Circular polyribonucleotides and unmodified linear rnas with reduced immunogenicity

Circular polyribonucleotides with optimized sequences and reduced uridine content address immunogenicity issues, ensuring stable and prolonged polypeptide expression by minimizing TLR7 and TLR8 recognition, enhancing delivery efficacy.

WO2025179198A1PCT designated stage Publication Date: 2025-08-28SAIL BIOMEDICINES INC +3
View PDF 35 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/016874
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-23
Filing Date
2025-02-21
Publication Date
2025-08-28

AI Technical Summary

Technical Problem

Circular polyribonucleotides and unmodified linear RNAs induce an immune response due to nucleic acid impurities and motifs recognized by immune receptors like TLRs and ribonucleases, leading to immunogenicity and instability in mammalian systems.

Method used

Development of circular polyribonucleotides with reduced uridine content and optimized sequences to minimize TLR7 and TLR8 recognition motifs, combined with a circularization element and IRES sequence, to enhance stability and reduce immunogenicity.

Benefits of technology

The modified RNAs provide prolonged and stable expression of encoded polypeptides with reduced immunogenicity, minimizing immune responses and improving delivery efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025016874_28082025_PF_FP_ABST
    Figure US2025016874_28082025_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure provides circular polyribonucleotides including a sequence including: a circularization element; a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides and / or reduce or remove TLR7- and TLR8-recognition motifs, and kits and compositions thereof. The present disclosure also provides methods of treating subjects in need thereof with the circular polyribonucleotides and compositions described herein.
Need to check novelty before this filing date? Find Prior Art

