Use of mirnas for the prognosis of stroke patients and as targets for the treatment of stroke.

Abstract

The invention provides an in vitro method for determining the prognosis of a patient with stroke comprising: (i) determining, in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a and combinations thereof, (ii) comparing the level of expression obtained in step (i) with a corresponding reference value, wherein if the expression level determined in step (i) is higher than the corresponding reference value, the patient is considered to have a bad prognosis. The invention also provides an in vitro method for deciding or recommending whether to initiate a medical regimen in a patient with stroke, and an in vitro method for determining the response of a patient already diagnosed with stroke, to a medical regimen for treating stroke. The invention further provides a miRNA inhibitor of a miRNA selected from the list consisting of miR-376c- 3p, miR-199a and combinations thereof, for use in the treatment or prevention of stroke in a patient. The invention also provides a combination of miRNAs comprising said miRNA inhibitor, and a pharmaceutical composition for use in the treatment or prevention of stroke.

Description

[0001] Use of miRNAs for the prognosis of stroke patients and as targets for the treatment of stroke.

[0002] This application claims the benefit of European Patent Application EP24382236.8 filed March 4th2024.

[0003] Technical Field

[0004] The present invention is related to the fields of prognosis and of therapeutic treatments. In particular, the present invention provides non-invasive methods for the prognosis of patients that have suffered stroke, based on measuring the amount of specific miRNAs in body fluids. It also provides miRNA inhibitors for the treatment of stroke patients.

[0005] Background Art

[0006] Stroke, (also known as a cerebrovascular accident or brain attack) is a medical condition in which poor blood flow to the brain causes cell death. There are two main types of stroke: ischemic stroke (IS), due to a lack of blood flow, and haemorrhagic stroke, as a result of haemorrhagic bleeding. Both stroke types cause parts of the brain to stop functioning properly. It has been estimated that 87% of stroke is ischemic, with the rest being haemorrhagic.

[0007] Stroke, in particular IS, is the leading cause of adult disability and the second cause of death worldwide according to the WHO. Approximately 13 million people suffer yearly a stroke and five million result in longterm disability.

[0008] Functional outcome after stroke differs between individuals, regardless of clinical factors as the initial stroke severity. There are multiple biological processes involved in the response to cerebral damage resulting from a stroke event, and their activity may be modulated by many different mechanisms that could contribute to differential interindividual recovery. Some of these mechanisms are epigenetic processes, including DNA methylation, histone modification and its modulation by long-non-coding RNAs, and microRNAs (miRNAs).

[0009] MicroRNAs are non protein-coding short RNA molecules that regulate gene expression at post-transcription level, primarily through the interaction with messenger RNAs (mRNAs). MiRNAs recognize binding sites generally located in the 3' untranslated region (3' UTR) of mRNA to repress their translation or less frequently induce their degradation. MiRNAs regulate the expression of approximately 60% of human protein-coding genes, and one miRNA can simultaneously regulate several target genes. Besides, these molecules participate in a large number of physiological and pathological processes, such as cell differentiation, development, proliferation, apoptosis, migration, and cellular stress response.

[0010] Recent studies proved that miRNAs also regulate neuroprotection and neurodegeneration processes, which are both highly involved in the recovery after stroke. Moreover, several different miRNAs, and their target genes, are recognized to be involved in the pathophysiology of stroke. However, most studies are focused on the potential of miRNA as biomarkers for the diagnosis of acute IS, as well as in studying their role in IS pathogenesis, rather than in the prognosis of stroke patients, or in the identification of targets for the neurological recovery of stroke patients.

[0011] Additionally, current therapies for the treatment of stroke are most of them focused on the causative events. In the case of ischemic stroke, for instance, therapies are generally addressed to the restauration of cerebral blood flow, for instance upon administration of thrombolytic agents recombinant tissue plasminogen activator (rtPA), or mechanical thrombectomy. In the case of haemorrhagic stroke, most treatments are addressed to regulating blood pressure or to promoting blood clotting, for instance upon administration of prothrombin or clotting factors, or in severe cases, emergency surgery to remove the accumulated blood and relieve the pressure in the brain. However, efficient therapies addressed to preservation, recovery, and / or regeneration of the nervous system damaged during ischemic or haemorrhagic stroke (besides cognitive rehabilitation therapies) are currently missing.

[0012] Therefore, there is a need in the art to identify efficient markers to evaluate the severity of the neurological damage following a stroke event and the outcome and prognosis of patients that have suffered a stroke event, and for efficient neuroprotective therapies for stroke patients' daily life recovery.

[0013] Summary of the Invention.

[0014] The authors of the present invention have surprisingly found that the expression level of miRNAs miR-376c- 3p, miR-199a, miR134-5p, miR-4463, and miR-584-5p is higher in blood samples from stroke patients with a bad outcome (a modified Rankin Scale (mRS) from 3 to 6) at 3-6 months after the stroke event, than in blood samples from stroke patients with a good outcome (a modified Rankin Scale (mRS) lower than 3) at 3-6 months after the stroke event.

[0015] As shown in the examples, miRNAs miR-376c-3p, miR-199a, miR-134-5p, miR-4463, and miR-584-5p are robust biomarkers for determining the outcome of stroke patients by simply analysing their expression level in blood samples of the stroke patients.

[0016] Thus, in a first aspect, the invention is addressed to an in vitro method for determining the prognosis of a patient with stroke comprising:

[0017] (I) determining, in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a and combinations thereof,

[0018] (ii) comparing the level of expression obtained in step (I) with a corresponding reference value, wherein if the expression level determined in step (I) is higher than the corresponding reference value, the patient is considered to have a bad prognosis.

[0019] Depending on the prognosis of the patient, different therapies can be provided, for instance, personalized endovascular therapies, and in case of worse prognosis, personalized endovascular therapies in combination with neuroprotective drugs or treatments. Therefore, an advantage of the method is that it allows to determine the medical treatment, as well as the subsequent medical follow-up care best suited for the patient. Additionally, an important characteristic of the method is that it can be performed with simple means and in a time-efficient manner. The method can thus be performed quickly at ambulatory level or at ambulances. It is well-documented that for most known medical treatments of stroke patients, early performing the correct therapeutic intervention can be crucial for optimal therapeutic results. Thus, an important advantage of the method is that, not only it allows determining the best treatment to be provided to the stroke patient, but also to determine it soon after the onset of stroke symptoms, which can be crucial for the patient and for a better outcome.

[0020] In a second aspect, the invention is addressed to an in vitro method for deciding or recommending whether to initiate a medical regimen in a patient with stroke, the method comprising the steps of:

[0021] (i) determining in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a and combinations thereof,

[0022] (ii) comparing the level of expression obtained in step (i) with a corresponding reference value, wherein if the expression level determined in step (i) is higher than the corresponding reference value, it is decided or recommended to initiate the medical regimen.

[0023] In a third aspect, the invention is addressed to an in vitro method for determining the response of a patient already diagnosed with stroke, to a medical regimen for treating stroke, the method comprising the steps of:

[0024] (i) determining in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a and combinations thereof,

[0025] (ii) comparing the expression level obtained in step (i) with the expression level of the same miRNA(s) determined at the start of the medical regimen or at an earlier phase of the medical regimen, wherein a reduced expression level of the miRNA(s) with respect to the expression level at the start of the medical regimen, or at an earlier phase of the medical regimen, is indicative of a good response to the medical regimen.

[0026] Additionally, the identified miRNAs have been annotated to target genes involved in Gene Ontologies (GO) pathways related to biological processes such as angiogenesis, neuron morphogenesis, transforming growth factor beta (TGF-p), endothelial development and cognition; which all have been associated with stroke recovery (see for instance Fig. 3 and Fig. 5). Said miRNAs thus represent useful targets for the treatment of neurological damages and for neuroprotection in stroke patients. In addition, miR199a-3p and miR376c-3p negatively affect stroke recovery, as shown with scratch assays in Example 3, and miR199a- 3p inhibits the expression of proteins functionally associated to stroke recovery, such as YAP1, as shown in Example 4.

[0027] Thus, in a fourth aspect, the invention is addressed to a miRNA inhibitor of a miRNA selected from the list consisting of miR-376c-3p, miR-199a and combinations thereof, for use in the treatment or prevention of stroke in a patient. In a fifth aspect, the invention is addressed to a combination of miRNA inhibitors for use in the treatment or prevention of stroke in a patient, wherein the combination of miRNA inhibitors comprises the miRNA inhibitor as defined in the fourth aspect and further comprises:

[0028] - a miRNA inhibitor of a miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof,

[0029] - two miRNA inhibitors wherein each one is a miRNA inhibitor of a different miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof,

[0030] - three miRNA inhibitors wherein each one is a miRNA inhibitor of a different miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof, particularly wherein each miRNA inhibitor is a miRNA inhibitor of a different miRNA selected from the group consisting of miR134-5p, miR-4463 and miR-584-5p.

[0031] In a sixth aspect, the invention is addressed to a pharmaceutical composition for use in the treatment or prevention of stroke that comprises the miRNA inhibitor as defined in the fourth aspect, or the combination of miRNA inhibitors as defined in the fifth aspect.

[0032] Brief description of the figures

[0033] Figure 1 Study design. At the discovery phase we measured 2083 plasma circulating miRNAs with Next Generation Sequencing (NGS) in 215 ischemic stroke patients and we conducted a differential expression and gene-set enrichment analyses. At the replication phase, we sequenced by RT-PCR the selected candidate miRNAs in an independent cohort of 191 patients.

[0034] Figure 2 Discovery phase — Differential expression analysis results. Panel A depicts the bootstrapped results in the subset of significant miRNAs. Circles indicate whether a candidate was significant after doing the bootstrap (full black circle) or not (black circle filled in white). Panel B compares the distribution of miRNAs having a FC higher than 1 .5 between patients with good (left box in each boxplot) and poor prognosis (right box in each boxplot). All results are adjusted for age, sex, previous mRS, 24h NIHSS and rTPA.

[0035] Figure 3: Functional annotations of significant miRNAs obtained in discovery phase. The heatmap shows 6 clusters of miRNAs with similar functions based on their target genes. Rows represent pathways, grouped into 18 families according to the processes in which they participate (numbered from 1-18 at the left of the panel), and columns represent miRNAs. The color depends on how many genes a miRNA regulates in a pathway. Lighter colours represent a greater number of genes, while the darker ones indicate that a miRNA does not regulate any gene belonging to a pathway. Numbers at the left of the panel represent the following families of pathways: 1 : TGF Beta response, 2: Angiogenesis, 3: Synapsis, 4: Cardiac muscle proliferation, 5: Neuron morphogenesis, 6: Heart and artery development, 7: Cognition and behavior, 8: DNA transcription, 9: Regulation of growth, 10: Brain development, 11 : Muscle tissue development, 12: Cell adhesion, 13: Endothelial development, 14: Catabolism regulation, 15: Cellular localization, 16: Receptor binding, 17: Phosphorus metabolism, 18: Chromatin. Figure 4: Replication phase results. Panel A shows the fold change of miRNA candidates and the miRNAs found to be significant (miRNA's name marked with a black circle in the Y axes) or not (miRNA's name not marked with any circle in the Y axes). Panel B shows the results after doing the bootstrap, where miRNAs found to be still significant are marked with a circle in the miRNA's name in the Y axes. We can see that miR-376c-3p, miR-4463, miR-134-5p, miR-199a-3p and miR-584-5p are still significant. The p- coefficients correspond to the AACt value (difference of ACt between the two groups), where negative values indicate that the miRNA expression is higher in patients with poor outcome. Panel C depicts the differences in ACt values between patients with good and poor outcome (lower ACt values indicate a higher miRNA expression). Panel D represents the interaction between stroke outcome and sex in the concentration of miR-134-5p. All results are adjusted for age, sex, previous mRS, 24h NIHSS, rTPA treatment and RNA quantification.

[0036] Figure 5: Functional annotations of miRNAs validated at the replication stage. In panel A rows represent pathways, grouped into 22 families according to the processes in which they participate, and columns represent miRNAs. The color depends on how many genes a miRNA regulates in a family of GO entries. Lighter greys represent a greater number of genes, while the darker ones indicate that a miRNA does not regulate any gene belonging to a pathway. Panel B shows the functional network of replicated miRNAs. Nodes represent the validated miRNAs (blue squares), genetic targets (green triangles) or clusters of GO entries (red circles). Edges (grey dashed lines) are weighted according to the degree of evidence supporting a miRNA-gene relationship (number of published articles) or the importance of a gene in a family of biological processes (number of gene-sets in which the gene is present).

[0037] Figure 6. Wound closure under normoxic conditions. C+ represents the cells transfected with a control RNA. A) Image taken from cells cultured under normoxic conditions, transfected with control RNA (C+), miR-199a-39 (199) and miR-376c-3p (376). B) quantification of data obtained from A) with Image J.

[0038] Figure 7. Wound closure under hypoxic conditions. C+ represents the cells transfected with a control RNA. A) Image taken from cells cultured under hypoxic conditions, transfected with control RNA (C+), miR-199a-39 (199) and miR-376c-3p (376). B) quantification of data obtained from A) with Image J.

[0039] Figure 8. YAP protein levels in cells transfected with scramble or miR-199a-3p mimic. Scramble: miRNA with no known target in the human genome. A) WB of cells transfected with scramble or miR- 199a-3p mimic (miR-199a-3p MIMIC). Scramble (Scr): miRNA with no known target in the human genome. B) Quantificatino of data shown in A) wherein MIMIC corresponds to miR-199a-3p MIMIC.

[0040] Figure 9. YAP1 actin fibers and cell stiffness. A) WB that confirms that the KO and transfection of YAP is working. B) YAP-KO cells presents higher F / G-actin ratio. C) Immunofluorescence of phalloidin, YAP-KO cells presents increased filaments and the addition of YAP decreases stress fibers. D) YAP-KO presents higher stiffness, cells are less flexible.

[0041] Detailed description of the invention All terms as used herein in this application, unless otherwise stated, shall be understood in their ordinary meaning as known in the art. Other more specific definitions for certain terms as used in the present application are as set forth below and are intended to apply uniformly through-out the specification and claims unless an otherwise expressly set out definition provides a broader definition.

[0042] As used herein, the indefinite articles "a” and "an” are synonymous with "at least one” or "one or more.” Unless indicated otherwise, definite articles used herein, such as "the” also include the plural of the noun.

[0043] For purposes of the present invention, any ranges given include both the lower and the upper end-points of the range. Ranges given, such as concentrations and the like, should be considered approximate, unless specifically stated. The term "about" refers to a deviation of plus / minus 10 %, preferably plus / minus 5 %.

[0044] 1. Methods of the invention

[0045] 1.1 Definitions

[0046] The term "stroke”, "cerebrovascular accident” or "brain attack”, as used herein, refers to a medical condition in which poor blood flow to the brain causes cell death. Stroke can be classified into two major categories: ischemic and haemorrhagic. Ischemic stroke is caused by interruption of the blood supply to the brain (ischaemic infarction of part of the brain), while haemorrhagic stroke results from the rupture of a blood vessel or an abnormal vascular structure (intracerebral haemorrhage). IS can be classified as thrombotic IS (or cerebral thrombosis) or embolic IS (cerebral embolism). Thrombotic IS is the most common type of ischemic stroke, characterized in that a blood clot forms inside a diseased or damaged artery in the brain resulting from atherosclerosis (cholesterol-containing deposits called plaque), blocking blood flow. Embolic IS is caused by a clot or a small plaque formed in one of the arteries leading to the brain or in the heart, that is pushed through the bloodstream and lodges in a narrower brain arteries. The blood supply is cut off from the brain due to the clogged vessel. Regarding haemorrhagic stroke, depending on the brain area affected by the haemorrhage, can be classified as intracerebral haemorrhage (ICH) or subarachnoid haemorrhage (SAH). ICH is characterized by bleeding into the brain parenchyma, and SAH is characterized by bleeding into the subarachnoid space. In both cases (ischemic or haemorrhagic stroke), stroke causes parts of the brain to stop functioning properly.

[0047] Ischaemic infarction may be caused by atheroma or thromboembolism and, more rarely, by trauma, infection or tumours. In ischemic stroke, the pathogenic stroke cascade includes two main phases. The first phase is characterized by acute injury and neuronal cell loss within minutes, hours, and days due to ischemia. The second phase includes neurodegenerative processes occurring days, weeks, and even months after the ischemic event. Haemorrhagic stroke is caused by either bleeding directly into the brain or into the space between the brain's membranes. Bleeding can be caused by brain aneurysms (abnormal bulging of a blood vessel wall in places where it's weaker than normal), brain tumours, may occur due to a ruptured brain aneurysm, blood-thinning medications, head injuries, or IS that had secondary bleeding. Bleeding can develop inside areas of ischemia, a condition known as "haemorrhagic transformation." It has also been reported that some cases of haemorrhagic stroke actually started as ischemic stroke.

[0048] Signs and symptoms of stroke may include an inability to move or feel on one side of the body, problems understanding or speaking, dizziness, or loss of vision to one side. Signs and symptoms often appear soon after the stroke has occurred. If symptoms last less than one or two hours, the stroke is a transient ischemic attack (TIA), also called a mini-stroke. Haemorrhagic stroke may also be associated with a severe headache. The symptoms of stroke can be permanent. Long-term complications may include pneumonia and loss of bladder control.

[0049] Diagnosis is typically based on a physical exam and supported by medical imaging such as a computer tomography (CT) scan or magnetic resonance imaging (MRI) scan. Said methods are also useful to determine how much time has lapsed since the stroke event took place.

[0050] Other tests such as an electrocardiogram (ECG) and blood tests are done to determine risk factors and rule out other possible causes. Low blood sugar may cause similar symptoms.

[0051] The current therapeutic options are still mainly limited to causal recanalization therapies, such as systemic thrombolysis and interventional thrombectomy in ischemic stroke, or blood pressure and blood clotting therapies. Non-limitative examples of such treatments of stroke patients include, depending on the type of stroke:

[0052] - Ischemic stroke: focused on removing obstruction and restoring blood flow to the brain, particularly to restore blood flow to the regions of brain that are ischemic but not yet infarcted: o Medicines: administration of thrombolytic agents such as tissue plasminogen activator (tPA), or biosynthetic forms of human tPA, such as altepase. TPA must be administered within a 4.5 hours window from the onset of symptoms to work optimally. Unfortunately, only 3- 5 percent of those who suffer a stroke reach the hospital in time to be considered for this treatment. This medication carries a risk for increased intracranial haemorrhage. Alteplase is is the most widely used thrombolytic agent that is manufactured by recombinant DNA technology (rTPA). Thrombolytic agents, can be administered through vein to perform intravenous thrombolysis (IVT), or using microcatheter-based surgical intervention to deliver them at the obstruction in the brain, to perform intraarterial thrombolysis (IAT). . o Surgical intervention: thrombectomy, which involves threading a catheter through a blood vessel, usually in the groin, and up to the blood clot.. It uses intraarterial mechanical devises (stent-retrievers) or aspiration devises to remove the clot and recanalize the occluded artery to allow blood to flow freely again. o Intravenous thrombolysis (IVT) and mechanical thrombectomy (MT): Treatment with IVT prior to MT, known as bridging therapy, is recommended for most patients who are candidates for both reperfusion therapies. Potential advantages of IVT before MT include complete or partial lysis of the thrombus causing the large vessel occlusion (the target of MT), lysis of thrombotic emboli in distal vessels beyond the reach of MT, and faster resolution of brain ischemia. Potential disadvantages of giving IVT first include a delay in the time to the start of the MT procedure, an increased risk of symptomatic brain haemorrhage, and partial lysis of the large vessel thrombus that allows it to travel to more distal vessels beyond the reach of MT.

[0053] - Haemorrhagic stroke: o Medicines: addressed to regulate blood pressure or blood clotting, and that are well-known by an expert in the field. Examples of blood pressure regulating medicaments include labetalol, or osmotic diuretics such as mannitol, to decrease intracranial pressure in the subarachnoid space.

[0054] Examples of blood clotting medicaments include vitamin K therapy, prothrombin or clotting factors well known by an expert in the field. o Surgery: In intracranial haemorrhages, sometimes it is necessary to drain the blood accumulated in order to reduce the increasing intracranial pressure and reduce the damage of the compression exerted. In subarachnoid haemorrhages, surgery is addressed to treat the aneurism such as "clipping” the aneurysm to isolate it from the normal bloodstream after a craniotomy (opening the skull surgically), or endovascular microcoil embolization, well-known by an expert in the field. Other non-limitative examples of surgical intervention are addressed to relieve increased intracranial pressure, such as craniectomy, in which part of the skull is removed and left off temporarily.

[0055] Rehabilitation programmes and physiotherapy are focused on the functional recovery of the patients. They are adapted to the severity of the symptoms and the capacity of the patient to endure harder or softer exercise plannings.

[0056] Neuroprotective drugs that had the potential of promoting the neuronal plasticity and improving the functional recovery could be provided in both cases, particularly if the patient is considered to have a bad outcome. However, neuroprotective therapies addressed to the preservation, recovery, and / or regeneration of the nervous system by interfering with the stroke event-triggering cascade are missing.

[0057] The term "stroke event” as used herein, refers to the event that directly triggers the cell death detected in the brain of a stroke patient, and thus, that triggers a part of the brain to lose function, or to completely lose function. Thus, the stroke event, as used herein, refers to the event that triggers the cascade of neurological damages occurring in a stroke patient. Thus, as used herein, the stroke event in an ischemic stroke patient (or ischemic event) corresponds to the process during which blood supply to the brain is interrupted (infarction event) and that triggers the cell death detected in the brain of the IS patient. This ischemic event, as indicated above, can be caused by several mechanisms, such as atheroma or thromboembolism and, more rarely, by trauma, infection, or tumours.

[0058] In haemorrhagic stroke patients, the stroke event as used herein refers to the process caused by a blood vessel rupture during which bleeding into the brain occurs and that triggers the cell death detected in the brain of the haemorrhagic stroke patient. The impairment caused by stroke ban be classified with the well-known National Institutes of Health Stroke Scale (NIHSS). The NIHSS is composed of 11 items, each of which scores a specific ability between a 0 and 4. For each item, a score of 0 typically indicates normal function in that specific ability, while a higher score is indicative of some level of impairment (details about each item and the scoring method can be found, for instance, in H.P. Adams Jr. et al., Baseline NIH Stroke Scale score strongly predicts outcome after stroke: A report of the Trial of Org 10172 in Acute Stroke Treatment (TOAST). Neurology July 1, 1999 vol. 53 no. 1 126). The individual scores from each item are summed in order to calculate a patient's total NIHSS score. The maximum possible NIHSS score is 42, with the minimum score being a 0.

[0059] The final NIHSS score obtained is used to classify degree of stroke severity suffered by a patient:

[0060] NIHSS score 0: No stroke symptoms

[0061] NIHSS score 1-4: Minor stroke

[0062] NIHSS score 5-15: Moderate stroke

[0063] NIHSS score 16-20: Moderate to severe stroke

[0064] NIHSS score 21-42: Severe stroke

[0065] The term "prognosis”, "determining the prognosis”, or "monitoring the prognosis”, as used herein, relates to the prediction of a medical outcome, for example, a poor or good outcome (e.g. likelihood of long-term survival, overall survival, disease-specific survival, progression-free survival or disease-free survival). A "negative prognosis", or "bad prognosis", or "poor outcome", includes a prediction of moderate to severe disability, prediction of relapse, or mortality. A "positive prognosis", or "good prognosis", or "good outcome", includes stabilization of the disease, or no residual symptoms of stroke to slight disability. Outcome of stroke patients can be defined with the Modified Ranking Score (mRS), the most widely used outcome measure in stroke clinical trials. The term "Modified Rankin Score” or "mRS” refers to a 6 point disability scale with possible scores ranging from 0 to 5. A separate category of 6 is usually added for patients who expire. Standardized interviews to obtain an mRS score are recommended at 3 months (90 days) following hospital discharge.

[0066] The following numbers are assigned to stroke patients depending on their outcome at about 3 months after the stroke event occurred, on the mRS system:

[0067] - 0: The patient has no residual symptoms.

[0068] - 1 : The patient has no significant disability; able to carry out all pre-stroke activities.

[0069] - 2: The patient has slight disability; unable to carry out all pre-stroke activities but able to look after self without daily help.

[0070] - 3: The patient has moderate disability; requiring some external help but able to walk without the assistance of another individual.

[0071] - 4: The patient has moderately severe disability; unable to walk or attend to bodily functions without assistance of another individual.

[0072] 5: The patient has severe disability; bedridden, incontinent, requires continuous care. 6: The patient has expired (during the hospital stay or after discharge from the hospital).

[0073] As it will be understood by those skilled in the art, the prediction, although preferred to be, need not to be correct for 100% of the subjects to be evaluated. However, the term requires that a statistically significant part of the subjects can be identified as having an increased probability of having a given outcome. The person skilled in the art can easily determine if a part is statistically significant using several well-known statistical evaluation tools, for example, determination of confidence intervals, determination of p values, Student's t-test, Mann- Whitney test, etc. The details are found in Dowdy and Wearden, Statistics for Research, John Wiley and Sons, New York 2004. The preferred confidence intervals are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99%. The p values are preferably 0.1 , 0.05, 0.01 , 0.005 or 0.0001. More preferably, at least 60%, at least 70%, at least 80% or at least 90% of the subjects of a population can be suitably identified by the method of the present invention. Any parameter which is widely accepted for determining prognosis of a patient can be used in the present invention including, without limitation, an increased disability level than that observed at hospitalization (bad prognosis), a decreased or stabilization of the disability level as compared to that observed at hospitalization due to the stroke event (good prognosis), and preferably includes the use of mRS, more preferably, wherein levels 0-2 are assigned to good prognosis, and levels 3-6 are assigned to bad prognosis.

[0074] The term "patient” or "subject”, as used herein, refers to any subject, particularly a mammalian subject of any sex, that has suffered a stroke event. Mammalian subjects, include males orfemales, humans, domestic animals, farm animals, and zoo, sports, or pet animals such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, cows, and so on. In a particular embodiment of the invention, the subject is a mammal. In a more particular embodiment of the invention, the subject is human. Particularly, the human as referred herein is of any age, sex or ethnicity. In another particular embodiment, the patient is an elder age human, particularly, older than 50, 55, 60, 65, 70, 75, or 80, particularly older than 70, more particularly older than 75. In another particular embodiment, the patient as defined in the embodiments herein is a male or a female, particularly a male.

[0075] As indicated in the examples, the experimental data was obtained from samples from a multicentric Spanish cohort, making the findings more applicable to Caucasian populations than previous studies mainly performed with Asian populations. On this regard, some studies have described differences in miRNA expression between Asian and Caucasian populations (Jaegil Kim et al. " Racial Differences in Expression Levels of miRNA Machinery-Related Genes, Dicer, Drosha, DGCR8, and AGO2, in Asian Korean Papillary Thyroid Carcinoma and Comparative Validation Using the Cancer Genome Atlas" , International Journal of Genomics, 2017; Xianglin Yang et al., “Association of miR-27a polymorphism with the risk of digestive system cancers", Pathol Res Pract, 216(10): 153115, 2020). Thus, in a particular embodiment, the patient referred in the different aspects of the invention is a Caucasian human subject, particularly a European or European American human subject. In a particular embodiment, the patient referred in the aspects of the invention is a non-Asian human subject.

[0076] The term "Caucasian” or "Caucasian subject”, as used herein, refers to the term commonly known by an expert in the field, in particular to a human subject with a physical complexation commonly associated to human beings native to Europe.

[0077] The term "European” or "European subject”, as used herein, refers to the term commonly known by an expert in the field, in particular to a human subject native to Europe or with most of ancestors native to Europe. The term "European American”, as used herein, refers to the term commonly known by an expert in the field, in particular to a human subject native to America with most of ancestors native to Europe subjects. The physical complexation a European subject or a European American subject, as well understood by a skilled person, is generally one commonly associated to human beings native to Europe.

[0078] The term "Asian” or "Asian subject”, as used herein refers to the term commonly known by an expert in the field, particularly a subject with most ancestors native to a country of Asia, particularly of East Asia, such as China, Korea or Japan. The physical complexation of an Asian subject, as well understood skilled person, is generally one commonly associated to human beings native to East Asia, in particular to China, Korea or Japan. In a particular embodiment, the Asian subject is a subject native to China, Kore or Japan.

[0079] The term "ischemic stroke patient”, or "ischemic patient”, as used herein, refers to a stroke patient as defined above, that has suffered ischemic stroke. The term "haemorrhagic stroke patient”, as used herein, refers to a stroke patient as defined above, that has suffered haemorrhagic stroke.

[0080] The term "sample”, as used herein, refers to biological material isolated from a subject. The sample can derive from or correspond to a representative amount of any fluid or tissue of the subject. In a particular embodiment, the sample is isolated from any suitable biological fluid of the subject as defined herein, including blood, blood plasma, serum, urine, cerebral spinal fluid (CSF), saliva, sputum, deposition, tears, mucus and sweat. In a more particular embodiment, the sample is isolated from blood of the subject as defined herein. The blood sample can be whole blood, plasma or serum, particularly is plasma. Thus, in a particular embodiment of the invention, the isolated sample used in the methods of the invention is a fluid biological sample. In a more particular embodiment, the isolated sample used in the methods of the invention is a blood sample, a plasma sample, or a serum sample, more particularly, a plasma sample. The sample comprises cell and / or non-cell material of the patient, particularly non-cell material. In the present invention, the sample comprises genetic material, e.g., RNA, circulating RNA, miRNA, circulating miRNA, heterogeneous nuclear RNA (hnRNA), mRNA, DNA, genomic DNA (gDNA), complementary DNA (cDNA) etc., from the patient under study. In a particular embodiment, the genetic material is RNA, more particularly miRNA, yet more particularly, circulating miRNA. In a more particular embodiment, the sample comprises RNA, particularly miRNA, yet more particularly circulating miRNA, but does not comprise DNA. Methods for obtaining samples from a subject, including blood, plasma or serum samples, are well known to those skilled in the art. The term "test sample”, as used herein, refers to the isolated sample, as defined herein, from the patient being analysed in the methods of the invention, and used in step (i) of the methods. The term "control sample”, as used herein, refers to an isolated sample, as defined herein, obtained from the control subject or group of control subjects as referred in the definition of "reference value”.

