate, stearate, aspartate and glutamate. In addition, the stoichiometry of the salt formed by the compounds of the present disclosure can be an integer multiple or a non-integer multiple of 1.

[0250] Compounds of the present disclosure containing basic nitrogen-containing groups can be treated with reagents such as C 1-4 Quaternization of alkyl halides, for example, methyl, ethyl, isopropyl and tert-butyl chloride, bromine and iodine; di-C 1-4Alkyl sulfates, such as dimethyl sulfate, diethyl sulfate, and dipentyl sulfate; C 10-18 Alkyl halides, such as decyl, dodecyl, lauryl, myristyl, and stearyl chlorides, bromides, and iodides; and aryl C 1-4 Alkyl halides, such as benzyl chloride and phenethyl bromide.

[0251] If the compounds of the present invention contain both acidic and basic groups in the molecule, the present invention also includes, in addition to the above-mentioned salt forms, inner salts or betaines (zwitterions). The corresponding salts can be obtained by conventional methods known to those skilled in the art, for example, by contacting them with organic or inorganic acids or bases in a solvent or dispersant, or by anion exchange or cation exchange with other salts. The present invention also includes all salts of the compounds of the present invention, which are not directly suitable for pharmaceutical use due to low physiological compatibility, but can be used, for example, as intermediates in chemical reactions or for the preparation of pharmaceutically acceptable salts. For a review of more suitable salts, see Stahl and Wermuth, Handbook of Pharmaceutical Salts: Properties, Selection and Use (Wiley-VCH, 2002).

[0252] The peptoid-lipid conjugates of the present disclosure and their pharmaceutically acceptable salts can exist in unsolvated and solvated forms. As used herein, the term "solvate" refers to a molecular complex comprising the peptoid-lipid conjugates of the present disclosure or their pharmaceutically acceptable salts and one or more pharmaceutically acceptable solvent molecules. For example, the term "hydrate" is used when the solvent is water.

[0253] The peptoid-lipid conjugates of the present disclosure may have one or more chiral (asymmetric) centers. The present invention encompasses all stereoisomeric forms of the peptoid-lipid conjugates of the present disclosure. The asymmetric centers present in the peptoid-lipid conjugates of the present disclosure may have (R) or (S) configurations independently of one another. When the bond to the chiral carbon is described as a straight line in the structural formula of the present disclosure, or when the compound name is described in the absence of the (R) or (S) chiral name of the chiral carbon, it is understood that the (R) and (S) configurations of each such chiral carbon and therefore each enantiomer or diastereomer and mixtures thereof are included in the formula or name. The production of a specific stereoisomer or mixture thereof can be identified in the examples in which such stereoisomers or mixtures are obtained, but this in no way limits all stereoisomers and mixtures thereof to being included within the scope of the present disclosure.

[0254] The present invention includes all possible enantiomers and diastereomers and mixtures of two or more stereoisomers, such as mixtures of enantiomers and / or diastereomers in all ratios. Therefore, enantiomers are enantiomerically pure forms (as left-handed and right-handed enantiomers), racemic forms, and mixtures of two enantiomers in all ratios of the subject matter of the present invention. In the case of cis / trans isomers, the present invention includes mixtures of all ratios of cis-form and trans-form and these forms. If necessary, single stereoisomers can be prepared by conventional methods (such as by chromatography or crystallization, by using stereochemically uniform synthetic starting materials or by stereoselective synthesis). Optionally, derivatization can be carried out before stereoisomer separation. The separation of stereoisomer mixtures can be carried out in an intermediate step during the synthesis of the peptoid-lipid conjugates of the present disclosure, or can be carried out on the final racemic product. Absolute stereochemistry can be determined by X-ray crystallography of crystalline products or crystalline intermediates which have been derivatized, if necessary, with reagents containing stereocenters of known configuration. Alternatively, absolute stereochemistry can be determined by vibrational circular dichroism (VCD) spectroscopy.

[0255] Unless otherwise stated, structures depicted herein are also intended to include compounds that differ only in the presence of one or more isotopically enriched atoms, that is, compounds in which one or more atoms are replaced by atoms having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number prevalent in nature. Such compounds are termed "isotopic variants". The present invention is intended to include all pharmaceutically acceptable isotopic variants of the compounds of Formula (I). Examples of suitable isotopes for inclusion in the compounds of the present disclosure include, but are not limited to, isotopes of hydrogen, such as 2 H (ie, D) and 3 H; carbon, e.g. 11 C. 13 C and 14 C; chlorine, e.g. 36 Cl; fluorine, e.g. 18 F; iodine, e.g. 123 I and 125 I; nitrogen, e.g. 13 N and 15 N; oxygen, e.g. 15 O. 17 O and 18 O; phosphorus, e.g. 32 P; and sulfur, e.g. 35 Certain isotopic variations of the compounds of formula (I), for example those incorporating radioactive isotopes, are useful in drug and / or substrate tissue distribution studies. In particular, variations in the isotopes of the compounds of formula (I) may be useful only after substitution with heavier isotopes, for example with deuterium ( 2H or D) replaces hydrogen) in the depicted structure of different compounds may provide certain therapeutic advantages, for example, due to greater metabolic stability, increased in vivo half-life or reduced dosage requirements, and therefore may be used in some specific situations. Isotopic variations of the compounds of formula (I) can generally be prepared by conventional techniques known to those skilled in the art or by methods analogous to those described in the accompanying examples and by using appropriate isotopically labeled reagents instead of the non-labeled reagents previously employed.

[0256] Pharmaceutically acceptable solvates according to the present disclosure may include those wherein the solvent of crystallization may be isotopically substituted, for example D2O, d6-acetone, d6-DMSO.

[0257] As used herein, the term "lipid" refers to a class of organic compounds that are derivatives of fatty acids (e.g., esters) and are generally characterized by being insoluble in water but soluble in many organic solvents. Lipids are generally divided into at least three categories: (1) "simple lipids," which include fats and oils, as well as waxes; (2) "complex lipids," which include phospholipids and glycolipids; and (3) "derivative lipids," such as steroids.

[0258] As used herein, the term "phospholipid" refers to a lipid molecule consisting of two hydrophobic fatty acid "tails" and a hydrophilic "head" consisting of a phosphate group. These two components are most often bound together by a glycerol molecule, and therefore, in this article, phospholipids are preferably glycero-phospholipids. In addition, the phosphate group is often modified by a simple organic molecule such as choline (i.e., to produce phosphocholine) or ethanolamine (i.e., to produce phosphoethanolamine). In some embodiments, the phospholipid can be selected from the following group, which includes but is not limited to: 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (D SPC), 1,2-di-undecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholestyrene hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dialinolenoyl-sn-glycero-3-phosphocholine, 1,2-arachidonoyl-sn-glycero-3-phosphocholine, 1,2-bisdocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin and mixtures thereof. In some preferred embodiments, the phospholipid is selected from the group consisting of DSPC, DOPC, DOPE, DPPC, DMPC or any mixture thereof.

[0259] As used herein, the term "structured lipid" refers to sterol and also refers to a lipid containing a sterol moiety. In some embodiments, the structured lipid can be selected from the group consisting of cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, tomatin, ursolic acid, α-tocopherol, hornane, phytosterol, steroids, and mixtures thereof. In some embodiments, the structured lipid is cholesterol or a cholesterol analog.

[0260] As used herein, the term "polymer lipid" mainly includes PEG lipids, or alternatively referred to as PEGylated lipids, refers to any suitable lipid modified with a PEG (polyethylene glycol) group. In some embodiments, the PEG lipid can be selected from the following group, including but not limited to PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the specific examples of PEG lipids include but are not limited to C14-PEG2000 (1,2-dimyristoyl-rac-glycerol, methoxypolyethylene glycol-2000 (DMG-PEG2000)) and C18-PEG5000 (1,2-distearoyl-rac-glycerol, methoxypolyethylene glycol-5000 (DSG-PEG5000)).

[0261] As used herein, the term "hydrophobic lipid" means a compound having a non-polar group, including but not limited to long-chain saturated and unsaturated aliphatic hydrocarbon groups, and such groups are optionally substituted with one or more aromatic groups, cycloaliphatic groups, or heterocyclic groups. Suitable examples include but are not limited to diacylglycerols, dialkylglycerols, NN-dialkylamino, 1,2-diacyloxy-3-aminopropane, and 1,2-dialkyl-3-aminopropane.

[0262] As used herein, the terms "cationic lipid" and "ionizable lipid" are used interchangeably herein to include lipids and salts thereof having one, two, three or more fatty acid or fatty alkyl chains and a pH-titrable amino head group (e.g., an alkylamino or dialkylamino head group). Cationic lipids are typically protonated (i.e., positively charged) at a pH lower than the pKa of the cationic lipid and are substantially neutral at a pH higher than the pKa. Cationic lipids of the present disclosure may also be referred to as titratable cationic lipids. Cationic lipids are typically composed of three parts:

[0263] Head group: Contains ionizable amine groups (such as tertiary or secondary amines), which are protonated and positively charged in acidic environments (pH < 6.5), binding to the negative charge of nucleic acids; at physiological pH (~7.4), they are neutral and reduce cytotoxicity;

[0264] Linker: The head is connected to the hydrophobic tail through an ester bond, ether bond, ketal bond or a degradable linker group (such as a hydrolyzable ester bond), affecting the stability and metabolic pathway of the lipid;

[0265] Hydrophobic tail: usually a long-chain hydrocarbon structure, such as a C18 alkyl chain, which enhances the hydrophobic interaction of the lipid bilayer and maintains the stability of the nanoparticles.

[0266] Exemplary cationic lipids include, but are not limited to, DSDMA, DODMA, DLinDMA, DLenDMA, γ-DLenDMA, DLin-K-DMA, DLin-K-C2-DMA (also known as DLin-C2K-DMA, XTC2, and C2K), DLin-K-C3-DMA, DLin-K-C4-DMA, DLen-C2K-DMA, γ-DLen-C2K-DMA, DLin-M-C2-DMA (also known as MC2), DLin-M-C3-DMA (also known as MC3), and (DLin-MP-DMA) (also known as 1-B11).

[0267] Exemplary cationic lipids include: SM102 and cationic lipids of similar structures (reference patents US 10,799,463 B2, US9868691), ALC-0315 and cationic lipids of similar structures (reference patents US 10221127 B2, US10166298 B2), cationic lipids with polynitrogen structures (reference patents US 9,512,073 B2, CN 112930198 A, US 8,969,353 B2), and cationic lipids containing isonitrile or carboxylic acid end group structures (reference patent PCT / CN2024 / 070147). The present disclosure includes all the contents of the mentioned patent documents by reference.

[0268] As used herein, "nucleic acid" includes oligonucleotides, double-stranded RNA, single-stranded RNA, isolated RNA (such as partially purified RNA), substantially pure RNA, synthetic RNA, recombinantly produced RNA, and altered RNA that is different from naturally occurring RNA by adding, deleting, substituting, and / or changing one or more nucleotides. Such changes may include, for example, adding non-nucleotide substances to the end or interior of an interfering RNA (e.g., at one or more nucleotides of the RNA). The nucleotides in the RNA molecules of the present disclosure may also include non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs may be referred to as analogs or analogs of naturally occurring RNA. As used herein, the terms "ribonucleic acid" and "RNA" refer to molecules containing at least one ribonucleotide residue, including mRNA, circRNA, siRNA, microRNA, gRNA, ASO, tRNA, antisense RNA, single-stranded RNA, non-coding RNA, and multivalent RNA. Ribonucleotides are nucleotides having a hydroxyl group at the 2' position of the β-D-ribofuranose moiety. siRNA, or small interfering RNA, is a small RNA that plays an important role in the field of biology. It is a type of double-stranded RNA molecule with a length of about 21-25 nucleotides that can guide the RNA interference (RNAi) mechanism to specifically degrade target mRNA, thereby achieving regulation of gene expression. siRNA has a typical double-stranded RNA structure, with the two chains binding to each other through complementary base pairing to form a stable double helix structure. siRNA can also contain various possible chemical modifications, including but not limited to 2' methylation, fluorination, base modification, S substitution of O modification of phosphate groups, etc., and can also contain deoxyribonucleotides (including modified and non-chemically modified) at some sites. These terms include double-stranded RNA (dsRNA), single-stranded RNA (ssRNA), isolated RNA (such as partially purified RNA), substantially pure RNA, synthetic RNA, recombinantly produced RNA, and modified and altered RNA that differs from naturally occurring RNA by adding, deleting, substituting, modifying and / or changing one or more nucleotides. Alterations of RNA may include, for example, adding non-nucleotide substances to the ends or interior of the interfering RNA (e.g., at one or more nucleotides of the RNA), and the nucleotides in the RNA molecule include non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs may be referred to as analogs.

[0269] As used herein, the term "liposome" refers to a vesicle, preferably a spherical vesicle, having at least one lipid bilayer. Liposomes are capable of carrying aqueous solutions, compounds, drugs, or other substances in a compartment (i.e., an internal cavity or space) surrounded by at least one lipid bilayer.

[0270] As used herein, the term "lipid nanoparticle" refers to a lipid formulation that can be used to deliver therapeutic nucleic acids (e.g., mRNA) to a target site of interest (e.g., cells, tissues, organs, etc.). In some embodiments, the lipid nanoparticle is a nucleic acid-lipid particle, which is typically composed of a nucleic acid, a cationic lipid, a non-cationic lipid (e.g., a phospholipid), a binding polymer lipid (e.g., PEG-lipid or a peptoid-lipid conjugate of the present disclosure) and an optional structural lipid (e.g., cholesterol or steroid analogs) to prevent particle aggregation. Typically, therapeutic nucleic acids (e.g., mRNA) can be encapsulated in the lipid portion of the lipid nanoparticle, thereby protecting it from enzymatic degradation.

[0271] Peptide-like compounds

[0272] In one aspect, the present disclosure provides a peptoid compound, or a stereoisomer or a pharmaceutically acceptable salt thereof, comprising one or more structural units M of formula (I): a ,

[0273] in,

[0274] Group A is absent or substituted with R 3 -CH-;

[0275] When each appears, each R 1 、R 2 and R 3 are each independently selected from hydrogen, C 1-6 Alkyl or group B;

[0276] Group B has the structure shown in the following formula:

[0277] wherein l and m are each independently an integer selected from 1-6;

[0278] R 4 、R 5 、R 6 、R 7 and R 8 are each independently selected from hydrogen and C 1-6 alkyl;

[0279] R 9 、R 9’ 、R 10 and R 10’ are each independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 1-6 alkoxy;

[0280] The group Q is selected from -CO2－ 、-SO2 － 、-SO3 － 、-OSO2 － 、-SO4 － 、-P(O)(OR P )O － AND-OP(O)(OR P )O － The group consisting of R P Selected from hydrogen and C 1-6 alkyl;

[0281] When multiple structural units M are included a When the plurality of structural units M a are the same or different, each structural unit M a Independently have the structure represented by formula (I).

[0282] In some embodiments, in the peptoid compound, at least one structural unit M a including a group B, the group B being R 1 、R 2 and R 3 In some embodiments, in the at least one structural unit M a In, R 1 、R 2 and R 3 In some embodiments, at least one structural unit M is a group B. a In, R 1 、R 2 and R 3 Any two of them are group B, or any three of them are group B.

[0283] In some embodiments, in the peptoid compound, at least two structural units M a including a group B, each occurrence of which is independently R 1 、R 2 and R 3 Any one of; or all structural units M a including a group B, each occurrence of which is independently R 1 、R 2 and R 3 In some embodiments, in the at least two structural units M a or all structural units M a In, R 1 、R 2 and R 3 In some embodiments, there is only one group B in the at least two structural units M.a or all structural units M a In, R 1 、R 2 and R 3 Any two of them are group B, or any three of them are group B.

[0284] In some embodiments, the two terminal groups of the peptoid compound are independently selected from hydrogen, C 1-6 Hydrocarbon, C 1-6 Halogenated hydrocarbon, C 1-6 Hydroxyl, C 1-6 Alkyl, -C(O)-C 1-6 A group consisting of alkylene -COOH, OH, NH2, SH, N3, group B, and a linker containing one or more double bonds or triple bonds, wherein the linker containing one or more double bonds or triple bonds can be coupled with peptides, proteins, nucleic acids, carbohydrates, small molecule drugs, etc.

[0285] In some embodiments, the present disclosure provides a peptoid compound, or a stereoisomer or pharmaceutically acceptable salt thereof, having a structure represented by formula (II):

[0286] in:

[0287] R a Selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 Alkyl, C 1-6 Alkanoyl such as C 1-4 Alkanoyl, -C(O)-C 1-6 Alkylene-COOH such as -C(O)-C 1-4 a group consisting of alkylene -COOH;

[0288] R b Selected from the group consisting of OH, NH2, group B;

[0289] i is an integer selected from 2-100, preferably selected from 2-80, more preferably selected from 2-60, even more preferably selected from 2-40, most preferably selected from 2-20;

[0290] The peptidic compound comprises a plurality of structural units M of formula (I) a ,

[0291] Group A is absent or substituted with R 3 -CH-;

[0292] When each appears, each R 1 、R 2 and R 3are each independently selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 Alkyl or group B;

[0293] Group B has the structure shown in the following formula:

[0294] wherein l and m are each independently an integer selected from 1-6;

[0295] R 4 、R 5 、R 6 、R 7 and R 8 are each independently selected from hydrogen and C 1-6 Alkyl groups such as C 1-4 alkyl;

[0296] R 9 、R 9’ 、R 10 and R 10’ are each independently selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 Alkyl, C 1-6 Haloalkyl such as C 1-4 Halogenated alkyl, C 1-6 Alkoxy groups such as C 1-4 alkoxy;

[0297] The group Q is selected from -CO2 － 、-SO2 － 、-SO3 － 、-OSO2 － 、-SO4 － 、-P(O)(OR P )O － AND-OP(O)(OR P )O － The group consisting of R P Selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 alkyl;

[0298] The plurality of structural units M a are the same or different, each structural unit M a Independently having the structure shown in formula (I);

[0299] In this peptide compound, at least one structural unit M a including a group B, the group B being R 1 、R 2 and R 3 In some embodiments, at least one structural unit M a In, R1 、R 2 and R 3 In some embodiments, at least one structural unit M is a group B. a In, R 1 、R 2 and R 3 Any two of them are group B, or all three of them are group B;

[0300] When the peptoid compound includes a plurality of groups B, the plurality of groups B are the same or different.

[0301] In some embodiments, in the peptoid compound, at least two structural units M a including a group B, each occurrence of which is independently R 1 、R 2 and R 3 Any one of; or all structural units M a including a group B, each occurrence of which is independently R 1 、R 2 and R 3 In some embodiments, in the at least two structural units M a or all structural units M a In, R 1 、R 2 and R 3 In some embodiments, there is only one group B in the at least two structural units M. a or all structural units M a In, R 1 、R 2 and R 3 Any two of them are group B, or any three of them are group B.

[0302] In some embodiments, the structural unit M a Has the following structure:

[0303] wherein m is an integer selected from 1 to 6, preferably m is 2 or 3;

[0304] l is an integer selected from 1-6, and preferably l is 1, 2 or 3.

[0305] In some embodiments, the peptoid compounds of the present disclosure are selected from the following:

[0306] or its stereoisomers or pharmaceutically acceptable salts. It should be understood that in the above chemical formula, the expression "2-20" covers every integer in the range, that is, any chemical formula actually includes the structural unit M a Repeated 2 times, 3 times, 4 times... up to 20 times for multiple specific compounds.

[0307] In another aspect, the peptoid compound of the present disclosure is a peptoid compound having a structure represented by formula (III), or a stereoisomer or a pharmaceutically acceptable salt thereof,

[0308] The peptidic compound comprises one or more structural units M of formula (I) a and one or more structural units M b ,

[0309] in:

[0310] R a Selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 Alkyl, C 1-6 Alkanoyl such as C 1-4 Alkanoyl, -C(O)-C 1-6 Alkylene-COOH such as -C(O)-C 1-4 a group consisting of alkylene -COOH;

[0311] R b Selected from the group consisting of OH, NH2, group B;

[0312] i is an integer selected from 2-100, preferably selected from 2-80, more preferably selected from 2-60, even more preferably selected from 2-40, most preferably selected from 2-20;

[0313] Group A is absent or substituted with R 3 -CH-;

[0314] When each appears, each R 1 、R 2 and R 3 are each independently selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 an alkyl group, and a group B;

[0315] Group B has the structure shown in the following formula:

[0316] wherein l and m are each independently an integer selected from 1-6;

[0317] R 4 、R5 、R 6 、R 7 and R 8 are each independently selected from hydrogen and C 1-6 Alkyl groups such as C 1-4 alkyl;

[0318] R 9 、R 9’ 、R 10 and R 10’ are each independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 1-6 alkoxy;

[0319] The group Q is selected from -CO2 － 、-SO2 － 、-SO3 － 、-OSO2 － 、-SO4 － 、-P(O)(OR P )O － AND-OP(O)(OR P )O － The group consisting of R P Selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 alkyl;

[0320] When multiple structural units M are included a When the plurality of structural units M a are the same or different, each structural unit M a Each independently has the structure shown in formula (I);

[0321] In this peptide compound, at least one structural unit M a including a group B, wherein the group B is R 1 、R 2 and R 3 In some embodiments, at least one structural unit M a In, R 1 、R 2 and R 3 In some embodiments, at least one structural unit M is a group B. a In, R 1 、R 2 and R 3 Any two of them are group B, or all three of them are group B;

[0322] When the peptoid compound includes multiple groups B, the multiple groups B are the same or different;

[0323] When each occurs, each structural unit M b Each is independently selected from an amino acid residue, preferably an α-amino acid residue, more preferably an α-amino acid residue having a neutral side chain, for example, an amino acid residue selected from the following group: alanine (Ala), glycine (Gly), proline (Pro), cysteine ​​(Cys), valine (Val) and sarcosine (Sar);

[0324] j is an integer selected from 1-100, preferably selected from 1-80; more preferably selected from 1-60; even more preferably selected from 1-40, most preferably selected from 1-20;

[0325] In this peptide compound, the structural unit M a and structural unit M b The linkages are random, block, alternating, or a combination thereof in any order.

[0326] It should be understood that the formula (III) does not limit the structural unit M a and structural unit M b The connection order of the peptoid compound of the present disclosure is not the same as that of the structural unit M. a and structural unit M b , these structural units M a and structural unit M b Can be connected in any order.

[0327] In some embodiments, in the peptoid compound, at least two structural units M a including a group B, each occurrence of which is independently R 1 、R 2 and R 3 Any one of; or all structural units M a including a group B, each occurrence of which is independently R 1 、R 2 and R 3 In some embodiments, in the at least two structural units M a or all structural units M a In, R 1 、R 2 and R 3 In some embodiments, there is only one group B in the at least two structural units M. a or all structural units M a In, R 1 、R 2 and R 3Any two of them are group B, or any three of them are group B.

[0328] In some embodiments, the structural unit M a Has the following structure:

[0329] wherein m is an integer selected from 1 to 6, preferably m is 2 or 3;

[0330] l is an integer selected from 1-6, and preferably l is 1, 2 or 3.

[0331] In some embodiments, the structural unit M a and structural unit M b The numbers of repetitions may be the same or different.

[0332] In some embodiments, the structural unit M a and structural unit M b are connected in alternating order. Optionally, the structural unit M a and structural unit M b The number of repetitions may be the same or different.

[0333] In some embodiments, the structural unit M a and structural unit M b The peptide compounds are connected in an alternating manner so that the peptide compound comprises repeating structural units shown in the following structure:

[0334] wherein k is an integer selected from 2 to 50;

[0335] m is an integer selected from 1-6, preferably m is 2 or 3;

[0336] l is an integer selected from 1-6, and preferably l is 1, 2 or 3.

[0337] It is understood that one or more structural units M can be optionally connected in any order on both sides of the above-mentioned repeating structural unit. a and / or structural unit M b .

[0338] In some embodiments, the peptoid compound of formula (III) is selected from the following:

[0339] In one aspect, the present disclosure provides a compound of formula (IV), or a stereoisomer or pharmaceutically acceptable salt thereof,

[0340] wherein l and m are each independently an integer selected from 1-6;

[0341] PG 1 is hydrogen, or an acid protecting group, preferably

[0342] PG 2 is hydrogen or an amino protecting group, preferably Fmoc.

[0343] According to another aspect of the present disclosure, there is provided a compound of formula (IV'), or a stereoisomer or a pharmaceutically acceptable salt thereof,

[0344] wherein l and m are each independently an integer selected from 1-6;

[0345] PG 1 is hydrogen, or an acid protecting group, preferably

[0346] PG 2 is hydrogen or an amino protecting group, preferably Fmoc.

[0347] In one aspect, the present disclosure provides a method for solid phase preparation of a peptoid compound of formula (I) or a peptoid compound of formula (III) of the present disclosure, comprising the following steps:

[0348] (1) reacting the compound of formula (IV) or (IV′) or the amino acid derivative with a resin for solid phase synthesis to attach it to the resin;

[0349] (2) Optionally remove the amino protecting group PG 2 ;

[0350] (3) continuing the reaction to connect the next compound of formula (IV) or (IV') or amino acid derivative;

[0351] (4) optionally repeating steps (2) and (3) to extend the backbone length of the peptoid compound; and

[0352] (5) optionally performing terminal group modification, resin cleavage and / or deprotection to obtain a peptoid compound;

[0353] wherein the compound of formula (IV) or (IV') or the amino acid derivative in step (1) and each repeated step (3) are the same or different,

[0354] The amino acid derivative is an amino acid having an α-amino protecting group, whose side chain has or does not have a protecting group, the α-amino protecting group is preferably Fmoc, and the amino acid is preferably an α-amino acid, more preferably an α-amino acid with a neutral side chain, for example, an amino acid selected from the following group: alanine (Ala), glycine (Gly), proline (Pro), cysteine ​​(Cys), valine (Val) and sarcosine (Sar).

[0355] According to another aspect of the present disclosure, there is provided a primary amine compound of formula (V), or a stereoisomer or a pharmaceutically acceptable salt thereof,

[0356] NH2-B'-PG 3 (V)

[0357] Wherein, group B' has the structure shown in the following formula:

[0358] wherein l and m are each independently an integer selected from 1-6;

[0359] R 4 and R 5 are each independently selected from hydrogen and C 1-6 Alkyl groups such as C 1-4 alkyl;

[0360] R 9 、R 9’ 、R 10 and R 10’ are each independently selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 Alkyl, C 1-6 Haloalkyl such as C 1-4 Halogenated alkyl, C 1-6 Alkoxy groups such as C 1-4 alkoxy;

[0361] The group Q is selected from -CH(OR Q )O-、-C(O)O-、-P(O)(OR P )O- and -OP(O)(OR P )O-, wherein R P Selected from hydrogen, C 1-6 Alkyl groups such as C 1-4 Alkyl, R Q Selected from C 1-6 Alkyl groups such as C 1-4 Alkyl, Q is preferably -C(O)O-;

[0362] PG 3 It is hydrogen, C 1-6 Alkyl, or acid protecting group, preferably

[0363] In some embodiments, the primary amine compound of formula (V) is selected from the following:

[0364] In one aspect, the present disclosure provides a method for solid phase preparation of a peptoid compound of formula (I) or a peptoid compound of formula (III) of the present disclosure, comprising the following steps:

[0365] (1) reacting a halogenated acid with a resin for solid phase synthesis to link the halogenated acid to the resin; and subjecting a primary amine compound of formula (V) according to claim 16 or 17 to a substitution reaction with a halogen atom on the resin to link the primary amine compound of formula (V) according to claim 16 or 17 to the resin;

[0366] (2) condensing the α-amino protected amino acid through the amino group on the carboxyl resin;

[0367] (3) optionally repeating step (1) or (2) to extend the backbone length of the peptoid compound; and

[0368] (4) optionally performing terminal group modification, resin cleavage and / or deprotection to obtain a peptoid compound;

[0369] Wherein, the halogenated acid is preferably selected from bromoacetic acid, 2-bromopropionic acid, 1-bromopropionic acid, chloroacetic acid, 2-chloroacetic acid, 1-chloroacetic acid, iodoacetic acid,

[0370] The primary amine compound of formula (V) in each repeated step (1) and the amino acid derivative in step (2) are the same or different,

[0371] The α-amino protected amino acid, the amino protecting group is preferably Fmoc, the amino acid is preferably an α-amino acid, more preferably an α-amino acid with a neutral side chain, for example, an amino acid selected from the following group: alanine (Ala), glycine (Gly), proline (Pro), cysteine ​​(Cys), valine (Val) and sarcosine (Sar).