Description

Fish Ref: 56929-0006WO1 Client Ref: LRN23-109WO1 CIRCULAR POLYRIBONUCLEOTIDES AND UNMODIFIED LINEAR RNAs WITH REDUCED IMMUNOGENICITY CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 557,158, filed February 23, 2024, the contents of which are hereby incorporated by reference in its entirety. SEQUENCE LISTING This application contains a Sequence Listing that has been submitted electronically as an XML file named “56929-0006WO1_ST26_SL.XML.” The XML file, created on February 5, 2025, is 66,012 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety. TECHNICAL FIELD The present disclosure generally relates to compositions including circular polyribonucleotides and unmodified linear RNAs, their associated elements, and the polypeptides which they encode. BACKGROUND Circular polyribonucleotides have been shown to have persistent expression in vitro and in vivo relative to traditional mRNA transfection. However, due to various nucleic acid impurities and / or motifs recognized by immune receptors such as toll-like receptors (TLRs), retinoic acid-inducible gene I (RIG-I) etc., or recognized and cleaved by ribonucleases (for example, RNase T2), an immune response can be generated in a mammal following administration of circular polyribonucleotides. The present disclosure features compositions to reduce immunogenicity associated with circular polyribonucleotides and / or unmodified linear RNAs. SUMMARYFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 The present disclosure is based, at least in part, on the development of circular polyribonucleotides and unmodified RNAs, their associated elements, and the polypeptides which they encode. These circular polyribonucleotides and unmodified linear RNAs provide for prolonged and stable expression of the encoded polypeptide(s) in a subject (e.g., subjects having a disease) and reduced immunogenicity due to reduced (or removed) uridine content and / or toll- like receptor (TLRs, in particular TLR7 and TLR8) recognition motifs, or target sites for RNase T2. Thus provided herein are circular polyribonucleotides that include: a circularization element; a first spacer, wherein the first spacer comprises AC120 (SEQ ID NO: 66); an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, wherein the second spacer comprises AC120 (SEQ ID NO: 66), where the sequence encoding the polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 20% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 25% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 30% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 40% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 50% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide. Also provided herein are circular polyribonucleotides that include: a circularization element; a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon- optimized to reduce or remove TLR7- and TLR8-recognition motifs. In some embodiments ofFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide does not comprise a TLR7- or TLR8-recognition motif. Also provided herein are circular polyribonucleotides that include: a circularization element; a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon- optimized to both reduce the number of uracil ribonucleotides and reduce or remove TLR7- and TLR8-recognition motifs. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 20% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide and does not include a TLR7- or TLR8-recognition motif. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 25% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide and does not include a TLR7- or TLR8-recognition motif. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 30% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide and does not include a TLR7- or TLR8-recognition motif. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 40% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide and does not include a TLR7- or TLR8-recognition motif. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 50% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide and does not include a TLR7- or TLR8-recognition motif. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 20% decrease in the number of TLR7- or TLR8-recognition motifs as compared to wild-type sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 30% decrease in the number of TLR7- or TLR8-recognition motifs as compared to wild-type sequence encoding the polypeptide. In some embodiments ofFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 40% decrease in the number of TLR7- or TLR8-recognition motifs as compared to wild-type sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 50% decrease in the number of TLR7- or TLR8-recognition motifs as compared to wild-type sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 60% decrease in the number of TLR7- or TLR8-recognition motifs as compared to wild-type sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 70% decrease in the number of TLR7- or TLR8-recognition motifs as compared to wild-type sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 80% decrease in the number of TLR7- or TLR8-recognition motifs as compared to wild-type sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 90% decrease in the number of TLR7- or TLR8-recognition motifs as compared to wild-type sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide does not comprise a TLR7- or TLR8-recognition motif. In some embodiments of any of the circular polyribonucleotides described herein, the first spacer comprises AC120 (SEQ ID NO: 66). In some embodiments of any of the circular polyribonucleotides described herein, the second spacer comprises AC120 (SEQ ID NO: 66). In some embodiments of any of the circular polyribonucleotides described herein, the first spacer comprises AC120 (SEQ ID NO: 66) and the second spacer comprises AC120 (SEQ ID NO: 66). Also provided are circular polyribonucleotides that include: a circularization element; a first spacer comprising an AC120 sequence (SEQ ID NO: 66); an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer comprising an AC120 sequence (SEQ ID NO: 66), where the sequence encoding the polypeptide has been codon- optimized to both reduce the number of uracil ribonucleotides and reduce or remove TLR7- and TLR8-recognition motifs.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 20% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 25% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 30% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 40% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide comprises at least a 50% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the polypeptide does not comprise a TLR7- or TLR8-recognition motif. In some embodiments of any of the circular polyribonucleotides described herein, the circular polyribonucleotide comprises one or more modifications. In some embodiments of any of the circular polyribonucleotides described herein, the one or more modifications comprise one or more modifications to a portion of the sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the one or more modifications comprise a modification to a sugar, a nucleobase, an internucleoside linkage, or a combination thereof. In some embodiments of any of the circular polyribonucleotides described herein, the circular polyribonucleotide further comprises a translation initiation sequence operably linked to the sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the circular polyribonucleotide further comprises a translation termination sequence. In some embodiments of any of the circular polyribonucleotides described herein, the circular polyribonucleotide lacks a translation termination sequence.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 In some embodiments of any of the circular polyribonucleotides described herein, the circular polyribonucleotide further comprises a stagger element at a 3’ end of the sequence encoding the polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the stagger element is configured to stall a ribosome during rolling circle translation. In some embodiments of any of the circular polyribonucleotides described herein, the circular polyribonucleotide does not comprise a poly(A) tail operably linked to the sequence encoding the polypeptide. Also provided herein are pharmaceutical compositions that include any of the circular polyribonucleotides described herein, and a pharmaceutically acceptable excipient. In some embodiments of any of the pharmaceutical compositions described herein, the circular polyribonucleotide is formulated as a lipid nanoparticle. In some embodiments of any of the pharmaceutical compositions described herein, the circular polyribonucleotide is formulated for unencapsulated delivery or natural particle delivery. In some embodiments of any of the pharmaceutical compositions described herein, the pharmaceutical composition is formulated for intravenous, subcutaneous, intrahepatic, inhalation, or intramuscular administration. In some embodiments of any of the pharmaceutical compositions described herein, the pharmaceutical composition is formulated for local administration. In some embodiments of any of the pharmaceutical compositions described herein, the pharmaceutical composition is formulated for systemic administration. In some embodiments of any of the pharmaceutical compositions described herein, the pharmaceutical composition comprises one or more of the following features: (i) a concentration of the circular polyribonucleotide of between 0.1 ng / mL and 500 mg / mL; (ii) a concentration of deoxyribonucleotide of no more than 100 ng / mL; (iii) a concentration of protein of less than 100 ng of protein per milligram (mg) of the circular polyribonucleotide; (iv) an A260 / A280 absorbance ratio of from about 1.6 to 2.3 as measured by a spectrophotometer; (v) substantially free of a process-related impurity selected from a cell protein, a cell deoxyribonucleic acid, an enzyme, a reagent component, a gel component, or a chromatographic material; and (vi) a reduced level of one or more markers of an immune or inflammatory response after purification compared to prior to purification.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 Also provided herein are kits that include any of the pharmaceutical compositions described herein. Also provided herein are methods of expressing the polypeptide in a subject in need thereof that include administering to the subject any of the circular polyribonucleotides described herein or any the pharmaceutical compositions described herein. In some embodiments of any of the methods described herein, the subject has been previously identified or diagnosed as being in need of increased levels of the polypeptide. Also provided herein are methods of increasing a level of the polypeptide in a subject in need thereof that include administering to the subject any of the circular polyribonucleotides described herein or any of the pharmaceutical compositions described herein. In some embodiments of any of the methods described herein, the subject has been previously identified or diagnosed as being in need of increased levels of the polypeptide. Also provided herein are methods of treating a subject in need thereof that include administering to the subject any of the circular polyribonucleotides described herein or any of the pharmaceutical compositions described herein. In some embodiments of any of the methods described herein, the subject has previously been identified or diagnosed as being in need of increased levels of the polypeptide. Also provided herein are circular polyribonucleotides that include: a circularization element; a first spacer; a first internal ribosome entry site (IRES) sequence; a sequence encoding a first polypeptide; a second spacer; a second IRES sequence; a sequence encoding a second polypeptide; and a third spacer; where the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides. In some embodiments, the circular polyribonucleotides include a circularization element; a first spacer; a first IRES sequence; a sequence encoding a first polypeptide; a stagger element; a second IRES sequence, a sequence encoding a second polypeptide; and a second spacer, where the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides. In some embodiments of any of the circular polyribonucleotides described herein, the first spacer, the second spacer, and / or the third spacer comprises AC120 (SEQ ID NO: 66). InFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 some embodiments of any of the circular polyribonucleotides described herein, the first spacer, the second spacer, and / or the third spacer comprises AU120 (SEQ ID NO: 67). In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide comprises at least a 20% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the first polypeptide or a wild-type sequence encoding the second polypeptide, respectively. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide comprises at least a 25% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the first polypeptide or a wild-type sequence encoding the second polypeptide, respectively. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide comprises at least a 30% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the first polypeptide or a wild-type sequence encoding the second polypeptide, respectively. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide comprises at least a 40% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the first polypeptide or a wild-type sequence encoding the second polypeptide, respectively. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide comprises at least a 50% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the first polypeptide or a wild-type sequence encoding the second polypeptide, respectively. In some embodiments of any of the circular polyribonucleotides described herein, the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide does not comprise a TLR7- or TLR8-recognition motif. In some embodiments of any of the circular polyribonucleotides described herein, the circular polyribonucleotide comprises one or more modifications. In some embodiments of any of the circular polyribonucleotides described herein, the one or more modifications comprise one or more modifications to a portion of the sequence encoding the first polypeptide and / or theFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 sequence encoding the second polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the one or more modifications comprise a modification to a sugar, a nucleobase, an internucleoside linkage, or a combination thereof. In some embodiments of any of the circular polyribonucleotides described herein, the circular polyribonucleotide further comprises a translation initiation sequence operably linked to the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the circular polyribonucleotide further comprises a translation termination sequence. In some embodiments of any of the circular polyribonucleotides described herein, the circular polyribonucleotide lacks a translation termination sequence. In some embodiments of any of the circular polyribonucleotides described herein, the circular polyribonucleotide further comprises a stagger element at a 3’ end of the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide. In some embodiments of any of the circular polyribonucleotides described herein, the stagger element is configured to stall a ribosome during rolling circle translation. In some embodiments of any of the circular polyribonucleotides described herein, the circular polyribonucleotide does not comprise a poly(A) tail operably linked to the sequence encoding the first polypeptide or the sequence encoding the second polypeptide. Also provided herein are pharmaceutical compositions that include any of the circular polyribonucleotides described herein and a pharmaceutically acceptable excipient. In some embodiments of any of the pharmaceutical compositions described herein, the circular polyribonucleotide is formulated as a lipid nanoparticle. In some embodiments of any of the pharmaceutical compositions described herein, the circular polyribonucleotide is formulated for unencapsulated delivery or natural particle delivery. In some embodiments of any of the pharmaceutical compositions described herein, the pharmaceutical composition is formulated for intravenous, subcutaneous, intrahepatic, inhalation, or intramuscular administration. In some embodiments of any of the pharmaceutical compositions described herein, the pharmaceutical composition is formulated for local administration. In some embodiments of any of the pharmaceutical compositions described herein, the pharmaceutical composition is formulated for systemic administration.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 In some embodiments of any of the pharmaceutical compositions described herein, the pharmaceutical composition comprises one or more of the following features: (i) a concentration of the circular polyribonucleotide of between 0.1 ng / mL and 500 mg / mL; (ii) a concentration of deoxyribonucleotide of no more than 100 ng / mL; (iii) a concentration of protein of less than 100 ng of protein per milligram (mg) of the circular polyribonucleotide; (iv) an A260 / A280 absorbance ratio of from about 1.6 to 2.3 as measured by a spectrophotometer; (v) substantially free of a process-related impurity selected from a cell protein, a cell deoxyribonucleic acid, an enzyme, a reagent component, a gel component, or a chromatographic material; and (vi) a reduced level of one or more markers of an immune or inflammatory response after purification compared to prior to purification. Also provided herein are kits that include any of the pharmaceutical compositions described herein. Also provided herein are methods of expressing the first polypeptide and the second polypeptide in a subject in need thereof that include administering to the subject any of the circular polyribonucleotides described herein or any of the pharmaceutical compositions described herein. In some embodiments of any of the methods described herein, the subject has been previously identified or diagnosed as being in need of increased levels of the first polypeptide and the second polypeptide. Also provided herein are methods of increasing a level of the first polypeptide and the second polypeptide in a subject in need thereof that include administering to the subject any of the circular polyribonucleotides described herein or any of the pharmaceutical compositions described herein. In some embodiments of any of the methods described herein, the subject has been previously identified or diagnosed as being in need of increased levels of the first polypeptide and the second polypeptide. Also provided herein are methods of treating a subject in need thereof that include administering to the subject any of the circular polyribonucleotides described herein or any of the pharmaceutical compositions described herein. In some embodiments of any of the methods described herein, the subject has previously identified or diagnosed as being need of increased levels of the first polypeptide and / or the second polypeptide. Also provided herein are DNA vectors encoding a polyribonucleotide including: a circularization element; a first spacer; an internal ribosome entry site (IRES) sequence; aFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 sequence encoding a polypeptide (e.g., an RNA sequence); and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides. Also provided herein are DNA vectors encoding a polyribonucleotide including: a circularization element; a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to both reduce the number of uracil ribonucleotides and reduce or remove TLR7- and TLR8-recognition motifs. Also provided herein DNA vectors encoding a polyribonucleotide including: a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides. Also provided herein are DNA vectors encoding a polyribonucleotide including: a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to both reduce the number of uracil ribonucleotides and reduce or remove TLR7- and TLR8-recognition motifs. Also provided herein are unmodified linear RNAs including: a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides. Also provided herein are unmodified linear RNAs including: a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to both reduce the number of uracil ribonucleotides and reduce or remove TLR7- and TLR8-recognition motifs. All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, patent application, or item of information was specifically and individually indicated to be incorporated by reference. To the extent publications, patents, patent applications, and items of information incorporated by reference contradict the disclosure contained in the specification, theFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 specification is intended to supersede and / or take precedence over any such contradictory material. Where values are described in terms of ranges, it should be understood that the description includes the disclosure of all possible sub-ranges within such ranges, as well as specific numerical values that fall within such ranges irrespective of whether a specific numerical value or specific sub-range is expressly stated. The term “each,” when used in reference to a collection of items, is intended to identify an individual item in the collection but does not necessarily refer to every item in the collection, unless expressly stated otherwise, or unless the context of the usage clearly indicates otherwise. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS The following drawings illustrate certain embodiments of the features and advantages of this disclosure. These embodiments are not intended to limit the scope of the appended claims in any manner. Like reference symbols in the drawings indicate like elements. FIG. 1 is a graph showing human growth hormone (hGH) expression encoded by a circular RNA in wildtype mice and interferon alpha receptor (IFNaR) knockout (KO) mice. FIG. 2 is a graph showing interferon alpha (IFNa) expression at 4 hours post in vivo injection of various RNA constructs. FIG. 3 is a graph showing interferon alpha (IFNa) expression at 4 hours post in vivo injection of various RNA constructs.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 FIG. 4 is a graph showing the percentage of CD69+B-cells post in vivo injection of circular RNAs. FIG. 5 is a graph showing the geometric mean of CD69 of B-cells post in vivo injection of circular RNAs. FIG. 6 is an exemplary circular RNA design including a circularization element (CE), a first spacer sequence, an internal ribosome entry site (IRES) sequence, an open reading frame (ORF), and a second spacer sequence. FIGs. 7A-B are graphs showing hGH expression encoded by various circular RNA constructs in either macrophages (FIG. 7A) or A549 RIG-I KO cells (FIG. 7B). FIG. 8 is a graph showing interferon gamma induced protein 10 (IP-10) expression after injection with various circular RNA constructs encoding hGH in macrophages. FIG. 9 is a graph showing IFN alpha expression after injection with various circular RNA constructs encoding hGH in macrophages. FIG. 10 is a graph showing hGH expression of various circular RNA constructs encoding hGH in macrophages. FIG. 11 is a graph showing hGH expression at 24 hours post-injection of various circular RNA constructs encoding hGH in macrophages. FIG. 12 is a graph showing hGH expression at 72 hours post-injection of various circular RNA constructs encoding hGH in macrophages. DETAILED DESCRIPTION Provided herein are circular polyribonucleotides and unmodified linear RNAs encoding a polypeptide (or a first polypeptide and a second polypeptide), and related pharmaceutical compositions, kits, and methods. Circular polyribonucleotides and unmodified linear RNAs described herein comprise a sequence encoding a polypeptide that have been codon-optimized to reduce the number of uracil ribonucleotides or remove the uracil ribonucleotides, and / or reduce or remove TLR7- and TLR8-recognition motifs. In some examples, the sequence encoding the polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides. In some examples, the sequence encoding the polypeptide has been codon-optimized to reduce or remove TLR7- and TLR8-recognition motifs. In some examples, the sequence encoding the polypeptide has been codon-optimized to both reduce or remove the number of uracil ribonucleotides and toFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 reduce or remove TLR7- and TLR8-recognition motifs. The circular polyribonucleotides and unmodified linear RNAs described herein are useful in reducing RNA induced immunogenicity. Sources of RNA-induced immunogenicity include double-stranded RNA, single-stranded RNA, uridine, and 5’ triphosphate RNA. These impurities can be targeted for degradation and / or inhibition of translation by pathways that include proteins such as toll-like receptor TLR7, TLR8, and RIG-I. The impurities can result from naturally occurring processes, i.e., DNA repair, translation errors, etc., however, these pathways can also be activated by RNA introduced into the cell or organism (e.g., circular or unmodified linear polyribonucleotides). TLR7 and TLR8 recognize single-stranded RNA molecules and can stimulate an immune response to produce interferon alpha, as well as numerous interleukins. More specifically, TLR7 and TLR8 are endosomal sensors that recognize single-stranded RNA viruses, some bacteria, and other synthetic oligoribonucleotides and, in general, recognize AU rich sequences. TLR7 has also been implicated in diseases such as lupus. Methods and compositions are still needed to deliver nucleic acids, such as circular polyribonucleotides, to subjects that mitigate or remove RNA-induced immunogenicity. Circular Polyribonucleotides / Unmodified Linear RNAs Circular Polyribonucleotides / Unmodified Linear RNAs Encoding a Polypeptide In some embodiments, circular polyribonucleotides and unmodified linear RNAs described herein comprise sequences include: a circularization element; a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides. In some embodiments, circular polyribonucleotides described herein include: a circularization element; a first spacer, optionally wherein the first spacer comprises AC120 (SEQ ID NO: 66); an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, optionally wherein the second spacer comprises AC120 (SEQ ID NO: 66), where the sequence encoding the polypeptide has been codon-optimized to reduce or remove TLR7- and TLR8-recognition motifs. In some embodiments, the sequence encoding the polypeptide does not include a TLR7- or TLR8-recognition motif.