[0081] In an embodiment, the sample analysed in step (i) of the methods of the invention is isolated from the patient within the 0.5, 1 , 2, 3, 4, 5, 6, 7,8, 9, 10, 12, 18, 20, 22, 24, 28, 30, 36, 40, 42, 45, 48 hours following the stroke event, particularly within the 24 hours following the stroke event. In a particular embodiment, the sample analysed in step (i) of the methods of the invention is isolated from the patient in the 0-48 h, 0-36h, 0-24h, 0-18h, 0-12h, 0-8h, 0-4, 0-3h, 0-2h, 0-1 h following the stroke event, particularly in the 0-24h following the stroke event. In another particular embodiment, the sample analysed in step (i) of the methods of the invention is / are isolated at 0, 1 , 2, 3, 4, 5, 6, 7,8, 9, 10, 12, 18, 20, 22, 24, 28, 30, 36, 40, 42, 45, 48 hours following the stroke event. In another particular embodiment, the sample analysed in step (i) of the methods of the invention is isolated from the patient within the 1 , 2, 3, 4, 5, 6, 7,8, 9, 10, 12, 18, 20, 22, 24, 28, 30, 36, 40, 42, 45, 48 hours, particularly within the 24 hours, following the first visible symptoms of stroke. In a particular embodiment, the sample analysed in step (i) of the methods of the invention is isolated from the patient in the 0-48 h, 0-36h, 0-24h, 0-18h, 0-12h, 0-8h, 0-4, 0-3h, 0-2h, 0-1 h following the first visible symptoms of stroke, particularly in the 0-24h following the first visible symptoms of stroke. In another particular embodiment, the sample analysed in step (i) of the methods of the invention is / are isolated at 0, 1 , 2, 3, 4, 5, 6, 7,8, 9, 10, 12, 18, 20, 22, 24, 28, 30, 36, 40, 42, 45, 48 hours, particularly at 24 hours, following the first visible symptoms of stroke.

[0082] The terms "miRNA" or "microRNA", used interchangeably herein, are endogenous RNAs, some of which are known to regulate the expression of protein-coding genes at the post-transcriptional level. As used herein, the term "miRNA" refers to any type of micro-interfering RNA, including but not limited to, endogenous microRNA and artificial microRNA. Typically, endogenous miRNAs are small RNAs encoded in the genome which are capable of modulating the productive utilization of mRNA. A mature miRNA is a single-stranded RNA molecule of about 21-23 nucleotides in length which is complementary to a target sequence and hybridizes to the target RNA sequence to inhibit its function, particularly its translation. miRNAs themselves are encoded by genes that are transcribed from DNA but not translated into protein (non-coding RNA); instead they are processed from primary transcripts known as pri-miRNA to short stemloop structures called pre-miRNA and finally to functional miRNA. Mature miRNA molecules are partially complementary to one or more messenger RNA (mRNA) molecules (herein referred as the target mRNA(s) of a miRNA), which triggers the gene expression down-regulation of their target mRNA(s), particularly translation inhibition of their target mRNA(s). Besides their intracellular function, miRNAs can be exported or released by cells into the circulating blood in very stable forms. The term "circulating miRNA" or "C-RNA”, as used herein, also known as "cell-free miRNA" or "cf-RNA, relates to extracellular miRNA that circulates in the bloodstream. Pre-miRNAs are referred to as "mir", whereas mature miRNAs are referred to as "miR". This prefix is followed by a dash and a number, the latter often indicating order of naming. miRNAs with nearly identical sequences except for one or two nucleotides are annotated with an additional lower-case letter. Pre-miRNAs that lead to 100% identical mature miRNAs but that are located at different places in the genome are indicated with an additional dash-number suffix. Species of origin is designated with a three-letter prefix. Some "mir" can have two mature products. For example, hsa-mir-199a has two mature products, named hsa-miR-199a-5p and hsa-miR-199a-3p. The mature product annotated with 5p arises from the 5 ' arm of the mir-199a hairpin precursor, and the mature product annotated with 3p arises from the 3 'arm of the mir- 199a hairpin precursor. As indicated in the definition of miR-199a below, two miRNA precursors have been identified in the human genome, mir-199a- 1 and mir-199a-2, which lead to 100% identical mature miRNAs. Thus, when referring to the mir-199a precursor, as used herein, particularly in the context of miRNA precursors from human origin, it is intended to refer to the has-mir-199a-1 precursor or to the has-mir-199a- 2 precursor. In a particular embodiment, the terms “mir-199a-1” and "mir-199a-2” used herein are interchangeable.

[0083] In the context of the present invention, miR-199a refers to the mature products of its mir-199a precursor, particularly to miR-199a-5p and / or miR-199a-3p. In a particular embodiment, miR-199a as used herein, refers to the mir-199a mature product miR-199a-5p or miR-199a-3p. In another particular embodiment, miR- 199a, as used herein, refers to the mir-199a products miR-199a-5p and miR-199a-3p. In another particular embodiment, miR-199a, as used herein, refers to the mir-199a product miR-199a-5p. In a more particular embodiment, miR-199a as used herein, refers to the mir-199a mature product miR-199a-3p. Regarding miR- 4463, the mature product from the mir-4463 precursor commonly known is that arising from the 3' arm. Thus, the term miR-4463 as used herein, refers to the miRNA mature product from the 3' arm of the mir-4463 precursor.

[0084] The term "miR-376c-3p”, as used herein, refers to the mature microRNA from the 3'-end arm of the "hsa- mir-376c” which has a sequence with accession number NR_029861.1 in the National Center for Biotechnology Information (NCBI) database as of October 14, 2023. In a particular embodiment, the term "miR-376c-3p” refers to the miRNA that has SEQ ID NO. 7.

[0085] The term "miR-199a”, as used herein, refers to the mature microRNA products from the "hsa-mir-199a” precursor. As indicated above, two hsa-miR-199a precursors have been identified in the human genome, miR-199a-1 and miR-199a-2, giving rise to 100% identical mature products: mir-199a-5p and / or miR-199- 3p. Thus, "miR-199a” as used herein, refers to the mature microRNA products from the “hsa-miR-199a-1” or "hsa-miR-199a-2”. In a particular embodiment, "miR-199a” refers to the mature microRNA products from the “hsa-miR-199a-1”, which has a sequence with accession number NR_029586.1 in the NCBI database as of January 15, 2024. In another particular embodiment, "miR-199a” as used herein, refers to the mature microRNA products from the "hsa-miR-199a-2”, which has a sequence with accession number NR_029618.1 in the NCBI database as of January 15, 2024. Thus, in a particular embodiment the term "miR-199a-5p” as used herein, refers to the mature product from the 5'-arm of has-mir-199a-1 or hsa-miR-199a-2 as defined herein, and has SEQ ID NO. 10. In another particular embodiment, the term "miR-199a-3p”, as used herein, refers to the mature product from the 3'- arm of has-mir-199a-1 or has-miR-199a-2 as defined herein, and has SEQ ID NO. 9.

[0086] The term "miR134-5p”, as used herein, refers to the mature microRNA from the 5'-end arm of the "hsa-mir- 134” which has a sequence with accession number NR_029698.1 in the NCBI database as of January 1 , 2024. Thus, in a particular embodiment, the term "miR-134-5p” refers to the miRNA that has SEQ ID NO. 8.

[0087] The term "miR-4463”, as used herein, refers to the mature microRNA obtained from the 3'-end arm of the "has-mir-4463” which has a sequence with accession number NR_039670.1 in the NCBI database as of July 3, 2022. Thus, in a particular embodiment , the term "miR-4463” as used herein, refers to the miRNA that has SEQ ID NO. 11.

[0088] The term "miR-584-5p”, as used herein, refers to the mature microRNA from the 5' -end arm of the "has-mir- 584” which has a nucleotide sequence with accession number NR_030310.1 in the NCBI database as of December 25, 2023. Thus, in a particular embodiment, the term "miR-584-5p” as used herein, refers to the miRNA that has SEQ ID NO. 12.

[0089] The term "expression level”, or "gene expression level”, as used herein, refers to the measurement of the amount of a nucleic acid, e.g. RNA, miRNA or mRNA, or of a protein in a particular sample or body fluid. In the context of the invention, the level of expression relates to the measurement of the amount of a nucleic acid, particularly RNA, more particularly miRNA, even more particularly of miR-376c-3p, miR-199a, miR134- 5p, miR-4463, and / or miR-584-5p. As well understood by a skilled person, in the context of the present invention, said expression level is measured or determined in an isolated sample as defined herein, from the subject under study.

[0090] Methods to determine or measure the expression level of an RNA, mRNA or miRNA in a sample are well known by an expert in the field. Non-limitative examples of such methods include gene expression analysis technology that measure RNA in solution, such as quantitative reverse transcription polymerase chain reaction (RT-qPCR), RNAscope™, Nanostring®, QuantiGene®, gNPA®, microarray, Next Generation Sequenceing (NGS) techniques, or RNA sequence (RNA-seq). Particular methods to perform RT-qPCR and NGS are well-known by an expert in the field and include those described in the examples below. Methods to perform RNA sequencing are also well-known by an expert in the field and include, for instance, using a Lexogen CORALL RNA-Seq Library Prep Kit to obtain libraries that are then sequenced (for instance with the Illumina® NovAseq sequencer). The sequencing data obtained can then be analysed with known bioinformatic tools, such as those described in the examples below, to obtain the expression level of the miRNAs of interest. Thus, in a particular embodiment, miRNA expression levels are determined in the methods of the invention by RT-qPCR, RT-PCR, Next Generation Sequencing (NGS) techniques or RNA sequencing, particularly by RT-qPCR of NGS. In another embodiment, gene expression levels are determined using an RNAscope™, Nanostring®, QuantiGene®, gNPA®, or a microarray technique. In the present invention, the term "reference value” or "reference level”, as used herein in any of the methods of the invention, is to be understood as a value used as a reference for the expression level value / data of the miRNA, or for each miRNA, determined in step (i) of the methods of the invention. In a preferred embodiment, when the expression level of several miRNAs is determined in step (i) of the methods of the invention, a reference value is independently provided for each of said miRNAs. The reference value or reference level according to the any of the methods of the invention can be an absolute value; a relative value; a value that has an upper and / or lower limit; a range of values; an average value; a median value, a mean value, or a value as compared to a particular control or baseline value. A reference value can be based on an individual sample value, such as for example, a value obtained from one or several samples from the subject being tested, but at an earlier time point. The reference value can be based on a large number of samples, such as from a control subject or a population of subjects, also referred to as control group or control subjects, formed by subjects of chronological age matched group, or based on a pool of samples including or excluding the sample to be tested. Various considerations are taken into account when determining the reference value of the marker miRNA. Among such considerations are the age, weight, sex, general physical condition of the patient and the like. For example, the control group is formed by at least 2, at least 10, at least 50, at least 100, at least 150, at least 200, at least 500, to preferably more than 1000 subjects, particularly classified according to the foregoing considerations, for example according to various age categories.

[0091] In a particular embodiment, the group of control subjects is a group of healthy subjects, particularly of subjects that have not suffered stroke. In another particular embodiment, the control subjects is a group of subjects that have suffered stroke before performing the methods of the invention and that shown a good outcome at least at 3-6 months, particularly at least at 3 months, after they suffered the stroke event and before performing the method. In a more particular embodiment, the group of control subjects as defined above is of the same range of age or sex, particularly of the same age and sex, as the patient being analysed with the methods of the invention. In another particular embodiment, the control subject is a healthy subject. In another embodiment, the control subject is a subject that has not suffered stroke. In another particular embodiment, the control subject is a subject that has suffered stroke before performing the methods of the invention and that has shown a good outcome at least at 3-6 months, particularly at least at 3 months, after they suffered the stroke event and before performing the method. In a more particular embodiment, the control subject is a subject of the same range of age or sex, particularly of the same age and sex, as the patient being analysed with the methods of the invention. In a particular embodiment, the control subject is the patient being analysed in the methods of the invention, but at an earlier time point, particularly, at a time point before the subject suffered the stroke event. In a particular embodiment, the sample / s used to determine the reference value, referred herein as control samples, is the same sample type as that used in step (i) of the methods of the invention. As well understood by a skilled person, the units of the corresponding reference level are preferably the same as the units of the expression level(s) determined in step (i) of the methods of the invention. For instance, in case the expression level is provided in number of counts, the reference value is also provided in number of counts. Methods for obtaining the reference value from the group of subjects selected are well-known in the state of the art (Burtis C. A. et al., 2008, Chapter 14, section "Statistical Treatment of Reference Values”).

[0092] In a particular embodiment, the "reference value” is a cut-off value defined by means of a conventional ROC analysis. As the skilled person will appreciate, optimal cut-off value will be defined according to the particular applications of the method: purpose, target population of the method being performed, balance between specificity and sensibility, etc.

[0093] The term "higher than a corresponding reference value”, as used herein in the context of the expression level of a miRNA, refers to a situation in which the level of expression of said miRNA is increased at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 120%, at least 130%, at least 150%, at least 170%, at least 180%, at least 190%, at least 200%, at least 250%, at least 300%, at least 350%, at least 400%, at least 500%, with respect to the corresponding reference value. In a particular embodiment, "higher than a corresponding reference value” in the context of the expression level of a miRNA refers to a situation in which the level of expression of said miRNA is at least 1.05, at least 1.1 , at least 1.15, at least 1.2, at least 1 .25, at least 1 .3, at least 1 .4, at least 1.5, at least 1 .55, at least 1 .6, at least 1 .7, at least 1.8, at least 1 .9, at least 2, at least 2.1 -Definitions, at least 2.2, at least 2.3, at least 2.4, at least 2.5, at least 2.7, at least 2.8, at least 2.85, at least 2.9, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 10 times higher, particularly at least 1.2 times higher, more particularly at least 1.5 times higher, than the corresponding reference value. Methods to determine if the expression level of a miRNA is higher or lower than a reference value are well known by an expert in the field and include determining the expression level of said miRNA with any of the methods provided above in the definition of the term "expression level”, and comparing it with that of a reference value, determined with any of the methods provided above in the definition of "reference value”.

[0094] The terms "medical regimen” and "therapeutic intervention” are interchangeable and refer herein to intervene or administer to the subject with medicines or with any therapeutical intervention including surgery, to try to relieve, reduce or alleviate at least one symptom of a disease in the subject. For example, in relation to stroke, these terms include administering medicines to the subject or performing surgery for the treatment of stroke physiological and / or psychological consequences. Non-limitative examples of such treatments have been provided above in the definition of stroke, for IS and haemorrhagic stroke separately. These terms also encompass preventive treatments, to try to delay or prevent the onset prior to clinical manifestation or the appearance of symptoms of stroke, and / or reducing the risk of developing or worsening the neurological damage caused by the stroke event. In a particular embodiment, the medical regimen comprises the administration of the inhibitor of the fourth aspect, the combination of miRNA inhibitors of the fifth aspect, or the pharmaceutical composition of the sixth aspect. In another embodiment, the medical regimen includes any known neuroprotective drug, as those disclosed in the second aspect of the invention.

[0095] In an embodiment, the therapeutic intervention, as used herein, is for the treatment or prevention of stroke, particularly for the treatment or prevention of the neurological damage caused by the stroke event. In a particular embodiment, the therapeutic intervention for the treatment or prevention of the neurological damage caused by the stroke event comprises or consists of the administration of the inhibitor of the fourth aspect, the combination of miRNA inhibitors of the fifth aspect, or the pharmaceutical composition of the sixth aspect.

[0096] In another particular embodiment, the stroke event is haemorrhagic stroke event, and thus the therapeutic intervention or treatment is for the treatment or prevention of haemorrhagic stroke, particularly for the treatment or prevention of the neurological damage caused by the haemorrhagic stroke event, more particularly comprises or consists of the administration of the inhibitor of the fourth aspect, the combination of miRNA inhibitors of the fifth aspect, or the pharmaceutical composition of the sixth aspect. Non-limitative examples of known treatments of haemorrhagic stroke have been provided above in the definition of stroke.

[0097] In a more particular embodiment, the stroke event is an ischemic stroke event, and thus the therapeutic intervention or treatment is for the treatment or prevention of ischemic stroke, particularly for the treatment of prevention of the neurological damage caused by the ischemic stroke event, more particularly comprises or consists of the administration of the inhibitor of the fourth aspect, the combination of miRNA inhibitors of the fifth aspect, or the pharmaceutical composition of the sixth aspect. Non-limitative examples of known treatments of IS have been provided above in the definition of stroke.

[0098] The term "initiate a medical regimen”, "to initiate a therapeutic intervention” or to "start a medical regimen”, as used herein, thus refers to the start of the administration of the medical regimen or therapeutic intervention to a patient. In a particular embodiment, the medical regimen or therapeutic intervention is any of those provided above in the definition of "medical regimen”.

[0099] The term "determining the response of a patient (...) to a medical regimen”, as used herein, refers to determining if a patient already diagnosed with stroke and that has received a therapeutic intervention or medical regimen for the treatment of stroke reacts favourably to the therapeutic intervention, or has a good response to the therapeutic intervention or medical regimen. As well understood by a skilled person, a therapy effective in the treatment of stroke can relieve, reduce or alleviate the symptoms, particularly at least one symptom, more particularly at least one symptom of interest of the disease in the patient. A therapy that is not effective in the treatment of stroke does not relieve, reduce, or alleviate the symptoms, particularly at least one symptom, more particularly at least one symptom of interest of the disease in the patient. In a particular embodiment, "a symptom of interest”, as used herein, refers to neurological damage, neurological impairment, an mRS equal or higher than 2, an mRS equal or higher than 3, or an NIHSS value of at least 2. In a more particular embodiment, a symptom of interest as used herein, refers to an NIHSS value of at at least 1 , least 2, at least 4, at least 5, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 15, at least 16, at least 18, at least 20, at least 21, at least 25, at least 30, at least 35, at least 40, at least 41, or of 42, particularly of at least 9. In a more particular embodiment, a symptom of interest as used herein, refers to an NIHSS value of about 1 , 2, 4, 5, 8, 9, 10, 11 , 12, 15, 16, 18, 20, 21 , 25, 30, 35, 40, 41 , or 42, particularly of about 9. In another embodiment, the symptom of interest as used herein refers to an NIHSS value comprised in the range of 1-4, 2-4, 5-15, 16-20 or 21-42, particularly of about 5-15. In a particular embodiment, an effective therapy addressed to the treatment of stroke, as defined herein, comprises reducing the NIHSS value of the patient in about 1 , 2, 3, 4, 5, 6, 7, 10, 12, 15, 20, 30 or even 40 NHSS values. In another particular embodiment, it comprises reducing the NIHSS level of the patient before starting the medical regimen, to at least one, two or three, particularly at least one, stroke severity degrees. The term "good response to a medical regimen”, or "good response to a therapeutic intervention”, as used herein, refers to the fact that the patient shows reduced intensity of all or some of the symptoms associated to the stroke condition at a time point after receiving the medical regimen or therapeutic intervention, as compared to the start of the medical regimen, or to an earlier phase of the medical regimen. Particularly, the symptom or symptoms showing a reduced intensity as herein indicated, are selected from those indicated above as "a symptom of interest”. As well understood by a skilled, in the context of a symptom of interest characterised by a particular NIHSS value or range of values, a good response to a medical regimen refers to a situation in which the administration of said medical regimen results in a reduction of the corresponding NIHSS value or range of values. Said reduction can be of about 1 , 2, 3, 4, 5, 6, 7, 10, 12, 15, 20, 30 or even 40 NIHSS values. In another particular embodiment, said reduction comprises reducing the NIHSS level, (or the stroke severity degree as indicated in the definition of NIHSS above), to an NIHSS level assigned to a stroke severity degree (or to a stroke severity degree), at least one, at least two at least three, at least four, at least five, particularly at least one, level below.

[0100] The term "start of the medical regimen”, as used herein, refers to the moment at which a medical regimen for the treatment of stroke has started, and thus the moment at which the first dose of a medication, or the moment at which a medical intervention such as surgery for the treatment of stroke is performed in a patient.

[0101] The term "at an earlier stage of the medical regimen”, as used herein, refers to any time between the start of a medical regimen as defined above, and the time at which the method of the third aspect of the invention is performed.

[0102] 1.2 Method for determining the prognosis of a patient with stroke

[0103] In a first aspect, the invention is addressed to an in vitro method for determining the prognosis of a patient with stroke comprising:

[0104] (i) determining, in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a and combinations thereof,

[0105] (ii) comparing the level of expression obtained in step (i) with a corresponding reference value, wherein if the expression level determined in step (i) is higher than the corresponding reference value, the patient is considered to have a bad prognosis.

[0106] In an embodiment of the first aspect of the invention, stroke is haemorrhagic stroke. As well understood by a skilled person, the patient being analysed in the first aspect of the invention is thus a haemorrhagic stroke patient. In a particular embodiment, haemorrhagic stroke is a "haemorrhagic transformation. In another particular embodiment, haemorrhagic stroke is intracerebral haemorrhage (ICH) or subarachnoid haemorrhage (SAH). In a more particular embodiment of the first aspect of the invention, stroke is ischemic stroke (IS). As well understood by a skilled person, the patient being analysed in the first aspect of the invention is thus an ischemic stroke patient. In another more particular embodiment, IS is thrombotic IS or embolic IS. In another embodiment, the patient being analysed in the first aspect of the invention is a patient diagnosed with stroke, particularly by any of the methods provided in the definition of stroke provided above, particularly by CT or MRI.

[0107] In another embodiment, the patient being analysed in the first aspect of the invention is a stroke patient with an NIHSS score of 1-4, 2-4, 5-15, 16-20 or 21-42, particularly of 5-15. IN another embodiment, patient being analysed in the first aspect of the invention is a stroke patient with an NIHSS score of at at least 1 , least 2, at least 4, at least 5, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 15, at least 16, at least 18, at least 20, at least 21 , at least 25, at least 30, at least 35, at least 40, at least 41 , or of 42, particularly of at least 9. In a more particular embodiment, the patient being analysed has an NIHSS value of about 1 , 2, 4, 5, 8, 9, 10, 11 , 12, 15, 16, 18, 20, 21 , 25, 30, 35, 40, 41 , or 42, particularly of about 9. In another embodiment, the patient being analysed has an NIHSS value comprised in the range of 1-4, 2-4, 5-15, 16- 20 or 21-42, particularly of about 5-15. In a particular embodiment, the patient being analyzed in the first aspect of the invention has an NIHSS score, particularly selected from the NIHSS scores referred in the embodiments of the present paragraph, determined at h, h, 2h, 4h, 5h, 6h, 8h, 10h, 12h, 20h, 24h, 30h, 36h, 48h after the stroke event, particularly at 24h after the stroke event. In a particular embodiment, the NIHSS scores referred in the embodiments of the present paragraph were determined at the moment of performing the method of the first aspect. The term "at the moment of performing the method of the first aspect”, as used herein, refers to a moment between 3 hours before and 3 hours after performing the method of the first aspect of the invention, particularly, to a moment between 1 hour before and 1 hour after performing the method of the first aspect of the invention, more particularly between 0.5 hour before and 0.5 hour after performing the method of the first aspect is performed.

[0108] In another embodiment, the patient being analysed in the first aspect of the invention had functional independence before the stroke event, particularly had an mRS lower than 2, particularly lower than 3 before the stroke event.

[0109] In another embodiment, the patient being analysed in the first aspect of the invention has not suffered of confounding illness such as neoplasm, demyelinating and autoimmune diseases, or vasculitis before performing the method of the first aspect.

[0110] In a more particular embodiment, the patient being analysed in the first aspect of the invention has been diagnosed with stroke, particularly by any of the methods provided in the definition of stroke above, more particularly by CT or MRI, has an NIHSS score of at least 2, particularly of about 9, wherein the NIHSS score value has been determined at 3-4h, particularly at 24 h, after the stroke event, and had an mRS value lower than 2, particularly lower than 3 before the stroke event.

[0111] In a more particular embodiment, the stroke event suffered by the patient analysed in the first aspect of the invention occurred in a region of the brain different from the cerebellar and brainstem location. In another particular embodiment, the stroke event suffered by the patient analysed in the first aspect of the invention is not a lacunar stroke. Lacunar stroke, or lacunar cerebral infarct (LACI), as well known by an expert in the field, refers to ischemic stroke resulting from the occlusion of small penetrating arteries that provide blood to the brain's deep structures. In a particular embodiment, the patient being analysed in the first aspect of the invention has been diagnosed to have suffered stroke 0.5h, 1 h, 2h, 3h, 4h, 6h, 12h, 15h, 20h, 24h, 36h, 48h, 72h, 5 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 6 months, particularly 24h before performing the method of the first aspect.

[0112] In another embodiment of the first aspect of the invention, the patient being analysed in the method of the first aspect has only been diagnosed with stroke once, particularly in his / her entire life, more particularly within the 6 months, 2 months, 1 month, 3 weeks, 2 weeks, 1 week, 5 days, 72h, 48h, 24h, 12h, 6h, 4h, 3h, 2h, 1 h before performing the method of the first aspect. In a particular embodiment, the stroke patient being analysed in the first aspect of the invention is a recidivist stroke patient. In a particular embodiment, in case the patient being analysed in the method of the first aspect has suffered several stroke events, the term "stroke event”, as used all along the present disclosure, refers to the last stroke event that the patient has suffered or has been diagnosed to have suffered before performing the method of the first aspect.

[0113] In another embodiment of the first aspect, step (i) of the method is performed with an isolated blood sample particularly an isolated plasma sample of the patient.

[0114] In another embodiment, step (i) of the method of the first aspect comprises or consists of determining the expression level of miR-376c-3p in the sample. In another embodiment, step (i) of the method of the first aspect comprises or consists of determining in the sample, the expression level of miR-199a-3p or miR- 199a-5p, more particularly of miR-199a-3p. In another embodiment, step (i) of the method of the first aspect comprises or consists of determining in the sample, the expression level of miR-199a, particularly miR- 199a-3p and miR-199a-5p. In a more particular embodiment, step (i) of the method of the first aspect comprises or consists of determining in the sample, the expression level of miR-376c-3p and miR-199a, particularly of miR-376c-3p and miR-199a-3p or of miR-376c-3p and miR-199a-5p, more particularly of miR- 376c-3p, miR-199a-3p and miR-199a-5p, even yet more particularly of miR-376c-3p and miR-199a-3p.

[0115] In another particular embodiment, step (i) of the method of the first aspect comprises or consists of determining in the sample, the expression level of any of the miRNAs referred in the paragraph above, and of least one miRNA selected from the listed consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof.

[0116] In a particular embodiment, step (i) of the method of the first aspect comprises or consists of determining the expression level of miR-376c-3p and of at least one miRNA selected from the list consisting of miR134- 5p, miR-4463 and miR-584-5p. In another particular embodiment, step (i) of the method of the first aspect comprises or consists of determining the expression level of miR-376c-3p and of one miRNA selected from the list consisting of miR134-5p, miR-4463 and miR-584-5p. In another particular embodiment, step (i) of the method of the first aspect comprises or consists of determining the expression level of miR-376c-3p and of two miRNAs selected from the list consisting of miR134-5p, miR-4463 and miR-584-5p. In another particular embodiment, step (i) of the method of the first aspect comprises or consists of determining the expression level of miR-376c-3p and of miR134-5p, miR-4463 and miR-584-5p.

[0117] In another particular embodiment, step (i) of the method of the first aspect comprises or consists of determining the expression level of miR-199a, particularly miR-199a-3p or miR-199a-5p, and of at least one miRNA selected from the list consisting of miR134-5p, miR-4463 and miR-584-5p. In another particular embodiment, step (i) of the method of the first aspect comprises or consists of determining the expression level of miR-199a, particularly of miR-199a-3p or miR-199a-5p, and of one miRNA selected from the list consisting of miR134-5p, miR-4463 and miR-584-5p. In another particular embodiment, step (i) of the method of the first aspect comprises or consists of determining the expression level of miR-199a, particularly miR-199a-3p or miR-199a-5p, and of two miRNAs selected from the list consisting of miR134-5p, miR-4463 and miR-584-5p. In another particular embodiment, step (i) of the method of the first aspect comprises or consists of determining the expression level of miR-199a, particularly miR-199a-3p or miR-199a-5p, and of miR134-5p, miR-4463 and miR-584-5p.

[0118] In a more particular embodiment, step (i) of the method of the first aspect comprises or consists of determining the expression level of miR-376c-3p, miR-199a, particularly miR-199a-3p or miR-199a-5p, and of at least one miRNA selected from the list consisting of miR134-5p, miR-4463 and miR-584-5p. In another particular embodiment, step (i) of the method of the first aspect comprises or consists of determining the expression level of miR-376c-3p, miR-199a, particularly miR-199a-3p or miR-199a-5p, and of one miRNA selected from the list consisting of miR134-5p, miR-4463 and miR-584-5p. In another particular embodiment, step (i) of the method of the first aspect comprises or consists of determining the expression level of miR-376c-3p, miR-199a, particularly miR-199a-3p or miR-199a-5p, and of two miRNAs selected from the list consisting of miR134-5p, miR-4463 and miR-584-5p. In another particular embodiment, step (i) of the method of the first aspect comprises or consists of determining the expression level of miR-376c-3p, miR-199a, particularly miR-199a-3p or miR-199a-5p, and of miR134-5p, miR-4463 and miR-584-5p.

[0119] In a particular embodiment, the expression level of the miRNA(s) determined in step (i) of the method of the first aspect is determined by NGS. In other particular embodiments, the expression level of the miRNA(s) determined in step (i) of the methods of the invention is determined by RT-qPCR.

[0120] In order to normalize the expression levels of a miRNA among different samples, it is possible to compare the expression levels of the miRNA of interest in the test samples with the expression of a reference RNA.

[0121] In an embodiment, the expression level determined in step (i) of the method of the first aspect is normalized by expression level of a reference RNA or a set of reference RNAs. In a particular embodiment, the reference RNA is a housekeeping gene, a spike control or a control RNA as defined above. In another particular embodiment, the set of reference RNAs is selected from the list consisting of housekeeping genes, spike-in controls, control RNAs, or combinations thereof. In an embodiment, the housekeeping gene is selected from the list consisting of hsa-miR-16-5p, hsa-miR-93-5p, , hsa-miR-191-5p and combinations thereof, particularly is hsa-miR-16-5p. In another embodiment, the spike-in control is selected from the list consisting of ath-miR159a, cel-miR-54-3p, cel-miR-39-3p, cel-miR-238-3p, and combinations thereof.. In a particular embodiment, the spike-in controls used for the normalization of the expression level in step (i) of the method of the first aspect are ath-miR159a, cel-miR-54-3p, cel-miR-39-3p, and cel-miR-238-3p. In another embodiment, the control RNA is a haemolysis control RNA selected from the list consisting of hsa- miR-451 a, hsa-miR-23a-3p and combinations thereof. In a particular embodiment, the RNA controls are the haemolysis controls hsa-miR-451 a and hsa-miR-23a-3p. In a more particular embodiment, where the hemolysis RNA controls are hsa-miR-451 a and hsa-miR-23a-3p, a ratio of the expression level of miR-451 a and of miR-23a (miR-451 a / miR23a ratio) lower than 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 7, 6, 5, particularly lower than 60, is indicative of no significative haemolysis. Non-limitative examples of methods to determine said ratio include those disclosed in Optimized Collection Protocol for Plasma MicroRNA Measurement in Patients with Cardiovascular Disease, Wu C.-S. et al., Biomed Res Int. 2016 (doi: 10.1155 / 2016 / 2901938).

[0122] The term "hsa-miR-16-5p”, as used herein, refers to the mature miRNA with NCBI access number LM378756.1 (version as of date 03 March 2015).

[0123] The term "hsa-miR-93-5p”, as used herein, refers to the mature miRNA with NCBI access number LM378780.1 (version as of date 03 March 2015).