[0372] Peptoid-lipid conjugates

[0373] The peptoid-lipid conjugates of the present disclosure can be used for small molecule drug and nucleic acid delivery, specifically can be used in liposomes and lipid nanoparticles to deliver therapeutic and / or prophylactic agents, such as small molecule drugs and nucleic acids, to cells or organs.

[0374] In one aspect, the present disclosure provides a peptoid-lipid conjugate having formula (VI), or a stereoisomer or pharmaceutically acceptable salt thereof,

[0375] Lipid-L-peptide (VI)

[0376] wherein the peptoid portion is the peptoid compound disclosed herein or a stereoisomer or a pharmaceutically acceptable salt thereof,

[0377] L is absent or is a linker moiety selected from a substituted or unsubstituted straight chain aliphatic group or a substituted or unsubstituted straight chain heteroaliphatic group, optionally attached to either terminus of the peptoid portion, wherein the straight chain aliphatic group is C 1-16 Straight chain aliphatic groups, such as C 1-15 、C 1-14 、C 1-13 、C 1-12 、C 1-11 、C 1-10 、C 1-9 、C 1-8 、C 1-7 、C 1-6 、C 1-5 、C 1-4 、C 1-3 or C 1-2 The straight-chain aliphatic group is a 1-16-membered straight-chain heteroaliphatic group, such as a 1-15-membered, 1-14-membered, 1-13-membered, 1-12-membered, 1-11-membered, 1-10-membered, 1-9-membered, 1-8-membered, 1-7-membered, 1-6-membered, 1-5-membered, 1-4-membered, 1-3-membered or 1-2-membered straight-chain aliphatic group.

[0378] It should be understood that when the peptoid compound of the present disclosure or its stereoisomer or pharmaceutically acceptable salt is used as the peptoid part, the terminal group R a or R b It is connected to the linker portion L by a covalent bond or directly connected to the lipid, that is, the peptoid portion has a structure shown in formula (II'), formula (II"), formula (III') or formula (III"):

[0379] In some embodiments, the L is attached to the carbon-terminal carbonyl (-C(O)-) of the peptoid portion;

[0380] The L is attached to the side group reactive site of the peptoid portion; or

[0381] Said L is a linker moiety having the formula (VII) which is linked to the nitrogen terminus of the peptoid moiety via an amide bond,

[0382] Among them, L a is substituted or unsubstituted C 1-12An aliphatic group or a substituted or unsubstituted 1-12 membered heteroaliphatic group, optionally comprising at least one -CH2CH2O- group in the backbone of the substituted or unsubstituted 1-12 membered heteroaliphatic group.

[0383] In some embodiments, L a is substituted or unsubstituted C 1-12 Straight chain alkyl, such as C 1-10 、C 1-8 、C 1-6 or C 1-4 Straight chain alkyl; or

[0384] In some embodiments, L a is a substituted or unsubstituted 1-12 membered straight chain heteroaliphatic group, such as a 1-10 membered, 1-8 membered, 1-6 membered or 1-4 membered straight chain heteroaliphatic group, optionally including at least one -CH2CH2O- in its main chain.

[0385] In some embodiments, the linker moiety L is selected from the group consisting of:

[0386] wherein p is an integer selected from 1-12, such as 1-10, 1-8, 1-6, or 1-4;

[0387] q, r and s are each independently 0, or an integer selected from 1-10, such as 1-8, 1-6, 1-4, or 1-2.

[0388] In some embodiments, the linker moiety L is selected from:

[0389] As used herein, the term "lipid moiety" refers to a molecular moiety having one or more, for example, two, three or four, long-chain hydrocarbon groups or long-chain heteroalkyl groups as a hydrophobic tail, wherein the long-chain hydrocarbon group or long-chain heteroalkyl group may be substituted or unsubstituted, saturated or unsaturated C 6-20 an aliphatic group, or a substituted or unsubstituted saturated or unsaturated 6-20 membered heteroaliphatic group.

[0390] In the absence of the linker moiety L, the lipid moiety can be directly linked to the peptoid moiety. In some embodiments, the lipid moiety is linked to the carbonyl group (-C(O)-) at the carbon terminal of the peptoid moiety; the lipid moiety is linked to a side reactive site of the peptoid moiety; or the lipid moiety is linked to the amino group (-NH2) at the nitrogen terminal of the peptoid moiety.

[0391] In some embodiments, the lipid moiety has the structure of Formula (VIII):

[0392] in Indicates that it has structure A group C, wherein c1 is selected from 0 or 1, R C Selected from H, -C 1- 6 alkyl such as methyl, ethyl, propyl, butyl, pentyl or hexyl; -OC 1-6 Alkyl such as methoxy, ethoxy, propoxy, butoxy, pentyloxy or hexyloxy; and -N(R N1 R N2 ), R N1 and R N2 Each independently selected from H and -C 1-6 an alkyl group such as methyl, ethyl, propyl, butyl, pentyl or hexyl;

[0393] When c1 is 0, the group C does not contain a carbonyl group (-C(O)-), R C Directly connected to the peptoid part or the linker part; when c1 is 1, the group C contains a carbonyl group (-C(O)-), R C The linkage to the peptoid portion or the linker portion is via the carbonyl group.

[0394] In this group C, one or more C atoms and / or N atoms can be used as the site for connecting long-chain alkyl and / or long-chain heteroalkyl.When multiple long-chain alkyl and / or long-chain heteroalkyl are connected on the group C, these multiple long-chain alkyl and / or long-chain heteroalkyl can be connected on the same C atom or N atom, also can be connected on different C atoms or N atoms.When one or more long-chain alkyl and / or long-chain heteroalkyl are connected on the C atom or N atom, this C atom or N atom is a bifurcation center.In group C, one or more bifurcation centers can exist. It should be understood that when one or more long-chain alkyl and / or long-chain heteroalkyl are connected on the one or more C atoms and / or N atom of group C, the hydrogen atom on these one or more C atoms and / or N atom is substituted to meet the valence bond rule.

[0395] In some embodiments, group C has a structure selected from, but not limited to, the following:

[0396] wherein one or more hydrogen atoms are replaced to connect one or more long-chain hydrocarbon groups or long-chain heterohydrocarbon groups (R L1 、R L2 、R L3 ...R Lm ).

[0397] R L1 、R L2 、R L3 ...R Lm Each independently absent or selected from substituted or unsubstituted saturated or unsaturated C 6-30For example, C 6-20 aliphatic groups and substituted or unsubstituted saturated or unsaturated 6-30 membered, for example 6-20 membered, heteroaliphatic groups, which are optionally substituted with one or more substituents selected from the group consisting of deuterium, halogen, oxo (=O), -NO2 and -OH. 6-30 Aliphatic groups and substituted or unsubstituted saturated or unsaturated 6-30 membered heteroaliphatic groups include but are not limited to C 6-30 Alkyl, C 6-30 Alkenyl, C 6-30 Alkynyl, -OC(O)-C 6-30 Alkyl, -OC(O)-C 6-30 Alkenyl, -OC(O)-C 6- 30 Alkynyl, -C(O)OC 6-30 Alkyl, -C(O)OC 6-30 Alkenyl, -C(O)OC 6-30 Alkynyl, -C 1-6 Alkylene-OC(O)-C 6-30 Alkyl, -C 1-6 Alkylene-OC(O)-C 6-30 Alkenyl, -C 1-6 Alkylene-OC(O)-C 6-30 Alkynyl, -C 1-6 Alkylene-C(O)OC 6-30 Alkyl, -C 1-6 Alkylene-C(O)OC 6-30 Alkenyl, -C 1-6 Alkylene-C(O)OC 6-30 Alkynyl, optionally substituted with one or more substituents selected from the group consisting of deuterium, halogen, oxo (=O), -NO2 and -OH.

[0398] m is an integer selected from 1-12, such as 1-10, 1-8, 1-6, or 1-4.

[0399] It should be understood that the expression “C 6-30 ” and “C 1-6 " is intended to cover every integer in the numerical range and the numerical range formed by any two integers therein, for example, C 6-25 、C 6-20 、C 6-18 、C 6-16 、C 8-25 、C 8- 20 、C 8-18 、C 8-16 、C 1-6 、C1-4 、C 1-2 , C1, C2, C3, etc.

[0400] In some embodiments, R L1 、R L2 、R L3 ...R Lm Each independently selected from:

[0401] In some embodiments, R L1 、R L2 、R L3 ...R Lm Each independently selected from:

[0402] It should be understood that in the above chemical formula, expressions such as "4-18" cover every integer in the numerical range, that is, including 4, 5, 6...16, 17, 18 carbon atoms, and a numerical range composed of any two integers therein, such as 4-18, 2-16, 3-17, and other numerical ranges have similar meanings.

[0403] In some embodiments, the lipid moiety includes one, two, three, four, five, six or more long chain hydrocarbon or long chain heteroalkyl groups R L1 、R L2 、R L3 ...R Lm m is an integer selected from 1-12, such as 1-10, 1-8, 1-6, or 1-4.

[0404] In some embodiments, the lipid moiety has the structure of Formula (VIIIa), (VIIIb), (VIIIc), or (VIIId):

[0405] Among them, R L1 and R L2 Each independently absent or selected from substituted or unsubstituted saturated or unsaturated C 6-30 For example, C 6-20 aliphatic groups and substituted or unsubstituted saturated or unsaturated 6-30 membered, for example 6-20 membered, heteroaliphatic groups, which are optionally substituted with one or more substituents selected from the group consisting of deuterium, halogen, oxo (=O), -NO2 and -OH,

[0406] n is selected from 0, or an integer selected from 1-10, such as 1-8, 1-6, 1-4, or 1-2.

[0407] In some embodiments, R L1 and RL2 Each independently selected from: C 6-20 Straight chain alkyl, -R L’ -OC(O)-R L” 、-R L’ -C(O)OR L” , where R L’ Selected from C 0-4 Straight chain alkyl, R L” Selected from C 4-18 Straight chain alkyl, C 4-18 Straight chain alkenyl, C 4-18 Straight chain alkynyl.

[0408] In some embodiments, R L1 and R L2 Each independently selected from:

[0409] In some embodiments, the lipid moiety is selected from the group consisting of:

[0410] In some embodiments, the peptoid-lipid conjugate of formula (VI) is selected from:

[0411] wherein m is an integer selected from 1 to 6, preferably m is 2 or 3;

[0412] l is an integer selected from 1-6, preferably l is 1, 2 or 3;

[0413] i is an integer selected from 2-100, preferably selected from 2-80, more preferably selected from 2-60, even more preferably selected from 2-40, most preferably selected from 2-20;

[0414] p is an integer selected from 1-12, such as 1-10, 1-8, 1-6, or 1-4.

[0415] In some embodiments, the peptoid-lipid conjugate of formula (VI) is selected from:

[0416] wherein m is an integer selected from 1 to 6, preferably m is 2 or 3;

[0417] l is an integer selected from 1-6, preferably l is 1, 2 or 3;

[0418] i is an integer selected from 2-100, preferably selected from 2-80, more preferably selected from 2-60, even more preferably selected from 2-40, most preferably selected from 2-20;

[0419] Each structural unit M b Each is independently selected from an amino acid residue, preferably an α-amino acid residue, more preferably an α-amino acid residue having a neutral side chain, for example, an amino acid residue selected from the following group: alanine (Ala), glycine (Gly), proline (Pro), cysteine ​​(Cys), valine (Val) and sarcosine (Sar);

[0420] j is an integer selected from 1-100, preferably selected from 1-80; more preferably selected from 1-60; even more preferably selected from 1-40, most preferably selected from 1-20;

[0421] The structural unit M a and structural unit M b connected in any order in random form, block form, alternating form, or a combination thereof;

[0422] p is an integer selected from 1-12, such as 1-10, 1-8, 1-6, or 1-4.

[0423] The peptoid-lipid conjugate of formula (VI) disclosed herein is selected from the following

[0424] In some embodiments, the peptoid-lipid conjugate of formula (VI) of the present disclosure has a molecular weight ranging from about 1000 g / mol to about 40000 g / mol.

[0425] The peptoid-lipid conjugate of formula (VI) disclosed herein is used for small molecule drug and / or nucleic acid delivery to achieve the introduction of small molecule drugs and / or nucleic acids (eg, DNA, RNA) into organelles, cells, tissues or organisms.

[0426] The peptoid-lipid conjugate of formula (VI) disclosed herein can be obtained by the following synthetic routes, for example, one synthetic route comprises first obtaining a peptoid compound by solid phase synthesis, cleavage and separation, and then linking it to a lipid to obtain the peptoid-lipid conjugate disclosed herein. Another synthetic route comprises first solid phase synthesis of a peptoid compound, linking it to a lipid, and then cleavage and separation to obtain the peptoid-lipid conjugate disclosed herein. Optionally, the lipid can be linked to the peptoid compound at any step of the solid phase synthesis, for example, in the first step or in the last step.

[0427] liposomes

[0428] In some aspects, the present invention relates to liposomes.The liposomes of the present disclosure comprise the peptoid-lipid conjugate of the present disclosure as described above.

[0429] In some embodiments, in the liposomes of the present disclosure, the peptoid-lipid conjugate accounts for about 0.1 mol% to about 60.0 mol%, or a range between any values ​​between about 0.1 mol% and about 60.0 mol%, such as about 0.1 mol%, 0.5 mol%, 1.0 mol%, 2.0 mol%, 3.0 mol%, 4.0 mol%, 5.0 mol%, 6.0 mol%, 7.0 mol%, 8.0 mol%, 9.0 mol%, 10.0 mol%, 15.0 mol%, 20.0 mol%, 25.0 mol%, 30.0 mol%, 35.0 mol%, 40.0 mol%, 45.0 mol%, 50.0 mol%, 55.0 mol%, 60.0 mol%, or a range between any two of the foregoing, based on the total molar amount of the components constituting the liposomes. Preferably, the peptoid-lipid conjugate accounts for about 0.5 mol% to about 20.0 mol%, and more preferably, the peptoid-lipid conjugate accounts for about 1.0 mol% to about 10.0 mol%.

[0430] In some embodiments, the liposomes of the present disclosure further comprise phospholipids, structural lipids such as cholesterol or cholesterol derivatives, and / or small molecule drugs or nucleic acids.

[0431] In some embodiments, the phospholipids comprise about 5.0 mol% to about 60.0 mol%, or a range between about 5.0 mol% and about 60.0 mol%, based on the total molar amount of the components constituting the liposomes, for example, about 5.0 mol%, 6.0 mol%, 7.0 mol%, 8.0 mol%, 9.0 mol%, 10.0 mol%, 15.0 mol%, 20.0 mol%, 25.0 mol%, 30.0 mol%, 35.0 mol%, 40.0 mol%, 45.0 mol%, 50.0 mol%, 55.0 mol%, 60.0 mol%, or a range between any two of the foregoing.

[0432] In some embodiments, the structural lipid, such as cholesterol or a cholesterol derivative, accounts for about 20.0 mol% to about 60.0 mol%, or a range between any values ​​from about 20.0 mol% to about 60.0 mol%, for example, about 20.0 mol%, 25.0 mol%, 30.0 mol%, 35.0 mol%, 40.0 mol%, 45.0 mol%, 50.0 mol%, 55.0 mol%, 60.0 mol%, or a range between any two of the above, based on the total molar amount of the components constituting the liposome.

[0433] lipid nanoparticles

[0434] In some aspects, the present invention relates to lipid nanoparticles.The lipid nanoparticles of the present disclosure comprise the peptoid-lipid conjugate of the present disclosure as described above.

[0435] In some embodiments, in the lipid nanoparticles of the present disclosure, the peptoid-lipid conjugate accounts for about 0.1 mol% to about 60.0 mol%, or a range between any values ​​between about 0.1 mol% and about 60.0 mol%, such as about 0.1 mol%, 0.5 mol%, 1.0 mol%, 2.0 mol%, 3.0 mol%, 4.0 mol%, 5.0 mol%, 6.0 mol%, 7.0 mol%, 8.0 mol%, 9.0 mol%, 10.0 mol%, 15.0 mol%, 20.0 mol%, 25.0 mol%, 30.0 mol%, 35.0 mol%, 40.0 mol%, 45.0 mol%, 50.0 mol%, 55.0 mol%, 60.0 mol%, or a range between any two of the above, based on the total molar amount of the components constituting the lipid nanoparticle. Preferably, the peptoid-lipid conjugate accounts for about 0.5 mol% to about 20.0 mol%, and more preferably, the peptoid-lipid conjugate accounts for about 1.0 mol% to about 10.0 mol%.

[0436] In some embodiments, the lipid nanoparticles of the present disclosure further comprise phospholipids, structural lipids such as cholesterol or cholesterol derivatives, cationic lipids, and / or nucleic acids.

[0437] In some embodiments, based on the total molar amount of the components constituting the lipid nanoparticle, the phospholipids comprise about 0 mol% to about 20.0 mol%, or any range between about 0 mol% to about 20.0 mol%, such as 1.0 mol%, 2.0 mol%, 3.0 mol%, 4.0 mol%, 5.0 mol%, 6.0 mol%, 7.0 mol%, 8.0 mol%, 9.0 mol%, 10.0 mol%, 15.0 mol%, 20.0 mol%, or any range therebetween. Preferably, the phospholipids comprise about 5.0 mol% to about 20.0 mol%.

[0438] In some embodiments, based on the total molar amount of the components constituting the lipid nanoparticles, the structural lipid, such as cholesterol or a cholesterol derivative, comprises about 10.0 mol% to about 60.0 mol%, or any range between about 10.0 mol% to about 60.0 mol%, such as 10.0 mol%, 15.0 mol%, 20.0 mol%, 25.0 mol%, 30.0 mol%, 35.0 mol%, 40.0 mol%, 45.0 mol%, 50.0 mol%, 55.0 mol%, 60.0 mol%, or any range therebetween. Preferably, the cholesterol or cholesterol derivative comprises about 20.0 mol% to about 60.0 mol%.

[0439] In some embodiments, the cationic lipid comprises about 10 mol% to about 90 mol%, or any range between about 10 mol% to about 90 mol%, such as 10.0 mol%, 15.0 mol%, 20.0 mol%, 25.0 mol%, 30.0 mol%, 35.0 mol%, 40.0 mol%, 45.0 mol%, 50.0 mol%, 55.0 mol%, 60.0 mol%, 65.0 mol%, 70.0 mol%, 75.0 mol%, 80.0 mol%, 85.0 mol%, 90.0 mol%, or any range between two of the above, based on the total molar amount of the components constituting the lipid nanoparticle. Preferably, the cationic lipid comprises about 20.0 mol% to about 60.0 mol%.

[0440] In some embodiments, the cationic lipid is a tertiary amine type cationic lipid, for example, comprising one or more tertiary amine type cationic lipids. In some embodiments, the cationic lipid is a quaternary amine type cationic lipid, for example, comprising one or more quaternary amine type cationic lipids. In some embodiments, the cationic lipid is a mixture of a tertiary amine type cationic lipid and a quaternary amine type cationic lipid, for example, a mixture of one or more tertiary amine type cationic lipids and one or more quaternary amine type cationic lipids, preferably a mixture of a tertiary amine type cationic lipid and a quaternary amine type cationic lipid.

[0441] In some embodiments, the content ratio of the tertiary amine cationic lipid to the quaternary ammonium cationic lipid is about 1:20 to 20:1, for example, about 1:15 to 15:1, about 1:10 to 10:1, about 1:5 to 5:1.

[0442] In some embodiments, the lipid nanoparticles of the present disclosure further comprise a polymer lipid, optionally wherein the polymer lipid is a PEG lipid, optionally wherein the polymer lipid comprises from about 0 mol% to about 10.0 mol%, or a range of any value between about 0 mol% and about 10.0 mol%, based on the total molar amount of the components constituting the lipid nanoparticle.

[0443] In some preferred embodiments, based on the total molar amount of the components constituting the lipid nanoparticles, the peptoid-lipid conjugate accounts for about 0.5 mol% to about 20.0 mol%, more preferably the peptoid-lipid conjugate accounts for about 1.0 mol% to about 10.0 mol%; the phospholipid accounts for about 5.0 mol% to about 20.0 mol%; the cholesterol or cholesterol derivative accounts for about 20.0 mol% to about 60.0 mol%; and / or the cationic lipid accounts for about 20.0 mol% to about 60.0 mol%.

[0444] In some embodiments, the N / P ratio of the cationic lipid to the nucleic acid is about 1.1:1 to 10:1, or a range between any values ​​of 1.1:1 to 10:1. In this article, the N / P ratio can be defined as the ratio of the number of N atoms of the ionizable group contained in the "cationic lipid" or "ionizable lipid" to the number of P atoms of the phosphate group of the nucleic acid in the lipid nanoparticle containing the nucleic acid. The N / P ratio can be based on the following calculation: for example, 1 μg of RNA typically contains about 3 nmol of phosphate residues, provided that the RNA presents a statistical distribution of bases. The "N" value of the cationic lipid can be calculated based on its molecular weight and the relative content of the cationic group. If more than one cationic lipid is present, the N value should be calculated based on all cationic lipids contained in the lipid nanoparticle.

[0445] In some embodiments, examples of nucleic acids include single-stranded and double-stranded DNA, single-stranded and double-stranded RNA, and hybrid molecules with a mixture of single-stranded and double-stranded DNA and RNA. In some embodiments, examples of nucleic acids include any type of RNA, such as messenger RNA (mRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), guide RNA (gRNA), CRISPR RNA (crRNA), trans-activating RNA (tracrRNA), plasmid DNA (pDNA), small circle DNA, genomic DNA (gNDA) and any fragment thereof.

[0446] One or more nucleic acids, for example, one nucleic acid, multiple identical nucleic acids, or multiple different nucleic acids, can be encapsulated in the lipid nanoparticles of the present disclosure. In some embodiments, one or more identical or different mRNAs are encapsulated in the lipid nanoparticles of the present disclosure. In some embodiments, multiple different RNAs are encapsulated in the lipid nanoparticles of the present disclosure in combination, such as a combination of Cas mRNA / sgRNA, a combination of multiple therapeutic RNAs.

[0447] In one aspect, the present invention provides lipid nanoparticles encapsulating nucleic acid molecules.

[0448] In one aspect, the present invention provides plasmid-entrapped lipid nanoparticles.

[0449] The preparation methods of lipid nanoparticles are widely known in the art. The lipid nanoparticles of the present disclosure can be prepared using conventional methods well known to those skilled in the art.

[0450] Pharmaceutical composition

[0451] In some aspects, the present invention relates to a pharmaceutical composition comprising the peptoid-lipid conjugate of the present disclosure, or a stereoisomer or pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or excipient.

[0452] As used herein, the term "pharmaceutically acceptable carrier or excipient" refers to a carrier or excipient that can be used to prepare a pharmaceutical composition, which is generally safe, non-toxic, and not biologically or otherwise undesirable, and includes carriers or excipients that are acceptable for veterinary use as well as human pharmaceutical use. As used herein, a pharmaceutically acceptable carrier or excipient includes one or more such carriers or excipients. The specific carrier or excipient used will depend on the manner and purpose of applying the compound of the present invention. Suitable carriers and excipients are well known to those skilled in the art and are described in detail in, for example, Ansel, Howard C, et al., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems. Philadelphia: Lippincott, Williams & Wilkins, 2004; Gennaro, Alfonso R., et al., Remington: The Science and Practice of Pharmacy. Philadelphia: Lippincott, Williams & Wilkins, 2000; and Rowe, Raymond C. Handbook of Pharmaceutical Excipients. Chicago, Pharmaceutical Press, 2005. One or more of buffers, stabilizers, surfactants, wetting agents, lubricants, emulsifiers, suspending agents, preservatives, antioxidants, opacifiers, glidants, processing aids, colorants, sweeteners, flavorings, flavorings, diluents and other known additives may also be included to provide a refined presentation of the drug (i.e., the compound or pharmaceutical composition provided herein) or to aid in the production of a pharmaceutical product (i.e., the drug).

[0453] In some embodiments, the peptoid-lipid conjugate comprises about 0.1 mol% to about 60.0 mol%, or any range between about 0.1 mol% to about 60.0 mol%, such as about 0.1 mol%, 0.5 mol%, 1.0 mol%, 2.0 mol%, 3.0 mol%, 4.0 mol%, 5.0 mol%, 6.0 mol%, 7.0 mol%, 8.0 mol%, 9.0 mol%, 10.0 mol%, 15.0 mol%, 20.0 mol%, 25.0 mol%, 30.0 mol%, 35.0 mol%, 40.0 mol%, 45.0 mol%, 50.0 mol%, 55.0 mol%, 60.0 mol%, or a range between any two of the foregoing, based on the total molar amount of the components constituting the pharmaceutical composition. Preferably, the peptoid-lipid conjugate accounts for about 0.5 mol% to about 20.0 mol%, and more preferably, the peptoid-lipid conjugate accounts for about 1.0 mol% to about 10.0 mol%.

[0454] In some embodiments, the pharmaceutical composition further comprises a phospholipid and cholesterol or a cholesterol derivative. Optionally, the phospholipid accounts for about 0 mol% to about 20.0 mol%, or a range between any values ​​of about 0 mol% to about 20.0 mol%, such as 1.0 mol%, 2.0 mol%, 3.0 mol%, 4.0 mol%, 5.0 mol%, 6.0 mol%, 7.0 mol%, 8.0 mol%, 9.0 mol%, 10.0 mol%, 15.0 mol%, 20.0 mol%, or a range between any two of the above. Preferably, the phospholipid accounts for about 5.0 mol% to about 20.0 mol%. Optionally, based on the total molar amount of the components constituting the pharmaceutical composition, the structured lipid, such as cholesterol or a cholesterol derivative, comprises about 10.0 mol% to about 60.0 mol%, or a range between any values ​​between about 10.0 mol% and about 60.0 mol%, such as 10.0 mol%, 15.0 mol%, 20.0 mol%, 25.0 mol%, 30.0 mol%, 35.0 mol%, 40.0 mol%, 45.0 mol%, 50.0 mol%, 55.0 mol%, 60.0 mol%, or a range between any two of the above. Preferably, the cholesterol or cholesterol derivative comprises about 20.0 mol% to about 60.0 mol%.

[0455] In some embodiments, the pharmaceutical composition further comprises a cationic lipid, preferably, in an amount of about 10 mol% to about 90 mol%, or in a range between about 10 mol% to about 90 mol%, based on the total molar amount of the components constituting the pharmaceutical composition, such as 10.0 mol%, 15.0 mol%, 20.0 mol%, 25.0 mol%, 30.0 mol%, 35.0 mol%, 40.0 mol%, 45.0 mol%, 50.0 mol%, 55.0 mol%, 60.0 mol%, 65.0 mol%, 70.0 mol%, 75.0 mol%, 80.0 mol%, 85.0 mol%, 90.0 mol%, or any range therebetween. Preferably, the cationic lipid accounts for about 20.0 mol% to about 60.0 mol%.

[0456] In some embodiments, the pharmaceutical composition further comprises a polymer lipid, optionally the polymer lipid is a PEG lipid, optionally, the polymer lipid accounts for about 0 mol% to about 10 mol%, or a range of any value between about 0 mol% and about 10 mol%, based on the total molar amount of the components constituting the lipid nanoparticle.

[0457] In some embodiments, the pharmaceutical composition further comprises a nucleic acid molecule and / or a small molecule drug. Preferably, the nucleic acid molecule is RNA.