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 In some embodiments, linear unmodified RNAs described herein include: a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to reduce or remove TLR7- and TLR8-recognition motifs. In some embodiments, the sequence encoding the polypeptide does not include a TLR7- or TLR8-recognition motif. TLR7 is expressed in intracellular compartments and mediates the recognition of guanosine- and uridine-rich ssRNA and ssRNA viruses, including influenza and vesicular stomatitis virus. TLR7 also recognizes synthetic antiviral nucleoside analogs such as imiquimod (R848), gardiquimod, and loxoribine. The TLR7 recognition motif is: “UCW”, where W = U or A. TLR8 can recognize GU-rich single-stranded RNA. It can recognize ssRNA viruses such as Influenza, Sendai, and Coxsackie B viruses. The TLR8 recognition motif is: “KNUNDK”, where K = G or U, N = any, D = any but C. In some embodiments, circular polyribonucleotides described herein include: a circularization element; a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to both reduce the number of uracil ribonucleotides and to reduce or remove TLR7- and TLR8-recognition motifs. In some embodiments, the unmodified linear RNAs described herein include a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to both reduce the number of uracil ribonucleotides and to reduce or remove TLR7- and TLR8- recognition motifs. Also provided herein are circular polyribonucleotides and unmodified linear RNAs that include: a circularization element; a first spacer including an AC120 sequence (SEQ ID NO: 66); an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer including an AC120 sequence (SEQ ID NO: 66), where the sequence encoding the polypeptide has been codon-optimized to both reduce the number of uracil ribonucleotides and to reduce or remove TLR7- and TLR8-recognition motifs. In some embodiments, the sequence encoding the polypeptide (e.g., any of the exemplary polypeptides described herein or known in the art) includes less than 500 (e.g., less than 480,Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 less than 460, less than 440, less than 420, less than 400, less than 380, less than 360, less than 340, less than 320, less than 300, less than 380, less than 360, less than 340, less than 320, less than 300, less than 280, less than 260, less than 240, less than 220, less than 200, less than 180, less than 160, less than 140, less than 120, less than 100, less than 90, less than 80, less than 70, less than 60, less than 50, less than 40, less than 30, less than 25, less than 20, less than 10, or less than 5) uracil ribonucleotides. In some embodiments, the sequence encoding the polypeptide (e.g., any of the exemplary polypeptides described herein) contains about 5 to about 500 (e.g., about 5 to about 480, about 5 to about 460, about 5 to about 440, about 5 to about 420, about 5 to about 400, about 5 to about 380, about 5 to about 360, about 5 to about 340, about 5 to about 320, about 5 to about 300, about 5 to about 280, about 5 to about 260, about 5 to about 240, about 5 to about 220, about 5 to about 200, about 5 to about 180, about 5 to about 160, about 5 to about 140, about 5 to about 120, about 5 to about 100, about 5 to about 80, about 5 to about 60, about 5 to about 40, about 5 to about 20, about 5 to about 10, about 10 to about 500, about 10 to about 480, about 10 to about 460, about 10 to about 440, about 10 to about 420, about 10 to about 400, about 10 to about 380, about 10 to about 360, about 10 to about 340, about 10 to about 320, about 10 to about 300, about 10 to about 280, about 10 to about 260, about 10 to about 240, about 10 to about 220, about 10 to about 200, about 10 to about 180, about 10 to about 160, about 10 to about 140, about 10 to about 120, about 10 to about 100, about 10 to about 80, about 10 to about 60, about 10 to about 40, about 10 to about 20, about 20 to about 500, about 20 to about 480, about 20 to about 460, about 20 to about 440, about 20 to about 420, about 20 to about 400, about 20 to about 380, about 20 to about 360, about 20 to about 340, about 20 to about 320, about 20 to about 300, about 20 to about 280, about 20 to about 260, about 20 to about 240, about 20 to about 220, about 20 to about 200, about 20 to about 180, about 20 to about 160, about 20 to about 140, about 20 to about 120, about 20 to about 100, about 20 to about 80, about 20 to about 60, about 20 to about 40, about 40 to about 500, about 40 to about 480, about 20 to about 460, about 40 to about 440, about 40 to about 420, about 40 to about 400, about 40 to about 380, about 40 to about 360, about 40 to about 340, about 40 to about 320, about 40 to about 300, about 40 to about 280, about 40 to about 260, about 40 to about 240, about 40 to about 220, about 40 to about 200, about 40 to about 180, about 40 to about 160, about 40 to about 140, about 40 to about 120, about 40 to about 100, about 40 to about 80, about 40 to about 60, about 60 to about 500, about 60 to about 480, aboutFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 60 to about 460, about 60 to about 440, about 60 to about 420, about 60 to about 400, about 60 to about 380, about 60 to about 360, about 60 to about 340, about 60 to about 320, about 60 to about 300, about 60 to about 280, about 60 to about 260, about 60 to about 240, about 60 to about 220, about 60 to about 200, about 60 to about 180, about 60 to about 160, about 60 to about 140, about 60 to about 120, about 60 to about 100, about 60 to about 80, about 80 to about 500, about 80 to about 480, about 80 to about 460, about 80 to about 440, about 80 to about 420, about 80 to about 400, about 80 to about 380, about 80 to about 360, about 80 to about 340, about 80 to about 320, about 80 to about 300, about 80 to about 280, about 80 to about 260, about 80 to about 240, about 80 to about 220, about 80 to about 200, about 80 to about 180, about 80 to about 160, about 80 to about 140, about 80 to about 120, about 80 to about 100, about 100 to about 500, about 100 to about 480, about 100 to about 460, about 100 to about 440, about 100 to about 420, about 100 to about 400, about 100 to about 380, about 100 to about 360, about 100 to about 340, about 100 to about 320, about 100 to about 300, about 100 to about 280, about 100 to about 260, about 100 to about 240, about 100 to about 220, about 100 to about 200, about 100 to about 180, about 100 to about 160, about 100 to about 140, about 100 to about 120, about 120 to about 500, about 120 to about 480, about 120 to about 460, about 120 to about 440, about 120 to about 420, about 120 to about 400, about 120 to about 380, about 120 to about 360, about 120 to about 340, about 120 to about 320, about 120 to about 300, about 120 to about 280, about 120 to about 260, about 120 to about 240, about 120 to about 220, about 120 to about 200, about 120 to about 180, about 120 to about 160, about 120 to about 140, about 140 to about 500, about 140 to about 480, about 140 to about 460, about 140 to about 440, about 140 to about 420, about 140 to about 400, about 140 to about 380, about 140 to about 360, about 140 to about 340, about 140 to about 320, about 140 to about 300, about 140 to about 280, about 140 to about 260, about 140 to about 240, about 140 to about 220, about 140 to about 200, about 140 to about 180, about 140 to about 160, about 160 to about 500, about 160 to about 480, about 160 to about 460, about 160 to about 440, about 160 to about 420, about 160 to about 400, about 160 to about 380, about 160 to about 360, about 160 to about 340, about 160 to about 320, about 160 to about 300, about 160 to about 280, about 160 to about 260, about 160 to about 240, about 160 to about 220, about 160 to about 200, about 160 to about 180, about 180 to about 500, about 180 to about 480, about 180 to about 460, about 180 to about 440, about 180 to about 420, about 180 to about 400, about 180 to about 380, about 180 to about 360, about 180 to about 340, about 180 to about 320,Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 about 180 to about 300, about 180 to about 280, about 180 to about 260, about 180 to about 240, about 180 to about 220, about 180 to about 200, about 200 to about 500, about 200 to about 480, about 200 to about 460, about 200 to about 440, about 200 to about 420, about 200 to about 400, about 200 to about 380, about 200 to about 360, about 200 to about 340, about 200 to about 320, about 200 to about 300, about 200 to about 280, about 200 to about 260, about 200 to about 240, about 200 to about 220, about 220 to about 500, about 220 to about 480, about 220 to about 460, about 220 to about 440, about 220 to about 420, about 220 to about 400, about 220 to about 380, about 220 to about 360, about 220 to about 340, about 220 to about 320, about 220 to about 300, about 220 to about 280, about 220 to about 260, about 220 to about 240, about 240 to about 500, about 240 to about 480, about 240 to about 460, about 240 to about 440, about 240 to about 420, about 240 to about 400, about 240 to about 380, about 240 to about 360, about 240 to about 340, about 240 to about 320, about 240 to about 300, about 240 to about 280, about 240 to about 260, about 260 to about 500, about 260 to about 480, about 260 to about 460, about 260 to about 440, about 260 to about 420, about 260 to about 400, about 260 to about 380, about 260 to about 360, about 260 to about 340, about 260 to about 320, about 260 to about 300, about 260 to about 280, about 280 to about 500, about 280 to about 480, about 280 to about 460, about 280 to about 440, about 280 to about 420, about 280 to about 400, about 280 to about 380, about 280 to about 360, about 280 to about 340, about 280 to about 320, about 280 to about 300, about 300 to about 500, about 300 to about 480, about 300 to about 460, about 300 to about 440, about 300 to about 420, about 300 to about 400, about 300 to about 380, about 300 to about 360, about 300 to about 340, about 300 to about 320, about 320 to about 500, about 320 to about 480, about 320 to about 460, about 320 to about 440, about 320 to about 420, about 320 to about 400, about 320 to about 380, about 320 to about 360, about 320 to about 340, about 340 to about 500, about 340 to about 480, about 340 to about 460, about 340 to about 440, about 340 to about 420, about 340 to about 400, about 340 to about 380, about 340 to about 360, about 360 to about 500, about 360 to about 480, about 360 to about 460, about 360 to about 440, about 360 to about 420, about 360 to about 400, about 360 to about 380, about 380 to about 500, about 380 to about 480, about 380 to about 460, about 380 to about 440, about 380 to about 420, about 380 to about 400, about 400 to about 500, about 400 to about 480, about 400 to about 460, about 400 to about 440, about 400 to about 420, about 420 to about 500, about 420 to about 480, about 420 to about 460, about 420 to about 440,Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 about 440 to about 500, about 440 to about 480, about 440 to about 460, about 460 to about 500, about 460 to about 480, or about 480 to about 500) uracil ribonucleotides. In some embodiments, the sequence encoding the polypeptide comprises at least a 1% decrease (e.g., at least a 5% decrease, at least a 10% decrease, at least a 15% decrease, at least a 20% decrease, at least a 25% decrease, at least a 30% decrease, at least a 30% decrease, at least a 35% decrease, at least a 40% decrease, at least a 45% decrease, at least a 50% decrease, at least a 55% decrease, at least a 60% decrease, at least a 65% decrease, at least a 70% decrease, at least a 75% decrease, at least a 80% decrease, at least a 85% decrease, at least a 90% decrease, at least a 95% decrease, at least a 96% decrease, at least a 97% decrease, at least a 98% decrease, or at least a 99% decrease) in the number of uracil ribonucleotides as compared to the number of uracil ribonucleotides present in a wildtype sequence encoding the polypeptide (e.g., a wildtype human sequence encoding the polypeptide). In some embodiments, the sequence encoding the polypeptide comprises about a 1% decrease to about a 100% decrease (e.g., about a 1% decrease to about a 99% decrease, about a 1% decrease to about a 98% decrease, about a 1% decrease to about a 97% decrease, about a 1% decrease to about a 96% decrease, about a 1% decrease to about a 95% decrease, about a 1% decrease to about a 90% decrease, about a 1% decrease to about a 85% decrease, about a 1% decrease to about a 80% decrease, about a 1% decrease to about a 75% decrease, a 1% decrease to about a 70% decrease, about a 1% decrease to about a 65% decrease, about a 1% decrease to about a 60% decrease, about a 1% decrease to about a 55% decrease, about a 1% decrease to about a 50% decrease, about a 1% decrease to about a 45% decrease, about a 1% decrease to about a 40% decrease, about a 1% decrease to about a 35% decrease, about a 1% decrease to about a 30% decrease, about a 1% decrease to about a 25% decrease, about a 1% decrease to about a 20% decrease, about a 1% decrease to about a 15% decrease, about a 1% decrease to about a 10% decrease, about a 1% decrease to about a 5% decrease, about a 5% decrease to about a 100% decrease, about a 5% decrease to about a 95% decrease, about a 5% decrease to about a 90% decrease, about a 5% decrease to about a 85% decrease, about a 5% decrease to about a 80% decrease, about a 5% decrease to about a 75% decrease, a 5% decrease to about a 70% decrease, about a 5% decrease to about a 65% decrease, about a 5% decrease to about a 60% decrease, about a 5% decrease to about a 55% decrease, about a 5% decrease to about a 50% decrease, about a 5% decrease to about a 45% decrease, about a 5% decrease to about a 40% decrease, about a 5% decrease to about a 35% decrease,Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 about a 5% decrease to about a 30% decrease, about a 5% decrease to about a 25% decrease, about a 5% decrease to about a 20% decrease, about a 5% decrease to about a 15% decrease, about a 5% decrease to about a 10% decrease, about a 10% decrease to about a 100% decrease, about a 10% decrease to about a 95% decrease, about a 10% decrease to about a 90% decrease, about a 10% decrease to about a 85% decrease, about a 10% decrease to about a 80% decrease, about a 10% decrease to about a 75% decrease, a 10% decrease to about a 70% decrease, about a 10% decrease to about a 65% decrease, about a 10% decrease to about a 60% decrease, about a 10% decrease to about a 55% decrease, about a 10% decrease to about a 50% decrease, about a 10% decrease to about a 45% decrease, about a 10% decrease to about a 40% decrease, about a 10% decrease to about a 35% decrease, about a 10% decrease to about a 30% decrease, about a 10% decrease to about a 25% decrease, about a 10% decrease to about a 20% decrease, about a 10% decrease to about a 15% decrease, about a 15% decrease to about a 100% decrease, about a 15% decrease to about a 95% decrease, about a 15% decrease to about a 90% decrease, about a 15% decrease to about a 85% decrease, about a 15% decrease to about a 80% decrease, about a 15% decrease to about a 75% decrease, a 15% decrease to about a 70% decrease, about a 15% decrease to about a 65% decrease, about a 15% decrease to about a 60% decrease, about a 15% decrease to about a 55% decrease, about a 15% decrease to about a 50% decrease, about a 15% decrease to about a 45% decrease, about a 15% decrease to about a 40% decrease, about a 15% decrease to about a 35% decrease, about a 15% decrease to about a 30% decrease, about a 15% decrease to about a 25% decrease, about a 15% decrease to about a 20% decrease, about a 20% decrease to about a 100% decrease, about a 20% decrease to about a 95% decrease, about a 20% decrease to about a 90% decrease, about a 20% decrease to about a 85% decrease, about a 20% decrease to about a 80% decrease, about a 20% decrease to about a 75% decrease, a 20% decrease to about a 70% decrease, about a 20% decrease to about a 65% decrease, about a 20% decrease to about a 60% decrease, about a 20% decrease to about a 55% decrease, about a 20% decrease to about a 50% decrease, about a 20% decrease to about a 45% decrease, about a 20% decrease to about a 40% decrease, about a 20% decrease to about a 35% decrease, about a 20% decrease to about a 30% decrease, about a 20% decrease to about a 25% decrease, about a 25% decrease to about a 100% decrease, about a 25% decrease to about a 95% decrease, about a 25% decrease to about a 90% decrease, about a 25% decrease to about a 85% decrease, about a 25% decrease to about a 80% decrease, about a 25% decrease to about a 75% decrease, a 25%Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 decrease to about a 70% decrease, about a 25% decrease to about a 65% decrease, about a 25% decrease to about a 60% decrease, about a 25% decrease to about a 55% decrease, about a 25% decrease to about a 50% decrease, about a 25% decrease to about a 45% decrease, about a 25% decrease to about a 40% decrease, about a 25% decrease to about a 35% decrease, about a 25% decrease to about a 30% decrease, about a 30% decrease to about a 100% decrease, about a 30% decrease to about a 95% decrease, about a 30% decrease to about a 90% decrease, about a 30% decrease to about a 85% decrease, about a 30% decrease to about a 80% decrease, about a 30% decrease to about a 75% decrease, a 30% decrease to about a 70% decrease, about a 30% decrease to about a 65% decrease, about a 30% decrease to about a 60% decrease, about a 30% decrease to about a 55% decrease, about a 30% decrease to about a 50% decrease, about a 30% decrease to about a 45% decrease, about a 30% decrease to about a 40% decrease, about a 30% decrease to about a 35% decrease, about a 35% decrease to about a 100% decrease, about a 35% decrease to about a 95% decrease, about a 35% decrease to about a 90% decrease, about a 35% decrease to about a 85% decrease, about a 35% decrease to about a 80% decrease, about a 35% decrease to about a 75% decrease, a 35% decrease to about a 70% decrease, about a 35% decrease to about a 65% decrease, about a 35% decrease to about a 60% decrease, about a 35% decrease to about a 55% decrease, about a 35% decrease to about a 50% decrease, about a 35% decrease to about a 45% decrease, about a 35% decrease to about a 40% decrease, about a 40% decrease to about a 100% decrease, about a 40% decrease to about a 95% decrease, about a 40% decrease to about a 90% decrease, about a 40% decrease to about a 85% decrease, about a 40% decrease to about a 80% decrease, about a 40% decrease to about a 75% decrease, a 40% decrease to about a 70% decrease, about a 40% decrease to about a 65% decrease, about a 40% decrease to about a 60% decrease, about a 40% decrease to about a 55% decrease, about a 40% decrease to about a 50% decrease, about a 40% decrease to about a 45% decrease, about a 45% decrease to about a 100% decrease, about a 45% decrease to about a 95% decrease, about a 45% decrease to about a 90% decrease, about a 45% decrease to about a 85% decrease, about a 45% decrease to about a 80% decrease, about a 45% decrease to about a 75% decrease, a 45% decrease to about a 70% decrease, about a 45% decrease to about a 65% decrease, about a 45% decrease to about a 60% decrease, about a 45% decrease to about a 55% decrease, about a 45% decrease to about a 50% decrease, about a 50% decrease to about a 100% decrease, about a 50% decrease to about a 95% decrease, about a 50% decrease to about a 90% decrease, about a 50%Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 decrease to about a 85% decrease, about a 50% decrease to about a 80% decrease, about a 50% decrease to about a 75% decrease, a 50% decrease to about a 70% decrease, about a 50% decrease to about a 65% decrease, about a 50% decrease to about a 60% decrease, about a 50% decrease to about a 55% decrease, about a 55% decrease to about a 100% decrease, about a 55% decrease to about a 95% decrease, about a 55% decrease to about a 90% decrease, about a 55% decrease to about a 85% decrease, about a 55% decrease to about a 80% decrease, about a 55% decrease to about a 75% decrease, a 55% decrease to about a 70% decrease, about a 55% decrease to about a 65% decrease, about a 55% decrease to about a 60% decrease, about a 60% decrease to about a 100% decrease, about a 60% decrease to about a 95% decrease, about a 60% decrease to about a 90% decrease, about a 60% decrease to about a 85% decrease, about a 60% decrease to about a 80% decrease, about a 60% decrease to about a 75% decrease, a 60% decrease to about a 70% decrease, about a 60% decrease to about a 65% decrease, about a 65% decrease to about a 100% decrease, about a 65% decrease to about a 95% decrease, about a 65% decrease to about a 90% decrease, about a 65% decrease to about a 85% decrease, about a 65% decrease to about a 80% decrease, about a 65% decrease to about a 75% decrease, a 65% decrease to about a 70% decrease, about a 70% decrease to about a 100% decrease, about a 70% decrease to about a 95% decrease, about a 70% decrease to about a 90% decrease, about a 70% decrease to about a 85% decrease, about a 70% decrease to about a 80% decrease, about a 70% decrease to about a 75% decrease, about a 75% decrease to about a 100% decrease, about a 75% decrease to about a 95% decrease, about a 75% decrease to about a 90% decrease, about a 75% decrease to about a 85% decrease, about a 75% decrease to about a 80% decrease, about a 80% decrease to about a 100% decrease, about a 80% decrease to about a 95% decrease, about a 80% decrease to about a 90% decrease, about a 80% decrease to about a 85% decrease, about a 85% decrease to about a 100% decrease, about a 85% decrease to about a 95% decrease, about a 85% decrease to about a 90% decrease, about a 90% decrease to about a 100% decrease, about a 90% decrease to about a 95% decrease, or about a 95% decrease to about a 100% decrease) in the number of uracil ribonucleotides as compared to the number of uracil ribonucleotides present in a wildtype sequence encoding the polypeptide (e.g., a wildtype human sequence encoding the polypeptide). In some embodiments, the sequence encoding the polypeptide does not comprise a TLR7-recognition motif. In some embodiments, the sequence encoding the polypeptide does notFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 include a TLR8-recognition motif. In some embodiments, the sequence encoding the polypeptide does not include any TLR7 or TLR8-recognition motifs. In some embodiments, the polypeptide is an antibody, a fusion protein, a contractile protein, an enzyme, a hormonal protein, an immunogen, a structural protein, a storage protein, a transport protein, a transmembrane protein, a fusion protein, or combinations thereof. In some embodiments, the circular polyribonucleotide or unmodified linear RNA comprises one or more modifications. In some embodiments, the one or more modifications comprise one or more modifications to a portion of the sequence encoding the polypeptide. In some embodiments, the one or more modifications comprise a modification to a sugar, a nucleobase, an internucleoside linkage, or a combination thereof. In some embodiments, the circular polyribonucleotide or unmodified linear RNA further comprises a translation initiation sequence operably linked to the sequence encoding the polypeptide. In some embodiments, the circular polyribonucleotide or unmodified linear RNA further comprises a translation termination sequence. In some embodiments, the circular polyribonucleotide or unmodified linear RNA lacks a translation termination sequence. In some embodiments, the circular polyribonucleotide or unmodified linear RNA further comprises a stagger element at a 3’ end of the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide. In some embodiments, the circular polyribonucleotide comprises a stagger element that is configured to stall a ribosome during rolling circle translation. In some embodiments, the circular polyribonucleotide or unmodified linear RNA does not comprise a poly(A) tail operably linked to the sequence encoding the polypeptide. Circular Polyribonucleotides / Modified RNAs Encoding a First and a Second Polypeptide Also provided herein are circular polyribonucleotides and unmodified linear RNAs that include: a circularization element; a first spacer; a first internal ribosome entry site (IRES) sequence; a sequence encoding a first polypeptide; a second spacer; a second IRES sequence; a sequence encoding a second polypeptide; and a third spacer; where the sequence encoding theFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 first polypeptide and / or the sequence encoding the second polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides. In some embodiments, the first spacer, the second spacer, and / or the third spacer comprises AC120 (SEQ ID NO: 66). In some embodiments, the first spacer, the second spacer, and / or the third spacer comprises AU120 (SEQ ID NO: 67). In some embodiments, the sequence encoding the first polypeptide (e.g., any of the exemplary polypeptides described herein or known in the art) and / or the sequence encoding the second polypeptide (e.g., any of the exemplary polypeptides described herein or known in the art) includes less than 500 (e.g., less than 480, less than 460, less than 440, less than 420, less than 400, less than 380, less than 360, less than 340, less than 320, less than 300, less than 380, less than 360, less than 340, less than 320, less than 300, less than 280, less than 260, less than 240, less than 220, less than 200, less than 180, less than 160, less than 140, less than 120, less than 100, less than 90, less than 80, less than 70, less than 60, less than 50, less than 40, less than 30, less than 25, less than 20, less than 10, or less than 5) uracil ribonucleotides. In some embodiments, the sequence encoding the first polypeptide (e.g., any of the exemplary polypeptides described herein) and / or the sequence encoding the second polypeptide (e.g., any of the exemplary polypeptides described herein) contains about 5 to about 500 (e.g., any of the exemplary subranges of this range described herein) uracil ribonucleotides. In some embodiments, the sequence encoding the first polypeptide and / or the second polypeptide includes, but is not limited to, a fusion protein, a hormonal protein, chimeric antigen receptors, contractile proteins, antibodies or antigen-binding antibody fragments thereof, extracellular proteins, intracellular proteins, cytokines, signaling proteins, sensory proteins, regulatory proteins, transcription factors, enzymes, structural proteins, storage proteins, and / or transport proteins. In some embodiments, the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide comprises at least a 1% decrease (e.g., at least a 5% decrease, at least a 10% decrease, at least a 15% decrease, at least a 20% decrease, at least a 25% decrease, at least a 30% decrease, at least a 30% decrease, at least a 35% decrease, at least a 40% decrease, at least a 45% decrease, at least a 50% decrease, at least a 55% decrease, at least a 60% decrease, at least a 65% decrease, at least a 70% decrease, at least a 75% decrease, at least a 80% decrease, at least a 85% decrease, at least a 90% decrease, at least a 95% decrease, at least a 96% decrease, atFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 least a 97% decrease, at least a 98% decrease, or at least a 99% decrease) in the number of uracil ribonucleotides as compared to the number of uracil ribonucleotides present in a wildtype sequence encoding the first polypeptide or the second polypeptide, respectively (e.g., a wildtype human sequence encoding the first polypeptide or the second polypeptide, respectively). In some embodiments, the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide comprises about a 1% decrease to about a 100% decrease (e.g., any of the subranges of this range described herein) in the number of uracil ribonucleotides as compared to the number of uracil ribonucleotides present in a wildtype sequence encoding the first polypeptide or the second polypeptide, respectively (e.g., a wildtype human sequence encoding the first polypeptide or the second polypeptide, respectively). In some embodiments, the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide does not comprise a TLR7-recognition motif. In some embodiments, the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide does not include a TLR8-recognition motif. In some embodiments, the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide does not include any TLR7 or TLR8-recognition motifs. In some embodiments, the polypeptide is an antibody, a fusion protein, a hormonal protein, a contractile protein, an enzyme, a hormonal protein, a structural protein, a storage protein, a transport protein, a chimeric antigen receptor, a fusion protein, or combinations thereof. In some embodiments, the circular polyribonucleotide or unmodified linear RNA comprises one or more modifications. In some embodiments, the one or more modifications comprise one or more modifications to a portion of the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide. In some embodiments, the one or more modifications comprise a modification to a sugar, a nucleobase, an internucleoside linkage, or a combination thereof. In some embodiments, the circular polyribonucleotide or unmodified linear RNA further comprises a translation initiation sequence operably linked to the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 In some embodiments, the circular polyribonucleotide or unmodified linear RNA further comprises a translation termination sequence. In some embodiments, the circular polyribonucleotide or unmodified linear RNA lacks a translation termination sequence. In some embodiments, the circular polyribonucleotide or unmodified linear RNA further comprises a stagger element at a 3’ end of the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide. In some embodiments, the circular polyribonucleotide comprises a stagger element that is configured to stall a ribosome during rolling circle translation. In some embodiments, the circular polyribonucleotide or unmodified linear RNA does not comprise a poly(A) tail operably linked to the sequence encoding the first polypeptide or the sequence encoding the second polypeptide. Codon Optimization Codon optimization generally refers to experimental approaches designed to improve the codon composition of a recombinant gene based on various criteria without altering the amino acid sequence. Due to the degeneracy of the genetic code (i.e., most amino acids are encoded by more than one codon), codon optimization is possible. Any of the sequences described herein can be codon-optimized. Codon optimization is readily understood by one of ordinary skill in the art and numerous tools are available to codon optimize nucleic acid sequences. Codon optimization is further described, for example, in Zhang, H. et al., Algorithm for optimized mRNA design improves stability and immunogenicity, Nature, 621(7978):396-403 (2023); and Li, S. et al., CodonBERT: Large Language Models for mRNA design and optimization, bioRxiv preprint (2023); each of which is incorporated herein by reference in its entirety. Non-coding RNA can also be codon optimized see e.g., Sample, P.J., Human 5’ UTR design and variant effect prediction from a massively parallel translation assay, Nat Biotechnol. 