[0124] The term "has-miR-191-5p”, as used herein, refers to the mature miRNA with NCBI access number LM379058.1 (version as of date 03 March 2015).

[0125] The term "ath-miR159a”, as used herein, refers to the mature miRNA with TAIR accession number AT1 G73687.1 (version as of date 02 November 2018)

[0126] The term "cel-miR-54-3p”, as used herein, referst to the mature miRNA with NCBI accession number LM378714.1 (version as of date 03 March 201).

[0127] The term "cel-miR-39-3p”, as used herein, refers to the mature miRNA with NCBI accession number LM378699.1 (version as of date 03 March 2015).

[0128] The term "cel-miR-238-3p”, as used herein, refers to the mature miRNA with NCBI accession number LM378932.1 (version as of date 03 March 2015).

[0129] The term "hsa-miR-451 a”, as used herein, refers to the mature miRNA with NCBI accession number LM379535.1 (version as of date 03 March 2015).

[0130] The term "hsa-miR-23a-3p”, as usede herein, refers to the mature miRNA with NCBI accesion number LM378765.1 (version as of date 03 March 2015).

[0131] The term "reference value” or "reference level”, has been defined above, and applies to the reference level used in step (ii) of the method of the first aspect. In a particular embodiment, the group of control subjects used to determine the reference value used in step (ii) of the method of the first aspect, is a group of stroke patients that at the moment of performing the methods of the invention already showed a good outcome at least at 3-6 months, particularly at least at 3 months, after they suffered the stroke event, and before performing the method. As well understood by a skilled person, the previously referred groups of control subjects suffered a stroke event at least 3-6 months, particularly at least 3 months before performing the method.

[0132] As indicated in the definition of "reference value” above, the units of the reference value of the miRNA(s) used in step (ii) of the methods of the invention are preferably the same units used to determine the expression level of the same miRNA(s) in step (I) of the method. Thus, in a particular embodiment, where the expression level in step (I) of the method of the first aspect is normalized by a reference RNA as indicated in any of the embodiments above, the expression level determining the corresponding reference value used in step (ii) of the method is normalized by the same procedure as the expression level of step (I) of the method.

[0133] The term "higher than the corresponding reference level” has been defined above in section "1.1- Definitions”, as well as values to be considered to fall within said definition, which apply to the first aspect of the invention.

[0134] The term "bad prognosis” has been defined above. In a particular embodiment of the first aspect, bad prognosis refers to the prediction that the patient being analysed will show an mRS value, as defined therein, of at least 2, at least 3, at least 4, at least 5, or of 6, particularly of at least 3, at 3-6 months after performing the method of the first aspect. In a particular embodiment, the predicted mRS value indicated in the previous embodiments is predicted to be assigned to the patient at about 6 months, more particularly at about 3 months after performing the method of the first aspect. In another embodiment of the first aspect, bad prognosis refers to the prediction that the patient being analysed will show an mRS value of 2, 3, 4, 5, or 6, at 3-6 months after performing the method of the first aspect. In a particular embodiment, the predicted mRS value indicated in the previous embodiment is predicted to be assigned to the patient at about 6 months, more particularly at about 3 months after performing the method of the first aspect. In another particular embodiment of the first aspect, "bad prognosis” refers to the prediction that the patient being analysed in the first aspect will show an mRS at 3-6 months after performing the method of the first aspect, particularly at about 6 months after performing the method of the first aspect, more particularly at about 3 months after performing the method of the first aspect, equal or higher than that assigned to the patient before or at the moment of performing the method of the first aspect. The term "equal”, as used herein in the context of two mRS values, refers to the situation in which two mRS values correspond to the same natural number. The term "higher than”, as used herein in the context of two mRS values, refers to the situation in which one mRS value is at least 1 mRS level, at least 2 mRS levels, at least 3 mRS levels, at least 4 mRS levels or 5 mRS levels higher than another mRS, particularly at least 1 mRS level higher.

[0135] In another particular embodiment of the first aspect, a bad prognosis refers to the prediction that a patient will show an NIHSS score at least 1 month at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months after performing the method of the first aspect, equal or higher than at the moment of, or before, performing the method of the first aspect. In another particular embodiment, bad prognosis refers to the prediction that a patient with show an NIHSS socre at 3-6 months after performing the method of the first aspect, particularly at about 6 months, more particularly at about 3 months after performing the method of the first aspect, equal or higher than at the moment of, or before, performing the method of the first aspect. The term "equal to”, as used herein in the context of two NIHSS score values, refers to the situation in which one NIHSS score is a natural number corresponding to plus / minus 1 the other NIHSS score, wherein the two NIHSS scores are in the range of NIHSS score values assigned to the same degree of stroke severity. In a particular embodiment, the term "higher than”, as used herein in the context of NIHSS scores, refers to the situation in which one NIHSS score is at least 2 NIHSS score values, at least 3 NIHSS score values, at least 4 NIHSS score values, at least 5 NIHSS score values, at least 6 NIHSS score values, at least 7 NIHSS score values, at least 8 NIHSS score values, at least 10 NIHSS score values, at least 12 NIHSS calues, at least 15 NIHSS score values, at least 20 NIHSS score values, t least 25 NIHSS values, at least 30 NIHSS values, at least 40 NIHSS values, particularly at least 3 NIHSS score values higher than the other NIHSS score. In another particular embodiment of the first aspect, bad prognosis refers to the prediction that the patient being analysed will show an NIHSS score at at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months after performing the method of the first aspect, assigned to a higher stroke severity degree, i.e. a higher stroke severity, than the NIHSS score determined at the moment of, or before, performing the method of the first aspect. In another particular embodiment of the first aspect, bad prognosis refers to the prediction that the patient being analysed will show an NIHSS score at 3-6 months after performing the method of the first aspect, particularly at about 6 months, more particularly at about 3 months after performing the method, assigned to a higher stroke severity degree, i.e. a higher stroke severity, than the NIHSS score determined at the moment of, or before, performing the method of the first aspect.

[0136] The term "at the moment of performing the method of the first aspect”, has been defined above.

[0137] In a particular embodiment, the term "before performing the method of the first aspect”, as used herein in the context of the NIHSS score or MRS assigned to the patient being analysed in the method of the first aspect, refers to the NIHSS score or MRS, respectively, determined after the stroke event, particularly at 0.5h, 1 h, 2h,. 3h, 4h,. 5h, 6h, 7h, 8h, 9h, 10h, 12h, 20h, 24h, 30h, 36h, 48h after the stroke event, more particularly at 24h after the stroke event. Particularly, "before performing the method of the first aspect” refers to the NIHSS score or MRS determined at least 3 hours, more particularly at least 1 hour, before performing the method of the first aspect. More particularly, "before performing the method of the first aspect” refers to the NIHSS score or MRS determined at least 3 hours, more particularly at least 1 hour, before performing the method of the first aspect, and after the stroke event, particularly at 0.5h, 1 h, 2h, 3h, 4h,5h, 6h, 7h, 8h, 9h, 10h, 12h, 20h, 24h, 30h, 36h, 48h after the stroke event, more particularly at 24h after the stroke event. Methods to determine when the stroke event occurred in a patient are well-known by an expert in the field, and include, as indicated in the definition of "stroke” the use of imaging techniques, such as MRI or CT.

[0138] In another embodiment of the first aspect, bad prognosis refers to the prediction that the stroke severity of the patient at at least 1 month at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, after performing the method of the first aspect is higher than at the moment of performing the method of the first aspect of the invention. In another embodiment of the first aspect, bad prognosis refers to the prediction that the stroke severity of the patient at 3-6 months after performing the method of the first aspect, particularly at about 6 months, more particularly at about 3 months after performing the method of the first aspect, is higher than at the moment of performing the method of the first aspect of the invention. Stroke severity degrees have been provided above in the definition of NIHSS score and particularly apply herein.

[0139] In a particular embodiment of the first aspect, when miR-134-5p expression level is determined in step (i) of the method, the patient being analysed is preferably a female.

[0140] In another embodiment of the first aspect, it is further specified in step (ii) of the method of the first aspect that if the expression level determined in step (i) of the method is lower than the corresponding reference value, the patient is considered to not have a bad prognosis, particularly to have a good prognosis. The term "lower than the corresponding reference value”, as used herein, refers to a situation in which the level of expression of the corresponding miRNA is at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 120%, at least 130%, at least 150%, at least 170%, at least 180%, at least 190%, at least 200%, at least 250%, at least 300%, at least 350%, at least 400%, at least 500%, lower than the corresponding reference value.

[0141] 1.3 Method for deciding or recommending whether to initiate a medical regimen in a patient with stroke

[0142] In a second aspect, the invention is addressed to an in vitro method for deciding or recommending whether to initiate a medical regimen in a patient with stroke, the method comprising the steps of:

[0143] (I) determining in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a and combinations thereof, medical regimen

[0144] (ii) comparing the level of expression obtained in step (i) with a corresponding reference value, wherein if the expression level determined in step (i) is higher than the corresponding reference value, it is decided or recommended to initiate the medical regimen.

[0145] The term "to initiate a medical regimen” has been defined above in section "1.1 Definitions” and applies to the second aspect of the invention. The term "medical regimen” has also been defined therein, and examples of medical regimen for the treatment of stroke patients have been provided therein, which also apply to the second aspect of the invention. In a particular embodiment, the stroke is ischemic stroke and the medical regimen is selected from the list of treatments provided in the definition of "medical regimen” or "stroke” in section "1.1- Definitions” above, for the treatment of ischemic stroke. In another particular embodiment, the stroke is haemorrhagic stroke and the medical regimen is selected from the list consisting of of treatments provided in the definition of "medical regimen” or "stroke” in section "1.1- Definitions” above, for the treatment of haemorrhagic stroke. In another particular embodiment of the second aspect, the medical regimen is adapted to patients with bad prognosis. For instance, the medical regimen includes rehabilitation programmes and / or physiotherapy, as indicated in the definition of "stroke” above, and / or the administration of neutoprotective therapies. In a particular embodiment, said rehabilitation programmes and physiotherapies are also adapted to patients with a bad prognosis, such as a long rehabilitation programme rather than an intensive rehabilitation programme. In another particular embodiment of the second aspect of the invention, the medical regimen comprises providing neuroprotective therapies. Non-limitative examples of neuroprotective therapies include the administration of one or more of NA-1 (nerinetide), Uric acid, Activated protein C or 3K3A-APC-activated protein C, alfa-1-antitrypsin, fingolimod, metmorfin, glyburide, glibenclamide, TLR-4 inhibitors, IL1 inhibitors (IL1-RA, anakinra), nitric oxide donor, glyceryl trinitrate (GTN), cilostazol, gingko-biloba extracts and derivates, antioxidants, edaravone and edaravone derivates, resveratrol, melatonin, NAD, anti-intercellular adhesion molecule-1 (ICAM-1) antibodies, Enlimomab, calcium-stabilizing agents, and anti-excitotoxic agents , Maxipost (BMS-204352), Nalmefene (Cervene), Fosphenytoin, Enoxaparin, Trafermin, Ancrod, Magnesium, UK-279,276, ONO-2506, Dipyridamole, Repinotan, Simvastatin, Lubeluzole, Buspirone, Nimodipine, Heparin, YM872, Aptiganel (CNS-1102, Cerestat), Diazepam, Clomethiazole, Natalizumab, Ebselen, Flunarizine, Pentoxifylline, Abciximab, Pethidine, Dextromethorphan, Granulocyte colony stimulating factor (G-CSF) and other growth factors, pituitary adenylate cyclase-activating polypeptides, MMP-9 inhibitors, minocycline, or combinations of those or those and other related neuroprotectants. The neuroprotective therapy also includes the recommendation of administering one or more of the previously listed compounds in combination with other neuroprotectants strategies such as hypothermia, remote limb ischemic postconditioning (RIPC), collateral cerebral blood flow augmentation, blood pressure manipulation, etc., that may be performed at the ambulance when the method is performed.

[0146] In a particular embodiment, neuroprotective therapies consist or comprise administration of the miRNA inhibitor of the fourth aspect, a combination of miRNA inhibitors of the fifth aspect, or a pharmaceutical composition of the sixth aspect. In another particular embodiment, neuroprotective therapies comprise or consist of any of the neuroprotective drugs listed in the paragraph above and administration of the miRNA inhibitor of the fourth aspect. In another particular embodiment, neuroprotective therapies comprise or consist of any of the neuroprotective drugs listed in the paragraph above and administration of the combination of miRNA inhibitors of the fifth aspect, or the pharmaceutical composition of the sixth aspect.

[0147] In another particular embodiment, the neuroprotective therapies are combined with any of the treatments provided in the definition of "stroke” in section "1.1-Definitions above”.

[0148] In another particular embodiment of the second aspect, the medical regimen comprises or consists of administering the miRNA inhibitor of the fourth aspect, the combination of miRNA inhibitors of the fifth aspect or the pharmaceutical composition of the sixth aspect. Particularly, the medical regimen comprises or consists of the administration of any of the treatments referred in section "1.1-Definitions above" and the miRNA inhibitor of the fourth aspect. More particularly, the medical regimen comprises or consists of the administration of any of the treatments referred in section "1.1 -Definitions above" and the combination of miRNA inhibitors of the fifth aspect or the pharmaceutical composition of the sixth aspect.

[0149] In a particular embodiment, the medical regimen of the second aspect of the invention is a first-line or a second-line medical regimen addressed to the treatment of stroke. In a particular embodiment, the medical regimen referred in the second aspect of the invention refers to a first-line medical regimen. In another particular embodiment, the medical regimen of the second aspect of the invention refers to a second-line or third-line medical regimen. In another particular embodiment, the medical regimen in the context of the second aspect of the invention refers to an adjuvant medical regimen for the treatment of stroke. A first-line treatment, as well known by an expert in the field, refers to the first choice for treating a particular condition as being considered a very effective treatment for that condition with the least likelihood of causing side effects. A second-line treatment, as well known by an expert in the field, and refers to a treatment for a disease or condition after the initial treatment (first-line treatment) has failed, stopped working, or has side effects that aren't tolerated. Concomitantly, a third-line treatment refers to a treatment for a disease or condition after the initial treatments (first-line and second-line treatments) have failed, stopped working, or have side effects that aren't tolerated.

[0150] The terms "sample”, "patient”, "expression level, "reference value”, "comparing the level of expression obtained in step (I) with a corresponding reference value”, "higher than the corresponding reference value” have been defined above in section "1.1 -Definitions” and in the first aspect of the invention, and also apply to the second aspect of the invention. The definitions and embodiments of the first aspect of the invention are equally applicable to the second aspect of the invention. Thus, the embodiments of the first aspect of the invention are equally applicable to the second aspect of the invention by substituting the term "first aspect” by "second aspect”.

[0151] In a more particular embodiment, the patient of the second aspect is as defined in any of the definitions and embodiments of the first aspect of the invention. In another particular embodiment, the expression level(s) determined in step (i) of the method of the second aspect is / are as defined in any of the definitions and embodiments of the first aspect. In another particular embodiment, the miRNA(s) whose expression level is determined in step (i) of the method of the second aspect is / are as defined in any of the definitions and embodiments of the first aspect. In another particular embodiment, the reference value used in step (ii) of the method of the second aspect is as defined in any of the definitions and embodiments of the first aspect. In another particular embodiment, "higher than the corresponding reference value” is as defined in any of the definitions and embodiments of the first aspect.

[0152] In a particular embodiment, it is further specified in step (ii) of the method of the second aspect that if the expression level determined in step (i) is lower than the corresponding reference value, it is not decided or recommended to initiate the medical regimen. The term "lower than than the corresponding reference value”, has been defined in the first aspect of the invention and also applies to the second aspect of the invention.

[0153] 1.4 Method for determining the response of a patient already diagnosed with stroke

[0154] In a third aspect, the invention is addressed to an in vitro method for determining the response of a patient already diagnosed with stroke, to a medical regimen for treating stroke, the method comprising the steps of:

[0155] (i) determining in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a and combinations thereof,

[0156] (ii) comparing the expression level obtained in step (i) with the expression level of the same miRNA(s) determined at the start of the medical regimen or at an earlier phase of the medical regimen, wherein a reduced expression level of the miRNA(s) with respect to the expression level at the start of the medical regimen, or at an earlier phase of the medical regimen, is indicative of a good response to the medical regimen.

[0157] The term "determining the response of a patient (...) to a medical regimen” has been defined above and applies to the third aspect of the invention. In a particular embodiment, the medical regimen is any of those indicated in the definition of stroke, or in the second aspect of the invention. As well understood by a skilled, when stroke is ischemic stroke, the medical regimen is preferably one indicated for ischemic stroke patients. When stroke is haemorrhagic stroke, the medical regimen is preferably one indicated for haemorrhagic stroke patients.

[0158] In a particular embodiment, the medical regimen of the third aspect of the invention is a first- line or a second- line medical regimen addressed to the treatment of stroke. In a particular embodiment, the medical regimen referred in the third aspect of the invention refers to a first-line medical regimen. In another particular embodiment, the medical regimen of the third aspect of the invention refers to a second-line or third-line medical regimen. In another particular embodiment, the medical regimen in the context of the third aspect of the invention refers to an adjuvant medical regimen for the treatment of stroke. The terms first-, second-, or third-line treatment have been defined in the second aspect of the invention.

[0159] The term "good response to a medical regimen” has been defined above in section "1.1- Definitions” and applies to the third aspect of the invention. In a particular embodiment of the third aspect, the good response to the medical regimen comprises or consists of a reduction of the neurological damage in the patient, or a reduction in the neurological impairment of the patient, as compared to the start of the medical regimen, or to an earlier stage of the medical regimen. In a particular embodiment, a good response to the medical regimen refers to a situation wherein the stroke patient shows a complete recovery from the neurological damage or neurological impairment caused by the stroke event.

[0160] In a more particular embodiment of the third aspect, a good response to the medical regimen, as used herein, refers to a situation in which the stroke patient shows at a time point after starting the medical regimen, particularly after the end of the medical regimen, an mRS value lower than at the start, or at an earlier stage, of the medical regimen. In a particular embodiment, the term "lower than” as used herein in the context of two mRS values, refers to a situation in which one mRS value is at least 1 mRS level, at least 2 mRS levels, at least 3 mRS levels, at least 4 mRS levels or 5 mRS levels lower than another mRS value, particularly at least 1 mRS level lower.

[0161] Yet more particularly, a good response to the medical regimen refers to a situation in which the stroke patient shows at a time point after starting the medical regimen, particularly after the end of the medical regimen, an mRS value lower than 3, particularly lower than 2, more particularly lower than 1 or even of 0, and more particularly, that is also lower than at the start, or at an earlier stage, of the medical regimen.

[0162] In another embodiment of the third aspect, a good response to the medical regimen refers to a situation in which the stroke patient shows at a time point after starting the medical regimen, particularly after the end of the medical regimen, an NIHSS score lower than at the start of the medical regimen, or at an earlier stage of the medical regimen. The term "lower than”, as used herein in the context of two NIHSS scores , refers to the situation in which one NIHSS score is at least 2, at least 3, at least 4, at least 5, at least 6, at elast 7, at least 8, at least 9, at least 19, at least 12, at least 15, at least 20, at least 30 or even at least 40, particularly at least 3 NIHSS score values, lower than the other NIHSS score.

[0163] In another particular embodiment of the third aspect, a good response to a medical regimen refers to the situation in which the stroke patient shows at a time point after starting to receive the medical regimen, particularly after the end of the medical regimen, an NIHSS score assigned to a lower stroke severity degree, i.e. a lower stroke severity, than the NIHSS score determined at the start of the medical regimen, or at an earlier stage of the medical regimen. In another particular embodiment of the third aspect, the reduction of the NIHSS level at a time point after starting to receive the medical regimen, particularly after the end of the medical regimen, with respect to the NIHSS score determined at the start of the medical regimen, or at an earlier stage of the medical regimen, is any of those indicated in the definition of "good response to a medical regimen” in section "1.1- Definitions” above. In a particular embodiment, the method of the third aspect is performed at least 0.5h, at least 1 h, at least 2h, at least 3h, at least 4h, at least 5h, at least 7h, at least 10h, at least 12h, at least 18h, at least 24h, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 3 months, at least 6 months, at least 9 months, at least 1 year, at least 2 years, at least 3 years, at least 5 years, at least 7 years, at least 10 years, after starting the medical regimen. In a particular embodiment, the term "time point after starting the medical regimen”, as used in the context of the third aspect, corresponds to the moment at which the method of the third aspect is performed.

[0164] The term "start of the medical regimen” has been defined above in section "1.1- Definitions” and applies to the third aspect of the invention.

[0165] The term "at an earlier stage of the medical regimen”, as used herein, refers to a moment between the start of the medical regimen, as defined above, and the time at which the method of the third aspect of the invention is performed. In a particular embodiment, an earlier stage of the medical regimen refers to at least 0.5h, at least 1h, at least 2h, at least 3h, at least 4h, at least 5h, at least 7h, at least 10h, at least 12h, at least 18h, at least 24h, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 1 week, at least 2 weeks, a least 3 weeks, at least 1 month, at least 2 months, at least 3 months, at least 6 months, at least 9 months, at least 1 year, at least 2 years, at least 3 years, at least 5 years, at least 7 years, at least 10 years, before performing the method of the third aspect, and after the start of the medical regimen as indicated in the definition of "start of the medical regimen”.

[0166] The term "expression level at the start of the medical regimen or at an earlier phase of the medical regimen”, as used herein, is also herein referred to as the reference value determined in step (II) of the method of the third aspect for the corresponding miRNA(s). In a particular embodiment, the reference value determined in step (II) of the method of the third aspect, is as the reference level defined above, particularly as the reference level defined in any of the definitions and embodiments of the first aspect, wherein the sample or samples used to determine the reference value have been isolated from the patient being analysed in the method of the third aspect at an earlier time point, particularly at the start of the medical regimen or at an earlier stage of the medical regimen. In another particular embodiment, the reference value determined in step (ii) of the method of the third aspect, corresponds to a reference value as defined in section "1.1- Defi nitions” or in the first aspect of the invention, wherein the control subject is the patient being analysed in the method of the third aspect but at an earlier time point, particularly, at the start of the medical regimen or at an earlier stage of the medical regimen.

[0167] The term "reduced expression level of the miRNA(s) with respect to the expression level at the start of the medical regimen or at an earlier phase of the medical regimen” as used herein, refers to a situation in which the level of expression of said miRNA is at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%, at least 120%, at least 130%, at least 150%, at least 170%, at least 180%, at least 190%, at least 200%, at least 250%, at least 300%, at least 350%, at least 400%, at least 500% lower than a corresponding reference value, wherein the reference value is the reference value determined in step (ii) of the method of the third aspect as defined above. Methods to determine if the expression level of a miRNA is reduced with respect to another expression level or reference value are as the methods described in the definition of "higher than a corresponding reference value”, wherein the comparison is performed to determine if an expression level is lower, instead of higher, than the reference value.

[0168] The terms "sample”, "patient”, "expression level, "comparing the level of expression obtained in step (I) with a corresponding reference value”, "higher than the corresponding reference value” have been defined above in section "1.1- Definitions” and in the first aspect of the invention and also apply to the third aspect of the invention. The definitions and embodiments of the first and second aspects of the invention are also equally applicable to the third aspect of the invention. Thus, the embodiments of the first or second aspect of the invention are equally applicable to the third aspect of the invention by substituting the term "first aspect” or "second aspect” by "third aspect”.

[0169] In a particular embodiment, the patient of the third aspect is as defined in any of the definitions and embodiments of the first aspect of the invention. In another particular embodiment, the expression level(s) determined in step (I) of the method of the third aspect is / are as defined in any of the definitions and embodiments of the first aspect. In another particular embodiment, the miRNA(s) whose expression level is determined in step (I) of the method of the third aspect is / are the miRNA(s) indicated in any of the embodiments of the first aspect, and whose expression level is determined in step (I) of the method of the first aspect. In another particular embodiment, the miRNA(s) whose expression level is determined in step (I) of the method of the third aspect is / are the miRNA(s) whose expression level is determined in step (I) of the method of the first aspect. In another particular embodiment, the reference value used in step (ii) of the method of the third aspect is as defined in any of the definitions and embodiments of the first aspect.

[0170] In an embodiment of the third aspect, it is further specified in step (ii) of the method of the third aspect that an increased expression level of the miRNA(s) determined in step (I) of the method, with respect to the expression level at the start of the medical regimen, or at an earlier phase of the medical regimen, is not indicative of a good response to the medical regimen. The term "increased expression level of the miRNAs”, as used herein, is as the term "higher than the corresponding reference value” defined above and in the first aspect of the invention, wherein the reference value is the reference value determined in step (ii) of the method of the third aspect as defined above.

[0171] 2. Products for use in the treatment of stroke

[0172] In a fourth aspect, the invention is addressed to a miRNA inhibitor that lowers the expression of a miRNA selected from the list consisting of miR-376c-3p, miR-199a and combinations thereof, for use in the treatment or prevention of stroke in a patient.

[0173] In a fifth aspect, the invention is addressed to a combination of miRNA inhibitors for use in the treatment or prevention of stroke in a patient, wherein the combination of miRNA inhibitors comprises the miRNA inhibitor as defined in the fourth aspect and further comprises:

[0174] - a miRNA inhibitor of a miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof, - two miRNA inhibitors wherein each one is a miRNA inhibitor of a different miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof,

[0175] - three miRNA inhibitors wherein each one is a miRNA inhibitor of a different miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof, particularly wherein each miRNA inhibitor is a miRNA inhibitor of a different miRNA selected from the group consisting of miR134-5p, miR-4463 and miR-584-5p.

[0176] In a sixth aspect, the invention is addressed to a pharmaceutical composition for use in the treatment or prevention of stroke that comprises the miRNA inhibitor as defined in the fourth aspect, or the combination of miRNA inhibitors as defined in the fifth aspect.

[0177] 2.1-Definitions Definitions

[0178] The term "miRNA inhibitor”, as used herein, refers to a molecule or molecular complex that neutralizes or inhibits the activity or function of a microRNA (miRNA) in a cell. Indeed, the activity of a miRNA is reduced in the presence of its miRNA inhibitor, as compared to a situation in the absence of said miRNA inhibitor. Thus, the gene expression of the mRNA target of a miRNA is increased (or "de-repressed”) in the presence of a miRNA inhibitor of said miRNA, as compared to a situation in the absence of the miRNA inhibitor. Inhibition of a target miRNA by a miRNA inhibitor has been reported to be mediated by degradation of the target miRNA or also by steric blocking mechanism. The term "steric blocking”, as used herein in the context of miRNA inhibitors, refers to the term well-known by an expert in the field, particularly refers to the mechanism by which a miRNA inhibitor binds to its target miRNA and blocks access of cellular machinery to said miRNA, in particular to cellular machinery required for triggering the function of the miRNA (i.e. machinery required for inhibiting the expression of the mRNA target by the miRNA). In a particular embodiment, the miRNA inhibitor is a miRNA antagonist, more particularly, the term "miRNA inhibitor” is interchangeable with "miRNA antagonist”. Methods to determine if a molecule is a miRNA inhibitor are well- known by an expert in the field. Non-limiting examples include determining the expression level of the miRNA against which the molecule has been designed (i.e. the target miRNA of the putative miRNA inhibitor), in the presence and absence of the molecule, by any technique known by an expert in the field such as PCR, RT-PCR or RT-qPCR, and in case the expression level of said miRNA is significantly lower in the presence of the molecule being analysed than in the absence of said molecule, it is indicative that said molecule is a miRNA inhibitor. Additionally, the expression level of the target mRNA of the miRNA against which the molecule has been designed (i.e. the mRNA target of the target miRNA of the putative miRNA inhibitor) can also be determined in the presence and absence of the molecule being analysed, by any known technique by an expert in the field such as those indicated above. In case the expression level of the target mRNA is higher in the presence of the molecule than in the absence, it is also indicative that the molecule is a miRNA inhibitor. Further techniques are well-known by an expert in the field, including for instance CRISPR-based methods disclosed for instance in Kaminski M. M. et al., CRISPR-based diagnostics; Nature biomedical Engineering, 2021 , 643:656.

[0179] Additionally, an expert in the field can easily design a miRNA inhibitor taking into account the sequence of the target miRNA of interest, applying routine methods. A non-limitative example of such method would include designing an oligonucleotide complementary to at least the seed region of the target miRNA, as herein defined, or for a higher specificity, being complementary to nucleotides at positions 3-20, or to all the nucleotides of the target miRNA. Methods to determine the complementarity of two nucleotide sequence are well-known by an expert in the field and can be based on those provided in the definition of "specifically binding” bellow. Additionally, nucleotide or backbone modifications to increase the properties of the oligonucleotide, such its stability, are provided in the definition of "oligonucleotide” bellow and could be implemented by an expert in the field with well-known routine techniques for an expert in the field. Nonlimiting examples of methods for the synthesis of oligonucleotide include synthesis by solid-phase synthesis using phosphoramidite method and phosphoramidite building blocks derived from protected 2'- deoxynucleosides (dA, dC, dG, and T), ribonucleosides (A, C, G, and U), or chemically modified nucleosides, e.g. LNA or BNA. Confirming the sequence and correct synthesis of the obtained oligonucleotide can be further performed, by well-known sequencing techniques by an expert in the field. Non-limitative examples include liquid chromatography-mass spectrometry (LC-MS or HPLC-MS) or capillary electrophoresis mass spectrometry (GEMS). Furthermore, methods to determine whether the obtained oligonucleotide is an inhibitor of the desired miRNA have been provided in the paragraph above.

[0180] The term "target miRNA”, as used herein, refers to the miRNA targeted or inhibited, by the miRNA inhibitor as defined herein. The expression "a miRNA inhibitor” of a miRNA, as used herein, is interchangeable with the expression "a miRNA inhibitor that inhibits the activity” of the miRNA indicated therein, or with the expression "a miRNA inhibitor whose miRNA target is” the miRNA indicated therein, or "a miRNA inhibitor that targets” the miRNA indicated therein.

[0181] Well-known miRNA inhibitors comprise or consist of a nucleotide sequence or an oligonucleotide that binds by base-pairing to its target miRNA.

[0182] The nucleotide sequence of said miRNA inhibitors that base pairs to the corresponding miRNA target sequence is herein also referred to as the miRNA binding sequence (MBS) of the mRNA inhibitor.

[0183] Concomitantly, the nucleotide sequence in a target miRNA complementary to its miRNA inhibitor (or to the oligonucleotide comprised in or consisting of said miRNA inhibitor), particularly to the MBS of said miRNA inhibitor, is herein referred as the "miRNA inhibitor target sequence”, or "the target sequence of the miRNA inhibitor”.

[0184] The miRNA inhibitor target sequence commonly comprises the seed region of the miRNA. The seed region of a miRNA, as well known by an expert in the field, refers to nucleotides at positions 2-8 in a 5'- to 3'- end direction of a mature miRNA, and is considered the minimal element needed for a miRNA to engage its target mRNA in a cell. Concomitantly, the MBS of a miRNA inhibitor generally comprises or consists of a nucleotide sequence complementary to the seed region of the miRNA inhibitor's target miRNA. Thus, in a particular embodiment, the miRNA inhibitor target sequence comprises or consists of the seed region of the target miRNA.