[0458] The compositions of the present disclosure can be formulated into various forms. These include, for example, aerosols, sprays, liquids, semisolids and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, tablets, pills, powders, liposomes, suppositories, etc. The form depends on the intended mode of administration and therapeutic application. In a preferred embodiment, the compositions of the present disclosure are aerosols.

[0459] In some embodiments, the pharmaceutical composition is a lipid nanoparticle, optionally a lipid nanoparticle that can be nebulized for inhalation, and optionally, after the lipid nanoparticle is nebulized by a nebulizer, the average particle size of the lipid nanoparticle does not increase by more than 100%, preferably does not increase by more than 30%; and / or the nucleic acid encapsulation efficiency of the lipid nanoparticle decreases by no more than 20%, preferably does not decrease by more than 5%.

[0460] As used herein, the term "atomized inhalation" refers to a drug delivery method, which utilizes a high-speed airflow to form a pharmaceutical composition into a mist, which is then inhaled through the respiratory tract to achieve therapeutic effects. The pharmaceutical composition of the present disclosure is administered to the trachea and / or lungs by atomized inhalation, and the pharmaceutical composition includes preventive and / or therapeutic small molecule drugs and / or nucleic acid molecules such as RNA. Through the administration method of atomized inhalation, the pharmaceutical composition of the present disclosure, such as a lipid nanoparticle composition, can pass through the pulmonary airway-blood barrier and deliver nucleic acids to other organs and tissues other than the lungs, for example, other internal organs such as the heart, liver, and spleen, where proteins with medical uses are translated and expressed. Therefore, the scope of utility of the pharmaceutical composition and method of the present disclosure is not limited to lung tissues and cells, but can be extended to other organs and tissues other than the lungs. In some embodiments, the pharmaceutical composition of the present disclosure delivers preventive and / or therapeutic small molecule drugs and / or nucleic acid molecules, such as RNA, to other organ tissues outside the lungs, such as the liver, spleen, heart, and / or other non-lung cells, via an aerosol inhalation administration route, and encodes and expresses proteins with medical uses.

[0461] Therefore, the pharmaceutical compositions of the present disclosure can be administered to a subject via a pulmonary administration route using various methods known to those skilled in the art, such as aerosol inhalation, and distributed to local target cells and tissues of the lung, as well as peripheral non-lung cells and tissues, such as the liver, spleen, kidney, heart, skeletal muscle, lymph nodes, cells of the brain, cerebrospinal fluid, and plasma, etc. Thus, the present disclosure is not limited to the prevention and treatment of lung diseases, but can be extended to the delivery of small molecule drugs and / or nucleic acids in other organs, tissues, and cells other than the lungs. Exemplary non-lung peripheral cells include, but are not limited to, hepatocytes, epithelial cells, hematopoietic cells, epithelial cells, endothelial cells, bone cells, stem cells, interstitial cells, neural cells, cardiac cells, adipocytes, vascular smooth muscle cells, cardiomyocytes, skeletal muscle cells, β cells, pituitary cells, synovial lining cells, ovarian cells, testicular cells, fibroblasts, B cells, T cells, reticulocytes, leukocytes, granulocytes, and tumor cells.

[0462] It has been demonstrated in the prior art that nucleic acids can be delivered to the lungs, for example, by intratracheal administration of a liquid suspension of a nucleic acid composition and inhalation of an aerosol mist generated by a liquid nebulizer or using a dry powder device, as described in US Patent No. 5,780,014, which is incorporated herein by reference.

[0463] In some embodiments, pharmaceutical compositions of the present disclosure can be formulated into aerosolization, atomization, or delivery in particulate liquid or solid form before or after being administered to a subject. Pharmaceutical compositions of the present disclosure can be formed into micro-droplets or micro-particle forms that can be easily breathed or inhaled by a subject with the assistance of one or more suitable devices. In some embodiments, these suitable devices include, for example, metered dose inhalers, vibrating mesh nebulizers, ultrasonic nebulizers, jet nebulizers, soft mist inhalers, jet nebulizers, dry powder inhalers, propellant-based inhalers or insufflators, etc., so that a pharmaceutical composition of a predetermined mass, volume or dosage, for example, about 0.5 mg / kg mRNA per dose is administered to a subject.

[0464] In some embodiments, the pharmaceutical compositions of the present disclosure formulated as inhalable microparticles, e.g., aerosolized inhalable microparticles, are of an appropriate size so that they can be inhaled by a subject or delivered using a suitable device, e.g., the pharmaceutical compositions of the present disclosure have an average D50 or D90 particle size of less than about 500 μm, 400 μm, 300 μm, 250 μm, 200 μm, 150 μm, 100 μm, 75 μm, 50 μm, 25 μm, 20 μm, 15 μm, 12.5 μm, 10 μm, 5 μm, 2.5 μm, or less.

[0465] In some embodiments, the pharmaceutical compositions of the present disclosure are administered to a subject at a single dose of, for example, at least 0.05 mg / kg, at least 0.1 mg / kg, at least 0.5 mg / kg, at least 1.0 mg / kg, at least 2.0 mg / kg, at least 3.0 mg / kg, at least 4.0 mg / kg, at least 5.0 mg / kg, at least 6.0 mg / kg, at least 7.0 mg / kg, at least 8.0 mg / kg, at least 9.0 mg / kg, at least 10 mg / kg, at least 1

[0014] In some embodiments, the dosage form of the present invention may be an oral dosage form of at least 5 mg / kg, at least 20 mg / kg, at least 25 mg / kg, at least 30 mg / kg, at least 35 mg / kg, at least 40 mg / kg, at least 45 mg / kg, at least 50 mg / kg, at least 55 mg / kg, at least 60 mg / kg, at least 65 mg / kg, at least 70 mg / kg, at least 75 mg / kg, at least 80 mg / kg, at least 85 mg / kg, at least 90 mg / kg, at least 95 mg / kg or at least 100 mg / kg body weight. In some embodiments, the pharmaceutical compositions of the present disclosure administer at least 0.1 mg, at least 0.5 mg, at least 1.0 mg, at least 2.0 mg, at least 3.0 mg, at least 4.0 mg, at least 5.0 mg, at least 6.0 mg, at least 7.0 mg, at least 8.0 mg, at least 9.0 mg, at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, or at least 100 mg of a nucleic acid to a subject in one or more doses.

[0466] In some embodiments, the lipid nanoparticles are atomized via a nebulization device, optionally selected from a vibrating mesh nebulizer, an ultrasonic nebulizer, a jet nebulizer, a soft mist inhaler, and the like.

[0467] In some embodiments, in the pharmaceutical composition, the peptoid-lipid conjugate comprises one or more structural units M a and optionally one or more structural units M b , which includes a structural unit M having a group B a The number of structural units M a and optional structural unit M b At least 10%, or at least 20%, 30%, 33%, 50%, 67%, 80%, 90% or 100% of the total.

[0468] The pharmaceutical compositions of the present disclosure can be prepared by any well-known pharmaceutical techniques (e.g., effective formulations and administration procedures). The above considerations on effective formulations and administration procedures are well known in the art and are described in standard textbooks. For example, in Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania, 1975; Liberman et al., eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, NY, 1980; and Kibbe et al., eds., Handbook of Pharmaceutical Excipients, 3rd edition, American Pharmaceutical Association, Washington, 1999, the formulation of drug products is discussed.

[0469] Methods to increase atomization stability

[0470] The inventors were surprised to find that when an amphiphilic conjugate, such as the peptoid-lipid conjugate of the present invention, is added to lipid nanoparticles, the stability of the lipid nanoparticles during the nebulization process can be increased. As used herein, the term "amphiphilic conjugate" refers to an amphiphilic compound formed by connecting two or more structural parts of different properties through covalent bonds or non-covalent bonds, which includes both a hydrophilic part and a hydrophobic part, so that the amphiphilic conjugate is both hydrophilic and hydrophobic. The peptoid-lipid conjugate of the present invention can be added to existing lipid nanoparticles as an auxiliary agent to stabilize the lipid nanoparticles. The peptoid-lipid conjugate of the present invention can also optionally partially or completely replace the polymer lipid component, such as the PEG lipid component, so as to be used as the main component to prepare lipid nanoparticles with high stability during the nebulization process.

[0471] In one aspect, the present disclosure provides a method for increasing the stability of lipid nanoparticles during a nebulization process, wherein the lipid nanoparticles comprise cationic lipids, phospholipids, cholesterol or cholesterol derivatives, and / or polymer lipids, and the method comprises: (1) adding an amphiphilic conjugate to the lipid nanoparticles; or (2) replacing the polymer lipid component of the lipid nanoparticles with an amphiphilic conjugate.

[0472] In some embodiments, the amphiphilic conjugate is a conjugate comprising a group B in its structure,

[0473] Group B has the structure shown in the following formula:

[0474] wherein l and m are each independently an integer selected from 1-6;

[0475] R 4 、R 5 、R 6 、R 7 and R 8 are each independently selected from hydrogen and C 1-6 alkyl;

[0476] R 9 、R 9’ 、R 10 and R 10’ are each independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 1-6 alkoxy;

[0477] The group Q is selected from -CO2 － 、-SO2 － 、-SO3 － 、-OSO2 － 、-SO4 － 、-P(O)(OR P )O － AND-OP(O)(OR P )O － The group consisting of R P Selected from hydrogen, C 1-6 alkyl;

[0478] When the amphiphilic conjugate comprises a plurality of groups B, the plurality of groups B are the same or different.

[0479] In some embodiments, the group B is located in the hydrophilic segment of the amphiphilic conjugate, and optionally, the amphiphilic conjugate further comprises a hydrophobic segment. In some embodiments, the main chain of the amphiphilic conjugate is a peptide chain, a peptoid chain, or other main chain structures.

[0480] In some embodiments, the amphiphilic conjugate has the following exemplary structure:

[0481] In some embodiments, the amphiphilic conjugate has the following exemplary structure:

[0482] In some embodiments, the amphiphilic conjugate is a peptoid-lipid conjugate of the present disclosure, or a stereoisomer or pharmaceutically acceptable salt thereof.

[0483] In one aspect, the present disclosure provides a lipid composition for aerosol inhalation, comprising an amphiphilic conjugate as defined herein.

[0484] In some embodiments, the amphiphilic conjugate is a peptoid-lipid conjugate of the present disclosure, optionally comprising one or more structural units M a and optionally one or more structural units M b , which includes a structural unit M having a group B a The number of structural units M a and optional structural unit M b At least 10%, or at least 20%, 30%, 33%, 50%, 67%, 75%, 80%, 90% or 100% of the total, for example, structural units M comprising groups B a The number of structural units M a and optional structural unit M b 30%-100% of the total, preferably 50%-100%, more preferably 75%-100%.

[0485] In some embodiments, the molecular weight of the amphiphilic conjugate is in the range of 1000 g / mol to 40000 g / mol.

[0486] In some embodiments, the lipid composition is a liposome or a lipid nanoparticle.

[0487] In some embodiments, the lipid composition for aerosol inhalation of the present disclosure is a liposome, which includes the peptoid-lipid conjugate of the present disclosure, phospholipids and structural lipids such as cholesterol or cholesterol derivatives.

[0488] Wherein, based on the total molar amount of the components constituting the liposome,

[0489] the peptoid-lipid conjugate comprises about 0.1 mol% to about 60.0 mol%, or any range between about 0.1 mol% to about 60.0 mol%, such as about 0.1 mol%, 0.5 mol%, 1.0 mol%, 2.0 mol%, 3.0 mol%, 4.0 mol%, 5.0 mol%, 6.0 mol%, 7.0 mol%, 8.0 mol%, 9.0 mol%, 10.0 mol%, 15.0 mol%, 20.0 mol%, 25.0 mol%, 30.0 mol%, 35.0 mol%, 40.0 mol%, 45.0 mol%, 50.0 mol%, 55.0 mol%, 60.0 mol%, or any range between two of the above, preferably the peptoid-lipid conjugate comprises about 0.5 mol% to about 20.0 mol%, more preferably the peptoid-lipid conjugate comprises about 1.0 mol% to about 10.0 mol%;

[0490] The phospholipids comprise from about 5.0 mol% to about 60.0 mol%, or any range between about 5.0 mol% and about 60.0 mol%, for example, about 5.0 mol%, 6.0 mol%, 7.0 mol%, 8.0 mol%, 9.0 mol%, 10.0 mol%, 15.0 mol%, 20.0 mol%, 25.0 mol%, 30.0 mol%, 35.0 mol%, 40.0 mol%, 45.0 mol%, 50.0 mol%, 55.0 mol%, 60.0 mol%, or a range between any two of the foregoing; and / or

[0491] The structured lipid, such as cholesterol or a cholesterol derivative, comprises about 20.0 mol% to about 60.0 mol%, or a range between any values ​​from about 20.0 mol% to about 60.0 mol%, for example, about 20.0 mol%, 25.0 mol%, 30.0 mol%, 35.0 mol%, 40.0 mol%, 45.0 mol%, 50.0 mol%, 55.0 mol%, 60.0 mol%, or a range between any two of the foregoing.

[0492] In some embodiments, the lipid composition for aerosol inhalation disclosed herein is a liposome, which further comprises a small molecule drug.

[0493] In some embodiments, the lipid composition for aerosol inhalation of the present invention is a lipid nanoparticle, which includes the peptoid-lipid conjugate of the present invention, phospholipids, structural lipids such as cholesterol or cholesterol derivatives and cationic lipids, and optionally PEG lipids.

[0494] Wherein, based on the total molar amount of the components constituting the lipid nanoparticles,

[0495] The peptoid-lipid conjugate comprises about 0.1 mol% to about 60.0 mol%, or any range between about 0.1 mol% to about 60.0 mol%, such as about 0.1 mol%, 0.5 mol%, 1.0 mol%, 2.0 mol%, 3.0 mol%, 4.0 mol%, 5.0 mol%, 6.0 mol%, 7.0 mol%, 8.0 mol%, 9.0 mol%, 10.0 mol%, 15.0 mol%, 20.0 mol%, 25.0 mol%, 30.0 mol%, 35.0 mol%, 40.0 mol%, 45.0 mol%, 50.0 mol%, 55.0 mol%, 60.0 mol%, or any range between two of the above. Preferably, the peptoid-lipid conjugate comprises about 0.5 mol% to about 20.0 mol%, more preferably, the peptoid-lipid conjugate comprises about 1.0 mol% to about 10.0 mol%.

[0496] The phospholipids account for about 0 mol% to about 20.0 mol%, or any range between about 0 mol% to about 20.0 mol%, such as 1.0 mol%, 2.0 mol%, 3.0 mol%, 4.0 mol%, 5.0 mol%, 6.0 mol%, 7.0 mol%, 8.0 mol%, 9.0 mol%, 10.0 mol%, 15.0 mol%, 20.0 mol%, or any range between two of the above, preferably, the phospholipids account for about 5.0 mol% to about 20.0 mol%;

[0497] The structured lipid, such as cholesterol or a cholesterol derivative, accounts for about 10.0 mol% to about 60.0 mol%, or any range between about 10.0 mol% to about 60.0 mol%, such as 10.0 mol%, 15.0 mol%, 20.0 mol%, 25.0 mol%, 30.0 mol%, 35.0 mol%, 40.0 mol%, 45.0 mol%, 50.0 mol%, 55.0 mol%, 60.0 mol%, or any range between two of the above, preferably, the cholesterol or cholesterol derivative accounts for about 20.0 mol% to about 60.0 mol%; and / or

[0498] The cationic lipid accounts for about 10 mol% to about 90 mol%, or any range between about 10 mol% to about 90 mol%, such as 10.0 mol%, 15.0 mol%, 20.0 mol%, 25.0 mol%, 30.0 mol%, 35.0 mol%, 40.0 mol%, 45.0 mol%, 50.0 mol%, 55.0 mol%, 60.0 mol%, 65.0 mol%, 70.0 mol%, 75.0 mol%, 80.0 mol%, 85.0 mol%, 90.0 mol%, or any range between two of the above, preferably, the cationic lipid accounts for about 20.0 mol% to about 60.0 mol%;

[0499] And optionally, the polymer lipid comprises about 0 mol% to about 10.0 mol%, or a range between any value between about 0 mol% to about 10.0 mol%, such as 1.0 mol%, 2.0 mol%, 3.0 mol%, 4.0 mol%, 5.0 mol%, 6.0 mol%, 7.0 mol%, 8.0 mol%, 9.0 mol%, 10.0 mol%, or a range between any two of the foregoing.

[0500] In some embodiments, the lipid composition for aerosol inhalation of the present disclosure is a lipid nanoparticle, which further includes a nucleic acid. In some embodiments, the N / P ratio of the cationic lipid to the nucleic acid is about 1.1:1 to 10:1, or a range between any values ​​of 1.1:1 to 10:1.

[0501] In one aspect, the present disclosure provides a method for increasing the stability of lipid nanoparticles during atomization, wherein the lipid nanoparticles include a high proportion of PEG lipids, for example, based on the total molar amount of the components constituting the lipid nanoparticles, the PEG lipids account for at least about 3 mol% or more, at least about 4 mol% or more, at least about 5 mol% or more, at least about 6 mol% or more, at least about 7 mol% or more, at least about 8 mol% or more, at least about 9 mol% or more, at least about 10 mol% or more,

[0502] The method comprises adding an amphiphilic conjugate to the lipid nanoparticles. The amphiphilic conjugate is as defined herein.

[0503] In some embodiments, the amphiphilic conjugate is a peptoid-lipid conjugate of the present disclosure, optionally comprising one or more structural units M a and optionally one or more structural units M b , which includes a structural unit M having a group B a The number of structural units M a and optional structural unit M b At least 10%, or at least 20%, 30%, 33%, 50%, 67%, 75%, 80%, 90% or 100% of the total, for example, structural units M comprising groups B a The number of structural units M a The total number and optional structural units M b 30%-100%, preferably 50%-100%, more preferably 75%-100%.

[0504] In some embodiments, the peptoid-lipid conjugate comprises about 0.1 mol% to about 60.0 mol%, or any range between about 0.1 mol% to about 60.0 mol%, such as about 0.1 mol%, 0.5 mol%, 1.0 mol%, 2.0 mol%, 3.0 mol%, 4.0 mol%, 5.0 mol%, 6.0 mol%, 7.0 mol%, 8.0 mol%, 9.0 mol%, 10.0 mol%, 15.0 mol%, 20.0 mol%, 25.0 mol%, 30.0 mol%, 35.0 mol%, 40.0 mol%, 45.0 mol%, 50.0 mol%, 55.0 mol%, 60.0 mol%, or a range between any two of the foregoing, based on the total molar amount of the components constituting the lipid nanoparticle. Preferably, the peptoid-lipid conjugate accounts for about 0.5 mol% to about 20.0 mol%, and more preferably, the peptoid-lipid conjugate accounts for about 1.0 mol% to about 10.0 mol%.

[0505] In some embodiments, the molecular weight of the amphiphilic conjugate is in the range of 1000 g / mol to 40000 g / mol.

[0506] In some embodiments, the lipid nanoparticles further comprise phospholipids, structural lipids such as cholesterol or cholesterol derivatives and cationic lipids.

[0507] Wherein, based on the total molar amount of the components constituting the lipid nanoparticles,

[0508] The phospholipids account for about 0 mol% to about 20.0 mol%, or any range between about 0 mol% to about 20.0 mol%, such as 1.0 mol%, 2.0 mol%, 3.0 mol%, 4.0 mol%, 5.0 mol%, 6.0 mol%, 7.0 mol%, 8.0 mol%, 9.0 mol%, 10.0 mol%, 15.0 mol%, 20.0 mol%, or any range between two of the above, preferably, the phospholipids account for about 5.0 mol% to about 20.0 mol%;

[0509] The structured lipid, such as cholesterol or a cholesterol derivative, accounts for about 10.0 mol% to about 60.0 mol%, or any range between about 10.0 mol% to about 60.0 mol%, such as 10.0 mol%, 15.0 mol%, 20.0 mol%, 25.0 mol%, 30.0 mol%, 35.0 mol%, 40.0 mol%, 45.0 mol%, 50.0 mol%, 55.0 mol%, 60.0 mol%, or any range between two of the above, preferably, the cholesterol or cholesterol derivative accounts for about 20.0 mol% to about 60.0 mol%; and / or

[0510] The cationic lipid accounts for about 10 mol% to about 90 mol%, or any range between about 10 mol% to about 90 mol%, such as 10.0 mol%, 15.0 mol%, 20.0 mol%, 25.0 mol%, 30.0 mol%, 35.0 mol%, 40.0 mol%, 45.0 mol%, 50.0 mol%, 55.0 mol%, 60.0 mol%, 65.0 mol%, 70.0 mol%, 75.0 mol%, 80.0 mol%, 85.0 mol%, 90.0 mol%, or any range between two of the above, preferably, the cationic lipid accounts for about 20.0 mol% to about 60.0 mol%.

[0511] In some embodiments, the lipid nanoparticle further comprises a nucleic acid. In some embodiments, the N / P ratio of the cationic lipid to the nucleic acid is about 1.1:1 to 10:1, or a range of any value between 1.1:1 and 10:1.

[0512] In some embodiments, lipid nanoparticles (LNPs) containing the disclosed peptoid-lipid conjugates have better size stability during nebulization than lipid nanoparticles comprising PEG lipids.

[0513] In some embodiments, after nebulization, the average size of the lipid nanoparticles containing the peptoid-lipid conjugates of the present invention increases to within 3 times the average size before nebulization; in other embodiments, the average size of the lipid nanoparticles containing the peptoid-lipid conjugates of the present invention before and after nebulization does not change by more than 20%; further, the average size of the lipid nanoparticles containing the peptoid-lipid conjugates of the present invention before and after nebulization does not change by more than 10%.

[0514] In some embodiments, the lipid nanoparticles comprising the peptoid-lipid conjugates of the present invention have an encapsulation efficiency of more than 50% for the loaded nucleic acids after nebulization; in other embodiments, the lipid nanoparticles comprising the peptoid-lipid conjugates of the present invention have an encapsulation efficiency of more than 70% for the loaded nucleic acids after nebulization; in other embodiments, the lipid nanoparticles comprising the peptoid-lipid conjugates of the present invention have an encapsulation efficiency of more than 80% for the loaded nucleic acids after nebulization; further, the lipid nanoparticles comprising the peptoid-lipid conjugates of the present invention have an encapsulation efficiency of more than 90% for the loaded nucleic acids after nebulization.

[0515] In some embodiments, after nebulization, the average size dispersity index (PDI) of the lipid nanoparticles containing the peptoid-lipid conjugates of the present disclosure increases to within 2 times of the PDI before nebulization; further, the average size PDI of the lipid nanoparticles containing the peptoid-lipid conjugates of the present disclosure increases by no more than 20% before nebulization.

[0516] In some embodiments, after nebulization, the mRNA expression efficiency level of the lipid nanoparticles comprising the peptoid-lipid conjugates of the present invention in cells is more than 30% of the expression efficiency at the same concentration before nebulization; in some embodiments, after nebulization, the mRNA expression efficiency level of the lipid nanoparticles comprising the peptoid-lipid conjugates of the present invention in cells is more than 50% of the expression efficiency at the same concentration before nebulization; in some embodiments, after nebulization, the mRNA expression efficiency level of the lipid nanoparticles comprising the peptoid-lipid conjugates of the present invention in cells is more than 70% of the expression efficiency at the same concentration before nebulization; in some embodiments, after nebulization, the mRNA expression efficiency level of the lipid nanoparticles comprising the peptoid-lipid conjugates of the present invention in cells is more than 85% of the expression efficiency at the same concentration before nebulization.

[0517] Example

[0518] To describe the present invention in more detail, the following examples are presented. The examples described herein are used to illustrate the peptoid compounds, peptoid-lipid conjugates, preparation methods, lipid nanoparticles and pharmaceutical compositions provided herein and should not be interpreted in any way as limiting their scope.

[0519] During the synthesis process, it may be necessary and / or desirable to protect sensitive or reactive groups on any of the molecules involved. This can be achieved by conventional protecting groups, such as those described in TW Greene and PGM Wutts, Protective Groups in Organic Synthesis, 4th Edition, John Wiley and Sons. The protecting groups are optionally removed at a convenient subsequent stage using methods well known in the art.

[0520] The peptoid compounds and peptoid-lipid conjugates of the present invention can be easily prepared according to the following reaction schemes and examples or modifications thereof, using readily available starting materials, reagents and conventional synthetic procedures. In these reactions, variants known to those skilled in the art but not mentioned in more detail may also be used. In addition, other methods for preparing the peptoid compounds and peptoid-lipid conjugates of the present invention will be apparent to those skilled in the art based on the reaction schemes and examples described herein. Unless otherwise stated, all variables are as defined above. In general, in the chemical procedures, all reagents and starting materials can be purchased from commercial suppliers or can be easily prepared by those skilled in the art.

[0521] Example 1: Synthesis of Monomers

[0522] 1 Synthesis of primary amine monomer

[0523] Unless otherwise specified, the synthesis of primary amine monomers can be obtained by the following general reaction formula:

[0524] Dissolve the raw amine (0.2 mol, 1.0 equiv.) in 400 mL of dichloromethane. Di-tert-butyl dicarbonate (0.2 mol, 1.0 equiv.) is diluted with 50 mL of dichloromethane and slowly added dropwise to the reaction mixture at room temperature. Allow to react at room temperature and monitor by TLC until the reaction is complete. The reaction mixture is concentrated under reduced pressure to yield Intermediate A.

[0525] The raw halide (1-1.5 equiv.) is slowly added dropwise to a solution of intermediate A in dichloromethane or N,N-dimethylformamide at room temperature. The reaction is allowed to proceed at room temperature or with heating, and monitored by TLC until the reaction is complete. The reaction solution is concentrated under reduced pressure and washed with methyl tert-butyl ether to obtain intermediate B. The crude product can be further purified by silica gel column chromatography (methanol / dichloromethane ratio: 20-60%).

[0526] Bromotrimethylsilane (1.5 equiv.) was diluted with 50 mL of dichloromethane and slowly added dropwise to a dichloromethane solution of Intermediate B at room temperature. The reaction was allowed to proceed at room temperature and monitored by TLC until completion. The reaction solution was concentrated under reduced pressure, and the crude product was recrystallized (ethanol-ethyl acetate ratio of 0.2-1.2) or separated by silica gel column chromatography (methanol / dichloromethane ratio of 20-80%) to obtain Product C (overall yield 25-60%).

[0527] Intermediate 1 (m=3 in Intermediate A)

[0528] 1 H NMR (400MHz, CDCl3) δ (ppm): 3.17 (m, 2H), 2.31 (t, 2H), 2.21 (s, 6H), 1.64 (m, 2H), 1.44 (s, 9H).

[0529] Molecular formula: C 10 H 22 N2O2, molecular weight: 202.30, LC-MS (m / z) = 203.15 [M+H] +

[0530] Intermediate 2 (m=2 in Intermediate A)

[0531] 1 H NMR (400MHz, CDCl3) δ (ppm): 3.21 (m, 2H), 2.45 (m, 2H), 2.20 (s, 6H), 1.44 (s, 9H).

[0532] Molecular formula: C9H 20 N2O2, molecular weight: 188.27, LC-MS (m / z) = 189.10 [M+H] +

[0533] Monomer 1 (m = 3, l = 1, X = Br, R = )

[0534] White solid, total yield 60%.

[0535] 1 H NMR (400MHz, CD3OD) δ (ppm): 4.42 (s, 2H), 3.78 (m, 2H), 3.40 (s, 6H), 3.10 (t, 2H), 2.25 (m, 2H), 1.57 (s, 9H).

[0536] Molecular formula: C 11 H 25 N2O2 +, molecular weight: 217.33, LC-MS (m / z) = 217.15 [M] +

[0537] Monomer 2 (m = 3, l = 1, X = Br, R = )

[0538] Light yellow solid, total yield 50%.

[0539] 1 H NMR (400MHz, CD3OD) δ (ppm): 7.43~7.39 (m, 5H), 5.31 (s, 2H), 4.54 (s, 2H), 3.76 (m, 2H), 3.38 (s, 6H), 3.05 (m, 2H), 2.22 (m, 2H).