37(7): 803-809 (2019), which is incorporated herein by reference in its entirety. Spacer Sequences In some embodiments, the circular polyribonucleotide or unmodified linear RNA as disclosed herein includes at least one spacer sequence. In some embodiments, the circularFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 polyribonucleotide or unmodified linear RNA includes 1, 2, 3, 4, 5, 6, 7, or more spacer sequences (e.g., identical or different spacer sequences). In some examples, the circular polyribonucleotide or unmodified linear RNA only includes a first spacer sequence (i.e., a spacer sequence 5’ to the open reading frame). In such examples, the circular polyribonucleotide or unmodified linear RNA lacks a second spacer sequence (i.e., a spacer sequence 3’ to the open reading frame). In some examples, the circular polyribonucleotide or unmodified linear RNA only includes a second spacer sequence (i.e., a spacer sequence 3’ to the ORF). In such examples, the circular polyribonucleotide or unmodified linear RNA lacks a first spacer sequence (i.e., a spacer sequence 5’ to the ORF). The spacer sequence can be a nucleic acid sequence having low GC content, e.g., less than 65%, 60%, 55%, 50%, 55%, 50%, 45%, 40%, 39%, 38%, 37%, 36%, 35%, 34%, 33%, 32%, 31 %, 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11 %, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1 %, across the full length of the spacer, or across at least 50%, 60%, 70%, 80%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% contiguous nucleic acid residues of the spacer. In some embodiments, the spacer sequence is substantially free of a secondary structure, such as less than 40 kcal / mol, less than -39, -38, -37, -36, -35, -34, -33, -32, -31, -30, -29, -28, -27, -26, -25, -24, -23, -22, -20, - 19, -18, -17, -16, -15, -14, -13, -12, -11, -10, -9, -8, -7, -6, -5, -4, -3, -2 or -1 kcal / mol. The spacer sequence can be a non-coding sequence or a coding sequence. When the spacer is a non-coding sequence, a start codon may be provided in the coding sequence of an adjacent sequence. When the spacer is a coding sequence, a start codon may be provided in the spacer sequence. In some embodiments, the spacer is operably linked to another sequence described herein. As discussed above, RNA-induced immunogenicity pathways can be triggered by the presence of AU or U-rich sequences. One way to reduce the uridine content of circular ribonucleotides and unmodified linear RNAs described herein include using spacer sequences the reduce or completely remove uridine content. In some embodiments, the spacer sequence comprises or consists of an AC120 sequence (shown below). AC120 (SEQ ID NO: 66)Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 AAAAAAACAAAAAAAAACCAAAAAAAAAACCCAAAAAAAAACCAAAAAAACCCA AAAAAAACCAAAAAAAAAACAAAAAACCAAAAAAACAAAAAAAAAACCCAAAAA AAAACAAAAAAACACA AU120 (SEQ ID NO: 67) AAATAAAAAAAAATTAAAAAAAAAATTTAAAAAAAAATTAAAAAAATTTAAAAAA AATTAAAAAAAAAATAAAAAATTAAAAAAATAAAAAAAAAATTTAAAAAAAAATA AAAAAA Modifications Any of the circular polyribonucleotides (or elements thereof) described herein can include one or more modifications (e.g., any of the exemplary modifications described herein or known in the art). Any of the unmodified linear RNAs described herein can include one or more modifications (e.g., any of the exemplary modifications described herein or known in the art). The one or more modifications can be included at any position in the circular polyribonucleotide or unmodified linear RNA. For example, a sequence encoding a polypeptide can comprise one or more modifications (e.g., the sequence encoding a polypeptide comprises one or more modified bases). In some embodiments, the circular polyribonucleotide or unmodified linear RNA can comprise a post-transcriptional modification (e.g., capping, cleavage, polyadenylation, and splicing). A circular polyribonucleotide or elements thereof, or an unmodified linear RNA or elements thereof, can include one or more nucleoside modifications (e.g., any of those described in Rozenski et al., Nucl. Acids Res. 27: 196-197, 1999). In some embodiments, the circular polyribonucleotide or unmodified linear RNA comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) modification(s) to some sugar, a nucleobase, an internucleoside linkage, or a combination thereof. In some embodiments, the circular polyribonucleotide or unmodified linear RNA can include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) pyrimidine nucleobases having one or more atoms substituted with an amino, a thiol, an alkyl (e.g., methyl or ethyl), or halo (e.g., chloro or fluoro) group.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 In some embodiments, the circular polyribonucleotide or unmodified linear RNA can include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) ribonucleotides that have been modified into deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), and / or locked nucleic acids (LNAs). In some embodiments, the circular polyribonucleotide or unmodified linear RNA includes at least one (e.g., two, three, four, or five) N(6)methyladenosine (m6A) modification to increase translation efficiency. In some embodiments, the N(6)methyladenosine (m6A) modification can reduce immunogenicity (e.g., reduce the level of one or more marker of an immune or inflammatory response) of the circular polyribonucleotide or unmodified linear RNA. In some embodiments, a modification may include a chemical or cellular induced modification. For example, some non-limiting examples of intracellular RNA modifications are described in Lewis et al., Nature Reviews Mol. Cell Biol. 18:202-210, 2017, herein incorporated by reference. In some embodiments, chemical modifications to the ribonucleotides of a circular polyribonucleotide or unmodified linear RNA may enhance immune evasion. The circular polyribonucleotide or unmodified linear RNA may be synthesized and / or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S.L. et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, herein incorporated by reference. Modifications include, for example, end modifications, e.g., 5’ end modifications (phosphorylation (mono-, di- and tri-), conjugation, inverted linkages), 3’ end modifications (conjugation, DNA nucleotides, inverted linkages), base modifications (e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners), removal of bases (abasic nucleotides), or conjugated bases. The modified ribonucleotide bases may also include 5- methylcytidine and pseudouridine. In some embodiments, base modifications may modulate expression, immune response, stability, subcellular localization, to name a few functional effects, of the circular polyribonucleotide or unmodified linear RNA. In some embodiments, the modification includes a bi-orthogonal nucleotide, e.g., an unnatural base. See, e.g., Kimoto et al., Chem. Comm. (Camb) 53:12309, 2017, which is herein incorporated by reference.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 In some embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) ribonucleotides of the circular polyribonucleotide or unmodified linear RNA can include a sugar modification (e.g., at the 2’ position or 4’ position) and optionally, a backbone modification, including modification or replacement of the phosphodiester linkages. Specific examples of circular polyribonucleotides or unmodified linear RNAs include, but are not limited to, circular polyribonucleotides or unmodified linear RNAs including modified backbones or no natural internucleoside linkages, such as internucleoside modifications, including modification or replacement of the phosphodiester linkages. Circular polyribonucleotides and unmodified linear RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. In particular embodiments, the circular polyribonucleotide or unmodified linear RNA will include ribonucleotides with a phosphorus atom in its internucleoside backbone. Modified backbones of circular polyribonucleotides and unmodified linear RNAs can include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates, such as 3’- alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, such as 3’- amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'- 5’ linkages, 2’-5’ linked analogs of these, and those having inverted polarity, wherein the adjacent pairs of nucleoside units are linked 3’-5’ to 5’-3’ or 2’-5’ to 5’-2’. Various salts, mixed salts, and free acid forms of the circular polyribonucleotides and unmodified linear RNAs are also included. In some embodiments, the circular polyribonucleotides or unmodified linear RNAs may be negatively- or positively-charged. The modified nucleotide(s), which may be incorporated into the circular polyribonucleotides or unmodified linear RNAs, can be modified on the internucleoside linkage (e.g., phosphate backbone). Herein, in the context of the polynucleotide backbone, the phrases “phosphate” and “phosphodiester” are used interchangeably. Backbone phosphate groups can be modified by replacing one or more of the oxygen atoms with a different substituent. Further, the modified nucleosides and nucleotides can include the wholesale replacement of an unmodified phosphate moiety with another internucleoside linkage as described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates,Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates have both non-linking oxygens replaced by sulfur. The phosphate linker can also be modified by the replacement of a linking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene -phosphonates). A-thio substituted phosphate moieties can be included to confer stability to circular polyribonucleotides and unmodified linear RNAs through the unnatural phosphorothioate backbone linkages. Phosphorothioate RNAs have increased nuclease resistance and subsequently a longer half-life in a cellular environment. Phosphorothioate linkages in a circular polyribonucleotide or unmodified linear RNA is expected to reduce the innate immune response through weaker binding / activation of cellular innate immune molecules. In specific embodiments, a modified nucleoside can include an alpha-thio-nucleoside (e.g., 5’-O-(l-thiophosphate)-adenosine, 5’-O-(l-thiophosphate)-cytidine (a-thio-cytidine), 5’-O- (l-thiophosphate)-guanosine, 5’-O-(l-thiophosphate)-uridine, or 5’-O- (1-thiophosphate)- pseudouridine). Other internucleoside linkages that may be employed according to the present disclosure, including internucleoside linkages which do not contain a phosphorous atom, are described herein. A circular polyribonucleotide or unmodified linear RNA may or may not be uniformly modified along the entire length of the molecule. For example, one or more or all types of nucleotide (e.g., naturally-occurring nucleotides, purine or pyrimidine, or any one or more or all of A, G, U, C, I, pU) may or may not be uniformly modified in the circular polyribonucleotide or unmodified linear RNA, or in a given predetermined subregion thereof. In some embodiments, the circular polyribonucleotide or unmodified linear RNA includes a pseudouridine. In some embodiments, the circular polyribonucleotide or unmodified linear RNA includes an inosine, which may aid in the immune system characterizing the circular polyribonucleotide or unmodified linear RNA as an endogenous RNA versus a viral RNA. The incorporation of inosine may also mediate improved RNA stability / reduced degradation. See for example, Yu, Z. et al., Cell Res. 25, 1283–1284, 2015, which is incorporated by reference in its entirety. In some embodiments, all or substantially all nucleotides in a circular polyribonucleotide or unmodified linear RNA (or in a given subregion thereof) are modified. In some embodiments,Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 the modification may include an m6A, which may augment expression; an inosine, which may attenuate an immune response; pseudouridine, which may increase RNA stability, or translational readthrough (stagger element); an m5C, which may increase stability; and a 2,2,7- trimethylguanosine, which aids subcellular translocation (e.g., nuclear localization). Different sugar modifications, nucleotide modifications, and / or internucleoside linkages (e.g., backbone structures) may exist at various positions in a circular polyribonucleotide or unmodified linear RNA. One of ordinary skill in the art will appreciate that the nucleotide analogs or other modification(s) may be located at any position(s) of the circular polyribonucleotide or unmodified linear RNA, such that the function of the circular polyribonucleotide or unmodified linear RNA is not substantially decreased. A modification can be included in a coding sequence or a non-coding sequence. In some embodiments, the circular polyribonucleotide or unmodified linear RNA may include about 1% to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, e.g., any one or more of A, G, U, or C) or any intervening percentage (e.g., about 1% to about 10%, about 1% to about 15%, about 1% to about 20%, from about 1% to about 25%, about 1% to about 30%, about 1% to about 40%, about 1% to about 50%, about 1% to about 60%, about 1% to about 70%, about 1% to about 80%, about 1% to about 90%, about 1% to about 95%, about 10% to about 20%, about 10% to about 25%, about 10% to about 30%, about 10% to about 40%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 30%, about 20% to about 40%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 20% to about 80%, about 20% to about 90%, about 20% to about 95%, about 20% to about 100%, about 30% to about 40%, about 30% to about 50%, about 30% to about 60%, about 30% to about 70%, about 30% to about 80%, about 30% to about 90%, about 30% to about 100%, about 40% to about 50%, about 40% to about 60%, about 40% to about 70%, about 40% to about 80%, about 40% to about 90%, about 40% to about 100%, about 50% to about 60%, about 50% to about 70%, about 50% to about 80%, about 50% to about 90%, about 50% to about 95%, about 50% to about 100%, about 60% to about 70%, about 60% to about 80%, about 60% to about 90%, about 60% to about 100%, about 70% to about 80%, about 70% to about 90%, about 70% to about 95%, about 70% to about 100%, about 80% to aboutFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 90%, about 80% to about 95%, about 80% to about 100%, about 90% to about 95%, about 90% to about 100%, and about 95% to about 100%). Internal Ribosome Entry Site (IRES) In some embodiments, the circular polyribonucleotides or unmodified linear RNAs described herein includes one or more internal ribosome entry site(s) (IRES(s)) (e.g., 2, 3, 4 or more IRES(s)). In some embodiments, an IRES is operably linked to the sequence encoding the polypeptide (e.g., any of the exemplary polypeptides described herein). In some embodiments, an IRES is located at or proximal to the 5’ end of the sequence encoding the polypeptide (e.g., any of the exemplary polypeptides described herein). In embodiments, where the circular polyribonucleotide encodes a second polypeptide, the circular polyribonucleotide includes a second IRES. A suitable IRES includes an RNA sequence capable of engaging a eukaryotic ribosome. In some embodiments, an IRES is at least about 50 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 250 nucleotides, at least about 350 nucleotides, or at least about 500 nucleotides. In some embodiments, an IRES is about 50 nucleotides to about 500 nucleotides, about 50 nucleotides to about 450 nucleotides, about 50 nucleotides to about 400 nucleotides, about 50 nucleotides to about 350 nucleotides, about 50 nucleotides to about 300 nucleotides, about 50 nucleotides to about 250 nucleotides, about 50 nucleotides to about 200 nucleotides, about 50 nucleotides to about 150 nucleotides, about 50 nucleotides to about 100 nucleotides, about 100 nucleotides to about 500 nucleotides, about 100 nucleotides to about 450 nucleotides, about 100 nucleotides to about 400 nucleotides, about 100 nucleotides to about 350 nucleotides, about 100 nucleotides to about 300 nucleotides, about 100 nucleotides to about 250 nucleotides, about 100 nucleotides to about 200 nucleotides, about 100 nucleotides to about 150 nucleotides, about 150 nucleotides to about 500 nucleotides, about 150 nucleotides to about 450 nucleotides, about 150 nucleotides to about 400 nucleotides, about 150 nucleotides to about 350 nucleotides, about 150 nucleotides to about 300 nucleotides, about 150 nucleotides to about 250 nucleotides, about 150 nucleotides to about 200 nucleotides, about 200 nucleotides to about 500 nucleotides, about 200 nucleotides to about 450 nucleotides, about 200 nucleotides to about 400 nucleotides, about 200 nucleotides to about 350 nucleotides, about 200 nucleotides to about 300 nucleotides, about 200 nucleotides to about 250 nucleotides, about 250 nucleotides to about 500Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 nucleotides, about 250 nucleotides to about 450 nucleotides, about 250 nucleotides to about 400 nucleotides, about 250 nucleotides to about 350 nucleotides, about 250 nucleotides to about 300 nucleotides, about 300 nucleotides to about 500 nucleotides, about 300 nucleotides to about 450 nucleotides, about 300 nucleotides to about 400 nucleotides, about 300 nucleotides to about 350 nucleotides, about 350 nucleotides to about 500 nucleotides, about 350 nucleotides to about 450 nucleotides, about 350 nucleotides to about 400 nucleotides, about 400 nucleotides to about 500 nucleotides, about 400 nucleotides to about 450 nucleotides, or about 450 nucleotides to about 500 nucleotides. In some embodiments, the IRES is derived from the DNA of an organism including, but not limited to, a virus, a mammal, and Drosophila. Such viral DNA may be derived from, but not limited to, picornavirus complementary DNA (cDNA), encephalomyocarditis virus (EMCV) cDNA, and poliovirus cDNA. In some embodiments, Drosophila DNA from which an IRES is derived includes, but is not limited to, an Antennapedia gene from Drosophila melanogaster. Herein, the term “derived from” in the context of a nucleic acid, i.e., for a nucleic acid “derived from” (another) nucleic acid, means that the nucleic acid, which is derived from (another) nucleic acid, shares e.g. at least 60%, 70%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleic acid from which it is derived. The skilled person is aware that sequence identity is typically calculated for the same types of nucleic acids, i.e., for DNA sequences or for RNA sequences. Thus, it is understood, if a DNA is “derived from” an RNA or if an RNA is “derived from” a DNA, in a first step the RNA sequence is converted into the corresponding DNA sequence (in particular by replacing the uracils (U) by thymidines (T) throughout the sequence) or, vice versa, the DNA sequence is converted into the corresponding RNA sequence (in particular by replacing the T by U throughout the sequence). Thereafter, the sequence identity of the DNA sequences or the sequence identity of the RNA sequences is determined. Preferably, a nucleic acid “derived from” a nucleic acid also refers to nucleic acid, which is modified in comparison to the nucleic acid from which it is derived, e.g., in order to increase RNA stability even further and / or to prolong and / or increase protein production. In the context of amino acid sequences, the term “derived from” means that the amino acid sequence, which is derived from (another) amino acid sequence, shares e.g. at least 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%,Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence from which it is derived. In some embodiments, if present, the IRES is an IRES of Taura syndrome virus, Triatoma virus, Theiler's encephalomyelitis virus, simian Virus 40, Solenopsis invicta virus 1, Rhopalosiphum padi virus, Reticuloendotheliosis virus, human poliovirus 1, Plautia stall intestine virus, Kashmir bee virus, Human rhinovirus 2, Homalodisca coagulata virus- 1, Human Immunodeficiency Virus type 1, Homalodisca coagulata virus- 1, Himetobi P virus, Hepatitis C virus, Hepatitis A virus, Hepatitis GB virus, foot and mouth disease virus, Human enterovirus 71, Equine rhinitis virus, Ectropis obliqua picorna-like virus, Encephalomyocarditis virus (EMCV), Drosophila C Virus, Crucifer tobamo virus, Cricket paralysis virus, Bovine viral diarrhea virus 1, Black Queen Cell Virus, Aphid lethal paralysis virus, Avian encephalomyelitis virus, Acute bee paralysis virus, Hibiscus chlorotic ringspot virus, Classical swine fever virus, Human FGF2, Human SFTPA1, Human AML1 / RUNX1, Drosophila antennapedia, Human AQP4, Human AT1R, Human BAG-l, Human BCL2, Human BiP, Human c-IAPl , Human c- myc, Human eIF4G, Mouse NDST4L, Human LEF1, Mouse HIF1 alpha, Human n-myc, Mouse Gtx, Human p27kipl, Human PDGF2 / c-sis, Human p53, Human Pim-l, Mouse Rbm3, Drosophila reaper, Canine Scamper, Drosophila Ubx, Human UNR, Mouse UtrA, Human VEGF-A, Human XIAP, Salivirus, Cosavirus, Parechovirus, Drosophila hairless, S. cerevisiae TFIID, S. cerevisiae YAP1, Human c-src, Human FGF-l, Simian picomavirus, Turnip crinkle virus, Aichivirus, Crohivirus, Echovirus 11, an aptamer to eIF4G, Coxsackievirus B3 (CVB3), or Coxsackievirus A (CVB1 / 2). In yet another embodiment, the IRES is an IRES of Coxsackievirus B3 (CVB3). In a further embodiment, the IRES is an IRES of Encephalomyocarditis virus. In some embodiments, the IRES sequence has more than 90% sequence identify with one of the foregoing IRES sequences. The IRES sequence may have a modified sequence in comparison to the wildtype IRES sequence. In some embodiments, when the last nucleotide of the wild-type IRES is not a cytosine nucleic acid residue, the last nucleotide of the wild-type IRES sequence may be modified such that it is a cytosine residue. For example, the IRES sequence may be a CVB3 IRES sequence wherein the terminal adenosine residue is modified to cytosine residue. In some embodiments, the modified CVB3 IRES may have the nucleic acid sequence of:Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 TTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCAC TCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTT AGAAGTAACACACACCGATCAACAGTCAGCGTGGCACACCAGCCACGTTTTGATCA AGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGA AAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGC AGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTC CCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCAT GGGACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTC CGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGG CAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTT TCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAG CTATTGGATTGGCCATCCGGTGACTAATAGAGCTATTATATATCCCTTTGTTGGGTTT ATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTGTTAAGTTGAATACA GCAA (SEQ ID NO: 1). In some embodiments, the IRES sequence is an Enterovirus 71 (EV71) IRES. In some embodiments, the terminal guanosine residue of the EV71 IRES sequence is modified to a cytosine residue. In some embodiments, the modified EV71 IRES may have the nucleic acid sequence of: ACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATG TTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTG TCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTC TGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGT CTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCG GCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCAC GTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAAC AAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCC TCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCG AACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATA (SEQ ID NO: 2). In some embodiments, the circular polyribonucleotides or unmodified linear RNAs described herein can include a modified IRES, such as those described in WO 2020 / 198403, which is incorporated herein by reference in its entirety or an IRES, such as those described inFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 Fan et al. Nature Communications 13(1):3751, 2022 doi: 10.1038 / s41467-022-31327-y; Chen et al. Mol. Cell 81:1-19, 2021; Jopling et al. Oncogene 20:2664-2670, 2001; Baranick et al. PNAS 105(12):4733-4738, 2008; Lang et al. Molecular Biology of the Cell 13(5):1792-1801, 2002; Dorokhov et al. PNAS 99(8):5301-5306, 2002; Wang et al. Nucleic Acids Research 33(7):2248- 2258, 2005; Petz et a. Nucleic Acids Research 35(8):2473-2482, 2007; and WO 2021 / 263124 A2, each of, which is hereby incorporated by reference in its entirety. In some embodiments, the circular polyribonucleotides or unmodified linear RNAs described herein include at least one IRES flanking the sequence encoding the polypeptide (e.g., any of the exemplary polypeptides described herein). In some embodiments, the IRES flanks both sides of the sequence encoding the polypeptide (e.g., any of the exemplary polypeptides described herein). Translation Initiation Sequence In some embodiments, the circular polyribonucleotides or unmodified linear RNAs described herein can include at least one translation initiation sequence. In some embodiments, the circular polyribonucleotide or unmodified linear RNA includes a translation initiation sequence operably linked to the sequence encoding the polypeptide (e.g., any of the exemplary polypeptides described herein). In some embodiments, the translation initiation sequence includes, e.g., a start codon. In some embodiments, the translation initiation sequence includes a Kozak or Shine-Dalgarno sequence. In some embodiments, the circular polyribonucleotide or unmodified linear RNA includes the translation initiation sequence, e.g., Kozak sequence, adjacent to the sequence encoding the polypeptide (e.g., any of the exemplary polypeptides described herein). In some embodiments, the translation initiation sequence, e.g., Kozak sequence, is present on one or both sides of each sequence encoding the polypeptide (e.g., any of the exemplary polypeptides described herein), leading to separation of the expression products. In some embodiments, the circular polyribonucleotide or unmodified linear RNA includes at least one translation initiation sequence adjacent to the sequence encoding the polypeptide (e.g., any of the exemplary polypeptides described herein). In some embodiments, the translation initiation sequence provides conformational flexibility to the circular polyribonucleotide or unmodified linear RNA.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 In some embodiments, the translation initiation sequence is within a substantially single stranded region of the circular polyribonucleotide or unmodified linear RNA. The circular polyribonucleotide may include more than 1 start codon such as, but not limited to, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, or more than 60 start codons. In such embodiments, translation may initiate on the first start codon or may initiate downstream of the first start codon. In some embodiments, the circular polyribonucleotide or unmodified linear RNA may initiate at a codon that is not the first start codon, e.g., AUG. Translation of the circular polyribonucleotide or unmodified linear RNA may initiate at an alternative translation initiation sequence, such as, but not limited to, ACG, AGG, AAG, CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, or TTG / UUG. In some embodiments, translation begins at an alternative translation initiation sequence under selective conditions, e.g., stress-induced conditions. As a non-limiting example, the translation of the circular polyribonucleotide or unmodified linear RNA may begin at alternative translation initiation sequence, such as ACG. As another non-limiting example, the circular polyribonucleotide or unmodified linear RNA translation may begin at alternative translation initiation sequence, CTG / CUG. As yet another non-limiting example, the circular polyribonucleotide or unmodified linear RNA translation may begin at alternative translation initiation sequence, GTG / GUG. As yet another non-limiting example, the circular polyribonucleotide or unmodified linear RNA may begin translation at a repeat-associated non- AUG (RAN) sequence, such as an alternative translation initiation sequence that includes short stretches of repetitive RNA, e.g., CGG, GGGGCC, CAG, or CTG. Nucleotides flanking a codon that initiates translation may affect the translation efficiency and the length and / or the structure of the circular polyribonucleotide or unmodified linear RNA. Masking any of the nucleotides flanking a codon that initiates translation may be used to alter the position of translation initiation, translation efficiency, and length, and / or structure of the circular polyribonucleotide or unmodified linear RNA. In some embodiments, a masking agent may be used near the start codon or alternative start codon in order to mask or hide the codon to reduce the probability of translation initiation at the masked start codon or alternative start codon. Non-limiting examples of masking agentsFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 include antisense locked nucleic acids (LNA) oligonucleotides and exon-junction complexes (EJCs). In some embodiments, a masking agent may be used to mask a start codon of the circular polyribonucleotide or unmodified linear RNA in order to increase the likelihood that translation will initiate at an alternative start codon. In some embodiments, translation is initiated under selective conditions, such as, but not limited to, viral-induced selection in the presence of GRSF-1 and the circular polyribonucleotide or unmodified linear RNA includes GRSF-1 binding sites. In some embodiments, translation is initiated by eukaryotic initiation factor 4A (eIF4A) treatment with Rocaglates. Translation may be repressed by blocking 43S scanning, leading to premature, upstream translation initiation and reduced protein expression from transcripts bearing the RocA–eIF4A target sequence. Translation Termination Sequences In some embodiments, the circular polyribonucleotides or unmodified linear RNAs can further include at least one translation termination sequence. In some embodiments, the translation termination sequence is operably linked to the 3’ end of the sequence encoding the polypeptide (e.g., any of the exemplary polypeptides described herein). In some embodiments, the circular polyribonucleotide or unmodified linear RNA includes a termination element at the end of a sequence encoding the polypeptide (e.g., any of the polypeptides described herein). In some embodiments, a circular polyribonucleotide or unmodified linear RNA can include two or more termination elements in succession. Generally, translation termination sequences include an in-frame nucleotide triplet that signals termination of translation, e.g., UAA, UGA, or UAG. In some embodiments, one or more translation termination sequences in the circular polyribonucleotide or unmodified linear RNA are frame- shifted termination elements, such as but not limited to, off-frame or -1 and + 1 shifted reading frames (e.g., hidden stop) that may terminate translation. Frame-shifted termination elements include nucleotide triples, e.g., TAA, TAG, or TGA, that appear in the second and third reading frames of the sequence encoding the polypeptide. Frame-shifted termination elements may be important in preventing misreads of the sequence encoding the polypeptide, which is often detrimental to a cell. In some embodiments, the termination element is a stop codon.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 Further examples of translation termination sequences are described in paragraphs