[0185] As well understood by a skilled person, when referring to a miRNA inhibitor that base pairs or that specifically binds to a target miRNA, it is herein understood that the miRNA inhibitor comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that base pairs or specifically binds to a sequence of said target miRNA. Thus, in a particular embodiment, the miRNA inhibitor comprises or consists of an oligonucleotide, particularly an oligonucleotide that specifically binds to the target miRNA, more particularly to a sequence of the target miRNA, yet more particularly to the seed region of the miRNA.

[0186] The term "miRNA inhibitor oligonucleotide”, "the oligonucleotide”, as used herein refers to the oligonucleotide comprised in, or consisting of, the miRNA inhibitor, as defined herein. In the context of this disclosure, the term "oligonucleotide" or "polynucleotide” refers to an oligomer of nucleotides commonly defined by a nucleotide sequence. Nucleotides consist of a naturally occurring nitrogenous base or nucleobase ((purines (adenine and guanine) and pyrimidines (cytosine, uracil, and thymine)) which is covalently bond to the T position of a 5-carbon sugar (deoxyribose or ribose) which is in turn covalently bond at its 5' position to a phosphate. Oligonucleotides are generally classified as deoxyribooligonucleotides or ribooligonucleotides, which are respectively oligomers of "deoxyribonucleotides” or "ribonucleotides”. An oligonucleotide formed by deoxyribonucleotides may be referred as "DNA oligonucleotide”, "DNA molecules” or simply as "DNA”; and an oligonucleotide formed by ribonucleotides may be referred as "RNA oligonucleotide”, "RNA molecules” or simply "RNA”. A deoxyribooligonucleotide consists of a deoxyribonucleotide (containing adenine or guanine as purines, or cytosine or thymine as pyrimidines) repeating structure wherein the phosphate of a deoxyribonucleotide covalently bonds to the 3' carbon of the deoxyribose of another deoxyribonucleotide, and forms an alternating, unbranched polymer. A ribooligonucleotide (containing adenine or guanine as purines, or cytosine or uracil as pyrimidines) consists of a similar repeating structure where the 5-carbon sugar is ribose. The structure created by the union of phosphates and sugars of the different nucleotides of an oligonucleotide is called the sugar-phosphate backbone, i.e. the oligonucleotide contains a sugar-phosphate backbone or phosphate backbone. In the context of this disclosure a "thymine nucleotide”, an "uracil nucleotide”, a "guanine nucleotide”, a "cytosine nucleotide” or an "adenine nucleotide” refer to the nucleotide that contains the corresponding nitrogenous base, in particular the nucleotides that contain these bases and that are part of the DNA or RNA.

[0187] In the context of this disclosure, oligonucleotide sequences are represented by a strand sequence in the 5' to 3' direction from left to right, and the first nucleotide presented in the sequence is residue at position number 1 . Thus, in the context of the present disclosure, the positions of nucleotides in an oligonucleotide or nucleotide sequence are provided from the 5'-end to the 3'-end of said oligonucleotide or nucleotide sequence (i.e. in a 5'- to 3'-end direction), being the residue at the 5'-end of the oligonucleotide at position 1.

[0188] In some embodiments, the miRNA inhibitor oligonucleotide comprises modifications to help enhance its properties, particularly its binding capacity, stability and / or its specificity to the miRNA target. For instance, an increased stability can be achieved by combining ribonucleotide and nucleotides in the oligonucleotide.

[0189] The term "oligonucleotide” also includes oligomers comprising monomers other than deoxyadenosine 3'- monophosphate, deoxyguanosine 3'-monophosphate, deoxycytidine 3'-monophosphate, deoxythymidine 3'-monophosphate, adenosine 3'-monophosphate, guanosine 3'-monophosphate, cytidine 3'- monophosphate, or uridine 3'-monophosphate, but are functionally and structurally similar thereto. These are also referred to as oligonucleotide analogues, modified oligonucleotides, or DNA / RNA-like oligonucleotides. Such oligonucleotides may be naturally-occurring or not and are sometimes preferred over native forms because of properties such as, for example, enhanced binding ability, enhanced cellular uptake, reduced immunogenicity, and increased stability in the presence of nucleases.

[0190] An oligonucleotide analogue is thus composed by nucleotide analogues (or modified nucleotides, or RNA / DNA-like nucleotides), which may have one or more of the three parts of it (phosphate, pentose sugar or nucleobase) altered compared to the above-mentioned "standard” nucleotides.

[0191] In some embodiments the miRNA inhibitor oligonucleotide may be modified by the substitution of at least one nucleotide by at least one modified nucleotide, ideally so that the in vivo and in vitro stability of the oligonucleotide is enhanced as compared to a corresponding unmodified oligonucleotide.

[0192] Non-limiting examples of nucleotide analogues include 2'-deoxy guanosine, 2'-deoxy adenosine, 2'-0- methylguanosine, 2'-0-methyl (e.g., 2'-O-methylcytidine, 2'-0-methylpseudouridine, 2'-0-methyluridine, 2'-0- methyladenosine (2prime-O-methyladenosine as referred in the sequence listing), 2'-0-methylguanosine) ribonucleotide, 2'- amino, 2'-thio and 2'-fluoro modified ribonucleotide, 2'-fluoro-cytidine, 2'-fluoro-uridine, 2'- fluoro-guanosine, 2'-fluoro-adenosine, 2'-amino-cytidine, 2'-amino-uridine, 2'-amino- adenosine, 2'- amino-guanosine, 2'-amino-butyryl-pyrene-uridine, 2'-amino-adenosine, 5-iodo-uridine, ribo- thymidine, 5- bromo-uridine, 2-aminopurine, 5-methyl-cytidine , 5-fluoro-cytidine, and 5- fluoro-uridine, 2,6-diaminopurine, 4-thio-uridine, 5-amino-allyl-uridine, and combinations thereof.

[0193] In another embodiment, the miRNA inhibitor oligonucleotide includes derivatization of the 5 position, for instance being selected from 5-(2-amino) propyl uridine, 5-bromo uridine, 5-propyne uridine, 5-propenyl uridine; derivatization of the 6 position, for instance 6-(2-amino)propyl uridine; derivatization of the 8-position for adenosine and / or guanosines, for instance 8- bromo guanosine, 8-chloro guanosine, or 8- fluoroguanosine.

[0194] In other embodiments, the miRNA inhibitor oligonucleotide comprises a modified sugar portion. Examples of modifications to the sugar portion of a nucleotide include the 2' OH-group being replaced by a group selected from H, OR, R, F, Cl, Br, I, SH, SR, H2, NHR, NR2, COOR, or OR, wherein R is substituted or unsubstituted 01-06 alkyl, alkenyl, alkynyl, aryl and so on. The phosphate group of the nucleotide may also be modified, such as by substituting one or more of the oxygens of the phosphate group with sulfur (for instance by employing phosphorothioates). Modifications may decrease the rate of hydrolysis of polynucleotides comprising the modified bases, for example by inhibiting degradation by exonucleases. In one preferred instance, the oligonucleotide is resistant to ribonucleases. Oligonucleotide which may be employed includes those with modifications to promote resistance to exonucleases. Thus, in an embodiment, the miRNA inhibitor oligonucleotide has been modified with a 2'- O-methyl group, also referred to as a 2'-methoxy modification (e.g., 2'-0-methylcytidine, 2'-0-methylpseudouridine, 2'-0- methylguanosine, 2'-0-methyluridine, 2'-0-methyladenosine, 2'-0-methyl).

[0195] In another embodiment, the miRNA inhibitor oligonucleotide comprises modifications to increase cellular uptake. Example of modifications to improve cellular uptake include Poly (ethylene glycol) (PEG), GalNAc (N-acetylgalactosamine) modification, cell penetrating peptides (GPP), peptide RGD, a-Tocopherol, or cholesterol. Such modifications can be added to the 5'-end or to the 3'-end of the oligonucleotide. Said attachment can be direct or by means of a linker. In a particular embodiment, any of such modifications is directly attached or attached by means of a linker to an internal nucleotide of the oligonucleotide (i.e. a nucleotide that is not the 3' -end or the 5'-end nucleotide). In a particular embodiment, a cholesterol group is added to the 5'- or to the 3'-end of the miRNA inhibitor oligonucleotide, particularly to the 3'-end of the miRNA inhibitor oligonucleotide. Therm "cholesterol” as used herein, refers to the molecule with IUPAC name Cholest-5-en-3p-ol.

[0196] In other embodiments, the miRNA inhibitor oligonucleotide contains at least one modification selected from the group consisting of: peptide nucleic acid (PNA), Morpholino nucleic acid, glycol nucleic acid (GNA), threose nucleic acid (TNA), and hexitol nucleic acids (HNA). In other embodiments, the miRNA inhibitor oligonucleotide contains locked nucleic acids (LNA) (an oligonucleotide comprising at least one 2'-C,4'-C- oxy- methylene-linked bicyclic ribonucleotide monomer), 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5- iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5- carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D- galactosylqueosine, inosine, N6-isopentenyladenine, 1- methylguanine, 1 -methylinosine, 2,2- dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D- mannosylqueosine, 5'-methoxycarboxymethyluraci 1 , 5-methoxyuracil, 2-methylthio-N6- isopentenyladenine, uracil-5-oxyacetic acid, wybutoxosine, pseudouracil, queosine, 2- thiocytosine, 5- methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5- oxyacetic acid methylester, 5-methyl- 2-thiouracil, 3-(3-amino- 3-N-2-carboxypropyl) uracil and / or 2,6-diaminopurine.

[0197] The backbone of an oligonucleotide can also be modified. A common modification is the substitution of the phosphate backbone for a phosphorothioated backbone, which provides an increased resistance to nucleases compared to unmodified oligonucleotides (containing 100% phosphodiester backbone). As well known by an expert in the field, a phsophoarothioate (PS) bond substitutes the non-bridging oxygen in the phosphate backbone of an oligonucleotide, by a non-bridging sulfur atom.

[0198] In some embodiments, the miRNA inhibitor oligonucleotide includes modifications to the phosphate backbone such as methyl phosphonates, methyl phosphonothioates, phosphoromorpholidates, phosphoropiperazidates and phosphoramidates. In some embodiments, the oligonucleotide contains a 2' lower alkyl moiety (e.g., C1-C4, linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1- propenyl, 2-propenyl, and isopropyl).

[0199] In a particular embodiment, the miRNA inhibitor oligonucleotide is a linear oligonucleotide. The term "linear oligonucleotide”, as used herein, refers to an oligonucleotide as defined herein, having a 5'-end and a 3'- end. Oligonucleotides forming secondary structures are not excluded from the definition of linear oligonucleotide, as long as they comprise a 5' and a 3' termini. In the context of the present invention, a linear miRNA inhibitor as used herein, refers to miRNA inhibitor that comprises or consists of a linear oligonucleotide .

[0200] In another particular embodiment, the miRNA inhibitor oligonucleotide is a circular oligonucleotide. The term "circular oligonucleotide” as used herein refers to closed singular DNA, RNA or DNA / RNA strands, with covalently linked ends. Circular oligonucleotides are more resistant to degradation by DNA and / or RNA decay machinery than linear oligonucleotides. In the context of the present invention, circular miRNA inhibitor as used herein refers to miRNA inhibitor that comprises or consists of a circular oligonucleotide. In a particular embodiment, the circular oligonucleotide comprises nucleotide or backbone modifications as indicated in the definition of "oligonucleotide”.

[0201] Non-limitative examples of well-known miRNA inhibitors include anti-miRNA oligonucleotides (AMOs), circular oligonucleotides, miRNA sponges, Tough Decoy (TuD). Thus, in a particular embodiment, the miRNA inhibitor, as referred herein, consists of, or comprises, an oligonucleotide, selected from the list consisting of AMO, a circular oligonucleotide, a miRNA sponge, and a TuD. AMOs can also be classified as (LNA)-AMOs, phosphorothioates (PS)-AMOs, peptide nucleic acid (PNA)-AMOs, phosphorodiamidate morpholino (PMO)-AMO or an AMO with a non-nucleotide compound called N, N-dimethyl-4-(4- nitronaphthalen-1-ylazo)-phenylamine (ZEN) attached to the end of a 2'-O-methyl modified AMO (ZEN- AMO).

[0202] The term "anti-miRNA oligonucleotide”, "AMO”, "anti-miR” or "antagomir”, as used herein, refers to a miRNA targeting antisense oligonucleotide (ASO). An AMO is a single-stranded small RNA that binds complementarily to its miRNA targets, blocking interaction of these targets with their corresponding endogenous mRNA targets, thereby increasing (or "de-repressing”) expression of said endogenous mRNA targets. Anti-miR oligonucleotides-based mechanism relies on the complementary base pairing of the oligonucleotide sequence to its target miRNA. AMOs are generally designed to have a perfect base pairing with the miRNA target, particularly when inactivation requires that binding affinity between the miRNA and the AMO is significantly higher than that of the natural miRNA guide strand / passenger strand interaction. As single stranded RNA oligonucleotides are prone to be degraded by nuclease, multiple chemical modifications are applied to improve their stability, enhance their binding affinity, prolong their inhibition and thereby increase their efficacy. These modifications are applied to the backbone as well as the ribose and / or nucleobase of AMOs and include any of the modification indicated above for oligonucleotide analogues. In general terms, said modifications can be classified as: (1) changes in the phosphodiester bonds, for instance, by placing at least one phosphorothioate internucleotide linkage (phosphorothioate backbone) to confer resistance to nuclease degradation and increase bioavailability, forming a phosphorothioate (PS)- AMO (herein also referred to as "PS-AMO”); (2) modification in the ribose of nucleotides to enhance AMOs stability and affinity for their target miRNA (e.g., by placing at least one 2'-O-methyl, 2'-O-methoxyethyl, or 2'-fluoro modification); (3) construction of a locked nucleic acid(LNA)-AMO (herein also referred to as "LNA- AMO”), by placing at least one methyl bridge between the 2'-0 and 4' position of the ribose ring (forming 2'- C,4'-C-oxy- methylene-linked bicyclic ribonucleotide monomer); or (4) substitution of the ribose-phosphate backbone with a pseudopeptide sequence between at least 2 nucleotides, creating a peptide nucleic acid (PNA)-AMO molecule (herein also referred to as "PNA-AMO”), or with a 6-membered morpholino ring or phosphorodiamidate linkage between at least 2 nculeotides, generating a phosphorodiamidate morpholino oligomer (herein also referred to as "PMO-AMO”). Both PNAs and PMOs are generally neutrally charged and are resistant to cleavage by nucleases. All the aforementioned chemical modifications in an AMO are thoroughly described in several documents, including Hammond S.M. et al., “Delivery of oligonucleotide- based therapeutics: challenges and opportunities." , EMBO Mol. Med. 2021 ; or in Lima J.F. et al., “Anti- miRNA oligonucleotides: a comprehensive guide for design." RNA Biol. 2018; 15: 338-352. By including such types of modifications, anti-miRNA oligonucleotides can be trimmed to shorter sequence with equal or even higher performance, can specifically bind to the common seed sequence of miRNAs and block the entire miRNA family via just one sequence design. Additional modifications that can be placed in an AMO to increase binding affinity and exonuclease resistance include placing a non-nucleotide compound called N, N-dimethyl-4-(4-nitronaphthalen-1-ylazo)-phenylamine (ZEN) attached to the end of a 2'-O-methyl modified AMO, forming a so-called ZEN-AMO (see K.A. Lennox, et al., "Improved performance of Anti- miRNA oligonucleotides using a novel non-nucleotide modifier, molecular therapy”, Nucleic Acids 2 (2013) e117). Additionally, an AMO as just defined can further comprise DNA residues, and thus be formed by a mixture of DNA and RNA residues.

[0203] In a particular embodiment, the AMO miRNA inhibitor is an LNA-AMOs, a PS-AMO, a PNA-AMO, a PMO- AMO, or a ZEN-AMO.

[0204] The term "miRNA sponge”, as used herein, refers to a designed RNA transcript that competitively binds to target miRNAs of interest via multiple and tandem MBS, that recognize the target miRNA(s). Once transfected and steadily expressed in cells, miRNA sponges can exert prolonged or permanent suppression against target individual miRNA or an entire miRNA family. Various miRNA sponge structure designs have been developed for better absorption of target miRNAs. A first miRNA sponge design consists of a linear structure, with MBS sequences tandemly arranged in the 3'UTR of a reporter gene, which can then be delivered into cell by viral vector. Generally, most miRNA sponges are built with 4-16 MBS sequences, addressed to the same or to different miRNAs. Another design of RNA sponges corresponds to that of circular oligonucleotides, which show higher resistant to exonucleases and more stability than linear miRNA sponges, due to the lack of free ends. In a particular embodiment, the miRNA inhibitor, is a miRNA sponge. In another particular embodiment, the miRNA inhibitor referred hereinis a miRNA sponge comprising any of the modifications indicated above in the definition of oligonucleotide, particularly any of the modification indicated above for the miRNA inhibitor oligonucleotide. In another particular embodiment, the miRNA inhibitor, as referred herein, is a miRNA sponge comprising any of the modifications indicated in the definition of AMO above, particularly comprising at least one modification indicated in the definition of AMO above.

[0205] The term "circular RNA”, as used herein refers to covalently closed RNA molecules. They can be transcribed and spliced from the exons or introns of genes and can be ubiquitous in eukaryotic cells and extracellular components, including blood. Due to lack of free ends, circular RNAs are particularly resistant to exonucleases. Some circRNAs comprise miRNA MBS, so that they sequester the corresponding miRNA(s), thus inhibiting said miRNAs and acting as circular miRNA sponges. In a particular embodiment, the miRNA inhibitor, as referred herein, is a miRNA sponge. In another particular embodiment, the miRNA inhibitor, as referred herein, is a circular miRNA sponge comprising any of the modifications indicated above in the definition of oligonucleotixde, particularly any of the modifications indicated above for the miRNA inhibitor oligonucleotide. In another particular embodiment, the miRNA inhibitor, as referred herein, is a circular miRNA sponge comprising any of the modifications indicated in the definition of AMO above, particularly comprising at least one modification indicated in the definition of AMO above.

[0206] One examples of circular miRNA inhibitor consists of has_circ_0012152, as described in Erdogan C. et al., A Bioinformatics Analysis of circRNA / miRNA / mRNA Interactions in Acute Myeloid Leukemia, Experimed 2023; 13(1): 45-53. In a particular embodiment, SEQ ID NO. 6 consists of the RNA sequence of has_circ_0012152 just cited.

[0207] The term "Tough Decoy”, or "TuD”, as used herein, refers to a miRNA inhibitor consisting of a ~60-bp long hairpin-shaped RNA containing a large, internal bulge exposing two miRNA target sites with imperfect basepairing with the miRNA, such as an internal bulge opposite to position 10-11 of the miRNA. Imperfect basepairing has been proposed to prevent fast endonucleolytic turnover of the inhibitor thereby prolonging the interaction between the miRNA and the inhibitor. Examples of such miRNA inhibitors is provided in Haraguchi et al., “Vectors expressing efficient RNA decoys achieve the long-term suppression of specific microRNA activity in mammalian cells". Nucleic Acids Res, 2009, 37: e43. In a particular embodiment, the miRNA inhibitor, as referred herein, is a TuD. In another particular embodiment, the miRNA inhibitor, as referred herein, is a TuD comprising any of the modifications indicated above for the in the definition of oligonucleotide, particularly any of the modifications indicated above for the miRNA inhibitor oligonucleotide. In another particular embodiment, the miRNA inhibitor, as referred herein, is a TuD comprising any of the modifications indicated in the definition of AMO above, particularly comprising at least one modification indicated in the definition of AMO above.

[0208] The term "specifically binds” or "specifically binding”, as used herein in the context of a miRNA inhibitor, refers to the fact that a nucleotide sequence of a miRNA inhibitor base pairs, hybridizes, or is complementary to a sequence of its target miRNA. While embodiments of this disclosure are not limited to a particular base pairing mechanism, the most common mechanism of base pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, reversed Hoogsteen or Wobble hydrogen bonding, between complementary nucleobases or nitrogenous bases. For example, the natural nucleobase adenine is complementary to the natural nucleobases thymidine and uracil, which pair through the formation of hydrogen bonds. Similarly, the natural base guanine is complementary to the natural nucleobases cytosine and 5-methyl cytosine. As well understood by a skilled person, a sequence that specifically binds to a target sequence needs not to be 100% complementary to said target sequence (i.e. not all the nucleotides of two sequences that are considered complementary to each other, base pair to each other). For example, a miRNA inhibitor with an MBS, as defined above, that comprises insertions, deletions, and single point mutations relative to its complementary sequence in its target miRNA may also be effective for inhibiting its target miRNA. Thus, two nucleotide sequence can be considered complementary when they are at least 30%, 40%. 50%, 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 97%, at least 99%, or 100% complementary to each other. In particular embodiments, the miRNA inhibitor comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence (or MBS) that is at least 30%, 40%. 50%, 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary to the the miRNA inhibitor's target miRNA, particularly to the miRNA inhibitor target sequence. In a more particular embodiment, the miRNA inhibitor comprises or consists of an oligonucleotide that comprises, or consists of, a nucleotide sequence (or MBS) that is 100% complementary to the miRNA inhibitor's target miRNA, particularly to the miRNA inhibitor target sequence. In more particular embodiments, the miRNA inhibitor comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence 100% complementary to the miRNA inhibitor target sequence.

[0209] Methods to determine the percentage of complementarity between a first nucleotide sequence and a second nucleotide sequence are well-known by an expert in the field an include determining the percentage of sequence identity of the first nucleotide sequence with the reverse complementary of the second nucleotide sequence. Thus, a nucleotide sequence or oligonucleotide complementary to a target sequence can be alternatively defined as comprising or consisting of a nucleotide sequence that has identity with respect to the reverse complimentary of its target sequence. Identity is of at least 30%, at least 40%, at least 50%, at least 60%, at least 65%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, or 100%, particularly of 100%, with respect to the reverse complementary of the oligonucleotide target sequence. Sequence identity, including determination of sequence complementarity for nucleic acid sequences, may be determined by sequence comparison and alignment algorithms known in the field. To determine the percent identity of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the first sequence or second sequence for optimal alignment). The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology = # of identical positions / total # of positions* 100), optionally penalizing the score for the number of gaps introduced and / or length of gaps introduced.

[0210] The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In one embodiment, the alignment generated over a certain portion of the sequence aligned having sufficient identity but not over portions having low degree of identity (i.e., a local alignment). A preferred, non- limiting example of a local alignment algorithm utilized for the comparison of sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264- 68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into the BLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. In another embodiment, the alignment is optimized by introducing appropriate gaps and percent identity is determined over the length of the aligned sequences (i.e., a gapped alignment). To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al, (1997) Nucleic Acids Res. 25(17):3389-3402. In another embodiment, the alignment is optimized by introducing appropriate gaps and percent identity is determined over the entire length of the sequences aligned (i.e., a global alignment). A preferred, non-limiting example of a mathematical algorithm utilized for the global comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

[0211] The expression "treatment”, as used herein, refers to any type of therapy, which is aimed at terminating, preventing, ameliorating, or reducing the susceptibility to a clinical condition as described herein. In a preferred embodiment, the term treatment relates to prophylactic treatment (i.e. a therapy to reduce the susceptibility to a clinical condition), of a disorder or a condition as defined herein. Thus, "treatment," "treating," and their equivalent terms refer to obtaining a desired pharmacologic or physiologic effect, covering any treatment of a pathological condition or disorder in a mammal, including a human. The effect may be prophylactic in terms of completely or partially preventing a disorder or symptom thereof and / or may be therapeutic in terms of a partial or complete cure for a disorder and / or adverse effect attributable to the disorder. That is, "treatment" includes (1) preventing the disorder from occurring or recurring in a subject, (2) inhibiting the disorder, such as arresting its development, (3) stopping or terminating the disorder or, at least, symptoms associated therewith, so that the host no longer suffers from the disorder or its symptoms, such as causing regression of the disorder or its symptoms, for example, by restoring or repairing a lost, missing or defective function, or stimulating an inefficient process, or (4) relieving, alleviating, or ameliorating the disorder, or symptoms associated therewith, where ameliorating is used in a broad sense to refer to at least a reduction in the magnitude of the alteration of a parameter associated to said disorder. In a particular embodiment, the term "treatment”, as used herein, also refers to the term "medical regimen” as defined in section 1 .1-Definitions above or in the first aspect of the invention.

[0212] The term "pharmaceutical composition”, as used herein, refers to a composition comprising a therapeutically effective among of the miRNA inhibitor of the fourth aspect of the invention, or of the combination of miRNA inhibitors of the fifth aspect of the invention, and at least one pharmaceutically acceptable excipient or carrier. Pharmaceutical compositions according to the invention can be prepared, for instance, as injectables such as liquid solutions, suspensions, and emulsions.

[0213] The terms "pharmaceutically acceptable excipient", or "pharmaceutically acceptable carrier," "pharmaceutically acceptable diluent”, or "pharmaceutically acceptable vehicle”, are used interchangeably herein, and refer to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any conventional type. A pharmaceutically acceptable carrier is essentially non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation. Suitable carriers include, but are not limited to water, dextrose, glycerol, saline, ethanol, and combinations thereof. The carrier can contain additional agents, such as wetting or emulsifying agents, pH buffering agents, or adjuvants that enhance the effectiveness of the formulation. Adjuvants could be selected from the group consisting of sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. Water or saline aqueous solutions and aqueous dextrose and glycerol solutions, particularly for injectable solutions, are preferably used as vehicles.

[0214] 2.2 The inhibitor of the invention for use in the treatment of stroke

[0215] In a fourth aspect, the invention is addressed to a miRNA inhibitor of a miRNA selected from the list consisting of miR-376c-3p, miR-199a and combinations thereof, for use in the treatment or prevention of stroke in a patient. The terms "miRNA”, “miR-376-c-3p”, “miR-199a”, "stroke” and "patient” have been described in the definitions and embodiments above in section "1 . Methods of the invention”, which are equally applicable to the fourth aspect of the invention. The terms "treatment” and "prevention” have been defined above in section "2.1 -Definitions”.

[0216] In a particular embodiment, all the definitions and embodiments of the first, second and third aspect are equally applicable to the fourth aspect of the invention.

[0217] The term "miRNA inhibitor” has been defined in section "2.1 -Definitions” above and methods for identifying them have also been provided in the definition of the term. The embodiments provided therein for the term "miRNA inhibitor” are equally applicable to the miRNA inhibitor of the fourth aspect.

[0218] In a particular embodiment of the fourth aspect, the term "miRNA inhibitor” is interchangeable with the term "a miRNA inhibitor that inhibits the activity” of the corresponding miRNA, i.e. of the miRNAs selected from the list provided in the fourth aspect. In another particular embodiment of the fourth aspect, the term "miRNA inhibitor” is interchangeable with the term "a miRNA inhibitor whose miRNA target is”, or with the term "a miRNA inhibitor that targets” a miRNA selected from the list of miRNAs provided in the fourth aspect.

[0219] In an embodiment, the miRNA inhibitor of the fourth aspect is a miRNA inhibitor of miR-376c-3p. In another embodiment, the miRNA inhibitor of the fourth aspect is a miRNA inhibitor of miR-199a. In another embodiment, the miRNA inhibitor of the fourth aspect is a miRNA inhibitor of miR-199a-3p. In another embodiment, the miRNA inhibitor of the fourth aspect is a miRNA inhibitor of miR-199a-5p. In another embodiment, the miRNA inhibitor of the fourth aspect is a miRNA inhibitor of miR-199a-3p and of miR-199a- 5p. In another embodiment, the miRNA inhibitor of the fourth aspect is a miRNA inhibitor of miR-199a-3p or of miR-199a-5p. In another embodiment, the miRNA inhibitor of the fourth aspect is a miRNA inhibitor of miR-199a-3p and a miRNA inhibitor of miR-199a-5p.

[0220] In another embodiment, the miRNA inhibitor of the fourth aspect is a miRNA inhibitor of miR-376c-3p and a miRNA inhibitor of miR-199a. In another embodiment, the miRNA inhibitor of the fourth aspect is a miRNA inhibitor of miR-376c-3p and a miRNA inhibitor of miR-199a-3p. In another embodiment, the miRNA inhibitor of the fourth aspect is a mirNA inhibitor of miR-376c-3p and a miRNA inhibitor of miR-199a-5p. In another embodiment, the miRNA inhibitor of the fourth aspect is a miRNA inhibitor of miR-376c-3p, and a miRNA inhibitor of miR-199a-3p and of miR-199a-5p. In another embodiment, the miRNA inhibitor of the fourth aspect is a miRNA inhibitor of miR-376c-3p, and a miRNA inhibitor of miR-199a-3p or of miR-199a-5p In another embodiment, the miRNA inhibitor of the fourth aspect is a miRNA inhibitor of miR-376c-3p, a miRNA inhibitor of miR-199a-3p and a miRNA inhibitor of miR-199a-5p.

[0221] Thus, in other words, the miRNA inhibitor of the fourth aspect is a miRNA inhibitor of miR-376c-3p and / or miR-199a. Particularly, the miRNA inhibitor of the fourth aspect refers to a miRNA inhibitor of miR-376c-3p and a miRNA inhibitor of miR-199a, or to a miRNA inhibitor of miR-376c-3p or miR-199a, or to a miRNA inhibitor of miR-376c-3p and of miR-199a.

[0222] In another particular embodiment, the miRNA inhibitor of miR199a-3p and miR-199a-5p as referred herein comprises or consists of a circular oligonucleotide or a miRNA sponge. In another embodiment, the miRNA inhibitor of the fourth aspect is a miRNA inhibitor of miR-376c-3p and of miR-199a, particularly wherein the miRNA inhibitor comprises or consists of a circular oligonucleotide or a miRNA sponge. In another embodiment, the miRNA inhibitor of the fourth aspect is a miRNA inhibitor of miR-376c-3p and of miR-199a-3p, particularly wherein the miRNA inhibitor comprises or consists of a circular oligonucleotide or a miRNA sponge. In another embodiment, the miRNA inhibitor of the fourth aspect is a miRNA inhibitor of miR-376c-3p and of miR-199a-5p, particularly wherein the miRNA inhibitor comprises or consists of a circular oligonucleotide or a miRNA sponge. In another embodiment, the miRNA inhibitor of the fourth aspect is a miRNA inhibitor of miR-376c-3p, miR199a-3p and miR-199a-5p, particularly wherein the miRNA inhibitor comprises or consists of a circular oligonucleotide or a miRNA sponge.

[0223] In an embodiment, upon binding to its target miRNA, the miRNA inhibitor of the fourth aspect inhibits the activity of its target miRNA. In another particular embodiment, upon binding to its target miRNA, the miRNA inhibitor of the fourth aspect degrades or blocks, particularly blocks by steric blocking, its target miRNA. In another embodiment, upon binding to its target miRNA, the miRNA inhibitor of the fourth aspect increases the gene expression of the mRNA(s) target(s) of its target miRNA, as compared to a situation in which the miRNA inhibitor does not bind to its miRNA target or to a situation in which the miRNA inhibitor is absent.