[0540] Molecular formula: C 14 H 23 N2O2 + , molecular weight: 251.35, LC-MS (m / z) = 251.15 [M] +

[0541] Monomer 3 (m = 3, l = 1, X = Cl, R = )

[0542] Light yellow oil, total yield 50%.

[0543] 1 H NMR (400MHz, CD3OD) δ (ppm): 5.87 (m, 1H), 5.35 (m, 2H), 4.73 (d, 2H), 4.52 (s, 2H), 3.77 (m, 2H), 3.41 (s, 6H), 3.07 (m, 2H), 2.24 (m, 2H).

[0544] Molecular formula: C 10 H 21 N2O2 + , molecular weight: 201.29, LC-MS (m / z) = 201.10 [M] +

[0545] Monomer 4 (m = 3, ll = 1, X = Br, R = )

[0546] Light yellow oil, total yield 25%.

[0547] 1H NMR (400MHz, CD3OD) δ (ppm): 5.66 (m, 1H), 4.54 (m, 4H), 4.39 (m, 2H), 3.69 (m, 2H), 3.39 (s, 6H), 3.08 (t, 2H), 2.22 (m, 2H), 1.21 (t, 6H).

[0548] Molecular formula: C 11 H 27 N2O2 + , molecular weight: 219.35, LC-MS (m / z) = 219.15 [M] +

[0549] Monomer 5 (m = 3, l = 1, X = Br, R = )

[0550] Light yellow oil, total yield 50%.

[0551] 1 H NMR (400MHz, CD3OD) δ (ppm): 4.42 (s, 2H), 3.88 (s, 3H), 3.78 (m, 2H), 3.40 (s, 6H), 3.11 (t, 2H), 2.23 (m, 2H).

[0552] Molecular formula: C8H 19 N2O2 + , molecular weight: 175.25, LC-MS (m / z) = 175.10 [M] +

[0553] Monomer 6 (m = 3, l = 1, X = Br, R = )

[0554] Light yellow oil, total yield 50%.

[0555] 1 H NMR (400MHz, CD3OD) δ (ppm): 4.42 (s, 2H), 3.94 (m, 2H), 3.78 (m, 2H), 3.40 (s, 6H), 3.11 (t, 2H), 2.24 (m, 2H), 1.20 (t, 3H).

[0556] Molecular formula: C9H 21 N2O2 + , molecular weight: 189.28, LC-MS (m / z) = 189.10 [M] +

[0557] Monomer 7 (m = 2, l = 1, X = Br, R = )

[0558] White solid, total yield 60%.

[0559] 1 H NMR (400MHz, CD3OD) δ (ppm): 4.42 (s, 2H), 3.78 (m, 2H), 3.40 (s, 6H), 3.09 (m, 2H), 1.57 (s, 9H).

[0560] Molecular formula: C 10 H 23 N2O2 + , molecular weight: 202.31, LC-MS (m / z) = 202.10 [M] +

[0561] Monomer 8 (m = 2, l = 1, X = Br, R = )

[0562] Light yellow oil, total yield 50%.

[0563] 1 H NMR (400MHz, CD3OD) δ (ppm): 7.43~7.39 (m, 5H), 5.31 (s, 2H), 4.54 (s, 2H), 3.76 (m, 2H), 3.38 (s, 6H), 3.05 (m, 2H), 2.22 (m, 2H).

[0564] Molecular formula: C 12 H 21 N2O2 + , molecular weight: 237.32, LC-MS (m / z) = 237.15 [M] +

[0565] Monomer 9 (m = 2, l = 1, X = Cl, R = )

[0566] Light yellow oil, total yield 50%.

[0567] 1 H NMR (400MHz, CD3OD) δ (ppm): 5.87 (m, 1H), 5.35 (m, 2H), 4.73 (d, 2H), 4.52 (s, 2H), 3.77 (m, 2H), 3.41 (s, 6H), 3.08 (m, 2H).

[0568] Molecular formula: C9H 19 N2O2+ , molecular weight: 187.26, LC-MS (m / z) = 187.10 [M] +

[0569] Monomer 10 (m = 2, l = 1, X = Br, R = )

[0570] Light yellow oil, total yield 25%.

[0571] 1 H NMR (400MHz, CD3OD) δ (ppm): 5.66 (m, 1H), 4.54 (m, 4H), 4.39 (m, 2H), 3.69 (m, 2H), 3.39 (s, 6H), 3.12 (t, 2H), 1.21 (t, 6H).

[0572] Molecular formula: C 10 H 25 N2O2 + , molecular weight: 205.32, LC-MS (m / z) = 205.10 [M] +

[0573] Monomer 11 (m = 2, l = 1, X = Br, R = )

[0574] Light yellow oil, total yield 50%.

[0575] 1 H NMR (400MHz, CD3OD) δ (ppm): 4.42 (s, 2H), 3.88 (s, 3H), 3.78 (m, 2H), 3.40 (s, 6H), 3.11 (t, 2H).

[0576] Molecular formula: C7H 17 N2O2 + , molecular weight: 161.22, LC-MS (m / z) = 161.10 [M] +

[0577] Monomer 12 (m = 2, l = 1, X = Br, R = )

[0578] Light yellow oil, total yield 50%.

[0579] 1H NMR (400MHz, CD3OD) δ (ppm): 4.42 (s, 2H), 3.94 (m, 2H), 3.78 (m, 2H), 3.40 (s, 6H), 3.12 (t, 2H), 1.20 (t, 3H).

[0580] Molecular formula: C8H 19 N2O2 + , molecular weight: 175.25, LC-MS (m / z) = 175.10 [M] +

[0581] Monomer 14 (m = 3, l = 3, X = Br, R = )

[0582] Light yellow oil, total yield 40%.

[0583] 1 H NMR (400MHz, CD3OD) δ (ppm): 3.50 (m, 2H), 3.41 (m, 2H), 3.17 (s, 6H), 3.07 (t, 2H), 2.42 (t, 2H), 2.19 (m, 2H), 2.03 (m, 2H), 1.46 (s, 9H).

[0584] Molecular formula: C 13 H 29 N2O2 + , molecular weight: 245.39, LC-MS (m / z) = 245.15 [M] +

[0585] Monomer 16 (m = 2, l = 3, X = Br, R = )

[0586] Light yellow oil, total yield 40%.

[0587] 1 H NMR (400MHz, CD3OD) δ (ppm): 3.50 (m, 2H), 3.41 (m, 2H), 3.17 (s, 6H), 3.07 (t, 2H), 2.42 (t, 2H), 2.19 (m, 2H), 1.46 (s, 9H).

[0588] Molecular formula: C 12 H 27 N2O2 + , molecular weight: 231.36, LC-MS (m / z) = 231.20 [M] +

[0589] Monomer 13

[0590] Tert-butyl 2-(methylamino)propylcarbamate (37.65 g, 0.2 mol, 1.0 equiv.) was dissolved in 400 mL of acetonitrile. Tert-butyl acrylate (38.45 g, 0.3 mol, 1.5 equiv.) was diluted with 50 mL of acetonitrile and slowly added dropwise to the reaction solution at room temperature. The reaction was allowed to proceed at 60°C and monitored by TLC until the reaction was complete. The reaction solution was concentrated under reduced pressure, and the crude product was separated by silica gel column chromatography (methanol / dichloromethane: 20-60%) to obtain 13.1 (44.3 g, 70% yield) as a light yellow oil.

[0591] Dissolve 13.1 in 400 mL of dichloromethane, slowly add iodomethane (28.39 g, 0.2 mol, 1.5 equiv.) dropwise to the reaction solution at room temperature, and react at room temperature. Monitor by TLC until the reaction is complete. Then proceed directly to the next step.

[0592] Bromotrimethylsilane (30.62 g, 0.2 mol, 1.5 equiv.) was diluted with 50 mL of dichloromethane and slowly added dropwise to the reaction mixture from the previous step at room temperature. The reaction was allowed to react at room temperature and monitored by TLC until the reaction was complete. The reaction mixture was concentrated under reduced pressure and washed with methyl tert-butyl ether. The crude product was separated by silica gel column chromatography (methanol / dichloromethane: 20-80%) to afford a light yellow oil (22 g, 35% overall yield).

[0593] 1 H NMR (400MHz, CD3OD) δ (ppm): 3.56 (m, 2H), 3.41 (m, 2H), 3.18 (s, 6H), 3.07 (t, 2H), 2.60 (t, 2H), 2.18 (m, 2H), 1.47 (s, 9H).

[0594] Molecular formula: C 12 H 27 N2O2 + , molecular weight: 231.36, LC-MS (m / z) = 231.20 [M] +

[0595] Monomer 15

[0596] Tert-butyl 2-(methylamino)ethylcarbamate (34.85 g, 0.2 mol, 1.0 equiv.) was dissolved in 400 mL of acetonitrile. Tert-butyl acrylate (38.45 g, 0.3 mol, 1.5 equiv.) was diluted with 50 mL of acetonitrile and slowly added dropwise to the reaction solution at room temperature. The reaction was allowed to proceed at 60°C and monitored by TLC until the reaction was complete. The reaction solution was concentrated under reduced pressure, and the crude product was separated by silica gel column chromatography (methanol / dichloromethane: 20-60%) to obtain 15.1 (42.3 g, 70% yield) as a light yellow oil.

[0597] Dissolve 15.1 in 400 mL of dichloromethane, slowly drop iodomethane (28.39 g, 0.2 mol, 1.5 equiv.) into the reaction solution at room temperature, react at room temperature, and monitor by TLC until the reaction is complete. Then proceed directly to the next step.

[0598] Bromotrimethylsilane (30.62 g, 0.2 mol, 1.5 equiv.) was diluted with 50 mL of dichloromethane and slowly added dropwise to the reaction mixture from the previous step at room temperature. The reaction was allowed to react at room temperature and monitored by TLC until the reaction was complete. The reaction mixture was concentrated under reduced pressure and washed with methyl tert-butyl ether. The crude product was separated by silica gel column chromatography (methanol / dichloromethane: 20-80%) to obtain a light yellow oil (21 g, 35% overall yield).

[0599] 1 H NMR (400MHz, CD3OD) δ (ppm): 3.56 (m, 2H), 3.41 (m, 2H), 3.18 (s, 6H), 3.09 (t, 2H), 2.61 (t, 2H), 1.48 (s, 9H).

[0600] Molecular formula: C 11 H 25 N2O2 + , molecular weight: 217.33, LC-MS (m / z) = 217.15 [M] +

[0601] 2. Synthesis of Fmoc Monomer

[0602] Monomer 17

[0603] 3-Dimethylaminopropylamine (61.31 g, 0.6 mol, 3.0 equiv.) was dissolved in 800 mL of methyl tert-butyl ether. Benzyl bromoacetate (45.81 g, 0.2 mol, 1.0 equiv.) was diluted with 200 mL of methyl tert-butyl ether and slowly added dropwise to the reaction mixture under an ice bath. The reaction was allowed to react at room temperature and monitored by TLC until completion. The reaction mixture was washed with water, dried, and concentrated under reduced pressure. The crude product was separated by silica gel column chromatography (methanol / ethyl acetate ratio: 10-60%) to afford the product 17.1 (9 g, 18% yield) as a colorless oil.

[0604] Dissolve 17.1 in 300 mL of tetrahydrofuran, add triethylamine (11.42 g, 0.11 mol, 3.0 equiv.), and stir until uniform. 9-Fluorenylmethyl chloroformate (29.20 g, 0.11 mol, 3.0 equiv.) is diluted with 200 mL of tetrahydrofuran and slowly added dropwise to the reaction mixture under an ice bath. The mixture reacts at room temperature and is monitored by TLC until the reaction is complete. The reaction mixture is washed with water, dried, and concentrated under reduced pressure. The crude product is separated by silica gel column chromatography (methanol / dichloromethane: 5-80%) to afford 17.2 (8 g, 45% yield) as a light yellow oil.

[0605] Dissolve 17.2 in 100 mL of dichloromethane, add tert-butyl bromoacetate (3.27 g, 0.017 mol, 1.0 equiv.) and N,N-diisopropylethylamine (3.25 g, 0.025 mol, 1.5 equiv.), and react at room temperature. Monitor the reaction by TLC until completion. The reaction solution is concentrated under reduced pressure, and the crude product is separated by silica gel column chromatography (methanol / dichloromethane: 20-100%) to afford 17.3 as a light yellow oil (9 g, 90% yield).

[0606] 17.3 was dissolved in 50 mL of methanol, and palladium on carbon (1 g, 10 wt%) was added. The reaction was allowed to proceed at room temperature under hydrogen atmosphere and monitored by TLC until the reaction was complete. The reaction solution was centrifuged to remove the palladium on carbon and concentrated under reduced pressure. The crude product was separated by silica gel column chromatography (methanol / dichloromethane: 20-80%) to obtain a colorless oil (5.4 g, total yield 5%).

[0607] 1 H NMR (400MHz, CD3OD) δ (ppm): 7.79 (m, 2H), 7.58 (m, 2H), 7.39 (m, 4H), 4.63 (d, 1H), 4.37 (d, 2H) ,4.23(s,2H),4.01(s,2H),3.63(m,2H),3.47(m,2H),3.26(s,6H),2.03(m,2H),1.50(s,9H).

[0608] Molecular formula: C 28 H 37 N2O6+ , molecular weight: 497.61, LC-MS (m / z) = 497.20 [M] +

[0609] Monomer 18

[0610] N-Boc-L-lysine (49.26 g, 0.2 mol, 1.0 equiv.) was dissolved in 180 mL of aqueous formaldehyde. Sodium cyanoborohydride (25.14 g, 0.4 mol, 2.0 equiv.) was added portionwise to the reaction mixture under an ice bath. The reaction was allowed to react at room temperature and monitored by TLC until completion. The reaction mixture was concentrated under reduced pressure, and the crude product was separated by silica gel column chromatography (methanol / ethyl acetate 10-60%) to afford the white oily product 18.1 (52 g, 95% yield).

[0611] Dissolve 18.1 in 500 mL of benzyl alcohol. Add thionyl chloride (118.97 g, 1.0 mol, 5.0 equiv.) portionwise to the reaction mixture under ice. Allow to react at room temperature, monitoring by TLC until the reaction is complete. Wash the reaction mixture with water, separate the aqueous phase, and concentrate under reduced pressure to yield the product 18.2 as a white oil.

[0612] 18.2 was dissolved in 300 mL of tetrahydrofuran, and triethylamine (60.72 g, 0.6 mol, 3.0 equiv.) was added and stirred thoroughly. 9-Fluorenylmethyl chloroformate (155.22 g, 0.6 mol, 3.0 equiv.) was diluted with 200 mL of tetrahydrofuran and slowly added dropwise to the reaction mixture under an ice bath. The mixture was allowed to react at room temperature and monitored by TLC until the reaction was complete. The reaction mixture was washed with water, dried, and concentrated under reduced pressure. The crude product was separated by silica gel column chromatography (methanol / dichloromethane: 5-80%) to afford 18.3 as a light yellow oil (17 g, 20% yield).

[0613] 18.3 was dissolved in 200 mL of dichloromethane, and tert-butyl bromoacetate (6.83 g, 0.035 mol, 1.0 equiv.) and N,N-diisopropylethylamine (4.52 g, 0.053 mol, 1.5 equiv.) were added. The reaction was allowed to react at room temperature and monitored by TLC until the reaction was complete. The reaction solution was concentrated under reduced pressure, and the crude product was separated by silica gel column chromatography (methanol / dichloromethane: 20-100%) to afford 18.4 as a light yellow oil (14 g, 60% yield).

[0614] 18.4 was dissolved in 100 mL of methanol, and palladium on carbon (1.5 g, 10 wt%) was added. The reaction was allowed to proceed at room temperature under hydrogen atmosphere and monitored by TLC until the reaction was complete. The reaction solution was centrifuged to remove the palladium on carbon and concentrated under reduced pressure. The crude product was separated by silica gel column chromatography (methanol / dichloromethane: 20-80%) to obtain a colorless oil (7.1 g, total yield 6%).

[0615] 1 H NMR (400MHz, CD3OD) δ (ppm): 7.80 (d, 2H), 7.66 (m, 2H), 7.40 (m, 2H), 7.32 (m, 2H), 4.38 (m, 2H), 4.25 (s, 2H),4.23(m,1H),4.17(m,1H),3.55(m,2H),3.27(s,6H),1.93~1.79(m,4H),1.51(s,9H),1.46(m,2H).

[0616] Molecular formula: C 29 H 39 N2O6 + , molecular weight: 511.64, LC-MS (m / z) = 511.20 [M] +

[0617] Monomer 19

[0618] Boc-L-ornithine (46.46 g, 0.2 mol, 1.0 equiv.) was dissolved in 180 mL of aqueous formaldehyde. Sodium cyanoborohydride (25.14 g, 0.4 mol, 2.0 equiv.) was added portionwise to the reaction mixture under an ice bath. The reaction was allowed to react at room temperature and monitored by TLC until completion. The reaction mixture was concentrated under reduced pressure, and the crude product was separated by silica gel column chromatography (methanol / ethyl acetate 10-60%) to afford the white oily product 19.1 (47 g, 90% yield).

[0619] Dissolve 19.1 in 500 mL of benzyl alcohol. Add thionyl chloride (118.97 g, 1.0 mol, 5.0 equiv.) portionwise to the reaction mixture under ice-cooling. Allow to react at room temperature, monitoring by TLC until the reaction is complete. Wash the reaction mixture with water, separate the aqueous phase, and concentrate under reduced pressure to yield 19.2 as a white oil.

[0620] 19.2 was dissolved in 300 mL of tetrahydrofuran, and triethylamine (60.72 g, 0.6 mol, 3.0 equiv.) was added and stirred thoroughly. 9-Fluorenylmethyl chloroformate (155.22 g, 0.6 mol, 3.0 equiv.) was diluted with 200 mL of tetrahydrofuran and slowly added dropwise to the reaction mixture under an ice bath. The mixture was allowed to react at room temperature and monitored by TLC until the reaction was complete. The reaction mixture was washed with water, dried, and concentrated under reduced pressure. The crude product was separated by silica gel column chromatography (methanol / dichloromethane: 5-80%) to afford 19.3 as a light yellow oil (13 g, 15% yield).

[0621] Dissolve 19.3 in 200 mL of dichloromethane, add tert-butyl bromoacetate (5.27 g, 0.027 mol, 1.0 equiv.) and N,N-diisopropylethylamine (5.29 g, 0.041 mol, 1.5 equiv.), and react at room temperature. Monitor the reaction by TLC until completion. The reaction solution is concentrated under reduced pressure, and the crude product is separated by silica gel column chromatography (methanol / dichloromethane: 20-100%) to afford 19.4 as a light yellow oil (9 g, 50% yield).

[0622] 19.4 was dissolved in 100 mL of methanol, and palladium on carbon (1 g, 10 wt%) was added. The reaction was allowed to proceed at room temperature under hydrogen atmosphere and monitored by TLC until the reaction was complete. The reaction solution was centrifuged to remove the palladium on carbon and concentrated under reduced pressure. The crude product was separated by silica gel column chromatography (methanol / dichloromethane: 20-80%) to obtain a colorless oil (4.7 g, 4% overall yield).

[0623] 1 H NMR (400MHz, CD3OD) δ (ppm): 7.82 (d, 2H), 7.70 (m, 2H), 7.42 (m, 2H), 7.34 (m, 2H), 4.45~4.35 (m,2H),4.25(s,2H),4.22(m,2H),3.61(m,2H),3.28(s,6H),1.92~1.78(m,4H),1.53(s,9H).

[0624] Molecular formula: C 28 H 37 N2O6 + , molecular weight: 497.61, LC-MS (m / z) = 497.20 [M] +

[0625] Example 2: Synthesis of Peptoids and Peptoid-Lipid Conjugates

[0626] The specific technical solutions of the present invention are further analyzed and illustrated by the following examples. Note that, unless otherwise specified, the expressions and technical terms used in this disclosure are consistent with the understanding of those skilled in the art to which this disclosure relates. Furthermore, any other materials equivalent to those described herein are also applicable to the practice of this disclosure. Furthermore, the zwitterionic compounds discussed in this disclosure are not limited to the structures shown herein.

[0627] The meanings of the abbreviations used in the present invention are listed in the following table:

[0628] In order to facilitate the demonstration of the implementation details of the disclosed technical solution, the specific content of the present invention is demonstrated by taking the synthesis of a series of multi-cyclic zwitterionic peptoids based on different resins as an example.

[0629] 2.1 Synthesis of lipid intermediates

[0630] 1.ALC(C 14 )-COOH

[0631] Ditetradecylamine (1,1 g, 0.0024 mol, 1.0 equiv.) and succinic anhydride (0.4884 g, 0.0049 mol, 2.0 equiv.) were added to a round-bottom flask and replaced with a nitrogen atmosphere. 36.61 mL of dichloromethane and triethylamine (2.2225 g, 0.0220 mol, 9.0 equiv.) were added and reacted overnight at room temperature. The reaction was monitored by TLC until completion. The product was washed with HCl 1M (2×30 mL) and deionized water (3×30 mL), dried over anhydrous magnesium sulfate, filtered and concentrated in vacuo, and then purified by PE / EA column to obtain a white solid 2 (771 mg, total yield 62%).

[0632] ALC(C 14 )-COOH is named PL-0-1, molecular formula: C 32 H 63 NO3, molecular weight: 509.48

[0633] 1 H NMR (400MHz, CDCl3) δ (ppm): 3.32 (t, 2H), 3.24 (t, 2H), 2.70 (t, 4H), 1.53 (m, 4H), 1.27 (m, 44H), 0.90 (m, 6H).

[0634] 2.DMG(C 14 )-COOH

[0635] Di-tert-butyl dicarbonate (2, 26.35 g, 0.1207 mol, 1.1 equiv.) was dissolved in 50 mL of methanol and placed in a constant pressure dropping funnel. 3-Amino-1,2-propanediol (1, 10.0 g, 0.1098 mol, 1.0 equiv.) was dissolved in 200 mL of methanol and placed in a round-bottom flask. The mixture was slowly added dropwise and allowed to react at room temperature for 4 hrs. The reaction was monitored by TLC until completion. The solvent was evaporated and the product was crystallized by slurrying with petroleum ether to obtain intermediate 3.

[0636] Tetradecanoyl chloride (4, 19.25 g, 0.078 mol, 3.0 equiv.) was dissolved in 20 ml of dichloromethane and placed in a constant pressure dropping funnel. Triethylamine (7.89 g, 0.078 mol, 3.0 equiv.) and DMG0191 (3, 5 g, 0.026 mol, 1.0 equiv.) were dissolved in 100 ml of dichloromethane and placed in a three-necked flask. Under ice bath conditions, the mixture was slowly added dropwise. After the addition was complete, the mixture was transferred to room temperature and reacted overnight. The reaction was monitored by TLC until completion. The solvent was removed directly, the mixture was coated with silica gel, and the mixture was filtered through a PE / EA column to obtain intermediate 5.

[0637] TFA (5.36 mL, 0.07 mol, 35 equiv.) was added dropwise to 10 mL of DMG0612 (5, 1.2239 g, 0.002 mol, 1.0 equiv.) dissolved in DCM. The mixture was stirred at room temperature for 2-4 hrs and monitored by TLC until the reaction was complete. 0.2 V of methanol was added and the mixture was stirred for 15 min. The mixture was concentrated by rotary evaporation and diluted with DCM. Most of the acid was neutralized with NaOH solution and then washed with saturated sodium bicarbonate solution. The organic phase was dried, filtered, and the solvent was removed by rotary evaporation to obtain intermediate 6.

[0638] DMG0512 (6, 10.0 g, 0.0195 mol, 1 equiv.) was dissolved in 50 mL of tetrahydrofuran and added to a round-bottom flask. Succinic anhydride (2.933 g, 0.0293 mol, 1.5 equiv.) was added, followed by triethylamine (5.920 g, 0.0585 mol, 3 equiv.), and the mixture was reacted in a water bath at 30°C overnight. TLC was used to confirm the reaction progress. The mixture was diluted with 50 mL of DCM and washed with 1 M HCl (2 x 30 mL) and deionized water (3 x 30 mL). The mixture was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. After purification through a PE / EA column, 7 (6.8 g, 59% overall yield) was obtained as a white solid.

[0639] DMG(C14)-COOH was named PL-0-2

[0640] 1 H NMR (500MHz, CDCl3, ppm): δ6.21(t,1H),5.10(t,1H),4.27(m,1H),4.13(m,1H),3.51( m,2H),2.70(m,2H),2.50(m,2H),2.32(m,4H),1.60(s,4H),1.26(m,40H),0.88(m,6H).

[0641] 3.DMG(C 16 )-COOH

[0642] Di-tert-butyl dicarbonate (2, 26.35 g, 0.1207 mol, 1.1 equiv.) was dissolved in 50 mL of methanol and placed in a constant pressure dropping funnel. 3-Amino-1,2-propanediol (1, 10.0 g, 0.1098 mol, 1.0 equiv.) was dissolved in 200 mL of methanol and placed in a round-bottom flask. The mixture was slowly added dropwise and allowed to react at room temperature for 4 hrs. The reaction was monitored by TLC until completion. The solvent was evaporated and the product was crystallized by slurrying with petroleum ether to obtain intermediate 3.

[0643] Hexadecanoyl chloride (4, 19.25 g, 0.078 mol, 3.0 equiv.) was dissolved in 20 ml of dichloromethane and placed in a constant pressure dropping funnel. Triethylamine (7.89 g, 0.078 mol, 3.0 equiv.) and DMG0191 (3, 5 g, 0.026 mol, 1.0 equiv.) were dissolved in 100 ml of dichloromethane and placed in a three-necked flask. Under ice bath conditions, the mixture was slowly added dropwise. After the addition was complete, the mixture was transferred to room temperature and reacted overnight. The reaction was monitored by TLC until completion. 0.1 V methanol was added, stirred for 0.5 hrs, and filtered through a PE / EA column to obtain intermediate 5.

[0644] TFA (5.36 mL, 0.07 mol, 35 equiv.) was added dropwise to 10 mL of DMG0668 (5, 1.2239 g, 0.002 mol, 1.0 equiv.) dissolved in DCM. The mixture was stirred at room temperature for 2-4 hrs and monitored by TLC until the reaction was complete. 0.2 V of methanol was added and the mixture was stirred for 15 min. The mixture was concentrated by rotary evaporation and diluted with DCM. Most of the acid was neutralized with NaOH solution and then washed with saturated sodium bicarbonate solution. The organic phase was dried, filtered, and the solvent was removed by rotary evaporation to obtain intermediate 6.

[0645] DMG0568 (6, 0.984 g, 0.002 mol, 1 equiv.) and DMAP were dissolved in 30 mL of DCM and added to a round-bottom flask. Succinic anhydride (2 equiv.) and triethylamine (6 equiv.) were added and the mixture was reacted in a water bath at 30°C overnight. TLC was used to monitor the reaction until completion. The product was washed with 1M HCl (2 x 30 mL) and deionized water (3 x 30 mL), dried over anhydrous magnesium sulfate, filtered, and concentrated in vacuo. The product was purified by column chromatography with PE / EA to afford 7 (521 mg, 39% overall yield) as a white solid.

[0646] DMG(C 16 )-COOH was named PL-0-3

[0647] 1 H NMR (500MHz, CDCl3, ppm): δ6.21(t,1H),5.10(t,1H),4.27(m,1H),4.13(m,1H),

[0648] 3.51(m,2H),2.70(m,2H),2.50(m,2H),2.32(m,4H),1.60(s,4H),1.26(m,48H),0.88(m,6H).

[0649] 4.DMG(C 18-0 )-COOH

[0650] Di-tert-butyl dicarbonate (2, 26.35 g, 0.1207 mol, 1.1 equiv.) was dissolved in 50 mL of methanol and placed in a constant pressure dropping funnel. 3-Amino-1,2-propanediol (1, 10.0 g, 0.1098 mol, 1.0 equiv.) was dissolved in 200 mL of methanol and placed in a round-bottom flask. The mixture was slowly added dropwise and allowed to react at room temperature for 4 hrs. The reaction was monitored by TLC until completion. The solvent was evaporated and the product was crystallized by slurrying with petroleum ether to obtain intermediate 3.