[0169] -

[0170] of WO2019 / 118919, which is hereby incorporated by reference in its entirety. Stagger Elements In some embodiments, the circular polyribonucleotide or unmodified linear RNA includes a stagger sequence or a stagger element. As used herein, the term “stagger element” or a “stagger sequence” is a moiety, such as a nucleotide sequence, that induces ribosomal pausing during translation. To avoid production of a continuous expression product, e.g., peptide or polypeptide, while maintaining rolling circle translation, a stagger sequence can be included to induce ribosomal pausing during translation. The stagger sequence may include a 2A-like or CHYSEL (cis-acting hydrolase element) sequence. In some embodiments, the stagger element encodes a sequence with a C-terminal consensus sequence that is X1X2X3EX5NPGP (SEQ ID NO: 3), where X1is absent or G or H, X2is absent or D or G, X3is D, V, I, S, or M, and X5is any amino acid. In some embodiments, the stagger element comprises a non-conserved sequence of amino-acids with a strong alpha-helical propensity followed by the consensus sequence -D(V / I)EXNPGP (SEQ ID NO: 4), where X is any amino acid. Some non-limiting examples of stagger elements include any of the stagger sequences shown in Table 1. In some embodiments, a stagger element described herein terminates translation and / or cleaves an expression product between G and P of the consensus sequence described herein. As one non-limiting example, the circular polyribonucleotide or unmodified linear RNA includes at least one stagger sequence to terminate translation and / or cleave the encoded polypeptide. In some embodiments, the circular polyribonucleotide or unmodified linear RNA includes a stagger element adjacent to at least one sequence encoding a polypeptide (e.g., any of the exemplary polypeptides described herein). In some embodiments, the circular polyribonucleotide or unmodified linear RNA includes a stagger element after each sequence encoding a polypeptide (e.g., any of the exemplary polypeptides described herein). In some embodiments, the circular polyribonucleotide or unmodified linear RNA includes a stagger element present on one or both sides of each sequence encoding a polypeptide (e.g., any of the exemplary polypeptides described herein), leading to translation of individual peptide(s) and or polypeptide(s) from each expression sequence.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 Table 1. Non-limiting examples of stagger elements SEQ Description Sequence ID NO:Replication Elements Replication of a circular polyribonucleotide can occur by generating a complement circular polyribonucleotide. In some embodiments, the circular polyribonucleotide can include a motif to initiate transcription, where transcription is driven by either endogenous cellular machinery (DNA-dependent RNA polymerase) or an RNA-depended RNA polymerase encoded by the circular polyribonucleotide. The product of the rolling-circle transcriptional event can beFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 cut by a ribozyme to generate either complementary or propagated circular polyribonucleotide at unit length. The ribozyme can be encoded by the circular polyribonucleotide, its complement, or by an RNA sequence in trans. In some embodiments, the encoded ribozyme can include a sequence or motif that regulates (inhibits or promotes) activity of the ribozyme to control circular polyribonucleotide propagation. In some embodiments, unit-length sequences can be ligated into a circular form by a cellular RNA ligase. In some embodiments, the circular polyribonucleotide includes a replication element that aids in self-amplification. Examples of such replication elements include HDV replication domains and replication competent circular RNA sense and / or antisense ribozymes, such as antigenomic 5’- CGGGUCGGCAUGGCAUCUCCACCUCCUCGC GGUCCGACCUGGGCAUCCGAAGGAGGACGCACGUCCACUCGGAUGGCUAAGGGAG AGCCA-3’ (SEQ ID NO: 24) or genomic 5’- UGGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCGGCUGGGCAACAUU CCGAGGGGACCGUCCCCUCGGUAAUGGCGAAUGGGACCCA-3’ (SEQ ID NO: 25). In some embodiments, the circular polyribonucleotide includes at least one cleavage sequence as described herein to aid in replication. A cleavage sequence within the circular polyribonucleotide can cleave long transcripts replicated from the circular polyribonucleotide to a specific length that can subsequently circularize to form a complement to the circular polyribonucleotide. In another embodiment, the circular polyribonucleotide includes at least one ribozyme sequence to cleave long transcripts replicated from the circular polyribonucleotide to a specific length, where another encoded ribozyme cuts the transcripts at the ribozyme sequence. Circularization forms a complement to the circular polyribonucleotide. In some embodiments, the circular polyribonucleotide is substantially resistant to degradation, e.g., by exonucleases. A “substantially resistant” circular polyribonucleotide can refer to one that has at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% resistance as compared to a reference polyribonucleotide. In some embodiments, the circular polyribonucleotide replicates within a cell. In some embodiments, the circular polyribonucleotide replicates within in a cell at a rate of about 10%- 20%, 20%-30%, 30%-40%, 40%-50%, 50%-60%, 60%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, 95%-99%, or any percentage therebetween. In some embodiments, theFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 circular polyribonucleotide is replicates within a cell and is passed to daughter cells. In some embodiments, a cell passes at least one circular polyribonucleotide to daughter cells with an efficiency of at least 25%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%. In some embodiments, a cell undergoing meiosis passes the circular polyribonucleotide to daughter cells with an efficiency of at least 25%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%. In some embodiments, a cell undergoing mitosis passes the circular polyribonucleotide to daughter cells with an efficiency of at least 25%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%. In some embodiments, the circular polyribonucleotide replicates within the host cell. In some embodiments, the circular polyribonucleotide is capable of replicating in a mammalian cell, e.g., a human cell. While in some embodiments the circular polyribonucleotide replicates in the host cell, the circular polyribonucleotide does not integrate into the genome of the host, e.g., with the host’s chromosomes. In some embodiments, the circular polyribonucleotide has a negligible recombination frequency, e.g., with the host’s chromosomes. In some embodiments, the circular polyribonucleotide has a recombination frequency, e.g., less than about 1.0 cM / Mb, 0.9 cM / Mb, 0.8 cM / Mb, 0.7 cM / Mb, 0.6 cM / Mb, 0.5 cM / Mb, 0.4 cM / Mb, 0.3 cM / Mb, 0.2 cM / Mb, 0.1 cM / Mb, or less, e.g., with the host’s chromosomes. Production Methods Also provided herein are methods for producing the circular polyribonucleotides described herein, including, e.g., recombinant technology or chemical synthesis. For example, a DNA molecule used to produce an RNA circle can include a DNA sequence of a naturally occurring nucleic acid sequence, a modified version thereof, or a DNA sequence encoding a synthetic polypeptide not normally found in nature (e.g., chimeric molecules or fusion proteins). DNA and RNA molecules can be modified using a variety of techniques including, but not limited to, classic mutagenesis techniques and recombinant techniques, such as site- directed mutagenesis, chemical treatment of a nucleic acid molecule to induce mutations, restriction enzyme cleavage of a nucleic acid fragment, ligation of nucleic acid fragments, polymerase chain reaction (PCR) amplification or mutagenesis of selected regions of a nucleic acid sequence, synthesis of oligonucleotide mixtures and ligation of mixture groups to "build" a mixture of nucleic acid molecules and combinations thereof.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 The circular polyribonucleotides may be prepared according to any available technique, including, but not limited to chemical synthesis and enzymatic synthesis. In some embodiments, a linear primary construct or linear polyribonucleotide for circularization may be cyclized or concatenated to create a circRNA described herein. In some embodiments, the linear polyribonucleotide for circularization may be cyclized in vitro prior to formulation and / or delivery. In some embodiments, the circular polyribonucleotide may be in a mixture with linear polyribonucleotides. In some embodiments, the linear polyribonucleotides have the same nucleic acid sequence as the circular polyribonucleotides. The mechanism of cyclization or concatenation may occur through methods such as, e.g., chemical, enzymatic, splint ligation, or ribozyme-catalyzed methods. The newly formed 5’-3’ linkage may be an intramolecular linkage or an intermolecular linkage. For example, a splint ligase, such as a SplintR® ligase, can be used for splint ligation. According to this method, a single stranded polynucleotide (splint), such as a single-stranded DNA or RNA, can be designed to hybridize with both termini of a linear polyribonucleotide, so that the two termini can be juxtaposed upon hybridization with the single-stranded splint. Splint ligase can thus catalyze the ligation of the juxtaposed two termini of the linear polyribonucleotide, generating a circular polyribonucleotide. In some embodiments, a DNA or RNA ligase may be used in the synthesis of the circular polynucleotides. As a non-limiting example, the ligase may be a circ ligase or circular ligase. In some embodiments, either the 5' or 3' end of the linear polyribonucleotide can encode a ligase ribozyme sequence such that during in vitro transcription, the resultant linear polyribonucleotide for circularization includes an active ribozyme sequence capable of ligating the 5' end of the linear polyribonucleotide for circularization to the 3' end of the linear polyribonucleotide for circularization. The ligase ribozyme may be derived from the Group I Intron, Hepatitis Delta Virus, Hairpin ribozyme or may be selected by SELEX (systematic evolution of ligands by exponential enrichment). In another example, a linear polyribonucleotide may be cyclized or concatenated by using at least one non-nucleic acid moiety. In one aspect, the at least one non-nucleic acid moiety may react with regions or features near the 5' terminus or near the 3' terminus of the linear polyribonucleotide for circularization in order to cyclize or concatenate the linear polyribonucleotide for circularization. In another aspect, the at least one non-nucleic acid moietyFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 may be located in or linked to or near the 5' terminus or the 3' terminus of the linear polyribonucleotide for circularization. The non-nucleic acid moieties may be homologous or heterologous. As a non-limiting example, the non-nucleic acid moiety may be a linkage such as a hydrophobic linkage, ionic linkage, a biodegradable linkage, or a cleavable linkage. As another non-limiting example, the non-nucleic acid moiety is a ligation moiety. As yet another non-limiting example, the non-nucleic acid moiety may be an oligonucleotide or a peptide moiety, such as an aptamer or a non-nucleic acid linker as described herein. In some embodiments, a linear polyribonucleotide for circularization may include a 5' triphosphate of the nucleic acid converted into a 5' monophosphate, e.g., by contacting the 5' triphosphate with RNA 5' pyrophosphohydrolase (RppH) or an ATP diphosphohydrolase (apyrase). In some embodiments, the 5’ end of at least a portion of the linear polyribonucleotides includes a monophosphate moiety. In some embodiments, a population of polyribonucleotides including circular and linear polyribonucleotides is contacted with RppH prior to digesting at least a portion of the linear polyribonucleotides with a 5’ exonuclease and / or a 3’ exonuclease. Alternately, converting the 5' triphosphate of the linear polyribonucleotide for circularization into a 5' monophosphate may occur by a two-step reaction including: (a) contacting the 5' nucleotide of the linear polyribonucleotide for circularization with a phosphatase (e.g., Antarctic Phosphatase, Shrimp Alkaline Phosphatase, or Calf Intestinal Phosphatase) to remove all three phosphates; and (b) contacting the 5' nucleotide after step (a) with a kinase (e.g., Polynucleotide Kinase) that adds a single phosphate. In another aspect, linear polyribonucleotides for circularization may be cyclized or concatenated by self-splicing. In some embodiments, the linear polyribonucleotide may include a sequence that mediates self- ligation. In some embodiments, the linear polyribonucleotides may include loop E sequence (e.g., in PSTVd) to self-ligate. In some embodiments, the linear polyribonucleotide may include a HDV sequence, e.g., HDV replication domain conserved sequence, GGCUCAUCUCGACAAGAGGCGGCAGUCCUCAGUACUCUUACUCUUUUCUGUAAAG AGGAGACUGCUGGACUCGCCGCCCAAGUUCGAGCAUGAGCC (SEQ ID NO: 26) (Beeharry et al., 2004) or GGCUAGAGGCGGCAGUCCUCAGUACUCUUACUCUUUUCUGUAAAGAGGAGACUG CUGGACUCGCCGCCCGAGCC (SEQ ID NO: 27), to self-ligate. In another embodiment, the linear polyribonucleotides may include a self-circularizing intron, e.g., a 5' and 3’ slice junction,Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 or a self-circularizing catalytic intron such as a Group I, Group II, or Group III Introns. Nonlimiting examples of group I intron self- splicing sequences may include self-splicing permuted intron-exon sequences derived from T4 bacteriophage gene td, and the intervening sequence (IVS) rRNA of Tetrahymena, cyanobacterium Anabaena pre-tRNA-Leu gene, or a Tetrahymena pre-rRNA. In some embodiments, the polyribonucleotide includes catalytic intron fragments, such as a 3′ half of Group I catalytic intron fragment and a 5′ half of Group I catalytic intron fragment. The first and second annealing regions may be positioned within the catalytic intron fragments. Group I catalytic introns are self-splicing ribozymes that catalyze their own excision from mRNA, tRNA, and rRNA precursors via two-metal ion phorphoryl transfer mechanism. Importantly, the RNA itself self-catalyzes the intron removal without the requirement of an exogenous enzyme, such as a ligase. In some embodiments, the 3′ half of Group I catalytic intron fragment and the 5’ half of Group I catalytic intron fragment are from a cyanobacterium Anabaena pre-tRNA-Leu gene, or a Tetrahymena pre-rRNA. In some embodiments, the 3′ half of Group I catalytic intron fragment and the 5’ half of Group I catalytic intron fragment are from a Cyanobacterium Anabaena pre-tRNA-Leu gene, and the 3’ exon fragment includes the first annealing region and the 5’ exon fragment includes the second annealing region. The first annealing region may include, e.g., from 5 to 50, e.g., from 10 to 15 (e.g., 10, 11, 12, 13, 14, or 15) ribonucleotides and the second annealing region may include, e.g., from 5 to 50, e.g., from 10 to 15 (e.g., 10, 11, 12, 13, 14, or 15) ribonucleotides. In some embodiments, the 3′ half of Group I catalytic intron fragment and the 5’ half of Group I catalytic intron fragment are from a Tetrahymena pre-rRNA, and the 3′ half of Group I catalytic intron fragment includes the first annealing region and the 5’ exon fragment includes the second annealing region. In some embodiments, the 3′ exon includes the first annealing region and the 5’ half of Group I catalytic intron fragment includes the second annealing region. The first annealing region may include, e.g., from 6 to 50, e.g., from 10 to 16 (e.g., 10, 11, 12, 13, 14, 15, or 16) ribonucleotides, and the second annealing region may include, e.g., from 6 to 50, e.g., from 10 to 16 (e.g., 10, 11, 12, 13, 14, 15, or 16) ribonucleotides.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 In some embodiments, the 3′ half of Group I catalytic intron fragment and the 5’ half of Group I catalytic intron fragment are from a cyanobacterium Anabaena pre-tRNA-Leu gene, a Tetrahymena pre-rRNA, or a T4 phage td gene. In some embodiments, the 3′ half of Group I catalytic intron fragment and the 5’ Group I catalytic intron fragment are from a T4 phage td gene. The 3′ exon fragment may include the first annealing region and the 5’ half of Group I catalytic intron fragment may include the second annealing region. The first annealing region may include, e.g., from 2 to 16, e.g., 10 to 16 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16) ribonucleotides, and the second annealing region may include, e.g., from 2 to 16, e.g., 10 to 16 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16) ribonucleotides. In some embodiments, the 3′ half of Group I catalytic intron fragment is the 5’ terminus of the linear polynucleotide. In some embodiments, the 5′ half of Group I catalytic intron fragment is the 3’ terminus of the linear polyribonucleotide. In some embodiments, the 3’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AACAACAGATAACTTACAGCTAGTCGGAAGGTGCAGAGACTCGACGGGAGCTACCC TAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAG CGAAAGCTGCGGGAGAATG-3’ (SEQ ID NO: 28). In some embodiments, the 5’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AAATAATTGAGCCTTAGAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGA AACCTAAATCTAGCTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAG TAAGTT-3’ (SEQ ID NO: 29). In some embodiments, the 3’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 28 and the 5’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 29. In some embodiments, the 3’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- CTTCTGTTGATATGGATGCAGTTCACAGACTAAATGTCGGTCGGGGAAGATGTATTC TTCTCATAAGATATAGTCGGACCTCTCCTTAATGGGAGCTAGCGGATGAAGTGATGCFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 AACACTGGAGCCGCTGGGAACTAATTTGTATGCGAAAGTATATTGATTAGTTTTGGA GTACTCG-3’ (SEQ ID NO: 30). In some embodiments, the 5’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AAATAGCAATATTTACCTTTGGAGGGAAAAGTTATCAGGCATGCACCTGGTAGCTAG TCTTTAAACCAATAGATTGCATCGGTTTAAAAGGCAAGACCGTCAAATTGCGGGAA AGGGGTCAACAGCCGTTCAGTACCAAGTCTCAGGGGAAACTTTGAGATGGCCTTGC AAAGGGTATGGTAATAAGCTGACGGACATGGTCCTAACCACGCAGCCAAGTCCTAA GTCAACAGAT-3’ (SEQ ID NO: 31). In some embodiments, the 3’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 30 and the 5’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 31. In some embodiments, the 3’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- GGTTCTACATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGA AACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACA TGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAATG-3’ (SEQ ID NO: 32). In some embodiments, the 5’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- TAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACC TCTCTAGTAGACAATCCCGTGCTAAATTGTAGGACT-3’ (SEQ ID NO: 33). In some embodiments, the 3’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 32 and the 5’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 33. In some embodiments, the 3’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- TAAACAACTAACAGCTTTAGAAGGTGCAGAGACTAGACGGGAGCTACCCTAACGGA TTCAGCCGAGGGTAAAGGGATAGTCCAATTCTCAACATCGCGATTGTTGATGGCAGC GAAAGTTGCAGAGAGAATGAAAATCCGCTGACTGTAAAGGTCGTGAGGGTTCGAGT CCCTCCGCCCCCA-3’ (SEQ ID NO: 34).Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 In some embodiments, the 5’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- ACGGTAGACGCAGCGGACTTAGAAAACTGGGCCTCGATCGCGAAAGGGATCGAGTG GCAGCTCTCAAACTCAGGGAAACCTAAAACTTTAAACATTMAAGTCATGGCAATCC TGAGCCAAGCTAAAGC-3’ (SEQ ID NO: 35). In some embodiments, the 3’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 34 and the 5’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 35. In some embodiments, the 3’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- TTAAACTCAAAATTTAAAATCCCAAATTCAAAATTCCGGGAAGGTGCAGAGACTCG ACGGGAGCTACCCTAACGTAAAGCCGAGGGTAAAGGGAGAGTCCAATTCTCAAAGC CTGAAGTTGCTGAAGCAACAAGGCAGTAGTGAAAGCTGCGAGAGAATGAAAATCCG TTGACTGTAAAAAGTCGTGGGGGTTCAAGTCCCCCCACCCCC-3’ (SEQ ID NO: 36). In some embodiments, the 5’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- ATGGTAGACGCTACGGACTTAGAAAACTGAGCCTTGATAGAGAAATCTTTTAAGTG GAAGCTCTCAAATTCAGGGAAACCTAAATCTGAATACAGATATGGCAATCCTGAGC CAAGCCCAGAAAATTTAGACTTGAGATTTGATTTTGGAG-3’ (SEQ ID NO: 37). In some embodiments, the 3’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 36 and the 5’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 37. In some embodiments, the 3’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- GGCTTTCAATTTGAAATCAGAAATTCAAAATTCAGGGAAGGTGCAGAGACTCGACG GGAGCTACCCTAACGTAAAGGCGAGGGTAAAGGGAGAGTCCAATTCTTAAAGCCTG AAGTTGTGCAAGCAACAAGGCAACAGTGAAAGCTGTGGAAGAATGAAAATCCGTTG ACCTTAAACGGTCGTGGGGGTTCAAGTCCCCCCACCCCC-3’ (SEQ ID NO: 38). In some embodiments, the 5’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- ATGGTAGACGCTACGGACTTAGAAAACTGAGCCTTGATAGAGAAATCTTTCAAGTGFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 GAAGCTCTCAAATTCAGGGAAACCTAAATCTGAATACAGATATGGCAATCCTGAGC CAAGCCCGGAAATTTTAGAATCAAGATTTTATTTT-3’ (SEQ ID NO: 39). In some embodiments, the 3’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 38 and the 5’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 39. In some embodiments, the 3’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AGAAATGGAGAAGGTGTAGAGACTGGAAGGCAGGCACCCTAACGTTAAAGGCGAG GGTGAAGGGACAGTCCAGACCACAAACCAGTAAATCTGGGCAGCGAAAGCTGTAGA TGGTAAGCATAACCCGAAGGTCAGTGGTTCAAATCCACTTCCCGCCACCAAATTAAA AAAACAATAA-3’ (SEQ ID NO: 40). In some embodiments, the 5’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AGAAATGGAGAAGGTGTAGAGACTGGAAGGCAGGCACCCTAACGTTAAAGGCGAG GGTGAAGGGACAGTCCAGACCACAAACCAGTAAATCTGGGCAGCGAAAGCTGTAGA TGGTAAGCATAACCCGAAGGTCAGTGGTTCAAATCCACTTCCCGCCACCAAATTAAA AAAACAATAA-3’ (SEQ ID NO: 41). In some embodiments, the 3’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 40 and the 5’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 41. In some embodiments, the 3’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- ACAACAGATAACTTACTAACTTACAGCTAGTCGGAAGGTGCAGAGACTCGACGGGA GCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAG GCAGTAGCGAAAGCTGCGGGAGAATGAAAATCCGTAGCGTCTAAACGGTCGTGTGG GTTCAAGTCCCTCCACCCCCA-3’ (SEQ ID NO: 42). In some embodiments, the 5’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AGACGCTACGGACTTAAATAATTGAGCCTTAGAGAAGAAATTCTTTAAGTGGATGCT CTCAAACTCAGGGAAACCTAAATCTAGCTATAGACAAGGCAATCCTGAGCCAAGCC GAAGTAGTAATTAGTAAGTTAGTAAGTT-3’ (SEQ ID NO: 43).Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 In some embodiments, the 3’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 42 and the 5’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 43. In some embodiments, the 3’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AACAACAGATAACTTACTAGTTACTAGTCGGAAGGTGCAGAGACTCGACGGGAGCT ACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCA GTAGCGAAAGCTGCGGGAGAATGAAAATCCGTAGCGTCTAAACGGTCGTGTGGGTT CAAGTCCCTCCACCCCCA-3’ (SEQ ID NO: 44). In some embodiments, the 5’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AGACGCTACGGACTTAAATAATTGAGCCTTAGAGAAGAAATTCTTTAAGTGGATGCT CTCAAACTCAGGGAAACCTAAATCTAGCTATAGACAAGGCAATCCTGAGCCAAGCC GAAGTAGTAATTAGTAAGTT-3’ (SEQ ID NO: 45). In some embodiments, the 3’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 44 and the 5’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 45. In some embodiments, the Group I catalytic intron fragment is from the T4 phage nrdB gene or nrdD gene. In some embodiments, the 3′ half of Group I catalytic intron fragment of includes a sequence having at least 80% sequence identity to 5’- TTGCAAAACAAGGTTCAACGACTAGTCTTCGGACGTAGGGTCAAGCGACTCGAAAT GGGGAGAATCCCTCCGGGATTGTGATATAGTCTGGACTGCATGGTAACATGCAGCA GTTCATAAGAGAACGGGTTGAGAATTAGCGAGCTCAATCGAACATACG-3’ (SEQ ID NO: 46). In some embodiments, the 3′ half of Group I catalytic intron fragment of (A) includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- TTGCAAAACAAGGTTCAACGACTAGTCTTCGGACGTAGGGTCAAGCGACTCGAAAT GGGGAGAATCCCTCCGGGATTGTGATATAGTCTGGACTGCATGGTAACATGCAGCA GTTCATAAGAGAACGGGTTGAGAATTAGCGAGCTCAATCGAACATACG-3’ (SEQ ID NO: 47).Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 In some embodiments, the 5′ half of Group I catalytic intron fragment from the T4 phage nrdB gene. In some embodiments, the 3′ half of Group I catalytic intron fragment is from the T4 phage nrdB gene and the 5′ half of Group I catalytic intron fragment is from the T4 phage nrdB gene. In some embodiments, the 5′ half of Group I catalytic intron includes a sequence having at least 80% sequence identity to 5’- AAAATGCGCCTTTAAACGGTAACGTTTATCGAAAACTCCTTTAATTGCTGGAAAGTC CTTTATGGAAAACTAGCAGCCAAGGTTTTGCTT-3’ (SEQ ID NO: 48). In some embodiments, the 5′ half of Group I catalytic intron includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- AAAATGCGCCTTTAAACGGTAACGTTTATCGAAAACTCCTTTAATTGCTGGAAAGTC CTTTATGGAAAACTAGCAGCCAAGGTTTTGCTT-3’ (SEQ ID NO: 49). In some embodiments, the 3′ half of Group I catalytic intron fragment is from the T4 phage nrdD gene. In some embodiments, the 3′ half of Group I catalytic intron fragment includes a sequence having at least 80% sequence identity to 5’- CAGTAGCTGTAAATGCCCAACGACTATCCCTGATGAATGTAAGGGAGTAGGGTCAA GCGACCCGAAACGGCAGACAACTCTAAGAGTTGAAGATATAGTCTGAACTGCATGG TGACATGCAGCTGTTTATCCTCGTATAAATATGAATACGAGGTGAAACGATGAAATG AATTACATTGTTTCATATAAACGGGTAGAGAAGTAGCGAACTCTACTGAACACATTG -3’ (SEQ ID NO: 50). In some embodiments, the 3′ half of Group I catalytic intron fragment includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- CAGTAGCTGTAAATGCCCAACGACTATCCCTGATGAATGTAAGGGAGTAGGGTCAA GCGACCCGAAACGGCAGACAACTCTAAGAGTTGAAGATATAGTCTGAACTGCATGG TGACATGCAGCTGTTTATCCTCGTATAAATATGAATACGAGGTGAAACGATGAAATG AATTACATTGTTTCATATAAACGGGTAGAGAAGTAGCGAACTCTACTGAACACATTG -3’ (SEQ ID NO: 51). In some embodiments, the 5′ half of Group I catalytic intron fragment is from the T4 phage nrdD gene. In some embodiments, the 3′ half of Group I catalytic intron fragment is fromFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 the T4 phage nrdD gene and the 5′ half of Group I catalytic intron fragment is from the T4 phage nrdD gene. In some embodiments, the 5′ half of Group I catalytic intron includes a sequence having at least 80% sequence identity to 5’- TAACGTAAGTCAAGCTCATGTAAAATCTGCCTAAAACGGGAAACTCTCACTGAGAC AATCCGTTGCTAAATCAG-3’ (SEQ ID NO: 52). In some embodiments, the 5′ half of Group I catalytic intron includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- TAACGTAAGTCAAGCTCATGTAAAATCTGCCTAAAACGGGAAACTCTCACTGAGAC AATCCGTTGCTAAATCAG-3’ (SEQ ID NO: 53). In some embodiments, the 3’ exon fragment includes a sequence having at least 80% sequence identity to 5’- GTACCTTTAACTTCCATAAGAACATGGAAATCATGGAAGGTAATGCCAAG-3’ (SEQ ID NO: 54). In some embodiments, the 3’ exon fragment includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- GTACCTTTAACTTCCATAAGAACATGGAAATCATGGAAGGTAATGCCAAG-3’ (SEQ ID NO: 55). In some embodiments, the 3’ exon fragment includes a sequence having at least 80% sequence identity to 5’- GTACCTTTAACTTCCAAAAGATACATAAAAATCATGGAAGGTAATGCCAAG-3’ (SEQ ID NO: 56. In some embodiments, the 3’ exon fragment includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- GTACCTTTAACTTCCAAAAGATACATAAAAATCATGGAAGGTAATGCCAAG-3’ (SEQ ID NO: 57). In some embodiments, the 5’ exon fragment includes a sequence having at least 80% sequence identity to 5’-TTTTTATGTATCTTTTGCGT-3’ (SEQ ID NO: 58). In some embodiments, the 5’ exon fragment includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’-TTTTTATGTATCTTTTGCGT-3’ (SEQ ID NO: 59).Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 In some embodiments, the 3’ exon fragment Includes a sequence having at least 80% sequence identity to 5’- ATGAAGTGAACACGTTATTCAGTTCAAACGGACAGACTCCTTTTGTAACA -3’ (SEQ ID NO: 60). In some embodiments, the 3’ exon fragment includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- ATGAAGTGAACACGTTATTCAGTTCAAACGGACAGACTCCTTTTGTAACA -3’ (SEQ ID NO: 61). In some embodiments, the 3’ exon fragment includes a sequence having at least 80% sequence identity to 5’- ATGAAGTGAACACGTTACATAAGCTTGGAATGCAGACTCCTTTTGTAACA -3’ (SEQ ID NO: 62). In some embodiments, the 3’ exon fragment includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- ATGAAGTGAACACGTTACATAAGCTTGGAATGCAGACTCCTTTTGTAACA -3’ (SEQ ID NO: 63). In some embodiments, the 5’ exon fragment includes a sequence having at least 80% sequence identity to 5’- TGCATTCCAAGCTTATGAGT -3’ (SEQ ID NO: 64). In some embodiments, the 5’ exon fragment includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- TGCATTCCAAGCTTATGAGT -3’ (SEQ ID NO: 65). In another aspect, a linear polyribonucleotide for circularization may be cyclized or concatenated by a non-nucleic acid moiety that causes an attraction between atoms, molecular surfaces at, near, or linked to the 5’ and 3’ ends of the linear polyribonucleotide for circularization. In one embodiment, one or more linear polyribonucleotides is cyclized or concatenated by intermolecular forces or intramolecular forces. Non-limiting examples of intermolecular forces include dipole-dipole forces, dipole-induced dipole forces, induced dipole- induced dipole forces, Van der Waals forces, and London dispersion forces. Non-limiting examples of intramolecular forces include covalent bonds, metallic bonds, ionic bonds, resonant bonds, agnostic bonds, dipolar bonds, conjugation, hyperconjugation and antibonding.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 In some embodiments, a linear polyribonucleotide for circularization may include a ribozyme RNA sequence near the 5’ terminus and near the 3’ terminus. The ribozyme RNA sequence may covalently link to a peptide when the sequence is exposed to the remainder of the ribozyme. In one aspect, the peptides covalently linked to the ribozyme RNA sequence near the 5’ terminus and the 3 ‘terminus may associate with each other causing a linear polyribonucleotide to cyclize or concatenate. In another example, the peptides covalently linked to the ribozyme RNA near the 5’ terminus and the 3’ terminus may cause the linear primary construct or linear mRNA to cyclize or concatenate after being subjected to ligation using various methods known in the art such as, but not limited to, protein ligation. Non-limiting examples of ribozymes for use in the linear primary constructs or linear polyribonucleotides of the present invention or a non-exhaustive listing of methods to incorporate or covalently link peptides are described in U.S. Patent Publication No. U.S. 2003 / 0082768, the contents of which is here in incorporated by reference in its entirety. In another aspect, chemical methods of circularization may be used to generate the circular polyribonucleotide. Such methods may include but are not limited to click chemistry (e.g., alkyne and azide-based methods, or clickable bases), olefin metathesis, phosphoramidate ligation, hemiaminal-imine crosslinking, base modification, and any combination thereof. In some chemical methods, the 5’-end and the 3’-end of a linear polyribonucleotide for circularization includes chemically reactive groups that, when close together, may form a new covalent linkage between the 5’-end and the 3’-end of the molecule. The 5’-end may contain an NHS-ester reactive group and the 3’-end may contain a 3’-amino-terminated nucleotide such that in an organic solvent the 3’-amino-terminated nucleotide on the 3’-end of a linear RNA molecule will undergo a nucleophilic attack on the 5’-NHS-ester moiety forming a new 5’- / 3’-amide bond. In another aspect, the circular polyribonucleotide may be produced using a deoxyribonucleotide template transcribed in a cell-free system (e.g., by in vitro transcription) to a produce a linear RNA. The linear polyribonucleotide produces a splicing-compatible polyribonucleotide, which may be self-spliced to produce a circular polyribonucleotide. In some embodiments, the disclosure provides a method of producing a circular polyribonucleotide (e.g., in a cell-free system) by providing a linear polyribonucleotide; and self- splicing linear polyribonucleotide under conditions suitable for splicing of the 3’ and 5’ splice sites of the linear polyribonucleotide; thereby producing a circular polyribonucleotide.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 In some embodiments, the disclosure provides a method of producing a circular polyribonucleotide by providing a deoxyribonucleotide encoding the linear polyribonucleotide; transcribing the deoxyribonucleotide in a cell-free system to produce the linear polyribonucleotide; optionally purifying the splicing-compatible linear polyribonucleotide; and self-splicing the linear polyribonucleotide under conditions suitable for splicing of the 3’ and 5’ splice sites of the linear polyribonucleotide, thereby producing a circular polyribonucleotide. In some embodiments, the disclosure provides a method of producing a circular polyribonucleotide by providing a deoxyribonucleotide encoding a linear polyribonucleotide; transcribing the deoxyribonucleotide in a cell-free system to produce the linear polyribonucleotide, wherein the transcribing occurs in a solution under conditions suitable for splicing of the 3’ and 5’ splice sites of the linear polyribonucleotide, thereby producing a circular polyribonucleotide. In some embodiments, the linear polyribonucleotide comprises a 5’ split- intron and a 3’ split-intron (e.g., a self-splicing construct for producing a circular polyribonucleotide). In some embodiments, the linear polyribonucleotide comprises a 5’ annealing region and a 3’ annealing region. Suitable conditions for in vitro transcriptions and or self-splicing may include any conditions (e.g., a solution or a buffer, such as an aqueous buffer or solution) that mimic physiological conditions in one or more respects. In some embodiments, suitable conditions include between 0.1-100mM Mg2+ ions or a salt thereof (e.g., 1-100mM, 1-50mM, 1-20mM, 5- 50mM, 5-20 mM, or 5-15mM). In some embodiments, suitable conditions include between 1- 1000mM K+ ions or a salt thereof such as KCl (e.g., 1-1000mM, 1-500mM, 1-200mM, 50- 500mM, 100-500mM, or 100-300mM). In some embodiments, suitable conditions include between 1-1000mM Cl- ions or a salt thereof such as KCl (e.g., 1-1000mM, 1-500mM, 1- 200mM, 50- 500mM, 100-500mM, or 100-300mM). In some embodiments, suitable conditions include between 0.1-100mM Mn2+ ions or a salt thereof such as MnCl2 (e.g., 0.1-100mM, 0.1- 50mM, 0.1-20mM, 0.1-10mM, 0.1-5mM, 0.1-2mM, 0.5- 50mM, 0.5-20 mM, 0.5-15mM, 0.5- 5mM, 0.5-2mM, or 0.1-10mM). In some embodiments, suitable conditions include dithiothreitol (DTT) (e.g., 1-1000 μM, 1-500 μM, 1-200μM, 50- 500μM, 100-500μM, 100-300μM, 0.1- 100mM, 0.1-50mM, 0.1-20mM, 0.1-10mM, 0.1-5mM, 0.1-2mM, 0.5- 50mM, 0.5-20 mM, 0.5- 15mM, 0.5-5mM, 0.5-2mM, or 0.1-10mM). In some embodiments, suitable conditions include between 0.1mM and 100mM ribonucleoside triphosphate (NTP) (e.g., 0.1-100 mM, 0.1-50mM,Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 0.1-10mM, 1- 100mM, 1-50mM, or 1-10mM). In some embodiments, suitable conditions include a pH of 4 to 10 (e.g., pH of 5 to 9, pH of 6 to 9, or pH of 6.5 to 8.5). In some embodiments, suitable conditions include a temperature of 4°C to 50°C (e.g., 10°C to 40°C, 15 °C to 40°C, 20°C to 40°C, or 30°C to 40°C), In some embodiments the linear polyribonucleotide is produced from a deoxyribonucleic acid, e.g., a deoxyribonucleic acid described herein, such as a DNA vector, a linearized DNA vector, or a cDNA. In some embodiments, the linear polyribonucleotide is transcribed from the deoxyribonucleic acid by transcription in a cell-free system (e.g., in vitro transcription). In another aspect, the circular polyribonucleotide may be produced in a cell, e.g., a prokaryotic cell or a eukaryotic cell. In some embodiments, an exogenous polyribonucleotide is provided to a cell (e.g., a linear polyribonucleotide described herein or a DNA molecule encoding for the transcription of a linear polyribonucleotide described here). The linear polyribonucleotides may be transcribed in the cell from an exogenous DNA molecule provided to the cell. The linear polyribonucleotide may be transcribed in the cell from an exogenous recombinant DNA molecule transiently provided to the cell. In some embodiments, the exogenous DNA molecule does not integrate into the cell’s genome. In some embodiments, the linear polyribonucleotide is transcribed in the cell from a recombinant DNA molecule that is incorporated into the cell’s genome. In some embodiments, the cell is a prokaryotic cell. In some embodiments, the prokaryotic cell including the polyribonucleotides described herein is a bacterial cell or an archaeal cell. For example, the prokaryotic cell including the polyribonucleotides described herein may be E coli, halophilic archaea (e.g., Haloferax volcaniii), Sphingomonas, cyanobacteria (e.g., Synechococcus elongatus, Spirulina (Arthrospira) spp., and Synechocystis spp.), Streptomyces, actinomycetes (e.g., Nonomuraea, Kitasatospora, or Thermobifida), Bacillus spp. (e.g., Bacillus subtilis, Bacillus anthracis, Bacillus cereus), betaproteobacteria (e.g., Burkholderia), alphaproteobacterial (e.g., Agrobacterium), Pseudomonas (e.g., Pseudomonas putida), and enterobacteria. The prokaryotic cells may be grown in a culture medium. The prokaryotic cells may be contained in a bioreactor. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the eukaryotic cell is a unicellular eukaryotic cell. In some embodiments, the unicellular eukaryotic is a unicellular fungal cell such as a yeast cell (e.g., Saccharomyces cerevisiae and otherFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 Saccharomyces spp., Brettanomyces spp., Schizosaccharomyces spp., Torulaspora spp, and Pichia spp.). In some embodiments, the unicellular eukaryotic cell is a unicellular animal cell. A unicellular animal cell may be a cell isolated from a multicellular animal and grown in culture, or the daughter cells thereof. In some embodiments, the unicellular animal cell is dedifferentiated. In some embodiments, the unicellular eukaryotic cell is a unicellular plant cell. A unicellular plant cell may be a cell isolated from a multicellular plant and grown in culture, or the daughter cells thereof. In some embodiments, the unicellular plant cell is dedifferentiated. In some embodiments, the unicellular plant cell is from a plant callus. In embodiments, the unicellular cell is a plant cell protoplast. In some embodiments, the unicellular eukaryotic cell is a unicellular eukaryotic algal cell, such as a unicellular green alga, a diatom, an euglenid, or a dinoflagellate. Non-limiting examples of unicellular eukaryotic algae of interest include Dunaliella salina, Chlorella vulgaris, Chlorella zofingiensis, Haematococcus pluvialis, Neochloris oleoabundans and other Neochloris spp., Protosiphon botryoides, Botryococcus braunii, Cryptococcus spp., Chlamydomonas reinhardtii and other Chlamydomonas spp. In some embodiments, the unicellular eukaryotic cell is a protist cell. In some embodiments, the unicellular eukaryotic cell is a protozoan cell. In some embodiments, the eukaryotic cell is a cell of a multicellular eukaryote. For example, the multicellular eukaryote may be selected from the group consisting of a vertebrate animal, an invertebrate animal, a multicellular fungus, a multicellular alga, and a multicellular plant. In some embodiments, the eukaryotic organism is a human. In some embodiments, the eukaryotic organism is a non-human vertebrate animal. In some embodiments, the eukaryotic organism is an invertebrate animal. In some embodiments, the eukaryotic organism is a multicellular fungus. In some embodiments, the eukaryotic organism is a multicellular plant. In embodiments, the eukaryotic cell is a cell of a human or a cell of a non-human mammal such as a non-human primate (e.g., monkeys, apes), ungulate (e.g., bovids including cattle, buffalo, bison, sheep, goat, and musk ox; pig; camelids including camel, llama, and alpaca; deer, antelope; and equids including horse and donkey), carnivore (e.g., dog, cat), rodent (e.g., rat, mouse, guinea pig, hamster, squirrel), or lagomorph (e.g., rabbit, hare). In embodiments, the eukaryotic cell is a cell of a bird, such as a member of the avian taxa Galliformes (e.g., chickens, turkeys, pheasants, quail), Anseriformes (e.g., ducks, geese), Paleaognathae (e.g., ostriches, emus), Columbiformes (e.g., pigeons, doves), or Psittaciformes (e.g., parrots). In embodiments, the eukaryotic cell is aFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 cell of an arthropod (e.g., insects, arachnids, crustaceans), a nematode, an annelid, a helminth, or a mollusc. In embodiments, the eukaryotic cell is a cell of a multicellular plant, such as an angiosperm plant (which can be a dicot or a monocot) or a gymnosperm plant (e.g., a conifer, a cycad, a gnetophyte, a Ginkgo), a fern, horsetail, clubmoss, or a bryophyte. In embodiments, the eukaryotic cell is a cell of a eukaryotic multicellular alga. The eukaryotic cells may be grown in a culture medium. The eukaryotic cells may be contained in a bioreactor. In some embodiments, any method of producing a circular polyribonucleotide described herein may be performed in a bioreactor. A bioreactor refers to any vessel in which a chemical or biological process is carried out which involves organisms or biochemically active substances derived from such organisms. Bioreactors may be compatible with the cell-free methods for production of circular RNA described herein. A vessel for a bioreactor may include a culture flask, a dish, or a bag that may be single use (disposable), autoclavable, or sterilizable. A bioreactor may be made of glass, or it may be polymer-based, or it may be made of other materials. Examples of bioreactors include, without limitation, stirred tank (e.g., well mixed) bioreactors and tubular (e.g., plug flow) bioreactors, airlift bioreactors, membrane stirred tanks, spin filter stirred tanks, vibromixers, fluidized bed reactors, and membrane bioreactors. The mode of operating the bioreactor may be a batch or continuous processes. A bioreactor is continuous when the reagent and product streams are continuously being fed and withdrawn from the system. A batch bioreactor may have a continuous recirculating flow, but no continuous feeding of reagents or product harvest. Some methods of the present disclosure are directed to large-scale production of circular polyribonucleotides. For large-scale production methods, the method may be performed in a volume of 1 liter (L) to 50 L, or more (e.g., 5 L, 10 L, 15 L, 20 L, 25 L, 30 L, 35 L, 40 L, 45 L, 50 L, or more). In some embodiments, the method may be performed in a volume of 5 L to 10 L, 5 L to 15 L, 5 L to 20 L, 5 L to 25 L, 5 L to 30 L, 5 L to 35 L, 5 L to 40 L, 5 L to 45 L, 10 L to 15 L, 10 L to 20 L, 10 L to 25 L, 20 L to 30 L, 10 L to 35 L, 10 L to 40 L, 10 L to 45 L, 10 L to 50 L, 15 L to 20 L, 15 L to 25 L, 15 L to 30 L, 15 L to 35 L, 15 L to 40 L, 15 L to 45 L, or 15 to 50 L. In some embodiments, a bioreactor may produce at least 1g of circular RNA. In some embodiments, a bioreactor may produce 1-200g of circular RNA (e.g., 1-10g, 1-20g, 1-50g, 10-50g, 10-100g, 50-100g, or 50-200g of circularFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 RNA). In some embodiments, the amount produced is measured per liter (e.g., 1-200g per liter), per batch or reaction (e.g., 1-200g per batch or reaction), or per unit time (e.g., 1-200g per hour or per day). In some embodiments, more than one bioreactor may be utilized in series to increase the production capacity (e.g., one, two, three, four, five, six, seven, eight, or nine bioreactors may be used in series). In some embodiments, circularization efficiency is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or 100%. In some embodiments, circularization efficiency is at least about 40%. In some embodiments, circularization efficiency is between about 10% and about 100%; for example, circularization efficiency is about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, and about 99%. In some embodiments, circularization efficiency is between about 20% and about 80%. In some embodiments, circularization efficiency is between about 30% and about 60%. In some embodiments, circularization efficiency is about 40%. Additional methods of making the circular polyribonucleotides described herein are described in, for example, Khudyakov & Fields, Artificial DNA: Methods and Applications, CRC Press (2002); in Zhao, Synthetic Biology: Tools and Applications, (First Edition), Academic Press (2013); Muller and Appel, from RNA Biol, 2017, 14(8):1018-1027; and Egli & Herdewijn, Chemistry and Biology of Artificial Nucleic Acids, (First Edition), Wiley-VCH (2012). Other methods of making circular polyribonucleotides are described, for example, in International Publication No. WO2023 / 044006, International Publication No. WO2022 / 247943, U.S. Patent No. 11000547, International Publication No. 2018 / 191722, International Publication No. WO2019 / 236673, International Publication No. WO2020 / 023595, International Publication No. WO2022 / 204460, International Publication No. WO2022 / 204464, International Publication No. WO2022 / 204466, and International Publication No. 2022 / 261490, the contents of each of which are herein incorporated by reference in their entirety). Additional methods of synthesizing circular polyribonucleotides are also described elsewhere (see, e.g., U.S. Patent No. 6210931, U.S. Patent No. 5773244, U.S. Patent No. 5766903, U.S. Patent No. 5712128, U.S. Patent No. 5426180, U.S. Patent Publication No.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 US20100137407, International Publication No. WO1992 / 001813, International Publication No. WO2010 / 084371, and Petkovic et al., Nucleic Acids Res. 43:2454-65 (2015); the contents of each of which are herein incorporated by reference in their entirety). Purification Methods One or more purification steps may be included in the methods described herein. For example, in some embodiments, the linear polyribonucleotide is substantively enriched or pure (e.g., purified) prior to self-splicing the linear polyribonucleotide. In other embodiments, the linear polyribonucleotide is not purified prior to self-splicing the linear polyribonucleotide. In some embodiments, the resulting circular polyribonucleotide is purified. Purification may include separating or enriching the desired reaction product from one or more undesired components, such as any unreacted stating material, byproducts, enzymes, or other reaction components. For example, purification of linear polyribonucleotide following transcription in a cell-free system (e.g., in vitro transcription) may include separation or enrichment from the DNA template prior to self-splicing the linear polyribonucleotide. Purification of the circular RNA product following splicing may be used to separate or enrich the circular polyribonucleotide from its corresponding linear polyribonucleotide. Methods of purification of polyribonucleotides are known to those of skill in the art and include enzymatic purification or by chromatography. In some embodiments, the methods of purification result in a circular polyribonucleotide that has less than 50% (e.g., less than 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, or 1%) linear polyribonucleotides. In some embodiments, the reference criterion for the amount of linear polyribonucleotide molecules present in a preparation (e.g., pharmaceutical preparation) is the presence of no more than 1 ng / mL, 5 ng / mL, 10 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL, 30 ng / mL, 35 ng / mL, 40 ng / mL, 50 ng / mL, 60 ng / mL, 70 ng / mL, 80 ng / mL, 90 ng / mL, 100 ng / mL, 200 ng / mL, 300 ng / mL, 400 ng / mL, 500 ng / mL, 600 ng / mL, 1 µg / mL, 10 µg / mL, 50 µg / mL, 100 µg / mL, 200 g / mL, 300 µg / mL, 400 µg / mL, 500 µg / mL, 600 µg / mL, 700 µg / mL, 800 µg / mL, 900 µg / mL, 1 mg / mL, 1.5 mg / mL, or 2 mg / mL of linear polyribonucleotide molecules. In some embodiments, the reference criterion for the amount of circular polyribonucleotide molecules present in a preparation (e.g., pharmaceutical preparation) is atFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 least 30% (w / w), 40% (w / w), 50% (w / w), 60% (w / w), 70% (w / w), 80% (w / w), 85% (w / w), 90% (w / w), 91% (w / w), 92% (w / w), 93% (w / w), 94% (w / w), 95% (w / w), 96% (w / w), 97% (w / w), 98% (w / w), 99% (w / w), 99.1% (w / w), 99.2% (w / w), 99.3% (w / w), 99.4% (w / w), 99.5% (w / w), 99.6% (w / w), 99.7% (w / w), 99.8% (w / w), 99.9% (w / w), or 100% (w / w) molecules of the total ribonucleotide molecules in the preparation. In some embodiments, the reference criterion for the amount of linear polyribonucleotide molecules present in a preparation (e.g., pharmaceutical preparation) is no more than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 40% (w / w), 50% (w / w) linear polyribonucleotide molecules of the total ribonucleotide molecules in the preparation. In some embodiments, the reference criterion for the amount of nicked polyribonucleotide molecules present in a preparation (e.g., pharmaceutical preparation) is no more than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), or 15% (w / w) nicked polyribonucleotide molecules of the total ribonucleotide molecules in the preparation. In some embodiments, the reference criterion for the amount of combined nicked and linear polyribonucleotide molecules present in a preparation (e.g., pharmaceutical preparation) is no more than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 40% (w / w), 50% (w / w) combined nicked and linear polyribonucleotide molecules of the total ribonucleotide molecules in the preparation. In some embodiments, a preparation (e.g., pharmaceutical preparation) is an intermediate preparation of a final circular polyribonucleotide drug product. In some embodiments, a preparation (e.g., pharmaceutical preparation) is a drug substance or active pharmaceutical ingredient (API). In some embodiments, a preparation (e.g., pharmaceutical preparation) is a drug product for administration to a subject. In some embodiments, a preparation (e.g., pharmaceutical preparation) of circular polyribonucleotides is (before, during or after the reduction of linear polyribonucleotide) further processed to substantially remove DNA, protein contamination (e.g., cell protein such as a host cell protein or protein process impurities), endotoxin, mononucleotide molecules, and / or a process-related impurity. Pharmaceutical CompositionsFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 Also provided herein are compositions and pharmaceutical compositions comprising (i) any of the circular polyribonucleotides or unmodified linear RNAs described herein and (ii) a pharmaceutically acceptable excipient. Pharmaceutical compositions can comprise one or more additional therapeutic agents, e.g., therapeutically and / or prophylactically active agents. Methods of making pharmaceutical compositions including circular polyribonucleotides or unmodified linear RNAs are described in WO 2020 / 181013, which is incorporated herein by reference in its entirety. Pharmaceutical compositions provided herein are suitable for administration to humans or any other animal, e.g., to non-human animals, e.g., non-human mammals. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood. Non-limiting examples of subjects that can be administered any of the pharmaceutical compositions described herein include humans, non-human primate, mammals (e.g., commercially-relevant mammals, such as cattle, pigs, horses, sheep, cats, dogs, mice, and rats), and birds (e.g., including commercially relevant birds such as poultry, chickens, ducks, geese, and / or turkeys). Pharmaceutical compositions provided herein can be formulated for any suitable mode of administration. Non-limiting examples include formulation of the pharmaceutical composition for intravenous, subcutaneous, intrahepatic, inhalation, or intramuscular administration. In some embodiments, a pharmaceutical composition is formulated for local administration. In some embodiments, a pharmaceutical composition is formulated for systemic administration. Pharmaceutical compositions provided herein can include an unencapsulated circular polyribonucleotide of unmodified linear RNA, a partially encapsulated circular polyribonucleotide or unmodified linear RNA, or a completely encapsulated circular polyribonucleotide or unmodified linear RNA. Any of the circular polyribonucleotides or unmodified linear RNAs described herein can be included in a pharmaceutical composition with a carrier or without a carrier. In some embodiments, pharmaceutical compositions described herein can be formulated with a carrier, e.g., pharmaceutical carrier and / or a polymeric carrier, e.g., a liposome. In such instances, the circular polyribonucleotide or unmodified linear RNA can be formulated as a lipid nanoparticle. In some embodiments, the circular polyribonucleotide or unmodified linear RNA is formulated for unencapsulated delivery or natural particle delivery.