[0224] In a particular embodiment, the miRNA inhibitor of the fourth aspect, specifically binds to its target miRNA. more particularly to its miRNA target sequence. Therefore, in an embodiment, the term "binding” in the embodiments or definitions above can be substituted by "specifically binds”. The term "specifically binds” has been defined in section 2.1 -Definitions above. In an embodiment, the miRNA inhibitor of the fourth aspect specifically binds at least to the seed region of its target miRNA, particularly specifically binds to the seed region of its target miRNA. In another particular embodiment, the miRNA inhibitor of the fourth aspect specifically binds to at least nucleotides at positions 2-8, 2-7, 3-7 or 3-8, particularly at least to nucleotides at positions 2-7 or 3-8 in a 5' to 3'-end direction of its target miRNA. In a more particular embodiment, the miRNA inhibitor of the fourth aspect specifically binds to at least nucleotides at positions 2-8 in a 5' to 3'- end direction of its target miRNA. In another particular embodiment, the miRNA inhibitor of the fourth aspect specifically binds to at least nucleotides at positions 3-7, 3-8, 3-9, 3-10, 3-11 , 3-11 , 3-12, 3-13, 3-14, 3-15, 3-16, 3-17, 3-18, 3-19, 3-20, 3-21, 3-22, or 3-23, particularly 3-21 , in a 5'-end to 3'-end direction of its target miRNA. In another particular embodiment, the miRNA inhibitor of the fourth aspect specifically binds to at least nucleotides at positions 2-7, 2-8, 2-9, 2-10, 2-11 , 2-11 , 2-12, 2-13, 2-14, 2-15, 2-16, 2-17, 2-18, 2-19, 2-20, 2-21 , 2-22, or 2-23, in a 5'-end to 3'-end direction of its target miRNA. In another particular embodiment, the miRNA inhibitor of the fourth aspect specifically binds to at least nucleotides at positions 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11 , 1-11 , 1-12, 1-13, 1-14, 1-15, 1-16, 1-17, 1-18, 1-19, 1-20, 1-21 , 1-22, or

[0225] 1-23, in a 5'-end to 3'-end direction of its target miRNA, particularly to all the nucleotides of its target miRNA.

[0226] In another particular embodiment, the miRNA inhibitor of the fourth aspect specifically binds to nucleotides at positions 3-7, 3-8, 2-7 or 2-8, particularly to nucleotides at positions 2-8, in a 5' to 3'-end direction of its target miRNA. In another particular embodiment, the miRNA inhibitor of the fourth aspect specifically binds to nucleotides at positions 3-7, 3-8, 3-9, 3-10, 3-11 , 3-11 , 3-12, 3-13, 3-14, 3-15, 3-16, 3-17, 3-18, 3-19, 3- 20, 3-21 , 3-22, or 3-23, particularly 3-21 , in a 5'-end to 3' -end direction of its target miRNA. In another particular embodiment, the miRNA inhibitor of the fourth aspect specifically binds to nucleotides at positions

[0227] 2-7, 2-8, 2-9, 2-10, 2-11 , 2-11 , 2-12, 2-13, 2-14, 2-15, 2-16, 2-17, 2-18, 2-19, 2-20, 2-21, 2-22, or 2-23, in a 5'-end to 3'-end direction of its target miRNA. In another particular embodiment, the miRNA inhibitor of the fourth aspect specifically binds to nucleotides at positions 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11 , 1-11 , 1-12, 1- 13, 1-14, 1-15, 1-16, 1-17, 1-18, 1-19, 1-20, 1-21 , 1-22, or 1-23, in a 5'-end to 3'-end direction of its target miRNA, particularly to all the nucleotides of its target miRNA.

[0228] As indicated in the definition of "miRNA inhibitor”, a miRNA inhibitor that specifically binds, base-pairs or is complementary, to its target miRNA, is herein understood to comprise or consist of a nucleotide sequence or to an oligonucleotide that specifically binds, base-pairs or is complementary to a sequence of said target miRNA. As indicated above, said oligonucleotide is herein also referred to as the "miRNA inhibitor oligonucleotide”.

[0229] More particularly, the miRNA inhibitor of the fourth aspect is an oligonucleotide, as defined herein.

[0230] In another particular embodiment, the miRNA inhibitor of the fourth aspect comprises or consists of an oligonucleotide that comprises, or consists of, a nucleotide sequence that specifically binds to the miRNA inhibitor's target miRNA, particularly to a sequence of the miRNA inhibitor's target miRNA (herein also referred to as the miRNA inhibitor's target sequence). In a more particular embodiment, the miRNA inhibitor's target sequence corresponds to the nucleotides at any of the positions indicated in the embodiments above of the target miRNA.

[0231] In a particular embodiment, the miRNA inhibitor of the fourth aspect comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that is at least 30%, at least 40%, at least 45%, at least 50%, at least 55%, 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 97%, at least 99%, or 100% complementary to the miRNA target, particularly to the miRNA inhibitor's target sequence. In a more particular embodiment, the miRNA inhibitor of the fourth aspect comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that is at least 70% complementary to the miRNA target, particularly to the miRNA inhibitor's target sequence. In another particular embodiment, the miRNA inhibitor of the fourth aspect comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that is at least 75% complementary to the miRNA target, particularly to the miRNA inhibitor's target sequence. In another particular embodiment, the miRNA inhibitor of the fourth aspect comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that is at least 80% complementary to the miRNA target, particularly to the miRNA inhibitor's target sequence. In another particular embodiment, the miRNA inhibitor of the fourth aspect comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that is at least 85% complementary to the miRNA target, particularly to the miRNA inhibitor's target sequence. In another particular embodiment, the miRNA inhibitor of the fourth aspect comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that is at least 90% complementary to the miRNA target, particularly to the miRNA inhibitor's target sequence. In another particular embodiment, the miRNA inhibitor of the fourth aspect comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that is at least 95% complementary to the miRNA target, particularly to the miRNA inhibitor's target sequence. In another particular embodiment, the miRNA inhibitor of the fourth aspect comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that is 100% complementary to the miRNA target, particularly to the miRNA inhibitor's target sequence.

[0232] Methods to determine the percentage of complementarity between two nucleotide sequences have been provided in the definition of the term "specifically binds”.

[0233] In an embodiment of the fourth aspect, the length of the miRNA inhibitor oligonucleotide is of at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least

[0234] 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least

[0235] 24, at least 25, at least 27, at least 30, at least 32, at least 35, at least 40, at least 45, at least 50, at least

[0236] 75, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at east 650, at least 700, at least 730, at least 740, at least 742, at least 750, at least 770, at least 800 nucleotide. In a particular embodiment of the fourth aspect, the length of the miRNA inhibitor oligonucleotide is of at least 15 nucleotides. In another particular embodiment, the length of the miRNA inhibitor oligonucleotide is of at least 19 nucleotides. In another particular embodiment, the length of the miRNA inhibitor oligonucleotide is of at least 20 nucleotides. In another particular embodiment, the length of the miRNA inhibitor oligonucleotide is of at least 21 nucleotides. In another particular embodiment, the length of the miRNA inhibitor oligonucleotide is of at least 22 or at least 23 nucleotides.

[0237] In another embodiment of the fourth aspect, the length of the miRNA inhibitor oligonucleotide is of about 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 27, 30, 32, 35, 40, 45, 50, 75, 100, 150, 200, 250, 300, 400, 450, 500, 550,. 600, 650, 700, 740, 742, 750, 770, or about 800 nucleotides. In a particular embodiment of the fourth aspect, the length of the miRNA inhibitor oligonucleotide is of about 15 nucleotides. In another particular embodiment, the length of the miRNA inhibitor oligonucleotide is of about 19 nucleotides. In another particular embodiment, the length of the miRNA inhibitor oligonucleotide is of about 20 nucleotides. In another particular embodiment, the length of the miRNA inhibitor oligonucleotide is of about 21 nucleotides. In another particular embodiment, the length of the miRNA inhibitor oligonucleotide is of about 22 or 23 nucleotides

[0238] In another particular embodiment, the length of the miRNA inhibitor oligonucleotide is of about 5-800, 5-750, 5-742, 5-740, 5-700, 5-650, 5-600, 5-500, 5-400, 5-300, 5-250, 5-200, 5-150, 5-100, 5-75, 5-50, 5-45, 5-40, 5-35, 5-30, 5-27, 5-25, 5-23, 5-22, 5-21, 5-20, 5-19, or 5-15 nucleotides. In another particular embodiment, the length of the miRNA inhibitor oligonucleotide is of about 12-800, 12-750, 12-742, 12-740, 12-700, 12- 650, 12-600, 12-500, 12-400,12-300, 12-250, 12-200, 12-150, 12-100, 12-75, 12-50, 12-45, 12-40, 12-35, 12-30, 12-27, 12-25, 12-23, 12-22, 12-21 , 12-20, 12-19, or 12-15 nucleotides. In another particular embodiment, the length of the miRNA inhibitor oligonucleotide is of about 15-800, 15-750, 15-742, 15-740, 15-700, 15-650, 15-600, 15-500, 15-400, 15-300, 15-250, 15-200, 15-150, 15-100, 15-75, 15-50, 15-45, 15- 40, 15-35, 15-30, 15-27, 15-25, 15-23, 15-22, 15-21 , 15-20, or, 15-19, particularly of 15-23. In a more particular embodiment, the length of the miRNA inhibitor oligonucleotide is of 15-22 nucleotides. In another more particular embodiment, the length of the miRNA inhibitor oligonucleotide is of 15-21 nucleotides. In another more particular embodiment, the length of the miRNA inhibitor oligonucleotide is of 15-20 nucleotides. In another more particular embodiment, the length of the miRNA inhibitor oligonucleotide is of 15-19 nucleotides.

[0239] The term "length” as used herein in the context of an oligonucleotide, refers to the term well-known by an expert in the field, particularly to the number of nucleotides that form the oligonucleotide, from the 5'-end to the 3'-end of the oligonucleotide. In the case of a circular oligonucleotide, the length of the oligonucleotide is the total number of nucleotides that form said circular oligonucleotide.

[0240] In another embodiment, the miRNA inhibitor oligonucleotide comprises ribonucleotides and deoxyribonucleotides, which are also referred herein referred as RNA-DNA oligonucleotides. In a particular embodiment, the miRNA inhibitor oligonucleotide is an RNA-DNA oligonucleotide. In a particular embodiment, the miRNA inhibitor oligonucleotide comprises or consists of ribonucleotides and 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 27, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, or 400 deoxyribonucleotides. In another particular embodiment, the miRNA inhibitor oligonucleotide comprises or consists of ribonucleotides and 1-400, 1-350, 1-300, 1-200, 1-150, 1-100, 1- 75, 1-50, 1-40, 1-30, 1-25, 1-20, 1-17, 1-15, 1-12, 1-10, 1-7, or 1-5 deoxyribonucleotides.

[0241] In a particular embodiment, the miRNA inhibitor oligonucleotide comprises nucleotide analogues or consists of nucleotide analogues bond to each other. The term "nucleotide analogue” has been defined above and examples of such analogues have been provided which can be used in the miRNA inhibitor oligonucleotide as herein described.

[0242] In another particular embodiment, the miRNA inhibitor oligonucleotide comprises ribonucleotide analogues or consists of ribonucleotide analogues bond to each other. In another particular embodiment, the miRNA inhibitor oligonucleotide comprises or consists of ribonucleotides and 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 27, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, or 400 nucleotide analogues. In another particular embodiment, the miRNA inhibitor oligonucleotide comprises or consists of ribonucleotides and 1-400, 1-350, 1-300, 1-200, 1-150, 1-100, 1-75, 1-50, 1-40, 1-30, 1-25, 1- 20, 1-17, 1-15, 1-12, 1-10, 1-7, or 1-5 nucleotide analogues.

[0243] In other embodiments, the miRNA inhibitor oligonucleotide comprises nucleotide analogs such as deazanucleotides, e.g., 7-deaza-adenosine; O- and N-modified (for instance alkylated, such as N6-methyl adenosine) nucleotides; and other heterocyclically modified nucleotide analogs.

[0244] In a particular embodiment, a cholesterol group is added to the 5'- or to the 3'-end of the miRNA inhibitor oligonucleotide, particularly to the 3'-end of the oligonucleotide.

[0245] In another particular embodiment, the miRNA inhibitor oligonucleotide comprises nucleotides with a 2'- methoxy modification. As well-known by an expert in the field, a 2'-methoxy modification, or 2'-O- methylation, or 2'-O-Me, in a nucleotide, consists of a common modification where a methyl group (i.e. group with chemical formula CH3) is added to the 2' hydroxyl of the ribose moiety of a nucleotide, particularly of a ribonucleotide, producing a methoxy group (-OCH3). In another particular embodiment, the miRNA inhibitor oligonucleotide comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 27, 30, 35, 40, 45, 50, 100, 150, 200, 300, 350, or 400 or all nucleotides with a 2'-methoxy modification. In a more particular embodiment, the miRNA inhibitor oligonucleotide comprises or consists of ribonucleotides with a 2'-methoxy modification. In another particular embodiment, the miRNA inhibitor oligonucleotide comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 27, 30, 35, 40, 45, 50, 100, 150, 200, 300, 350, or 400 or all ribonucleotides with a 2'-methoxy modification. In a yet more particular embodiment, all the nucleotides of the miRNA inhibitor oligonucleotide are ribonucleotides with a 2'-methoxy modification.

[0246] In some embodiments, the miRNA inhibitor oligonucleotide comprises a phosphorothioated backbone (i.e. modifying the phosphodiester linkage to phosphorothioate of a sugar-phosphate backbone). In a particular embodiment, the miRNA inhibitor oligonucleotide comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13,

[0247] 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 27, 30, 35, 40, 45, 50, 100, 150, 200, 300, 350, or 400 or all of its oligonucleotide bases, having a phosphorothioated backbone. In particular embodiments, the miRNA inhibitor oligonucleotide comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive nucleotides, particularly 2 consecutive nucleotides, at the 5'-end of the oligonucleotide having a phosphorothioated backbone. In other particular embodiments, the miRNA inhibitor oligonucleotide comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive nucleotides, particularly 4 consecutive nucleotides, at the 3'-end of the oligonucleotide having a phosphorothioated backbone. In another embodiment, the miRNA inhibitor oligonucleotide 2 consecutive nucleotides at the 5'-end of the oligonucleotide and 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive nucleotides, particularly 4 consecutive nucleotides, at the 3'-end of the oligonucleotide, having a phosphorothioated backbone. In another embodiment, the miRNA inhibitor oligonucleotide comprise 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive nucleotides, particularly 2 consecutive nucleotides, at the 5'-end and 4 consecutive nucleotides at the 3'-end of the oligonucleotide having a phosphorothioated backbone. In another embodiment, the miRNA inhibitor oligonucleotide comprises at least 2 consecutive nucleotides, particularly 2 consecutive nucleotides, at the 5'-end and at least 2, particularly 4 consecutive nucleotides at the 3'-end of the oligonucleotide having a phosphorothioated backbone, and 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14,

[0248] 15, 16, 17, 18, 19, 20, 21 , 22,23, 24, 25, 27, 30, 35, 40, 45, 50, 100, 150, 200, 300, 350, or 400 additional nucleotides having a phosphorothioated backbone. In a particular embodiment, the nucleotides of the miRNA inhibitor oligonucleotide referred in the present paragraph are deoxyribonucleotide or ribonucleotides, particularly are ribonucleotides.

[0249] In an embodiment, the miRNA inhibitor oligonucleotide comprises a phosphorothioate backbone and additional modifications to increase resistance to ribonucleases. In a particular embodiment, the miRNA inhibitor oligonucleotide comprises at least one nucleotide with a 2'-methoxy modification and at least one nucleotide with a phosphorothioated backbone. In a more particular embodiment, the at least one nucleotide with a 2'-methoxy modification corresponds to the nucleotides with 2'-methoxy modification indicated in any of the embodiments above defining oligonucleotides with 2'-methoxy modifications. In another embodiment, the at least one nucleotide with a phosphorothioated backbone corresponds to the nucleotides with a phosphorothioated backbone indicated in any of the embodiments above defining oligonucleotides with a phosphorothioated backbone. In a more particular embodiment, all the nucleotides of the oligonucleotide comprise a 2'-methoxy modification, and at least one nucleotide has a phosphorothioated backbone, particularly, comprises the nucleotides indicated in any of the embodiments of the previous paragraph, having a phosphorothioated backbone. In another particular embodiment, the miRNA inhibitor oligonucleotide comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 27, 30, 35, 40, 45, 50, 100, 150, 200, 300, 350, or 400 or all nucleotides with a 2'-methoxy modification, and at least one nucleotide with a phosphorothioated backbone, particularly, wherein the nucleotides with phosphorothioated backbone correspond to those indicated in any of the embodiments above defining oligonucleotides with a phosphorothioated backbone. In a yet more particular embodiment, all the nucleotides of the miRNA inhibitor oligonucleotide are ribonucleotides with a 2'-methoxy modification and at least one nucleotide of the oligonucleotide has a phosphorothioated backbone, particularly, wherein the nucleotides with phosphorothioated backbone correspond to those indicated in any of the embodiments above defining oligonucleotides with a phosphorothioated backbone. In an even yet more particular embodiment, the nucleotides of the miRNA inhibitor oligonucleotide as defined in the present paragraph are deoxyribonucleotides, or ribonucleotides, particularly are ribonucleotides. In another particular embodiment, the miRNA inhibitor oligonucleotide as defined in the present paragraph comprises a cholesterol group at the 5'-end or at the 3'-end of the oligonucleotide, particularly at the 3'-end. In another particular embodiment, the miRNA inhibitor oligonucleotide as defined in the present paragraph comprises a cholesterol group at the 5'-end an at the 3'-end of the oligonucleotide.

[0250] In another particular embodiment, 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive nucleotides, particularly 2 consecutive nucleotides, at the 5'-end of the oligonucleotide have a phosphorothioated backbone and all the nucleotides of the oligonucleotide have a 2'-methoxy modification, more particularly wherein all the nucleotides of the miRNA inhibitor oligonucleotide are ribonucleotides. In another particular embodiment, 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive nucleotides, particularly 4 consecutive nucleotides, at the 3' -end of the oligonucleotide have a phosphorothioated backbone and all the nucleotides of the oligonucleotide have a 2'-methoxy modification, more particularly wherein all the nucleotides of the miRNA inhibitor oligonucleotide are ribonucleotides. In another particular embodiment, at least 2 consecutive nucleotides, particularly 2 consecutive nucleotides at the 5'-end of the oligonucleotide, and at least 2 consecutive nucleotides, particularly 4 consecutive nucleotides at the 3'-end of the oligonucleotide have a phosphorothioated backbone, and all the nucleotides of the oligonucleotide have a 2'-methoxy modification, more particularly wherein all the nucleotides of the miRNA inhibitor oligonucleotide are ribonucleotides. In a yet more particular embodiment, the miRNA inhibitor oligonucleotide as defined in the present paragraph comprises a cholesterol group at the 5'-end or at the 3'-end of the oligonucleotide, particularly at the 3'-end. In another particular embodiment, the miRNA inhibitor oligonucleotide as defined in the present paragraph comprises a cholesterol group at the 5'-end an at the 3'-end of the oligonucleotide.

[0251] In an embodiment, the miRNA inhibitor oligonucleotide is as any of the oligonucleotides described in the definition of "oligonucleotide” in section 2.1 -Definitions above.

[0252] In a particular embodiment of the fourth aspect, the miRNA inhibitor oligonucleotide is selected from the list consisting of: anti-miRNA oligonucleotide (AMO), circular oligonucleotide, miRNA sponge, and Tough Decoy (TuD). A definition of each of said terms has been provided in section 2.1 -Definitions above.

[0253] In a more particular embodiment, the miRNA inhibitor oligonucleotide is an anti-miRNA oligonucleotide (AMO) or a circular oligonucleotide, particularly an AMO. In another particular embodiment, the miRNA inhibitor oligonucleotide is an AMO selected from the list consisting of LNA-AMO, PS-AMO, PNA-AMO, PMO-AMO, and a ZEN-AMO. A definition of each of said terms has been provided in section 2.1-Definitions above.

[0254] In an even more particular embodiment, the miRNA inhibitor oligonucleotide is an AMO wherein all the nucleotides of the AMO have a 2'-methoxy modification. In another particular embodiment, the miRNA inhibitor oligonucleotide is an AMO wherein all the nucleotides of the AMO have a 2'-methoxy modification; at least 2, particularly 2, consecutive nucleotides at the 5'-end of the miRNA inhibitor oligonucleotide have a phosphorothioate backbone; at least 2, particularly 4, consecutive nucleotides at the 3'-end of the miRNA inhibitor oligonucleotide have a phosphorothioate backbone; and wherein a cholesterol group is attached to the 3'-end of the oligonucleotide. In a particular embodiment, the nucleotides of the AMO miRNA inhibitor as defined in the present paragraph are ribonucleotides.

[0255] In a particular embodiment, the miRNA inhibitor of miR-376c-3p has SEQ ID NO. 1. In a particular embodiment, the miRNA inhibitor of miR-376c-3p comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92% at least 95%, or 100% sequence identity with SEQ ID NO. 1. In another particular embodiment, the miRNA inhibitor of miR-376c-3p has SEQ ID NO. 14. In a particular embodiment, the miRNA inhibitor of miR-376c-3p comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92% at least 95%, at least 97%, at least 99%, or 100% sequence identity with SEQ ID NO. 14. Methods to determine the sequence identity between two nucleotide sequences have been provided above.

[0256] In another particular embodiment, the miRNA inhibitor of miR-199a-3p has SEQ ID NO. 2. In a particular embodiment, the miRNA inhibitor of miR-199a-3p comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92% at least 95%, at least 97%, at least 99% or 100% sequence identity with SEQ ID NO. 2. In another particular embodiment, the miRNA inhibitor of miR-199a- 3p has SEQ ID NO. 15. In a particular embodiment, the miRNA inhibitor of miR-199a-3p comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92% at least 95%, at least 97%, at least 99% or 100% sequence identity with SEQ ID NO. 15.

[0257] In another particular embodiment, the miRNA inhibitor of miR-199a-5p has SEQ ID NO. 13. In a particular embodiment, the miRNA inhibitor of miR-199a-5p comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92% at least 95%, at least 97%, at least 99% or 100% sequence identity with SEQ ID NO. 13. In another particular embodiment, miRNA inhibitor of miR-199a-5p has SEQ ID NO. 19. In a particular embodiment, the miRNA inhibitor of miR-199a-5p comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92% at least 95%, at least 97%, at least 99% or 100% sequence identity with SEQ ID NO. 19. In another embodiment, the miRNA inhibitor oligonucleotide is a circular miRNA inhibitor, with at least 1 miRNA target, particularly with at least 2 miRNA targets, more particularly with at least 3 miRNA targets. In more particular embodiment, the miRNA inhibitor comprises or consists of a circular miRNA inhibitor, or a miRNA sponge, with miRNA targets comprising or consisting of miR-376c-3p and miR-199a. In a more particular embodiment, the miRNA inhibitor comprises or consists of a circular miRNA inhibitor, or a miRNA sponge, with miRNA targets comprising or consisting of miR-376c-3p and miR-199a-3p. In another more particular embodiment, the miRNA inhibitor oligonucleotide comprises or consists of a circular miRNA inhibitor, or a miRNA sponge, with miRNA targets comprising or consisting of miR-376c-3p and miR-199a- 5p. In another more particular embodiment, the miRNA inhibitor oligonucleotide comprises or consists of a circular miRNA inhibitor, or a miRNA sponge, with miRNA targets comprising or consisting of miR-376c-3p, miR-199a-3p and miR-199a-5p.

[0258] In another embodiment, the miRNA inhibitor of miR-376c-3p and miR-199a comprises or consists of a circular miRNA inhibitor or a miRNA sponge. In a particular embodiment, the miRNA inhibitor of miR-376c- 3p and miR-199a-3p comprises or consists of a circular miRNA inhibitor or a miRNA sponge. In another particular embodiment, the miRNA inhibitor of miR-376c-3p and miR-199a-5p comprises or consists of a circular miRNA inhibitor or a miRNA sponge.

[0259] In a yet more particular embodiment of the fourth aspect, the miRNA inhibitor of miR-376c-3p and miR-199a comprises or consists of SEQ ID NO. 6. In a particular embodiment, the miRNA inhibitor of miR-376c-3p and miR199a, particularly miR199a-5p, comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% sequence identity with SEQ ID NO. 6. In another particular embodiment, the miRNA inhibitor of miR-376c-3p, miR199-5p and miR199-3p comprises or consists of an oligonucleotide that comprises a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or 99% sequence identity with SEQ ID NO. 6. In a particular embodiment, the miRNA inhibitor comprising or consisting of SEQ ID NO.6 is a circular miRNA inhibitor or a miRNA sponge.

[0260] In an embodiment of the fourth aspect, stroke refers to ischemic stroke.

[0261] In a particular embodiment of the fourth aspect, the patient is a Caucasian subject, particularly a European or European American subject. In another particular embodiment, the patient is a non-Asian subject.

[0262] 2.3 Combination of miRNA inhibitors for use in the treatment or prevention of stroke in a patient

[0263] In a fifth aspect, the invention is addressed to a combination of miRNA inhibitors for use in the treatment or prevention of stroke in a patient, wherein the combination of miRNA inhibitors comprises the miRNA inhibitor as defined in the fourth aspect and further comprises:

[0264] - a miRNA inhibitor of a miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof,

[0265] - two miRNA inhibitors wherein each one is a miRNA inhibitor of a different miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof, - three miRNA inhibitors wherein each one is a miRNA inhibitor of a different miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof, particularly wherein each miRNA inhibitor is a miRNA inhibitor of a different miRNA selected from the group consisting of miR134-5p, miR-4463 and miR-584-5p.

[0266] The terms "miRNA inhibitor”, "treatment”, "prevention”, "stroke”, "patient” have been defined above, particularly in section "1-Methods of the invention”, in section "2.1 -Definitions- or in the fourth aspect of the invention and apply to the fifth aspect of the invention.

[0267] In a particular embodiment, all the definitions and embodiments of the first, second, third and fourth aspect are equally applicable to the fifth aspect of the invention.

[0268] All the definitions and embodiments provided in the disclosure for the miRNA inhibitor of the fourth aspect of the invention are equally applicable to the combination of miRNA inhibitors of the fifth aspect of the invention.

[0269] In an embodiment, the definitions and embodiments of the miRNA inhibitor of the fourth aspect are equally applicable to at least one miRNA inhibitor of the fifth aspect. In another embodiment, the definitions and embodiments of the miRNA inhibitor of the fourth aspect are equally applicable to at least two miRNA inhibitors of the fifth aspect. In another embodiment, the definitions and embodiments of the miRNA inhibitor of the fourth aspect are equally applicable to at least three miRNA inhibitors of the fifth aspect. In another embodiment, the definitions and embodiments of the miRNA inhibitor of the fourth aspect are equally applicable to at least four miRNA inhibitors of the fifth aspect. In another embodiment, the definitions and embodiments of the miRNA inhibitor of the fourth aspect are equally applicable to all miRNA inhibitors of the fifth aspect.

[0270] In an embodiment, the definitions and embodiments of the miRNA inhibitor of the fourth aspect are equally applicable to one miRNA inhibitor of the fifth aspect. In another embodiment, the definitions and embodiments of the miRNA inhibitor of the fourth aspect are equally applicable to two miRNA inhibitors of the fifth aspect. In another embodiment, the definitions and embodiments of the miRNA inhibitor of the fourth aspect are equally applicable to three miRNA inhibitors of the fifth aspect. In another embodiment, the definitions and embodiments of the miRNA inhibitor of the fourth aspect are equally applicable to four miRNA inhibitors of the fifth aspect.

[0271] In a particular embodiment, the combination of miRNA inhibitors of the fifth aspect comprises the miRNA inhibitor as defined in the fourth aspect, and further comprises a miRNA inhibitor of a miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof, particularly from the group consisting of miR134-5p, miR-4463, miR-584-5p.

[0272] In another particular embodiment, the combination of miRNA inhibitors of the fifth aspect comprises the miRNA inhibitor as defined in the fourth aspect, and further comprises two miRNA inhibitors wherein each one is a miRNA inhibitor of a different miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof, particularly from the group consisting of miR134-5p, miR-4463, miR- 584-5p In another particular embodiment, the combination of miRNA inhibitors of the fifth aspect comprises the miRNA inhibitor as defined in the fourth aspect, and further comprises three miRNA inhibitors wherein each one is a miRNA inhibitor of a different miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof, particularly wherein each miRNA inhibitor is a miRNA inhibitor of a different miRNA selected from the group consisting of miR134-5p, miR-4463 and miR-584-5p.

[0273] In an embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 2 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-376c-3p and miR134-5p. In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 2 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-376c-3p and miR-4463. In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 2 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-376c-3p and miR-584-5p. In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 4 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-376c-3p, miR134-5p and miR-4463. In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 4 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-376c-3p, miR134-5p and miR- 584-5p. In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 3 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR- 376c-3p, miR-4463 and miR-584-5p. In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 4 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-376c-3p, miR134-5p, miR-4463 and miR-584-5p.

[0274] In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 2 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-199a and miR134-5p. In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 2 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-199a and miR-4463. In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 2 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-199a and miR-584-5p. In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 3 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-199a, miR134-5p and miR-4463. In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 3 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-199a, miR134-5p and miR-584-5p. In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 3 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-199a, miR-4463 and miR-584-5p.

[0275] In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 3 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-376c-3p, miR-199a, and miR-4463. In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 3 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-376c-3p, miR-199a, and miR134-5p. In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 3 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-376c-3p, miR-199a and miR-584-5p. In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 4 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-376c-3p, miR-199a, miR-4463 and miR134-5p. In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 4 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-376c-3p, miR-199a, miR-4463 and miR-584-5p. In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 4 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-376c-3p, miR-199a, miR134-5p and miR-584-5p. In another embodiment, the combination of miRNA inhibitors of the fifth aspect comprises 5 miRNA inhibitors wherein each miRNA inhibitor targets a different miRNA selected from the list consisting of miR-376c-3p, miR-199a, miR134-5p, miR-4463 and miR-584-5p.

[0276] In an embodiment, the miRNA inhibitor that targets miR-376c-3p in any of the embodiments of the fifth aspect, also targets miR-199a, particularly wherein the miRNA inhibitor comprises or consists of a circular oligonucleotide or a miRNA sponge. In another embodiment, the miRNA inhibitor that targets miR-376c-3p in any of the embodiments of the fifth aspect, also targets miR-199a-5p, particularly wherein the miRNA inhibitor comprises or consists of a circular oligonucleotide or a miRNA sponge. In another embodiment, the miRNA inhibitor that targets miR-376c-3p in any of the embodiments of the fifth aspect, also targets miR- 199a-3p, particularly wherein the miRNA inhibitor comprises or consists of a circular oligonucleotide or a miRNA sponge. In another embodiment, the miRNA inhibitor that targets miR-376c-3p in any of the embodiments of the fifth aspect, also targets miR-199a-5p and miR-199a-3p, particularly wherein the miRNA inhibitor comprises or consists of a circular oligonucleotide or a miRNA sponge.