[0651] Octadecanoyl chloride (4, 19.25 g, 0.078 mol, 3.0 equiv.) was dissolved in 20 ml of dichloromethane and placed in a constant pressure dropping funnel. Triethylamine (7.89 g, 0.078 mol, 3.0 equiv.) and DMG0191 (3, 5 g, 0.026 mol, 1.0 equiv.) were dissolved in 100 ml of dichloromethane and placed in a three-necked flask. Under ice bath conditions, the mixture was slowly added dropwise. After the addition was complete, the mixture was transferred to room temperature and reacted overnight. The reaction was monitored by TLC until completion. 0.1 V methanol was added, stirred for 0.5 hrs, and filtered through a PE / EA column to obtain intermediate 5.

[0652] TFA (5.36 mL, 0.07 mol, 35 equiv.) was added dropwise to 10 mL of DMG0724 (5, 1.2239 g, 0.002 mol, 1.0 equiv.) dissolved in DCM. The mixture was stirred at room temperature for 2-4 hrs and monitored by TLC until the reaction was complete. 0.2 V of methanol was added and the mixture was stirred for 15 min. The mixture was concentrated by rotary evaporation and diluted with DCM. Most of the acid was neutralized with NaOH solution and then washed with saturated sodium bicarbonate solution. The organic phase was dried, filtered, and the solvent was removed by rotary evaporation to obtain intermediate 6.

[0653] DMG0624 (6, 0.9904 g, 0.002 mol, 1 equiv.) and DMAP were dissolved in 30 mL of DCM and added to a round-bottom flask. Succinic anhydride (2 equiv.) and triethylamine (6 equiv.) were added, and the mixture was reacted in a water bath at 30°C overnight. The reaction was monitored by TLC until completion. The product was washed with 1M HCl (2 x 30 mL) and deionized water (3 x 30 mL), dried over anhydrous magnesium sulfate, filtered, and concentrated in vacuo. After purification through a PE / EA column, 7 (376 mg, 26% overall yield) was obtained as a white solid.

[0654] DMG(C 18-0 )-COOH was named PL-0-4

[0655] 1 H NMR (500MHz, CDCl3, ppm): δ6.21(t,1H),5.10(t,1H),4.27(m,1H),4.13(m,1H),3.51( m,2H),2.70(m,2H),2.50(m,2H),2.32(m,4H),1.60(s,4H),1.26(m,56H),0.88(m,6H).

[0656] 5.DMG(C 18-1 )-COOH

[0657] Di-tert-butyl dicarbonate (2, 5.24 g, 0.024 mol, 1.1 equiv.) was dissolved in 10 mL of methanol and placed in a constant pressure dropping funnel. 3-Amino-1,2-propanediol (1, 2.0 g, 0.022 mol, 1.0 equiv.) was dissolved in 30 mL of methanol and placed in a round-bottom flask. The mixture was slowly added dropwise and allowed to react at room temperature for 2-4 hrs. The reaction was monitored by TLC until completion. The solvent was evaporated and the product was crystallized by slurrying with petroleum ether to obtain intermediate 3.

[0658] Oleic acid (4, 3.686 g, 0.0125 mol, 2.5 equiv.) was dissolved in 10 ml of dichloromethane and placed in a constant pressure dropping funnel. EDCI (2.5 g, 12.5 mol, 2.5 equiv.), TEA (1.265 g, 12.5 mol, 2.5 equiv.) and DMG0191 (3, 1 g, 5 mol, 1.0 equiv.) were dissolved in 40 ml of dichloromethane and placed in a three-necked flask and added dropwise slowly. After the addition was complete, the mixture was transferred to room temperature and reacted overnight. TLC was monitored until the reaction was complete. 120 ml of dichloromethane was added to dilute the reaction, and the mixture was washed with 1 M HCl (2*50 ml) and deionized water (2*50 ml) in sequence. The organic phase was dried, filtered and evaporated under reduced pressure. After column chromatography with PE / EA, intermediate 5 was obtained.

[0659] TFA (5.36 mL, 0.07 mol, 35 equiv.) was added dropwise to 20 mL of DMG0720 (5, 1.2239 g, 0.002 mol, 1.0 equiv.) dissolved in DCM. The mixture was stirred at room temperature for 4 hrs and monitored by TLC until the reaction was complete. The mixture was concentrated by rotary evaporation, diluted with DCM, and washed with saturated sodium bicarbonate solution. The organic phase was dried, filtered, and the solvent was removed by rotary evaporation to obtain intermediate 6.

[0660] DMG0620 (6, 0.9904 g, 0.002 mol, 1 equiv.) and DMAP were dissolved in 30 mL of DCM and added to a round-bottom flask. Succinic anhydride (2 equiv.) and triethylamine (6 equiv.) were added, and the mixture was reacted in a water bath at 30°C overnight. The reaction was monitored by TLC until completion. The product was washed with 1M HCl (2 x 30 mL) and deionized water (3 x 30 mL), dried over anhydrous magnesium sulfate, filtered, and concentrated in vacuo. After purification through a PE / EA column, 7 (302 mg, 21% overall yield) was obtained as a white solid.

[0661] DMG(C 18-1 )-COOH was named PL-0-5

[0662] 1 H NMR (500MHz, CDCl3, ppm): δ6.21(t,1H),5.34(m,4H)5.10(t,1H),4.27(m,1H),4.13(m,1H),3.51(m ,2H),2.70(m,2H),2.50(m,2H),2.32(m,4H),2.00(m,8H),1.60(s,4H),1.26(m,40H),0.88(m,6H).

[0663] 6.DMG(C 18-2 )-COOH

[0664] Di-tert-butyl dicarbonate (2, 5.24 g, 0.024 mol, 1.1 equiv.) was dissolved in 10 mL of methanol and placed in a constant pressure dropping funnel. 3-Amino-1,2-propanediol (1, 2.0 g, 0.022 mol, 1.0 equiv.) was dissolved in 30 mL of methanol and placed in a round-bottom flask. The mixture was slowly added dropwise and allowed to react at room temperature for 2-4 hrs. The reaction was monitored by TLC until completion. The solvent was evaporated and the product was crystallized by slurrying with petroleum ether to obtain intermediate 3.

[0665] Oleic acid (4, 3.686 g, 0.0125 mol, 2.5 equiv.) was dissolved in 10 ml of dichloromethane and placed in a constant pressure dropping funnel. EDCI (2.5 g, 12.5 mol, 2.5 equiv.), TEA (1.265 g, 12.5 mol, 2.5 equiv.) and DMG0191 (3, 1 g, 5 mol, 1.0 equiv.) were dissolved in 40 ml of dichloromethane and placed in a three-necked flask and added dropwise slowly. After the addition was complete, the mixture was transferred to room temperature and reacted overnight. TLC was monitored until the reaction was complete. 120 ml of dichloromethane was added to dilute the reaction, and the mixture was washed with 1 M HCl (2*50 ml) and deionized water (2*50 ml) in sequence. The organic phase was dried, filtered and evaporated under reduced pressure. After column chromatography with PE / EA, intermediate 5 was obtained.

[0666] TFA (5.36 mL, 0.07 mol, 35 equiv.) was added dropwise to 20 mL of DMG0720 (5, 1.2239 g, 0.002 mol, 1.0 equiv.) dissolved in DCM. The mixture was stirred at room temperature for 4 hrs and monitored by TLC until the reaction was complete. The mixture was concentrated by rotary evaporation, diluted with DCM, and washed with saturated sodium bicarbonate solution. The organic phase was dried, filtered, and the solvent was removed by rotary evaporation to obtain intermediate 6.

[0667] DMG0615 (6, 0.9904 g, 0.002 mol, 1 equiv.) and DMAP were dissolved in 30 mL of DCM and added to a round-bottom flask. Succinic anhydride (2 equiv.) and triethylamine (6 equiv.) were added, and the mixture was reacted in a water bath at 30°C overnight. The reaction was monitored by TLC until completion. The product was washed with 1M HCl (2 x 30 mL) and deionized water (3 x 30 mL), dried over anhydrous magnesium sulfate, filtered, and concentrated in vacuo. 7 was purified by column chromatography with PE / EA to afford 7 as a white solid (329 mg, 23% overall yield).

[0668] DMG(C 18-2 )-COOH was named PL-0-6

[0669] 1 H NMR (500MHz, CDCl3, ppm): δ6.21(t,1H),5.34(m,8H)5.10(t,1H),4.27(m,1H),4.13(m,1H),3.51(m,2H), 2.77(m,4H),2.70(m,2H),2.50(m,2H),2.32(m,4H),2.00(m,8H),1.60(s,4H),1.26(m,28H),0.88(m,6H).

[0670] 2.2 Preparation of peptoids and peptoid lipids using the bromoacetic acid / primary amine monomer method

[0671] Synthesis Method 1: A series of peptoids and peptoid lipids were prepared by alternately coupling bromoacetic acid and primary amine monomers on a solid phase resin. This synthesis method consists of the following steps:

[0672] Example 1: Preparation of Peptoids PL-1-0 and PL-1-1 Using Rink Amide MBHA Resin

[0673] Step 1: Resin swelling

[0674] 500 mg of Rink resin (loading capacity 0.318 mmol / g) was added to DMF (10 Vol, 5 mL), and after swelling with microwave, the waste liquid was discharged and the resin was washed with DMF three times.

[0675] Step 2: Fmoc removal

[0676] 5 mL of a 20% piperidine-DMF mixture was added to the resin, microwaved for 5 min, and then discarded. The deprotection was repeated once for 10 min. The resin was washed with DMF 5 times.

[0677] Step 3: Bromoacetic acid condensation

[0678] Weigh bromoacetic acid (10 eq, 222 mg) and DIC (10 eq, 246 uL) and dissolve them in 5 mL of DMF. Mix well and add to the resin. Heat at 90°C in a microwave oven for 1-10 min, or at 25°C for 30 min before discarding. Wash the resin with DMF 5 times.

[0679] Step 4: Primary amine substitution (taking monomer 1 as an example)

[0680] Weigh monomer 1 (8 eq, 379 mg) and DIPEA (24 eq, 665 uL) and dissolve them in 4 mL of DMF. Mix well and add to the resin. Heat at 90°C in a microwave oven for 1-10 min, or at 25°C for 30 min before discarding.

[0681] Step 5: Repeat steps (3) and (4) to increase the peptoid until the coupling of the target peptoid sequence is completed;

[0682] The resin obtained in step 5 is further subjected to lipid coupling (step 6) to synthesize peptoid lipids; step 6 is omitted and the resin is directly cleaved to synthesize the target peptoid.

[0683] Step 6: Lipid Coupling

[0684] Taking the coupling of DMG lipids as an example: weigh 300 mg of the weighted resin obtained in step 5, and at the same time weigh DMG(C14)-COOH (5eq, 292 mg) and DIC (5eq, 74uL) and dissolve them in 2.5 mL of THF. Mix well and add to the resin. Heat to 90°C in a microwave for 1-10 minutes, or react at 25°C for 30 minutes and then discard. Wash the resin with THF 5 times and with DMF 5 times.

[0685] Step 7: Resin cutting and precipitation

[0686] After drying the resin at room temperature for 10 min, 20 Vol of freshly prepared cleavage reagent TFA / TIS / H2O (5.7 mL / 0.15 mL / 0.15 mL) was added to the resin and reacted at room temperature for 3 hrs. The TFA cleavage solution was collected, precipitated with icy ether three times, and centrifuged to obtain a crude product.

[0687] The target peptoid or peptoid lipid can be obtained by subjecting the crude product to corresponding HPLC separation (Unisil C8, 10×250mm 10um, 5% to 100% mobile phase B (mobile phase A: water containing 0.1% TFA, B: ACN containing 0.1% TFA)). The preparation method is Time: 0-60-65-70-75min, B%: 5-100-100-100-5-5.

[0688] PL-1-0; molecular formula: C 45 H 83 N 11 O 15 , molecular weight: 1017.61, LCMS (m / z) = 509.90 [M+2H] 2+ 、340.30[M+3H] 3+ 、255.40[M+4H] 4+ .

[0689] PL-1-1; molecular formula: C 80 H 146 N 12 O 21 , molecular weight: 1611.07, LCMS (m / z) = 806.70 [M+2H] 2+ 、538.20[M+3H] 3+ 、403.90[M+4H] 4+ .

[0690] Example 2.2.1: Preparation of Peptoids PL-2-0 and PL-2-1 Using Rink Resin

[0691] PL-2-0; molecular formula: C 90 H163 N 21 O 30 , molecular weight: 2018.19, LCMS (m / z) = 673.90 [M+3H] 3+ 、505.70[M+4H] 4+ 、404.80[M+5H] 5+ .

[0692] PL-2-1; molecular formula: C 125 H 226 N 22 O 36 , molecular weight: 2611.65, LCMS (m / z) = 1307.70 [M+2H] 2+ 、871.70[M+3H] 3+ 、654.10[M+4H] 4+ .

[0693] 1 H NMR (400MHz, CD3OD) δ (ppm): 5.12 ~ 5.04 (m, 1H), 4.67 ~ 4.56 (m, 2H), 4.48 ~ 4.28 (m, 20H), 4.24 ~ 4.03 (m, 20H), 3.95 ~ 3.65 (m, 20H), 3.55 ~ 3.45 ( m,20H),3.42~3.18(m,62H),2.69~2.55(m,4H),2.38~2.31(m,4H),2. 14~1.88(m,20H),1.65~1.54(m,4H),1.39~1.22(m,40H),0.88(t,6H).

[0694] Example 2.2.2: Preparation of Peptide PL-3 Using Rink Resin

[0695] PL-3, molecular formula: C 122 H 224 N 22 O 32 , molecular weight: 2509.66, LCMS (m / z) = 1255.90 [M+2H] 2+ 、837.80[M+3H] 3+ 、628.60[M+4H] 4+ .

[0696] Example 2.2.3: Preparation of Peptide PL-4 Using Rink Resin

[0697] PL-4, molecular formula: C 129 H 234 N 22 O 36, molecular weight: 2667.72, LCMS (m / z) = 1336.20 [M+2H] 2+ 、890.30[M+3H] 3+ 、668.40[M+4H] 4+ .

[0698] 1 H NMR (400MHz, CD3OD) δ (ppm): 5.18 ~ 5.07 (m, 1H), 4.56 ~ 4.45 (m, 2H), 4.3 ~ 4.22 (m, 20H), 4.22 ~ 4.06 (m, 20H), 3.82 ~ 3.61 (m, 20H), 3.54 ~ 3.36 ( m,20H),3.26~3.17(m,62H),2.61~2.39(m,4H),2.37~2.25(m,4H),2. 07~1.91(m,20H),1.63~1.51(m,4H),1.35~1.22(m,48H),0.88(t,6H).

[0699] Example 2.2.4: Preparation of Peptide PL-5 Using Rink Resin

[0700] PL-5, molecular formula: C 133 H 242 N 22 O 36 , molecular weight: 2723.78.

[0701] 1 H NMR (400MHz, CD3OD) δ (ppm): 5.16 ~ 5.01 (m, 1H), 4.56 ~ 4.45 (m, 2H), 4.44 ~ 4.22 (m, 20H), 4.22 ~ 4.06 (m, 20H), 3.81 ~ 3.62 (m, 20H), 3.54 ~ 3.39 ( m,20H),3.26~3.18(m,62H),2.65~2.49(m,4H),2.35~2.25(m,4H),2. 07~1.91(m,20H),1.64~1.52(m,4H),1.36~1.22(m,56H),0.88(t,6H).

[0702] Example 2.2.5: Preparation of Peptide PL-6 Using Rink Resin

[0703] PL-6, molecular formula: C 133 H 238 N 22 O 36 , molecular weight: 2719.75.

[0704] 1H NMR (400MHz, CD3OD) δ (ppm): 5.55~5.20 (m, 4H), 5.10~5.01 (m, 1H), 4.57~4 .45(m,2H),4.39~4.23(m,20H),4.23~4.05(m,20H),3.80~3.61(m,20H),3. 53~3.39(m,20H),3.26~3.17(m,62H),2.66~2.53(m,4H),2.35~2.27(m,4H ), 2.07~1.88(m,20H), 1.61~1.47(m,4H), 1.36~1.22(m,48H), 0.88(t,6H).

[0705] Example 2.2.6: Preparation of Peptide PL-7 Using Rink Resin

[0706] PL-7, molecular formula: C 133 H 234 N 22 O 36 , molecular weight: 2715.72.

[0707] 1 H NMR (400MHz, CD3OD) δ (ppm): 5.57~5.30 (m, 8H), 5.11~5.04 (m, 1H), 4.57~4.46 ( m,2H),4.36~4.20(m,20H),4.17~4.00(m,20H),3.84~3.59(m,20H),3.58~3.42( m,20H),3.28~3.20(m,62H),2.80~2.73(m,4H),2.67~2.57(m,4H),2.38~2.32( m,4H), 2.09~1.93(m,20H), 1.65~1.50(m,4H), 1.38~1.26(m,36H), 0.88(t,6H).

[0708] Example 2.2.7: Preparation of Peptoids PL-8-0 and PL-8-1 Using Rink Resin

[0709] PL-8-0, molecular formula: C 135 H 243 N 31 O 45 , molecular weight: 3018.77, LCMS (m / z) = 1007.60 [M+3H] 3+ 、755.90[M+4H] 4+ 、604.95[M+5H] 5+ .

[0710] PL-8-1, molecular formula: C 170 H 306 N 32 O 51 , molecular weight: 3612.23, LCMS (m / z) = 1204.90 [M+3H] 3+ 、904.30[M+4H] 4+ 、724.50[M+5H] 5+ .

[0711] Example 2.2.8: Preparation of Peptoids PL-9-0 and PL-9-1 Using Rink Resin

[0712] PL-9-0, molecular formula: C 180 H 323 N 41 O 60 , molecular weight: 4019.35, LCMS (m / z) = 805.20 [M+5H] 5+ 、669.80[M+6H] 6+ 、575.41[M+7H] 7+ ;

[0713] PL-9-1, molecular formula: C 215 H 386 N 42 O 66 , molecular weight: 4612.81, LCMS (m / z) = 1538.60 [M+3H] 3+ 、1154.20[M+4H] 4+ 、924.00[M+5H] 5+ .

[0714] Example 2.2.9: Preparation of Peptoids PL-10-0 and PL-10-1 Using Rink Resin

[0715] PL-10-0, molecular formula: C 110 H 203 N 21 O 30 , molecular weight: 2298.50, LCMS (m / z) = 767.30 [M+3H] 3+ 、575.61[M+4H] 4+ 、460.80[M+5H] 5+ ;

[0716] PL-10-1, molecular formula: C 145 H 266 N 22 O 36, molecular weight: 2891.97, LCMS (m / z) = 724.40 [M+4H] 4+ 、579.40[M+5H] 5+ 、483.20[M+6H] 6+ .

[0717] 1 H NMR (400MHz, CD3OD) δ (ppm): 5.10 ~ 5.01 (m, 1H), 4.63 ~ 4.52 (m, 2H), 4.42 ~ 4.06 (m, 20H), 3.55 ~ 3.44 (m, 20H), 3.43 ~ 3.31 (m, 40H), 3.18 ~ 3.03 ( m,62H),2.67~2.52(m,4H),2.52~2.38(m,20H),2.37~2.30(m,4H),2. 11~1.91(m,40H),1.65~1.53(m,4H),1.37~1.21(m,40H),0.88(t,6H).

[0718] Example 2.2.10: Preparation of Peptide PL-11 Using Rink Resin

[0719] PL-11, molecular formula: C 200 H 366 N 32 O 51 , molecular weight: 4032.7, LCMS (m / z) = 673.00 [M+6H] 6+ 、577.10[M+7H] 7+ 、504.90[M+8H] 8+ .

[0720] Example 2.2.11: Preparation of Peptide PL-12 Using Rink Resin

[0721] PL-12, molecular formula: C 255 H 466 N 42 O 66 , molecular weight: 5173.44, LCMS (m / z) = 863.30 [M+6H] 6+ 、740.10[M+7H] 7+ 、647.60[M+8H] 8+ .

[0722] Example 2.2.12: Preparation of Peptoids PL-2-2, PL-2-3, and PL-2-4 Using Rink Resin

[0723] PL-2-2; molecular formula: C 134 H 240N 26 O 41 , molecular weight: 2871.54, LCMS (m / z) = 957.60 [M+3H] 3+ 、718.60[M+4H] 4+ 、575.20[M+5H] 5+ .

[0724] PL-2-3; molecular formula: C 100 H 182 N 22 O 31 , molecular weight: 2188.68, LCMS (m / z) = 730.56 [M+3H] 3+ 、548.17[M+4H] 4+ 、438.74[M+5H] 5+ .

[0725] PL-2-4; molecular formula: C 107 H 176 N 22 O 33 , molecular weight: 2298.71, LCMS (m / z) = 767.23 [M+3H] 3+ 、575.67[M+4H] 4+ 、460.74[M+5H] 5+ .

[0726] Example 2.2.13: Preparation of Peptoids PL-10-2, PL-10-3, and PL-10-4 Using Rink Resin

[0727] PL-10-2; molecular formula: C 142 H 264 N 22 O 32 , molecular weight: 2791.80, LCMS (m / z) = 931.10 [M+3H] 3+ 、698.41[M+4H] 4+ 、558.93[M+5H] 5+ .

[0728] PL-10-3; molecular formula: C 127 H 216 N 22 O 33 , molecular weight: 2579.25, LCMS (m / z) = 860.75 [M+3H] 3+ 、645.81[M+4H] 4+ 、516.85[M+5H] 5+ .

[0729] PL-10-4; molecular formula: C 128 H 237 N 21 O 31 , molecular weight: 2566.42, LCMS (m / z) = 642.02 [M+4H] 4+ 、513.72[M+5H] 5+ 、428.21[M+6H] 6+ .

[0730] Example 2.2.14: Preparation of Peptoids PL-25, PL-26-0, and PL-26-1 Using Rink Resin

[0731] PL-25; molecular formula: C 90 H 166 N 12 O 21 , molecular weight: 1752.38, LCMS (m / z) = 876.49 [M+2H] 2+ 、584.55[M+3H] 3+ 、438.58[M+4H] 4+ .

[0732] PL-26-0; molecular formula: C 134 H 246 N 20 O 33 , molecular weight: 2665.55, LCMS (m / z) = 889.23 [M+3H] 3+ 、667.08[M+4H] 4+ 、533.80[M+5H] 5+ .

[0733] PL-26-1; molecular formula: C 131 H 244 N 20 O 29 , molecular weight: 2563.50, LCMS (m / z) = 854.71 [M+3H] 3+ 、641.11[M+4H] 4+ 、513.60[M+5H] 5+ .

[0734] 2.3 Preparation of peptoid / polypeptide mixed peptides

[0735] Example 2.3.1: Preparation of Peptoids PL-13-0 and PL-13-1 Using Rink Resin

[0736] Step 1: Resin swelling

[0737] Take 500 mg of Rink resin (loading capacity 0.318 mmol / g): add DMF (10 Vol, 5 mL), swell with microwave, discharge the waste liquid, and wash the resin with DMF three times.

[0738] Step 2: Fmoc removal

[0739] 5 mL of a 20% piperidine-DMF mixture was added to the resin, microwaved for 5 min, and then discarded. The deprotection was repeated once for 10 min. The resin was washed with DMF 5 times.

[0740] Step 3: Bromoacetic acid condensation

[0741] Weigh bromoacetic acid (10 eq, 222 mg) and DIC (10 eq, 246 uL) and dissolve them in 5 mL of DMF. Mix well and add to the resin. Heat at 90°C in a microwave oven for 1-10 min, or at 25°C for 30 min before discarding. Wash the resin with DMF 5 times.

[0742] Step 4: Primary amine substitution (taking monomer 1 as an example)

[0743] Weigh monomer 1 (8 eq, 379 mg) and DIPEA (24 eq, 665 uL) and dissolve them in 4 mL of DMF. Mix well and add to the resin. Heat to 90°C in a microwave oven for 1-10 min, or react at 25°C for 30 min before discarding. Wash the resin with DMF 5 times.

[0744] Step 5: Amino acid condensation: Weigh Fmoc-Gly-OH (8 eq, 378 mg) and DIC (8 eq, 197 uL), dissolve in 4 mL of DMF, mix well, and add to the resin. Heat to 90°C in a microwave for 1-10 min, or react at 25°C for 30 min and then discard. Wash the resin with DMF 5 times.

[0745] Step 6: Fmoc removal

[0746] 5 mL of a 20% piperidine-DMF mixture was added to the resin, microwaved for 5 min, and then discarded. The deprotection was repeated once for 10 min. The resin was washed with DMF 5 times.

[0747] Step 7: Repeat steps (3), (4), (5), and (6) to increase the peptoid until the coupling of the target peptoid sequence is completed;

[0748] The resin obtained in step 7 is further coupled with lipids (step 8) to synthesize peptoid lipids; step 8 is omitted and the resin is directly cleaved to synthesize the target peptoid.

[0749] Step 8: Lipid Coupling

[0750] Taking the coupling of DMG lipids as an example: weigh 300 mg of the weighted resin obtained in step 5, and at the same time weigh DMG(C14)-COOH (5eq, 292 mg) and DIC (5eq, 74uL) and dissolve them in 2.5 mL of THF. Mix well and add to the resin. Heat to 90°C in a microwave for 1-10 minutes, or react at 25°C for 30 minutes and then discard. Wash the resin with THF 5 times and with DMF 5 times.

[0751] Step 9: Resin cutting and precipitation

[0752] After drying the resin at room temperature for 10 min, 20 Vol of freshly prepared cleavage reagent TFA / TIS / H2O (5.7 mL / 0.15 mL / 0.15 mL) was added to the resin and reacted at room temperature for 3 hrs. The TFA cleavage solution was collected, precipitated with icy ether three times, and centrifuged to obtain a crude product.

[0753] The target peptoids or peptoid lipids were obtained by HPLC separation of the crude product (Unisil C8, 10×250 mm 10 μm, 5% to 100% mobile phase B (mobile phase A: water containing 0.1% TFA, B: ACN containing 0.1% TFA)), preparation method (5→100→100→5→5B%), Time / min (0→60→70→80→90).

[0754] The product of the five-cycle monomer 1 / Gly is named PL-13-0, with the molecular formula: C 55 H 98 N 16 O 20 , molecular weight: 1302.71, LCMS (m / z) = 652.40 [M+2H] 2+ 、435.30[M+3H] 3+ 、326.70[M+4H] 4+ ;

[0755] PL-13-1, molecular formula: C 90 H 161 N 17 O 26 , molecular weight: 1896.18, LCMS (m / z) = 950.10 [M+2H] 2+ 、633.20[M+3H] 3+ 、475.20[M+4H] 4+ .

[0756] Example 2.3.2: Preparation of Peptoids PL-14-0 and PL-14-1 Using Rink Resin

[0757] The product of ten cycles of monomer 1 / Gly is named PL-14-0, with the molecular formula: C 110 H 193 N 31 O 40 , molecular weight: 2588.40, LCMS (m / z) = 863.90 [M+3H] 3+ 、648.30[M+4H] 4+ 、518.80[M+5H] 5+ ;

[0758] PL-14-1, molecular formula: C 145 H 256 N 32 O 46 , molecular weight: 3181.87, LCMS (m / z) = 1061.20 [M+3H] 3+ 、796.60[M+4H] 4+ 、638.00[M+5H] 5+ .

[0759] Example 2.3.3: Preparation of Peptoids PL-15-0 and PL-15-1 Using Rink Resin

[0760] The product of the fifteen-cycle monomer 1 / Gly is named PL-15-0, with the molecular formula: C 165 H 288 N 46 O 60 , molecular weight: 3874.09, LCMS (m / z) = 792.50 [M+2K + +5H] 5+ 、660.60[M+2K + +6H] 6+ 、566.30[M+2K + +7H] 7+ ;

[0761] PL-15-1, molecular formula: C 200 H 351 N 47 O 66 , molecular weight: 4467.56, LCMS (m / z) = 1117.90 [M+4H] 4+ 、894.60[M+5H] 5+ 、745.20[M+6H] 6+ .