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 Plant nanovesicles and plant messenger packs (PMPs), e.g., as described in International Patent Publication Nos. WO2011 / 097480, WO2013 / 070324, WO2017 / 004526, or WO2020 / 041784 can also be used as carriers to deliver any of the circular polyribonucleotides or unmodified linear RNAs described herein. Lipid reconstructed plant messenger packs (LPMPs), e.g., as described in International Patent Publication Nos. WO2021 / 041301, WO2023 / 069498, or WO2023 / 122080 can also be used as carriers to deliver any of the circular polyribonucleotides or unmodified linear RNAs described herein. Lipid reconstructed natural messenger packs (LNMPs), e.g., as described in International Patent Publication Nos. WO2024 / 102434 can also be used as carriers to deliver any of the circular polyribonucleotides or unmodified linear RNAs described herein. Bacteria-derived lipid compositions, e.g., as described in International Patent Publication Nos. WO2023 / 096858 can also be used as carriers to deliver any of the circular polyribonucleotides or unmodified linear RNAs described herein. In some embodiments, pharmaceutical compositions described herein can be formulated without a carrier, e.g., in a naked delivery formulation. A naked delivery formulation refers to a formulation that is free from a carrier. In some embodiments, a naked delivery formulation can be free of any or all of: transfection reagents, cationic carriers, carbohydrate carriers, nanoparticle carriers, or protein carriers. For example, a naked delivery formulation can be free from phtoglycogen octenyl succinate, phytoglycogen beta-dextrin, anhydride-modified phytoglycogen beta-dextrin, lipofectamine, polyethylenimine, poly(trimethylenimine), poly(tetramethylenimine), polypropylenimine, aminoglycoside-polyamine, dideoxy-diamino-b-cyclodextrin, spermine, spermidine, poly(2-dimethylamino)ethyl methacrylate, poly(lysine), poly(histidine), poly(arginine), cationized gelatin, dendrimers, chitosan, l,2-Dioleoyl-3-Trimethylammonium- Propane (DOTAP), N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), l-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOTIM), 2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-l-propanaminium trifluoroacetate (DOSPA), 3B—[N—(N\N′-Dimethylaminoethane)-carbamoyl]Cholesterol Hydrochloride (DC-Cholesterol HC1), diheptadecylamidoglycyl spermidine (DOGS), N,N- distearyl-N,N-dimethylammonium bromide (DDAB), N-(1,2-dimyristyloxyprop-3-yl)-N,N- dimethyl-N-hydroxyethyl ammonium bromide (DMRIE), N,N-dioleyl-N,N-dimethylammoniumFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 chloride (DODAC), human serum albumin (HSA), low-density lipoprotein (LDL), high-density lipoprotein (HDL), or globulin. In some embodiments, the naked delivery formulation can comprise a non-carrier excipient. In some embodiments, a non-carrier excipient may comprise an inactive ingredient that does not exhibit an active cell-penetrating effect. In some embodiments, a non-carrier excipient may comprise a buffer, for example PBS. In some embodiments, a non-carrier excipient may be a solvent, a non-aqueous solvent, a diluent, a suspension aid, a surface active agent, an isotonic agent, a thickening agent, an emulsifying agent, a preservative, a polymer, a peptide, a protein, a cell, a hyaluronidase, a dispersing agent, a granulating agent, a disintegrating agent, a binding agent, a buffering agent, a lubricating agent, or an oil. In some embodiments, the naked delivery formulation can comprise a diluent (e.g., a parenterally acceptable diluent). A diluent can be a liquid diluent or a solid diluent. In some embodiments, a diluent can be an RNA solubilizing agent, a buffer, or an isotonic agent. Non- limiting examples of an RNA solubilizing agent include water, ethanol, methanol, acetone, formamide, and 2-propanol. Examples of a buffer include 2-(N-morpholino)ethanesulfonic acid (MES), Bis-Tris, 2-[(2-amino-2-oxoethyl)-(carboxymethyl)amino]acetic acid (ADA), N-(2- Acetamido)-2-aminoethanesulfonic acid (ACES), piperazine-N,N′-bis(2-ethanesulfonic acid) (PIPES), 2-[[1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl]amino]ethanesulfonic acid (TES), 3- (N-morpholino)propanesulfonic acid (MOPS), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), Tris, Tricine, Gly-Gly, Bicine, or phosphate. Non-limiting examples of an isotonic agent include glycerin, mannitol, polyethylene glycol, propylene glycol, trehalose, or sucrose. Purity of the pharmaceutical composition comprising the circular polyribonucleotide or unmodified linear RNA can be measured using any method known in the art, e.g., chromatography, electrophoresis, mass spectrometry, fluorescence, light scattering, refractive index, microscopy, circular dichroism (CD) spectroscopy, spectrophotometry, or surface plasmon resonance (SPR). In some embodiments, the pharmaceutical composition comprising the circular polyribonucleotide or unmodified linear RNA is at least 30% (w / w), 40% (w / w), 50% (w / w), 60% (w / w), 70% (w / w), 80% (w / w), 85% (w / w), 90% (w / w), 91% (w / w), 92% (w / w), 93%Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 (w / w), 94% (w / w), 95% (w / w), 96% (w / w), 97% (w / w), 98% (w / w), 99% (w / w), or 100% (w / w) pure on a mass basis. In some embodiments, a concentration of the circular polyribonucleotide or unmodified linear RNA in the pharmaceutical composition is at least 0.1 ng / mL, 0.5 ng / mL, 1 ng / mL, 5 ng / mL, 10 ng / mL, 50 ng / mL, 0.1 μg / mL, 0.5 μg / mL, 1 µg / mL, 2 μg / mL, 5 μg / mL, 10 μg / mL, 20 μg / mL, 30 μg / mL, 40 μg / mL, 50 μg / mL, 60 μg / mL, 70 μg / mL, 80 μg / mL, 100 μg / mL, 200 μg / mL, 300 μg / mL, 500 μg / mL, 1 mg / mL, 2 mg / mL, 3 mg / mL, 5 mg / mL, 10 mg / mL, 100 mg / mL, or 500 mg / mL. In some embodiments, the pharmaceutical composition is substantially free of mononucleotide or has a mononucleotide content of no more than 1 pg / mL, 10 pg / mL, 0.1 ng / mL, 1 ng / mL, 5 ng / mL, 10 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL, 30 ng / mL, 35 ng / mL, 40 ng / mL, 50 ng / mL, 60 ng / mL, 70 ng / mL, 80 ng / mL, 90 ng / mL, 100 ng / mL, 200 ng / mL, 300 ng / mL, 400 ng / mL, 500 ng / mL, 1 μg / mL, 5 μg / mL, 10 μg / mL, or 100 μg / mL. In some embodiments, the pharmaceutical composition has a mononucleotide content of no more than 0.1% (w / w), 0.2% (w / w), 0.3% (w / w), 0.4% (w / w), 0.5% (w / w), 0.6% (w / w), 0.7% (w / w), 0.8% (w / w), 0.9% (w / w), 1% (w / w), 2% (w / w), 3% (w / w), 4% (w / w), 5% (w / w), 6% (w / w), 7% (w / w), 8% (w / w), 9% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), or any percentage therebetween of total nucleotides on a mass basis, wherein total nucleotide content is the total mass of deoxyribonucleotide molecules and ribonucleotide molecules. In some embodiments, the pharmaceutical composition has a linear RNA content, e.g., linear RNA counterpart or RNA fragments, of no more than 1 ng / mL, 5 ng / mL, 10 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL, 30 ng / mL, 35 ng / mL, 40 ng / mL, 50 ng / mL, 60 ng / mL, 70 ng / mL, 80 ng / mL, 90 ng / mL, 100 ng / mL, 200 ng / mL, 300 ng / mL, 400 ng / mL, 500 ng / mL, 600 ng / mL, 1 μg / mL, 10 μg / mL, 50 μg / mL, 100 μg / mL, 200 μg / mL, 300 μg / mL, 400 μg / ml, 500 μg / mL, 600 μg / mL, 700 μg / mL, 800 μg / mL, 900 μg / mL, 1 mg / mL, 1.5 mg / mL, 2 mg / mL, 5 mg / mL, 10 mg / mL, 50 mg / mL, 100 mg / mL, 200 mg / mL, 300 mg / mL, 400 mg / mL, 500 mg / mL, 600 mg / mL, 650 mg / mL, 700 mg / mL, or 750 mg / mL. In some embodiments, the pharmaceutical composition has a nicked RNA content of no more than 10% (w / w), 9.9% (w / w), 9.8% (w / w), 9.7% (w / w), 9.6% (w / w), 9.5% (w / w), 9.4% (w / w), 9.3% (w / w), 9.2% (w / w), 9.1% (w / w), 9% (w / w), 8% (w / w), 7% (w / w), 6% (w / w), 5%Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 (w / w), 4% (w / w), 3% (w / w), 2% (w / w), 1% (w / w), 0.5% (w / w), or 0.1% (w / w), or percentage therebetween. In some embodiments, the pharmaceutical composition is substantially free of DNA content, e.g., template DNA or cell DNA (e.g., host cell DNA), has a DNA content, as low as zero, or has a DNA content of no more than 1 pg / mL, 10 pg / mL, 0.1 ng / mL, 1 ng / mL, 5 ng / mL, 10 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL, 30 ng / mL, 35 ng / mL, 40 ng / mL, 50 ng / mL, 60 ng / mL, 70 ng / mL, 80 ng / mL, 90 ng / mL, 100 ng / mL, 200 ng / mL, 300 ng / mL, 400 ng / mL, 500 ng / mL, 1 μg / mL, 5 μg / mL, 10 μg / mL, or 100 μg / mL. In some embodiments, the pharmaceutical composition is substantially free of an impurity (e.g., a cell protein, a cell nucleic acid, an enzyme, a reagent component, a gel component, or a chromatographic material, protein contamination, or endotoxin contamination). In some embodiments, the pharmaceutical composition comprises a concentration of protein that is less than 0.1 ng, 1 ng, 5 ng, 10 ng, 15 ng, 20 ng, 25 ng, 30 ng, 35 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, 100 ng, 200 ng, 300 ng, 400 ng, or 500 ng of protein per milligram (mg) of the circular polyribonucleotide. In some embodiments, the pharmaceutical composition has an A260 / A280 absorbance ratio from about 1.6 to about 2.3, e.g., as measured by spectrophotometer. In some embodiments, the A260 / A280 absorbance ratio is about 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, or any number therebetween. In some embodiments, the pharmaceutical composition comprises an amount of endotoxin that is less than 20 EU / kg (weight), 10 EU / kg, 5 EU / kg, 1 EU / kg, or is below a predetermined threshold, e.g., the pharmaceutical composition comprises a level of endotoxin below a limit of detection by a specified method. In some embodiments, the pharmaceutical composition is a sterile drug product or substantially free of microorganisms (e.g., supports growth of fewer than 100 viable microorganisms as tested under aseptic conditions). In some embodiments, the pharmaceutical composition comprises a bioburden of less than 100 CFU / 100 mL, 50 CFU / 100 mL, 40 CFU / 100 mL, 30 CFU / 100 mL, 200 CFU / 100 mL, 10 CFU / 100 mL, or 10 CFU / 100 mL before sterilization. In some embodiments, the pharmaceutical composition comprising the circular polyribonucleotide that has undergone a purification step produces a reduced level of one moreFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 markers of an immune or inflammatory response after administration to a subject compared to a pharmaceutical composition comprising an unpurified circular polyribonucleotide. In some embodiments, the one or more markers of an immune or inflammatory response is a cytokine or immune response related gene. In some embodiments, the one or more markers of an immune or inflammatory response is expression of a gene, such as RIG-I, MDA5, PKR, IFN-beta, OAS, and OASL. Methods of Using the Circular Polyribonucleotides and Unmodified Linear RNAs Also provided herein are methods of expressing the polypeptide in a subject in need thereof that include administering to the subject any of the circular polyribonucleotides or unmodified linear RNAs described herein or any of the pharmaceutical compositions described herein. Also provided herein are methods of increasing a level of the polypeptide in a subject in need thereof that include administering to the subject any of the circular polyribonucleotides or unmodified linear RNAs described herein or any of the pharmaceutical compositions described herein. Also provided herein are methods of treating a subject in need thereof that include administering to the subject any of the circular polyribonucleotides or unmodified linear RNAs described herein or any of the pharmaceutical compositions described herein. In some embodiments, the subject has previously been identified or diagnosed as being in need of increased levels of the polypeptide. Also provided herein are methods of expressing the first polypeptide and the second polypeptide in a subject in need thereof that include administering to the subject any of the circular polyribonucleotides or unmodified linear RNAs described herein or any of the pharmaceutical compositions described herein. Also provided herein are methods of increasing a level of the first polypeptide and the second polypeptide in a subject in need thereof that include administering to the subject any of the circular polyribonucleotides or unmodified linear RNAs described herein or any of the pharmaceutical compositions described herein.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 Also provided herein are methods of treating a subject in need thereof that include administering to the subject any of the circular polyribonucleotides described herein or any of the pharmaceutical compositions described herein. In some embodiments, the subject has previously identified or diagnosed as being need of increased levels of the first polypeptide and / or the second polypeptide. The term “subject” refers to a subject who needs treatment as described herein. In some embodiments, the subject is a human or a non-human mammal (e.g., cat, dog, horse, cow, goat, or sheep). An “effective amount” or a “therapeutically effective amount” as used herein refers to the amount of each active agent required to confer therapeutic effect on the subject, either alone or in combination with one or more other active agents. Effective amounts vary, as recognized by those skilled in the art, depending on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size, weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. These factors are well known in the medical field. It is generally preferred that a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons, or virtually any other reason. Empirical considerations such as the half-life of an agent will generally contribute to the determination of the dosage. Frequency of administration can be determined and adjusted over the course of therapy, and is generally, but not necessarily, based on treatment and / or suppression and / or amelioration and / or delay of a disease. In some embodiments, dosages of any of the circular polyribonucleotides, unmodified linear RNAs, or pharmaceutical compositions described herein can be determined empirically in individuals who have been given one or more administration(s) of the circular polyribonucleotide or unmodified linear RNA. For example, individuals are given incremental dosages of any of the circular polyribonucleotides, unmodified linear RNAs, and pharmaceutical compositions described herein and an indicator and / or a symptom of a disease can be followed to assess efficacy.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 Any suitable dosing regimen can be used in methods described herein. In some embodiments, the dosage regimen depends on the pattern of pharmacokinetic decay that the practitioner wishes to achieve. In some embodiments, dosing frequency is once every day, once every other day, once every week, or longer. In some embodiments, dosing frequency is multiple times per day. For repeated administrations over several days or longer, depending on the condition, the treatment can be sustained until a desired suppression of symptoms occurs or until sufficient therapeutic levels are achieved to alleviate a disease, or a symptom thereof. In some embodiments, dosing regimens (including inhibitor used) can vary over time. As used herein, the term “treating” refers to the application or administration of a composition including one or more active agents to a subject who has a disease or condition, a symptom of a disease, and / or an increased risk of developing a disease, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disease, the symptom of the disease, and / or the risk of developing a disease. Alleviating a disease includes delaying the development or progression of the disease, and / or reducing disease severity. Alleviating the disease does not necessarily require curative results. As used herein, “delaying” the development of a disease means to defer, hinder, slow, retard, stabilize, and / or postpone progression of the disease. This delay can be of varying lengths of time, depending on the history of the disease and / or individuals being treated. A method that “delays” or alleviates the development of a disease and / or delays the onset of the disease is a method that reduces probability of developing one or more symptoms of the disease in a given time frame and / or reduces extent of the symptoms in a given time frame, when compared to not using the method. Such comparisons are typically based on clinical studies, using a number of subjects sufficient to give a statistically significant result. “Development” or “progression” of a disease means initial manifestations and / or ensuing progression of the disease. Development of the disease can be detectable and assessed using standard clinical techniques known in the art. However, development also refers to progression that may be undetectable. For purposes of this disclosure, development or progression refers to the biological course of the symptoms. “Development” includes occurrence, recurrence, and onset. As used herein, “onset” or “occurrence” of a disease includes initial onset and / or recurrence.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 In some embodiments, any of the circular polyribonucleotides, unmodified linear RNAs, or pharmaceutical compositions described herein is administered to a subject in an amount sufficient to increase levels of a polypeptide or a first and a second polypeptide by at least 5% (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or more). In some embodiments, the polypeptide (or the first and second polypeptide) is an antibody, a fusion protein, a hormonal protein, a contractile protein, an enzyme, a hormonal protein, a structural protein, a storage protein, a transport protein, or combinations thereof. In some embodiments, methods for treating a disease involve restoring, at least in part, expression and / or activity of a polypeptide (or a first and a second polypeptide) using any of the circular polyribonucleotides, unmodified linear RNAs, or pharmaceutical compositions described herein. Any of the circular polyribonucleotides, unmodified linear RNAs, or pharmaceutical compositions described herein can be administered using any suitable method for achieving delivery of the circular polyribonucleotide or unmodified linear RNA to the subject in need thereof. The route of administration can depend on various factors such as the type of disease to be treated and the site of the disease. In some embodiments, any of the circular polyribonucleotides, unmodified linear RNAs, or pharmaceutical composition described herein can be administered topically, locally, nasally, parenterally, buccally, or by inhalation. Parenteral administration includes, but is not limited to, subcutaneous, intracutaneous, intravenous, inhalation, intramuscular, or intrasynovial injection, or infusion techniques. In some embodiments, any of the circular polyribonucleotides, unmodified linear RNAs, or pharmaceutical composition described herein is administered locally (e.g., intramuscular injection). In some embodiments, any of the circular polyribonucleotides, the unmodified linear RNAs, or the pharmaceutical composition described herein is administered systemically (e.g., intravenous infusion). In some embodiments, any of the circular polyribonucleotides, the unmodified linear RNAs, or the pharmaceutical compositions described herein is administered one or more times to the subject. Alternatively, or in addition, any of the circular polyribonucleotides, the unmodified linear RNAs, or the pharmaceutical compositions described herein can be administered as part of a combination therapy with an additional therapeutic agent.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 Any therapeutic agent suitable for treating a disease can be used as an additional therapeutic agent in methods and / or pharmaceutical compositions described herein. Non- limiting examples of additional therapeutic agents include anti-inflammatory agents (e.g., steroids, such as corticosteroids)), immunosuppressants (e.g., methotrexate, cyclosporine), or insulin. Alternatively, in some embodiments, no other agents are administered. Kits Also provided herein are kits that can be used, e.g., in any of the methods described herein. Such kits include (a) (i) a composition comprising any of the circular polyribonucleotides described herein or any of the unmodified linear RNAs described herein or (ii) any of the pharmaceutical compositions described herein; and optionally, (b) instructions for administering the composition or the pharmaceutical composition to a subject in need thereof. Nucleic Acids The present disclosure further provides nucleic acids (e.g., DNA; a DNA vector) encoding any of the circular polyribonucleotides and unmodified linear RNAs described herein. In some embodiments, the nucleic acid encodes a polyribonucleotide comprising: a circularization element; a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides. In some embodiments, the nucleic acid encodes a linear unmodified RNA comprising: a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides. In some embodiments, the nucleic acid encodes a polyribonucleotide comprising: a circularization element; a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; a second spacer, optionally a stagger element, a second IRES sequence, a sequence encoding a second polypeptide, and optionally a third spacer sequence, where the sequence encoding the polypeptide and / or the second polypeptide has been codon- optimized to reduce the number of uracil ribonucleotides.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 In some embodiments, the nucleic acid encodes a linear unmodified RNA comprising: a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; a second spacer, optionally a stagger element, a second IRES sequence, a sequence encoding a second polypeptide, and optionally, a third spacer sequence, where the sequence encoding the polypeptide and / or the second polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides. In some embodiments, the nucleic acid encodes circular polyribonucleotides described herein that include: a circularization element; a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to both reduce the number of uracil ribonucleotides and to reduce or remove TLR7- and TLR8-recognition motifs. In some embodiments, the nucleic acid encodes unmodified linear RNAs described herein that include a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to both reduce the number of uracil ribonucleotides and to reduce or remove TLR7- and TLR8-recognition motifs. Also provided herein are unmodified linear RNAs including: a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides. Also provided herein are unmodified linear RNAs including: a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, where the sequence encoding the polypeptide has been codon-optimized to both reduce the number of uracil ribonucleotides and reduce or remove TLR7- and TLR8-recognition motifs. EXAMPLES In order that the disclosure described may be more fully understood, the following examples are set forth. The examples described in this application are offered to illustrate the methods provided herein and are not to be construed in any way as limiting their scope.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 Example 1: Sequence Optimization Decreases Innate Immune Response and Increases Expression Window Expression of Endless RNA™ (i.e., eRNA™, circular polyribonucleotides) results in persistent expression within cells and organisms, however, the resulting immunogenicity can negatively impact the persistency of eRNA expression. FIG. 1 shows human Growth Hormone (hGH) eRNA expression in either wildtype or interferon alpha receptor (IFNaR) knockout (KO) mice. The data in FIG. 1 show that IFNaR KO mice expressed eRNA up to 72 hours post- injection, whereas eRNA expression in wildtype mice was reduced after about 20 hours post- injection. The brief expression of hGH in wildtype mice compared to the IFNaR KO mouse was likely due to the innate immune response. To test this hypothesis, constructs were designed to remove uridine nucleosides and toll-like receptor (TLR) motifs that potentially cause activation of immune pathways described herein. Various DNA templates were developed via PCR, in vitro transcribed, splint-ligated into a circular construct, purified, packaged into LNP and in vivo injected into immunocompetent mice. Post-injection, blood was collected at 4 hours and tested for interferon alpha (IFN alpha). Mouse spleens were collected at 24 hours post-injection. B and T cell activation was also tested. FIG. 2 and FIG. 3 are graphs showing IFN alpha expression (pg / mL) four hours post-injection with the various constructs shown. IFN alpha expression was measured via a Quantikine™ ELISA kit. The graphs show a cryobuffer negative control, a V1.0 eRNA E082 / RP construct, an open reading frame (ORF) modified mRNA N1MePsU (N1-methylpseudouridine) construct, an ORF-only construct, an ORF N1MePsU fully-modified construct, an ORF with no uridine content, an ORF with low uridine content, and an ORF lacking any toll-like receptor (TLR)7 and TLR8 motifs. More specifically, FIG. 2 shows absolute IFN alpha expression and FIG. 3 shows the same data on a logarithmic scale. The data demonstrate that the no uridine construct (“ORF zero U”) and the fully modified hGH construct (“ORF N1MePsU fully modified”) completely avoided inducing an IFN alpha response. FIG. 4 shows the percentage of CD69+B-cells and FIG. 5 shows the geometric mean of the CD69 marker within the B cell population. Specifically, FIG. 4 and FIG. 5 show that the full N1-MePsU modification construct and the construct lacking any uridine content lowersFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 immunoreactivity close to phosphate-buffered saline in immune cells. Modified mRNAs (“ORF mod mRNA N1MePsU” and “hGH N1MePsU mRNA”) were used as controls in FIGs. 2-5. Collectively, the data showed that the hGH ORF alone triggers an immune response; however, removal of uridine or substitution of uridine with N1MePsU-modified nucleosides drastically reduced the immune response. Additionally, reducing uridine-content by 20% resulted in a two-fold reduction in IFN alpha. Removal of TLR motifs had about a two-fold reduction in IFN alpha; however, those constructs showed similar T-cell and B-cell activation as the non-optimized hGH construct. Example 2. Increasing Expression Window Using Sequence Optimization FIG. 6 shows a baseline construct design for a circular polyribonucleotide that includes the following elements: CE (circularization element), a first spacer sequence, an IRES sequence, an open reading frame (ORF) (e.g., a sequence encoding a polypeptide), and a second spacer sequence. In some examples, the first and / or second spacer includes an AU120 sequence (SEQ ID NO: 67). In some examples the first and / or second spacer includes an AC120 sequence (SEQ ID NO: 66). In some examples, the circular polyribonucleotide includes a first spacer sequence (i.e., a spacer sequence 5’ to the ORF), but lacks a second spacer sequence (i.e., a spacer sequence 3’ to the ORF). In some examples, the circular polyribonucleotide includes a second spacer sequence (i.e., a spacer sequence 3’ to the ORF), but lacks a first spacer sequence (i.e., a spacer sequence 5’ to the ORF). FIG. 7A shows hGH expression (pg / mL) in macrophages (FIG. 7A) of the constructs shown in Table 2 below. Briefly, hGH expression in macrophages was measured after 24 hours. 0.125 pmols of each construct were transfected into macrophages using MessengerMax™. Similarly, FIG. 7B shows hGH expression in A549 RIG-I KO cells was measured after 24 hours. In FIG. 7B, RIG-I KO cells (10,000 cells / well) were transfected with 0.025 pmols of eRNA constructs using MessengerMax™. Figure 7B demonstrates that increased hGH expression was observed in the circular polyribonucleotide constructs that had AC120 spacers, AC120 spacers plus low uridine ORFs and AC120 spacers plus zero TLR motifs in the ORF, relative to the baseline construct. Table 2. eRNA Constructs tested in MacrophagesFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 ORF Only Total eRNAuridine; T2: RNase T2” indicates the number of cleavage (GU and AU) sites, T2 RNase is an endoribonucleasethat has a role in innate immunity and removing uridine residues eliminates T2 cleavage sites; Baseline: AU120 sequence on both sites FIG. 8 is a graph showing the immune response as measured by interferon gamma- induced protein 10 (IP-10) in macrophages transfected with the constructs shown in Table 2. Briefly, IP-10 expression was measured after 24 hours where 0.125 pmols of each construct was transfected into macrophages using MessengerMax™. The data demonstrate a comparable immune response in macrophages across all constructs. Next, an in vivo experiment was performed in mice where 0.75 mg / kg of each construct was separately injected into a mouse and IFN alpha and hGH expression were measured at 4 hours. hGH expression was further measured at 24, 48, and 72 hours post-injection.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 FIG. 9 is a graph showing the constructs with an AC120 spacer (SEQ ID NO: 66) and either low uridine content (i.e., 80%) or no TLR7 or TLR8 motifs generated the lowest IFN alpha response at 4 hours post-injection in macrophages. FIG. 10 is a graph showing hGH expression at 4, 24, 48, and 72 hours post-injection with the constructs shown in macrophages. The constructs including an AC120 spacer (SEQ ID NO: 66) and either low uridine content (i.e., 80%) and no TLR7 or TLR8 motifs showed an increased hGH expression window i.e., persistent expression over time. FIG. 11 is a graph showing the data from FIG. 10 normalized to the 4 hour hGH expression timepoint. The construct including the AC120 spacer (SEQ ID NO: 66) and low uridine content in the open reading frame encoding hGH and the construct with the AC120 spacer (SEQ ID NO: 66) and no TLR7 or TLR8 motifs showed robust expression at 24 hours in macrophages. Further, FIG. 12 is a graph showing hGH expression at 72 hours post-injection. The construct having the AC120 spacers with low uridine content (i.e., 80%) demonstrated the highest hGH expression at 72 hours and highest total overall expression as shown in Table 3 in macrophages. Table 3. hGH Expression at 72 hours Post-injection 72h level Area Under CurveCollectively, the data demonstrate that the AC120 spacer increased overall hGH expression. The AC120 spacer in combination with either a low uridine content ORF (i.e., ORFFish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 encoding hGH) or no TLR7 or TLR8 motifs both decreased the IFNα response and increased the hGH expression window.