[0277] In a particular embodiment, the miRNA inhibitor of miR-376c-3p has SEQ ID NO. 1. In a particular embodiment, the miRNA inhibitor of miR-376c-3p comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 97%, at least 99% or 100% sequence identity with SEQ ID NO. 1. In another particular embodiment, the miRNA inhibitor of miR-376c-3p has SEQ ID NO. 14. In a particular embodiment, the miRNA inhibitor of miR-376c-3p comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 97%, at least 99% or 100% sequence identity with SEQ ID NO. 14. Methods to determine the sequence identity between two nucleotide sequences have been provided above.

[0278] In another particular embodiment, the miRNA inhibitor of miR-199a-3p has SEQ ID NO. 2. In a particular embodiment, the miRNA inhibitor of miR-199a-3p comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 97%, at least 99% or 100% sequence identity with SEQ ID NO. 2. In another particular embodiment, the miRNA inhibitor of miR-199a-3p has SEQ ID NO. 15. In a particular embodiment, the miRNA inhibitor of miR-199a-3p comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 97%, at least 99% or 100% sequence identity with SEQ ID NO. 15.

[0279] In another particular embodiment, the miRNA inhibitor of miR134-5p has SEQ ID NO. 3. In a particular embodiment, the miRNA inhibitor of miR134-5p comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 97%, at least 99% or 100% sequence identity with SEQ ID NO. 3. In another particular embodiment, the miRNA inhibitor of miR134-5p has SEQ ID NO. 16. In a particular embodiment, the miRNA inhibitor of miR134-5p comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 97%, at least 99% or 100% sequence identity with SEQ ID NO. 16.

[0280] In another particular embodiment, the miRNA inhibitor of miR-4463 has SEQ ID NO. 4. In a particular embodiment, the miRNA inhibitor of miR-4463 comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 97%, at least 99% or 100% sequence identity with SEQ ID NO. 4. In another particular embodiment, the miRNA inhibitor of miR-4463 has SEQ ID NO. 17. In a particular embodiment, the miRNA inhibitor of miR-4463 comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 97%, at least 99% or 100% sequence identity with SEQ ID NO. 17.

[0281] In another particular embodiment, the miRNA inhibitor of miR-584-5p has SEQ ID NO. 5. In a particular embodiment, the miRNA inhibitor of miR-584-5p comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 97%, at least 99% or 100% sequence identity with SEQ ID NO. 5. In another particular embodiment, the miRNA inhibitor of miR-584-5p has SEQ ID NO. 18. In a particular embodiment, the miRNA inhibitor of miR-584-5p comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 97%, at least 99% or 100% sequence identity with SEQ ID NO. 18.

[0282] In another particular embodiment, the miRNA inhibitor of miR-376c-3p and miR-199a-5p, has SEQ ID NO. 6. In another particular embodiment of the fourth aspect, the miRNA inhibitor of miR-376c-3p and miR-199a, comprises or consists of an oligonucleotide comprises or consists of a circular miRNA inhibitor with SEQ ID NO. 6. In a particular embodiment, the miRNA inhibitor of miR-376c-3p and miR-199a, particularly miR- 199a-5p, comprises or consists of an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 97%, at least 99% or 100% sequence identity with SEQ ID NO. 6. In a particular embodiment, the miRNA inhibitor of miR-376c-3p and miR-199a, particularly miR- 199a-3p, comprises an oligonucleotide that comprises or consists of a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 97%, or at least 99% sequence identity with SEQ ID NO. 6. In another particular embodiment, the miRNA inhibitor of miR-376c-3p, miR-199-5p and miR-199-3p comprises an oligonucleotide that comprises a nucleotide sequence that shows at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 97%, or at least 99% or 100% sequence identity with SEQ ID NO. 6.

[0283] In a particular embodiment of the fifth aspect, the combination of miRNAs consists of the combination of miRNAs indicated in any of the embodiments of the fifth aspect.

[0284] In a particular embodiment of the fifth aspect, when the combination of miRNAs comprises an inhibitor for miR-134-5p, the treatment is preferably administered to a female subject. In a sixth aspect, the invention is addressed to a pharmaceutical composition for use in the treatment or prevention of stroke that comprises the miRNA inhibitor as defined in the fourth aspect, or the combination of miRNA inhibitors as defined in the fifth aspect.

[0285] Ther terms "pharmaceutical composition”, "pharmaceutically acceptable carrier”, "treatment”, "prevention”, "stroke” have been defined in section "1- Methods of the invention” or in section "2.1 -Definitions- Definitions” and are equally applicable to the seventh aspect.

[0286] In an embodiment, all the definitions and embodiments of the previous aspects are equally applicable to the sixth aspect.

[0287] 3- Additional aspects

[0288] A seventh aspect of the invention is addressed to the use of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a and combinations thereof, as a biomarker for the prognosis of patient with stroke, or as a biomarker for deciding or recommending whether to initiate a medical regimen in a patient with stroke, or as a biomarker for determining the response of a patient already diagnosed with stroke, to a medical regimen for treating stroke.

[0289] An eighth aspect of the invention is addressed to the use of a kit for the prognosis of a patient with stroke, or for deciding or recommending whether to initiate a medical regimen in a patient with stroke, or for determining the response of a patient already diagnosed with stroke, to a medical regimen for treating stroke, the kit comprising means for detecting the level of of at least one miRNA selected from the list consisting of miR-376c-3p, miR-199a and combinations thereof, and optionally a solid support.

[0290] In a particular embodiment, the seventh aspect, further comprises the use as a biomarker as indicated in the seventh aspect above, of at least one additional miRNA selected from the list consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof. In another particular embodiment of the seventh aspect, the miRNA(s) used as a biomarker in the seventh aspect is any of the combinations of miRNAs whose expression level is determined in step (i) of the first or second aspect of the invention.

[0291] In another particular embodiment, the eighth aspect further comprises the use of a kit as indicated in the eighth aspect above, wherein the kit further comprises means for detecting at least one additional miRNA selected from the list consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof. In another particular embodiment of the eighth aspect, the miRNA(s) that can be detected with the means for detecting miRNAs of the kit is any of the combinations of miRNAs whose expression level is determined in the first or second aspect of the invention, or any of the combination of miRNAs of the use of the invention.

[0292] A ninth aspect of the invention is addressed to a miRNA inhibitor of a miRNA selected from the list consisting of: miR-376c-3p, miR-199a, miR134-5p, miR-4463, miR-584-5p and combinations thereof for the treatment or prevention of stroke in a patient.

[0293] In a particular embodiment, all the definitions and embodiments of the fourth aspect of the invention are equally applicable to the ninth aspect.

[0294] A tenth aspect of the invention is addressed to an in vitro method for the prognosis and treatment of stroke in a patient, said method comprising steps (i) and (ii) as defined in the first aspect of the invention, and (iii) administering a treatment to the patient considered to have a bad prognosis, particularly wherein the treatment is selected from the treatments of stroke indicated in the definitions of "treatment” or of "medical regiment” above..

[0295] An eleventh aspect of the invention is addressed to an in vitro method for treating stroke comprising administering to a patient in the need thereof, a therapeutically effective amount of a miRNA inhibitor as defined in the fourth or ninth aspect of the invention, a combination of miRNA inhibitors as defined in the fifth or twelfth aspect of the invention, or the pharmaceutical composition as defined in the sixth or thirteenth aspect.

[0296] A twelfth aspect is addressed to a combination of miRNA inhibitors for use in the treatment or prevention of stroke in a patient, wherein the combination of miRNA inhibitors comprises at least one, particularly one, miRNA inhibitor of a miRNA selected from miR-376c-3p, miR-199a, miR134-5p, miR-4463, miR-584-5p and combinations thereof. In a particular embodiment of the twelfth aspect, the combination of miRNA inhibitors comprises at least two, particularly two, miRNA inhibitors wherein each one is a miRNA inhibitor of a different miRNA selected from miR-376c-3p, miR-199a, miR134-5p, miR-4463, miR-584-5p and combinations thereof. In another particular embodiment of the twelfth aspect, the combination of miRNA inhibitors comprises at least three, particularly three, miRNA inhibitors wherein each one is a miRNA inhibitor of a different miRNA selected selected from miR-376c-3p, miR-199a, miR134-5p, miR-4463, miR-584-5p and combinations thereof. In another particular embodiment of the twelfth aspect, the combination of miRNA inhibitors comprises at least four, particularly four, miRNA inhibitors wherein each one is a miRNA inhibitor of a different miRNA selected from miR-376c-3p, miR-199a, miR134-5p, miR-4463, miR-584-5p and combinations thereof.

[0297] In a particular embodiment of the twelfth aspect, the combination of miRNA inhibitors comprises at least one miRNA inhibitor that inhibits a miRNA selected from the list consisting of miR-376c-3p, miR-199a, miR134- 5p, miR-4463, miR-584-5p and combinations thereof, particularly wherein miR199a is miR199a-3p. In a particular embodiment of the twelfth aspect, the combination of miRNA inhibitors comprises a miRNA inhibitor that inhibits miR199a, particularly miR199a-3p. In another particular embodiment of the twelfth aspect, the combination of miRNA inhibitors comprises a miRNA inhibitor that inhibits miR-376c-3p. In another particular embodiment of the twelfth aspect, the combination of miRNA inhibitors comprises a miRNA inhibitor that inhibits miR199a, particularly miR199a-3p, and a miRNA inhibitor that inhibits miR- 376c-3p. In another particular embodiment of the twelfth aspect, the combination of miRNA inhibitors comprises a miRNA inhibitor that inhibits miR199a, particularly miR199a-3p, and at least one miRNA inhibitor that inhibits a miRNA selected from the list consisting of miR-376c-3p, miR134-5p, miR-4463, miR- 584-5p and combinations thereof. In another particular embodiment of the twelfth aspect, the combination of miRNA inhibitors comprises a miRNA inhibitor that inhibits miR-376c-3p, and at least one miRNA inhibitor that inhibits a miRNA selected from the list consisting of miR-199a, miR134-5p, miR-4463, miR-584-5p, and combinations thereof, particularly wherein miR199a is miR199a-3p. In another particular embodiment of the twelfth aspect, the combination of miRNA inhibitors comprises a miRNA inhibitor that inhibits miR199a, particularly miR199a-3p, and a miRNA inhibitor that inhibits miR-376c-3p, and at least one miRNA inhibitor that inhibits a miRNA selected from the list consisting of miR134-5p, miR-4463, miR-584-5p. In another particular embodiment of the twelfth aspect, the combination of miRNAs consists of the combination of miRNAs indicated in any of the embodiments of the disclosure, particularly of the twelfth aspect.

[0298] In a particularly preferred embodiment, the embodiments and definitions of the fourth and fifth aspects are equally applicable to the twelfth aspect. In a particular embodiment, all the definitions and embodiments of the fifth aspect of the invention are equally applicable to the twelfth aspect.

[0299] In a thirteenth aspect, the invention is addressed to a pharmaceutical composition for use in the treatment or prevention of stroke that comprises the miRNA inhibitor as defined in the fourth or in the ninth aspect, or the combination of miRNA inhibitors as defined in the fifth aspect or in the twelfth aspect.

[0300] In a particular embodiment, all the definitions and embodiments of the sixth spect of the invention are equally applicable to the thirteenth aspect.

[0301] In a fourteenth aspect, the invention is addressed to the use of the miRNA inhibitor as defined in the fourth aspect or in the ninth aspect, or the combination of miRNA inhibitors as defined in the fifth aspect or in the twelfth aspect, or the pharmaceutical composition as defined in the sixth aspect or in the thirteenth aspect, for the manufacture of a medicament for the treatment of stroke.

[0302] In a fifteenth aspect, the invention is addressed an in vitro method for determining the prognosis of a patient with stroke comprising:

[0303] (i) determining, in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a, miR134-5p, miR-4463, miR-584-5p and combinations thereof,

[0304] (ii) comparing the level of expression obtained in step (i) with a corresponding reference value, wherein if the expression level determined in step (i) is higher than the corresponding reference value, the patient is considered to have a bad prognosis.

[0305] In a particular embodiment, all the definitions and embodiments of the first aspect of the invention are equally applicable to the fifteenth aspect.

[0306] In sixteenth aspect, the invention is addressed to an in vitro method for deciding or recommending whether to initiate a medical regimen in a patient with stroke, the method comprising the steps of: (i) determining in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a, miR134-5p, miR-4463, miR-584-5p and combinations thereof,

[0307] (II) comparing the level of expression obtained in step (I) with a corresponding reference value, wherein if the expression level determined in step (I) is higher than the corresponding reference value, it is decided or recommended to initiate the medical regimen.

[0308] In a particular embodiment, all the definitions and embodiments of the second aspect of the invention are equally applicable to the fifteenth aspect.

[0309] In a seventeenth aspect, the invention is addressed to an in vitro method for determining the response of a patient already diagnosed with stroke, to a medical regimen for treating stroke, the method comprising the steps of:

[0310] (I) determining in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a, miR134-5p, miR-4463, miR-584-5p and combinations thereof,

[0311] (ii) comparing the expression level obtained in step (I) with the expression level of the same miRNA(s) determined at the start of the medical regimen or at an earlier phase of the medical regimen, wherein a reduced expression level of the miRNA(s) with respect to the expression level at the start of the medical regimen, or at an earlier phase of the medical regimen, is indicative of a good response to the medical regimen.

[0312] In a particular embodiment, all the definitions and embodiments of the third aspect of the invention are equally applicable to the seventeenth aspect.

[0313] An eighteenth aspect of the invention is addressed to the use of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a, miR134-5p, miR-4463, miR-584-5p and combinations thereof, as a biomarker for the prognosis of a patient with stroke, or as a biomarker for deciding or recommending whether to initiate a medical regimen in a patient with stroke, or as a biomarker for determining the response of a patient already diagnosed with stroke, to a medical regimen for treating stroke. In a particular embodiment, all the definitions and embodiments of the seventh aspect of the invention are equally applicable to the eighteenth aspect.

[0314] A nineteenth aspect of the invention is addressed to the use of a kit for the prognosis of a patient with stroke, or for deciding or recommending whether to initiate a medical regimen in a patient with stroke, or for determining the response of a patient already diagnosed with stroke, to a medical regimen for treating stroke, the kit comprising means for detecting the level of of at least one miRNA selected from the list consisting of miR-376c-3p, miR-199a, miR134-5p, miR-4463, miR-584-5p and combinations thereof, and optionally a solid support. In a particular embodiment, all the definitions and embodiments of the eighth aspect of the invention are equally applicable to the nineteenth aspect.

[0315] All the definitions and embodiments of the first, second, third, fourth, fifth and sixth aspects of the invention are equally applicable to the aspects defined in present section 3-. Throughout the description and claims the word "comprise" and variations of the word, are not intended to exclude other technical features, additives, components, or steps. Furthermore, the word "comprise” encompasses the case of "consisting of'. In a another particular embodiment, a miRNA inhibitor with a SEQ ID NO., or having a SEQ ID NO:, as referred in the present disclosure, is to be understood as a miRNA inhibitor consisting of said SEQ ID NO. In another particular embodiment, a miRNA with a SEQ ID NO., or having a SEQ ID NO., as referred in the present disclosure, is to be understood as a miRNA consisting of said SEQ ID NO.

[0316] Additional objects, advantages and features of the invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the invention. The following examples are provided by way of illustration, and they are not intended to be limiting of the present invention. Furthermore, the present invention covers all possible combinations of particular and preferred embodiments described herein.

[0317] For completeness, the present description is also disclosed in the following numbered embodiments:

[0318] 1- An in vitro method for determining the prognosis of a patient with stroke comprising:

[0319] (I) determining, in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a, miR134-5p, miR-4463, miR-584-5p and combinations thereof, particularly from the group consisting of miR-376c-3p, miR-199a and combinations thereof, (ii) comparing the level of expression obtained in step (I) with a corresponding reference value, wherein if the expression level determined in step (I) is higher than the corresponding reference value, the patient is considered to have a bad prognosis.

[0320] 2- A method for deciding or recommending whether to initiate a medical regimen in a patient with stroke, the method comprising the steps of:

[0321] (I) determining in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a, miR134-5p, miR-4463, miR-584-5p and combinations thereof, particularly from the group consisting of miR-376c-3p, miR-199a and combinations thereof,

[0322] (ii) comparing the level of expression obtained in step (I) with a corresponding reference value, wherein if the expression level determined in step (I) is higher than the corresponding reference value, it is decided or recommended to initiate the medical regimen.

[0323] 3- An in vitro method for determining the response of a patient already diagnosed with stroke, to a medical regimen for treating stroke, the method comprising the steps of:

[0324] (I) determining in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a, miR134-5p, miR-4463, miR-584-5p and combinations thereof, particularly from the group consisting of miR-376c-3p, miR-199a and combinations thereof,

[0325] (ii) comparing the expression level obtained in step (I) with the expression level of the same miRNA(s) determined at the start of the medical regimen or at an earlier phase of the medical regimen, wherein a reduced expression level of the miRNA(s) with respect to the expression level at the start of the medical regimen, or at an earlier phase of the medical regimen, is indicative of a good response to the medical regimen. 4- The method according to any one of embodiments 1-3 wherein step (i) comprises determining the expression level of miR-376c-3p and / or miR-199a, particularly of miR-376c-3p and miR-199a.

[0326] 5- The method according to any one of embodiments 1-4, wherein step (I) comprises determining the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a and combinations thereof, and further comprises determining the expression level of at least one miRNA selected from the group consisting of: miR134-5p, miR-4463, miR-584-5p and combinations thereof.

[0327] 6- The method according to embodiment 5, wherein step (I) comprises determining the expression level of miR-376c-3p, miR-199a, miR134-5p, miR-4463, and miR-584-5; miR-376c-3p, miR134-5p, miR- 4463, and miR-584-5; miR-376c-3p, miR-199a, miR134-5p, miR-4463, and miR-584-5; miR-376c-3p, miR- 199a, miR-134-5p and miR-4463; miR-376-3p, miR-199a, miR-134-5p and miR-584-5p; miR-376-3p, miR- 199a, miR4463 and miR-584-5p; miR-376-3p, miR-199a, and miR-134-5p; miR-376-3p, miR-199a, and miR-4463; miR-376-3p miR-199a, and miR-584-5p; miR-199a, miR134-5p, miR-4463, and miR-584-5; miR- 199a, miR-134-5p and miR-4463; miR-199a, miR-134-5p and miR-584-5p; miR-199a, miR4463 and miR- 584-5p; miR-199a and miR-134-5p; miR-199a and miR-4463; miR-199a and miR-584-5p; miR-376c-3p, miR134-5p, miR-4463, and miR-584-5; miR-376c-3p, miR-134-5p and miR-4463; miR-376-3p, miR-134- 5p and miR-584-5p; miR-376-3p, miR4463 and miR-584-5p; miR-376-3p and miR-134-5p; miR-376-3p and miR-4463; miR-376-3p and miR-584-5p; miR134-5p, miR-4463, and miR-584-5p; miR-134-5p and miR- 4463; miR-134-5p and miR-584-5p; miR4463 and miR-584-5p; miR-134-5p; miR-4463; or miR-584-5p; particularly, of miR-376c-3p, miR-199a, miR134-5p, miR-4463, and miR-584-5p.

[0328] 7- The methods according to any of the previous claims, wherein the sample is a blood sample, particularly a plasma sample.

[0329] 8- Use of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a, miR134- 5p, miR-4463, miR-584-5p and combinations thereof, particularly from the group consisting of miR-376c- 3p, miR-199a and combinations thereof, as a biomarker for the prognosis of patient with stroke, or as a biomarker for deciding or recommending whether to initiate a medical regimen in a patient with stroke, or as a biomarker for determining the response of a patient already diagnosed with stroke, to a medical regimen for treating stroke.

[0330] 9- The use according to embodiment 8 wherein at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a and combinations thereof and at least one additional miRNA selected from the list consisting of miR-134-5p, miR-4463, miR-584-5p and combinations thereof, are used as a biomarker for the prognosis of patient with stroke, or as a biomarker for deciding or recommending whether to initiate a medical regimen in a patient with stroke, or as a biomarker for determining the response of a patient already diagnosed with stroke, to a medical regimen for treating stroke.

[0331] 10- The use according to embodiment 8, wherein the at least one miRNA is miR-376c-3p, miR-199a, miR134-5p, miR-4463, and miR-584-5; miR-376c-3p, miR134-5p, miR-4463, and miR-584-5; miR-376c-3p, miR-199a, miR134-5p, miR-4463, and miR-584-5; miR-376c-3p, miR-199a, miR-134-5p and miR-4463; miR-376-3p, miR-199a, miR-134-5p and miR-584-5p; miR-376-3p, miR-199a, miR4463 and miR-584-5p; miR-376-3p, miR-199a, and miR-134-5p; miR-376-3p, miR-199a, and miR-4463; miR-376-3p miR-199a, and miR-584-5p; miR-199a, miR134-5p, miR-4463, and miR-584-5; miR-199a, miR-134-5p and miR-4463; miR-199a, miR-134-5p and miR-584-5p; miR-199a, miR4463 and miR-584-5p; miR-199a and miR-134-5p; miR-199a and miR-4463; miR-199a and miR-584-5p; miR-376c-3p, miR134-5p, miR-4463, and miR-584- 5; miR-376c-3p, miR-134-5p and miR-4463; miR-376-3p, miR-134-5p and miR-584-5p; miR-376-3p, miR4463 and miR-584-5p; miR-376-3p and miR-134-5p; miR-376-3p and miR-4463; miR-376-3p and miR- 584-5p; miR134-5p, miR-4463, and miR-584-5p; miR-134-5p and miR-4463; miR-134-5p and miR-584-5p; miR4463 and miR-584-5p; miR-134-5p; miR-4463; or miR-584-5p; particularly, miR-376c-3p, miR-199a, miR134-5p, miR-4463, and miR-584-5p.

[0332] 11- A miRNA inhibitor of a miRNA selected from the list consisting of miR-376c-3p, miR-199a, miR134- 5p, miR-4463, miR-584-5p and combinations thereof. , particularly from the group consisting of miR-376c- 3p, miR-199a and combinations thereof, for use in the treatment or prevention of stroke in a patient.

[0333] 12- The miRNA inhibitor for use according to embodiment 11 wherein the miRNA inhibitor specifically binds to at least nucleotides at positions 2-7 or 3-8 in a 5' to 3' end direction of the selected miRNA / s.

[0334] 13- The miRNA inhibitor for use according to any one of embodiments 11-12 wherein the miRNA inhibitor is of miR376c-3p and miR199a.

[0335] 14- A combination of miRNA inhibitors for use in the treatment or prevention of stroke in a patient, wherein the combination of miRNA inhibitors comprises at least one miRNA inhibitor that inhibits a miRNA selected from the group consisting of miR-376c-3p, miR-199a, miR134-5p, miR-4463, miR-584-5p and combinations thereof.

[0336] 15- The combination of miRNA inhibitors for use according to embodiment 14, wherein the combination of miRNA inhibitors comprises a miRNA inhibitor that inhibits miR199a, particularly miR199a-3p.

[0337] 16- The combination of miRNA inhibitors for use according to any one of embodiments 14-15, wherein the combination of miRNA inhibitors comprises a miRNA inhibitor that inhibits miR-376c-3p.

[0338] 17- The combination of miRNA inhibitors for use according to any one of embodiments 14-16, wherein the combination of miRNA inhibitors comprises a miRNA inhibitor that inhibits miR134-5p.

[0339] 18- The combination of miRNA inhibitors for use according to any one of embodiments 14-17, wherein the combination of miRNA inhibitors comprises a miRNA inhibitor that inhibits miR-4463.

[0340] 19- The combination of miRNA inhibitors for use according to any one of embodiments 14-18, wherein the combination of miRNA inhibitors comprises a miRNA inhibitor that inhibits miR-584-5p.

[0341] 20- The combination of miRNA inhibitors for use according to any one of embodiments 14-19, wherein the combination of miRNA inhibitors comprises a miRNA inhibitor that inhibits miR199a, particularly miR199a-3p, and miR-376c-3p.

[0342] 21- The combination of miRNA inhibitors for use according to embodiment 20 wherein the miRNA inhibitor that inhibits miR199a, particularly miR199a-3p, and miR-376c-3p, is a circular oligonucleotide or a miRNA sponge.

[0343] 22- The combination of miRNA inhibitors for use according to any one of embodiments 14-21, wherein each miRNA inhibitor of the at least one miRNA inhibitors is a miRNA inhibitor of a different miRNA selected from the list consisting of miR-376c-3p, miR134-5p, miR-4463, and miR-584-5; miR- 376c-3p, miR-199a, miR134-5p, miR-4463, and miR-584-5; miR-376c-3p, miR-199a, miR-134-5p and miR-4463; miR-376-3p, miR-199a, miR-134-5p and miR-584-5p; miR-376-3p, miR-199a, miR4463 and miR-584-5p; miR-376-3p, miR-199a, and miR-134-5p; miR-376-3p, miR-199a, and miR-4463; miR-376-3p miR-199a, and miR-584-5p; miR-199a, miR134-5p, miR-4463, and miR-584-5; miR-199a, miR-134-5p and miR-4463; miR-199a, miR-134-5p and miR-584-5p; miR-199a, miR4463 and miR-584-5p; miR-199a and miR-134-5p; miR-199a and miR-4463; miR-199a and miR-584-5p; miR-376c-3p, miR134-5p, miR- 4463, and miR-584-5; miR-376c-3p, miR-134-5p and miR-4463; miR-376-3p, miR-134-5p and miR-584- 5p; miR-376-3p, miR4463 and miR-584-5p; miR-376-3p and miR-134-5p; miR-376-3p and miR-4463; miR-376-3p and miR-584-5p; miR134-5p, miR-4463, and miR-584-5p; miR-134-5p and miR-4463; miR- 134-5p and miR-584-5p; miR4463 and miR-584-5p; miR-134-5p; miR-4463; or miR-584-5p; particularly, from the group consisting of miR-376c-3p, miR-199a, miR134-5p, miR-4463, and miR-584-5p.

[0344] 23- The combination of miRNA inhibitors for use according to any one of embodiments 14-22, wherein the combination of miRNA inhibitors comprises at least one miRNA inhibitor of a miRNA selected from the group consisting of miR-376c-3p, miR-199a, and combinations thereof, and further comprises:

[0345] - a miRNA inhibitor of a miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof,

[0346] - two miRNA inhibitors wherein each one is a miRNA inhibitor of a different miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof,

[0347] - three miRNA inhibitors wherein each one is a miRNA inhibitor of a different miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof, particularly wherein each miRNA inhibitor is a miRNA inhibitor of a different miRNA selected from the group consisting of miR134-5p, miR-4463 and miR-584-5p.

[0348] 24- The combination of miRNA inhibitors for use according to any one of embodiments 14-23, wherein each miRNA inhibitor of the at least one miRNA inhibitors is a miRNA inhibitor of a different miRNA selected from the list consisting of miR134-5p, miR-4463, and miR-584-5p; miR-134-5p and miR-4463; miR-134-5p and miR-584-5p; miR4463 and miR-584-5p; miR-134-5p; miR-4463; or miR-584-5p; particularly, miR-376c- 3p, miR-199a-3p, miR134-5p, miR-4463, and miR-584-5p.

[0349] 25- The combination of miRNA inhibitors for use according to any one of embodiments 14-24 wherein the miRNA inhibitor / s specifically bind / s to at least nucleotides 2-7 or 3-8 in a 5' to 3' end direction of the selected miRNA / s.

[0350] 26- The miRNA inhibitor for use according to any one of embodiments 11-13, or the combination of miRNA inhibitors for use according to any one of claims 14-25, wherein at least one miRNA inhibitor is an oligonucleotide.

[0351] 27- The miRNA inhibitor for use according to any one of embodiments 11-13, or the combination of miRNA inhibitors for use according to any one of claims 14-26, wherein each miRNA inhibitor is an oligonucleotide.

[0352] 28- The miRNA inhibitor for use according to any one of embodiments 26-27, or the combination of miRNA inhibitors for use according to any one of embodiments 26-27, wherein the oligonucleotide is selected from the list consisting of an anti-miRNA oligonucleotide (AMO), circular oligonucleotide, miRNA sponge, and Tough Decoy (TuD).

[0353] 29- The miRNA inhibitor for use according to embodiment 28 or the combination of miRNA inhibitors for use according to embodiment 28, wherein the miRNA inhibitor of miR-376c-3p and miR-199a-5p, of 376c-3p and miR-199a-3-p, or of miR-376c-3p, miR-199a-5p and miR-199a-5p, is a circular oligonucleotide or a miRNA sponge.

[0354] 30- The miRNA inhibitor for use according to any one of embodiments 11-13, or 26-29, or the combination of miRNA inhibitors according to any one of embodiments 14-29, wherein at least one miRNA inhibitor specifically binds to nucleotides at positions 3-21 in 5' to 3' end direction of the selected miRNA / s.

[0355] 31- The miRNA inhibitor for use according to embodiment 30, or the combination of miRNA inhibitors for use according to embodiment 30, wherein the miRNA inhibitor(s) specifically bind(s) to nucleotides at positions 3-21 in 5' to 3' end direction of the selected miRNA / s. 32- A pharmaceutical composition for use in the treatment or prevention of stroke that comprises the miRNA inhibitor as defined in embodiments 11-13, or 26-31, or the combination of miRNA inhibitors as defined in any one of embodiments 14-31.

[0356] 33- The method according to any one of embodiments 1-7, the use according to any one of embodiments 8-10, the miRNA inhibitor for use according to any one of embodiments 11 -13, or 26-31 , the combination of miRNA inhibitors for use according to any one of embodiments 14-31 , or the pharmaceutical composition for use according to embodiment 32, wherein stroke is ischemic stroke.

[0357] 34- The method according to any one of embodiments 1-7 or 33, the use according to any one of embodiments 8-9, the miRNA inhibitor for use according to any one of embodiments 11-13, or 26-31 or 33, the combination of miRNA inhibitors for use according to any one of embodiments 14-31 or 33, or the pharmaceutical composition for use according to embodiment 32 or 33, wherein the patient is a non-Asian subject, particularly is a Caucasian subject, more particularly a European Subject or a European American subject.

[0358] For completeness, the present description is also disclosed in the following clauses:

[0359] 1- An in vitro method for determining the prognosis of a patient with stroke comprising:

[0360] (i) determining, in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a and combinations thereof,

[0361] (ii) comparing the level of expression obtained in step (i) with a corresponding reference value, wherein if the expression level determined in step (i) is higher than the corresponding reference value, the patient is considered to have a bad prognosis.