[0762] Example 2.3.4: Preparation of Peptoids PL-16-0 and PL-16-1 Using Rink Resin

[0763] The product of ten cycles of monomer 1 / Sar is named PL-16-0, with the molecular formula: C 120 H 213 N 31 O 40 , molecular weight: 2728.56, LCMS (m / z) = 910.60 [M+3H] 3+ 、683.30[M+4H] 4+ 、546.80[M+5H] 5+ ;

[0764] PL-16-1, molecular formula: C 155 H 276 N 32 O 46 , molecular weight: 3322.02, LCMS (m / z) = 1108.70 [M+3H] 3+ 、831.70[M+4H] 4+ 、665.70[M+5H] 5+ .

[0765] Example 2.3.5: Preparation of Peptoids PL-17-0 and PL-17-1 Using Rink Resin

[0766] PL-17-0, molecular formula: C 180 H 318 N 46 O 60 , molecular weight: 4084.32, LCMS (m / z) = 818.20 [M+5H] 5+ 、682.00[M+6H] 6+ 、584.72[M+7H] 7+ ;

[0767] PL-17-1, molecular formula: C 215 H 381 N 47 O 66 , molecular weight: 4677.79, LCMS (m / z) = 936.80 [M+5H] 5+ 、780.90[M+6H] 6+ 、669.50[M+7H] 7+ .

[0768] Example 2.3.6: Preparation of Peptide PL-18 Using Rink Resin

[0769] PL-18, molecular formula: C 59 H 103 N 15 O 19, molecular weight: 1325.76, LCMS (m / z) = 663.90 [M+2H] 2+ 、443.00[M+3H] 3+ 、332.50[M+4H] 4+ .

[0770] Example 2.3.7: Preparation of Peptide PL-27 Using Rink Resin

[0771] PL-27; molecular formula: C 126 H 227 N 23 O 34 , molecular weight: 2608.33, LCMS (m / z) = 870.00 [M+3H] 3+ 、652.90[M+4H] 4+ 、522.70[M+5H] 5+ .

[0772] Example 2.3.8: Preparation of Peptide PL-28 Using Rink Resin

[0773] PL-28; molecular formula: C 139 H 250 N 26 O 38 , molecular weight: 2893.67, LCMS (m / z) = 724.30 [M+4H] 4+ 、579.70[M+5H] 5+ 、483.20[M+6H] 6+ .

[0774] Example 2.3.9: Preparation of Peptide PL-29 Using Rink Resin

[0775] PL-29; molecular formula: C 152 H 273 N 29 O 42 , molecular weight: 3179.02, LCMS (m / z) = 795.30 [M+4H] 4+ 、636.60[M+5H] 5+ 、530.80[M+6H] 6+ .

[0776] Example 2.3.10: Preparation of Peptide PL-30 Using Rink Resin

[0777] PL-30; molecular formula: C 165 H 296 N 32 O 46, molecular weight: 3464.36, LCMS (m / z) = 867.00 [M+4H] 4+ 、693.90[M+5H] 5+ 、578.30[M+6H] 6+ .

[0778] Example 2.4 Preparation of Side Chain Protected Peptoids and Peptoid Lipids

[0779] Example 2.4.1: Preparation of Peptoids PL-19-0, PL-19-1, and PL-19-2 Using 2-Cl-Trt-Cl Resin

[0780] Step 1: Resin swelling

[0781] 385 mg of 2-Cl-Trt-Cl resin (loading 1.3 mmol / g) was added to DCM (10 Vol, 4 mL), and after swelling with microwaves, the waste liquid was discharged and the resin was washed with DCM three times.

[0782] Step 2: Alkali treatment of resin

[0783] Weigh bromoacetic acid (3 eq, 209 mg) and DIPEA (15 eq, 1.3 ml) and dissolve them in 2.6 mL of DCM. Mix well and add to the resin. React at room temperature (25°C) for 2-3 hours and then drain. Wash the resin with DCM 5 times.

[0784] Step 3: Methanol-terminated resin

[0785] Add 4 mL of end-capping solution DCM / methanol / DIPEA (3.2 mL / 600 uL / 200 uL) to the resin, react at room temperature for 10-50 min, then drain and wash the resin with DCM five times; the degree of substitution here is set to 0.35 mmol / g.

[0786] Step 4: Primary amine substitution (taking monomer 1 as an example)

[0787] Weigh monomer 1 (8 eq, 321 mg) and DIPEA (24 eq, 564 uL) and dissolve them in 4 mL of DMF. Mix well and add to the resin. Heat to 90°C in a microwave oven for 1-10 min, or react at 25°C for 30 min before discarding. Wash the resin with DMF 5 times.

[0788] Step 5: Bromoacetic acid condensation

[0789] Weigh bromoacetic acid (10 eq, 187 mg) and DIC (10 eq, 208 uL) and dissolve them in 5 mL of DMF. Mix well and add to the resin. Heat to 90°C in a microwave oven for 1-10 min, or react at 25°C for 30 min and then discard. Wash the resin with DMF 5 times.

[0790] Step 6: Primary Amine Substitution

[0791] Weigh monomer 1 (8 eq, 321 mg) and DIPEA (24 eq, 564 uL) and dissolve them in 4 mL of DMF. Mix well and add to the resin. Heat to 90°C in a microwave oven for 1-10 min, or react at 25°C for 30 min before discarding. Wash the resin with DMF 5 times.

[0792] Step 7: Repeat steps (5) and (6) to increase the peptoid until the coupling of the target peptoid sequence is completed;

[0793] The resin obtained in step 7 is further capped (step 8) to synthesize a capped peptoid;

[0794] The resin obtained in step 7 is further subjected to lipid coupling (step 9) to synthesize peptoid lipids;

[0795] Omit steps 8 and 9 and proceed directly to resin cleavage to synthesize the target peptoid.

[0796] Step 8: Resin Capping

[0797] Weigh acetic acid (10 eq, 20 uL) and DIC (10 eq, 54 uL) and dissolve them in 1.2 mL of DMF. Mix well and add to 100 mg of resin. Heat at 90°C in a microwave oven for 1-10 min, or at 25°C for 30 min and then discard. Wash the resin with DMF 5 times.

[0798] Step 9: Lipid Coupling

[0799] Taking the coupling of DMG lipids as an example: weigh 100 mg of the weighted resin obtained in step 7, and weigh DMG(C14)-COOH (5 eq, 214 mg) and DIC (5 eq, 54 uL) and dissolve them in 2.0 mL of THF. Mix well and add to the resin. Heat to 90°C in a microwave for 1-10 minutes, or react at 25°C for 30 minutes and then discard. Wash the resin with THF 5 times and with DMF 5 times.

[0800] Step 10: Resin cleavage and precipitation (side chain full protection)

[0801] After drying the resin at room temperature for 10 min, add 20 Vol of freshly prepared cleavage reagent TFA / TIS / DCM (40 uL / 200 uL / 3.76 mL) to the resin and react at room temperature for 1-10 min. Collect the TFA cleavage solution and repeat this operation 3 times. Precipitate with icy ether 3 times and centrifuge to obtain the crude product.

[0802] Step 11: Resin cleavage and precipitation (side chain deprotection)

[0803] After drying the resin at room temperature for 10 min, 20 Vol of freshly prepared cleavage reagent TFA / TIS / H2O (3.8 mL / 100 uL / 100 uL) was added to the resin and reacted at room temperature for 3 hrs. The TFA cleavage solution was collected, precipitated with icy ether three times, and centrifuged to obtain a crude product.

[0804] The target peptoids or peptoid lipids were obtained by HPLC separation of the crude product (Unisil C8, 10×250 mm 10 μm, 5% to 100% mobile phase B (mobile phase A: water containing 0.1% TFA, B: ACN containing 0.1% TFA)), preparation method (5→100→100→5→5B%), Time / min (0→60→70→80→90).

[0805] PL-19-0, molecular formula: C 67 H 129 N 10 O 17 , molecular weight: 1345.95, LCMS (m / z) = 337.50 [M+4H] 4+ ;

[0806] PL-19-1, molecular formula: C 100 H 190 N 11 O 22 , molecular weight: 1897.41, LCMS (m / z) = 647.30 [M+HCOO - +3H] 3+ 、474.30[M+4H] 4+ 、379.6[M+5H] 5+ ;

[0807] PL-19-2, molecular formula: C 80 H 145 N 11 O 22 , molecular weight: 1612.06, LCMS (m / z) = 807.10 [M+2H] 2+ 、538.50[M+3H] 3+ 、404.10[M+4H] 4+ .

[0808] Example 2.4.2: Preparation of Peptoids PL-20-0, PL-20-1, and PL-20-2 Using 2-Cl-Trt-Cl Resin

[0809] PL-20-0, molecular formula: C 76 H147 N 12 O 19 , molecular weight: 1532.09, LCMS (m / z) = 382.90 [M+4H] 4+ 、306.50[M+5H] 5+ ;

[0810] PL-20-1, molecular formula: C 111 H 210 N 13 O 25 , molecular weight: 2125.55, LCMS (m / z) = 723.40 [M+HCOO - +3H] 3+ 、531.30[M+4H] 4+ 、425.30[M+5H] 5+ ;

[0811] PL-20-2, molecular formula: C 86 H 157 N 13 O 23 , molecular weight: 1740.15, LCMS (m / z) = 871.20 [M+2H] 2+ 、581.20[M+3H] 3+ 、436.20[M+4H] 4+ .

[0812] Example 2.4.3: Preparation of Peptoids PL-21-0 and PL-21-1 Using 2-Cl-Trt-Cl Resin

[0813] PL-21-0, molecular formula: C 108 H 208 N 13 O 21 , molecular weight: 2023.56, LCMS (m / z) = 689.10 [M+HCOO - +3H] 3+ 、505.80[M+4H] 4+ 、404.90[M+5H] 5+ ;

[0814] PL-21-1, molecular formula: C 83 H 155 N 13 O 19 , molecular weight: 1638.16, LCMS (m / z) = 820.20 [M+2H] 2+ 、547.20[M+3H] 3+ 、410.70[M+4H] 4+ .

[0815] Example 2.4.4: Preparation of Peptide PL-22 Using 2-Cl-Trt-Cl Resin

[0816] PL-22, molecular formula: C 89 H 148 N 11 O 18 , molecular weight: 1691.07, LCMS (m / z) = 422.70 [M+4H] 4+ 、338.40[M+5H] 5+ .

[0817] Example 2.4.5: Preparation of Peptide PL-23 Using 2-Cl-Trt-Cl Resin

[0818] PL-23, molecular formula: C 69 H 132 N 11 O 18 , molecular weight: 1402.97, LCMS (m / z) = 350.60 [M+4H] 4+ 、280.60[M+5H] 5+ .

[0819] Example 2.5 Preparation of peptoids and peptoid lipids via the Fmoc route

[0820] Example 2.5.1: Preparation of Peptide PL-24 Using Rink Resin

[0821] Step 1: Resin swelling

[0822] 400 mg of Rink resin (loading capacity 0.318 mmol / g) was added to DMF (10 Vol, 5 mL), and after swelling with microwave, the waste liquid was discharged and the resin was washed with DMF three times.

[0823] Step 2: Fmoc removal

[0824] 4 mL of a 20% piperidine-DMF mixture was added to the resin, microwaved for 5 min, and then discarded. The deprotection was repeated once for 10 min, and the resin was washed with DMF 5 times.

[0825] Step 3: Monomer condensation (taking Fmoc-497-tBu monomer as an example)

[0826] Weigh Fmoc-497-OH (5 eq, 367 mg), PyBop (5 eq, 331 mg), and DIPEA (5 eq, 112 uL) and dissolve them in 3 mL of DMF. Mix well and add to the resin. Heat to 90°C in a microwave for 1-10 min, or react at 25°C for 30 min and then discard. Wash the resin with DMF 5 times.

[0827] Step 4: Fmoc removal

[0828] 4 mL of a 20% piperidine-DMF mixture was added to the resin, microwaved for 5 min, and then discarded. The deprotection was repeated once for 10 min, and the resin was washed with DMF 5 times.

[0829] Step 5: Repeat steps (3) and (4) to increase the peptoid until the coupling of the target peptoid sequence is completed.

[0830] Step 6: Resin cutting and precipitation

[0831] After drying the resin at room temperature for 10 min, 20 Vol of freshly prepared cleavage reagent TFA / TIS / H2O (9.5 mL / 2.5 mL / 2.5 mL) was added to the resin and reacted at room temperature for 3 hrs. The TFA cleavage solution was collected, precipitated with icy ether three times, and centrifuged to obtain a crude product.

[0832] The target peptoid was obtained by performing corresponding HPLC separation on the crude product (Unisil C8, 10×250 mm 10 μm, 5% to 100% mobile phase B (mobile phase A: water containing 0.1% TFA, B: ACN containing 0.1% TFA)), preparation method (5→100→100→5→5B%), Time / min (0→60→70→80→90).

[0833] The product is named PL-24, molecular formula: C 60 H 93 N 11 O 17 , molecular weight: 1239.68, LCMS (m / z) = 620.90 [M+2H] 2+ 、414.30[M+3H] 3+ 、311.00[M+4H] 4+ .

[0834] The analytical method information for the HPLC characterization of the following molecules is as follows:

[0835] Analysis Method 0:

[0836] HPLC preparation column model (Waters C18, 4.6 x 150mm 5um), (mobile phase A: 0.1% TFA + 99.9% H2O,

[0837] B: 0.1% TFA + 99.9% ACN, volume ratio; flow rate 0.7 mL / min;

[0838] Mobile phase conditions: (5→5→100→100→5→5B%),

[0839] Time / min(0→2→10→12→12.1→15).

[0840] Analysis Method 1:

[0841] HPLC analytical column model (C8, 4.6 x 150 mm, 5 μm), (mobile phase A: 0.1% TFA + 99.9% H2O,

[0842] B: 0.1% TFA + 99.9% ACN, volume ratio; flow rate 0.7 mL / min.

[0843] Mobile phase conditions:

[0844] (5→5→100→100→5→5B%),

[0845] Time / min(0→2→10→12→12.1→15).

[0846] Analysis Method 2:

[0847] HPLC analytical column model (C8, 4.6 x 150 mm, 5 μm), (mobile phase A: 0.1% TFA + 99.9% H2O,

[0848] B: 0.1% TFA + 99.9% ACN, volume ratio; flow rate 0.7 mL / min.

[0849] Mobile phase conditions:

[0850] (55→55→75→75→55→55B%),

[0851] Time / min(0→2→12→15→17→20).

[0852] Analysis Method 3:

[0853] HPLC analytical column model (C8, 4.6 x 150 mm, 5 μm), (mobile phase A: 0.1% TFA + 99.9% H2O,

[0854] B: 0.1% TFA + 99.9% ACN, volume ratio; flow rate 0.7 mL / min.

[0855] Mobile phase conditions:

[0856] (50→50→65→65→50→50B%),

[0857] Time / min(0→5→35→40→42→50).

[0858] Peptide and amino acid alternating copolymerization peptide, and corresponding peptoid lipid compound

[0859] Peptide compounds with fully protected side groups (carboxyl groups) and peptide lipid compounds (intermediates)

[0860] C-terminal Lys side chain fully protected peptide

[0861] C-terminal Cys-terminated side chain fully protected peptoid

[0862] Carbon-terminal Gly-terminated side chain fully protected peptoid

[0863] Peptoids and peptoid lipid compounds prepared using Fmoc monomers

[0864] Example 3: Lipid Nanoparticles Containing Peptoid Lipids

[0865] 3.1 LNP preparation, physicochemical properties testing and in vitro transfection

[0866] LNPs were prepared by high-speed mixing of an ethanolic lipid solution (containing ionizable lipids, phospholipids, cholesterol, and peptoid lipids or PEG-DMG) with an aqueous mRNA solution (0.2 mg / ml, 100 mM citric acid buffer, pH 4.0) in a T-type mixer. The flow rate ratio of the aqueous phase to the alcohol phase was 3:1, and the total flow rate at the outlet of the T-type mixer was maintained at 16 ml / min (the flow rate of the RNA-aqueous phase channel was 12 ml / min, and the flow rate of the lipid-alcohol phase channel was 4 ml / min) to complete the LNP-mRNA preparation. After the mixing preparation, the LNP was dialyzed to remove the ethanol in the solution, and the final sample was prepared by concentration and filtration. The particle size and distribution of the LNPs were measured by dynamic light scattering (DLS, Brookhaven), and the mRNA encapsulation efficiency was calculated by measuring the mRNA concentration before and after demulsification using a Ribogreen detection kit. The corresponding LNP formulation composition and physicochemical properties are summarized in the following table:

[0867] Table 1. LNP formulation composition and physicochemical properties

[0868] SM102: 1-Octylnonyl 8-[(2-hydroxyethyl)[6-O-6-(undecyloxy)hexyl]amino]-octanoate

[0869] Lipid A:

[0870] cKK-e12:

[0871] (Yizhou Dong et al. PNAS 2014, 111, 3955–3960)

[0872] RCB 4-8:

[0873] (Bowen Li et al. Nature Biotechnology 2023, 41, 1410–1415 (2023))

[0874] Lipid B:

[0875] Lipid C:

[0876] Lipid D:

[0877] Lipid E:

[0878] Lipid F:

[0879] Lipid G:

[0880] MC3: 4-(N,N-dimethylamino)butyric acid (dilinoleyl) methyl ester

[0881] PEG-DMG: Dimyristoylglycerol-Polyethylene Glycol 2000

[0882] DOPE: dioleoylphosphatidylethanolamine

[0883] DSPC: Distearoylphosphatidylcholine

[0884] DOTAP: (2,3-dioleyloxypropyl)trimethylammonium chloride

[0885] EPC 14:0:

[0886] Analysis of the data in Table 1 and Figure 3 reveals that the peptoid lipids listed above can form nanoparticles with various ionizable lipids, and the particle size dispersion is also small. In vitro transfection experiments show that for the same ionizable lipid, by selecting and changing the chain length of the peptoid segment of the peptoid lipid, the resulting LNPs have different in vitro mRNA delivery efficiencies. LNPs formed with the participation of peptoid lipids can achieve delivery efficiencies similar to or even several times greater than those of PEG-LNPs. This conclusion is also supported by the in vivo mRNA delivery data in Table 2. For example, compared with PEG-DMG lipids, PL-14-1 peptoid lipids achieve several times higher luciferase mRNA delivery and expression efficiency than PEG-DMG lipid LNPs via intravenous administration.

[0887] At the same time, peptoid lipids and ionizable lipids of various structures can form LNPs for encapsulating mRNA and achieving functionalized mRNA delivery.

[0888] 3.2 LNPs delivering luciferase mRNA in Balb / c mice

[0889] Each mouse received 5 μg of mRNA encapsulated in LNPs (IV: tail vein injection; IM: hind leg muscle injection). Six hours later, mice were given 150 mg / kg of D-luciferin via intraperitoneal injection, and bioluminescence signals were collected using an IVIS system. Table 2 summarizes the results of in vivo luciferase mRNA delivery in mice using LNPs constructed with either PL-2-1 or PL-14-1 instead of PEG-DMG lipids. These data demonstrate that LNPs constructed with peptoid lipids successfully delivered the target mRNA in mice and achieved efficient protein expression in vivo.

[0890] Table 2. LNPs delivering luciferase mRNA in Balb / c mice

[0891] The DSPC formulation has an N / P ratio of ionizable lipid to mRNA of 6, and a molar ratio of PEG (or peptoid) lipid of 1.5%. The DOPE formulation has an N / P ratio of ionizable lipid to mRNA of 2.8, and a molar ratio of PEG (or peptoid) lipid of 2.5%.

[0892] 3.3 Preparation of LNPs Containing Different Contents of Peptoid Lipids and In Vitro mRNA Delivery

[0893] LNPs were prepared by mixing an ethanolic solution of lipids (lipid A, phospholipid DSPC, cholesterol, and peptoid lipids PL-2-1 or PL-10-1) with an aqueous solution of mRNA (0.2 mg / ml, 100 mM citric acid buffer, pH 4.0) at high speed in a T-type mixer. The flow rate ratio of the aqueous phase to the alcohol phase was 3:1, and the total flow rate at the outlet of the T-type mixer was maintained at 16 ml / min (the flow rate of the RNA-aqueous phase channel was 12 ml / min, and the flow rate of the lipid-alcohol phase channel was 4 ml / min) to complete the preparation of LNP-mRNA. After the mixing and preparation, the LNPs were dialyzed to remove the ethanol in the solution, and the final sample was prepared by concentration and filtration. The particle size and distribution of the LNPs were measured by dynamic light scattering (DLS, Brookhaven), and the mRNA encapsulation efficiency was calculated by measuring the mRNA concentration before and after demulsification using a Ribogreen detection kit. The corresponding LNP formulation composition and physicochemical properties are summarized in the following table:

[0894] Table 3. Physicochemical properties of LNPs containing different peptoid lipid contents

[0895] The data in Table 3 and Figure 2 show that adjusting the content of peptoid lipids in LNPs can change their ability to deliver Fluc mRNA in vitro. In the DSPC phospholipid-based formulation, an increase in the proportion of peptoid lipids in the LNP formulation led to an increase in the in vitro delivery ability of the corresponding mRNA. This increase peaked at a formulation ratio of 4.83%. Further increasing the proportion of peptoid lipids led to a decrease in the in vitro delivery ability.

[0896] Example 4: mRNA vaccine containing peptoid lipids

[0897] 4.1 RSV mRNA Sequence Information and Stock Solution Preparation

[0898] First, an mRNA containing a stable RSV preF protein sequence was prepared. The mRNA sequence and the corresponding protein sequence are described below. The mRNA sequence also contains 5' and 3' UTR sequences and a 120nt polyA sequence.

[0899] 5′UTR (SEQ ID NO. 1):

[0900] ORF of mRNA (SEQ ID NO.2):

[0901] 3′UTR (SEQ ID NO. 3):

[0902] Corresponding amino acid sequence (SEQ ID NO.4)

[0903] LNP formulation preparation

[0904] LNPs loaded with RSV antigen-mRNA (N / P=6) were prepared using the following formula ratio: lipid A: DSPC: cholesterol: peptoid lipid = 50.0: 10.0: 38.5: 1.5 (molar percentage).

[0905] 4.2 Peptide-lipid LNP encapsulation of mRNA

[0906] The lipid ethanol solution and the mRNA aqueous solution (0.2 mg / ml, 100 mM citric acid buffer, pH 4.0) were connected to the two ends of a T-type mixer via catheters. The flow rate ratio of the aqueous phase to the alcohol phase was set to 3:1, and the total flow rate at the outlet of the T-type mixer was maintained at 16 ml / min (12 ml / min for the RNA-aqueous phase channel and 4 ml / min for the lipid-alcohol phase channel) to complete the LNP-mRNA preparation. After the mixed preparation, the LNP was dialyzed to remove the ethanol in the solution and concentrated and filtered to complete the final sample preparation.

[0907] 4.3 RSV mRNA vaccine inoculation in mice

[0908] BALB / c mice were administered intramuscularly at a dose of 5 μg per dose of either RSV mRNA-encapsulated LNP formulations or the PreF protein antigen, respectively. Immunizations were repeated three weeks apart for a total of two immunizations. Mouse serum was collected after the second immunization (Day 35). Anti-PreF protein mouse IgG antibody titers were measured using an ELISA kit (Acro, Catalog No. RAS-T161). As shown in Figure 3, the LNP-mRNA-RSV vaccine constructed with peptoid lipids successfully elicited specific antibodies against the RSV preF protein antigen in mice, and the antibody titer was significantly higher than that obtained with two injections of the PreF protein vaccine. This demonstrates the potential of LNPs containing peptoid lipids in vaccine product development.

[0909] Example 5: Nebulizable Peptoid Lipid LNP

[0910] Six LNPs containing peptoid lipids and one LNP containing PEG-DMG were prepared, encapsulating luciferase Fluc-mRNA (N / P = 2.8) using the following formulation ratio: Lipid A: DOPE: Cholesterol: Peptoid lipid / PEG-DMG = 35.0: 16.0: 46.5: 2.5 (percentages). The mRNA concentration in each LNP solution was 0.1 mg / mL. 10 mL of LNP solution was placed in a vibrating mesh nebulizer (Aerogen) and aerosolized, and the aerosolized liquid was collected at the nebulizer outlet. The mRNA content and encapsulation efficiency in the aerosolized LNPs were measured using a Ribogreen RNA detection kit, and the LNP particle size and PDI were determined before and after aerosolization using dynamic light scattering. The delivery efficiency of the loaded Fluc-mRNA in 293T cells was determined before and after aerosolization (50 ng mRNA / 30,000 cells). Classic nebulizers achieve atomization of the liquid by ultrasonicating, squeezing or shearing the liquid, so that the drug carried in the liquid can reach the lesion site in the respiratory tract or lungs by inhalation. This embodiment uses a representative vibrating mesh nebulizer to characterize the effect of the peptoid lipids in the present invention on the stability of LNP. The vibrating mesh nebulizer performs high-speed shearing on the solution through two layers of porous mesh to achieve atomization of the liquid. Usually, the droplet size atomized by the vibrating mesh nebulizer can reach 3-4um. Such small micron-sized droplets can smoothly pass through the respiratory tract of animals or humans and disperse into various tiny bronchi in the lungs, thereby achieving contact between the drug solution and lung epithelial cells, macrophages and even alveoli and other lung cells, making inhalation-type drug delivery possible.

[0911] Figure 4 shows that the physicochemical properties of LNPs prepared using PEG-DMG lipids undergo significant changes after nebulization. The particle size of the PEG-LNPs increases by 5.34 times their original size, and the PDI also increases by 2.2 times. This indicates that the shearing effect of the nebulizer on the solution causes instability in the nanoparticles formed by physical interactions, resulting in significant aggregation between the particles. The photographs in Figure 5 also demonstrate this aggregation phenomenon. The OD of the PEG-LNP solution's absorption spectrum for 660 nm light increases from 0.33 before nebulization to 2.34. The mRNA loading capacity of the PEG-LNP particles also decreases significantly after nebulization. In Figure 4c, the mRNA encapsulation efficiency of the PEG-LNPs decreases to 52.87% of the initial level. These significant changes in physicochemical properties result in a decrease in the mRNA delivery ability of the PEG-LNPs. In Figure 4d, the delivery level of the delivered luciferase mRNA in 293T cells is only 10.13% of the pre-nebulization level. In contrast, under the same formulation conditions, the LNPs prepared using zwitterionic peptoid lipids showed less change in their physicochemical properties than PEG-LNPs after nebulization, and their efficiency in delivering luciferase mRNA remained above 50% of that before nebulization. This demonstrates that LNPs containing zwitterionic peptoids have better self-assembly stability and better tolerance to shear. It is worth mentioning that the zwitterionic peptoid lipids (PL-10-1, PL-11, PL-12) prepared from monomer 14 performed better in terms of particle size stability than the peptoid lipids of the same length prepared from monomer 1 (PL-2-1, PL-8-1, PL-9-1). Similar advantages were also demonstrated in the maintenance of mRNA encapsulation efficiency. The mRNA encapsulation efficiency of LNPs containing PL-10-1, PL-11, and PL-12 lipids after nebulization remained above 90% of the initial level. However, in terms of the efficiency of in vitro mRNA delivery, the performance of these two types of peptide lipids was relatively close, but PL-11 showed the best level of maintenance of delivery efficiency after atomization.