Claims

Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 WHAT IS CLAIMED IS:

1. A circular polyribonucleotide comprising: a circularization element; a first spacer, wherein the first spacer comprises AC120 (SEQ ID NO: 66); an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, wherein in the second spacer comprises AC120 (SEQ ID NO: 66), wherein the sequence encoding the polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides.

2. The circular polyribonucleotide of claim 1, wherein the sequence encoding the polypeptide comprises at least a 20% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide.

3. The circular polyribonucleotide of claim 1 or 2, wherein the sequence encoding the polypeptide comprises at least a 25% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide.

4. The circular polyribonucleotide of any one of claims 1-3, wherein the sequence encoding the polypeptide comprises at least a 30% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide.

5. The circular polyribonucleotide of any one of claims 1-4, wherein the sequence encoding the polypeptide comprises at least a 40% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide.

6. The circular polyribonucleotide of any one of claims 1-5, wherein the sequence encoding the polypeptide comprises at least a 50% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide.

7. A circular polyribonucleotide comprising:Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 a circularization element; a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, wherein the sequence encoding the polypeptide has been codon-optimized to reduce or remove TLR7- and TLR8-recognition motifs.

8. The circular polyribonucleotide of claim 7, wherein the sequence encoding the polypeptide does not comprise a TLR7- or TLR8-recognition motif.

9. A circular polyribonucleotide comprising: a circularization element; a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, wherein the sequence encoding the polypeptide has been codon-optimized to both reduce the number of uracil ribonucleotides and reduce or remove TLR7- and TLR8-recognition motifs.

10. The circular polyribonucleotide of claim 9, wherein the sequence encoding the polypeptide comprises at least a 20% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide.

11. The circular polyribonucleotide of claim 9 or 10, wherein the sequence encoding the polypeptide comprises at least a 25% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide.

12. The circular polyribonucleotide of any one of claims 9-11, wherein the sequence encoding the polypeptide comprises at least a 30% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 13. The circular polyribonucleotide of any of one of claims 1-12, wherein the sequence encoding the polypeptide comprises at least a 40% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide.

14. The circular polyribonucleotide of any one of claims 1-13, wherein the sequence encoding the polypeptide comprises at least a 50% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide.

15. The circular polyribonucleotide of any one of claims 9-14, wherein the sequence encoding the polypeptide does not comprise a TLR7- or TLR8-recognition motif.

16. The circular polyribonucleotide of any one of claims 7-15, wherein the first spacer comprises AC120 (SEQ ID NO: 66).

17. The circular polyribonucleotide of any one of claims 7-15, wherein the second spacer comprises AC120 (SEQ ID NO: 66).

18. The circular polyribonucleotide of any one of claims 7-15, wherein the first spacer comprises AC120 (SEQ ID NO: 66) and the second spacer comprises AC120 (SEQ ID NO: 66).

19. A circular polyribonucleotide comprising: a circularization element; a first spacer comprising an AC120 sequence (SEQ ID NO: 66); an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer comprising an AC120 sequence (SEQ ID NO: 66), wherein the sequence encoding the polypeptide has been codon-optimized to both reduce the number of uracil ribonucleotides and reduce or remove TLR7- and TLR8-recognition motifs.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 20. The circular polyribonucleotide of claim 19, wherein the sequence encoding the polypeptide comprises at least a 20% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide.

21. The circular polyribonucleotide of claim 19 or 20, wherein the sequence encoding the polypeptide comprises at least a 25% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide.

22. The circular polyribonucleotide of any one of claims 19-21, wherein the sequence encoding the polypeptide comprises at least a 30% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide.

23. The circular polyribonucleotide of any one of claims 19-22, wherein the sequence encoding the polypeptide comprises at least a 40% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide.

24. The circular polyribonucleotide of any one of claims 19-23, wherein the sequence encoding the polypeptide comprises at least a 50% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the polypeptide.

25. The circular polyribonucleotide of any one of claims 19-24, wherein the sequence encoding the polypeptide does not comprise a TLR7- or TLR8-recognition motif.

26. The circular polyribonucleotide of any one of claims 1-25, wherein the circular polyribonucleotide comprises one or more modifications.

27. The circular polyribonucleotide of claim 26, wherein the one or more modifications comprise one or more modifications to a portion of the sequence encoding the polypeptide.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 28. The circular polyribonucleotide of claim 26 or 27, wherein the one or more modifications comprise a modification to a sugar, a nucleobase, an internucleoside linkage, or a combination thereof.

29. The circular polyribonucleotide of any one of claims 1-28, wherein the circular polyribonucleotide further comprises a translation initiation sequence operably linked to the sequence encoding the polypeptide.

30. The circular polyribonucleotide of any one of claims 1-29, wherein the circular polyribonucleotide further comprises a translation termination sequence.

31. The circular polyribonucleotide of any one of claims 1-29, wherein the circular polyribonucleotide lacks a translation termination sequence.

32. The circular polyribonucleotide of any one of claims 1-31, wherein the circular polyribonucleotide further comprises a stagger element at a 3’ end of the sequence encoding the polypeptide.

33. The circular polyribonucleotide of claim 32, wherein the stagger element is configured to stall a ribosome during rolling circle translation.

34. The circular polyribonucleotide of any one of claims 1-33, wherein the circular polyribonucleotide does not comprise a poly(A) tail operably linked to the sequence encoding the polypeptide.

35. A circular polyribonucleotide comprising: a circularization element; a first spacer; a first internal ribosome entry site (IRES) sequence; a sequence encoding a first polypeptide; a second spacer;Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 a second internal ribosome entry site (IRES) sequence; a sequence encoding a second polypeptide; and a third spacer; wherein the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides.

36. The circular polyribonucleotide of claim 35, wherein the first spacer, the second spacer, and / or the third spacer comprises AC120 (SEQ ID NO: 66).

37. The circular polypeptide of claim 35, wherein the first spacer, the second spacer, and / or the third spacer comprises AU120 (SEQ ID NO: 67).

38. The circular polyribonucleotide of any one of claims 35-37, wherein the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide comprises at least a 20% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the first polypeptide or a wild-type sequence encoding the second polypeptide, respectively.

39. The circular polyribonucleotide of any one of claims 35-38, wherein the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide comprises at least a 25% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the first polypeptide or a wild-type sequence encoding the second polypeptide, respectively.

40. The circular polyribonucleotide of any one of claims 35-39, wherein the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide comprises at least a 30% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the first polypeptide or a wild-type sequence encoding the second polypeptide, respectively.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 41. The circular polyribonucleotide of any one of claims 35-40, wherein the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide comprises at least a 40% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the first polypeptide or a wild-type sequence encoding the second polypeptide, respectively.

42. The circular polyribonucleotide of any one of claims 35-41, wherein the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide comprises at least a 50% decrease in the number of the uracil ribonucleotides as compared to a wild-type sequence encoding the first polypeptide or a wild-type sequence encoding the second polypeptide, respectively.

43. The circular polyribonucleotide of any one of claims 35-42, wherein the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide does not comprise a TLR7- or TLR8-recognition motif.

44. The circular polyribonucleotide of any one of claims 35-43, wherein the circular polyribonucleotide comprises one or more modifications.

45. The circular polyribonucleotide of claim 44, wherein the one or more modifications comprise one or more modifications to a portion of the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide.

46. The circular polyribonucleotide of claim 44 or 45, wherein the one or more modifications comprise a modification to a sugar, a nucleobase, an internucleoside linkage, or a combination thereof.

47. The circular polyribonucleotide of any one of claims 35-46, wherein the circular polyribonucleotide further comprises a translation initiation sequence operably linked to the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 48. The circular polyribonucleotide of any one of claims 35-47, wherein the circular polyribonucleotide further comprises a translation termination sequence.

49. The circular polyribonucleotide of any one of claims 35-47, wherein the circular polyribonucleotide lacks a translation termination sequence.

50. The circular polyribonucleotide of any one of claims 35-49, wherein the circular polyribonucleotide further comprises a stagger element at a 3’ end of the sequence encoding the first polypeptide and / or the sequence encoding the second polypeptide.

51. The circular polyribonucleotide of claim 50, wherein the stagger element is configured to stall a ribosome during rolling circle translation.

52. The circular polyribonucleotide of any one of claims 35-51, wherein the circular polyribonucleotide does not comprise a poly(A) sequence operably linked to the sequence encoding the first polypeptide or the sequence encoding the second polypeptide.

53. A pharmaceutical composition comprising the circular polyribonucleotide of any one of claims 1-34, and a pharmaceutically acceptable excipient.

54. The pharmaceutical composition of claim 53, wherein the circular polyribonucleotide is formulated as a lipid nanoparticle.

55. The pharmaceutical composition of claim 53, wherein the circular polyribonucleotide is formulated for unencapsulated delivery or natural particle delivery.

56. The pharmaceutical composition of any one of claims 53-55, wherein the pharmaceutical composition is formulated for intravenous, subcutaneous, intrahepatic, inhalation, or intramuscular administration.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 57. The pharmaceutical composition of any one of claims 53-55, wherein the pharmaceutical composition is formulated for local administration.

58. The pharmaceutical composition of any one of claims 53-55, wherein the pharmaceutical composition is formulated for systemic administration.

59. The pharmaceutical composition of any one of claims 53-55, wherein the pharmaceutical composition comprises one or more of the following features: (i) a concentration of the circular polyribonucleotide of between 0.1 ng / mL and 500 mg / mL; (ii) a concentration of deoxyribonucleotide of no more than 100 ng / mL; (iii) a concentration of protein of less than 100 ng of protein per milligram (mg) of the circular polyribonucleotide; (iv) an A260 / A280 absorbance ratio of from about 1.6 to 2.3 as measured by a spectrophotometer; (v) substantially free of a process-related impurity selected from a cell protein, a cell deoxyribonucleic acid, an enzyme, a reagent component, a gel component, or a chromatographic material; and (vi) a reduced level of one or more markers of an immune or inflammatory response after purification compared to prior to purification.

60. A pharmaceutical composition comprising the circular polyribonucleotide of any one of claims 35-52, and a pharmaceutically acceptable excipient.

61. The pharmaceutical composition of claim 60, wherein the circular polyribonucleotide is formulated as a lipid nanoparticle.

62. The pharmaceutical composition of claim 60, wherein the circular polyribonucleotide is formulated for unencapsulated delivery or natural particle delivery.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 63. The pharmaceutical composition of any one of claims 60-62, wherein the pharmaceutical composition is formulated for intravenous, subcutaneous, intrahepatic, inhalation, or intramuscular administration.

64. The pharmaceutical composition of any one of claims 60-62, wherein the pharmaceutical composition is formulated for local administration.

65. The pharmaceutical composition of any one of claims 60-62, wherein the pharmaceutical composition is formulated for systemic administration.

66. The pharmaceutical composition of any one of claims 60-62, wherein the pharmaceutical composition comprises one or more of the following features: (i) a concentration of the circular polyribonucleotide of between 0.1 ng / mL and 500 mg / mL; (ii) a concentration of deoxyribonucleotide of no more than 100 ng / mL; (iii) a concentration of protein of less than 100 ng of protein per milligram (mg) of the circular polyribonucleotide; (iv) an A260 / A280 absorbance ratio of from about 1.6 to 2.3 as measured by a spectrophotometer; (v) substantially free of a process-related impurity selected from a cell protein, a cell deoxyribonucleic acid, an enzyme, a reagent component, a gel component, or a chromatographic material; and (vi) a reduced level of one or more markers of an immune or inflammatory response after purification compared to prior to purification.

67. A kit comprising the pharmaceutical composition of any one of claims 53-66.

68. A method of expressing the polypeptide in a subject in need thereof, the method comprising administering to the subject the circular polyribonucleotide of any one of claims 1-34 or the pharmaceutical composition of claims 53-59.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 69. The method of claim 68, wherein the subject has been previously identified or diagnosed as being in need of increased levels of the polypeptide.

70. A method of expressing the first polypeptide and the second polypeptide in a subject in need thereof, the method comprising administering to the subject the circular polyribonucleotide of any one of claims 35-52 or the pharmaceutical composition of claims 60- 66.

71. The method of claim 70, wherein the subject has been previously identified or diagnosed as being in need of increased levels of the first polypeptide and the second polypeptide.

72. A method of increasing a level of the polypeptide in a subject in need thereof, the method comprising administering to the subject the circular polyribonucleotide of any one of claims 1-34 or the pharmaceutical composition of claims 53-59.

73. The method of claim 72, wherein the subject has been previously identified or diagnosed as being in need of increased levels of the polypeptide.

74. A method of increasing a level of the first polypeptide and the second polypeptide in a subject in need thereof, the method comprising administering to the subject the circular polyribonucleotide of any one of claims 35-52 or the pharmaceutical composition of claims 60- 66.

75. The method of claim 74, wherein the subject has been previously identified or diagnosed as being in need of increased levels of the first polypeptide and the second polypeptide.

76. A method of treating a subject in need thereof, the method comprising administering to the subject the circular polyribonucleotide of any one of claims 1-34 or the pharmaceutical composition of claims 53-59.Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 77. The method of claim 76, wherein the subject has previously been identified or diagnosed as being in need of increased levels of the polypeptide.

78. A method of treating a subject in need thereof, the method comprising administering to the subject the circular polyribonucleotide of any one of claims 35-52 or the pharmaceutical composition of any one of claims 60-66.

79. The method of claim 78, wherein the subject has previously identified or diagnosed as being need of increased levels of the first polypeptide and / or the second polypeptide.

80. A DNA vector encoding a polyribonucleotide comprising: a circularization element; a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, wherein the sequence encoding the polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides.

81. A DNA vector encoding a polyribonucleotide comprising: a circularization element; a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, wherein the sequence encoding the polypeptide has been codon-optimized to both reduce the number of uracil ribonucleotides and reduce or remove TLR7- and TLR8-recognition motifs.

82. A DNA vector encoding a polyribonucleotide comprising: a first spacer;Fish Ref: 56929.0006WO1 Client Ref: LRN23-109WO1 an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, wherein the sequence encoding the polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides.

83. A DNA vector encoding a polyribonucleotide comprising: a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, wherein the sequence encoding the polypeptide has been codon-optimized to both reduce the number of uracil ribonucleotides and reduce or remove TLR7- and TLR8-recognition motifs.

84. An unmodified linear RNA comprising: a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, wherein the sequence encoding the polypeptide has been codon-optimized to reduce the number of uracil ribonucleotides.

85. An unmodified linear RNA comprising: a first spacer; an internal ribosome entry site (IRES) sequence; a sequence encoding a polypeptide; and a second spacer, wherein the sequence encoding the polypeptide has been codon-optimized to both reduce the number of uracil ribonucleotides and reduce or remove TLR7- and TLR8-recognition motifs.

Citation Information

Patent Citations

  • Compositions related to rna in circularized form

    US11000547B2

  • Use of a ribozyme to join nucleic acids and peptides

    US20030082768A1

  • Single-chain circular RNA and method of producing the same

    US20100137407A1

  • Systems and Methods for Use in Managing Access to User Profiles, and Content Blocks Included Therein

    US20180191722A1

  • Methods of making single-stranded circular oligonucleotides

    US5426180A