[0362] 2- A method for deciding or recommending whether to initiate a medical regimen in a patient with stroke, the method comprising the steps of:

[0363] (i) determining in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a and combinations thereof,

[0364] (ii) comparing the level of expression obtained in step (i) with a corresponding reference value, wherein if the expression level determined in step (i) is higher than the corresponding reference value, it is decided or recommended to initiate the medical regimen.

[0365] 3- A method for determining the response of a patient already diagnosed with stroke, to a medical regimen for treating stroke, the method comprising the steps of:

[0366] (i) determining in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a and combinations thereof,

[0367] (ii) comparing the expression level obtained in step (i) with the expression level of the same miRNA(s) determined at the start of the medical regimen or at an earlier phase of the medical regimen, wherein a reduced expression level of the miRNA(s) with respect to the expression level at the start of the medical regimen, or at an earlier phase of the medical regimen, is indicative of a good response to the medical regimen.

[0368] 4- The method according to any one of clauses 1-3 wherein step (i) comprises determining the expression level of miR-376c-3p and miR-199a.

[0369] 5- The method according to any one of clauses 1-4, wherein step (i) further comprises determining the expression level of at least one miRNA selected from the group consisting of: miR134-5p, miR-4463, miR-584-5p and combinations thereof. 6- The methods according to any of the previous clauses, wherein the sample is a blood sample, particularly a plasma sample.

[0370] 7- Use of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a and combinations thereof, as a biomarker for the prognosis of patient with stroke, or as a biomarker for deciding or recommending whether to initiate a medical regimen in a patient with stroke, or as a biomarker for determining the response of a patient already diagnosed with stroke, to a medical regimen for treating stroke.

[0371] 8- A miRNA inhibitor of a miRNA selected from the list consisting of miR-376c-3p, miR-199a and combinations thereof, for use in the treatment or prevention of stroke in a patient.

[0372] 9- The miRNA inhibitor for use according to clause8 wherein the miRNA inhibitor specifically binds to at least nucleotides at positions 2-7 or 3-8 in a 5' to 3' end direction of the selected miRNA / s.

[0373] 10- A combination of miRNA inhibitors for use in the treatment or prevention of stroke in a patient, wherein the combination of miRNA inhibitors comprises the miRNA inhibitor as defined in any one of clauses 8-9 and further comprises:

[0374] - a miRNA inhibitor of a miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof,

[0375] - two miRNA inhibitors wherein each one is a miRNA inhibitor of a different miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof,

[0376] - three miRNA inhibitors wherein each one is a miRNA inhibitor of a different miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof, particularly wherein each miRNA inhibitor is a miRNA inhibitor of a different miRNA selected from the group consisting of miR134-5p, miR-4463 and miR-584-5p.

[0377] 11- The combination of miRNA inhibitors for use according to clauselO wherein the miRNA inhibitor / s specifically bind / s to at least nucleotides 2-7 or 3-8 in a 5' to 3' end direction of the selected miRNA / s.

[0378] 12- The miRNA inhibitor for use according to any one of clauses 8-9, or the combination of miRNA inhibitors for use according to any one of clauses 10-11 , wherein at least one miRNA inhibitor is an oligonucleotide.

[0379] 13- The miRNA inhibitor for use according to clause12, or the combination of miRNA inhibitors for use according to clause12, wherein the oligonucleotide is selected from the list consisting of an anti-mlRNA oligonucleotide (AMO), circular oligonucleotide, miRNA sponge, and Tough Decoy (TuD).

[0380] 14- A pharmaceutical composition for use in the treatment or prevention of stroke that comprises the miRNA inhibitor as defined in any one of clauses 8-9 or 12-13, or the combination of miRNA inhibitors as defined in any one of clauses 10-13.

[0381] 15- The method according to any one of clauses 1-6, the use according to clause 7, the miRNA inhibitor for use according to any one of clauses 8-9 or 12-13, the combination of miRNA inhibitors for use according to any one of clauses 10-13, or the pharmaceutical composition for use according to clause14, wherein stroke is ischemic stroke.

[0382] Throughout the description and claims the word "comprise" and variations of the word, are not intended to exclude other technical features, additives, components, or steps. Furthermore, the word "comprise” encompasses the case of "consisting of'. Additional objects, advantages and features of the invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the invention. The following examples are provided by way of illustration, and they are not intended to be limiting of the present invention. Furthermore, the present invention covers all possible combinations of particular and preferred embodiments described herein.

[0383] Examples

[0384] A- MiRNAs identification

[0385] Example 1- Materials and Methods

[0386] 1.1. Study design

[0387] A study with 406 acute ischemic stroke (IS) patients was conducted. A first discovery study was performed in 215 patients with acute IS by screening 2083 circulating miRNA. A differential expression analysis was performed, and a pathway enrichment analysis with those differentially expressed miRNA. This phase was followed by a replication stage in 191 patients of 26 selected candidate miRNAs (Figure 1).

[0388] 1.2. Setting and participants

[0389] 1.2.1. Discovery cohort

[0390] This cohort of acute IS patients was a subset of individuals nested within the BASICMAR Register (consecutive patients assessed in Hospital del Mar of Barcelona from 2009-2018 with diagnosis of stroke, ISCIII, No. PI051737). The specifics of the selection criteria are as follows.

[0391] Selection criteria for Discovery and Replication cohorts

[0392] The discovery cohort is a cohort of acute IS patients nested within the BASICMAR Register (consecutive patients assessed in Hospital del Mar of Barcelona from 2009-2018 with diagnosis of stroke, ISCIII, No. PI051737). The inclusion criteria for this study were: (1) diagnosis of IS, confirmed in brain imaging with computed tomography or magnetic resonance imaging; (2) initial stroke severity higher than 2, according to the National Institutes of Health Stroke Scale (NIHSS); (3) hospital admission during the first 24 hours since IS onset ; (4) availability of clinical data supporting the assigned stroke subtype according to Trial of ORG 10172 in Acute Stroke Treatment (TOAST) classification2; (5) information on NIHSS score at 24 hours after stroke; (6) previous functional independence before the stroke, defined as modified Rankin Scale (mRS) lower than 3; (7) information on post-stroke functional status at 3 months (or alternatively between 3 to 6 months); (8) availability of plasma samples, and (9) absence of confounding illness such as neoplasm, demyelinating and autoimmune diseases, or vasculitis. All patients were assessed and classified by a neurologist.

[0393] Individuals with stroke recurrence during the follow-up period were excluded. Cerebellar and brainstem location and lacunar strokes were also excluded, given that in these locations there is a poor correlation between infarct size and clinical symptoms, and therefore, functional outcomes. In these cases, the recovery process might rely too heavily on the randomness of the stroke's location and not as much on the underlying biological recovery processes, obscuring and distorting the potential effect of the epigenetic contribution to the degree of recovery. Replication cohort met the same inclusion and exclusion criteria as the discovery cohort, except for the NIHSS score at 24 hours threshold that was greater than 3 to enrich the cohort with more severe cases. This approach aims to leave room or margin for differences in patients' recovery capabilities to manifest. We enrolled new patients from four independent cohorts of different institutions: Hospital del Mar from Barcelona (Basicmar 2 cohort), Albacete University Hospital Complex, Arnau de Vilanova Hospital from Lleida, Son Espases Hospital from Mallorca.1.2.2. Replication cohort

[0394] Replication cohort was established based on four independent cohorts from different institutions: Hospital del Mar from Barcelona (Basicmar 2 cohort), Albacete University Hospital Complex, Arnau de Vilanova Hospital from Lleida, Son Espases Hospital from Mallorca (see Selection criteria for Discovery and Replication cohorts above)

[0395] 1.3. Outcome variables

[0396] Clinical functional outcome was evaluated by a trained neurologist through the modified Rankin scale (mRS) at the 3-month follow-up visit. This scale was recorded with its ordinal values from 0 to 6 for each patient. For the analyses, it was also dichotomized considering good outcome as a mRS from 0 to 2, and poor outcome from 3 to 6. Reperfusion therapy (intravenous recombinant tissue Plasminogen Activator - rtPA- or thrombectomy) was also recorded. All patients followed the standard post-stroke rehabilitation treatment at our institution.

[0397] 1.4. Clinical variables

[0398] Vascular risk factors, defined as recommended by international consensus, were recorded in a direct interview of the patient, relatives or caregivers, as well as from medical records:

[0399] Clinical Variables

[0400] Vascular risk factors, defined as recommended by international consensus, were recorded in a direct interview of the patient, relatives or caregivers, as well as from medical records, as described elsewherel . Examinations were performed and standardized questionnaires administered during the hospitalization by a team of neurologists and reviewed by an additional neurologist. We collected data about age, sex, arterial hypertension (at least two measurements of systolic blood pressure >140 mm Hg or diastolic blood pressure >90 mm Hg previous to stroke), diabetes mellitus (at least two time of admission serum fasting blood glucose levels >126 mg / dL or use of diabetes medication) and hyperlipidemia (cholesterol concentration >220 mg / dL, low-density lipoprotein cholesterol (LDL-c) >130 mg / dL, serum triglyceride concentration >150 mg / dL or use of medication). Glycemia, levels of total cholesterol, high-density lipoprotein cholesterol and LDL-c were obtained via a blood test during hospitalization.

[0401] 1.5. miRNA quantification

[0402] Patients' plasma samples were collected during the first 24h after arrival. In patients receiving rtPA treatment, the sample was collected after its administration. First, peripheral blood samples were extracted in 4.5 mL citrate-treated tubes. Then, the cells were removed by centrifugation for 15 minutes at 2000 x g. The supernatant (plasma) was removed from the cell pellet using a Pasteur pipette, transferred into a 1.8 mL cryogenic vial and stored at -80°C.

[0403] 1.5.1. Discovery phase

[0404] A total of 224 plasma samples were processed at the Institute Valenciano de Oncologla (IVO) Laboratory, in 3 different batches, to perform miRNA sequentiation using HTG EdgeSeq (HTGMolecular Diagnostics, Inc., Tucson, AZ). Nine samples did not pass quality controls (QC) according to HTG criteria, and thus they were not used for subsequent analyses. miRNA quantification in the Discovery phase

[0405] A total of 224 plasma samples were processed at the Instituto Valenciano de Oncologla (IVO) Laboratory, in 3 different batches, to perform miRNA sequentiation using HTG EdgeSeq (HTGMolecular Diagnostics, Inc., Tucson, AZ), a new next-generation sequencing-based miRNA profiling platform (Songia P. et al., 2018). Next-generation-sequencing (NGS) technology has emerged as the preferred platform for studying and discovering novel circulating miRNAs. It enables the simultaneous sequencing of multiple samples. Furthermore, it has higher sensitivity and specificity than other techniques such as microarray or RNA- sequencing technology.

[0406] All samples were run with the HTG EdgeSeq miRNA Whole Transcriptome Assay, which contains probes for 2083 miRNA transcripts. Sequencing was performed on the Illumina NextSeq 550, using the standard NGS protocols. Data were retrieved and analyzed from the sequencer in the form of FASTQ files and processed using the EdgeSeq parser software (HTG Molecular Diagnostics, Inc.) to generate raw counts for 2083 miRNAs per sample. A file containing the final counts for 2083 miRNAs per sample was generated for downstream data analysis.

[0407] Data were generated for the 224 samples. Nine of them did not pass quality controls according to HTG criteria, and thus they were not used for subsequent analyses.

[0408] 1.5.2. Replication phase miRNAs were extracted from 1 OOpil of plasma in 238 patients using the MagMaxTM mirVanaTM Total RNA Isolation Kit (A27828, ThermoFisher Scientific). To prepare cDNA templates for the real-time quantitative polymerase chain reaction (RT-qPCR), TaqMan™ Advanced miRNA cDNA Synthesis Kit (A28007, ThermoFisher Scientific) was used. The RT-qPCR was performed using Taqman™ Fast Advanced Master Mix (4444557, ThermoFisher Scientific) and customized TaqMan™ Array Cards. After QCs, 191 samples and 26 miRNAs were included for analysis. (Supplemental Methods 3.2 and Figure 1). miRNA quantification in the replication phase

[0409] MiRNAs were extracted from 10Opil of plasma in 238 patients using the MagMaxTM mirVanaTM Total RNA Isolation Kit (A27828, ThermoFisher Scientific). The protocol was followed as the manual kit shows with the addition of 4 RNA spike-ins to be used as miRNA extraction controls (ath-miR159a, cel-miR-54- 3p, cel-miR-39-3p, cel-miR-238-3p). After the lysis of the samples and before the addition of the Binding- Beads, 2 l at 0.5|JM of each RNA spike-in were added into each sample. At the end of the protocol, miRNAs were eluded with 50pil of elution buffer and quantified by Qubit.

[0410] Customized TaqMan™ Array Cards included the 41 miRNAs candidates, the 4 RNA spike-ins, 2 hemolysis controls (hsa-miR-451a, hsa-miR-23a-3p) and 1 endogenous control (hsa-miR-16-5p) (Solayman MHM. et al., 2016).

[0411] 1 .6. Bioinformatics & Statistics

[0412] 1.6.1. Descriptive statistics

[0413] Data were reported as mean (± standard deviation), median (interquartile range) and frequency (%) according to the type and distribution of each variable. The 3-month mRS was our study endpoint and it was dichotomized using standard cutoffs: good outcome (0 to 2) and poor outcome (3 to 6).

[0414] Bivariate analyses were first conducted in the discovery cohort aimed to determine which factors (demographic or clinical variables) were associated with stroke outcome in the discovery cohort. To that aim, we used t-, Kruskal-Wallis-, and x2-tests, as appropriate. Those variables that had a significant effect on stroke outcome (p-value < .05) were considered as covariables to include in the models for subsequent analyses.

[0415] 1.6.2. Discovery phase

[0416] 1.6.2.1. Differential miRNA expression analysis

[0417] A differential expression analysis was run to identify which miRNAs were up- or downregulated in cases (poor outcome) as compared to controls (good outcome). DESeq2 was used, which is a R-library intended to analyze count data obtained from omics experiments in an efficient way (Love Ml, et al., 2014; Zhu A, et al., 2019)(see the DESeq2 pipeline and specifics of the analysis below).

[0418] These models were adjusted for age, previous mRS (before IS), 24h NIHSS, sex and rTPA treatment (as both are described to affect miRNA expression profile(He XW et al., 2019, Zhao YY et al., 2015, Xiang W. et al., 2017, Siegel C. et al., 2011, Sharma S. et al., 2014) ), and batch. 24h NIHSS was included instead of initial NIHSS in the adjustment in order to consider the baseline stroke severity as the neurological deficits established after possible acute reperfusion (spontaneous or after reperfusion therapy).

[0419] A total of 869 miRNA were finally included in the analysis. After conducting the analysis, p-values representing the association between stroke outcome and each miRNA were corrected by multiple comparisons according to the False Discovery Rate (FDR), using the Benjamini-Hochberg method.

[0420] The differential expression analysis was repeated also adjusting for the interaction of the main covariates defined above with stroke outcome.

[0421] 1 .6.2.2. Internal validation using bootstrap

[0422] After obtaining the first set of significant miRNAs and doing the enrichment analysis in the discovery phase, we did a bootstrap by running the same DESeq2 pipeline in resampled sets of the original cohort (see details in Supplementary information: Bioinformatics & Statistics, A.2)) This step helped to filter which miRNAs were good candidate for replication.

[0423] 1 .6.2.3. Selection of candidates to replicate

[0424] Those miRNAs that were significant after bootstrap were considered, and with higher FC values, coming up with 41 selected miRNAs for the replication phase.

[0425] 1.6.3. Replication phase

[0426] After obtaining RT-qPCR data, QCs were run for detection rates, call-rates and hemolysis ratio. After this set of QCs, 191 patients and 26 miRNAs were kept for the replication study. Details are explained in Supplementary information Bioinformatics and Statistics, B-).

[0427] Batch effect corresponding to cDNA extraction was removed via the sva library (Leek JT. , et al., 2022)., and subsequent replication models for RNA quantification were also adjusted . Each of the 26 candidate miRNAs that passed QCs was normalized using the housekeeping (hsa-miR-16-5p)as follows: where lower ACt values represent a higher miRNA expression. Normalized Ct values were subsequently used in multivariate regression models, which were adjusted for the same set of covariables that were selected in the discovery phase: age, sex, previous mRS, 24h NIHSS, rTPA treatment and, additionally, RNA quantification. Dichotomized stroke outcome was the predictor of interest, and the adjusted marginal means were calculated for good and poor outcome groups, as well as the fold change. Replication results were also bootstrapped following the same methodology as in the discovery study. A miRNA was considered as replicated when p-value was lower than 0.05 and it was significant after doing the bootstrap.

[0428] 1.6.4. Functional enrichment analysis

[0429] To provide additional insight on which biological functions were regulated by the set of significant miRNAs obtained in the discovery phase, a functional enrichment analysis was run. The predicted target-genes for those miRNAs that had Q-value lower than 0.05 in the previous phase were first obtained. 4 available databases which predict miRNAs-genes relationships using sequence-based prediction algorithms were used: TargetScan v7.2 (Garcia-Moreno A. et al., 2020), miRDB v6 (Agarwal V. et al., 2015), Diana-microT v5 (Paraskevopoulou MD et al., 2013) and PicTar v2 (Krek A. et al., 2005 (see details of full Functional enrichment analysis in Supplementary information Bioinformatics and statistice, C-).

[0430] The biological functions, as indexed on Gene Ontologies (GO) database, that were overrepresented in the set of genes of interest were inferred considering the background universe. The Ensembl database (release 106, April 2022) was queried to identify those GO gene sets that had at least one gene present in the background universe. The three main domains included in GO: biological processes (BP), molecular functions (MF) and cellular components (CO) were considered. The hypergeometric tests (Fisher's exact test) were continued to be done, to determine whether each of these gene-sets was overrepresented in the experiment (TopGO R library). Only those GO entries having between 10 to 800 nodes were considered . Results were FDR-corrected.

[0431] Clusters were then annotated, using the auto-annotate plug-in included in Cytoscape (version 3.9.1), although all text annotations were revised and modified when necessary, based on the literature regarding those GO entries.

[0432] Hierarchical cluster algorithm was used to find groups of miRNAs with similar functions (Euclidian norm as distance metric and Ward as link function).

[0433] An enrichment analysis was finally conducted in the set of replicated miRNAs and a functional network was built in which the links between replicated miRNAs, their genetic targets and families of biological pathways could be seen (Supplementary information Bioinformatics and Statistics, C).

[0434] 1.6.5 Supplementary information: Bioinformatics & Statistics

[0435] A- Discovery phase

[0436] A. 1 Differential miRNA expression analysis

[0437] To identify which miRNAs were differentially expressed in the two groups, DESeq2 (R-library) was used. The DESeq2 pipeline normalizes data by dividing each count by sample-specific size factors determined by the median ratio of miRNA counts relative to the geometric mean per miRNA. Then, it fits negative binomial models for each miRNA to obtain fold change (FC) values representing the difference in the expression between cases and controls, after calculating an estimate of features dispersion using a local fit. 7 miRNAs with outlier dispersion values were excluded from the analysis.

[0438] Regarding batch effect, it was detected by doing principal components analysis (PCA) in the miRNA dataset, and plotting the first component against the second one according to the technical run. Moreover, several statistical assumptions are checked in the context of DESeq2 pipeline. Specifically those miRNA with low-count features were excluded, and those with outlier dispersion values.

[0439] The differential expression analysis was repeated also adjusting for the interaction of the main covariates defined above with stroke outcome. This analysis intended to check whether the candidate miRNAs were associated with the functional status at the third month in the whole sample or just in specific strata.

[0440] Continuous variables (age and NIHSS at 24h) were categorized into tertiles to facilitate the interpretation of these interactions.

[0441] A 2. Internal validation using bootstrap

[0442] After obtaining the first set of significant miRNAs and doing the enrichment analysis in the discovery phase, a bootstrap was performed by running the same DESeq2 pipeline in resampled sets of the original cohort, aiming to check whether the observed associations were biased due to outlier observations or other sources of error that can be corrected by resampling with replacement. After 1000 iterations, a new distribution was obtained, of p-coefficients for each miRNA-stroke outcome relationship that was significant in the previous step. In these distributions, 2.5 and 97.5 percentiles (a=.O5) were taken to check whether miRNAs were significantly associated with stroke outcome after the bootstrap. This step helped to filter which miRNAs were good candidate for replication.

[0443] B- Replication phase

[0444] After obtaining RT-qPCR data, quality controls (QCs) were run. First, those samples in which at least one of the 4 RNA spike-ins or the housekeeping miRNA (cycle threshold [Ct] value >35, N=6) were not detected, were excluded. Then, the hemolysis ratio (miR-451a / mlR-23a ratio) was checked, which should be lower than 60, excluding no samples regarding this QC. Those miRNAs being not detected in at least 80% of samples, were also filtered, excluding 15 miRNAs from the subsequent analyses. Finally, patients with a call-rate lower than 80% were excluded. After this set of QCs, 191 patients and 26 miRNAs were kept for the replication study.

[0445] The batch effect was also detected by doing the PCA of the raw Ct values of the 26 miRNAs and plotting the first two components. Thereby, a batch effect was identified, corresponding to cDNA extraction which was subsequently removed via the sva library. Finally, a second PCA was done, on the batch-corrected Ct values, and the main two components with the RNA quantification measured by Qubit were correlated, finding that there was an effect of RNA quantification on global RT-qPCR results. Therefore, subsequent replication models for RNA quantification were adjusted.

[0446] C- Functional enrichment analysis

[0447] To run the functional enrichment analysis, the recommendations from previous studies were followed, and more than one database was used to reduce the number of false positives obtained from the queries. Specifically, only those predicted target-genes that were present in at least 2 out of 4 databases were kept. Queries were run for both significant miRNAs and panel background (N=2076 miRNAs) using a R- library designed for this purpose (Ru Y. et al., 2014). Additionally, only the top 20% predictions from each database were kept as candidate target-genes to achieve a high-quality set of miRNA-gene relationships.

[0448] The biological functions, as indexed on Gene Ontologies (GO) database, that were overrepresented in the set of genes of interest were inferred, considering the background universe. The Ensembl database (release 106, April 2022) was queried to identify those GO gene sets that had at least one gene present in our background universe. The three main domains included in GO were considered: biological processes (BP), molecular functions (MF) and cellular components (CO). Hypergeometric tests (Fisher's exact test) were continued to be done, to determine whether each of these gene-sets was overrepresented in the experiment (TopGO R library). Only those GO entries having between 10 to 800 nodes were considered. Results were FDR-corrected.

[0449] To provide insight on which broad functions were overrepresented in the study and summarize the results, the similarity between the significant GO pathways (FDR-corrected p-value < 0.05) obtained in the previous step was calculated by applying the following formula: Similarityij = N^ij genes — ij genes Where ij represent two GO pathways. That is, the total number of genes resulting from the union of genesets divided by its intersection. An enrichment map (non-directed graph) was continued to be constructed, where significant GO pathways were introduced as nodes and edges between nodes were weighted according to this similarity index explained above. Cytoscape (version 3.9.1) was used to view this graph. To find clusters of highly related GO gene-sets, those edges having a similarity index equal or higher than 0.25 and those nodes with a p-value < 10-5 were filtered. Clusters were then annotated using the autoannotate plug-in included in Cytoscape, although all text annotations were revised and modified when necessary, based on the literature regarding those GO entries.

[0450] Using the set of GO entries obtained with Cytoscape, annotated according to the similarity clusters, the number of miRNA target-genes were obtained for each pathway and were represented as a heatmap to visualize in which broad functions were involved each significant miRNA. This count was log-normalized and corrected by the number of target-genes of each miRNA and pathway size for a correct visualization, such that miRNAs with many targets or gene-sets with many nodes were penalized. Finally, hierarchical cluster algorithm was used to find groups of miRNAs with similar functions (Euclidian norm as distance metric and Ward as link function).

[0451] An enrichment analysis was finally conducted in the set of replicated miRNAs following the same methodology as used in the discovery study and, thus, obtaining the clusters or families of pathways in which a miRNA is involved by using the genetic targets obtained at the discovery stage. It was also aimed to build a functional network in which the links between replicated miRNAs could be seen, their genetic targets and families of biological pathways. Links between miRNAs and target-genes were weighted according to whether a miRNA-gene relationship has been validated via experimental studies. The 'mlRNetR' library was used to know the number of manuscripts which validated a miRNA target and scaled this number from 0 to 1 for each miRNA-target relationship. The strength of the links between genes and families of pathways was weighted calculating the number of individual GO entries within a single family that each gene is involved, and scaling this number in the range from 0 to 1 .

[0452] Example 2-. RESULTS

[0453] 2.1. Discovery phase

[0454] 2.1.1. Demographics

[0455] In the discovery phase we evaluated 215 patients with IS. Demographic and clinical characteristics are summarized in Table 1. Average age was 74.7 (±10.2), 118 (54.9%) were men and 142 individuals had a previous mRS of 0. As expected in stroke a cohort, we observed a high prevalence of vascular risk factors. Median initial NIHSS was 9 (interquartile range [IQR] = 5-18), and 75 (34.9%) subjects received intravenous rTPA treatment, while 19 (8.8%) received mechanical thrombectomy. Regarding stroke prognosis, 133 patients (61.9%) had a poor outcome at discharge, while 114 (53%) had a poor outcome at 3 months.

[0456] Demographical and clinical characteristics of discovery cohort

[0457] Table 1. Demographical and clinical characteristics of discovery cohort. Data are reported as mean (± standard deviation), median (interquartile range) and frequency (%) according to the type and distribution of each variable. Column on the right shows the p-values from bivariate analysis between each covariate and stroke outcome.

[0458] In the univariate analysis (Table 1), we found that age, stroke severity (measured by initial and 24h NIHSS) and previous mRS variables were all significantly associated with 3-month outcome (all p-value < 0.05).

[0459] 2.1.2. Differential expression analysis

[0460] The differential miRNA expression analysis was done adjusting for age, 24h NIHSS, previous mRS, sex and rTPA treatment. After QC, a total of 869 miRNAs were analyzed in the 215 patients of the discovery cohort. 74 miRNAs were found below Q-value < 0.05 . All these miRNAs were overexpressed in patients with poor outcome, with FC values ranging between 1.2 and 2.2. Differences in expression between patients with good and poor prognosis in the subset of miRNAs having a FC higher than 1 .5 are visually represented in Figure 2-B. Interestingly, these candidate miRNAs were highly positively correlated. 2.1.3. Internal validation

[0461] After bootstrapping results, 64 miRNAs maintained their significant association with stroke outcome (Figure 2-A). The differential expression analysis was repeated in the subset of 64 significant miRNAs after bootstrap but also adjusting for the interaction of main covariables with stroke outcome. Only significant interactions for age (Q-value < 0.05) were found. To visualize these results, age was categorized according to the tertile distribution, and 7 miRNAs were found to significantly interacted with age, 6 of them being overexpressed mainly in younger patients with poor prognoses (45-72 years old), while the other showed the opposite trend. These results suggest that most miRNA candidates were upregulated in the whole sample and the link with stroke outcome was not conditioned by other variables. 2.2. Replication phase

[0462] 2.2.1. Selection of the miRNAs to be replicated

[0463] 41 miRNAs were selected for replication based on FC values and pathway analysis results (Table 2). Following QCs procedures, 26 miRNAs underwent evaluation in 191 patients. Demographic and clinical characteristics of the replication cohort are summarized in Table 3. As expected, higher NIHSS values were observed in the replication cohort because more severe strokes were selected in the selection criteria of this stage, ved A higher number of thrombectomies was observed as well. Table 2: Differentially expressed miRNAs after internal validation in the discovery phase. Marks show which miRNA were selected for replication, and if the decision was based on fold change (FC) values or on pathway analysis (PA).

[0464] Demographic and clinical characteristics of the replication cohort Table 3. Demographic and clinical characteristics of the replication cohort. Data are reported as mean (± standard deviation), median (interquartile range) and frequency (%). P-values show if there are differences between discovery and replication cohorts.

[0465] 2.2.2. Differential expression analysis The correlation between the 26 candidate miRNAs was first explores, finding that all candidates were highly correlated, as they were in the discovery cohort . The expression of these candidates was then compared between patients with good and poor prognosis. After adjusting for the same confounders as selected at the discovery phase, all miRNAs were found to be overexpressed in patients with poor outcome (lower AACt values), with five of these showing statistical significance at the nominal level (p- value < 0.05): miR-376c-3p, miR-4463, miR-134-5p, miR-199a-3p, miR-584-5p (Figure 4). After bootstrapping the results, the same 5 significant miRNAs were observed (Figure 4-B). Figure 4-0 represents the difference in the expression of those miRNAs depending on the outcome. On the other hand, one of the replicated candidates (miR-134-5p) was found to be associated with stroke prognosis mainly in females (Figure 4-D).

[0466] 2.3. Pathway analysis

[0467] 2.3.1 Pathway analysis of the significant miRNAs in the discovery phase

[0468] After merging the predictions from four different databases, annotations for 53 out of 74 significant miRNAs were found and this represented 2476 unique target genes, involving 4223 miRNA-gene relationships. These 2476 targets received a median input of 1 miRNA (1-2) and each miRNAs targeted a median number of 30 genes (14-81). Valid genetic targets were found for 1090 miRNAs which annotated to 10079 unique target genes based on 77446 miRNA-gene interactions.

[0469] 425 significant GO pathways were found overrepresented in the gene-set after applying FDR correction. Specifically, 350 pathways were significant for BP-GO, 42 for GO-GO and 33 for MF-GO.

[0470] An enrichment map was then constructed and the significant GO entries annotated to clusters based on their similarity (genes in common). Interestingly, several of these clusters grouped GO entries related to biological processes such as angiogenesis, neuron morphogenesis, transforming growth factor beta (TGF- |3), endothelial development and cognition, which all have been associated with stroke recovery. Regarding cellular component, many nodes were annotated to neuronal and synaptic GO entries.

[0471] As one miRNA might interact with more than one genetic target, it was aimed to calculate how many target genes had the 53 significant miRNAs with valid annotations for each significant pathway (Figure 3). Applying the hierarchical cluster algorithm, a small cluster of four miRNAs was found to have higher counts in pathways related to Angiogenesis function, Synapsis cellular component, cognition and neuron morphogenesis. There were also two bigger clusters on cardiac muscle proliferation, and another group involved in TGF-p response related pathways.

[0472] 2.3.2. Pathway analysis of the replicated miRNA

[0473] Finally, the second pathway enrichment analysis with the genetic targets of the five replicated miRNAs showed 353 unique target-genes involved in 135 significant GO entries (Q-value < 0.05). As in the discovery study, these GO entries were clustered onto several families of biological processes based on their genes in common and it was checked which clusters were enriched for each of the replicated miRNAs (Figure 5-A). Several groups of GO entries observed in the discovery study were confirmed, such as TGF-p response or learning and memory. The miR-199a-3p miRNA exhibited the highest involvement in numerous biological processes, followed by miR-376c-3p and miR-134-5p. These miRNAs are part of the same group of miRNAs, sharing similar functions. On the other hand, miR-584-5p was mainly involved in learning and memory GO entries. Finally, miR-4463 is related to protein signal transduction, serine phosphatase regulator and steroid hormones. Moreover, the links between validated miRNAs, target genes and families of GO entries as an acyclic graph, were represented, weighting the links between miRNAs and genes according to the scientific evidence validating that relationship (Figure 5-B). Interestingly, miR-199a-3p was the miRNA with more validated genetic targets, followed by miR-134-5p and miR-376c-3p. MiR-4463 is the most unknown of those significant miRNAs, it does not have validated genetic targets.