[0912] Example 6: Aerosolizable Zwitterionic Polymer Lipid LNPs

[0913] The following formula ratio was used: lipid A: DOPE: cholesterol: pCB-C14 = 35.0: 16.0: 46.5: 2.5 (percentage) to prepare LNPs encapsulating luciferase Fluc-mRNA (N / P = 2.8), wherein pCB-C14 was synthesized according to the method disclosed in patent WO2022140404A1, and the molecular weight of pCB was 5k Da. The mRNA concentration of the LNP solution was 0.1 mg / mL. 10 mL of LNP solution was placed in a vibrating mesh nebulizer (Aerogen-pro) for atomization, and the atomized liquid mist was collected at the outlet of the nebulizer. The LNP particle size and PDI before and after atomization were measured using a dynamic light scattering instrument. The pCB-C14-containing LNPs had a particle size of 124.16 nm and a PDI of 0.123 before aerosolization. After aerosolization, the LNPs' particle size increased by approximately 54% to 191.25 nm, and the PDI increased by approximately 21% to 0.149. These results demonstrate that pCB lipids containing zwitterionic groups exhibit significantly better aerosolized particle stability than PEG lipids in equivalent formulations.

[0914] Example 7: Long-term stability and freeze-thaw stability of peptoid lipid LNPs

[0915] The storage and freeze-thaw stability of LNPs, to a certain extent, determine the development potential of the final pharmaceutical formulation, which is crucial for both vaccine and therapeutic drug development. We tested the storage stability of one of our peptoid lipid LNPs at 4°C. As shown in Table 4, PL-10-1 and lipid A maintained formulation stability for at least six months of storage. Neither the LNP particle size, particle distribution, nor the mRNA encapsulation level changed significantly under these conditions.

[0916] We further examined the multiple freeze-thaw stability of LNPs composed of PL-10-1 and lipid A. In this LNP formula, we chose the classic DSPC formula, which is also the formulation ratio used by Moderna's new crown mRNA vaccine. The only difference is that we used peptoid lipid PL-10-1 instead of PEG lipid to prepare LNP. Since the new crown mRNA vaccine cannot be stored in solution for a longer period of time at 4 degrees or even higher, the industry currently mainly uses freezing to extend the shelf life of LNP-mRNA, so this formula is more representative in freeze-thaw stability tests. It is worth mentioning that the LNP solution is also consistent with the classic formula, and 8% sucrose is further added as a cryoprotectant. As can be seen from the data in Table 5, the peptoid lipid LNP maintained similar parameter levels to the original LNP formulation after 1 and 5 freeze-thaw treatments, verifying its reliable freeze-thaw stability.

[0917] Table 4. Storage stability of peptoid lipid LNPs

[0918] Table 5. Freeze-thaw stability of peptoid lipid LNPs

[0919] Example 8: Preparation and physicochemical properties of LNPs containing peptoid lipids

[0920] The LNP in the present embodiment is prepared by the following method: an ethanol solution (ionizable lipid, phospholipid, cholesterol and peptoid lipid) containing lipids is mixed at high speed with an aqueous solution (0.2 mg / ml, 5 mM sodium acetate, 10 mM sodium chloride buffer solution, pH=5.5) of mRNA in a T-type mixer, the flow rate ratio of the aqueous phase to the alcohol phase mixture is 3: 1, and the total flow rate at the outlet of the T-type mixer is maintained at 32 ml / min (the RNA-aqueous phase passage flow rate is 24 ml / min, and the lipid-alcohol phase passage flow rate is 8 ml / min), to complete the preparation of LNP-mRNA. The LNP after the mixed preparation is removed from the solution by dialysis and the preparation of the final sample is completed by concentration and filtration. The particle size and distribution of LNP are measured by dynamic light scattering (DLS, Brookhaven), and the encapsulation efficiency of mRNA is calculated by measuring the mRNA concentration before and after demulsification by Ribogreen detection kit. The corresponding LNP formulation composition and physicochemical properties are summarized in Table 6:

[0921] Table 6. Formulation and physicochemical properties of peptoid lipid LNPs

[0922] The RSV sequence in this table is consistent with the mRNA sequence disclosed in Example 4; EPO mRNA is the human erythropoietin protein sequence; Cas9 / sgRNA: the mass ratio of Cas9 mRNA to sgRNA is 1 / 1; ABE: adenine base editor; Cre: Cre-LoxP-based recombinase.

[0923] In this example, we tested the ability of peptoid lipid LNPs to effectively encapsulate mRNAs of varying sequences and lengths. As shown in the table, peptoid lipids combined with ionizable lipids effectively encapsulated both the relatively short EPO mRNA (approximately 800 nt) and the relatively long gene editing tools. Furthermore, peptoid lipid LNPs demonstrated the ability to simultaneously encapsulate nucleic acid sequences of varying types and lengths. For combinations of long-chain editor mRNA (Cas9 or ABE) and short-chain gRNA (approximately 100 nt), peptoid lipid LNPs combined with various ionizable lipids achieved highly efficient nucleic acid encapsulation levels (>95%).

[0924] Example 9 Inhaled mRNA RSV preventive vaccine

[0925] Using a method similar to that described in Example 4, we prepared a respiratory syncytial virus (RSV) LNP-mRNA vaccine for airway administration. The formulation information for this LNP (R-2) is shown in Table 6. The loaded mRNA sequence encoding the PreF protein was the same as that described in Example 4.

[0926] The LNP-mRNA vaccine was administered intratracheally to BALB / c mice at a dose of 5 μg per dose, with immunizations occurring once every three weeks for a total of two immunizations (days 0 and 21). On day 35, mouse serum was collected, and the lungs were lavaged with 500 μl of PBS solution, and the final lavage fluid was collected. Measurement of IgG antibodies against the PreF protein in mouse serum revealed that the RSV vaccine successfully stimulated high systemic humoral immunity via airway administration (Figure 6). Positive IgA (Figure 7) and IgG (Figure 8) levels were also detected in the lung lavage fluid of mice vaccinated with the mRNA vaccine, indicating that the vaccine also successfully activated mucosal immunity in mice. We further collected T cells from the mouse lungs and stimulated them with a peptide library of the PreF protein antigen. Finally, the activation level of lung T cells was measured by flow cytometry. As shown in Figure 9, among the lung T cells (CD3 positive) of mice vaccinated with the LNP-mRNA vaccine, there were nearly 7% and 2% antigen-specific INFy-positive CD8 cells and CD4 cells, respectively. In the negative control group, such T cells were almost undetectable, which proves that the vaccine administered through the airway can stimulate lung antigen-specific T cell immunity.

[0927] Example 10: Gene Editing of Lung Airway Epithelial Cells in Td-tomato Transgenic Mice

[0928] We loaded the mRNA of Cre recombinase into LNPs prepared by the PL-10-1 / lipid F composite formula and administered it to td-tomato transgenic mice via the trachea (IT) at a dose of 5ug / mouse. The successfully edited cells will spontaneously express red td-tomato fluorescent protein. After 48 hours, the mice were euthanized and lung tissue was collected. After fixation and sectioning, immunofluorescence staining was performed. It can be found from Figures 10 and 11 that the LNP can effectively deliver Cre mRNA to achieve gene editing of large and small airway epithelial cells (EpCAM positive cells) in the lungs. At the same time, we also saw obvious gene editing effects in some basal cells. This embodiment demonstrates that LNPs based on peptoid lipids can be administered via the airway to achieve nucleic acid delivery to lung epithelial cells.

[0929] Example 11: Nebulizable Peptoid Lipid LNP

[0930] The LNPs in this embodiment were prepared by the following method: an ethanolic solution containing lipids (ionizable lipids, phospholipids, cholesterol, and peptoid lipids) was mixed at high speed in a T-type mixer with an aqueous solution of mRNA (0.2 mg / ml, 5 mM sodium acetate, 10 mM sodium chloride buffer, pH = 5.5). The flow rate ratio of the aqueous phase to the alcohol phase was 3:1, and the total flow rate at the outlet of the T-type mixer was maintained at 32 ml / min (the RNA-aqueous phase flow rate was 24 ml / min, and the lipid-alcohol phase flow rate was 8 ml / min) to complete the preparation of LNP-mRNA. The formulation information of each LNP is recorded in Table 7.

[0931] Table 7. Formulation Information of Nebulizable LNPs Containing Peptoid Lipids

[0932] The above 6 kinds of LNPs were subjected to atomization experiments by a vibrating mesh atomizer (Aerogen), and the changes in the efficiency of delivering luciferase mRNA in the physicochemical properties of the preparations before and after atomization and in vitro cells (293T) were detected at the same time. The particle size and distribution of LNPs were determined by dynamic light scattering (DLS, Brookhaven), and the encapsulation efficiency of mRNA was calculated by measuring the mRNA concentration before and after demulsification by Ribogreen detection kit. In vitro cell transfection experiments were carried out in 293T cells, and LNPs were incubated with cells for 24h at a dose of 50ng mRNA / 30000 cells, and the expression level of the cells was determined by a luciferase detection kit, and finally displayed by the percentage of chemical luminescence at the same dose (after atomization / before atomization). The relevant data are disclosed in Table 8. Data show that both PL-10-1 and PL-10-2 peptide lipids can be used to prepare LNPs encapsulating mRNA at different lipid ratios, and can effectively stabilize the LNP formulation parameter levels and in vitro transfection efficiency during the atomization process.

[0933] Table 8. Formulation parameter levels of LNPs containing peptoid lipids before and after nebulization

[0934] We further determined the efficiency of peptoid lipid LNPs in delivering luciferase to the lungs of mice by direct tracheal administration and nebulized inhalation administration. The method of nebulized inhalation administration is as follows: the mice are fixed in a nebulized exposure tower, and an Aerogen Pro nebulizer is installed at the top entrance of the nebulizer tower. Six mice in the nebulizer tower are nebulized at the same time with a dose of 500ug RNA. The entire administration process does not exceed 30 minutes, and the mice are exposed to the mist through natural breathing to achieve administration. The dose of tracheal administration is 5ug RNA per mouse. The results show that this type of LNP containing peptoid lipids can effectively deliver nucleic acids to lung tissue cells through the airway (Table 9). It is worth noting that due to the narrow airway and device limitations of mice, direct tracheal administration is easier to accurately control the dosage, while the actual bioavailability of nebulized inhalation is lower.

[0935] In addition, we further observed the expression of mRNA in various major organs after airway administration. As shown in Figure 12, N-2LNP mainly expressed Fluc mRNA in the lungs and trachea of ​​mice, and there was almost no significant expression in other major organs. This proves that the airway administration of peptoid lipid LNP is mainly focused on delivering nucleic acids to the tissue cells of the respiratory tract, trachea and lungs.

[0936] Table 9. LNPs deliver luciferase mRNA via the airway in Balb / c mice

[0937] Example 12: Inhalable Microparticles Containing Peptoid Lipid LNPs Formed by Different Nebulizers

[0938] This example compares and verifies the effects of different nebulizer types on the stability of PEG lipid LNP and peptoid lipid LNP formulations. In addition to the Aerogen Pro nebulizer based on vibrating mesh technology used in the previous examples, we employed two other common nebulizers in this experiment: an ultrasonic nebulizer and a jet nebulizer (PARIBOY). The formulations and parameter properties of the LNPs used in the experiment are shown in Table 10. The results showed that LNPs prepared with PEG lipids showed a significant increase in particle size (nearly 7-fold) and a broadening of the particle size distribution after passage through either the ultrasonic or jet nebulizer. Their RNA encapsulation rate also decreased from an initial 93.39% to below 50%, similar to the results obtained with a vibrating mesh nebulizer (Table 11). Unlike PEG lipid LNPs, LNPs prepared with the peptoid lipid PL-10-2 showed only minimal increases in relevant formulation parameters after passage through the two aforementioned nebulizers, while maintaining their RNA encapsulation capacity. This is similar to the results of the previous experiments using a vibrating mesh nebulizer. The above data prove that the peptoid lipid disclosed in the present invention has a significantly better stabilizing effect on LNP during the atomization process than PEG lipid, and has a certain universality and is suitable for a variety of common types of atomization devices.

[0939] We further conducted aerodynamic testing of N-2LNP aerosol particles generated using a jet nebulizer (Pariboy) and a vibrating mesh nebulizer (Aerogen Pro) using a next-generation impactor (NGI). The results showed that the mass median aerodynamic diameter (MMAD) of the N-2LNP aerosol particles generated by the jet nebulizer was approximately 3.67 μm, while that of the N-2LNP aerosol generated by the vibrating mesh nebulizer was 4.86 μm. These results demonstrate that these aerosolized particles can be effectively deposited in the human respiratory tract and lungs.

[0940] Table 10. LNP formulation information for different nebulizers

[0941] Table 11. Changes in the properties of LNP formulations aerosolized by different nebulizers

[0942] Example 13: Peptide lipid LNPs containing tertiary amine lipids / quaternary ammonium lipids

[0943] In this example, we prepared a series of peptoid lipid LNPs containing both tertiary amine ionizable lipids and quaternary ammonium lipids. The LNPs in this example were prepared using the following method: an ethanolic solution containing lipids (tertiary amine ionizable lipids, quaternary ammonium lipids, phospholipids, cholesterol, and peptoid lipids) was mixed with an aqueous solution of mRNA (Fluc) (0.2 mg / ml, 5 mM sodium acetate, 10 mM sodium chloride buffer, pH 5.5) in a T-type mixer at high speed. The flow rate of the aqueous phase to the alcohol phase was 3:1, and the total flow rate at the outlet of the T-type mixer was maintained at 32 ml / min (24 ml / min for the RNA-aqueous phase and 8 ml / min for the lipid-alcohol phase). The LNP-mRNA preparation was completed. As shown in Table 12, the peptoid lipids in this five-component formulation containing quaternary ammonium lipids were able to efficiently encapsulate the loaded nucleic acid molecules, regardless of the ratio of the formulation, the N / P ratio, or the use of lipids with different structures. This demonstrates the robustness of peptoid lipids in preparing LNPs.

[0944] Table 12. Formulations and physicochemical properties of peptide lipid LNPs containing tertiary amine lipids / quaternary ammonium lipids

[0945] Example 14: Efficiency and Immunological Study of EPO mRNA Delivery in Mice by Peptoid-Containing Lipid LNPs (Repeated Dosing)

[0946] The immunogenicity of PEG and the prevalence of pre-existing anti-PEG antibodies in the human body have, to a certain extent, limited the development and application of PEG-containing drugs and pose potential safety risks. For example, anti-PEG antibodies can accelerate the clearance of drugs such as PEG liposomes and PEG protein-conjugates from the human circulatory system. Furthermore, individual immune responses to PEG can also lead to side effects. For example, in the early stages of the launch of the COVID-19 mRNA vaccine, multiple cases of varying degrees of allergic reactions occurred in vaccinated populations. In this example, we compared the performance of peptoid lipids and PEG lipids in nucleic acid delivery efficiency and antibody stimulation levels through repeated dosing experiments in mice. The PEG lipid LNPs and peptoid lipid LNPs used in this experiment used the same classic formulation: ionizable lipid A / phospholipid / cholesterol / PL-10-1 or PEG-DMG = 50%:10%:38.5%:1.5% (molar ratio). Balb / c mice were administered LNP-EPO mRNA at a dose of 0.5 mpk (calculated based on EPO mRNA) weekly for five consecutive times via tail vein injection. Blood samples were collected 6 hours and 24 hours after the first and fifth administrations to determine the expression level of EPO in the serum. Seven days after the last administration, mouse serum was collected and the levels of anti-PEG or anti-peptide antibodies in the serum were determined by indirect ELISA. In the ELISA test, the bottom of the ELISA test plate was treated with PEG (2k)-conjugated bovine serum albumin (BSA) and PL-10-0-conjugated BSA (calculated as 1 ug BSA per well), and the levels of relevant specific antibodies in the serum were detected using goat anti-mouse IgG secondary antibody (Sino SSA007, HRP-conjugated) and goat anti-mouse IgM secondary antibody (Abcam, ab97230, HRP-conjugated).

[0947] As shown in Figure 13, after five doses of PEG-DMG LNP, the EPO expression level in the serum of mice decreased significantly compared to that after the first dose. Regardless of the 6h or 24h sampling point, the EPO concentration in the serum after the fifth dose was less than 50% of that at the same time point after the first dose, which is consistent with the typical phenomenon of accelerated blood clearance. In contrast, in the PL-10-1LNP administration group (Figure 14), even after five consecutive doses, the EPO concentration in the serum showed similar pharmacokinetic behavior to that after the first dose. The analysis of the test results of the specific antibody levels in the final serum further explained the reasons for the different EPO expression levels (Figures 15 and 16). In the experimental group of mice receiving PEG-DMG LNP administration, we detected extremely high titer levels of anti-PEG antibodies, and the OD value of the anti-PEG IgM antibody was higher than that of the IgG antibody, which is similar to the results of previous experiments. In the serum of mice that received PL-10-1 LNP, we were unable to detect the presence of anti-peptoid antibodies at the same serum dilution multiple, which further demonstrated that the peptoid lipid PL-10-1 has lower immunogenicity than PEG-DMG.

[0948] Example 15: LNPs containing peptoid lipids loaded with siRNA

[0949] 15.1 Preparation, Physicochemical Properties, and In Vitro mRNA Interference of LNP-siRNA

[0950] LNPs were prepared by mixing a lipid ethanol solution (DSPC formula: ionizable lipid / DSPC phospholipid / cholesterol / PEG-DMG or peptoid lipid = 50.0 / 10.0 / 38.5 / 1.5; DOPE formula: ionizable lipid / DSPC phospholipid / cholesterol / PEG-DMG or peptoid lipid = 35.0 / 16.0 / 46.5 / 2.5) with an aqueous solution (0.2 mg / ml, sodium acetate buffer, pH 4.0) of siRNA (interfering glyceraldehyde-3-phosphate dehydrogenase, siGAPDH, N / P = 3) at a flow rate ratio of 3:1 between the aqueous and alcohol phases, and maintaining a total flow rate of 16 ml / min at the outlet of the T-mixer (12 ml / min for the RNA-aqueous phase channel and 4 ml / min for the lipid-alcohol phase channel) to complete the preparation of LNP-siRNA. After the mixed preparation, the LNP was dialyzed to remove the ethanol in the solution, and the final sample was prepared by concentration and filtration.

[0951] 5 mL of LNP solution was placed in a vibrating mesh nebulizer (Aerogen) for aerosolization, and the aerosolized liquid mist was collected at the nebulizer outlet. The siRNA content and encapsulation efficiency in the LNPs were measured before and after aerosolization using the Ribogreen RNA detection kit. The LNP particle size and PDI were measured before and after aerosolization using dynamic light scattering.

[0952] LNP-siGAPDH was added to HeLa cells before and after nebulization. After 48 hours of co-culture, the cells were digested and lysed. Total RNA was extracted using an RNA extraction kit and reverse transcribed into cDNA. qPCR quantitative testing was performed using cDNA as a template, and the relative transcription amount of GAPDH mRNA in each group of cells was calculated (compared with cells not treated with LNP-siRNA).

[0953] Analysis of the data in Table 13 reveals that the peptoid lipids described above can all form nanoparticles with various ionizable lipids, and the particle size dispersity is relatively small. Compared to LNP-siRNA prepared using PEG-DMG, LNPs using zwitterionic peptoid lipids can better maintain nanoparticle stability during aerosolization, while also maintaining the in vitro siRNA delivery efficiency of LNPs before and after aerosolization.

[0954] 15.2 Inhalation of LNP-siRNA in Mice

[0955] Eight-week-old female Balb / c mice were selected and divided into the following groups: PBS control group, LNP-4, LNP-6, and LNP-7. Each mouse was secured in the restraint barrel of a nebulizer tower, with only their noses and mouths exposed to the tower's gas delivery chamber. A nebulizer (Aerogen Pro) was then aerosolized into the delivery chamber using 10 mL of the corresponding LNP-siRNA formulation (1 mg siRNA, calculated as RNA) from the tower's mouth. Nebulization was completed within 30 minutes for each group. Ten days after the completion of the inhalation administration, the mice were euthanized, and whole lung tissue was dissected and cryopreserved.

[0956] The frozen lung tissue was homogenized and broken, and total RNA was extracted using an RNA extraction kit and reverse transcribed into cDNA. qPCR quantitative test was performed using cDNA as a template, and the relative expression of GAPDH mRNA in each group of tissues was calculated.

[0957] Table 14. Efficiency of LNP-siGAPDH inhalation in Balb / c mice

[0958] As shown in Table 13, the LNP-siGAPDH (LNP-7) prepared with PEG-DMG lipids has a significant increase in nanoparticle size after atomization, and the siRNA delivery efficiency is significantly reduced. This instability of the atomization process also explains the difference in the effects of atomization administration in mice in Table 14. As shown in Table 14, the lung tissue of mice that inhaled LNP-7 still retained nearly 89% of the GAPDH mRNA content, while both LNP-4 and LNP-6 significantly reduced the GAPDH mRNA content. Therefore, LNPs based on zwitterionic peptide lipids can effectively deliver siRNA while maintaining the stability and delivery efficiency of such nanoparticles during atomization inhalation.

[0959] Example 16: Delivery of siRNA (SOD1) by peptoid-containing lipid LNPs

[0960] In this example, we used peptoid lipid LNPs to encapsulate small interfering nucleic acids and studied their ability to deliver therapeutic siRNA (SOD1) to the respiratory tract and lungs via the airway. The LNPs were prepared by the following method: an ethanol solution containing lipids (tertiary amine ionizable lipids, quaternary ammonium lipids, phospholipids, cholesterol, and peptoid lipids) was mixed at high speed with an aqueous solution of siRNA (0.2 mg / ml, 5 mM sodium acetate, 10 mM sodium chloride buffer, pH = 5.5) in a T-type mixer. The flow rate ratio of the aqueous phase to the alcohol phase was 3:1, and the total flow rate at the outlet of the T-type mixer was maintained at 32 ml / min (the flow rate of the RNA-aqueous phase channel was 24 ml / min, and the flow rate of the lipid-alcohol phase channel was 8 ml / min) to complete the preparation of LNP-siRNA. The relevant LNP formulation formula information is recorded in Table 15. The sequence of the siRNA (target gene: mouse SOD1) is as follows:

[0961] Sense strand: CAUUUUAAUCCUCACUCUAAA (SEQ ID NO: 5);

[0962] Antisense strand: UUUAGAGUGAGGAUUAAAAUGAG (SEQ ID NO: 6).

[0963] We collected the three LNPs using an Aerogen Pro nebulizer and recalibrated the siRNA concentration in the liquid. The experimental results (Table 16) show that, aside from a slight increase in particle size, the three LNPs maintained the formulation properties of the pre-nebulization LNPs. This result demonstrates that peptoid lipid LNPs can also efficiently load siRNA and stabilize the formulation parameters of LNP-siRNA nanoparticles during the nebulization process.

[0964] Then, we selected Si-2 LNP and conducted a pharmacodynamic study on its airway administration in C57 mice. The mice were sacrificed 10 days after administration to collect lung tissue, collect RNA samples, and test the transcriptional expression of the SOD1 gene by RT-qPCR. The experiment used the PBS administration group as a negative control, and C16-siRNA and Si-2 LNP-siRNA as experimental groups. It is worth mentioning that although the target sequence silenced by C16-siRNA is exactly the same as the siRNA sequence used in the above-mentioned LNP preparation, it has been fully chemically modified on the backbone and bases, and its half-life and stability in vivo are compared with the unmodified siRNA sequence. It has significant advantages. The sequence was prepared according to the sequence reported in the document Nature Biotechnology (40,1500,2022).

[0965] Sense strand: c*a*uuu(C16u)AaUCCucacucua*a*a (SEQ ID NO: 7);

[0966] Antisense strand: Vpu*U*uagAgUGaggaUuAaaaug*a*g (SEQ ID NO: 8).

[0967] Uppercase 2-F base, lowercase 2-oMe base, 5 segments of VP modification on the antisense chain, * represents the phosphorothioate backbone.

[0968] The experimental results are shown in Figure 17. By intranasal administration (IN), C16-siRNA only achieved about 17% SOD1 gene silencing relative to the negative control at the same dose of siRNA (1 mpk), while LNP-siRNA based on the peptoid lipid PL-10-1 achieved about 86% target gene silencing. We further tested the Si-2 LNP collected by atomization by tracheal intubation (IT). The results showed that the transcriptional expression of the SOD1 gene in the lung tissue of mice in this experimental group was inhibited by more than 95%. Considering that the LNP basically maintains the relevant property parameters of the original preparation after atomization, we believe that the intubation administration method may allow the drug to more fully contact the lung tissue of the mouse than the intranasal administration method, thereby achieving a stronger level of efficacy.

[0969] Table 15. Formulation information of peptoid lipid LNP-siRNA

[0970] Table 16. Changes in formulation parameters of peptoid lipid LNP-siRNA before nebulization

[0971] Although various improvements have been described herein with reference to specific embodiments of the invention, it should be understood that such description is by way of illustration only and should not be construed as limiting the scope of any claimed invention. Accordingly, the scope and content of any claimed invention will be limited solely by the terms of the appended claims in their current form or as amended during prosecution or as implemented in any continuation application. Furthermore, it should be understood that, unless otherwise indicated, features of any specific embodiment discussed herein may be combined with one or more features of any one or more embodiments otherwise discussed or contemplated herein.

Claims

1. A peptoid compound, or a stereoisomer or a pharmaceutically acceptable salt thereof, comprising one or more structural units M of formula (I) a , in, Group A is absent or substituted with R 3 -CH-; When each appears, each R 1 、R 2 and R 3 are each independently selected from hydrogen, C 1-6 Alkyl or group B; Group B has the structure shown in the following formula: wherein l and m are each independently an integer selected from 1-6; R 4 、R 5 、R 6 、R 7 and R 8 are each independently selected from hydrogen and C 1-6 alkyl; R 9 、R 9’ 、R 10 and R 10’ are each independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 1-6 alkoxy; The group Q is selected from -CO2 － 、-SO2 － 、-SO3 － 、-OSO2 － 、-SO4 － 、-P(O)(OR P )O － AND-OP(O)(OR P )O － The group consisting of R P Selected from hydrogen and C 1-6 alkyl; When multiple structural units M are included a When the plurality of structural units M a are the same or different, each structural unit M a independently having the structure represented by formula (I), In this peptide compound, at least one structural unit M a including a group B, wherein the group B is R 1 、R 2 and R 3 Any one of When the peptoid compound includes a plurality of groups B, the plurality of groups B are the same or different.

2. The peptoid compound according to claim 1, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein the two terminal groups of the peptoid compound are independently selected from hydrogen, C 1-6 Hydrocarbon, C 1-6 Halogenated hydrocarbon, C 1-6 Hydroxyl, C 1-6 Alkyl, -C(O)-C 1-6 A group consisting of alkylene -COOH, OH, NH2, SH, N3, group B, and a linker containing one or more double bonds or triple bonds, wherein the linker containing one or more double bonds or triple bonds can be coupled with peptides, proteins, nucleic acids, carbohydrates, small molecule drugs, etc.

3. The peptoid compound according to claim 1 or 2, or a stereoisomer or pharmaceutically acceptable salt thereof, having a structure represented by formula (II): in: R a Selected from hydrogen, C 1-6 Alkyl, C 1-6 Alkanoyl, -C(O)-C 1-6 a group consisting of alkylene -COOH; R b Selected from the group consisting of OH, NH2, group B; i is an integer selected from 2-100, preferably selected from 2-80, more preferably selected from 2-60, even more preferably selected from 2-40, most preferably selected from 2-20; The peptidic compound comprises a plurality of structural units M of formula (I) a , Group A is absent or substituted with R 3 -CH-; When each appears, each R 1 、R 2 and R 3 are each independently selected from hydrogen, C 1-6 Alkyl or group B; Group B has the structure shown in the following formula: wherein l and m are each independently an integer selected from 1-6; R 4 、R 5 、R 6 、R 7 and R 8 are each independently selected from hydrogen and C 1-6 alkyl; R 9 、R 9’ 、R 10 and R 10’ are each independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 1-6 alkoxy; The group Q is selected from -CO2 － 、-SO2 － 、-SO3 － 、-OSO2 － 、-SO4 － 、-P(O)(OR P )O － AND-OP(O)(OR P )O － The group consisting of R P Selected from hydrogen, C 1-6 alkyl; The plurality of structural units M a are the same or different, each structural unit M a independently having the structure represented by formula (I), In this peptide compound, at least one structural unit M a including a group B, wherein the group B is R 1 、R 2 and R 3 Any one of When the peptoid compound includes a plurality of groups B, the plurality of groups B are the same or different.