[0474] B- Experimental data with model disease

[0475] Example 3- NEURONAL MODEL (SH-SY5Y)

[0476] 3.1 Materials and methods

[0477] SH-SY5Y cells were used as neuronal model for evaluating the potential neuronal damage caused by the expression of miR-199a-3p and mir376c-3p under hypoxic and normoxic conditions. All experiments in this example 3 are made with SH-SY5Y cells. SH-SY5Y cells were obtained from cell line biobank of our institution (Hospital del Mar Research Institute) and were routinely cultured in Dulbecco's Modified Eagle Medium (DMEM) and F12 (1 :1) supplemented with 10% fetal bovine serum (FBS), 100 unit / mL penicillin and 100 pg / mL streptomycin. The cultures were maintained in a humidified 37°C incubator with 5% CO2 and the medium was changed every 2-3 days.

[0478] 3.1.1- . miRNAs mimics & inhibitors transfection (miR-199a-3p & mir376c-3p)

[0479] Hsa-miR-199a-3p and hsa-miR-376c-3p mimics (MedChemExpress®, HY-R00398 and HY-

[0480] R00840, respectively) were used in the assays in this section 3, which are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by upregulation of miRNA activity. On the other hand,hsa-miR-199a-3p and hsa-miR-376c-3p inhibitors (MedChemExpress®, HY-RI00398, HY-RI00840, respectively) were used in the assays in this section 3, which are chemically-modified oligonucleotides that hybridize with mature miRNAs. Said miRNA inhibitors consist of SEQ ID NO. 2 and SEQ ID NO: 1, respectively. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification and strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

[0481] Cells were reverse transfected using Lipofectamine RNAIMAX transfection reagent (13778075,

[0482] I nvi trogen™) with 1 .2 pmol / well of mimic or transfection control (Fluorescent control BLOCK-IT™ Alexa Fluor™ Red, 14750100, ThermoFisher) and 0.2ul / well of lipofectamine in 96 well-plate. Afterwards, part of the cells were exposed to hypoxia (hypoxic chamber) for 6 hours in glucose-free medium to simulate stroke. The other part of the cells were cultured under normoxia conditions with standard medium. Twenty-four hours after mimic transfection, the scratch assay is performed.

[0483] 3.1.2. Scratch assay A scratch is made in the middle of the well, and a photo is taken at 0 hours. The following days, photos are taken at 24 and 48 hours. The images are analyzed using Imaged with the wound healing size tool (Suarez-Arnedo A et al., PLoS One, 15(7):e0232565, 2020), )

[0484] 3.1.3. qPCR

[0485] To test efficiency of miRNA inhibitors, cells were transfected with the miR-199a-3p or mir376c-3p miRNA MIMICS as indicated in 3.1.1 just above, and twenty-four hours after mimic transfection, the corresponding miRNA inhibitors (see above) were forward transfected using RNAIMAX kit (Invitrogen). Four different conditions were tested:

[0486] • Condition 1 : 3 pmol of inhibitor + 0.3ul lipofectamine per well

[0487] • Condition 2: 6 pmol of inhibitor + 0.3ul lipofectamine per well

[0488] • Condition 3: 4.4 pmol of inhibitor + 0.4ul lipofectamine per well

[0489] • Condition 4: 6 pmol of inhibitor + 0.4ul lipofectamine per well

[0490] 48 hours after transfection with the inhibitor, the cells are collected and RNA is extracted. A reverse transcription reaction is performed with TaqMan™ microRNA Reverse Transcription Kit (4366596, ThermoFisher), and the expression levels are evaluated by qPCR with TaqMan Fast Advanced Master Mix (4444558, ThermoFisher) using Taqman primer oligos for miR199a-3p and miR376c-3p (ThermoFisher catalog ID 002304 for miR199a-3p, and ThermoFisher catalog ID 002122 for miR376c-3p)..

[0491] 3.2 RESULTS

[0492] 3.2.1. mir199a-3p and mir376c-3p expression decreases the wound closure in scratch assay

[0493] Results show a delay in the scratch closure after transfection with miR-376c-3p mimics under normoxic conditions at 24h, but not with miR-199a-3p, and that complete closure is obtained with both miRNAs at 48h (Figure 6). However, under hypoxic conditions (Figure 7), which mimic stroke conditions, there is a delay of wound closure for both miRNA at 24h, and a decrease in the wound closure capacity at 48 hours post-transfection of miR-199a-3p mimic and especially miR-376c-3p mimic, which is not detected under normoxic conditions.These data support the negative effect of miR-199a-3p and miR-376c-3p in stroke recovery.

[0494] 3.2.2 The inhibitors reduce the expression of the miRNAs

[0495] The results of qPCR show a reduction in the expression of both miRNAs after transfection together with their specific inhibitors, with a decrease of up to 2 CTs (Cycle Threshold) in the case of miR-199a-3p. Table 4 shows the CT values of miRNA expression after inhibitor transfection, where four different transfection conditions (lipofectamine and inhibitor concentrations) were tested. In all cases, the mimics were transfected in the same way, and the effect of the different inhibitors conditions (1-4, explained at methods section 3.1.3) was then evaluated. Notably, transfecting the inhibitor 24 hours after the transfection of the mimic can lead to a reduction of up to four times (equivalent to 2 CTs). Additionally, at the basal level (C+), the model does not express miR-376c-3p and shows very low expression of miR- 199a-3p.

[0496] Table 4. CTs of the miRNAs expression after the inhibitor transfection. 199-mimic: Transfection with miR199a-3p; 199_1-4: Transfection with miR199a-3p + inhitor against miR199a-3p; 376-mimic: Transfection with miR376c-3p; 376_1 -4: Transfection with miR376c-3p + inhibitor against miR376c-3p, C+: Transfection with RNA control.

[0497] Example 4- CEREBRAL ENDOTHELIUM MODEL (hCMEC)

[0498] 4. 1. Materials and methods

[0499] The studies in this cellular model (hCMEC ) have focused on YAP1 (Yes-associated protein 1) as possible indicator of stroke recovery in the presence of miR199a-3p and / or its inhibitor, as YAP1, a coactivator of the Hippo signaling pathway, plays a key role in regulating mechanical forces in the vascular system, as well as in angiogenic responses (Boopathy GTK and Hong W (2019) Role of Hippo Pathway-YAP / TAZ Signaling in Angiogenesis. Front. Cell Dev. Biol. 7:49.). On the one hand, angiogenesis is an important protective mechanism that promotes neural regeneration and functional recovery during the pathophysiological process of stroke. It improves hemodynamics, promotes vascular remodeling and recovery of neurovascular function after ischemic stroke (Fang J, Wang Z, Miao CY. Angiogenesis after ischemic stroke. Acta Pharmacol Sin. 2023 Jul;44(7): 1305-1321. doi: 10.1038 / s41401 -023-01061-2. Epub 2023 Feb 24.). On the other hand, stiffness of vascular system contributes to ischemic stroke and it's a predictor of the long-term functional outcome in ischemic stroke patients (Louka AM, Sagris D, Ntaios G. Immunity, Vascular Aging and Stroke. Curr Med Chem. 2022;29(34):5510-5521; Fu X, Chu C, Li X, Gao Q, Jia J. Cerebral arterial stiffness for predicting functional outcome in acute ischemic stroke. Hypertens Res. 2019 Dec; 42(12): 1916-1922.). Thus, YAP1 appears as a possible indicator of stroke recovery, particularly of IS recovery.

[0500] - Cell Cultures: Immortalized human brain microvascular endothelial cells (hCMEC / D3), kindly provided by Dr. Anna Rosell Laboratory (Vail d'Hebron Institute of Research, Barcelona), were cultured in Lonza EBM-2 medium (Lonza, Walkersville, MD, USA) supplemented with the EGM-2 SingleQuots that contains 2% fetal bovine serum, hydrocortisone, human basic fibroblast growth factor, vascular endothelial growth factor, R3-insulin-like growth factor-1, ascorbic acid, human epidermal growth factor, Gentamicin sulfate- Amphotericin (GA-1000) and heparin (Lonza, Walkersville, MD, USA) in flasks coated with rat tail collagen type I (Corning, NY). The cultures were maintained in a humidified 37°C incubator with 5% CO2 and the medium was changed every 2-3 days.

[0501] - MiRNA nucleofection: Electroporation was performed with the Amaxa Technology (Lonza). hCMEC / D3 cells, grown in 25 cm2 flasks at 90% confluency were trypsinized and counted to obtain 4,5x105cells which were transfected with a synthetic human miR-199a-3p molecule (5 nmol miRIDIAN microRNA MIMIC, Dharmacon, catalog ID C-300535-05-0005) or scrambled RNA (5 nmol MIMIC Transfection Control with Dy547, Dharmacon, catalog ID CP-004500-01-05). The transfection was performed with the 4D-Nucleofector System and the P5 Primary Cell Solution Kit (Amaxa, Lonza), according to the manufacturer's protocol. After transfection, cells were incubated for 24 hours in a 6 well-plate prior to be harvested for Western Blotting analysis.

[0502] - Western Blotting and Antibodies: hCMEC / D3 cells were harvested, centrifuged and washed with PBS 1X before being homogenized in RIPA lysis Buffer (50mM Tris pH8, 15mM NaCI, 1mM EDTA pH8, 1% sodium deoxycholate, 0,1% SDS, 1% Trito-X-100) for 2 hours in ice, vortexing every 10 minutes. After the mixture was sonicated and centrifuged at 12.000 x g for 10min at 4°C, the supernatant was collected. Total protein quantitation was determined using the DC™ Protein assay kit (Biorad) following manufacturer's instructions. Protein samples were mixed with NUPAGE LDS sample Buffer (4X) (Invitrogen) and boiled at 70°C for 10 min. For WB analysis, Twenty micrograms of hCMEC / D3 cell lysates proteins were resolved by NuPAGE 4-12% Bis-Tris Gel (Invitrogen) electrophoresis and immobilized on polyvinylidene fluoride (PVDF) membranes 0,45pm pore size (Merk, Darmstadt, Germany). Primary antibodies: rb anti-YAP (Cell Signalling, ref 14074S) and anti-YAP / TAZ (Cell Signalling, ref 8418S), and rb anti-GAPDH (Cell signalling, ref 2118L), purchased from Cell Signaling. Secondary antibodies: anti-rb 800CW and anti-ms 700CW (LI-COR Biosciences). Proteins were visualized with fluorescence using Odyssey Imaging Systems (LI-COR Bioscience, Lincoln, NB, USA). The quantification of the bands was obtained with Imaged software (National Institutes of Health, NIH).

[0503] 4.2. Results

[0504] 4.2.1. miRNA 199a-3p induces the depletion of YAPI

[0505] The analysis through WB strongly suggested that the overexpression of the miR-199a-3p MIMIC induces YAP1 depletion in hCMEC cells. Figure 8(B) represents the relative quantification of the target genes analyzed from four different blots. Figure 8(A) shows the variation in YAP expression in cells transfected with scramble and mimic of the miR-199a-3p. It is noticed that mimic transfection causes a downregulation of YAP. This data also supports the negative effect of miR-199a-3p in stroke recovery.

[0506] 4.2.2. Hippo Pathway-YAP / TAZ is involved in angiogenesis

[0507] As indicated above, YAP1, is considered a to play a key role in regulating mechanical forces in the vascular system, as well as in angiogenic responses

[0508] Figure 9 shows that YAP1 negatively regulates actin fibers promoting stiffness of the cells. Immunofluorescence of phalloidin (Figure 90) shows that cell morphology changes depending on YAP expression. When YAP is suppressed (KO), filaments in the cells increase and also its stiffness. Moreover, Figure 9D shows the results of Young's Modulus that measure the ability of the cells to withstand changes in length when under lengthwise tension or compression, indicating that YAP-KO presents higher stiffness. These data thus support that YAP1 has multiple functions that contribute to stroke recovery, and that accordingly, inhibition of YAP1 (as shown above by miR199a-3p) negatively affects stroke recovery.

[0509] Altogether, these data support the negative role of miR199a-3p and miR376c-3p in stroke recovery, and accordingly, that efficient inhibition of said miRNAs and thus abrogation of this negative effect on stroke recovery, is to promote stroke recovery.

[0510] References

[0511] - Dowdy and Wearden, Statistics for Research, John Wiley and Sons, New York, 2004

[0512] - Jaegil Kim et al. “Racial Differences in Expression Levels of miRNA Machinery-Related Genes, Dicer, Drosha, DGCR8, and AGO2, in Asian Korean Papillary Thyroid Carcinoma and Comparative Validation Using the Cancer Genome Atlas" , International Journal of Genomics, 2017;

[0513] - Xianglin Yang et al., “Association ofmiR-27a polymorphism with the risk of digestive system cancers", Pathol Res Pract, 216(10): 153115, 2020.

[0514] - H.P. Adams Jr. et al., Baseline NIH Stroke Scale score strongly predicts outcome after stroke: A report of the Trial of Org 10172 in Acute Stroke Treatment (TOAST). Neurology July 1, 1999 vol. 53 no. 1 126

[0515] - Burtis C. A. et al., 2008, Chapter 14, section "Statistical Treatment of Reference Values”

[0516] - Erdogan C. et al., A Bioinformatics Analysis ofcircRNA / miRNA / mRNA Interactions in Acute Myeloid Leukemia, Experimed 2023; 13(1): 45-53. - Stanzione R, Cotugno M, Bianchi F, Marchitti S, Forte M, Volpe M, et al. Pathogenesis of ischemic stroke: Role of epigenetic mechanisms. Vol. 11 , Genes. MDPI AG; 2020;

[0517] - Love Ml, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014 Dec 5; 15(12).

[0518] - Zhu A, Ibrahim JG, Love Ml. Heavy-Tailed prior distributions for sequence count data: Removing the noise and preserving large differences. Bioinformatics. 2019 Jun 1 ;35(12):2084— 92

[0519] - Guo H, Ingolia NT, Weissman JS, Bartel DP. Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature. 2010 Aug 12;466(7308):835— 40

[0520] - Kaminski M. M., Omar O. Abudayyeh, Jonathan S. Gootenberg, Feng Zhang & James J. Collins, CRISPR-based diagnostics. Nature biomedical Engineering, 2021 , 643:656

[0521] - Rotkrua P, Shimada S, Mogushi K, Akiyama Y, Tanaka H, Yuasa Y. Circulating microRNAs as biomarkers for early detection of diffuse-type gastric cancer using a mouse model. Br J Cancer. 2013 Mar 5; 108(4):932— 40

[0522] - Hammond S.M. et al., “Delivery of oligonucleotide-based therapeutics: challenges and opportunities." , EMBO Mol. Med. 13(4) 2021 ; D0l:10.15252 / emmm.202013243

[0523] - Lima J.F. et al., “Anti-miRNA oligonucleotides: a comprehensive guide for design." RNA Biol. 2018; 15: 338-352.

[0524] - K.A. Lennox, Richard Owczarzy, Derek M Thomas, Joseph A Walder, Mark A Behlke, "Improved performance of Anti-miRNA oligonucleotides using a novel non-nucleotide modifier, molecular therapy”, Nucleic Acids 2 (2013) e117

[0525] - Erdogan C., Murat KAYA and llknur SUER, A Bioinformatics Analysis of circRNA / miRNA / mRNA Interactions in Acute Myeloid Leukemia, Experimed 2023; 13(1): 45-53

[0526] - Takeshi Haraguchi, Yuka Ozaki, and Hideo Iba., “Vectors expressing efficient RNA decoys achieve the long-term suppression of specific microRNA activity in mammalian cells". Nucleic Acids Res, 2009, 37: e43

[0527] - Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-68

[0528] - Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77

[0529] - Altschul, et al. (1990) J. Mol. Biol. 215:403-10

[0530] - Altschul et al, (1997) Nucleic Acids Res. 25(17):3389-3402

[0531] - Songia P. et al., Direct screening of plasma circulating microRNAs, RNA Biol., 2018; 15(10): 1268-1272

[0532] - Solayman MHM, Langaee T, Patel A, El-Wakeel L, El-Hamamsy M, Badary O, et al. Identification of Suitable Endogenous Normalizers for qRT-PCR Analysis of Plasma microRNA Expression in Essential Hypertension. Mol Biotechnol. 2016 Mar 1 ;58(3): 179-87

[0533] - He XW, Shi YH, Liu YS, Li GF, Zhao R, Hu Y, et al. Increased plasma levels of miR-124-3p, miR-125b-5p and miR-192-5p are associated with outcomes in acute ischaemic stroke patients receiving thrombolysis. Atherosclerosis. 2019 Oct 1 ;289:36— 43.

[0534] - Zhao YY, Wang WA, Hu H. Treatment with recombinant tissue plasminogen activator alters the microRNA expression profiles in mouse brain after acute ischemic stroke. Neurological Sciences. 2015 Aug 28;36(8): 1463-70.

[0535] - Xiang W, Tian C, Lin J, Wu X, Pang G, Zhou L, et al. Plasma let-7i and miR-15a expression are associated with the effect of recombinant tissue plasminogen activator treatment in acute ischemic stroke patients. Thromb Res. 2017 Oct 1 ; 158:121-5. - Siegel C, Li J, Liu F, Benashski SE, McCullough LD. miR-23a regulation of X-linked inhibitor of apoptosis (XIAP) contributes to sex differences in the response to cerebral ischemia. Proc Natl Acad Sci U S A. 2011 Jul 12; 108(28): 11662-7.

[0536] - Sharma S, Eghbali M. Influence of sex differences on microRNA gene regulation in disease. Vol. 5, Biology of Sex Differences. BioMed Central Ltd.; 2014.

[0537] - Leek JT, Johnson WE, Parker HS, Ertif EJ, Jaffe AE, Zhang Y, et al. Package "sva” Title Surrogate Variable Analysis [Internet], 2022. Available from: https: / / git.bioconductor.org / packages / sva

[0538] Garcia-Moreno A, Carmona-Saez P. Computational methods and software tools for functional analysis of mirna data. Vol. 10, Biomolecules. MDPI AG; 2020. p. 1-16

[0539] - Agarwal V, Bell GW, Nam JW, Bartel DP. Predicting effective microRNA target sites in mammalian mRNAs. Elife. 2015

[0540] - Paraskevopoulou MD, Georgakilas G, Kostoulas N, Vlachos IS, Vergoulis T, Reczko M, et al. DIANA- microT web server v5.0: service integration into miRNA functional analysis workflows. Nucleic Acids Res. 2013;41

[0541] - Krek A, Grin D, Poy MN, Wolf R, Rosenberg L, Epstein EJ, et al. Combinatorial microRNA target predictions. Nat Genet. 2005 May; 37 (5): 495-500.

[0542] - Ru Y. et al., The multiMiR R package and database: integration of microRNA-target interactions along with their disease and drug associations, Nucleic Acids Res, 2014; 42(17):e133

[0543] Suarez-Arnedo A, Torres Figueroa F, Clavijo C, Arbelaez P, Cruz JC, Munoz-Camargo C. An image J plugin for the high throughput image analysis of in vitro scratch wound healing assays. PLoS One. 2020 Jul 28; 15(7):e0232565. doi: 10.1371 / journal.pone.0232565. PMID: 32722676; PMCID: PMC7386569.

[0544] Boopathy GTK and Hong W (2019) Role of Hippo Pathway-YAP / TAZ Signaling in Angiogenesis. Front. Cell Dev. Biol. 7:49. doi: 10.3389 / fcell.2019.00049

[0545] Fang J, Wang Z, Miao CY. Angiogenesis after ischemic stroke. Acta Pharmacol Sin. 2023 Jul;44(7): 1305-1321. doi: 10.1038 / s41401-023-01061-2. Epub 2023 Feb 24. PMID: 36829053; PMCID: PMC 10310733.

[0546] Louka AM, Sagris D, Ntaios G. Immunity, Vascular Aging and Stroke. Curr Med Chem. 2022;29(34):5510-5521. doi: 10.2174 / 0929867329666220103101700. PMID: 34979888.

[0547] Fu X, Chu C, Li X, Gao Q, Jia J. Cerebral arterial stiffness for predicting functional outcome in acute ischemic stroke. Hypertens Res. 2019 Dec;42(12): 1916-1922. doi: 10.1038 / s41440-019-0313-8. Epub 2019 Aug 14. PMID: 31409919.

[0548] SEQUENCES IN THE SEQUENCE LISTING: miRNA inhibitors:

[0549] - miR-376c-3p inhibitors:

[0550] SEQ ID NO. 1: ACGUGGAAUUUCCUCUAUG (full-length nucleotide 2'-methoxy modification) SEQ ID NO. 14: (ACGUGGAAUUUCCUCUAUG) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

[0551] - miR-199a-3p inhibitors:

[0552] SEQ ID NO. 2: (UAACCAAUGUGCAGACUACU) (full-length nucleotide 2'-methoxy modification) SEQ ID NO.15: (UAACCAAUGUGCAGACUACU) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

[0553] - miR-199a-5p inhibitors:

[0554] SEQ ID NO. 13: (GAACAGGUAGUCUGAACACUG) (full-length nucleotide 2'-methoxy modification)

[0555] SEQ ID NO. 19: (GAACAGGUAGUCUGAACACUG) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

[0556] - miR134-5p inhibitors:

[0557] SEQ ID NO. 3: (CCCCUCUGGUCAACCAGUCA) (full-length nucleotide 2'-methoxy modification)

[0558] SEQ ID NO.16: RNA, (CCCCUCUGGUCAACCAGUCA) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

[0559] - miR-4463 inhibitors:

[0560] SEQ ID NO. 4: (GGCCCCACCCCAGUC) (full-length nucleotide 2'-methoxy modification)

[0561] SEQ ID NO.17: RNA, (GGCCCCACCCCAGUC) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

[0562] - miR-584-5p inhibitors:

[0563] SEQ ID NO. 5: (CUCAGUCCCAGGCAAACCAU) (full-length nucleotide 2'-methoxy modification)

[0564] SEQ ID NO.18: (CUCAGUCCCAGGCAAACCAU) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification) miRNAs:

[0565] SEQ ID NO. 6: circular RNA inhibitor has_circ_0012152, as described in Erdogan C. et al., A Bioinformatics Analysis of circRNA / miRNA / mRNA Interactions in Acute Myeloid Leukemia, Experimed 2023; 13(1): 45-53

[0566] CAGAAUCCUCCCUUACUAAGGGGUCAUUAUAAGGGACGGGACUGGGUUUCACGACCAACCGGAGG GAGGGUCCCUUCUGACGAAGAACGCAUUGCGGCCGGUGUCUUUCUCUGAGGCUACCUGAAUGUG GCCCGUCGGAAGUUCUACCUCUUGAGUAGGAUGGAAGGGUUGGGAGACCGUAGGGGUCGUGACU ACCAGGACCGUAGGUGCCGACUCCGGUCGGCACUACGAAGGUAGGGAACAGUCGUCGGUGCUGG GAAACCACAUGGACAGAGUCAACUGUUCCUGCACGUAUAAGGAAAGUGGUUGCCAAGGAUAUGGA AACGGAGAUACAUGGUAGCCGUUCCACCCCACGGUCCGUGAAAACGGUUAGCACUAAAGGGGGGA AGAGAUGAUGUGGAGGUGGGAGUUAAACGAGGGGGUUUAGAUCUAACGUGGGGUUAGUCAUACG ACUUAGUAUCACCACACCCCCGAAAGGCCGGGAAACGGAGGUGGCUCCUGGCCCUCUCGAUAGUC AGUCGGAAAUGCGGCCGGUUCGCUGAAUUCUUGACGGUACUGUGUCUCAGAGGGGUGAACGCGA AGAGUCUACGUCUACCGUUCCUUAUACUGAAACCCUGUGUCGACGGUAGAUCGAGGGGGCCAAGU GAUUUCCAACUACUGUGACCCUUCUUCUAAAAACGACAGAGACCGGAGUAAAGACUAGCCCUUCG GAGUAGAUCGGGUCUCCUAGCCUUACUGUCUA

[0567] SEQ ID NO. 7: miR-376c-3p

[0568] AACAUAGAGGAAAUUCCACGU

[0569] SEQ ID NO. 9: miR-199a-3p

[0570] ACAGUAGUCUGCACAUUGGUUA SEQIDNO.10: miR-199a-5p CCCAGUGUUCAGACUACCUGUUC SEQID NO.11: miR-4463 GAGACUGGGGUGGGGCC SEQIDNO.8: miR-134-5p UGUGACUGGUUGACCAGAGGGG SEQ ID NO.12: miR-584-5p UUAUGGUUUGCCUGGGACUGAG

Claims

CLAIMS1- A miRNA inhibitor of a miRNA selected from the list consisting of miR-376c-3p, miR-199a, miR134- 5p, miR-4463, miR-584-5p and combinations thereof, for use in the treatment or prevention of stroke in a patient.2- The miRNA inhibitor for use according to claim 1 , wherein the miRNA inhibitor is selected from the list consisting of miR-376c-3p, miR-199a and the combination thereof.3- The miRNA inhibitor for use according to any one of claims 1-2 wherein the miRNA inhibitor specifically binds to at least nucleotides at positions 2-7 or 3-8 in a 5' to 3' end direction of the selected miRNA / s.4- A combination of miRNA inhibitors for use in the treatment or prevention of stroke in a patient, wherein the combination of miRNA inhibitors comprises at least one miRNA inhibitor that inhibits a miRNA selected from the group consisting of miR-376c-3p, miR-199a, miR134-5p, miR-4463, miR-584-5p and combinations thereof.5- The combination of miRNA inhibitors for use according to claim 4, wherein the combination of miRNA inhibitors comprises a miRNA inhibitor that inhibits miR-199a, particularly miR199a-3p.6- The combination of miRNA inhibitors for use according to any one of claims 4-5, wherein the combination of miRNA inhibitors comprises a miRNA inhibitor that inhibits miR-376c-3p.7- The combination of miRNA inhibitors for use according to any one of claims 4-6, wherein the combination of miRNA inhibitors comprises a miRNA inhibitor that inhibits miR-199a, particularly miR199a- 3p, and a miRNA inhibitor that inhibits miR-376c-3p.8- The combination of miRNA inhibitors for use according to any one of claims 4-7, wherein the combination of miRNA inhibitors comprises at least one miRNA inhibitor that inhibits a miRNA selected from the list consisting of miR-199a, miR-376c-3p, and combinations thereof, particularly at least one miRNA inhibitor that inhibits miR-199a and one miRNA inhibitor that inhibits miR-376c-3p, and further comprises:- a miRNA inhibitor that inhibits a miRNA selected from the group consisting of miR134-5p, miR-4463, miR- 584-5p and combinations thereof,- two miRNA inhibitors wherein each one is a miRNA inhibitor that inhibits a different miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof,- three miRNA inhibitors wherein each one is a miRNA inhibitor that inhibits a different miRNA selected from the group consisting of miR134-5p, miR-4463, miR-584-5p and combinations thereof, particularly wherein each miRNA inhibitor is a miRNA inhibitor that inhibits a different miRNA selected from the group consisting of miR134-5p, miR-4463 and miR-584-5p.9- The combination of miRNA inhibitors for use according to any one of claims 4-8 wherein the miRNA inhibitor / s specifically bind / s to at least nucleotides 2-7 or 3-8 in a 5' to 3' end direction of the selected miRNA / s.10- The miRNA inhibitor for use according to any one of claims 1-3, or the combination of miRNA inhibitors for use according to any one of claims 4-9, wherein at least one miRNA inhibitor is an oligonucleotide.11- The miRNA inhibitor for use according to claim 10, or the combination of miRNA inhibitors for use according to claim 10, wherein the oligonucleotide is selected from the list consisting of an anti-miRNA oligonucleotide (AMO), circular oligonucleotide, miRNA sponge, and Tough Decoy (TuD).12- A pharmaceutical composition for use in the treatment or prevention of stroke that comprises the miRNA inhibitor as defined in any one of claims 1-3 or 10-11, or the combination of miRNA inhibitors as defined in any one of claims 4-11.13- An in vitro method for determining the prognosis of a patient with stroke comprising:(I) determining, in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a, miR134-5p, miR-4463, miR-584-5p and combinations thereof,(ii) comparing the level of expression obtained in step (I) with a corresponding reference value, wherein if the expression level determined in step (I) is higher than the corresponding reference value, the patient is considered to have a bad prognosis.14- A method for deciding or recommending whether to initiate a medical regimen in a patient with stroke, the method comprising the steps of:(I) determining in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a, miR134-5p, miR-4463, miR-584-5p and combinations thereof,(ii) comparing the level of expression obtained in step (I) with a corresponding reference value, wherein if the expression level determined in step (I) is higher than the corresponding reference value, it is decided or recommended to initiate the medical regimen.15- A method for determining the response of a patient already diagnosed with stroke, to a medical regimen for treating stroke, the method comprising the steps of:(I) determining in a sample isolated from the patient, the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a, miR134-5p, miR-4463, miR-584-5p and combinations thereof,(ii) comparing the expression level obtained in step (I) with the expression level of the same miRNA(s) determined at the start of the medical regimen or at an earlier phase of the medical regimen, wherein a reduced expression level of the miRNA(s) with respect to the expression level at the start of the medical regimen, or at an earlier phase of the medical regimen, is indicative of a good response to the medical regimen.16- The method according to any one of claims 13-15 wherein step (I) comprises determining the expression level of at least one miRNA selected from the group consisting of miR-376c-3p, miR-199a and combinations thereof.17- The method according to any one of claims 13-16 wherein step (I) comprises determining the expression level of miR-376c-3p and miR-199a.18- The method according to any one of claims 16-17, wherein step (I) further comprises determining the expression level of at least one miRNA selected from the group consisting of: miR134-5p, miR-4463, miR-584-5p and combinations thereof.19- The methods according to any of claims 13-18, wherein the sample is a blood sample, particularly a plasma sample.5p, miR-4463, miR-584-5p and combinations thereof, as a biomarker for the prognosis of a patient with stroke, or as a biomarker for deciding or recommending whether to initiate a medical regimen in a patient with stroke, or as a biomarker for determining the response of a patient already diagnosed with stroke, to a medical regimen for treating stroke.21- The use according to claim 20, wherein the at least one miRNA is selected from the group consisting of 376c-3p, miR-199a and combinations thereof.22- The miRNA inhibitor for use according to any one of claims 1-3 or 10-11, the combination of miRNA inhibitors for use according to any one of claims 4-11, the pharmaceutical composition for use according to claim 12, the method according to any one of claims 13-19 or the use according to any one of claims 20-21, wherein stroke is ischemic stroke.