4. The peptoid compound according to any one of claims 1 to 3, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: In this peptide compound, at least two structural units M a including a group B, each occurrence of which is independently R 1 、R 2 and R 3 Any one of; or all structural units M a including a group B, each occurrence of which is independently R 1 、R 2 and R 3 Any one of .

5. The peptoid compound according to any one of claims 1 to 4, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: The structural unit M a Has the following structure: wherein m is an integer selected from 1 to 6, preferably m is 2 or 3; l is an integer selected from 1-6, and preferably l is 1, 2 or 3.

6. The peptoid compound according to any one of claims 1 to 5, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: The peptoid compound is selected from the following:

7. A peptoid compound, or a stereoisomer or pharmaceutically acceptable salt thereof, having the structure represented by formula (III): The peptidic compound comprises one or more structural units M of formula (I) a and one or more structural units M b , in: R a Selected from hydrogen, C 1-6 Alkyl, C 1-6 Alkanoyl, -C(O)-C 1-6 a group consisting of alkylene -COOH; R b Selected from the group consisting of OH, NH2, group B; i is an integer selected from 2-100, preferably selected from 2-80, more preferably selected from 2-60, even more preferably selected from 2-40, most preferably selected from 2-20; Group A is absent or substituted with R 3 -CH-; When each appears, each R 1 、R 2 and R 3 are each independently selected from hydrogen, C 1-6 an alkyl group and a group B; Group B has the structure shown in the following formula: wherein l and m are each independently an integer selected from 1-6; R 4 、R 5 、R 6 、R 7 and R 8 are each independently selected from hydrogen and C 1-6 alkyl; R 9 、R 9’ 、R 10 and R 10’ are each independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 1-6 alkoxy; The group Q is selected from -CO2 － 、-SO2 － 、-SO3 － 、-OSO2 － 、-SO4 － 、-P(O)(OR P )O － AND-OP(O)(OR P )O － The group consisting of R P Selected from hydrogen, C 1-6 alkyl; When multiple structural units M are included a When the plurality of structural units M a are the same or different, each structural unit M a Each independently has the structure shown in formula (I), In this peptide compound, at least one structural unit M a including a group B, wherein the group B is R 1 、R 2 and R 3 Any one of When the peptoid compound includes multiple groups B, the multiple groups B are the same or different; When each occurs, each structural unit M b Each is independently selected from an amino acid residue, preferably an α-amino acid residue, more preferably an α-amino acid residue having a neutral side chain, for example, an amino acid residue selected from the following group: alanine (Ala), glycine (Gly), proline (Pro), cysteine (Cys), valine (Val) and sarcosine (Sar); j is an integer selected from 1-100, preferably selected from 1-80; more preferably selected from 1-60; even more preferably selected from 1-40, most preferably selected from 1-20; In this peptide compound, the structural unit M a and structural unit M b The linkages are random, block, alternating, or a combination thereof in any order.

8. The peptoid compound according to claim 7, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: In this peptide compound, at least two structural units M a including a group B, each occurrence of which is independently R 1 、R 2 and R 3 Any one of; or all structural units M a including a group B, each occurrence of which is independently R 1 、R 2 and R 3 Any one of .

9. The peptoid compound according to claim 7 or 8, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: The structural unit M a Has the following structure: wherein m is an integer selected from 1 to 6, preferably m is 2 or 3; l is an integer selected from 1-6, and preferably l is 1, 2 or 3.

10. The peptoid compound according to any one of claims 7 to 9, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: In this peptide compound, the structural unit M a and structural unit M b Connect sequentially in an alternating fashion.

11. The peptoid compound according to any one of claims 7 to 10, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: In this peptide compound, the structural unit M a and structural unit M b The peptide compounds are connected in an alternating manner so that the peptide compound comprises repeating structural units shown in the following structure: wherein k is an integer selected from 2 to 50; m is an integer selected from 1-6, preferably m is 2 or 3; l is an integer selected from 1-6, and preferably l is 1, 2 or 3.

12. The peptoid compound according to any one of claims 7 to 10, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: The peptoid compound of formula (III) is selected from the following:

13. An amino acid derivative compound of formula (IV), or a stereoisomer or pharmaceutically acceptable salt thereof, in, l and m are each independently an integer selected from 1-6; PG 1 is hydrogen, or an acid protecting group, preferably PG 2 is hydrogen or an amino protecting group, preferably Fmoc.

14. An amino acid derivative compound of formula (IV'), or a stereoisomer or pharmaceutically acceptable salt thereof, in, l and m are each independently an integer selected from 1-6; PG 1 is hydrogen, or an acid protecting group, preferably PG 2 is hydrogen or an amino protecting group, preferably Fmoc.

15. A solid phase method for preparing the peptoid compound according to any one of claims 1 to 12, comprising the following steps: (1) reacting the compound of formula (IV) or (IV′) or the amino acid derivative with a resin for solid phase synthesis to attach it to the resin; (2) Optionally remove the amino protecting group PG 2 ; (3) continuing the reaction to connect the next compound of formula (IV) or (IV') or amino acid derivative; (4) optionally repeating steps (2) and (3) to extend the backbone length of the peptoid compound; and (5) optionally performing terminal group modification, resin cleavage and / or deprotection to obtain a peptoid compound; wherein the compound of formula (IV) or (IV') or the amino acid derivative in step (1) and each repeated step (3) are the same or different, The amino acid derivative is an amino acid having an α-amino protecting group, whose side chain has or does not have a protecting group, the α-amino protecting group is preferably Fmoc, and the amino acid is preferably an α-amino acid, more preferably an α-amino acid with a neutral side chain, for example, an amino acid selected from the following group: alanine (Ala), glycine (Gly), proline (Pro), cysteine (Cys), valine (Val) and sarcosine (Sar).

16. A primary amine compound of formula (V), or a stereoisomer or pharmaceutically acceptable salt thereof, NH2-B’-PG 3 (V) in, The group B' has the structure shown in the following formula: wherein l and m are each independently an integer selected from 1-6; R 4 and R 5 are each independently selected from hydrogen and C 1-6 alkyl; R 9 、R 9’ 、R 10 and R 10’ are each independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 1-6 alkoxy; The group Q is selected from -CH(OR Q )O-、-C(O)O-、-P(O)(OR P )O- and -OP(O)(OR P )O-, wherein R P Selected from hydrogen, C 1-6 Alkyl, R Q Selected from C 1-6 Alkyl, Q is preferably -C(O)O-; PG 3 It is hydrogen, C 1-6 Alkyl, or acid protecting group, preferably 17. The primary amine compound of formula (V) according to claim 16, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein The primary amine compound of formula (V) is selected from the following:

18. A solid phase method for preparing the peptoid compound according to any one of claims 1 to 12, comprising the following steps: (1) reacting a halogenated acid with a resin for solid phase synthesis to link the halogenated acid to the resin; and subjecting a primary amine compound of formula (V) according to claim 16 or 17 to a substitution reaction with a halogen atom on the resin to link the primary amine compound of formula (V) according to claim 16 or 17 to the resin; (2) condensing the α-amino protected amino acid through the amino group on the carboxyl resin; (3) optionally repeating step (1) or (2) to extend the backbone length of the peptoid compound; and (4) optionally performing terminal group modification, resin cleavage and / or deprotection to obtain a peptoid compound; Wherein, the halogenated acid is preferably selected from bromoacetic acid, 2-bromopropionic acid, 1-bromopropionic acid, chloroacetic acid, 2-chloroacetic acid, 1-chloroacetic acid, iodoacetic acid, The primary amine compound of formula (V) in each repeated step (1) and the amino acid derivative in step (2) are the same or different, The α-amino protected amino acid, the amino protecting group is preferably Fmoc, the amino acid is preferably an α-amino acid, more preferably an α-amino acid with a neutral side chain, for example, an amino acid selected from the following group: alanine (Ala), glycine (Gly), proline (Pro), cysteine (Cys), valine (Val) and sarcosine (Sar).

19. A conjugate comprising the peptoid compound according to any one of claims 1 to 12 or a stereoisomer or a pharmaceutically acceptable salt thereof, and a biologically active molecule or a small molecule drug linked thereto.

20. A peptoid-lipid conjugate of formula (VI), or a stereoisomer or pharmaceutically acceptable salt thereof, Lipid-L-peptide (VI) in, The peptoid portion is a peptoid compound according to any one of claims 1 to 12, or a stereoisomer or a pharmaceutically acceptable salt thereof, L is absent or is a linker moiety selected from a substituted or unsubstituted straight chain aliphatic group or a substituted or unsubstituted straight chain heteroaliphatic group, optionally attached to either terminus of the peptoid portion, wherein the straight chain aliphatic group is C 1-16 Straight chain aliphatic groups, such as C 1-15 、C 1-14 、C 1-13 、C 1-12 、C 1-11 、C 1-10 、C 1-9 、C 1-8 、C 1-7 、C 1-6 、C 1-5 、C 1-4 、C 1-3 or C 1-2 The straight-chain aliphatic group is a 1-16-membered straight-chain heteroaliphatic group, such as a 1-15-membered, 1-14-membered, 1-13-membered, 1-12-membered, 1-11-membered, 1-10-membered, 1-9-membered, 1-8-membered, 1-7-membered, 1-6-membered, 1-5-membered, 1-4-membered, 1-3-membered or 1-2-membered straight-chain aliphatic group.

21. The peptoid-lipid conjugate according to claim 20, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: The L is connected to the carbon-terminal carbonyl (-C(O)-) of the peptoid portion; The L is attached to the side group reactive site of the peptoid portion; or Said L is a linker moiety having the formula (VII) which is linked to the nitrogen terminus of the peptoid moiety via an amide bond, Among them, L a is substituted or unsubstituted C 1-12 An aliphatic group or a substituted or unsubstituted 1-12 membered heteroaliphatic group, optionally comprising at least one -CH2CH2O- group in the backbone of the substituted or unsubstituted 1-12 membered heteroaliphatic group.

22. The peptoid-lipid conjugate according to claim 21, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: L a is substituted or unsubstituted C 1-12 Straight chain alkyl, such as C 1-10 、C 1-8 、C 1-6 or C 1-4 Straight chain alkyl; or L a is a substituted or unsubstituted 1-12 membered straight chain heteroaliphatic group, such as a 1-10 membered, 1-8 membered, 1-6 membered or 1-4 membered straight chain heteroaliphatic group, optionally including at least one -CH2CH2O- in its main chain.

23. The peptoid-lipid conjugate according to any one of claims 20 to 22, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: The linker portion L is selected from the following: wherein p is an integer selected from 1-12, such as 1-10, 1-8, 1-6, or 1-4; q, r and s are each independently 0, or an integer selected from 1-10, such as 1-8, 1-6, 1-4, or 1-2.

24. The peptoid-lipid conjugate according to any one of claims 20 to 23, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: The lipid portion has the structure of formula (VIII): in Indicates that it has structure A group C, wherein c1 is selected from 0 or 1, R C Selected from H, -C 1- 6 alkyl such as methyl, ethyl, propyl, butyl, pentyl or hexyl; -OC 1-6 Alkyl such as methoxy, ethoxy, propoxy, butoxy, pentyloxy or hexyloxy; and -N(R N1 R N2 ), R N1 and R N2 Each independently selected from H and -C 1-6 an alkyl group such as methyl, ethyl, propyl, butyl, pentyl or hexyl; R L1 、R L2 、R L3 ...R Lm Each independently absent or selected from substituted or unsubstituted saturated or unsaturated C 6-30 For example, C 6-20 aliphatic groups and substituted or unsubstituted saturated or unsaturated 6-30 membered, for example 6-20 membered, heteroaliphatic groups, which are optionally substituted with one or more substituents selected from the group consisting of deuterium, halogen, oxo (=O), -NO2 and -OH, m is an integer selected from 1-12, such as 1-10, 1-8, 1-6, or 1-4.

25. The peptoid-lipid conjugate according to any one of claims 20 to 24, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: The group C has a structure selected from the following: wherein one or more hydrogen atoms are replaced to connect one or more R L1 、R L2 、R L3 ...R Lm .

26. The peptoid-lipid conjugate according to any one of claims 20 to 25, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: R L1 、R L2 、R L3 ...R Lm Each independently selected from:

27. The peptoid-lipid conjugate according to any one of claims 20 to 26, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: The lipid portion has the structure of Formula (VIIIa), Formula (VIIIb), (VIIIc), or (VIIId): Among them, R L1 and R L2 are each independently selected from substituted or unsubstituted saturated or unsaturated C 6-30 For example, C 6- 20 aliphatic groups and substituted or unsubstituted saturated or unsaturated 6-30 membered, for example 6-20 membered, heteroaliphatic groups, which are optionally substituted with one or more substituents selected from the group consisting of deuterium, halogen, oxo (=O), -NO2 and -OH, n is 0, or an integer selected from 1-10, such as 1-8, 1-6, 1-4, or 1-2.

28. The peptoid-lipid conjugate according to any one of claims 20 to 27, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: R L1 and R L2 Each independently selected from: C 6-20 Straight chain alkyl, -R L’ -OC(O)-R L” 、-R L’ -C(O)OR L” , where R L’ Selected from C 0-4 Straight chain alkyl, R L” Selected from C 4-18 Straight chain alkyl, C 4-18 Straight chain alkenyl, C 4-18 Straight chain alkynyl.

29. The peptoid-lipid conjugate according to any one of claims 20 to 28, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: R L1 and R L2 Each independently selected from:

30. The peptoid-lipid conjugate according to any one of claims 20 to 29, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: The lipid moiety is selected from the group consisting of:

31. The peptoid-lipid conjugate according to any one of claims 20 to 30, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: The peptoid-lipid conjugate of formula (VI) is selected from: wherein m is an integer selected from 1 to 6, preferably m is 2 or 3; l is an integer selected from 1-6, preferably l is 1, 2 or 3; i is an integer selected from 2-100, preferably selected from 2-80, more preferably selected from 2-60, even more preferably selected from 2-40, most preferably selected from 2-20; p is an integer selected from 1-12, such as 1-10, 1-8, 1-6, or 1-4.

32. The peptoid-lipid conjugate according to any one of claims 20 to 30, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: The peptoid-lipid conjugate of formula (VI) is selected from: wherein m is an integer selected from 1 to 6, preferably m is 2 or 3; l is an integer selected from 1-6, preferably l is 1, 2 or 3; i is an integer selected from 2-100, preferably selected from 2-80, more preferably selected from 2-60, even more preferably selected from 2-40, most preferably selected from 2-20; Each structural unit M b Each is independently selected from an amino acid residue, preferably an α-amino acid residue, more preferably an α-amino acid residue having a neutral side chain, for example, an amino acid residue selected from the following group: alanine (Ala), glycine (Gly), proline (Pro), cysteine (Cys), valine (Val) and sarcosine (Sar); j is an integer selected from 1-100, preferably selected from 1-80; more preferably selected from 1-60; even more preferably selected from 1-40, most preferably selected from 1-20; The structural unit M a and structural unit M b connected in any order in random form, block form, alternating form, or a combination thereof; p is an integer selected from 1-12, such as 1-10, 1-8, 1-6, or 1-4.

33. The peptoid-lipid conjugate according to any one of claims 20 to 32, or a stereoisomer or a pharmaceutically acceptable salt thereof, wherein: The peptoid-lipid conjugate of formula (VI) is selected from:

34. The peptoid-lipid conjugate according to any one of claims 20 to 33, or a stereoisomer or a pharmaceutically acceptable salt thereof, for use in preparing a lipid composition, such as a liposome or a lipid nanoparticle.

35. Use of the peptoid-lipid conjugate according to any one of claims 20 to 33, or a stereoisomer or a pharmaceutically acceptable salt thereof, in the preparation of a lipid composition, such as a liposome or a lipid nanoparticle.

36. A lipid composition comprising the peptoid-lipid conjugate according to any one of claims 20-33, or a stereoisomer or a pharmaceutically acceptable salt thereof, optionally wherein the peptoid-lipid conjugate accounts for about 0.1 mol% to about 60.0 mol%, preferably about 0.5% to about 20.0%, and preferably about 1.0% to about 10.0%, based on the total molar amount of the components constituting the lipid composition.

37. The lipid composition according to claim 36, wherein The lipid composition is a liposome or a lipid nanoparticle (LNP).

38. The lipid composition according to claim 36, wherein The lipid composition is a liposome, which further comprises a phospholipid and cholesterol or a cholesterol derivative.

39. The lipid composition according to claim 38, wherein The phospholipid accounts for about 5.0 mol% to about 60.0 mol% based on the total molar amount of the components constituting the liposome, or a range of any value between about 5.0 mol% and about 60.0 mol%.

40. The lipid composition according to claim 38 or 39, wherein Based on the total molar amount of the components constituting the liposome, the cholesterol or cholesterol derivative accounts for about 20.0 mol% to about 60.0 mol%, or a range of any value between about 20.0 mol% and about 60.0 mol%.

41. The lipid composition according to any one of claims 38-40, wherein The liposomes also include a small molecule drug.

42. The lipid composition according to claim 36, wherein The lipid composition is a lipid nanoparticle which further comprises a phospholipid and cholesterol or a cholesterol derivative.

43. The lipid composition according to claim 42, wherein Based on the total molar amount of the components constituting the lipid nanoparticles, the phospholipids account for about 0 mol% to about 20.0 mol%, or a range between about 0 mol% to about 20.0 mol%, preferably, the phospholipids account for about 5.0 mol% to about 20.0 mol%, or a range between about 5.0 mol% to about 20.0 mol%.

44. The lipid composition according to claim 42 or 43, wherein Based on the total molar amount of the components constituting the lipid nanoparticles, the cholesterol or cholesterol derivative accounts for about 10.0 mol% to about 60.0 mol%, or a range between any values between about 10.0 mol% to about 60.0 mol%, preferably, the cholesterol or cholesterol derivative accounts for about 20.0 mol% to about 60.0 mol%, or a range between any values between about 20.0 mol% to about 60.0 mol%.

45. The lipid composition according to any one of claims 42-44, wherein The lipid nanoparticles further comprise a cationic lipid, optionally comprising, based on the total molar amount of the components constituting the lipid nanoparticles, about 10.0 mol% to about 90.0 mol%, or a range of any value between about 10.0 mol% to about 90.0 mol%, preferably about 20.0 mol% to about 65.0 mol%, or a range of any value between about 20.0 mol% to about 65.0 mol%.

46. according to the lipid composition described in claim 45, wherein, The cationic lipid is a tertiary amine type cationic lipid.

47. The lipid composition according to claim 46, wherein The cationic lipid is a mixture of tertiary amine cationic lipid and quaternary ammonium cationic lipid.

48. The lipid composition according to claim 47, wherein The content ratio of the tertiary amine type cationic lipid to the quaternary ammonium type cationic lipid is about 1:20 to 20:

1.

49. The lipid composition according to any one of claims 42-48, wherein The lipid nanoparticle further comprises a polymer lipid, optionally the polymer lipid is a PEG lipid, optionally the polymer lipid comprises about 0 mol% to about 10.0 mol%, or a range of any value between about 0 mol% and about 10.0 mol%, based on the total molar amount of the components constituting the lipid nanoparticle.

50. The lipid composition according to any one of claims 42-49, wherein The lipid nanoparticle further comprises a nucleic acid, and optionally, the N / P ratio of the cationic lipid to the nucleic acid is about 1.1:1 to 20:

1.

51. The lipid composition according to claim 50, wherein The nucleic acid is RNA.

52. lipid compositions according to claim 51, wherein said RNA is mRNA, circRNA, siRNA, microRNA, gRNA, ASO, tRNA etc., or the combination of above one or more RNA.

53. Use of a lipid composition comprising the peptoid-lipid conjugate according to any one of claims 20-33, or a stereoisomer or a pharmaceutically acceptable salt thereof in the delivery of small molecule drugs or nucleic acids, optionally wherein the lipid composition is a liposome or a lipid nanoparticle.

54. The method of claim 53, wherein the small molecule drug or nucleic acid delivery comprises delivering the small molecule drug or nucleic acid to cells in vitro, and delivering the small molecule drug or nucleic acid to a subject in vivo, including a human subject and an animal subject.

55. A liposome-based small molecule drug delivery system, wherein the liposome comprises the peptoid-lipid conjugate according to any one of claims 20 to 33, or a stereoisomer or a pharmaceutically acceptable salt thereof.

56. A nucleic acid delivery system based on lipid nanoparticles, wherein the lipid nanoparticles comprise the peptoid-lipid conjugate according to any one of claims 20-33, or a stereoisomer or a pharmaceutically acceptable salt thereof.

57. A pharmaceutical composition comprising the peptoid-lipid conjugate according to any one of claims 20-33, or a stereoisomer or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or excipient, optionally wherein the peptoid-lipid conjugate accounts for about 0.1 mol% to about 60.0 mol%, preferably about 0.5% to about 20.0%, and preferably about 1% to about 10.0%, based on the total molar amount of the components constituting the pharmaceutical composition.

58. The pharmaceutical composition according to claim 57, further comprising a phospholipid and cholesterol or a cholesterol derivative, optionally, based on the total molar amount of the components constituting the pharmaceutical composition, the phospholipid accounts for about 0 mol% to about 20.0 mol%, or a range of any values between about 0 mol% and about 20.0 mol%, or, optionally, based on the total molar amount of the components constituting the pharmaceutical composition, the cholesterol or cholesterol derivative accounts for about 10.0 mol% to about 60.0 mol%, or a range of any values between about 10.0 mol% and about 60.0 mol%.

59. The pharmaceutical composition according to claim 57 or 58, further comprising a cationic lipid, preferably, the cationic lipid accounts for about 10.0 mol% to about 90.0 mol%, or a range of any value between about 10.0 mol% and about 90.0 mol%, based on the total molar amount of the components constituting the pharmaceutical composition.

60. The pharmaceutical composition of any one of claims 57-59, further comprising a polymer lipid, optionally wherein the polymer lipid is a PEG lipid, optionally wherein the polymer lipid comprises from about 0 mol% to about 10.0 mol%, or a range of any value between about 0 mol% and about 10.0 mol%, based on the total molar amount of the components constituting the lipid nanoparticle.

61. The pharmaceutical composition according to any one of claims 57-60, further comprising a nucleic acid molecule and / or a small molecule drug, preferably, the nucleic acid molecule is RNA.

62. The pharmaceutical composition according to any one of claims 57 to 61, wherein The pharmaceutical composition is a lipid nanoparticle, optionally a lipid nanoparticle that can be aerosolized and inhaled.

63. The pharmaceutical composition according to claim 62, wherein The lipid nanoparticles are atomized via a nebulization device, optionally selected from a vibrating mesh nebulizer, an ultrasonic nebulizer, a jet nebulizer, a soft mist inhaler, and the like.

64. The pharmaceutical composition according to any one of claims 57 to 63, wherein The peptoid-lipid conjugate comprises one or more structural units M a and optionally one or more structural units M b , which includes a structural unit M having a group B a The number of structural units M a and optional structural unit M b At least 10%, or at least 20%, 30%, 33%, 50%, 67%, 80%, 90% or 100% of the total.

65. A method for increasing the stability of a lipid composition during a nebulization process, optionally wherein the lipid composition is a liposome, or a lipid nanoparticle (LNP).

66. according to the method for claim 65, wherein said lipid composition is lipid nanoparticle, and it comprises cationic lipid, phospholipid, cholesterol or cholesterol derivative, and / or polymer lipid, The method comprises: (1) adding an amphiphilic conjugate to the lipid nanoparticles; or (2) replacing the polymer lipid component of the lipid nanoparticle with an amphiphilic conjugate, Optionally, the amphiphilic conjugate is a conjugate comprising a group B in its structure, Group B has the structure shown in the following formula: wherein l and m are each independently an integer selected from 1-6; R 4 、R 5 、R 6 、R 7 and R 8 are each independently selected from hydrogen and C 1-6 alkyl; R 9 、R 9’ 、R 10 and R 10’ are each independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 1-6 alkoxy; The group Q is selected from -CO2 － 、-SO2 － 、-SO3 － 、-OSO2 － 、-SO4 － 、-P(O)(OR P )O － AND-OP(O)(OR P )O － The group consisting of R P Selected from hydrogen, C 1-6 alkyl; When the amphiphilic conjugate comprises a plurality of groups B, the plurality of groups B are the same or different.

67. The method according to claim 65 or 66, wherein the amphiphilic conjugate is a peptoid-lipid conjugate according to any one of claims 20 to 33, or a stereoisomer or a pharmaceutically acceptable salt thereof, optionally comprising one or more structural units M a and optionally one or more structural units M b , which includes a structural unit M having a group B a The number of structural units M a and optional structural unit M b At least 10%, or at least 20%, 30%, 33%, 50%, 67%, 80%, 90% or 100% of the total number of structural units M, for example, including groups B a The number of structural units M a and optional structural unit M b 30%-100% of the total, preferably 50%-100%, more preferably 75%-100%.

68. A lipid composition for aerosol inhalation, comprising an amphiphilic conjugate, optionally wherein the amphiphilic conjugate is a peptoid-lipid conjugate according to any one of claims 20-33, or a stereoisomer or a pharmaceutically acceptable salt thereof, optionally wherein the peptoid-lipid conjugate comprises one or more structural units M a and optionally one or more structural units M b , which includes a structural unit M having a group B a The number of structural units M a and optional structural unit M b At least 10%, or at least 20%, 30%, 33%, 50%, 67%, 75%, 80%, 90% or 100% of the total, for example, structural units M comprising groups B a The number of structural units M a and optional structural unit M b 30%-100% of the total, preferably 50%-100%, more preferably 75%-100%.

69. The lipid composition according to claim 68, wherein The molecular weight of the amphiphilic conjugate is in the range of 1000 g / mol to 40000 g / mol.

70. The lipid composition according to claim 68 or 69, wherein The lipid composition is a liposome or a lipid nanoparticle.

71. A method for increasing the stability of lipid nanoparticles during atomization, wherein the lipid nanoparticles comprise a high proportion of PEG lipids, in, The method comprises adding an amphiphilic conjugate to the lipid nanoparticle, optionally wherein the amphiphilic conjugate is a peptoid-lipid conjugate according to any one of claims 20-33, optionally wherein the peptoid-lipid conjugate comprises one or more structural units M a and optionally one or more structural units M b , which includes a structural unit M having a group B a The number of structural units M a and optional structural unit M b At least 10%, or at least 20%, 30%, 33%, 50%, 67%, 75%, 80%, 90% or 100% of the total, for example, structural units M comprising groups B a The number of structural units M a and optional structural unit M b 30%-100% of the total, preferably 50%-100%, more preferably 75%-100%.

72. The method of claim 71, wherein the high proportion of PEG lipids means that, based on the total molar amount of the components constituting the lipid nanoparticles, PEG lipids account for at least about 3 mol%, at least about 4 mol%, at least about 5 mol%, at least about 6 mol%, at least about 7 mol%, at least about 8 mol%, at least about 9 mol%, or at least about 10 mol%.

73. The method according to claim 71 or 72, wherein The molecular weight of the amphiphilic conjugate is in the range of 1000 g / mol to 40000 g / mol.

74. A nebulized inhalation microparticle, which is formed by atomizing a solution formed by dispersing the lipid composition according to any one of claims 36-52 or the pharmaceutical composition according to any one of claims 57-64 in a buffer via a nebulizer, wherein the nebulizer is optionally selected from a vibrating mesh nebulizer, an ultrasonic nebulizer, a jet nebulizer, a soft mist inhaler, etc.

75. The aerosolized inhalation microparticles according to claim 74, which deliver nucleic acid drugs to respiratory tract and / or lung tissue cells by inhalation.

76. The aerosolized inhalation microparticles according to claim 74 or 75, which deliver nucleic acid drugs to non-lung cells through the respiratory tract and lung tissue by inhalation.

77. The aerosolized inhalation microparticles according to any one of claims 74-76, wherein the peptoid-lipid conjugate comprises at least about 1.5 mol %, at least about 2.5 mol %, at least about 3 mol %, or at least about 5 mol % of the lipid composition.

Images